Science.gov

Sample records for eukaryotic 80s ribosomes

  1. Localization of eukaryote-specific ribosomal proteins in a 5.5-Å cryo-EM map of the 80S eukaryotic ribosome

    PubMed Central

    Armache, Jean-Paul; Jarasch, Alexander; Anger, Andreas M.; Villa, Elizabeth; Becker, Thomas; Bhushan, Shashi; Jossinet, Fabrice; Habeck, Michael; Dindar, Gülcin; Franckenberg, Sibylle; Marquez, Viter; Mielke, Thorsten; Thomm, Michael; Berninghausen, Otto; Beatrix, Birgitta; Söding, Johannes; Westhof, Eric; Wilson, Daniel N.; Beckmann, Roland

    2010-01-01

    Protein synthesis in all living organisms occurs on ribonucleoprotein particles, called ribosomes. Despite the universality of this process, eukaryotic ribosomes are significantly larger in size than their bacterial counterparts due in part to the presence of 80 r proteins rather than 54 in bacteria. Using cryoelectron microscopy reconstructions of a translating plant (Triticum aestivum) 80S ribosome at 5.5-Å resolution, together with a 6.1-Å map of a translating Saccharomyces cerevisiae 80S ribosome, we have localized and modeled 74/80 (92.5%) of the ribosomal proteins, encompassing 12 archaeal/eukaryote-specific small subunit proteins as well as the complete complement of the ribosomal proteins of the eukaryotic large subunit. Near-complete atomic models of the 80S ribosome provide insights into the structure, function, and evolution of the eukaryotic translational apparatus. PMID:20974910

  2. Cryo-EM structure and rRNA model of a translating eukaryotic 80S ribosome at 5.5-Å resolution

    PubMed Central

    Armache, Jean-Paul; Jarasch, Alexander; Anger, Andreas M.; Villa, Elizabeth; Becker, Thomas; Bhushan, Shashi; Jossinet, Fabrice; Habeck, Michael; Dindar, Gülcin; Franckenberg, Sibylle; Marquez, Viter; Mielke, Thorsten; Thomm, Michael; Berninghausen, Otto; Beatrix, Birgitta; Söding, Johannes; Westhof, Eric; Wilson, Daniel N.; Beckmann, Roland

    2010-01-01

    Protein biosynthesis, the translation of the genetic code into polypeptides, occurs on ribonucleoprotein particles called ribosomes. Although X-ray structures of bacterial ribosomes are available, high-resolution structures of eukaryotic 80S ribosomes are lacking. Using cryoelectron microscopy and single-particle reconstruction, we have determined the structure of a translating plant (Triticum aestivum) 80S ribosome at 5.5-Å resolution. This map, together with a 6.1-Å map of a Saccharomyces cerevisiae 80S ribosome, has enabled us to model ∼98% of the rRNA. Accurate assignment of the rRNA expansion segments (ES) and variable regions has revealed unique ES–ES and r-protein–ES interactions, providing insight into the structure and evolution of the eukaryotic ribosome. PMID:20980660

  3. Crystal structure of the 80S yeast ribosome.

    PubMed

    Jenner, Lasse; Melnikov, Sergey; Garreau de Loubresse, Nicolas; Ben-Shem, Adam; Iskakova, Madina; Urzhumtsev, Alexandre; Meskauskas, Arturas; Dinman, Jonathan; Yusupova, Gulnara; Yusupov, Marat

    2012-12-01

    The first X-ray structure of the eukaryotic ribosome at 3.0Å resolution was determined using ribosomes isolated and crystallized from the yeast Saccharomyces cerevisiae (Ben-Shem A, Garreau de Loubresse N, Melnikov S, Jenner L, Yusupova G, Yusupov M: The structure of the eukaryotic ribosome at 3.0 A resolution. Science 2011, 334:1524-1529). This accomplishment was possible due to progress in yeast ribosome biochemistry as well as recent advances in crystallographic methods developed for structure determination of prokaryotic ribosomes isolated from Thermus thermophilus and Escherichia coli. In this review we will focus on the development of isolation procedures that allowed structure determination (both cryo-EM and X-ray crystallography) to be successful for the yeast S. cerevisiae. Additionally we will introduce a new nomenclature that facilitates comparison of ribosomes from different species and kingdoms of life. Finally we will discuss the impact of the yeast 80S ribosome crystal structure on perspectives for future investigations.

  4. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  5. Composition and structure of the 80S ribosome from the green alga Chlamydomonas reinhardtii: 80S ribosomes are conserved in plants and animals.

    PubMed

    Manuell, Andrea L; Yamaguchi, Kenichi; Haynes, Paul A; Milligan, Ronald A; Mayfield, Stephen P

    2005-08-12

    We have conducted a proteomic analysis of the 80S cytosolic ribosome from the eukaryotic green alga Chlamydomonas reinhardtii, and accompany this with a cryo-electron microscopy structure of the ribosome. Proteins homologous to all but one rat 40S subunit protein, including a homolog of RACK1, and all but three rat 60S subunit proteins were identified as components of the C. reinhardtii ribosome. Expressed Sequence Tag (EST) evidence and annotation of the completed C. reinhardtii genome identified genes for each of the four proteins not identified by proteomic analysis, showing that algae potentially have a complete set of orthologs to mammalian 80S ribosomal proteins. Presented at 25A, the algal 80S ribosome is very similar in structure to the yeast 80S ribosome, with only minor distinguishable differences. These data show that, although separated by billions of years of evolution, cytosolic ribosomes from photosynthetic organisms are highly conserved with their yeast and animal counterparts.

  6. Crystal structure of the eukaryotic ribosome.

    PubMed

    Ben-Shem, Adam; Jenner, Lasse; Yusupova, Gulnara; Yusupov, Marat

    2010-11-26

    Crystal structures of prokaryotic ribosomes have described in detail the universally conserved core of the translation mechanism. However, many facets of the translation process in eukaryotes are not shared with prokaryotes. The crystal structure of the yeast 80S ribosome determined at 4.15 angstrom resolution reveals the higher complexity of eukaryotic ribosomes, which are 40% larger than their bacterial counterparts. Our model shows how eukaryote-specific elements considerably expand the network of interactions within the ribosome and provides insights into eukaryote-specific features of protein synthesis. Our crystals capture the ribosome in the ratcheted state, which is essential for translocation of mRNA and transfer RNA (tRNA), and in which the small ribosomal subunit has rotated with respect to the large subunit. We describe the conformational changes in both ribosomal subunits that are involved in ratcheting and their implications in coordination between the two associated subunits and in mRNA and tRNA translocation.

  7. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs.

  8. [Structure and function of the eukaryotic ribosome].

    PubMed

    Bakowska-Zywicka, Kamilla; Twardowski, Tomasz

    2008-01-01

    The protein biosynthesis is a complicated process and not fully understood yet. According to smaller size and less complicated structure, understanding of prokaryotic 70S ribosomes is much more advanced. Eucaryotic 80S ribosomes are more complex and generate more difficulties in research. The morphology of 80S ribosome has been pretty well resolved and we know a lot about mechanism of functioning. Determination of the interactions between the ribosomes and the factors taking part in protein biosynthesis is still a great challenge. Dynamic changes of these interactions during particular steps of elongation cycle are quite difficult to understand. Conformational changes of the ribosome are of great functional and regulatory importance during protein biosynthesis. They are essential for the whole gene expression process. Only further research of the structure and function of the ribosome will lead us to knowledge about specificity of the mechanism of their action. In this article we present current opinions concerning structure and function of the eukaryotic ribosomes.

  9. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  10. The structure and function of the eukaryotic ribosome.

    PubMed

    Wilson, Daniel N; Doudna Cate, Jamie H

    2012-05-01

    Structures of the bacterial ribosome have provided a framework for understanding universal mechanisms of protein synthesis. However, the eukaryotic ribosome is much larger than it is in bacteria, and its activity is fundamentally different in many key ways. Recent cryo-electron microscopy reconstructions and X-ray crystal structures of eukaryotic ribosomes and ribosomal subunits now provide an unprecedented opportunity to explore mechanisms of eukaryotic translation and its regulation in atomic detail. This review describes the X-ray crystal structures of the Tetrahymena thermophila 40S and 60S subunits and the Saccharomyces cerevisiae 80S ribosome, as well as cryo-electron microscopy reconstructions of translating yeast and plant 80S ribosomes. Mechanistic questions about translation in eukaryotes that will require additional structural insights to be resolved are also presented.

  11. Structural basis for the inhibition of the eukaryotic ribosome.

    PubMed

    Garreau de Loubresse, Nicolas; Prokhorova, Irina; Holtkamp, Wolf; Rodnina, Marina V; Yusupova, Gulnara; Yusupov, Marat

    2014-09-25

    The ribosome is a molecular machine responsible for protein synthesis and a major target for small-molecule inhibitors. Compared to the wealth of structural information available on ribosome-targeting antibiotics in bacteria, our understanding of the binding mode of ribosome inhibitors in eukaryotes is currently limited. Here we used X-ray crystallography to determine 16 high-resolution structures of 80S ribosomes from Saccharomyces cerevisiae in complexes with 12 eukaryote-specific and 4 broad-spectrum inhibitors. All inhibitors were found associated with messenger RNA and transfer RNA binding sites. In combination with kinetic experiments, the structures suggest a model for the action of cycloheximide and lactimidomycin, which explains why lactimidomycin, the larger compound, specifically targets the first elongation cycle. The study defines common principles of targeting and resistance, provides insights into translation inhibitor mode of action and reveals the structural determinants responsible for species selectivity which could guide future drug development.

  12. Calcium-dependent interaction of calmodulin with human 80S ribosomes and polyribosomes.

    PubMed

    Behnen, Petra; Davis, Elizabeth; Delaney, Erin; Frohm, Birgitta; Bauer, Mikael; Cedervall, Tommy; O'Connell, David; Åkerfeldt, Karin S; Linse, Sara

    2012-08-28

    Ribosomes are the protein factories of every living cell. The process of protein translation is highly complex and tightly regulated by a large number of diverse RNAs and proteins. Earlier studies indicate that Ca(2+) plays a role in protein translation. Calmodulin (CaM), a ubiquitous Ca(2+)-binding protein, regulates a large number of proteins participating in many signaling pathways. Several 40S and 60S ribosomal proteins have been identified to interact with CaM, and here, we report that CaM binds with high affinity to 80S ribosomes and polyribosomes in a Ca(2+)-dependent manner. No binding is observed in buffer with 6 mM Mg(2+) and 1 mM EGTA that chelates Ca(2+), suggesting high specificity of the CaM-ribosome interaction dependent on the Ca(2+) induced conformational change of CaM. The interactions between CaM and ribosomes are inhibited by synthetic peptides comprising putative CaM-binding sites in ribosomal proteins S2 and L14. Using a cell-free in vitro translation system, we further found that these synthetic peptides are potent inhibitors of protein synthesis. Our results identify an involvement of CaM in the translational activity of ribosomes.

  13. The structure of the eukaryotic ribosome at 3.0 Å resolution.

    PubMed

    Ben-Shem, Adam; Garreau de Loubresse, Nicolas; Melnikov, Sergey; Jenner, Lasse; Yusupova, Gulnara; Yusupov, Marat

    2011-12-16

    Ribosomes translate genetic information encoded by messenger RNA into proteins. Many aspects of translation and its regulation are specific to eukaryotes, whose ribosomes are much larger and intricate than their bacterial counterparts. We report the crystal structure of the 80S ribosome from the yeast Saccharomyces cerevisiae--including nearly all ribosomal RNA bases and protein side chains as well as an additional protein, Stm1--at a resolution of 3.0 angstroms. This atomic model reveals the architecture of eukaryote-specific elements and their interaction with the universally conserved core, and describes all eukaryote-specific bridges between the two ribosomal subunits. It forms the structural framework for the design and analysis of experiments that explore the eukaryotic translation apparatus and the evolutionary forces that shaped it.

  14. The binding sites for tRNA on eukaryotic ribosomes.

    PubMed

    Leader, D P; Machray, G C

    1975-07-01

    We have studied the non-enzymic binding of phe-tRNA to ribosomes from rat liver using deacylated tRNA to inhibit binding to the P-site and puromycin (5 x 10-minus3M) to inhibit binding to the A-site. We conclude that at a low concentration of magnesium ions (10mM) phe-tRNA is bound only at the A-site of 80S irbosomes, whereas at a high concentration of magnesium ions (40mM) phe-tRNA is also bound at the P-site. Studies with edeine indicate that, during non-enzymic binding of phe-tRNA, eukaryotic ribosomes (in contrast to prokarotic ribosomes) have the A-site of the 60S subunit and the initiation site of the 40S subunit juxtaposed. This may account for the differences observed, in formation of diphenylalanyl-tRNA and phenylalanyl-puromycin, between phe-tRNA bound non-enzymically to the P-sites of eukaryotic and prokaryotic ribosomes.

  15. The binding sites for tRNA on eukaryotic ribosomes.

    PubMed Central

    Leader, D P; Machray, G C

    1975-01-01

    We have studied the non-enzymic binding of phe-tRNA to ribosomes from rat liver using deacylated tRNA to inhibit binding to the P-site and puromycin (5 x 10-minus3M) to inhibit binding to the A-site. We conclude that at a low concentration of magnesium ions (10mM) phe-tRNA is bound only at the A-site of 80S irbosomes, whereas at a high concentration of magnesium ions (40mM) phe-tRNA is also bound at the P-site. Studies with edeine indicate that, during non-enzymic binding of phe-tRNA, eukaryotic ribosomes (in contrast to prokarotic ribosomes) have the A-site of the 60S subunit and the initiation site of the 40S subunit juxtaposed. This may account for the differences observed, in formation of diphenylalanyl-tRNA and phenylalanyl-puromycin, between phe-tRNA bound non-enzymically to the P-sites of eukaryotic and prokaryotic ribosomes. PMID:1098024

  16. Crystal Structure of Hypusine-Containing Translation Factor eIF5A Bound to a Rotated Eukaryotic Ribosome.

    PubMed

    Melnikov, Sergey; Mailliot, Justine; Shin, Byung-Sik; Rigger, Lukas; Yusupova, Gulnara; Micura, Ronald; Dever, Thomas E; Yusupov, Marat

    2016-09-11

    Eukaryotic translation initiation factor eIF5A promotes protein synthesis by resolving polyproline-induced ribosomal stalling. Here, we report a 3.25-Å resolution crystal structure of eIF5A bound to the yeast 80S ribosome. The structure reveals a previously unseen conformation of an eIF5A-ribosome complex and highlights a possible functional link between conformational changes of the ribosome during protein synthesis and the eIF5A-ribosome association.

  17. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  18. Dom34-Hbs1 mediated dissociation of inactive 80S ribosomes promotes restart of translation after stress.

    PubMed

    van den Elzen, Antonia M G; Schuller, Anthony; Green, Rachel; Séraphin, Bertrand

    2014-02-01

    Following translation termination, ribosomal subunits dissociate to become available for subsequent rounds of protein synthesis. In many translation-inhibiting stress conditions, e.g. glucose starvation in yeast, free ribosomal subunits reassociate to form a large pool of non-translating 80S ribosomes stabilized by the 'clamping' Stm1 factor. The subunits of these inactive ribosomes need to be mobilized for translation restart upon stress relief. The Dom34-Hbs1 complex, together with the Rli1 NTPase (also known as ABCE1), have been shown to split ribosomes stuck on mRNAs in the context of RNA quality control mechanisms. Here, using in vitro and in vivo methods, we report a new role for the Dom34-Hbs1 complex and Rli1 in dissociating inactive ribosomes, thereby facilitating translation restart in yeast recovering from glucose starvation stress. Interestingly, we found that this new role is not restricted to stress conditions, indicating that in growing yeast there is a dynamic pool of inactive ribosomes that needs to be split by Dom34-Hbs1 and Rli1 to participate in protein synthesis. We propose that this provides a new level of translation regulation.

  19. Dominant Rio1 kinase/ATPase catalytic mutant induces trapping of late pre-40S biogenesis factors in 80S-like ribosomes.

    PubMed

    Ferreira-Cerca, Sébastien; Kiburu, Irene; Thomson, Emma; LaRonde, Nicole; Hurt, Ed

    2014-07-01

    During eukaryotic ribosome biogenesis, members of the conserved atypical serine/threonine protein kinase family, the RIO kinases (Rio1, Rio2 and Rio3) function in small ribosomal subunit biogenesis. Structural analysis of Rio2 indicated a role as a conformation-sensing ATPase rather than a kinase to regulate its dynamic association with the pre-40S subunit. However, it remained elusive at which step and by which mechanism the other RIO kinase members act. Here, we have determined the crystal structure of the human Rio1-ATP-Mg(2+) complex carrying a phosphoaspartate in the active site indicative of ATPase activity. Structure-based mutations in yeast showed that Rio1's catalytic activity regulates its pre-40S association. Furthermore, we provide evidence that Rio1 associates with a very late pre-40S via its conserved C-terminal domain. Moreover, a rio1 dominant-negative mutant defective in ATP hydrolysis induced trapping of late biogenesis factors in pre-ribosomal particles, which turned out not to be pre-40S but 80S-like ribosomes. Thus, the RIO kinase fold generates a versatile ATPase enzyme, which in the case of Rio1 is activated following the Rio2 step to regulate one of the final 40S maturation events, at which time the 60S subunit is recruited for final quality control check.

  20. A 'garbage can' for ribosomes: how eukaryotes degrade their ribosomes.

    PubMed

    Lafontaine, Denis L J

    2010-05-01

    Ribosome synthesis is a major metabolic activity that involves hundreds of individual reactions, each of which is error-prone. Ribosomal insults occur in cis (alteration in rRNA sequences) and in trans (failure to bind to, or loss of, an assembly factor or ribosomal protein). In addition, specific growth conditions, such as starvation, require that excess ribosomes are turned over efficiently. Recent work indicates that cells evolved multiple strategies to recognize specifically, and target for clearance, ribosomes that are structurally and/or functionally deficient, as well as in excess. This surveillance is active at every step of the ribosome synthesis pathway and on mature ribosomes, involves nearly entirely different mechanisms for the small and large subunits, and requires specialized subcellular organelles. PMID:20097077

  1. Structure of the hypusinylated eukaryotic translation factor eIF-5A bound to the ribosome

    PubMed Central

    Schmidt, Christian; Becker, Thomas; Heuer, André; Braunger, Katharina; Shanmuganathan, Vivekanandan; Pech, Markus; Berninghausen, Otto; Wilson, Daniel N.; Beckmann, Roland

    2016-01-01

    During protein synthesis, ribosomes become stalled on polyproline-containing sequences, unless they are rescued in archaea and eukaryotes by the initiation factor 5A (a/eIF-5A) and in bacteria by the homologous protein EF-P. While a structure of EF-P bound to the 70S ribosome exists, structural insight into eIF-5A on the 80S ribosome has been lacking. Here we present a cryo-electron microscopy reconstruction of eIF-5A bound to the yeast 80S ribosome at 3.9 Å resolution. The structure reveals that the unique and functionally essential post-translational hypusine modification reaches toward the peptidyltransferase center of the ribosome, where the hypusine moiety contacts A76 of the CCA-end of the P-site tRNA. These findings would support a model whereby eIF-5A stimulates peptide bond formation on polyproline-stalled ribosomes by stabilizing and orienting the CCA-end of the P-tRNA, rather than by directly contributing to the catalysis. PMID:26715760

  2. Structure of the hypusinylated eukaryotic translation factor eIF-5A bound to the ribosome.

    PubMed

    Schmidt, Christian; Becker, Thomas; Heuer, André; Braunger, Katharina; Shanmuganathan, Vivekanandan; Pech, Markus; Berninghausen, Otto; Wilson, Daniel N; Beckmann, Roland

    2016-02-29

    During protein synthesis, ribosomes become stalled on polyproline-containing sequences, unless they are rescued in archaea and eukaryotes by the initiation factor 5A (a/eIF-5A) and in bacteria by the homologous protein EF-P. While a structure of EF-P bound to the 70S ribosome exists, structural insight into eIF-5A on the 80S ribosome has been lacking. Here we present a cryo-electron microscopy reconstruction of eIF-5A bound to the yeast 80S ribosome at 3.9 Å resolution. The structure reveals that the unique and functionally essential post-translational hypusine modification reaches toward the peptidyltransferase center of the ribosome, where the hypusine moiety contacts A76 of the CCA-end of the P-site tRNA. These findings would support a model whereby eIF-5A stimulates peptide bond formation on polyproline-stalled ribosomes by stabilizing and orienting the CCA-end of the P-tRNA, rather than by directly contributing to the catalysis. PMID:26715760

  3. Ribosomal RNA sequence suggests microsporidia are extremely ancient eukaryotes.

    PubMed

    Vossbrinck, C R; Maddox, J V; Friedman, S; Debrunner-Vossbrinck, B A; Woese, C R

    The microsporidia are a group of unusual, obligately parasitic protists that infect a great variety of other eukaryotes, including vertebrates, arthropods, molluscs, annelids, nematodes, cnidaria and even various ciliates, myxosporidia and gregarines. They possess a number of unusual cytological and molecular characteristics. Their nuclear division is considered to be primitive, they have no mitochondria, their ribosomes and ribosomal RNAs are reported to be of prokaryotic size and their large ribosomal subunit contains no 5.8S rRNA. The uniqueness of the microsporidia may reflect their phylogenetic position, because comparative sequence analysis shows that the small subunit rRNA of the microsporidium Vairimorpha necatrix is more unlike those of other eukaryotes than any known eukaryote 18S rRNA sequence. We conclude that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  4. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement

    PubMed Central

    Budkevich, Tatyana V.; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J.F.; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W.; Tung, Chang-Shung; Nierhaus, Knud H.; Sanbonmatsu, Karissa Y.; Spahn, Christian M.T.

    2014-01-01

    SUMMARY The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present sub-nanometer resolution cryo-electron microscopy maps of the mammalian 80S ribosome in the post-translocational state and in complex with the eukaryotic eEF1A•Val-tRNA•GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the post-translocational state from the classical pre-translocational state ribosome. We term this motion “subunit rolling”. Correspondingly, a mammalian decoding complex visualized in sub-states before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  5. On the expansion of ribosomal proteins and RNAs in eukaryotes.

    PubMed

    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2014-07-01

    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins.

  6. Potent, Reversible, and Specific Chemical Inhibitors of Eukaryotic Ribosome Biogenesis.

    PubMed

    Kawashima, Shigehiro A; Chen, Zhen; Aoi, Yuki; Patgiri, Anupam; Kobayashi, Yuki; Nurse, Paul; Kapoor, Tarun M

    2016-10-01

    All cellular proteins are synthesized by ribosomes, whose biogenesis in eukaryotes is a complex multi-step process completed within minutes. Several chemical inhibitors of ribosome function are available and used as tools or drugs. By contrast, we lack potent validated chemical probes to analyze the dynamics of eukaryotic ribosome assembly. Here, we combine chemical and genetic approaches to discover ribozinoindoles (or Rbins), potent and reversible triazinoindole-based inhibitors of eukaryotic ribosome biogenesis. Analyses of Rbin sensitivity and resistance conferring mutations in fission yeast, along with biochemical assays with recombinant proteins, provide evidence that Rbins' physiological target is Midasin, an essential ∼540-kDa AAA+ (ATPases associated with diverse cellular activities) protein. Using Rbins to acutely inhibit or activate Midasin function, in parallel experiments with inhibitor-sensitive or inhibitor-resistant cells, we uncover Midasin's role in assembling Nsa1 particles, nucleolar precursors of the 60S subunit. Together, our findings demonstrate that Rbins are powerful probes for eukaryotic ribosome assembly.

  7. Eukaryotic ribosomes that lack a 5.8S RNA

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  8. Structural diversity of eukaryotic small subunit ribosomal RNAs. Evolutionary implications.

    PubMed

    Sogin, M L; Gunderson, J H

    1987-01-01

    The phylogenetic diversity of the eukaryotic kingdom was assessed by comparing the structural and evolutionary diversity of 18-20S ribosomal RNA genes. The coding regions for cytoplasmic small subunit ribosomal RNA genes vary in length from 1753 to 2305 nucleotides, and they appear to be evolutionary mosaics in which highly and partially conserved sequences are interspersed among regions that display very high rates of genetic drift. Structural similarities between these gene sequences were used to establish a phylogenetic framework for the eukaryotes. The extent of sequence variation within the eukaryotes exceeds that displayed within the eubacterial or archaebacterial lines of descent. The kinetoplastids and euglenoids represent the earliest branchings among the eukaryotes. These branchings preceded the divergence of lineages leading to the slime molds and apicomplexans and far antedate a radiative period that gave rise to the plants, animals, fungi, and other protists.

  9. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth.

  10. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  11. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  12. Common DNA structural features exhibited by eukaryotic ribosomal gene promoters.

    PubMed Central

    Marilley, M; Pasero, P

    1996-01-01

    Nucleotide sequences of DNA regions containing eukaryotic ribosomal promoters were analysed using strategies designed to reveal sequence-directed structural features. DNA curvature, duplex stability and pattern of twist angle variation were studied by computer modelling. Although ribosomal promoters are known to lack sequence homology (unless very closely related species are considered), investigation of these structural characteristics uncovered striking homologies in all the taxonomic groups examined so far. This wide conservation of DNA structures, while DNA sequence is not conserved, suggests that the determined structures are fundamental for ribosomal promoter function. Moreover, this result agrees well with the recent observations showing that RNA polymerase I transcription factors have not evolved as intensively as previously suspected. PMID:8710487

  13. The CCA-end of P-tRNA Contacts Both the Human RPL36AL and the A-site Bound Translation Termination Factor eRF1 at the Peptidyl Transferase Center of the Human 80S Ribosome.

    PubMed

    Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria

    2014-01-01

    We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.

  14. Quantitative studies of mRNA recruitment to the eukaryotic ribosome.

    PubMed

    Fraser, Christopher S

    2015-07-01

    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome.

  15. Quantitative studies of mRNA recruitment to the eukaryotic ribosome

    PubMed Central

    Fraser, Christopher S.

    2015-01-01

    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5′ UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5′ UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  16. A general procedure for the production of antibody reagents against eukaryotic ribosomal proteins.

    PubMed

    Dieci, Giorgio; Bottarelli, Lorena; Ottonello, Simone

    2005-08-01

    Despite recent progress in the structural and functional analysis of bacterial and archaeal ribosomes, the structure and biogenesis of eukaryotic ribosomes still awaits a detailed characterization. Ribosomal protein-specific antibodies would be valuable tools for such studies, but their production is commonly hindered by the poor expression and solubility of eukaryotic ribosomal proteins in E. coli. We report here an improved general procedure for the over-production of recombinant eukaryotic ribosomal proteins and for the generation of the corresponding polyclonal antibodies. The specificity and sensitivity of detection of the antibodies produced by this procedure are documented.

  17. Structure of the no-go mRNA decay complex Dom34-Hbs1 bound to a stalled 80S ribosome.

    PubMed

    Becker, Thomas; Armache, Jean-Paul; Jarasch, Alexander; Anger, Andreas M; Villa, Elizabeth; Sieber, Heidemarie; Motaal, Basma Abdel; Mielke, Thorsten; Berninghausen, Otto; Beckmann, Roland

    2011-06-01

    No-go decay (NGD) is a mRNA quality-control mechanism in eukaryotic cells that leads to degradation of mRNAs stalled during translational elongation. The key factors triggering NGD are Dom34 and Hbs1. We used cryo-EM to visualize NGD intermediates resulting from binding of the Dom34-Hbs1 complex to stalled ribosomes. At subnanometer resolution, all domains of Dom34 and Hbs1 were identified, allowing the docking of crystal structures and homology models. Moreover, the close structural similarity of Dom34 and Hbs1 to eukaryotic release factors (eRFs) enabled us to propose a model for the ribosome-bound eRF1-eRF3 complex. Collectively, our data provide structural insights into how stalled mRNA is recognized on the ribosome and how the eRF complex can simultaneously recognize stop codons and catalyze peptide release.

  18. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    PubMed

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  19. Eukaryote-specific extensions in ribosomal proteins of the small subunit: Structure and function.

    PubMed

    Ghosh, Arnab; Komar, Anton A

    2015-01-01

    High-resolution structures of yeast ribosomes have improved our understanding of the architecture and organization of eukaryotic rRNA and proteins, as well as eukaryote-specific extensions present in some conserved ribosomal proteins. Despite this progress, assignment of specific functions to individual proteins and/or eukaryote-specific protein extensions remains challenging. It has been suggested that eukaryote-specific extensions of conserved proteins from the small ribosomal subunit may facilitate eukaryote-specific reactions in the initiation phase of protein synthesis. This review summarizes emerging data describing the structural and functional significance of eukaryote-specific extensions of conserved small ribosomal subunit proteins, particularly their possible roles in recruitment and spatial organization of eukaryote-specific initiation factors. PMID:26779416

  20. Protection of rat liver 80 S ribosomes against ricin A chain inactivation by proteins extracted from rat liver and wheat germ ribosomal subunits with ammonium chloride/magnesium chloride.

    PubMed

    Chang, M S; Houston, L L

    1981-09-28

    Proteins extracted from wheat germ 60 S ribosomal subunits and rat liver 60 S and 40 S ribosomal subunits with 3 M NH4Cl/75 mM MgCl2 were able to prevent the ricin A chain-mediated inactivation of untreated 80 S rat liver ribosomes. The protection of polyphenylalanine synthetic capability of 80 S ribosomes was saturable and reached 100% protection in the presence of about 20 micrograms of extracted protein using a uniform set of assay conditions. No protection was observed using proteins extracted from wheat germ 40 S subunits or the core fraction of rat liver 60 S subunits or protein extracted from Escherichia coli ribosomes or ribosomal subunits. The conclusion that the protective effect of extracted 60 S subunit proteins was specific, was further strengthened by showing that unrelated proteins such as alpha-lactalbumin, bovine serum albumin and lysozyme, and polypeptides such as polylysine and poly(aspartic acid), also showed no protection. If 80 S ribosomes were first treated with ricin A chain and then incubated with proteins extracted from rat liver 60 S subunits, no protection was observed. Proteins extracted with NH4Cl/MgCl2 from 60 S rat liver subunits were applied to carboxymethylcellulose column equilibrated with 6 M urea. Stepwise elution with increasing concentrations of LiCl resulted in seven fractions. One fraction (D) contained most of the protective factor; one fraction (E) contained a lesser amount of the protective factor. Two-dimensional polyacrylamide gel electrophoresis of fraction D showed the presence of ten proteins. These data are consistent with the idea that the enzymatic target of ricin A chain is protein is nature and that fraction D contains one or more proteins that appear to act as a inhibitor against ricin A chain.

  1. Lateral transfer of eukaryotic ribosomal RNA genes: an emerging concern for molecular ecology of microbial eukaryotes.

    PubMed

    Yabuki, Akinori; Toyofuku, Takashi; Takishita, Kiyotaka

    2014-07-01

    Ribosomal RNA (rRNA) genes are widely utilized in depicting organismal diversity and distribution in a wide range of environments. Although a few cases of lateral transfer of rRNA genes between closely related prokaryotes have been reported, it remains to be reported from eukaryotes. Here, we report the first case of lateral transfer of eukaryotic rRNA genes. Two distinct sequences of the 18S rRNA gene were detected from a clonal culture of the stramenopile, Ciliophrys infusionum. One was clearly derived from Ciliophrys, but the other gene originated from a perkinsid alveolate. Genome-walking analyses revealed that this alveolate-type rRNA gene is immediately adjacent to two protein-coding genes (ubc12 and usp39), and the origin of both genes was shown to be a stramenopile (that is, Ciliophrys) in our phylogenetic analyses. These findings indicate that the alveolate-type rRNA gene is encoded on the Ciliophrys genome and that eukaryotic rRNA genes can be transferred laterally.

  2. Crystal structure of the eukaryotic 60S ribosomal subunit in complex with initiation factor 6.

    PubMed

    Klinge, Sebastian; Voigts-Hoffmann, Felix; Leibundgut, Marc; Arpagaus, Sofia; Ban, Nenad

    2011-11-18

    Protein synthesis in all organisms is catalyzed by ribosomes. In comparison to their prokaryotic counterparts, eukaryotic ribosomes are considerably larger and are subject to more complex regulation. The large ribosomal subunit (60S) catalyzes peptide bond formation and contains the nascent polypeptide exit tunnel. We present the structure of the 60S ribosomal subunit from Tetrahymena thermophila in complex with eukaryotic initiation factor 6 (eIF6), cocrystallized with the antibiotic cycloheximide (a eukaryotic-specific inhibitor of protein synthesis), at a resolution of 3.5 angstroms. The structure illustrates the complex functional architecture of the eukaryotic 60S subunit, which comprises an intricate network of interactions between eukaryotic-specific ribosomal protein features and RNA expansion segments. It reveals the roles of eukaryotic ribosomal protein elements in the stabilization of the active site and the extent of eukaryotic-specific differences in other functional regions of the subunit. Furthermore, it elucidates the molecular basis of the interaction with eIF6 and provides a structural framework for further studies of ribosome-associated diseases and the role of the 60S subunit in the initiation of protein synthesis.

  3. Structures of eukaryotic ribosomal stalk proteins and its complex with trichosanthin, and their implications in recruiting ribosome-inactivating proteins to the ribosomes.

    PubMed

    Choi, Andrew K H; Wong, Eddie C K; Lee, Ka-Ming; Wong, Kam-Bo

    2015-03-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA.

  4. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  5. A hierarchical model for assembly of eukaryotic 60S ribosomal subunit domains.

    PubMed

    Gamalinda, Michael; Ohmayer, Uli; Jakovljevic, Jelena; Kumcuoglu, Beril; Woolford, Joshua; Mbom, Bertrade; Lin, Lawrence; Woolford, John L

    2014-01-15

    Despite having high-resolution structures for eukaryotic large ribosomal subunits, it remained unclear how these ribonucleoprotein complexes are constructed in living cells. Nevertheless, knowing where ribosomal proteins interact with ribosomal RNA (rRNA) provides a strategic platform to investigate the connection between spatial and temporal aspects of 60S subunit biogenesis. We previously found that the function of individual yeast large subunit ribosomal proteins (RPLs) in precursor rRNA (pre-rRNA) processing correlates with their location in the structure of mature 60S subunits. This observation suggested that there is an order by which 60S subunits are formed. To test this model, we used proteomic approaches to assay changes in the levels of ribosomal proteins and assembly factors in preribosomes when RPLs functioning in early, middle, and late steps of pre-60S assembly are depleted. Our results demonstrate that structural domains of eukaryotic 60S ribosomal subunits are formed in a hierarchical fashion. Assembly begins at the convex solvent side, followed by the polypeptide exit tunnel, the intersubunit side, and finally the central protuberance. This model provides an initial paradigm for the sequential assembly of eukaryotic 60S subunits. Our results reveal striking differences and similarities between assembly of bacterial and eukaryotic large ribosomal subunits, providing insights into how these RNA-protein particles evolved.

  6. A hierarchical model for assembly of eukaryotic 60S ribosomal subunit domains

    PubMed Central

    Gamalinda, Michael; Ohmayer, Uli; Jakovljevic, Jelena; Kumcuoglu, Beril; Woolford, Joshua; Mbom, Bertrade; Lin, Lawrence; Woolford, John L.

    2014-01-01

    Despite having high-resolution structures for eukaryotic large ribosomal subunits, it remained unclear how these ribonucleoprotein complexes are constructed in living cells. Nevertheless, knowing where ribosomal proteins interact with ribosomal RNA (rRNA) provides a strategic platform to investigate the connection between spatial and temporal aspects of 60S subunit biogenesis. We previously found that the function of individual yeast large subunit ribosomal proteins (RPLs) in precursor rRNA (pre-rRNA) processing correlates with their location in the structure of mature 60S subunits. This observation suggested that there is an order by which 60S subunits are formed. To test this model, we used proteomic approaches to assay changes in the levels of ribosomal proteins and assembly factors in preribosomes when RPLs functioning in early, middle, and late steps of pre-60S assembly are depleted. Our results demonstrate that structural domains of eukaryotic 60S ribosomal subunits are formed in a hierarchical fashion. Assembly begins at the convex solvent side, followed by the polypeptide exit tunnel, the intersubunit side, and finally the central protuberance. This model provides an initial paradigm for the sequential assembly of eukaryotic 60S subunits. Our results reveal striking differences and similarities between assembly of bacterial and eukaryotic large ribosomal subunits, providing insights into how these RNA–protein particles evolved. PMID:24449272

  7. Eukaryote-specific rRNA expansion segments function in ribosome biogenesis.

    PubMed

    Ramesh, Madhumitha; Woolford, John L

    2016-08-01

    The secondary structure of ribosomal RNA (rRNA) is largely conserved across all kingdoms of life. However, eukaryotes have evolved extra blocks of rRNA sequences, relative to those of prokaryotes, called expansion segments (ES). A thorough characterization of the potential roles of ES remains to be done, possibly because of limitations in the availability of robust systems to study rRNA mutants. We sought to systematically investigate the potential functions, if any, of the ES in 25S rRNA of Saccharomyces cerevisiae by deletion mutagenesis. We deleted 14 of the 16 different eukaryote-specific ES in yeast 25S rRNA individually and assayed their phenotypes. Our results show that all but two of the ES tested are necessary for optimal growth and are required for production of 25S rRNA, suggesting that ES play roles in ribosome biogenesis. Further, we classified expansion segments into groups that participate in early nucleolar, middle, and late nucleoplasmic steps of ribosome biogenesis, by assaying their pre-rRNA processing phenotypes. This study is the first of its kind to systematically identify the functions of eukaryote-specific expansion segments by showing that they play roles in specific steps of ribosome biogenesis. The catalog of phenotypes we identified, combined with previous investigations of the roles ribosomal proteins in large subunit biogenesis, leads us to infer that assembling ribosomes are composed of distinct RNA and protein structural neighborhood clusters that participate in specific steps of ribosome biogenesis. PMID:27317789

  8. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process

    SciTech Connect

    Khanna-Gupta, A.; Ware, V.C. )

    1989-03-01

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope.

  9. Nucleotide sequence of a crustacean 18S ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs.

    PubMed

    Nelles, L; Fang, B L; Volckaert, G; Vandenberghe, A; De Wachter, R

    1984-12-11

    The primary structure of the gene for 18 S rRNA of the crustacean Artemia salina was determined. The sequence has been aligned with 13 other small ribosomal subunit RNA sequences of eukaryotic, archaebacterial, eubacterial, chloroplastic and plant mitochondrial origin. Secondary structure models for these RNAs were derived on the basis of previously proposed models and additional comparative evidence found in the alignment. Although there is a general similarity in the secondary structure models for eukaryotes and prokaryotes, the evidence seems to indicate a different topology in a central area of the structures.

  10. Eukaryotic ribosomal RNA determinants of aminoglycoside resistance and their role in translational fidelity.

    PubMed

    Fan-Minogue, Hua; Bedwell, David M

    2008-01-01

    Recent studies of prokaryotic ribosomes have dramatically increased our knowledge of ribosomal RNA (rRNA) structure, functional centers, and their interactions with antibiotics. However, much less is known about how rRNA function differs between prokaryotic and eukaryotic ribosomes. The core decoding sites are identical in yeast and human 18S rRNAs, suggesting that insights obtained in studies with yeast rRNA mutants can provide information about ribosome function in both species. In this study, we examined the importance of key nucleotides of the 18S rRNA decoding site on ribosome function and aminoglycoside susceptibility in Saccharomyces cerevisiae cells expressing homogeneous populations of mutant ribosomes. We found that residues G577, A1755, and A1756 (corresponding to Escherichia coli residues G530, A1492, and A1493, respectively) are essential for cell viability. We also found that residue G1645 (A1408 in E. coli) and A1754 (G1491 in E. coli) both make significant and distinct contributions to aminoglycoside resistance. Furthermore, we found that mutations at these residues do not alter the basal level of translational accuracy, but influence both paromomycin-induced misreading of sense codons and readthrough of stop codons. This study represents the most comprehensive mutational analysis of the eukaryotic decoding site to date, and suggests that many fundamental features of decoding site function are conserved between prokaryotes and eukaryotes.

  11. Engineering of ribosomal shunt-modulating eukaryotic ON riboswitches by using a cell-free translation system.

    PubMed

    Ogawa, Atsushi

    2015-01-01

    A number of natural and artificial bacterial riboswitches have been reported thus far. However, they generally function only in bacteria, not in eukaryotes. This is because of the differences of expression mechanisms (transcription, translation, and so on) between these two main types of organisms. For example, the mechanism of translation initiation is quite different between bacteria and eukaryotes, especially in ribosome loading on mRNA. While the bacterial ribosome binds to a well-conserved, internal sequence some bases before the start codon to initiate translation, the eukaryotic one is loaded on the 5' terminus with the help of certain eukaryotic initiation factors. This means not only that bacterial riboswitches regulating translation initiation are not available in eukaryotic translation systems, but also that it is physically difficult to construct eukaryotic ON riboswitches that regulate the eukaryotic canonical translation initiation, because an aptamer cannot be inserted upstream of the ribosome loading site. However, the mechanism of noncanonical translation initiation via "ribosomal shunt" enables us to design translation initiation-modulating (specifically, ribosomal shunt-modulating) eukaryotic ON riboswitches. This chapter describes a facile method for engineering these ribosomal shunt-modulating eukaryotic ON riboswitches by using a cell-free translation system. Because these riboswitches do not require hybridization switching thanks to a unique shunting mechanism, they have the major advantages of a low energy requirement for upregulation and relatively straightforward design over common hybridization switch-based ON riboswitches.

  12. A comparison of the yeast and rabbit 80 S ribosome reveals the topology of the nascent chain exit tunnel, inter-subunit bridges and mammalian rRNA expansion segments.

    PubMed

    Morgan, D G; Ménétret, J F; Radermacher, M; Neuhof, A; Akey, I V; Rapoport, T A; Akey, C W

    2000-08-11

    Protein synthesis in eukaryotes is mediated by both cytoplasmic and membrane-bound ribosomes. During the co-translational translocation of secretory and membrane proteins, eukaryotic ribosomes dock with the protein conducting channel of the endoplasmic reticulum. An understanding of these processes will require the detailed structure of a eukaryotic ribosome. To this end, we have compared the three-dimensional structures of yeast and rabbit ribosomes at 24 A resolution. In general, we find that the active sites for protein synthesis and translocation have been highly conserved. It is interesting that a channel was visualized in the neck of the small subunit whose entrance is formed by a deep groove. By analogy with the prokaryotic small subunit, this channel may provide a conserved portal through which mRNA is threaded into the decoding center. In addition, both the small and large subunits are built around a dense tubular network. Our analysis further suggests that the nascent chain exit tunnel and the docking surface for the endoplasmic reticulum channel are formed by this network. We surmise that many of these features correspond to rRNA, based on biochemical and structural data. Ribosomal function is critically dependent on the specific association of small and large subunits. Our analysis of eukaryotic ribosomes reveals four conserved inter-subunit bridges with a geometry similar to that found in prokaryotes. In particular, a double-bridge connects the small subunit platform with the interface canyon on the large subunit. Moreover, a novel bridge is formed between the platform and the base of the L1 domain. Finally, size differences between mammalian and yeast large subunit rRNAs have been correlated with five expansion segments that form two large spines and three extended fingers. Overall, we find that expansion segments within the large subunit rRNA have been incorporated at positions distinct from the active sites for protein synthesis and translocation.

  13. Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry.

    PubMed Central

    Pestova, T V; Hellen, C U; Shatsky, I N

    1996-01-01

    Translation of picornavirus RNA is initiated after ribosomal binding to an internal ribosomal entry site (IRES) within the 5' untranslated region. We have reconstituted IRES-mediated initiation on encephalomyocarditis virus RNA from purified components and used primer extension analysis to confirm the fidelity of 48S preinitiation complex formation. Eukaryotic initiation factor 2 (eIF2), eIF3, and eIF4F were required for initiation; eIF4B and to a lesser extent the pyrimidine tract-binding protein stimulated this process. We show that eIF4F binds to the IRES in a novel cap-independent manner and suggest that cap- and IRES-dependent initiation mechanisms utilize different modes of interaction with this factor to promote ribosomal attachment to mRNA. PMID:8943341

  14. Structural basis for interaction of a cotranslational chaperone with the eukaryotic ribosome.

    PubMed

    Zhang, Yixiao; Ma, Chengying; Yuan, Yi; Zhu, Jing; Li, Ningning; Chen, Chu; Wu, Shan; Yu, Li; Lei, Jianlin; Gao, Ning

    2014-12-01

    Cotranslational chaperones, ubiquitous in all living organisms, protect nascent polypeptides from aggregation and facilitate their de novo folding. Importantly, emerging data have also suggested that ribosome-associated cotranslational chaperones have active regulatory roles in modulating protein translation. By characterizing the structure of a type of eukaryotic cotranslational chaperone, the ribosome-associated complex (RAC) from Saccharomyces cerevisiae, we show that RAC cross-links two ribosomal subunits, through a single long α-helix, to limit the predominant intersubunit rotation required for peptide elongation. We further demonstrate that any changes in the continuity, length or rigidity of this middle α-helix impair RAC function in vivo. Our results suggest a new mechanism in which RAC directly regulates protein translation by mechanically coupling cotranslational folding with the peptide-elongation cycle, and they lay the foundation for further exploration of regulatory roles of RAC in translation control.

  15. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-08-24

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon.

  16. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  17. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  18. Arrested cell proliferation through cysteine protease activity of eukaryotic ribosomal protein S4.

    PubMed

    Yadaiah, Madasu; Sudhamalla, Babu; Rao, P Nageswara; Roy, Karnati R; Ramakrishna, Dasari; Hussain Syed, Gulam; Ramaiah, Kolluru V A; Bhuyan, Abani K

    2013-02-01

    S4 is an integral protein of the smaller subunit of cytosolic ribosome. In prokaryotes, it regulates the synthesis of ribosomal proteins by feedback inhibition of the α-operon gene expression, and it facilitates ribosomal RNA synthesis by direct binding to RNA polymerase. However, functional roles of S4 in eukaryotes are poorly understood, although its deficiency in humans is thought to produce Turner syndrome. We report here that wheat S4 is a cysteine protease capable of abrogating total protein synthesis in an actively translating cell-free system of rabbit reticulocytes. The translation-blocked medium, imaged by atomic force microscopy, scanning electron microscopy, and transmission electron microscopy, shows dispersed polysomes, and the disbanded polyribosome elements aggregate to form larger bodies. We also show that human embryonic kidney cells transfected with recombinant wheat S4 are unable to grow and proliferate. The mutant S4 protein, where the putative active site residue Cys 41 is replaced by a phenylalanine, can neither suppress protein synthesis nor arrest cell proliferation, suggesting that the observed phenomenon arises from the cysteine protease attribute of S4. The results also inspire many questions concerning in vivo significance of extraribosomal roles of eukaryotic S4 performed through its protease activity.

  19. Dissociation of ribosomes into large and small subunits.

    PubMed

    Rivera, Maria C; Maguire, Bruce; Lake, James A

    2015-04-01

    Structural and functional studies of ribosomal subunits require the dissociation of intact ribosomes into individual small and large ribosomal subunits. The dissociation of the prokaryotic 70S ribosomes into the 50S and 30S subunits is achieved by dialysis against a buffer containing a lower Mg(2+) concentration. Eukaryotic 80S ribosomes are dissociated into 60S and 40S subunits by incubation in a buffer containing puromycin and higher KCl and Mg(2+) concentrations.

  20. Stage-specific assembly events of the 6-MDa small-subunit processome initiate eukaryotic ribosome biogenesis.

    PubMed

    Chaker-Margot, Malik; Hunziker, Mirjam; Barandun, Jonas; Dill, Brian D; Klinge, Sebastian

    2015-11-01

    Eukaryotic ribosome biogenesis involves a plethora of ribosome-assembly factors, and their temporal order of association with preribosomal RNA is largely unknown. By using Saccharomyces cerevisiae as a model organism, we developed a system that recapitulates and arrests ribosome assembly at early stages, thus providing in vivo snapshots of nascent preribosomal particles. Here we report the stage-specific order in which 70 ribosome-assembly factors associate with preribosomal RNA domains, thereby forming the 6-MDa small-subunit processome. PMID:26479197

  1. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay

    2011-01-01

    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  2. GC-biased gene conversion impacts ribosomal DNA evolution in vertebrates, angiosperms, and other eukaryotes.

    PubMed

    Escobar, Juan S; Glémin, Sylvain; Galtier, Nicolas

    2011-09-01

    Ribosomal DNA (rDNA) is one of the most conserved genes in eukaryotes. The multiples copies of rDNA in the genome evolve in a concerted manner, through unequal crossing over and/or gene conversion, two mechanisms related to homologous recombination. Recombination increases local GC content in several organisms through a process known as GC-biased gene conversion (gBGC). gBGC has been well characterized in mammals, birds, and grasses, but its phylogenetic distribution across the tree of life is poorly understood. Here, we test the hypothesis that recombination affects the evolution of base composition in 18S rDNA and examine the reliability of this thoroughly studied molecule as a marker of gBGC in eukaryotes. Phylogenetic analyses of 18S rDNA in vertebrates and angiosperms reveal significant heterogeneity in the evolution of base composition across both groups. Mammals, birds, and grasses experience increases in the GC content of the 18S rDNA, consistent with previous genome-wide analyses. In addition, we observe increased GC contents in Ostariophysi ray-finned fishes and commelinid monocots (i.e., the clade including grasses), suggesting that the genomes of these two groups have been affected by gBGC. Polymorphism analyses in rDNA confirm that gBGC, not mutation bias, is the most plausible explanation for these patterns. We also find that helix and loop sites of the secondary structure of ribosomal RNA do not evolve at the same pace: loops evolve faster than helices, whereas helices are GC richer than loops. We extend analyses to major lineages of eukaryotes and suggest that gBGC might have also affected base composition in Giardia (Diplomonadina), nudibranch gastropods (Mollusca), and Asterozoa (Echinodermata). PMID:21444650

  3. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly.

    PubMed

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R; Kim, Kelly H; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-29

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes-UtpA and UtpB-interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  4. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    NASA Astrophysics Data System (ADS)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  5. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    PubMed Central

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-01-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes—UtpA and UtpB—interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA–protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5′ end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5′ ETS and U3 snoRNA as well as the 3′ boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly. PMID:27354316

  6. Integrative structural analysis of the UTPB complex, an early assembly factor for eukaryotic small ribosomal subunits

    PubMed Central

    Zhang, Cheng; Sun, Qi; Chen, Rongchang; Chen, Xining; Lin, Jinzhong; Ye, Keqiong

    2016-01-01

    Ribosome assembly is an essential and conserved cellular process in eukaryotes that requires numerous assembly factors. The six-subunit UTPB complex is an essential component of the 90S precursor of the small ribosomal subunit. Here, we analyzed the molecular architecture of UTPB using an integrative structural biology approach. We mapped the major interactions that associate each of six UTPB proteins. Crystallographic studies showed that Utp1, Utp21, Utp12 and Utp13 are evolutionarily related and form a dimer of dimers (Utp1–Utp21, Utp12–Utp13) through their homologous helical C-terminal domains. Molecular docking with crosslinking restraints showed that the WD domains of Utp12 and Utp13 are associated, as are the WD domains of Utp1, Utp21 and Utp18. Electron microscopy images of the entire UTPB complex revealed that it predominantly adopts elongated conformations and possesses internal flexibility. We also determined crystal structures of the WD domain of Utp18 and the HAT and deviant HAT domains of Utp6. A structural model of UTPB was derived based on these data. PMID:27330138

  7. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.

    PubMed

    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

    2016-09-19

    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

  8. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits

    PubMed Central

    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

    2016-01-01

    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873

  9. The eukaryote-specific N-terminal extension of ribosomal protein S31 contributes to the assembly and function of 40S ribosomal subunits.

    PubMed

    Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús

    2016-09-19

    The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D.

  10. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding.

  11. Transcriptome-wide studies uncover the diversity of modes of mRNA recruitment to eukaryotic ribosomes.

    PubMed

    Shatsky, Ivan N; Dmitriev, Sergey E; Andreev, Dmitri E; Terenin, Ilya M

    2014-01-01

    The conventional paradigm of translation initiation in eukaryotes states that the cap-binding protein complex eIF4F (consisting of eIF4E, eIF4G and eIF4A) plays a central role in the recruitment of capped mRNAs to ribosomes. However, a growing body of evidence indicates that this paradigm should be revised. This review summarizes the data which have been mostly accumulated in a post-genomic era owing to revolutionary techniques of transcriptome-wide analysis. Unexpectedly, these techniques have uncovered remarkable diversity in the recruitment of cellular mRNAs to eukaryotic ribosomes. These data enable a preliminary classification of mRNAs into several groups based on their requirement for particular components of eIF4F. They challenge the widely accepted concept which relates eIF4E-dependence to the extent of secondary structure in the 5' untranslated regions of mRNAs. Moreover, some mRNA species presumably recruit ribosomes to their 5' ends without the involvement of either the 5' m(7)G-cap or eIF4F but instead utilize eIF4G or eIF4G-like auxiliary factors. The long-standing concept of internal ribosome entry site (IRES)-elements in cellular mRNAs is also discussed.

  12. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  13. How does a scanning ribosomal particle move along the 5'-untranslated region of eukaryotic mRNA? Brownian Ratchet model.

    PubMed

    Spirin, Alexander S

    2009-11-17

    A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.

  14. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs

    PubMed Central

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964

  15. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964

  16. Mechanistic Insight into the Reactivation of BCAII Enzyme from Denatured and Molten Globule States by Eukaryotic Ribosomes and Domain V rRNAs.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process.

  17. Selection of antigenic markers on a GFP-C{kappa} fusion scaffold with high sensitivity by eukaryotic ribosome display

    SciTech Connect

    Yang Yongmin; Barankiewicz, Teresa J.; He Mingyue; Taussig, Michael J.; Chen, Swey-Shen . E-mail: alexchen.IGE.com@gmail.com

    2007-07-27

    Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (C{kappa}) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes on either GFP (5') or C{kappa} (3') were selected by anti-GFP or anti-C{kappa} antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins.

  18. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome.

    PubMed

    Prokhorova, Irina V; Akulich, Kseniya A; Makeeva, Desislava S; Osterman, Ilya A; Skvortsov, Dmitry A; Sergiev, Petr V; Dontsova, Olga A; Yusupova, Gulnara; Yusupov, Marat M; Dmitriev, Sergey E

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  19. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome.

    PubMed

    Prokhorova, Irina V; Akulich, Kseniya A; Makeeva, Desislava S; Osterman, Ilya A; Skvortsov, Dmitry A; Sergiev, Petr V; Dontsova, Olga A; Yusupova, Gulnara; Yusupov, Marat M; Dmitriev, Sergey E

    2016-06-14

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value.

  20. Amicoumacin A induces cancer cell death by targeting the eukaryotic ribosome

    PubMed Central

    Prokhorova, Irina V.; Akulich, Kseniya A.; Makeeva, Desislava S.; Osterman, Ilya A.; Skvortsov, Dmitry A.; Sergiev, Petr V.; Dontsova, Olga A.; Yusupova, Gulnara; Yusupov, Marat M.; Dmitriev, Sergey E.

    2016-01-01

    Amicoumacin A is an antibiotic that was recently shown to target bacterial ribosomes. It affects translocation and provides an additional contact interface between the ribosomal RNA and mRNA. The binding site of amicoumacin A is formed by universally conserved nucleotides of rRNA. In this work, we showed that amicoumacin A inhibits translation in yeast and mammalian systems by affecting translation elongation. We determined the structure of the amicoumacin A complex with yeast ribosomes at a resolution of 3.1  Å. Toxicity measurement demonstrated that human cancer cell lines are more susceptible to the inhibition by this compound as compared to non-cancerous ones. This might be used as a starting point to develop amicoumacin A derivatives with clinical value. PMID:27296282

  1. Potential key bases of ribosomal RNA to kingdom-specific spectra of antibiotic susceptibility and the possible archaeal origin of eukaryotes.

    PubMed

    Xie, Qiang; Wang, Yanhui; Lin, Jinzhong; Qin, Yan; Wang, Ying; Bu, Wenjun

    2012-01-01

    In support of the hypothesis of the endosymbiotic origin of eukaryotes, much evidence has been found to support the idea that some organelles of eukaryotic cells originated from bacterial ancestors. Less attention has been paid to the identity of the host cell, although some biochemical and molecular genetic properties shared by archaea and eukaryotes have been documented. Through comparing 507 taxa of 16S-18S rDNA and 347 taxa of 23S-28S rDNA, we found that archaea and eukaryotes share twenty-six nucleotides signatures in ribosomal DNA. These signatures exist in all living eukaryotic organisms, whether protist, green plant, fungus, or animal. This evidence explicitly supports the archaeal origin of eukaryotes. In the ribosomal RNA, besides A2058 in Escherichia coli vs. G2400 in Saccharomyces cerevisiae, there still exist other twenties of sites, in which the bases are kingdom-specific. Some of these sites concentrate in the peptidyl transferase centre (PTC) of the 23S-28S rRNA. The results suggest potential key sites to explain the kingdom-specific spectra of drug resistance of ribosomes.

  2. Cladistic analysis of ribosomal RNAs--the phylogeny of eukaryotes with respect to the endosymbiotic theory.

    PubMed

    Wolters, J; Erdmann, V A

    1988-01-01

    A strict cladistic analysis of 5S and 16S rRNA secondary and primary structure confirms particular hypotheses concerning the phylogeny of eukaryotes: plastids of Euglena, green algae and land plants, and the cyanelle of Cyanophora share a specific character and are closely related to cyanobacteria of the Synechococcus-type. Angiosperm mitochondria share specific signatures with the alpha subdivision of rhodobacteria. Cyanophora is a member of the Euglenozoa, the Oomycetes are derived from a group of heterokont algae.

  3. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Global eukaryote phylogeny: Combined small- and large-subunit ribosomal DNA trees support monophyly of Rhizaria, Retaria and Excavata.

    PubMed

    Moreira, David; von der Heyden, Sophie; Bass, David; López-García, Purificación; Chao, Ema; Cavalier-Smith, Thomas

    2007-07-01

    Resolution of the phylogenetic relationships among the major eukaryotic groups is one of the most important problems in evolutionary biology that is still only partially solved. This task was initially addressed using a single marker, the small-subunit ribosomal DNA (SSU rDNA), although in recent years it has been shown that it does not contain enough phylogenetic information to robustly resolve global eukaryotic phylogeny. This has prompted the use of multi-gene analyses, especially in the form of long concatenations of numerous conserved protein sequences. However, this approach is severely limited by the small number of taxa for which such a large number of protein sequences is available today. We have explored the alternative approach of using only two markers but a large taxonomic sampling, by analysing a combination of SSU and large-subunit (LSU) rDNA sequences. This strategy allows also the incorporation of sequences from non-cultivated protists, e.g., Radiozoa (=radiolaria minus Phaeodarea). We provide the first LSU rRNA sequences for Heliozoa, Apusozoa (both Apusomonadida and Ancyromonadida), Cercozoa and Radiozoa. Our Bayesian and maximum likelihood analyses for 91 eukaryotic combined SSU+LSU sequences yielded much stronger support than hitherto for the supergroup Rhizaria (Cercozoa plus Radiozoa plus Foraminifera) and several well-recognised groups and also for other problematic clades, such as the Retaria (Radiozoa plus Foraminifera) and, with more moderate support, the Excavata. Within opisthokonts, the combined tree strongly confirms that the filose amoebae Nuclearia are sisters to Fungi whereas other Choanozoa are sisters to animals. The position of some bikont taxa, notably Heliozoa and Apusozoa, remains unresolved. However, our combined trees suggest a more deeply diverging position for Ancyromonas, and perhaps also Apusomonas, than for other bikonts, suggesting that apusozoan zooflagellates may be central for understanding the early evolution of

  5. Mutations in eukaryotic 18S ribosomal RNA affect translational fidelity and resistance to aminoglycoside antibiotics.

    PubMed

    Chernoff, Y O; Vincent, A; Liebman, S W

    1994-02-15

    Mutations have been created in the Saccharomyces cerevisiae 18S rRNA gene that correspond to those known to be involved in the control of translational fidelity or antibiotic resistance in prokaryotes. Yeast strains, in which essentially all chromosomal rDNA repeats are deleted and all cellular rRNAs are encoded by plasmid, have been constructed that contain only mutant 18S rRNA. In Escherichia coli, a C-->U substitution at position 912 of the small subunit rRNA causes streptomycin resistance. Eukaryotes normally carry U at the corresponding position and are naturally resistant to streptomycin. We show that a U-->C transition (rdn-4) at this position of the yeast 18S rRNA gene decreases resistance to streptomycin. The rdn-4 mutation also increases resistance to paromomycin and G-418, and inhibits nonsense suppression induced by paromomycin. The same phenotypes, as well as a slow growth phenotype, are also associated with rdn-2, whose prokaryotic counterpart, 517 G-->A, manifests itself as a suppressor rather than an antisuppressor. Neither rdn-2- nor rdn-4-related phenotypes could be detected in the presence of the normal level of wild-type rDNA repeats. Our data demonstrate that eukaryotic rRNA is involved in the control of translational fidelity, and indicate that rRNA features important for interactions with aminoglycosides have been conserved throughout evolution.

  6. Reconstructing evolution from eukaryotic small-ribosomal-subunit RNA sequences: calibration of the molecular clock.

    PubMed

    Van de Peer, Y; Neefs, J M; De Rijk, P; De Wachter, R

    1993-08-01

    The detailed descriptions now available for the secondary structure of small-ribosomal-subunit RNA, including areas of highly variable primary structure, facilitate the alignment of nucleotide sequences. However, for optimal exploitation of the information contained in the alignment, a method must be available that takes into account the local sequence variability in the computation of evolutionary distance. A quantitative definition for the variability of an alignment position is proposed in this study. It is a parameter in an equation which expresses the probability that the alignment position contains a different nucleotide in two sequences, as a function of the distance separating these sequences, i.e., the number of substitutions per nucleotide that occurred during their divergence. This parameter can be estimated from the distance matrix resulting from the conversion of pairwise sequence dissimilarities into pairwise distances. Alignment positions can then be subdivided into a number of sets of matching variability, and the average variability of each set can be derived. Next, the conversion of dissimilarity into distance can be recalculated for each set of alignment positions separately, using a modified version of the equation that corrects for multiple substitutions and changing for each set the parameter that reflects its average variability. The distances computed for each set are finally averaged, giving a more precise distance estimation. Trees constructed by the algorithm based on variability calibration have a topology markedly different from that of trees constructed from the same alignments in the absence of calibration. This is illustrated by means of trees constructed from small-ribosomal-subunit RNA sequences of Metazoa. A reconstruction of vertebrate evolution based on calibrated alignments matches the consensus view of paleontologists, contrary to trees based on uncalibrated alignments. In trees derived from sequences covering several metazoan

  7. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    PubMed

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  8. An overview of the secondary structure of the V4 region of eukaryotic small-subunit ribosomal RNA.

    PubMed

    Nickrent, D L; Sargent, M L

    1991-01-25

    The V4 region of the small subunit (18S) ribosomal RNA was examined in 72 different sequences representing a broad sample eukaryotic diversity. This domain is the most variable region of the 18S rRNA molecule and ranges in length from ca. 230 to over 500 bases. Based upon comparative analysis, secondary structural models were constructed for all sequences and the resulting generalized model shows that most organisms possess seven helices for this region. The protists and two insects show from one to as many as four helices in addition to the above seven. In this report, we summarize secondary structure information presented elsewhere for the V4 region, describe the general features for helical and apical regions, and identify signature sequences useful in helix identification. Our model generally agrees with other current concepts; however, we propose modifications or alternative structures for the start of the V4 region, the large protist inserts, and the sector that may possibly contain a pseudoknot.

  9. Optimal eukaryotic 18S and universal 16S/18S ribosomal RNA primers and their application in a study of symbiosis.

    PubMed

    Wang, Yong; Tian, Ren Mao; Gao, Zhao Ming; Bougouffa, Salim; Qian, Pei-Yuan

    2014-01-01

    Eukaryotic 18S ribosomal RNA (rRNA) gene primers that feature a wide coverage are critical in detecting the composition of eukaryotic microscopic organisms in ecosystems. Here, we predicted 18S rRNA primers based on consecutive conserved sites and evaluated their coverage efficiency and scope of application to different eukaryotic groups. After evaluation, eight of them were considered as qualified 18S primers based on coverage rate. Next, we examined common conserved regions in prokaryotic 16S and eukaryotic 18S rRNA sequences to design 16S/18S universal primers. Three 16S/18S candidate primers, U515, U1390 and U1492, were then considered to be suitable for simultaneous amplification of the rRNA sequences in three domains. Eukaryotic 18S and prokaryotic 16S rRNA genes in a sponge were amplified simultaneously using universal primers U515 and U1390, and the subsequent sorting of pyrosequenced reads revealed some distinctive communities in different parts of the sample. The real difference in biodiversity between prokaryotic and eukaryotic symbionts could be discerned as the dissimilarity between OTUs was increased from 0.005 to 0.1. A network of the communities in external and internal parts of the sponge illustrated the co-variation of some unique microbes in certain parts of the sponge, suggesting that the universal primers are useful in simultaneous detection of prokaryotic and eukaryotic microbial communities.

  10. A conserved domain important for association of eukaryotic J-protein co-chaperones Jjj1 and Zuo1 with the ribosome.

    PubMed

    Kaschner, Lindsey A; Sharma, Ruchika; Shrestha, Om Kumar; Meyer, Alison E; Craig, Elizabeth A

    2015-05-01

    J-proteins, obligate co-chaperones, provide specialization for Hsp70 function in a variety of cellular processes. Two of the 13 J-proteins of the yeast cytosol/nucleus, Zuo1 and Jjj1, are associated with 60S ribosomal subunits. Abundant Zuo1 facilitates folding of nascent polypeptides; Jjj1, of much lower abundance, functions in ribosome biogenesis. However, overexpression of Jjj1 substantially rescues growth defects of cells lacking Zuo1. We analyzed a region held in common by Zuo1 and Jjj1, outside the signature J-domain found in all J-proteins. This shared "zuotin homology domain" (ZHD) is important for ribosome association of both proteins. An N-terminal segment of Jjj1, containing the J-domain and ZHD, is ribosome-associated and, like full-length Jjj1, is competent to rescue both the cold- and cation-sensitivity of ∆zuo1. However, this fragment, when expressed at normal levels, cannot rescue the cytosolic ribosome biogenesis defect of ∆jjj1. Our results are consistent with a model in which the primary functions of Zuo1 and Jjj1 occur in the cytosol. In addition, our data suggest that Zuo1 and Jjj1 bind overlapping sites on ribosomes due to an interaction via their common ZHDs, but Jjj1 binds primarily to pre-60S particles and Zuo1 to mature subunits. We hypothesize that ZUO1 and JJJ1, which are conserved throughout eukaryotes, arose from an ancient duplication of a progenitor J-protein gene that encoded the ZHD ribosome-binding region; subsequently, specialized roles and additional ribosome interaction sites evolved.

  11. Structure–function insights reveal the human ribosome as a cancer target for antibiotics

    PubMed Central

    Myasnikov, Alexander G.; Kundhavai Natchiar, S.; Nebout, Marielle; Hazemann, Isabelle; Imbert, Véronique; Khatter, Heena; Peyron, Jean-François; Klaholz, Bruno P.

    2016-01-01

    Many antibiotics in clinical use target the bacterial ribosome by interfering with the protein synthesis machinery. However, targeting the human ribosome in the case of protein synthesis deregulations such as in highly proliferating cancer cells has not been investigated at the molecular level up to now. Here we report the structure of the human 80S ribosome with a eukaryote-specific antibiotic and show its anti-proliferative effect on several cancer cell lines. The structure provides insights into the detailed interactions in a ligand-binding pocket of the human ribosome that are required for structure-assisted drug design. Furthermore, anti-proliferative dose response in leukaemic cells and interference with synthesis of c-myc and mcl-1 short-lived protein markers reveals specificity of a series of eukaryote-specific antibiotics towards cytosolic rather than mitochondrial ribosomes, uncovering the human ribosome as a promising cancer target. PMID:27665925

  12. Primary and secondary structure of the 18S ribosomal RNA of the bird spider Eurypelma californica and evolutionary relationships among eukaryotic phyla.

    PubMed

    Hendriks, L; Van Broeckhoven, C; Vandenberghe, A; Van de Peer, Y; De Wachter, R

    1988-10-15

    The primary structure of the 18S rRNA of the bird spider Eurypelma californica has been determined in the framework of a study of metazoan phylogeny on the basis of ribosomal RNA structure. A secondary-structure model was derived by comparison of the sequence with that of 43 other eukaryotic small-ribosomal-subunit RNA sequences presently available. This comparison allows a rather detailed secondary-structure pattern to be postulated for a eukaryote-specific area of highly variable sequence and length for which no consensus model has hitherto been attained. A dendrogram, reflecting evolutionary relationships among the 40 eukaryotic species of known 18S rRNA structure, was constructed by a matrix method selecting the best-fitting tree on the basis of a least-squares criterion. The tree shows an early divergence of a microsporidium, an euglenoid, kinetoplastids and a slime mold. Among the remaining species, two main clusters are distinguishable, one comprising the Ciliata, the other comprising Metazoa, green plants, fungi and several protists. Among the Metazoa, the three phyla presently investigated, viz. Chordata, Arthropoda and Nemathelminthes, are distinguishable as three separate lines of descent.

  13. The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote small sub-unit rRNA sequences with curated taxonomy.

    PubMed

    Guillou, Laure; Bachar, Dipankar; Audic, Stéphane; Bass, David; Berney, Cédric; Bittner, Lucie; Boutte, Christophe; Burgaud, Gaétan; de Vargas, Colomban; Decelle, Johan; Del Campo, Javier; Dolan, John R; Dunthorn, Micah; Edvardsen, Bente; Holzmann, Maria; Kooistra, Wiebe H C F; Lara, Enrique; Le Bescot, Noan; Logares, Ramiro; Mahé, Frédéric; Massana, Ramon; Montresor, Marina; Morard, Raphael; Not, Fabrice; Pawlowski, Jan; Probert, Ian; Sauvadet, Anne-Laure; Siano, Raffaele; Stoeck, Thorsten; Vaulot, Daniel; Zimmermann, Pascal; Christen, Richard

    2013-01-01

    The interrogation of genetic markers in environmental meta-barcoding studies is currently seriously hindered by the lack of taxonomically curated reference data sets for the targeted genes. The Protist Ribosomal Reference database (PR(2), http://ssu-rrna.org/) provides a unique access to eukaryotic small sub-unit (SSU) ribosomal RNA and DNA sequences, with curated taxonomy. The database mainly consists of nuclear-encoded protistan sequences. However, metazoans, land plants, macrosporic fungi and eukaryotic organelles (mitochondrion, plastid and others) are also included because they are useful for the analysis of high-troughput sequencing data sets. Introns and putative chimeric sequences have been also carefully checked. Taxonomic assignation of sequences consists of eight unique taxonomic fields. In total, 136 866 sequences are nuclear encoded, 45 708 (36 501 mitochondrial and 9657 chloroplastic) are from organelles, the remaining being putative chimeric sequences. The website allows the users to download sequences from the entire and partial databases (including representative sequences after clustering at a given level of similarity). Different web tools also allow searches by sequence similarity. The presence of both rRNA and rDNA sequences, taking into account introns (crucial for eukaryotic sequences), a normalized eight terms ranked-taxonomy and updates of new GenBank releases were made possible by a long-term collaboration between experts in taxonomy and computer scientists.

  14. Partial methylation at Am100 in 18S rRNA of baker's yeast reveals ribosome heterogeneity on the level of eukaryotic rRNA modification.

    PubMed

    Buchhaupt, Markus; Sharma, Sunny; Kellner, Stefanie; Oswald, Stefanie; Paetzold, Melanie; Peifer, Christian; Watzinger, Peter; Schrader, Jens; Helm, Mark; Entian, Karl-Dieter

    2014-01-01

    Ribosome heterogeneity is of increasing biological significance and several examples have been described for multicellular and single cells organisms. In here we show for the first time a variation in ribose methylation within the 18S rRNA of Saccharomyces cerevisiae. Using RNA-cleaving DNAzymes, we could specifically demonstrate that a significant amount of S. cerevisiae ribosomes are not methylated at 2'-O-ribose of A100 residue in the 18S rRNA. Furthermore, using LC-UV-MS/MS of a respective 18S rRNA fragment, we could not only corroborate the partial methylation at A100, but could also quantify the methylated versus non-methylated A100 residue. Here, we exhibit that only 68% of A100 in the 18S rRNA of S.cerevisiae are methylated at 2'-O ribose sugar. Polysomes also contain a similar heterogeneity for methylated Am100, which shows that 40S ribosome subunits with and without Am100 participate in translation. Introduction of a multicopy plasmid containing the corresponding methylation guide snoRNA gene SNR51 led to an increased A100 methylation, suggesting the cellular snR51 level to limit the extent of this modification. Partial rRNA modification demonstrates a new level of ribosome heterogeneity in eukaryotic cells that might have substantial impact on regulation and fine-tuning of the translation process.

  15. Crosslinking of eukaryotic initiation factor eIF3 to the 40S ribosomal subunit from rabbit reticulocytes.

    PubMed

    Tolan, D R; Hershey, J W; Traut, R T

    1983-07-01

    Complexes of purified 40S ribosomal subunits and initiation factor 3 from rabbit reticulocytes were crosslinked using the reversible protein crosslinking reagent, 2-iminothiolane, under conditions shown previously to lead to the formation of dimers between 40S proteins but not higher multimers. The activity of both the 40S subunits and initiation factor 3 was maintained. Protein crosslinked to the factor was purified by sucrose density gradient centrifugation following nuclease digestion of the ribosomal subunit: alternatively, the total protein was extracted from 40S: factor complexes. The protein obtained by either method was analyzed by two-dimensional diagonal polyacrylamide/sodium dodecyl sulfate gel electrophoresis. Ribosomal proteins were found in multimeric complexes of high molecular weight due to their crosslinking to components of eIF3. Identification of the ribosomal proteins appearing below the diagonal was accomplished by elution, radioiodination, two-dimensional polyacrylamide/urea gel electrophoresis, and radioautography. Proteins S2, S3, S3a, S4, S5, S6, S8, S9, S11, S12, S14, S15, S16, S19, S24, S25, and S26 were identified. Because many of the proteins in this group form crosslinked dimers with each other, it was impossible to distinguish proteins directly crosslinked to eIF3 from those crosslinked indirectly through one bridging protein. The results nonetheless imply that the 40S ribosomal proteins identified are at or near the binding site for initiation factor 3.

  16. Partial phylogeny of the unicellular eukaryotes based on rapid sequencing of a portion of 28S ribosomal RNA.

    PubMed

    Baroin, A; Perasso, R; Qu, L H; Brugerolle, G; Bachellerie, J P; Adoutte, A

    1988-05-01

    Using a rapid rRNA sequencing technique, we have determined the sequence of the 400 nucleotides located at the 5' end of the large subunit rRNA molecule from eight species of unicellular eukaryotes (protists). This region contains a pair of conservative domains well-suited for long-range phylogenetic evaluations among eukaryotes, due both to their substantia, length and to their intrinsic rate of sequence variation during evolution. It also comprises a central more rapidly evolving portion, which allows for a fine tuning of distance evaluation between closely related species. Molecular distances were computed between the aligned nucleotides of all presently available protist sequences and were used to derive a tentative dendrogram. Within the limitations inherent to this approach, a number of interesting observations emerge: The various protist groups appear to have separated very early from each other. The most deeply divergent protists belong to a number of orders of flagellates (mastigotes), suggesting a very ancient origin for organelles containing a 9 + 2 microtubular arrangement. Ciliates emerged late among eukaryotes, suggesting that their peculiar genetic code was derived secondarily. Moreover, a dinoflagellate clusters with ciliates, thus making it likely that the unusual features of nuclear organization and mitosis of this group are not primitive but derived characters. Finally, within groups, taxonomic and evolutionary inferences appear to be feasible using this portion of the rRNA.

  17. Partial phylogeny of the unicellular eukaryotes based on rapid sequencing of a portion of 28S ribosomal RNA.

    PubMed Central

    Baroin, A; Perasso, R; Qu, L H; Brugerolle, G; Bachellerie, J P; Adoutte, A

    1988-01-01

    Using a rapid rRNA sequencing technique, we have determined the sequence of the 400 nucleotides located at the 5' end of the large subunit rRNA molecule from eight species of unicellular eukaryotes (protists). This region contains a pair of conservative domains well-suited for long-range phylogenetic evaluations among eukaryotes, due both to their substantia, length and to their intrinsic rate of sequence variation during evolution. It also comprises a central more rapidly evolving portion, which allows for a fine tuning of distance evaluation between closely related species. Molecular distances were computed between the aligned nucleotides of all presently available protist sequences and were used to derive a tentative dendrogram. Within the limitations inherent to this approach, a number of interesting observations emerge: The various protist groups appear to have separated very early from each other. The most deeply divergent protists belong to a number of orders of flagellates (mastigotes), suggesting a very ancient origin for organelles containing a 9 + 2 microtubular arrangement. Ciliates emerged late among eukaryotes, suggesting that their peculiar genetic code was derived secondarily. Moreover, a dinoflagellate clusters with ciliates, thus making it likely that the unusual features of nuclear organization and mitosis of this group are not primitive but derived characters. Finally, within groups, taxonomic and evolutionary inferences appear to be feasible using this portion of the rRNA. PMID:3368456

  18. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes.

    PubMed

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-12-15

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  19. The structure of Erb1-Ytm1 complex reveals the functional importance of a high-affinity binding between two β-propellers during the assembly of large ribosomal subunits in eukaryotes

    PubMed Central

    Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo

    2015-01-01

    Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442

  20. Interferon-dependent engagement of eukaryotic initiation factor 4B via S6 kinase (S6K)- and ribosomal protein S6K-mediated signals.

    PubMed

    Kroczynska, Barbara; Kaur, Surinder; Katsoulidis, Efstratios; Majchrzak-Kita, Beata; Sassano, Antonella; Kozma, Sara C; Fish, Eleanor N; Platanias, Leonidas C

    2009-05-01

    Although the roles of Jak-Stat pathways in type I and II interferon (IFN)-dependent transcriptional regulation are well established, the precise mechanisms of mRNA translation for IFN-sensitive genes remain to be defined. We examined the effects of IFNs on the phosphorylation/activation of eukaryotic translation initiation factor 4B (eIF4B). Our data show that eIF4B is phosphorylated on Ser422 during treatment of sensitive cells with alpha IFN (IFN-alpha) or IFN-gamma. Such phosphorylation is regulated, in a cell type-specific manner, by either the p70 S6 kinase (S6K) or the p90 ribosomal protein S6K (RSK) and results in enhanced interaction of the protein with eIF3A (p170/eIF3A) and increased associated ATPase activity. Our data also demonstrate that IFN-inducible eIF4B activity and IFN-stimulated gene 15 protein (ISG15) or IFN-gamma-inducible chemokine CXCL-10 protein expression are diminished in S6k1/S6k2 double-knockout mouse embryonic fibroblasts. In addition, IFN-alpha-inducible ISG15 protein expression is blocked by eIF4B or eIF3A knockdown, establishing a requirement for these proteins in mRNA translation/protein expression by IFNs. Importantly, the generation of IFN-dependent growth inhibitory effects on primitive leukemic progenitors is dependent on activation of the S6K/eIF4B or RSK/eIF4B pathway. Taken together, our findings establish critical roles for S6K and RSK in the induction of IFN-dependent biological effects and define a key regulatory role for eIF4B as a common mediator and integrator of IFN-generated signals from these kinases. PMID:19289497

  1. Structural basis for the binding of IRES RNAs to the head of the ribosomal 40S subunit

    PubMed Central

    Muhs, Margarita; Yamamoto, Hiroshi; Ismer, Jochen; Takaku, Hiroaki; Nashimoto, Masayuki; Uchiumi, Toshio; Nakashima, Nobuhiko; Mielke, Thorsten; Hildebrand, Peter W.; Nierhaus, Knud H.; Spahn, Christian M. T.

    2011-01-01

    Some viruses exploit internal initiation for their propagation in the host cell. This type of initiation is facilitated by structured elements (internal ribosome entry site, IRES) upstream of the initiator AUG and requires only a reduced number of canonical initiation factors. An important example are IRES of the virus family Dicistroviridae that bind to the inter-subunit side of the small ribosomal 40S subunit and lead to the formation of elongation-competent 80S ribosomes without the help of any initiation factor. Here, we present a comprehensive functional and structural analysis of eukaryotic-specific ribosomal protein rpS25 in the context of this type of initiation and propose a structural model explaining the essential involvement of rpS25 for hijacking the ribosome. PMID:21378123

  2. rRNA suppressor of a eukaryotic translation initiation factor 5B/initiation factor 2 mutant reveals a binding site for translational GTPases on the small ribosomal subunit.

    PubMed

    Shin, Byung-Sik; Kim, Joo-Ran; Acker, Michael G; Maher, Kathryn N; Lorsch, Jon R; Dever, Thomas E

    2009-02-01

    The translational GTPases promote initiation, elongation, and termination of protein synthesis by interacting with the ribosome. Mutations that impair GTP hydrolysis by eukaryotic translation initiation factor 5B/initiation factor 2 (eIF5B/IF2) impair yeast cell growth due to failure to dissociate from the ribosome following subunit joining. A mutation in helix h5 of the 18S rRNA in the 40S ribosomal subunit and intragenic mutations in domain II of eIF5B suppress the toxic effects associated with expression of the eIF5B-H480I GTPase-deficient mutant in yeast by lowering the ribosome binding affinity of eIF5B. Hydroxyl radical mapping experiments reveal that the domain II suppressors interface with the body of the 40S subunit in the vicinity of helix h5. As the helix h5 mutation also impairs elongation factor function, the rRNA and eIF5B suppressor mutations provide in vivo evidence supporting a functionally important docking of domain II of the translational GTPases on the body of the small ribosomal subunit.

  3. Education in the 80's: Science.

    ERIC Educational Resources Information Center

    Rowe, Mary Budd, Ed.

    Designed to serve as a resource for science teachers, kindergarten through college, this publication contains 10 chapters, each focused on a topic of interest to science teachers working in the 1980's. Chapter titles and their authors are: (1) Understanding Science as a Cultural Phenomenon - Mission for the 80's, Drew Christianson; (2) What…

  4. Expanding the ribosomal universe.

    PubMed

    Dinman, Jonathan D; Kinzy, Terri Goss

    2009-12-01

    In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.

  5. The scanning mechanism of eukaryotic translation initiation.

    PubMed

    Hinnebusch, Alan G

    2014-01-01

    In eukaryotes, the translation initiation codon is generally identified by the scanning mechanism, wherein every triplet in the messenger RNA leader is inspected for complementarity to the anticodon of methionyl initiator transfer RNA (Met-tRNAi). Binding of Met-tRNAi to the small (40S) ribosomal subunit, in a ternary complex (TC) with eIF2-GTP, is stimulated by eukaryotic initiation factor 1 (eIF1), eIF1A, eIF3, and eIF5, and the resulting preinitiation complex (PIC) joins the 5' end of mRNA preactivated by eIF4F and poly(A)-binding protein. RNA helicases remove secondary structures that impede ribosome attachment and subsequent scanning. Hydrolysis of eIF2-bound GTP is stimulated by eIF5 in the scanning PIC, but completion of the reaction is impeded at non-AUG triplets. Although eIF1 and eIF1A promote scanning, eIF1 and possibly the C-terminal tail of eIF1A must be displaced from the P decoding site to permit base-pairing between Met-tRNAi and the AUG codon, as well as to allow subsequent phosphate release from eIF2-GDP. A second GTPase, eIF5B, catalyzes the joining of the 60S subunit to produce an 80S initiation complex that is competent for elongation.

  6. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  7. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  8. All Ribosomes Are Created Equal. Really?

    PubMed

    Preiss, Thomas

    2016-02-01

    Ribosomes are generally thought of as molecular machines with a constitutive rather than regulatory role during protein synthesis. A study by Slavov et al.[1] now shows that ribosomes of distinct composition and functionality exist within eukaryotic cells, giving credence to the concept of 'specialized' ribosomes.

  9. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  10. Coordinated movements of eukaryotic translation initiation factors eIF1, eIF1A, and eIF5 trigger phosphate release from eIF2 in response to start codon recognition by the ribosomal preinitiation complex.

    PubMed

    Nanda, Jagpreet S; Saini, Adesh K; Muñoz, Antonio M; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-22

    Accurate recognition of the start codon in an mRNA by the eukaryotic translation preinitiation complex (PIC) is essential for proper gene expression. The process is mediated by eukaryotic translation initiation factors (eIFs) in conjunction with the 40 S ribosomal subunit and (initiator) tRNA(i). Here, we provide evidence that the C-terminal tail (CTT) of eIF1A, which we previously implicated in start codon recognition, moves closer to the N-terminal domain of eIF5 when the PIC encounters an AUG codon. Importantly, this movement is coupled to dissociation of eIF1 from the PIC, a critical event in start codon recognition, and is dependent on the scanning enhancer elements in the eIF1A CTT. The data further indicate that eIF1 dissociation must be accompanied by the movement of the eIF1A CTT toward eIF5 in order to trigger release of phosphate from eIF2, which converts the latter to its GDP-bound state. Our results also suggest that release of eIF1 from the PIC and movement of the CTT of eIF1A are triggered by the same event, most likely accommodation of tRNA(i) in the P site of the 40 S subunit driven by base pairing between the start codon in the mRNA and the anticodon in tRNA(i). Finally, we show that the C-terminal domain of eIF5 is responsible for the factor's activity in antagonizing eIF1 binding to the PIC. Together, our data provide a more complete picture of the chain of molecular events that is triggered when the scanning PIC encounters an AUG start codon in the mRNA.

  11. Crystallization and preliminary X-ray structure analysis of human ribosomal protein L30e.

    PubMed

    Kawaguchi, Akiko; Ose, Toyoyuki; Yao, Min; Tanaka, Isao

    2011-12-01

    Many functions have been reported for the eukaryotic ribosomal protein L30e. L30e makes several inter-subunit and intra-subunit interactions with protein or RNA components of the 80S ribosome. Yeast L30e has been shown to bind to its own transcript to autoregulate expression at both the transcriptional and the translational levels. Furthermore, it has been reported that mammalian L30e is a component of the selenocysteine-incorporation machinery by binding to the selenocysteine-insertion sequence on mRNA. As high-resolution crystal structures of mammalian L30e are not available, the purification, crystallization and X-ray structure analysis of human L30e are presented here.

  12. Human eukaryotic initiation factor 4G (eIF4G) protein binds to eIF3c, -d, and -e to promote mRNA recruitment to the ribosome.

    PubMed

    Villa, Nancy; Do, Angelie; Hershey, John W B; Fraser, Christopher S

    2013-11-15

    Recruitment of mRNA to the 40S ribosomal subunit requires the coordinated interaction of a large number of translation initiation factors. In mammals, the direct interaction between eukaryotic initiation factor 4G (eIF4G) and eIF3 is thought to act as the molecular bridge between the mRNA cap-binding complex and the 40S subunit. A discrete ∼90 amino acid domain in eIF4G is responsible for binding to eIF3, but the identity of the eIF3 subunit(s) involved is less clear. The eIF3e subunit has been shown to directly bind eIF4G, but the potential role of other eIF3 subunits in stabilizing this interaction has not been investigated. It is also not clear if the eIF4A helicase plays a role in stabilizing the interaction between eIF4G and eIF3. Here, we have used a fluorescence anisotropy assay to demonstrate that eIF4G binds to eIF3 independently of eIF4A binding to the middle region of eIF4G. By using a site-specific cross-linking approach, we unexpectedly show that the eIF4G-binding surface in eIF3 is comprised of the -c, -d and -e subunits. Screening multiple cross-linker positions reveals that eIF4G contains two distinct eIF3-binding subdomains within the previously identified eIF3-binding domain. Finally, by employing an eIF4G-dependent translation assay, we establish that both of these subdomains are required for efficient mRNA recruitment to the ribosome and stimulate translation. Our study reveals unexpected complexity to the eIF3-eIF4G interaction that provides new insight into the regulation of mRNA recruitment to the human ribosome.

  13. Molecular phylogeny of eukaryotes.

    PubMed

    Schlegel, M

    1994-09-01

    Comparisons of ribosomal RNAs and various protein coding genes have contributed to a new view of eukaryote phylogeny. Analyses of paralogous protein coding genes suggest that archaebacteria and eukaryotes are sistergroups. Sequence diversity of small subunit rRNAs in protists by far exceeds that of any multicellular or prokaryote taxon. Remarkably, a group of taxa that lack mitochondria first branches off in the small subunit rRNA tree. The later radiations are formed by a series of clades that were once thought to be more ancestral. Furthermore, tracing of the evolutionary origin of secondary endobiontic events is now possible with sequence comparisons.

  14. Mammalian translation elongation factor eEF1A2: X-ray structure and new features of GDP/GTP exchange mechanism in higher eukaryotes.

    PubMed

    Crepin, Thibaut; Shalak, Vyacheslav F; Yaremchuk, Anna D; Vlasenko, Dmytro O; McCarthy, Andrew; Negrutskii, Boris S; Tukalo, Michail A; El'skaya, Anna V

    2014-11-10

    Eukaryotic elongation factor eEF1A transits between the GTP- and GDP-bound conformations during the ribosomal polypeptide chain elongation. eEF1A*GTP establishes a complex with the aminoacyl-tRNA in the A site of the 80S ribosome. Correct codon-anticodon recognition triggers GTP hydrolysis, with subsequent dissociation of eEF1A*GDP from the ribosome. The structures of both the 'GTP'- and 'GDP'-bound conformations of eEF1A are unknown. Thus, the eEF1A-related ribosomal mechanisms were anticipated only by analogy with the bacterial homolog EF-Tu. Here, we report the first crystal structure of the mammalian eEF1A2*GDP complex which indicates major differences in the organization of the nucleotide-binding domain and intramolecular movements of eEF1A compared to EF-Tu. Our results explain the nucleotide exchange mechanism in the mammalian eEF1A and suggest that the first step of eEF1A*GDP dissociation from the 80S ribosome is the rotation of the nucleotide-binding domain observed after GTP hydrolysis.

  15. Ribosomal Initiation Complex Assembly within the Wild-Strain of Coxsackievirus B3 and Live-Attenuated Sabin3-like IRESes during the Initiation of Translation

    PubMed Central

    Souii, Amira; M’hadheb-Gharbi, Manel Ben; Sargueil, Bruno; Brossard, Audrey; Chamond, Nathalie; Aouni, Mahjoub; Gharbi, Jawhar

    2013-01-01

    Coxsackievirus B3 (CVB3) is an enterovirus of the family of Picornaviridae. The Group B coxsackieviruses include six serotypes (B1 to B6) that cause a variety of human diseases, including myocarditis, meningitis, and diabetes. Among the group B, the B3 strain is mostly studied for its cardiovirulence and its ability to cause acute and persistent infections. Translation initiation of CVB3 RNA has been shown to be mediated by a highly ordered structure of the 5′-untranslated region (5′UTR), which harbors an internal ribosome entry site (IRES). Translation initiation is a complex process in which initiator tRNA, 40S and 60S ribosomal subunits are assembled by eukaryotic initiation factors (eIFs) into an 80S ribosome at the initiation codon of the mRNA. We have previously addressed the question of whether the attenuating mutations of domain V of the poliovirus IRES were specific for a given genomic context or whether they could be transposed and extrapolated to a genomic related virus, i.e., CVB3 wild-type strain. In this context, we have described that Sabin3-like mutation (U473→C) introduced in CVB3 genome led to a defective mutant with a serious reduction in translation efficiency. In this study, we analyzed the efficiency of formation of ribosomal initiation complexes 48S and 80S through 10%–30% and 10%–50% sucrose gradients using rabbit reticulocyte lysates (RRLs) and stage-specific translation inhibitors: 5′-Guanylyl-imidodiphosphate (GMP-PNP) and Cycloheximide (CHX), respectively. We demonstrated that the interaction of 48S and 80S ribosomal complexes within the mutant CVB3 RNA was abolished compared with the wild-type RNA by ribosome assembly analysis. Taken together, it is possible that the mutant RNA was unable to interact with some trans-acting factors critical for enhanced IRES function. PMID:23439549

  16. Ribosome-associated protein quality control

    PubMed Central

    Brandman, Onn; Hegde, Ramanujan S

    2016-01-01

    Protein synthesis by the ribosome can fail for numerous reasons including faulty mRNA, insufficient availability of charged tRNAs and genetic errors. All organisms have evolved mechanisms to recognize stalled ribosomes and initiate pathways for recycling, quality control and stress signaling. Here we review the discovery and molecular dissection of the eukaryotic ribosome-associated quality-control pathway for degradation of nascent polypeptides arising from interrupted translation. PMID:26733220

  17. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  18. Operons in eukaryotes.

    PubMed

    Blumenthal, Thomas

    2004-11-01

    It was thought that polycistronic transcription is a characteristic of bacteria and archaea, where many of the genes are clustered in operons composed of two to more than ten genes. By contrast, the genes of eukaryotes are generally considered to be monocistronic, each with its own promoter at the 5' end and a transcription terminator at the 3' end; however, it has recently become clear that not all eukaryotic genes are transcribed monocistronically. Numerous instances of polycistronic transcription in eukaryotes, from protists to chordates, have been reported. These can be divided into two broad types. Dicistronic transcription units specify a messenger RNA (mRNA) encoding two separate genes that is transported to the cytoplasm and translated in that form. Presumably, internal ribosome entry sites (IRES), or some form of translational re-initiation following the stop codon, are responsible for allowing translation of the downstream gene. In the other type, the initial transcript is processed by 3' end cleavage and trans-splicing to create monocistronic mRNAs that are transported to the cytoplasm and translated. Like bacterial operons, eukaryotic operons often result in co-expression of functionally related proteins.

  19. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  20. The Arabidopsis Cytosolic Ribosomal Proteome: From form to Function

    PubMed Central

    Carroll, Adam J.

    2013-01-01

    The cytosolic ribosomal proteome of Arabidopsis thaliana has been studied intensively by a range of proteomics approaches and is now one of the most well characterized eukaryotic ribosomal proteomes. Plant cytosolic ribosomes are distinguished from other eukaryotic ribosomes by unique proteins, unique post-translational modifications and an abundance of ribosomal proteins for which multiple divergent paralogs are expressed and incorporated. Study of the A. thaliana ribosome has now progressed well beyond a simple cataloging of protein parts and is focused strongly on elucidating the functions of specific ribosomal proteins, their paralogous isoforms and covalent modifications. This review summarises current knowledge concerning the Arabidopsis cytosolic ribosomal proteome and highlights potentially fruitful areas of future research in this fast moving and important area. PMID:23459595

  1. A unique phosphorylation-dependent eIF4E assembly on 40S ribosomes co-ordinated by hepatitis C virus protein NS5A that activates internal ribosome entry site translation.

    PubMed

    Panda, Swarupa; Vedagiri, Dhiviya; Viveka, Thangaraj Soundara; Harshan, Krishnan Harinivas

    2014-09-01

    We previously reported that the HCV (hepatitis C virus) protein NS5A up-regulated mRNA cap binding eIF4F (eukaryotic initiation factor 4F) complex assembly through mTOR (mechanistic target of rapamycin)-4EBP1 (eIF4E-binding protein 1) pathway and that NS5A (non-structural protein 5A) physically interacted with translation apparatus. In the present study, we demonstrate that NS5A co-ordinates a unique assembly of the cap binding protein eIF4E and 40S ribosome to form a complex that we call ENR (eIF4E-NS5A-ribosome). Recruitment of NS5A and eIF4E to 40S ribosome was confirmed by polysome fractionation, subcellular fractionation and high-salt-wash immunoprecipitation. These observations were also confirmed in HCV-infected cells, validating its biological significance. eIF4E phosphorylation was critical for ENR assembly. 80S ribosome dissociation and RNase integrity assays revealed that, once associated, the ENR complex is stable and RNA interaction is dispensable. Both the N- and C-terminal regions of NS5A domain 1 were indispensable for this assembly and for the NS5A-induced HCV IRES (internal ribosome entry site) activation. The present study demonstrates that NS5A initially associates with phosphorylated eIF4E of eIF4F complex and subsequently recruits it to 40S ribosomes. This is the first time the interaction of viral protein with both eIF4E and ribosomes has been reported. We propose that this assembly would determine the outcome of HCV infection and pathogenesis through regulation of viral and host translation.

  2. Energy in the '80s: a call for leadership

    SciTech Connect

    Not Available

    1981-07-01

    The theme of this conference - Energy in the '80s: A Call for Leadership - was selected to focus attention on what was believed to be what America needs now - to get on with the tasks at hand. This proceedings of the Public Awareness Symposium, held on February 19, featured six speakers; the address of Senator Jackson at the banquet on February 20, which concluded the conference is also included; a separate abstract was prepared for each of these seven presentations. Also, the society-sponsored technical session papers are listed in Appendix A, and the Engineering/Communication scholarships are noted in Appendix B.

  3. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    NASA Astrophysics Data System (ADS)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  4. Structural characterization of ribosome recruitment and translocation by type IV IRES

    PubMed Central

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts the otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451

  5. Rli1/ABCE1 Recycles Terminating Ribosomes and Controls Translation Reinitiation in 3'UTRs In Vivo.

    PubMed

    Young, David J; Guydosh, Nicholas R; Zhang, Fan; Hinnebusch, Alan G; Green, Rachel

    2015-08-13

    To study the function of Rli1/ABCE1 in vivo, we used ribosome profiling and biochemistry to characterize its contribution to ribosome recycling. When Rli1 levels were diminished, 80S ribosomes accumulated both at stop codons and in the adjoining 3'UTRs of most mRNAs. Frequently, these ribosomes reinitiated translation without the need for a canonical start codon, as small peptide products predicted by 3'UTR ribosome occupancy in all three reading frames were confirmed by western analysis and mass spectrometry. Eliminating the ribosome-rescue factor Dom34 dramatically increased 3'UTR ribosome occupancy in Rli1 depleted cells, indicating that Dom34 clears the bulk of unrecycled ribosomes. Thus, Rli1 is crucial for ribosome recycling in vivo and controls ribosome homeostasis. 3'UTR translation occurs in wild-type cells as well, and observations of elevated 3'UTR ribosomes during stress suggest that modulating recycling and reinitiation is involved in responding to environmental changes.

  6. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  7. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation.

  8. Eukaryotic origins.

    PubMed

    Lake, James A

    2015-09-26

    The origin of the eukaryotes is a fundamental scientific question that for over 30 years has generated a spirited debate between the competing Archaea (or three domains) tree and the eocyte tree. As eukaryotes ourselves, humans have a personal interest in our origins. Eukaryotes contain their defining organelle, the nucleus, after which they are named. They have a complex evolutionary history, over time acquiring multiple organelles, including mitochondria, chloroplasts, smooth and rough endoplasmic reticula, and other organelles all of which may hint at their origins. It is the evolutionary history of the nucleus and their other organelles that have intrigued molecular evolutionists, myself included, for the past 30 years and which continues to hold our interest as increasingly compelling evidence favours the eocyte tree. As with any orthodoxy, it takes time to embrace new concepts and techniques.

  9. Eukaryotic origins

    PubMed Central

    Lake, James A.

    2015-01-01

    The origin of the eukaryotes is a fundamental scientific question that for over 30 years has generated a spirited debate between the competing Archaea (or three domains) tree and the eocyte tree. As eukaryotes ourselves, humans have a personal interest in our origins. Eukaryotes contain their defining organelle, the nucleus, after which they are named. They have a complex evolutionary history, over time acquiring multiple organelles, including mitochondria, chloroplasts, smooth and rough endoplasmic reticula, and other organelles all of which may hint at their origins. It is the evolutionary history of the nucleus and their other organelles that have intrigued molecular evolutionists, myself included, for the past 30 years and which continues to hold our interest as increasingly compelling evidence favours the eocyte tree. As with any orthodoxy, it takes time to embrace new concepts and techniques. PMID:26323753

  10. Evolution of prokaryote and eukaryote lines inferred from sequence evidence

    NASA Technical Reports Server (NTRS)

    Hunt, L. T.; George, D. G.; Yeh, L.-S.; Dayhoff, M. O.

    1984-01-01

    This paper describes the evolution of prokaryotes and early eukaryotes, including their symbiotic relationships, as inferred from phylogenetic trees of bacterial ferredoxin, 5S ribosomal RNA, ribulose-1,5-biphosphate carboxylase large chain, and mitochondrial cytochrome oxidase polypeptide II.

  11. Ribosomal RNA pseudouridines and pseudouridine synthases.

    PubMed

    Ofengand, James

    2002-03-01

    Pseudouridines are found in virtually all ribosomal RNAs but their function is unknown. There are four to eight times more pseudouridines in eukaryotes than in eubacteria. Mapping 19 Haloarcula marismortui pseudouridines on the three-dimensional 50S subunit does not show clustering. In bacteria, specific enzymes choose the site of pseudouridine formation. In eukaryotes, and probably also in archaea, selection and modification is done by a guide RNA-protein complex. No unique specific role for ribosomal pseudouridines has been identified. We propose that pseudouridine's function is as a molecular glue to stabilize required RNA conformations that would otherwise be too flexible.

  12. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  13. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  14. Interrelationships between Yeast Ribosomal Protein Assembly Events and Transient Ribosome Biogenesis Factors Interactions in Early Pre-Ribosomes

    PubMed Central

    Jakob, Steffen; Ohmayer, Uli; Neueder, Andreas; Hierlmeier, Thomas; Perez-Fernandez, Jorge; Hochmuth, Eduard; Deutzmann, Rainer; Griesenbeck, Joachim; Tschochner, Herbert; Milkereit, Philipp

    2012-01-01

    Early steps of eukaryotic ribosome biogenesis require a large set of ribosome biogenesis factors which transiently interact with nascent rRNA precursors (pre-rRNA). Most likely, concomitant with that initial contacts between ribosomal proteins (r-proteins) and ribosome precursors (pre-ribosomes) are established which are converted into robust interactions between pre-rRNA and r-proteins during the course of ribosome maturation. Here we analysed the interrelationship between r-protein assembly events and the transient interactions of ribosome biogenesis factors with early pre-ribosomal intermediates termed 90S pre-ribosomes or small ribosomal subunit (SSU) processome in yeast cells. We observed that components of the SSU processome UTP-A and UTP-B sub-modules were recruited to early pre-ribosomes independently of all tested r-proteins. On the other hand, groups of SSU processome components were identified whose association with early pre-ribosomes was affected by specific r-protein assembly events in the head-platform interface of the SSU. One of these components, Noc4p, appeared to be itself required for robust incorporation of r-proteins into the SSU head domain. Altogether, the data reveal an emerging network of specific interrelationships between local r-protein assembly events and the functional interactions of SSU processome components with early pre-ribosomes. They point towards some of these components being transient primary pre-rRNA in vivo binders and towards a role for others in coordinating the assembly of major SSU domains. PMID:22431976

  15. [Analysis of ribosomes by polyacrylamide gel electrophoresis (author's transl)].

    PubMed

    Ledoigt, G; Curgy, J J; Stevens, B J; André, J

    1975-10-01

    Ribosomal polymers, monomers and subunits from several eukaryotes and prokaryotes were isolated and analyzed by polyacrylamide gel electrophoresis. Extraction of RNA from ribosomal particles after their migration in a polyacrylamide gel, analyses by sedimentation in sucrose gradients and observations in the electron microscope were carried out in parallel. Attention was directed to the reproducibility, the precision and the limitations of the electrophoresis technique.

  16. Ribosome regulation by the nascent peptide.

    PubMed Central

    Lovett, P S; Rogers, E J

    1996-01-01

    Studies of bacterial and eukaryotic systems have identified two-gene operons in which the translation product of the upstream gene influences translation of the downstream gene. The upstream gene, referred to as a leader (gene) in bacterial systems or an upstream open reading frame (uORF) in eukaryotes, encodes a peptide that interferes with a function(s) of its translating ribosome. The peptides are therefore cis-acting negative regulators of translation. The inhibitory peptides typically consist of fewer than 25 residues and function prior to emergence from the ribosome. A biological role for this class of translation inhibitor is demonstrated in translation attenuation, a form or regulation that controls the inducible translation of the chloramphenicol resistance genes cat and cmlA in bacteria. Induction of cat or cmlA requires ribosome stalling at a particular codon in the leader region of the mRNA. Stalling destabilizes an adjacent, downstream mRNA secondary structure that normally sequesters the ribosome-binding site for the cat or cmlA coding regions. Genetic studies indicate that the nascent, leader-encoded peptide is the selector of the site of ribosome stalling in leader mRNA by cis interference with translation. Synthetic leader peptides inhibit ribosomal peptidyltransferase in vitro, leading to the prediction that this activity is the basis for stall site selection. Recent studies have shown that the leader peptides are rRNA-binding peptides with targets at the peptidyl transferase center of 23S rRNA. uORFs associated with several eukaryotic genes inhibit downstream translation. When inhibition depends on the specific codon sequence of the uORF, it has been proposed that the uORF-encoded nascent peptide prevents ribosome release from the mRNA at the uORF stop codon. This sets up a blockade to ribosome scanning which minimizes downstream translation. Segments within large proteins also appear to regulate ribosome activity in cis, although in most of the

  17. Voices of Chinese Post-­80s Students in English Academic Writing

    ERIC Educational Resources Information Center

    Que, Hua; Li, Xuemei

    2015-01-01

    This study looks into the changing voice of Chinese Post-80s' students in English academic writing. Data were collected qualitatively through interviews with four Chinese Post-80s overseas graduate students and through an examination of their English essays with a focus on discursive features. Findings indicate that Chinese Post-80s' voice is…

  18. The new phylogeny of eukaryotes.

    PubMed

    Philippe, H; Germot, A; Moreira, D

    2000-12-01

    Molecular phylogeny has been regarded as the ultimate tool for the reconstruction of relationships among eukaryotes-especially the different protist groups-given the difficulty in interpreting morphological data from an evolutionary point of view. In fact, the use of ribosomal RNA as a marker has provided the first well resolved eukaryotic phylogenies, leading to several important evolutionary hypotheses. The most significant is that several early-emerging, amitochondriate lineages, are living relics from the early times of eukaryotic evolution. The use of alternative protein markers and the recognition of several molecular phylogeny reconstruction artefacts, however, have strongly challenged these ideas. The putative early emerging lineages have been demonstrated as late-emerging ones, artefactually misplaced to the base of the tree. The present state of eukaryotic evolution is best described by a multifurcation, in agreement with the 'big bang' hypothesis that assumes a rapid diversification of the major eukaryotic phyla. For further resolution, the analysis of genomic data through improved phylogenetic methods will be required.

  19. Ancestral relationships of the major eukaryotic lineages.

    PubMed

    Sogin, M L; Morrison, H G; Hinkle, G; Silberman, J D

    1996-03-01

    Molecular systematics has revolutionized our understanding of microbial evolution. Phylogenetic frameworks relating all organisms in this biosphere can be inferred from comparisons of slowly evolving molecules such as the small and large subunit ribosomal RNAs. Unlike today's text book standard, the "Five Kingdoms" (plants, animals, fungi, protists and bacteria), molecular studies define three primary lines of descent (Eukaryotes, Eubacteria, and Archaebacteria). Within the Eukaryotes, the "higher" kingdoms (Fungi, Plantae, and Animalia) are joined by at least two novel complex evolutionary assemblages, the "Alveolates" (ciliates, dinoflagellates and apicomplexans) and the "Stramenopiles" (diatoms, oomycetes, labyrinthulids, brown algae and chrysophytes). The separation of these eukaryotic groups (described as the eukaryotic "crown") occurred approximately 10(9) years ago and was preceded by a succession of earlier diverging protist lineages, some as ancient as the separation of the prokaryotic domains. The molecular phylogenies suggest that multiple endosymbiotic events introduced plastids into discrete eukaryotic lineages.

  20. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    PubMed Central

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-01-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5′-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome–HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs. PMID:26155016

  1. Isolation and mapping of the human eukaryotic translation initiation factor 5 to chromosome 14

    SciTech Connect

    Romano, D.M.; Wasco, W.; Murell, J.

    1994-09-01

    Eukaryotic translation initiation factor 5 (eIF-5) is essential for the initiation of protein synthesis. eIF-5 catalyzes the hydrolysis of GTP on the 40S ribosomal initiation complex. Subsequent to GTP hydrolysis and the release of eIF-2-GDP, the 60S ribosomal subunit is joined to the 40S subunit to form an 80S initiation complex which can engage in peptide transfer. In an effort to isolate the major early-onset familial Alzheimer`s disease (FAD) gene on chromosome 14, we have isolated expressed sequences from this autosome in the form of exons `trapped` from chromosome 14-specific cosmids (library provided by L. Deaven, Los Alamos, NM). One cosmid yielded multiple exons displaying strong DNA and amino acid homology (>90%) with the rat eIF-5 gene. These exons were used to isolate full-length cDNAs from a human brain library. The eIF-5 message is approximately 3.6 kB in size and is ubiquitously expressed. The predicted amino acid sequence reveals multiple phosphorylation sites which may be involved in regulation of activity of eIF-5 and regions with homology to the GTPase superfamily, consistent with eIF-5`s role in GTP hydrolysis. Further studies are underway to determine whether the eIF-5 gene resides within the FAD minimal candidate region on chromosome 14q24.3.

  2. Dynamics of ribosome scanning and recycling revealed by translation complex profiling.

    PubMed

    Archer, Stuart K; Shirokikh, Nikolay E; Beilharz, Traude H; Preiss, Thomas

    2016-07-28

    Regulation of messenger RNA translation is central to eukaryotic gene expression control. Regulatory inputs are specified by them RNA untranslated regions (UTRs) and often target translation initiation. Initiation involves binding of the 40S ribosomal small subunit (SSU) and associated eukaryotic initiation factors (eIFs)near the mRNA 5′ cap; the SSU then scans in the 3′ direction until it detects the start codon and is joined by the 60S ribosomal large subunit (LSU) to form the 80S ribosome. Scanning and other dynamic aspects of the initiation model have remained as conjectures because methods to trap early intermediates were lacking. Here we uncover the dynamics of the complete translation cycle in live yeast cells using translation complex profile sequencing (TCP-seq), a method developed from the ribosome profiling approach. We document scanning by observing SSU footprints along 5′ UTRs. Scanning SSU have 5′-extended footprints (up to~75 nucleotides), indicative of additional interactions with mRNA emerging from the exit channel, promoting forward movement. We visualized changes in initiation complex conformation as SSU footprints coalesced into three major sizes at start codons (19, 29 and 37 nucleotides). These share the same 5′ start site but differ at the 3′ end, reflecting successive changes at the entry channel from an open to a closed state following start codon recognition. We also observe SSU 'lingering' at stop codons after LSU departure. Our results underpin mechanistic models of translation initiation and termination, built on decades of biochemical and structural investigation, with direct genome-wide in vivo evidence. Our approach captures ribosomal complexes at all phases of translation and will aid in studying translation dynamics in diverse cellular contexts. Dysregulation of translation is common in disease and, for example, SSU scanning is a target of anti-cancer drug development. TCP-seq will prove useful in discerning differences

  3. Role of DNA damage and repair in the function of eukaryotic genes: radiation-induced single-strand breaks and their rejoining in chromosomal and extrachromosomal ribosomal DNA of Tetrahymena

    SciTech Connect

    Chiu, S.M.; Oleinick, N.L.

    1980-04-01

    The production and rejoining of single-strand breaks (SSB) in chromosomal DNA and extrachromosomal ribosomal DNA (rDNA) were investigated after sublethal doses of ..gamma.. radiation to exponentially growing Tetrahymena. Hydrogen-3-labeled total nuclear DNA isolated from either control or irradiated cells was heat denatured and electrophoresed in agarose gels containing formaldehyde. Ribosomal DNA was identified by hybridization to (/sup 32/P)rRNA after transferring the DNA from the gels to nitrocellulose strips. It was found that (a) approximately 0.68 SSB is produced in each strand of rDNA exposed to 40 krad; (b) greater than 80% of SSB were rejoined within the first 20 min after irradiation in both chromosomal and rDNA; and (c) the rejoining process in both chromosomal and rDNA proceeded in the presence of inhibitors of protein synthesis, RNA synthesis, or oxidative metabolism. While the majority of SSB induced by 40 krad is rejoined within 20 min after irradiation, the resumption of rRNA synthesis does not occur until 30 min thereafter; it is concluded that the restoration of the normal size of the rDNA template is probably necessary but not sufficient for the resumption of rRNA synthesis.

  4. Comparative analysis of the ribosomal components of the hydrogenosome-containing protist, Trichomonas vaginalis.

    PubMed

    Arisue, Nobuko; Maki, Yasushi; Yoshida, Hideji; Wada, Akira; Sánchez, Lidya B; Müller, Miklós; Hashimoto, Tetsuo

    2004-07-01

    The ribosomes of the amitochondriate but hydrogenosome-containing protist lineage, the trichomonads, have previously been reported to be prokaryotic or primitive eukaryotic, based on evidence that they have a 70S sedimentation coefficient and a small number of proteins, similar to prokaryotic ribosomes. In order to determine whether the components of the trichomonad ribosome indeed differ from those of typical eukaryotic ribosomes, the ribosome of a representative trichomonad, Trichomonas vaginalis, was characterized. The sedimentation coefficient of the T. vaginalis ribosome was smaller than that of Saccharomyces cerevisiae and larger than that of Escherichia coli. Based on two-dimensional PAGE analysis, the number of different ribosomal proteins was estimated to be approximately 80. This number is the same as those obtained for typical eukaryotes (approximately 80) but larger than that of E. coli (approximately 55). N-Terminal amino acid sequencing of 18 protein spots and the complete sequences of 4 ribosomal proteins as deduced from their genes revealed these sequences to display typical eukaryotic features. Phylogenetic analyses of the five ribosomal proteins currently available also clearly confirmed that the T. vaginalis sequences are positioned within a eukaryotic clade. Comparison of deduced secondary structure models of the small and large subunit rRNAs of T. vaginalis with those of other eukaryotes revealed that all helices commonly found in typical eukaryotes are present and conserved in T. vaginalis, while variable regions are shortened or lost. These lines of evidence demonstrate that the T. vaginalis ribosome has no prokaryotic or primitive eukaryotic features but is clearly a typical eukaryotic type. PMID:15383908

  5. Interaction between 25S rRNA A loop and eukaryotic translation initiation factor 5B promotes subunit joining and ensures stringent AUG selection.

    PubMed

    Hiraishi, Hiroyuki; Shin, Byung-Sik; Udagawa, Tsuyoshi; Nemoto, Naoki; Chowdhury, Wasimul; Graham, Jymie; Cox, Christian; Reid, Megan; Brown, Susan J; Asano, Katsura

    2013-09-01

    In yeast, 25S rRNA makes up the major mass and shape of the 60S ribosomal subunit. During the last step of translation initiation, eukaryotic initiation factor 5B (eIF5B) promotes the 60S subunit joining with the 40S initiation complex (IC). Malfunctional 60S subunits produced by misfolding or mutation may disrupt the 40S IC stalling on the start codon, thereby altering the stringency of initiation. Using several point mutations isolated by random mutagenesis, here we studied the role of 25S rRNA in start codon selection. Three mutations changing bases near the ribosome surface had strong effects, allowing the initiating ribosomes to skip both AUG and non-AUG codons: C2879U and U2408C, altering the A loop and P loop, respectively, of the peptidyl transferase center, and G1735A, mapping near a Eukarya-specific bridge to the 40S subunit. Overexpression of eIF5B specifically suppressed the phenotype caused by C2879U, suggesting functional interaction between eIF5B and the A loop. In vitro reconstitution assays showed that C2879U decreased eIF5B-catalyzed 60S subunit joining with a 40S IC. Thus, eIF5B interaction with the peptidyl transferase center A loop increases the accuracy of initiation by stabilizing the overall conformation of the 80S initiation complex. This study provides an insight into the effect of ribosomal mutations on translation profiles in eukaryotes.

  6. Role of Pre-rRNA Base Pairing and 80S Complex Formation in Subnucleolar Localization of the U3 snoRNP

    PubMed Central

    Granneman, Sander; Vogelzangs, Judith; Lührmann, Reinhard; van Venrooij, Walther J.; Pruijn, Ger J. M.; Watkins, Nicholas J.

    2004-01-01

    In the nucleolus the U3 snoRNA is recruited to the 80S pre-rRNA processing complex in the dense fibrillar component (DFC). The U3 snoRNA is found throughout the nucleolus and has been proposed to move with the preribosomes to the granular component (GC). In contrast, the localization of other RNAs, such as the U8 snoRNA, is restricted to the DFC. Here we show that the incorporation of the U3 snoRNA into the 80S processing complex is not dependent on pre-rRNA base pairing sequences but requires the B/C motif, a U3-specific protein-binding element. We also show that the binding of Mpp10 to the 80S U3 complex is dependent on sequences within the U3 snoRNA that base pair with the pre-rRNA adjacent to the initial cleavage site. Furthermore, mutations that inhibit 80S complex formation and/or the association of Mpp10 result in retention of the U3 snoRNA in the DFC. From this we propose that the GC localization of the U3 snoRNA is a direct result of its active involvement in the initial steps of ribosome biogenesis. PMID:15367679

  7. The sequential addition of ribosomal proteins during the formation of the small ribosomal subunit in Friend erythroleukemia cells.

    PubMed

    Todorov, I T; Noll, F; Hadjiolov, A A

    1983-03-15

    Nucleolar '80-S' and '40-S' preribosomes (containing 45-S and 21-S pre-rRNA, respectively), as well as cytoplasmic ribosomes, were isolated from Friend erythroleukemia cells. The presence of structural ribosomal proteins in the isolated particles was studied by using antisera against individual rat liver small ribosomal subunit proteins. The analysis is based on the established crossreactivity between rat and mouse ribosomes [F. Noll and H. Bielka (1970) Mol. Gen. Genet. 106, 106-113]. The identification of the proteins was achieved by two independent immunological techniques: the passive haemagglutination test and the enzyme immunoassay of electrophoretically fractionated proteins, blotted on nitrocellulose. All 17 proteins tested are present in cytoplasmic ribosomes. A large number of proteins (S3a, S6, S7, S8, S11, S14, S18, S20, S23/24 and S25) are present in the '80-S' preribosome. Only two proteins (S3 and S21) are added during the formation of the '40-S' preribosome in the nucleolus. Four proteins (S2, S19, S26 and S29) are added at later, possibly extranucleolar, stages of ribosome formation. The results obtained provide evidence for the sequential addition of proteins during the formation of the small ribosomal subunit in Friend erythroleukemia cells.

  8. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  9. Reconstructing Early Events in Eukaryotic Evolution.

    PubMed

    Roger

    1999-10-01

    Resolving the order of events that occurred during the transition from prokaryotic to eukaryotic cells remains one of the greatest problems in cell evolution. One view, the Archezoa hypothesis, proposes that the endosymbiotic origin of mitochondria occurred relatively late in eukaryotic evolution and that several mitochondrion-lacking protist groups diverged before the establishment of the organelle. Phylogenies based on small subunit ribosomal RNA and several protein-coding genes supported this proposal, placing amitochondriate protists such as diplomonads, parabasalids, and Microsporidia as the earliest diverging eukaryotic lineages. However, trees of other molecules, such as tubulins, heat shock protein 70, TATA box-binding protein, and the largest subunit of RNA polymerase II, indicate that Microsporidia are not deeply branching eukaryotes but instead are close relatives of the Fungi. Furthermore, recent discoveries of mitochondrion-derived genes in the nuclear genomes of entamoebae, Microsporidia, parabasalids, and diplomonads suggest that these organisms likely descend from mitochondrion-bearing ancestors. Although several protist lineages formally remain as candidates for Archezoa, most evidence suggests that the mitochondrial endosymbiosis took place prior to the divergence of all extant eukaryotes. In addition, discoveries of proteobacterial-like nuclear genes coding for cytoplasmic proteins indicate that the mitochondrial symbiont may have contributed more to the eukaryotic lineage than previously thought. As genome sequence data from parabasalids and diplomonads accumulate, it is becoming clear that the last common ancestor of these protist taxa and other extant eukaryotic groups already possessed many of the complex features found in most eukaryotes but lacking in prokaryotes. However, our confidence in the deeply branching position of diplomonads and parabasalids among eukaryotes is weakened by conflicting phylogenies and potential sources of artifact

  10. Eukaryotic initiation factor 5B: a new player for the anti-hepatitis C virus effect of ribavirin?

    PubMed

    Galmozzi, E; Aghemo, A; Colombo, M

    2012-10-01

    The addition of the broad-spectrum antiviral agent ribavirin (RBV), a synthetic guanosine analog, to interferon-alpha (IFNα) monotherapy has been a major breakthrough in the treatment of patients with hepatitis C virus (HCV), as it greatly improved treatment response rates. Although several mechanisms of action have been proposed for RBV's antiviral activity, each with some experimental evidence, the precise mechanism by which it acts synergistically with IFNα has remained elusive. A cornerstone of the antiviral IFNα response is phosphorylation of the α subunit of eukaryotic initiation factor (eIF)2. This limits the availability of eIF2⋅GTP⋅Met-tRNA(i)(Met) ternary complexes, reduces formation of the 43S preinitiation complexes, ultimately blocking viral (and most cellular) mRNA translation. However recent studies indicated that translation driven by the HCV internal ribosome entry site (IRES) is insensitive to eIF2α phosphorylation. Particularly, in addition to the general eIF2-dependent pathway of translation, the HCV IRES makes use of a bacterial-like, eIF2-independent pathway requiring as initiation factors only eIF5B (an analog of bacterial IF2) and eIF3. Together, these observations support a model in which cellular stresses that induce eIF2α phosphorylation (e.g. treatment with IFNα) cause HCV IRES-directed translation to switch from an eIF2-dependent mode to an eIF5B-dependent mode, defining a tactic used by HCV to evade the INFα response. Eukaryotic eIF5B is a ribosome-dependent GTPase that is responsible for 80S complex formation in translation initiation but shows much lower affinities for GTP than to other GTPases, thus suggesting that it may mis-incorporate the RBV triphosphate (RTP) in place of GTP even at the RBV concentrations achieved in clinical use. Consequently, we theorize that RTP bound to eIF5B lowering its affinity for ribosome, blocks the 80S complex formation on HCV IRES inhibiting the eIF5B-dependent translation used by HCV to

  11. The role of the ribosome in the regulation of longevity and lifespan extension.

    PubMed

    MacInnes, Alyson W

    2016-01-01

    The most energy-consuming process that a cell must undertake to stay viable is the continuous biogenesis of ribosomes for the translation of RNA into protein. Given the inextricable links between energy consumption and cellular lifespan, it is not surprising that mutations and environmental cues that reduce ribosome biogenesis result in an extension of eukaryotic lifespan. This review goes into detail describing recent discoveries of different and often unexpected elements that play a role in the regulation of longevity by virtue of their ribosome biogenesis functions. These roles include controlling the transcription and processing of ribosomal RNA (rRNA), the translation of ribosomal protein (RP) genes, and the number of ribosomes overall. Together these findings suggest that a fundamental mechanism across eukaryotic species for extending lifespan is to slow down or halt the expenditure of cellular energy that is normally absorbed by the manufacturing and assembly of new ribosomes. PMID:26732699

  12. Phylogenomics of Prokaryotic Ribosomal Proteins

    PubMed Central

    Yutin, Natalya; Puigbò, Pere; Koonin, Eugene V.; Wolf, Yuri I.

    2012-01-01

    Archaeal and bacterial ribosomes contain more than 50 proteins, including 34 that are universally conserved in the three domains of cellular life (bacteria, archaea, and eukaryotes). Despite the high sequence conservation, annotation of ribosomal (r-) protein genes is often difficult because of their short lengths and biased sequence composition. We developed an automated computational pipeline for identification of r-protein genes and applied it to 995 completely sequenced bacterial and 87 archaeal genomes available in the RefSeq database. The pipeline employs curated seed alignments of r-proteins to run position-specific scoring matrix (PSSM)-based BLAST searches against six-frame genome translations, mitigating possible gene annotation errors. As a result of this analysis, we performed a census of prokaryotic r-protein complements, enumerated missing and paralogous r-proteins, and analyzed the distributions of ribosomal protein genes among chromosomal partitions. Phyletic patterns of bacterial and archaeal r-protein genes were mapped to phylogenetic trees reconstructed from concatenated alignments of r-proteins to reveal the history of likely multiple independent gains and losses. These alignments, available for download, can be used as search profiles to improve genome annotation of r-proteins and for further comparative genomics studies. PMID:22615861

  13. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  14. Isolation of eukaryotic ribosomal proteins. Purification and characterization of the 40 S ribosomal subunit proteins Sa, Sc, S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18, S19, S20, S21, S26, S27', and S29.

    PubMed

    Collatz, E; Ulbrich, N; Tsurugi, K; Lightfoot, H N; MacKinlay, W; Lin, A; Wool, I G

    1977-12-25

    The proteins of the small subunit of rat liver ribosomes were separated into five main groups by stepwise elution from carboxymethylcellulose with LiCl at pH 6.5. Twenty-one proteins (Sa, Sc, S3a, S3b, S5', S9, S10, S11, S12, S14, S15, S15', S16, S17, S18, S19, S20, S21, S26, S27', and S29) were isolated from three groups (A40, C40, and D40) by ion exchange chromatography on DEAE-cellulose, carboxymethylcellulose, and phosphocellulose and by filtration through Sephadex. The amount of protein obtained varied from 0.1 to 11 mg. Six of the proteins (S5', S10, S11, S18, S19, and S27') had no detectable contamination; the impurities in the others were no greater than 9%. The molecular weight of the proteins was estimated by polyacrylamide gel electrophoresis in sodium dodecyl sulfate; the amino acid composition was determined.

  15. Communities of microbial eukaryotes in the mammalian gut within the context of environmental eukaryotic diversity.

    PubMed

    Parfrey, Laura Wegener; Walters, William A; Lauber, Christian L; Clemente, Jose C; Berg-Lyons, Donna; Teiling, Clotilde; Kodira, Chinnappa; Mohiuddin, Mohammed; Brunelle, Julie; Driscoll, Mark; Fierer, Noah; Gilbert, Jack A; Knight, Rob

    2014-01-01

    Eukaryotic microbes (protists) residing in the vertebrate gut influence host health and disease, but their diversity and distribution in healthy hosts is poorly understood. Protists found in the gut are typically considered parasites, but many are commensal and some are beneficial. Further, the hygiene hypothesis predicts that association with our co-evolved microbial symbionts may be important to overall health. It is therefore imperative that we understand the normal diversity of our eukaryotic gut microbiota to test for such effects and avoid eliminating commensal organisms. We assembled a dataset of healthy individuals from two populations, one with traditional, agrarian lifestyles and a second with modern, westernized lifestyles, and characterized the human eukaryotic microbiota via high-throughput sequencing. To place the human gut microbiota within a broader context our dataset also includes gut samples from diverse mammals and samples from other aquatic and terrestrial environments. We curated the SILVA ribosomal database to reflect current knowledge of eukaryotic taxonomy and employ it as a phylogenetic framework to compare eukaryotic diversity across environment. We show that adults from the non-western population harbor a diverse community of protists, and diversity in the human gut is comparable to that in other mammals. However, the eukaryotic microbiota of the western population appears depauperate. The distribution of symbionts found in mammals reflects both host phylogeny and diet. Eukaryotic microbiota in the gut are less diverse and more patchily distributed than bacteria. More broadly, we show that eukaryotic communities in the gut are less diverse than in aquatic and terrestrial habitats, and few taxa are shared across habitat types, and diversity patterns of eukaryotes are correlated with those observed for bacteria. These results outline the distribution and diversity of microbial eukaryotic communities in the mammalian gut and across

  16. Communities of microbial eukaryotes in the mammalian gut within the context of environmental eukaryotic diversity

    PubMed Central

    Parfrey, Laura Wegener; Walters, William A.; Lauber, Christian L.; Clemente, Jose C.; Berg-Lyons, Donna; Teiling, Clotilde; Kodira, Chinnappa; Mohiuddin, Mohammed; Brunelle, Julie; Driscoll, Mark; Fierer, Noah; Gilbert, Jack A.; Knight, Rob

    2014-01-01

    Eukaryotic microbes (protists) residing in the vertebrate gut influence host health and disease, but their diversity and distribution in healthy hosts is poorly understood. Protists found in the gut are typically considered parasites, but many are commensal and some are beneficial. Further, the hygiene hypothesis predicts that association with our co-evolved microbial symbionts may be important to overall health. It is therefore imperative that we understand the normal diversity of our eukaryotic gut microbiota to test for such effects and avoid eliminating commensal organisms. We assembled a dataset of healthy individuals from two populations, one with traditional, agrarian lifestyles and a second with modern, westernized lifestyles, and characterized the human eukaryotic microbiota via high-throughput sequencing. To place the human gut microbiota within a broader context our dataset also includes gut samples from diverse mammals and samples from other aquatic and terrestrial environments. We curated the SILVA ribosomal database to reflect current knowledge of eukaryotic taxonomy and employ it as a phylogenetic framework to compare eukaryotic diversity across environment. We show that adults from the non-western population harbor a diverse community of protists, and diversity in the human gut is comparable to that in other mammals. However, the eukaryotic microbiota of the western population appears depauperate. The distribution of symbionts found in mammals reflects both host phylogeny and diet. Eukaryotic microbiota in the gut are less diverse and more patchily distributed than bacteria. More broadly, we show that eukaryotic communities in the gut are less diverse than in aquatic and terrestrial habitats, and few taxa are shared across habitat types, and diversity patterns of eukaryotes are correlated with those observed for bacteria. These results outline the distribution and diversity of microbial eukaryotic communities in the mammalian gut and across

  17. Studies on ribosomal proteins in the cellular slime mold Dictyostelium discoideum. Resolution, nomenclature and molecular weights of proteins in the 40-S and 60-S ribosomal subunits.

    PubMed

    Ramagopal, S; Ennis, H L

    1980-04-01

    This study is concerned with the identification and subunit localization of ribosomal proteins in Dictyostelium discoideum. The characterization is based on the resolution of ribosomal proteins by various methods of electrophoresis. 34 and 42 unique proteins were identified in the 40-S and 60-S ribosomal subunits respectively. The total mass of proteins in the 40-S subunit was 746,100 daltons and 981,900 daltons in the 60-S subunit. The molecular weights of individual proteins in the 40-S subunit ranged from 13,200 to 40,900 with a number-average molecular weight of 21,900. The molecular weight range for the 60-S subunit was 13,800--51,100 with a number-average molecular weight of 23,400. The 80-S ribosome contained 78 proteins, two of which were lost upon its dissociation into subunits. All the proteins of the 40-S and 60-S subunits could be identified individually in a 80-S map as well as in unfractionated proteins from whole cells. Purification of ribosomes in high-ionic-strength buffers resulted in non-specific loss of the various proteins from the 40-S and 60-S subunits. In addition, the undissociated ribosomes contained about 10 acidic proteins in the molecular weight range 50,000--100,000, which were retained after washing the ribosomes in high-salt buffers. They were found in polysomes, run-off ribosomes and could also be identified in the 40-S subunit after dissociation.

  18. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site

    PubMed Central

    Fuchs, Gabriele; Petrov, Alexey N.; Marceau, Caleb D.; Popov, Lauren M.; Chen, Jin; O’Leary, Seán E.; Wang, Richard; Carette, Jan E.; Sarnow, Peter; Puglisi, Joseph D.

    2015-01-01

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors. PMID:25516984

  19. The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants

    ERIC Educational Resources Information Center

    Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter

    2004-01-01

    Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…

  20. Ribosomal Protein S3: A Multifunctional Target of Attaching/Effacing Bacterial Pathogens

    PubMed Central

    Gao, Xiaofei; Hardwidge, Philip R.

    2011-01-01

    The extraribosomal functions of ribosomal proteins have drawn significant recent attention. Ribosomal protein S3 (RPS3), a component of the eukaryotic 40S ribosomal subunit, is a multifunctional protein that regulates DNA repair, apoptosis, and the innate immune response to bacterial infection. Here we the review the latest findings about RPS3 extraribosomal functions, with special emphasis on their relation to microbial pathogenesis and enteropathogenic Escherichia coli. PMID:21738525

  1. A Ribosome-Binding, 3′ Translational Enhancer Has a T-Shaped Structure and Engages in a Long-Distance RNA-RNA Interaction

    PubMed Central

    Gao, Feng; Kasprzak, Wojciech; Stupina, Vera A.

    2012-01-01

    Many plant RNA viruses contain elements in their 3′ untranslated regions (3′ UTRs) that enhance translation. The PTE (Panicum mosaic virus-like translational enhancer) of Pea enation mosaic virus (PEMV) binds to eukaryotic initiation factor 4E (eIF4E), but how this affects translation from the 5′ end is unknown. We have discovered a three-way branched element just upstream of the PEMV PTE that engages in a long-distance kissing-loop interaction with a coding sequence hairpin that is critical for the translation of a reporter construct and the accumulation of the viral genome in vivo. Loss of the long-distance interaction was more detrimental than elimination of the adjacent PTE, indicating that the RNA-RNA interaction supports additional translation functions besides relocating the PTE to the 5′ end. The branched element is predicted by molecular modeling and molecular dynamics to form a T-shaped structure (TSS) similar to the ribosome-binding TSS of Turnip crinkle virus (TCV). The PEMV element binds to plant 80S ribosomes with a Kd (dissociation constant) of 0.52 μM and to 60S subunits with a Kd of 0.30 μM. Unlike the TCV TSS, the PEMV element also binds 40S subunits (Kd, 0.36 μM). Mutations in the element that suppressed translation reduced either ribosome binding or the RNA-RNA interaction, suggesting that ribosome binding is important for function. This novel, multifunctional element is designated a kl-TSS (kissing-loop T-shaped structure) to distinguish it from the TCV TSS. The kl-TSS has sequence and structural features conserved with the upper portion of most PTE-type elements, which, with the exception of the PEMV PTE, can engage in similar long-distance RNA-RNA interactions. PMID:22761367

  2. Futurism in the Education of the Deaf: Directions and Alternatives for the 80's.

    ERIC Educational Resources Information Center

    Marshall, William J. A.

    The author presents a rationale for the study of futurism in education and analyzes the effects of significant future changes upon deaf education in the 80s. The roles that change agents play in influencing the permanence of innovations within the school are examined: advocacy, information sharing, and organizational development training.…

  3. Therapeutic Discourse and ACOA Films of the '80s and '90s.

    ERIC Educational Resources Information Center

    Lynch, Joan Driscoll

    2000-01-01

    Argues that many family melodramas in films of the '80s and '90s focus their narrative on the negative dynamics of the parental relationship. Identifies underlying generic patterns and ideas found in these films. Explores representations of mothers, fathers, and children; gender representation and codependency; and familial dysfunction. Broadens…

  4. The Saccharomyces cerevisiae protein Stm1p facilitates ribosome preservation during quiescence

    SciTech Connect

    Van Dyke, Natalya; Chanchorn, Ekkawit; Van Dyke, Michael W.

    2013-01-11

    Highlights: Black-Right-Pointing-Pointer Stm1p confers increased resistance to the macrolide starvation-mimic rapamycin. Black-Right-Pointing-Pointer Stm1p maintains 80S ribosome integrity during stationary phase-induced quiescence. Black-Right-Pointing-Pointer Stm1p facilitates polysome formation following quiescence exit. Black-Right-Pointing-Pointer Stm1p facilitates protein synthesis following quiescence exit. Black-Right-Pointing-Pointer Stm1p is a ribosome preservation factor under conditions of nutrient deprivation. -- Abstract: Once cells exhaust nutrients from their environment, they enter an alternative resting state known as quiescence, whereby proliferation ceases and essential nutrients are obtained through internal stores and through the catabolism of existing macromolecules and organelles. One example of this is ribophagy, the degradation of ribosomes through the process of autophagy. However, some ribosomes need to be preserved for an anticipated recovery from nutrient deprivation. We found that the ribosome-associated protein Stm1p greatly increases the quantity of 80S ribosomes present in quiescent yeast cells and that these ribosomes facilitate increased protein synthesis rates once nutrients are restored. These findings suggest that Stm1p can act as a ribosome preservation factor under conditions of nutrient deprivation and restoration.

  5. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  6. Defective ribosome assembly in Shwachman-Diamond syndrome.

    PubMed

    Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J

    2011-10-20

    Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.

  7. Ocean plankton. Eukaryotic plankton diversity in the sunlit ocean.

    PubMed

    de Vargas, Colomban; Audic, Stéphane; Henry, Nicolas; Decelle, Johan; Mahé, Frédéric; Logares, Ramiro; Lara, Enrique; Berney, Cédric; Le Bescot, Noan; Probert, Ian; Carmichael, Margaux; Poulain, Julie; Romac, Sarah; Colin, Sébastien; Aury, Jean-Marc; Bittner, Lucie; Chaffron, Samuel; Dunthorn, Micah; Engelen, Stefan; Flegontova, Olga; Guidi, Lionel; Horák, Aleš; Jaillon, Olivier; Lima-Mendez, Gipsi; Lukeš, Julius; Malviya, Shruti; Morard, Raphael; Mulot, Matthieu; Scalco, Eleonora; Siano, Raffaele; Vincent, Flora; Zingone, Adriana; Dimier, Céline; Picheral, Marc; Searson, Sarah; Kandels-Lewis, Stefanie; Acinas, Silvia G; Bork, Peer; Bowler, Chris; Gorsky, Gabriel; Grimsley, Nigel; Hingamp, Pascal; Iudicone, Daniele; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stephane; Raes, Jeroen; Sieracki, Michael E; Speich, Sabrina; Stemmann, Lars; Sunagawa, Shinichi; Weissenbach, Jean; Wincker, Patrick; Karsenti, Eric

    2015-05-22

    Marine plankton support global biological and geochemical processes. Surveys of their biodiversity have hitherto been geographically restricted and have not accounted for the full range of plankton size. We assessed eukaryotic diversity from 334 size-fractionated photic-zone plankton communities collected across tropical and temperate oceans during the circumglobal Tara Oceans expedition. We analyzed 18S ribosomal DNA sequences across the intermediate plankton-size spectrum from the smallest unicellular eukaryotes (protists, >0.8 micrometers) to small animals of a few millimeters. Eukaryotic ribosomal diversity saturated at ~150,000 operational taxonomic units, about one-third of which could not be assigned to known eukaryotic groups. Diversity emerged at all taxonomic levels, both within the groups comprising the ~11,200 cataloged morphospecies of eukaryotic plankton and among twice as many other deep-branching lineages of unappreciated importance in plankton ecology studies. Most eukaryotic plankton biodiversity belonged to heterotrophic protistan groups, particularly those known to be parasites or symbiotic hosts. PMID:25999516

  8. Ocean plankton. Eukaryotic plankton diversity in the sunlit ocean.

    PubMed

    de Vargas, Colomban; Audic, Stéphane; Henry, Nicolas; Decelle, Johan; Mahé, Frédéric; Logares, Ramiro; Lara, Enrique; Berney, Cédric; Le Bescot, Noan; Probert, Ian; Carmichael, Margaux; Poulain, Julie; Romac, Sarah; Colin, Sébastien; Aury, Jean-Marc; Bittner, Lucie; Chaffron, Samuel; Dunthorn, Micah; Engelen, Stefan; Flegontova, Olga; Guidi, Lionel; Horák, Aleš; Jaillon, Olivier; Lima-Mendez, Gipsi; Lukeš, Julius; Malviya, Shruti; Morard, Raphael; Mulot, Matthieu; Scalco, Eleonora; Siano, Raffaele; Vincent, Flora; Zingone, Adriana; Dimier, Céline; Picheral, Marc; Searson, Sarah; Kandels-Lewis, Stefanie; Acinas, Silvia G; Bork, Peer; Bowler, Chris; Gorsky, Gabriel; Grimsley, Nigel; Hingamp, Pascal; Iudicone, Daniele; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stephane; Raes, Jeroen; Sieracki, Michael E; Speich, Sabrina; Stemmann, Lars; Sunagawa, Shinichi; Weissenbach, Jean; Wincker, Patrick; Karsenti, Eric

    2015-05-22

    Marine plankton support global biological and geochemical processes. Surveys of their biodiversity have hitherto been geographically restricted and have not accounted for the full range of plankton size. We assessed eukaryotic diversity from 334 size-fractionated photic-zone plankton communities collected across tropical and temperate oceans during the circumglobal Tara Oceans expedition. We analyzed 18S ribosomal DNA sequences across the intermediate plankton-size spectrum from the smallest unicellular eukaryotes (protists, >0.8 micrometers) to small animals of a few millimeters. Eukaryotic ribosomal diversity saturated at ~150,000 operational taxonomic units, about one-third of which could not be assigned to known eukaryotic groups. Diversity emerged at all taxonomic levels, both within the groups comprising the ~11,200 cataloged morphospecies of eukaryotic plankton and among twice as many other deep-branching lineages of unappreciated importance in plankton ecology studies. Most eukaryotic plankton biodiversity belonged to heterotrophic protistan groups, particularly those known to be parasites or symbiotic hosts.

  9. Two Arabidopsis loci encode novel eukaryotic initiation factor 4E isoforms that are functionally distinct from the conserved plant eukaryotic initiation factor 4E.

    PubMed

    Patrick, Ryan M; Mayberry, Laura K; Choy, Grace; Woodard, Lauren E; Liu, Joceline S; White, Allyson; Mullen, Rebecca A; Tanavin, Toug M; Latz, Christopher A; Browning, Karen S

    2014-04-01

    Canonical translation initiation in eukaryotes begins with the Eukaryotic Initiation Factor 4F (eIF4F) complex, made up of eIF4E, which recognizes the 7-methylguanosine cap of messenger RNA, and eIF4G, which serves as a scaffold to recruit other translation initiation factors that ultimately assemble the 80S ribosome. Many eukaryotes have secondary EIF4E genes with divergent properties. The model plant Arabidopsis (Arabidopsis thaliana) encodes two such genes in tandem loci on chromosome 1, EIF4E1B (At1g29550) and EIF4E1C (At1g29590). This work identifies EIF4E1B/EIF4E1C-type genes as a Brassicaceae-specific diverged form of EIF4E. There is little evidence for EIF4E1C gene expression; however, the EIF4E1B gene appears to be expressed at low levels in most tissues, though microarray and RNA Sequencing data support enrichment in reproductive tissue. Purified recombinant eIF4E1b and eIF4E1c proteins retain cap-binding ability and form functional complexes in vitro with eIF4G. The eIF4E1b/eIF4E1c-type proteins support translation in yeast (Saccharomyces cerevisiae) but promote translation initiation in vitro at a lower rate compared with eIF4E. Findings from surface plasmon resonance studies indicate that eIF4E1b and eIF4E1c are unlikely to bind eIF4G in vivo when in competition with eIF4E. This study concludes that eIF4E1b/eIF4E1c-type proteins, although bona fide cap-binding proteins, have divergent properties and, based on apparent limited tissue distribution in Arabidopsis, should be considered functionally distinct from the canonical plant eIF4E involved in translation initiation.

  10. Two Arabidopsis Loci Encode Novel Eukaryotic Initiation Factor 4E Isoforms That Are Functionally Distinct from the Conserved Plant Eukaryotic Initiation Factor 4E1[W][OPEN

    PubMed Central

    Patrick, Ryan M.; Mayberry, Laura K.; Choy, Grace; Woodard, Lauren E.; Liu, Joceline S.; White, Allyson; Mullen, Rebecca A.; Tanavin, Toug M.; Latz, Christopher A.; Browning, Karen S.

    2014-01-01

    Canonical translation initiation in eukaryotes begins with the Eukaryotic Initiation Factor 4F (eIF4F) complex, made up of eIF4E, which recognizes the 7-methylguanosine cap of messenger RNA, and eIF4G, which serves as a scaffold to recruit other translation initiation factors that ultimately assemble the 80S ribosome. Many eukaryotes have secondary EIF4E genes with divergent properties. The model plant Arabidopsis (Arabidopsis thaliana) encodes two such genes in tandem loci on chromosome 1, EIF4E1B (At1g29550) and EIF4E1C (At1g29590). This work identifies EIF4E1B/EIF4E1C-type genes as a Brassicaceae-specific diverged form of EIF4E. There is little evidence for EIF4E1C gene expression; however, the EIF4E1B gene appears to be expressed at low levels in most tissues, though microarray and RNA Sequencing data support enrichment in reproductive tissue. Purified recombinant eIF4E1b and eIF4E1c proteins retain cap-binding ability and form functional complexes in vitro with eIF4G. The eIF4E1b/eIF4E1c-type proteins support translation in yeast (Saccharomyces cerevisiae) but promote translation initiation in vitro at a lower rate compared with eIF4E. Findings from surface plasmon resonance studies indicate that eIF4E1b and eIF4E1c are unlikely to bind eIF4G in vivo when in competition with eIF4E. This study concludes that eIF4E1b/eIF4E1c-type proteins, although bona fide cap-binding proteins, have divergent properties and, based on apparent limited tissue distribution in Arabidopsis, should be considered functionally distinct from the canonical plant eIF4E involved in translation initiation. PMID:24501003

  11. The Ribosomal Database Project

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Overbeek, R.; Larsen, N.; Marsh, T. L.; McCaughey, M. J.; Maciukenas, M. A.; Kuan, W. M.; Macke, T. J.; Xing, Y.; Woese, C. R.

    1992-01-01

    The Ribosomal Database Project (RDP) complies ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development.

  12. [Intracellular transport of nuclear ribosomal RNA in Acetabularia mediterranea].

    PubMed

    Naumova, L P; Pressman, E K; Sandakhchiev, L S

    1976-01-01

    The ribosomal RNA transport from a nucleus to a perinuclear cytoplasm and its following distribution in the cytoplasm of Acetabularia mediterranea cells were studied using transplantation of RNA-labeled rhizoid into unlabeled stalk. In addition rifamycin treatment was used for inhibition of cytoplasmic RNA synthesis. Acetabularia nuclei contain the stable RNA fractions similar to those present in some other eukaryotes. Nuclear 25S and 17S ribosomal RNA rapidly enter the rhizoid cytoplasm whereas the following trasfer of them to other regions of the cell is a very slow process. Within two days only an insignificant part of 25S and 17S ribosomal RNA is transferred from the rhizoid to the stalk and is distributed there over the base-apical gradient. No preferential transfer of the nuclear ribosomal RNA to the apical region was observed.

  13. Reduction in Ribosomal Protein Synthesis Is Sufficient To Explain Major Effects on Ribosome Production after Short-Term TOR Inactivation in Saccharomyces cerevisiae▿

    PubMed Central

    Reiter, Alarich; Steinbauer, Robert; Philippi, Anja; Gerber, Jochen; Tschochner, Herbert; Milkereit, Philipp; Griesenbeck, Joachim

    2011-01-01

    Ribosome synthesis depends on nutrient availability, sensed by the target of rapamycin (TOR) signaling pathway in eukaryotes. TOR inactivation affects ribosome biogenesis at the level of rRNA gene transcription, expression of ribosomal proteins (r-proteins) and biogenesis factors, preribosome processing, and transport. Here, we demonstrate that upon TOR inactivation, levels of newly synthesized ribosomal subunits drop drastically before the integrity of the RNA polymerase I apparatus is severely impaired but in good correlation with a sharp decrease in r-protein production. Inhibition of translation by cycloheximide mimics the rRNA maturation defect observed immediately after TOR inactivation. Both cycloheximide addition and the depletion of individual r-proteins also reproduce TOR-dependent nucleolar entrapment of specific ribosomal precursor complexes. We suggest that shortage of newly synthesized r-proteins after short-term TOR inactivation is sufficient to explain most of the observed effects on ribosome production. PMID:21149576

  14. Functional Interaction between Ribosomal Protein L6 and RbgA during Ribosome Assembly

    PubMed Central

    Davis, Joseph H.; Williamson, James R.; Britton, Robert A.

    2014-01-01

    RbgA is an essential GTPase that participates in the assembly of the large ribosomal subunit in Bacillus subtilis and its homologs are implicated in mitochondrial and eukaryotic large subunit assembly. How RbgA functions in this process is still poorly understood. To gain insight into the function of RbgA we isolated suppressor mutations that partially restored the growth of an RbgA mutation (RbgA-F6A) that caused a severe growth defect. Analysis of these suppressors identified mutations in rplF, encoding ribosomal protein L6. The suppressor strains all accumulated a novel ribosome intermediate that migrates at 44S in sucrose gradients. All of the mutations cluster in a region of L6 that is in close contact with helix 97 of the 23S rRNA. In vitro maturation assays indicate that the L6 substitutions allow the defective RbgA-F6A protein to function more effectively in ribosome maturation. Our results suggest that RbgA functions to properly position L6 on the ribosome, prior to the incorporation of L16 and other late assembly proteins. PMID:25330043

  15. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  16. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  17. The 3′ Untranslated Region of Pea Enation Mosaic Virus Contains Two T-Shaped, Ribosome-Binding, Cap-Independent Translation Enhancers

    PubMed Central

    Gao, Feng; Kasprzak, Wojciech K.; Szarko, Christine; Shapiro, Bruce A.

    2014-01-01

    ABSTRACT Many plant viruses without 5′caps or 3′ poly(A) tails contain 3′ proximal, cap-independent translation enhancers (3′CITEs) that bind to ribosomal subunits or translation factors thought to assist in ribosome recruitment. Most 3′CITEs participate in a long-distance kissing-loop interaction with a 5′ proximal hairpin to deliver ribosomal subunits to the 5′ end for translation initiation. Pea Enation Mosaic Virus (PEMV) contains two adjacent 3′CITEs in the center of its 703-nucleotide 3′ untranslated region (3′UTR), the ribosome-binding, kissing-loop T-shaped structure (kl-TSS) and eukaryotic translation initiation factor 4E-binding Panicum mosaic virus-like translation enhance (PTE). We now report that PEMV contains a third, independent 3′CITE located near the 3′ terminus. This 3′CITE is composed of three hairpins and two pseudoknots, similar to the TSS 3′CITE of the carmovirus Turnip crinkle virus (TCV). As with the TCV TSS, the PEMV 3′TSS is predicted to fold into a T-shaped structure that binds to 80S ribosomes and 60S ribosomal subunits. A small hairpin (kl-H) upstream of the 3′TSS contains an apical loop capable of forming a kissing-loop interaction with a 5′ proximal hairpin and is critical for the accumulation of full-length PEMV in protoplasts. Although the kl-H and 3′TSS are dispensable for the translation of a reporter construct containing the complete PEMV 3′UTR in vitro, deleting the normally required kl-TSS and PTE 3′CITEs and placing the kl-H and 3′TSS proximal to the reporter termination codon restores translation to near wild-type levels. This suggests that PEMV requires three 3′CITEs for proper translation and that additional translation enhancers may have been missed if reporter constructs were used in 3′CITE identification. IMPORTANCE The rapid life cycle of viruses requires efficient translation of viral-encoded proteins. Many plant RNA viruses contain 3′ cap-independent translation

  18. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  19. Regulation of ribosomal DNA amplification by the TOR pathway.

    PubMed

    Jack, Carmen V; Cruz, Cristina; Hull, Ryan M; Keller, Markus A; Ralser, Markus; Houseley, Jonathan

    2015-08-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions.

  20. Studies on the Coordination of Ribosomal Protein Assembly Events Involved in Processing and Stabilization of Yeast Early Large Ribosomal Subunit Precursors

    PubMed Central

    Sauert, Martina; Martín-Marcos, Pilar; Tamame, Mercedes; Tschochner, Herbert; Griesenbeck, Joachim; Milkereit, Philipp

    2015-01-01

    Cellular production of ribosomes involves the formation of highly defined interactions between ribosomal proteins (r-proteins) and ribosomal RNAs (rRNAs). Moreover in eukaryotic cells, efficient ribosome maturation requires the transient association of a large number of ribosome biogenesis factors (RBFs) with newly forming ribosomal subunits. Here, we investigated how r-protein assembly events in the large ribosomal subunit (LSU) rRNA domain II are coordinated with each other and with the association of RBFs in early LSU precursors of the yeast Saccharomyces cerevisiae. Specific effects on the pre-ribosomal association of RBFs could be observed in yeast mutants blocked in LSU rRNA domain II assembly. Moreover, formation of a cluster of r-proteins was identified as a downstream event in LSU rRNA domain II assembly. We analyzed in more detail the functional relevance of eukaryote specific bridges established by this r-protein cluster between LSU rRNA domain II and VI and discuss how they can support the stabilization and efficient processing of yeast early LSU precursor RNAs. PMID:26642313

  1. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  2. RNA Export through the NPC in Eukaryotes

    PubMed Central

    Okamura, Masumi; Inose, Haruko; Masuda, Seiji

    2015-01-01

    In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC. PMID:25802992

  3. Acidocalcisomes of eukaryotes.

    PubMed

    Docampo, Roberto; Huang, Guozhong

    2016-08-01

    Acidocalcisomes are organelles rich in polyphosphate and cations and acidified by proton pumps. Although they have also been described in prokaryotes they have been better characterized in unicellular and multicellular eukaryotes. Eukaryotic acidocalcisomes belong to the group of lysosome-related organelles. They have a variety of functions, from the storage of cations and phosphorus to calcium signaling, autophagy, osmoregulation, blood coagulation, and inflammation. Acidocalcisomes of several unicellular eukaryotes possess a variety of transporters, channels and pumps implying a large energetic requirement for their maintenance and suggesting other important functions waiting to be discovered. PMID:27125677

  4. An archaeal origin of eukaryotes supports only two primary domains of life.

    PubMed

    Williams, Tom A; Foster, Peter G; Cox, Cymon J; Embley, T Martin

    2013-12-12

    The discovery of the Archaea and the proposal of the three-domains 'universal' tree, based on ribosomal RNA and core genes mainly involved in protein translation, catalysed new ideas for cellular evolution and eukaryotic origins. However, accumulating evidence suggests that the three-domains tree may be incorrect: evolutionary trees made using newer methods place eukaryotic core genes within the Archaea, supporting hypotheses in which an archaeon participated in eukaryotic origins by founding the host lineage for the mitochondrial endosymbiont. These results provide support for only two primary domains of life--Archaea and Bacteria--because eukaryotes arose through partnership between them.

  5. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  6. The microtrabecular lattice and its relationships to other organelles in prokaryotes and eukaryotes--high resolution scanning electron microscopy.

    PubMed

    Epling, G P; Blixt, J A; Mahurin, R W; Rinaldi, M G

    1983-01-01

    High resolution scanning electron microscopy demonstrated the microtrabecular lattice in bacteria, fungi, plant and animal cells. It is attached to ribosomes and plasma membranes generally, but to other organelles and the nuclear envelope in eukaryotes. The eukaryotic organelle surface substructure is described. Differentiation of real structure from artifacts of fixation, critical point drying and sputter-coating, is discussed.

  7. The tree of eukaryotes.

    PubMed

    Keeling, Patrick J; Burger, Gertraud; Durnford, Dion G; Lang, B Franz; Lee, Robert W; Pearlman, Ronald E; Roger, Andrew J; Gray, Michael W

    2005-12-01

    Recent advances in resolving the tree of eukaryotes are converging on a model composed of a few large hypothetical 'supergroups', each comprising a diversity of primarily microbial eukaryotes (protists, or protozoa and algae). The process of resolving the tree involves the synthesis of many kinds of data, including single-gene trees, multigene analyses, and other kinds of molecular and structural characters. Here, we review the recent progress in assembling the tree of eukaryotes, describing the major evidence for each supergroup, and where gaps in our knowledge remain. We also consider other factors emerging from phylogenetic analyses and comparative genomics, in particular lateral gene transfer, and whether such factors confound our understanding of the eukaryotic tree.

  8. Eukaryotic diversity at pH extremes.

    PubMed

    Amaral-Zettler, Linda A

    2012-01-01

    Extremely acidic (pH < 3) and extremely alkaline (pH > 9) environments support a diversity of single-cell and to a lesser extent, multicellular eukaryotic life. This study compared alpha and beta diversity in eukaryotic communities from seven diverse aquatic environments with pH values ranging from 2 to 11 using massively-parallel pyrotag sequencing targeting the V9 hypervariable region of the 18S ribosomal RNA (rRNA) gene. A total of 946 operational taxonomic units (OTUs) were recovered at a 6% cut-off level (94% similarity) across the sampled environments. Hierarchical clustering of the samples segregated the communities into acidic and alkaline groups. Similarity percentage (SIMPER) analysis followed by indicator OTU analysis (IOA) and non-metric multidimensional scaling (NMDS) were used to determine which characteristic groups of eukaryotic taxa typify acidic or alkaline extremes and the extent to which pH explains eukaryotic community structure in these environments. Spain's Rio Tinto yielded the fewest observed OTUs while Nebraska Sandhills alkaline lakes yielded the most. Distinct OTUs, including metazoan OTUs, numerically dominated pH extreme sites. Indicator OTUs included the diatom Pinnularia and unidentified opisthokonts (Fungi and Filasterea) in the extremely acidic environments, and the ciliate Frontonia across the extremely alkaline sites. Inferred from NMDS, pH explained only a modest fraction of the variation across the datasets, indicating that other factors influence the underlying community structure in these environments. The findings from this study suggest that the ability for eukaryotes to adapt to pH extremes over a broad range of values may be rare, but further study of taxa that can broadly adapt across diverse acidic and alkaline environments, respectively present good models for understanding adaptation and should be targeted for future investigations.

  9. Eukaryotic diversity at pH extremes

    PubMed Central

    Amaral-Zettler, Linda A.

    2013-01-01

    Extremely acidic (pH < 3) and extremely alkaline (pH > 9) environments support a diversity of single-cell and to a lesser extent, multicellular eukaryotic life. This study compared alpha and beta diversity in eukaryotic communities from seven diverse aquatic environments with pH values ranging from 2 to 11 using massively-parallel pyrotag sequencing targeting the V9 hypervariable region of the 18S ribosomal RNA (rRNA) gene. A total of 946 operational taxonomic units (OTUs) were recovered at a 6% cut-off level (94% similarity) across the sampled environments. Hierarchical clustering of the samples segregated the communities into acidic and alkaline groups. Similarity percentage (SIMPER) analysis followed by indicator OTU analysis (IOA) and non-metric multidimensional scaling (NMDS) were used to determine which characteristic groups of eukaryotic taxa typify acidic or alkaline extremes and the extent to which pH explains eukaryotic community structure in these environments. Spain's Rio Tinto yielded the fewest observed OTUs while Nebraska Sandhills alkaline lakes yielded the most. Distinct OTUs, including metazoan OTUs, numerically dominated pH extreme sites. Indicator OTUs included the diatom Pinnularia and unidentified opisthokonts (Fungi and Filasterea) in the extremely acidic environments, and the ciliate Frontonia across the extremely alkaline sites. Inferred from NMDS, pH explained only a modest fraction of the variation across the datasets, indicating that other factors influence the underlying community structure in these environments. The findings from this study suggest that the ability for eukaryotes to adapt to pH extremes over a broad range of values may be rare, but further study of taxa that can broadly adapt across diverse acidic and alkaline environments, respectively present good models for understanding adaptation and should be targeted for future investigations. PMID:23335919

  10. Structural disorder in eukaryotes.

    PubMed

    Pancsa, Rita; Tompa, Peter

    2012-01-01

    Based on early bioinformatic studies on a handful of species, the frequency of structural disorder of proteins is generally thought to be much higher in eukaryotes than in prokaryotes. To refine this view, we present here a comparative prediction study and analysis of 194 fully described eukaryotic proteomes and 87 reference prokaryotes for structural disorder. We found that structural disorder does distinguish eukaryotes from prokaryotes, but its frequency spans a very wide range in the two superkingdoms that largely overlap. The number of disordered binding regions and different Pfam domain types also contribute to distinguish eukaryotes from prokaryotes. Unexpectedly, the highest levels--and highest variability--of predicted disorder is found in protists, i.e. single-celled eukaryotes, often surpassing more complex eukaryote organisms, plants and animals. This trend contrasts with that of the number of domain types, which increases rather monotonously toward more complex organisms. The level of structural disorder appears to be strongly correlated with lifestyle, because some obligate intracellular parasites and endosymbionts have the lowest levels, whereas host-changing parasites have the highest level of predicted disorder. We conclude that protists have been the evolutionary hot-bed of experimentation with structural disorder, in a period when structural disorder was actively invented and the major functional classes of disordered proteins established.

  11. When stable RNA becomes unstable: the degradation of ribosomes in bacteria and beyond.

    PubMed

    Maiväli, Ülo; Paier, Anton; Tenson, Tanel

    2013-07-01

    This review takes a comparative look at the various scenarios where ribosomes are degraded in bacteria and eukaryotes with emphasis on studies involving Escherichia coli and Saccharomyces cerevisiae. While the molecular mechanisms of degradation in bacteria and yeast appear somewhat different, we argue that the underlying causes of ribosome degradation are remarkably similar. In both model organisms during ribosomal assembly, partially formed pre-ribosomal particles can be degraded by at least two different sequentially-acting quality control pathways and fully assembled but functionally faulty ribosomes can be degraded in a separate quality control pathway. In addition, ribosomes that are both structurally- and functionally-sound can be degraded as an adaptive measure to stress.

  12. Evolutionary implications of intron-exon distribution and the properties and sequences of the RPL10A gene in eukaryotes.

    PubMed

    Del Campo, Eva M; Casano, Leonardo M; Barreno, Eva

    2013-03-01

    The RPL10A gene encodes the RPL10 protein, required for joining 40S and 60S subunits into a functional 80S ribosome. This highly conserved gene, ubiquitous across all eukaryotic super-groups, is characterized by a variable number of spliceosomal introns, present in most organisms. These properties facilitate the recognition of orthologs among distant taxa and thus comparative studies of sequences as well as the distribution and properties of introns in taxonomically distant groups of eukaryotes. The present study examined the multiple ways in which RPL10A conservation vs. sequence changes in the gene over the course of evolution, including in exons, introns, and the encoded proteins, can be exploited for evolutionary analysis at different taxonomic levels. At least 25 different positions harboring introns within the RPL10A gene were determined in different taxa, including animals, plants, fungi, and alveolates. Generally, intron positions were found to be well conserved even across different kingdoms. However, certain introns seemed to be restricted to specific groups of organisms. Analyses of several properties of introns, including insertion site, phase, and length, along with exon and intron GC content and exon-intron boundaries, suggested biases within different groups of organisms. The use of a standard primer pair to analyze a portion of the intron-containing RPL10A gene in 12 genera of green algae within Chlorophyta is presented as a case study for evolutionary analyses of introns at intermediate and low taxonomic levels. Our study shows that phylogenetic reconstructions at different depths can be achieved using RPL10A nucleotide sequences from both exons and introns as well as the amino acid sequences of the encoded protein.

  13. Analysis of plant ribosomes with asymmetric flow field-flow fractionation.

    PubMed

    Pitkänen, Leena; Tuomainen, Päivi; Eskelin, Katri

    2014-02-01

    Ribosome profiling is a technique used to separate ribosomal subunits, 80S ribosomes (monosomes), and polyribosomes (polysomes) from other RNA-protein complexes. It is traditionally performed in sucrose gradients. In this study, we used asymmetric flow field-flow fractionation (AsFlFFF) to characterize ribosome profiles of Nicotiana benthamiana plants. With the optimized running conditions, we were able to separate free molecules from ribosomal subunits and intact ribosomes. We used various chemical and enzymatic treatments to validate the positions of subunits, monosomes, and polysomes in the AsFlFFF fractograms. We also characterized the protein and RNA content of AsFlFFF fractions by gel electrophoresis and western blotting. The reverse transcription polymerase chain reaction (RT-PCR) analysis showed that ribosomes remained bound to messenger RNAs (mRNAs) during the analysis. Therefore, we conclude that AsFlFFF can be used for ribosome profiling to study the mRNAs that are being translated. It can also be used to study the protein composition of ribosomes that are active in translation at that particular moment.

  14. RiboVision suite for visualization and analysis of ribosomes.

    PubMed

    Bernier, Chad R; Petrov, Anton S; Waterbury, Chris C; Jett, James; Li, Fengbo; Freil, Larry E; Xiong, Xiao; Wang, Lan; Migliozzi, Blacki L R; Hershkovits, Eli; Xue, Yuzhen; Hsiao, Chiaolong; Bowman, Jessica C; Harvey, Stephen C; Grover, Martha A; Wartell, Zachary J; Williams, Loren Dean

    2014-01-01

    RiboVision is a visualization and analysis tool for the simultaneous display of multiple layers of diverse information on primary (1D), secondary (2D), and three-dimensional (3D) structures of ribosomes. The ribosome is a macromolecular complex containing ribosomal RNA and ribosomal proteins and is a key component of life responsible for the synthesis of proteins in all living organisms. RiboVision is intended for rapid retrieval, analysis, filtering, and display of a variety of ribosomal data. Preloaded information includes 1D, 2D, and 3D structures augmented by base-pairing, base-stacking, and other molecular interactions. RiboVision is preloaded with rRNA secondary structures, rRNA domains and helical structures, phylogeny, crystallographic thermal factors, etc. RiboVision contains structures of ribosomal proteins and a database of their molecular interactions with rRNA. RiboVision contains preloaded structures and data for two bacterial ribosomes (Thermus thermophilus and Escherichia coli), one archaeal ribosome (Haloarcula marismortui), and three eukaryotic ribosomes (Saccharomyces cerevisiae, Drosophila melanogaster, and Homo sapiens). RiboVision revealed several major discrepancies between the 2D and 3D structures of the rRNAs of the small and large subunits (SSU and LSU). Revised structures mapped with a variety of data are available in RiboVision as well as in a public gallery (). RiboVision is designed to allow users to distill complex data quickly and to easily generate publication-quality images of data mapped onto secondary structures. Users can readily import and analyze their own data in the context of other work. This package allows users to import and map data from CSV files directly onto 1D, 2D, and 3D levels of structure. RiboVision has features in rough analogy with web-based map services capable of seamlessly switching the type of data displayed and the resolution or magnification of the display. RiboVision is available at .

  15. Replication and transcription of eukaryotic DNA in Escherichia coli.

    PubMed

    Morrow, J F; Cohen, S N; Chang, A C; Boyer, H W; Goodman, H M; Helling, R B

    1974-05-01

    Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA.

  16. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  17. Mitochondrial ribosome assembly in health and disease.

    PubMed

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health.

  18. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  19. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  20. Subseabed radioactive waste disposal feasibility program: ocean engineering challenges for the 80's

    SciTech Connect

    Talbert, D. M.

    1980-11-01

    The objective of the Subseabed Disposal Program is to assess the feasibility of disposing of high-level radioactive wastes or spent fuel in suitable geologic formations beneath the deep ocean floor. The program is entering a phase which will address engineering feasibility. While the current phase of the program to determine the scientific and environmental feasibility of the concept is not yet complete, activities to assess the engineering aspects are being initiated in parallel to facilitate the development of the concept on a time scale commensurate with related programs both in the United States and abroad. It is anticipated that engineering aspects will become the central focus of the program during the early 80's and will continue so through the establishment of a pilot-plant level activity which could occur by the mid-90's.

  1. Subseabed Radioactive Waste Disposal Feasibility Program: ocean engineering challenges for the 80's

    SciTech Connect

    Talbert, D. M.

    1980-01-01

    The objective of the Subseabed Disposal Program is to assess the feasibility of disposing of high-level radioactive wastes or spent fuel in suitable geologic formations beneath the deep ocean floor. The program is entering a phase which will address engineering feasibility. While the current phase of the program to determine the scientific and environmental feasibility of the concept is not yet complete, activities to assess the engineering aspects are being initiated in parallel to facilitate the development of the concept on a time scale commensurate with other related programs both in the United States and abroad. It is anticipated that engineering aspects will become the central focus of the program during the early 80's and will continue so through the establishment of a pilot-plant level activity which could occur by the mid-90's.

  2. Purification of 70S ribosomes.

    PubMed

    Rivera, Maria C; Maguire, Bruce; Lake, James A

    2015-03-01

    Here we describe the further purification of prokaryotic ribosomal particles obtained after the centrifugation of a crude cell lysate through a sucrose cushion. In this final purification step, a fraction containing ribosomes, ribosomal subunits, and polysomes is centrifuged through a 7%-30% (w/w) linear sucrose gradient to isolate tight couple 70S ribosomes, as well as dissociated 30S and 50S subunits. The tight couples fraction, or translationally active ribosome fraction, is composed of intact vacant ribosomes that can be used in cell-free translation systems.

  3. Organelle fission in eukaryotes.

    PubMed

    Osteryoung, K W

    2001-12-01

    The cellular machineries that power chloroplast and mitochondrial division in eukaryotes carry out the topologically challenging job of constricting and severing these double-membraned organelles. Consistent with their endosymbiotic origins, mitochondria in protists and chloroplasts in photosynthetic eukaryotes have evolved organelle-targeted forms of FtsZ, the prokaryotic ancestor of tubulin, as key components of their fission complexes. In fungi, animals and plants, mitochondria no longer utilize FtsZ for division, but several mitochondrial division proteins that localize to the outer membrane and intermembrane space, including two related to the filament-forming dynamins, have been identified in yeast and animals. Although the reactions that mediate organelle division are not yet understood, recent progress in uncovering the constituents of the organelle division machineries promises rapid advancement in our understanding of the biochemical mechanisms underlying the distinct but related processes of chloroplast and mitochondrial division in eukaryotes.

  4. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  5. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410

  6. Eukaryotic Cell Panorama

    ERIC Educational Resources Information Center

    Goodsell, David S.

    2011-01-01

    Diverse biological data may be used to create illustrations of molecules in their cellular context. This report describes the scientific results that support an illustration of a eukaryotic cell, enlarged by one million times to show the distribution and arrangement of macromolecules. The panoramic cross section includes eight panels that extend…

  7. Prokaryote and eukaryote evolvability.

    PubMed

    Poole, Anthony M; Phillips, Matthew J; Penny, David

    2003-05-01

    The concept of evolvability covers a broad spectrum of, often contradictory, ideas. At one end of the spectrum it is equivalent to the statement that evolution is possible, at the other end are untestable post hoc explanations, such as the suggestion that current evolutionary theory cannot explain the evolution of evolvability. We examine similarities and differences in eukaryote and prokaryote evolvability, and look for explanations that are compatible with a wide range of observations. Differences in genome organisation between eukaryotes and prokaryotes meets this criterion. The single origin of replication in prokaryote chromosomes (versus multiple origins in eukaryotes) accounts for many differences because the time to replicate a prokaryote genome limits its size (and the accumulation of junk DNA). Both prokaryotes and eukaryotes appear to switch from genetic stability to genetic change in response to stress. We examine a range of stress responses, and discuss how these impact on evolvability, particularly in unicellular organisms versus complex multicellular ones. Evolvability is also limited by environmental interactions (including competition) and we describe a model that places limits on potential evolvability. Examples are given of its application to predator competition and limits to lateral gene transfer. We suggest that unicellular organisms evolve largely through a process of metabolic change, resulting in biochemical diversity. Multicellular organisms evolve largely through morphological changes, not through extensive changes to cellular biochemistry. PMID:12689728

  8. Reinitiation and other unconventional posttermination events during eukaryotic translation.

    PubMed

    Skabkin, Maxim A; Skabkina, Olga V; Hellen, Christopher U T; Pestova, Tatyana V

    2013-07-25

    During ribosome recycling, posttermination complexes are dissociated by ABCE1 and eRF1 into 60S and tRNA/mRNA-associated 40S subunits, after which tRNA and mRNA are released by eIF1/eIF1A, Ligatin, or MCT-1/DENR. Occasionally, 40S subunits remain associated with mRNA and reinitiate at nearby AUGs. We recapitulated reinitiation using a reconstituted mammalian translation system. The presence of eIF2, eIF3, eIF1, eIF1A, and Met-tRNAi(Met) was sufficient for recycled 40S subunits to remain on mRNA, scan bidirectionally, and reinitiate at upstream and downstream AUGs if mRNA regions flanking the stop codon were unstructured. Imposition of 3' directionality additionally required eIF4F. Strikingly, posttermination ribosomes were not stably anchored on mRNA and migrated bidirectionally to codons cognate to the P site tRNA. Migration depended on the mode of peptide release (puromycin > eRF1⋅eRF3) and nature of tRNA and was enhanced by eEF2. The mobility of posttermination ribosomes suggests that some reinitiation events could involve 80S ribosomes rather than 40S subunits.

  9. Ribosomal Antibiotics: Contemporary Challenges.

    PubMed

    Auerbach-Nevo, Tamar; Baram, David; Bashan, Anat; Belousoff, Matthew; Breiner, Elinor; Davidovich, Chen; Cimicata, Giuseppe; Eyal, Zohar; Halfon, Yehuda; Krupkin, Miri; Matzov, Donna; Metz, Markus; Rufayda, Mruwat; Peretz, Moshe; Pick, Ophir; Pyetan, Erez; Rozenberg, Haim; Shalev-Benami, Moran; Wekselman, Itai; Zarivach, Raz; Zimmerman, Ella; Assis, Nofar; Bloch, Joel; Israeli, Hadar; Kalaora, Rinat; Lim, Lisha; Sade-Falk, Ofir; Shapira, Tal; Taha-Salaime, Leena; Tang, Hua; Yonath, Ada

    2016-06-29

    Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of "pathogen-specific antibiotics," in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification.

  10. Ribosomal Antibiotics: Contemporary Challenges.

    PubMed

    Auerbach-Nevo, Tamar; Baram, David; Bashan, Anat; Belousoff, Matthew; Breiner, Elinor; Davidovich, Chen; Cimicata, Giuseppe; Eyal, Zohar; Halfon, Yehuda; Krupkin, Miri; Matzov, Donna; Metz, Markus; Rufayda, Mruwat; Peretz, Moshe; Pick, Ophir; Pyetan, Erez; Rozenberg, Haim; Shalev-Benami, Moran; Wekselman, Itai; Zarivach, Raz; Zimmerman, Ella; Assis, Nofar; Bloch, Joel; Israeli, Hadar; Kalaora, Rinat; Lim, Lisha; Sade-Falk, Ofir; Shapira, Tal; Taha-Salaime, Leena; Tang, Hua; Yonath, Ada

    2016-01-01

    Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of "pathogen-specific antibiotics," in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification. PMID:27367739

  11. Ribosomal Antibiotics: Contemporary Challenges

    PubMed Central

    Auerbach-Nevo, Tamar; Baram, David; Bashan, Anat; Belousoff, Matthew; Breiner, Elinor; Davidovich, Chen; Cimicata, Giuseppe; Eyal, Zohar; Halfon, Yehuda; Krupkin, Miri; Matzov, Donna; Metz, Markus; Rufayda, Mruwat; Peretz, Moshe; Pick, Ophir; Pyetan, Erez; Rozenberg, Haim; Shalev-Benami, Moran; Wekselman, Itai; Zarivach, Raz; Zimmerman, Ella; Assis, Nofar; Bloch, Joel; Israeli, Hadar; Kalaora, Rinat; Lim, Lisha; Sade-Falk, Ofir; Shapira, Tal; Taha-Salaime, Leena; Tang, Hua; Yonath, Ada

    2016-01-01

    Most ribosomal antibiotics obstruct distinct ribosomal functions. In selected cases, in addition to paralyzing vital ribosomal tasks, some ribosomal antibiotics are involved in cellular regulation. Owing to the global rapid increase in the appearance of multi-drug resistance in pathogenic bacterial strains, and to the extremely slow progress in developing new antibiotics worldwide, it seems that, in addition to the traditional attempts at improving current antibiotics and the intensive screening for additional natural compounds, this field should undergo substantial conceptual revision. Here, we highlight several contemporary issues, including challenging the common preference of broad-range antibiotics; the marginal attention to alterations in the microbiome population resulting from antibiotics usage, and the insufficient awareness of ecological and environmental aspects of antibiotics usage. We also highlight recent advances in the identification of species-specific structural motifs that may be exploited for the design and the creation of novel, environmental friendly, degradable, antibiotic types, with a better distinction between pathogens and useful bacterial species in the microbiome. Thus, these studies are leading towards the design of “pathogen-specific antibiotics,” in contrast to the current preference of broad range antibiotics, partially because it requires significant efforts in speeding up the discovery of the unique species motifs as well as the clinical pathogen identification. PMID:27367739

  12. Constructing ribosomes along the Danube

    PubMed Central

    Warner, Jonathan R.

    2010-01-01

    The EMBO Conference on Ribosome Synthesis held last summer explored the latest breakthroughs in ribosome assembly and how it affects disease. Both of these topics have recently seen important advances that enlighten how almost 200 proteins cooperate to produce a ribosome and how the cell responds to a malfunction in this process. PMID:20010797

  13. Ribosome profiling reveals pervasive translation outside of annotated protein-coding genes.

    PubMed

    Ingolia, Nicholas T; Brar, Gloria A; Stern-Ginossar, Noam; Harris, Michael S; Talhouarne, Gaëlle J S; Jackson, Sarah E; Wills, Mark R; Weissman, Jonathan S

    2014-09-11

    Ribosome profiling suggests that ribosomes occupy many regions of the transcriptome thought to be noncoding, including 5' UTRs and long noncoding RNAs (lncRNAs). Apparent ribosome footprints outside of protein-coding regions raise the possibility of artifacts unrelated to translation, particularly when they occupy multiple, overlapping open reading frames (ORFs). Here, we show hallmarks of translation in these footprints: copurification with the large ribosomal subunit, response to drugs targeting elongation, trinucleotide periodicity, and initiation at early AUGs. We develop a metric for distinguishing between 80S footprints and nonribosomal sources using footprint size distributions, which validates the vast majority of footprints outside of coding regions. We present evidence for polypeptide production beyond annotated genes, including the induction of immune responses following human cytomegalovirus (HCMV) infection. Translation is pervasive on cytosolic transcripts outside of conserved reading frames, and direct detection of this expanded universe of translated products enables efforts at understanding how cells manage and exploit its consequences. PMID:25159147

  14. Pseudouridines and pseudouridine synthases of the ribosome.

    PubMed

    Ofengand, J; Malhotra, A; Remme, J; Gutgsell, N S; Del Campo, M; Jean-Charles, S; Peil, L; Kaya, Y

    2001-01-01

    psi are ubiquitous in ribosomal RNA. Eubacteria, Archaea, and eukaryotes all contain psi, although their number varies widely, with eukaryotes having the most. The small ribosomal subunit can apparently do without psi in some organisms, even though others have as many as 40 or more. Large subunits appear to need at least one psi but can have up to 50-60. psi is made by a set of site-specific enzymes in eubacteria, and in eukaryotes by a single enzyme complexed with auxiliary proteins and specificity-conferring guide RNAs. The mechanism is not known in Archaea, but based on an analysis of the kinds of psi synthases found in sequenced archaeal genomes, it is likely to involve use of guide RNAs. All psi synthases can be classified into one of four related groups, virtually all of which have a conserved aspartate residue in a conserved sequence motif. The aspartate is essential for psi formation in all twelve synthases examined so far. When the need for psi in E. coli was examined, the only synthase whose absence caused a major decrease in growth rate under normal conditions was RluD, the synthase that makes psi 1911, psi 1915, and psi 1917 in the helix 69 end-loop. This growth defect was the result of a major failure in assembly of the large ribosomal subunit. The defect could be prevented by supplying the rluD structural gene in trans, and also by providing a point mutant gene that made a synthase unable to make psi. Therefore, the RluD synthase protein appears to be directly involved in 50S subunit assembly, possibly as an RNA chaperone, and this activity is independent of its ability to form psi. This result is not without precedent. Depletion of PET56, a 2'-O-methyltransferase specific for G2251 (E. coli numbering) in yeast mitochondria virtually blocks 50S subunit assembly and mitochondrial function (Sirum-Connolly et al. 1995), but the methylation activity of the enzyme is not required (T. Mason, pers. comm.). The absence of FtsJ, a heat shock protein that makes

  15. Final pre-40S maturation depends on the functional integrity of the 60S subunit ribosomal protein L3.

    PubMed

    García-Gómez, Juan J; Fernández-Pevida, Antonio; Lebaron, Simon; Rosado, Iván V; Tollervey, David; Kressler, Dieter; de la Cruz, Jesús

    2014-03-01

    Ribosomal protein L3 is an evolutionarily conserved protein that participates in the assembly of early pre-60S particles. We report that the rpl3[W255C] allele, which affects the affinity and function of translation elongation factors, impairs cytoplasmic maturation of 20S pre-rRNA. This was not seen for other mutations in or depletion of L3 or other 60S ribosomal proteins. Surprisingly, pre-40S particles containing 20S pre-rRNA form translation-competent 80S ribosomes, and translation inhibition partially suppresses 20S pre-rRNA accumulation. The GTP-dependent translation initiation factor Fun12 (yeast eIF5B) shows similar in vivo binding to ribosomal particles from wild-type and rpl3[W255C] cells. However, the GTPase activity of eIF5B failed to stimulate processing of 20S pre-rRNA when assayed with ribosomal particles purified from rpl3[W255C] cells. We conclude that L3 plays an important role in the function of eIF5B in stimulating 3' end processing of 18S rRNA in the context of 80S ribosomes that have not yet engaged in translation. These findings indicate that the correct conformation of the GTPase activation region is assessed in a quality control step during maturation of cytoplasmic pre-ribosomal particles.

  16. Lateral gene transfer in eukaryotes.

    PubMed

    Andersson, J O

    2005-06-01

    Lateral gene transfer -- the transfer of genetic material between species -- has been acknowledged as a major mechanism in prokaryotic genome evolution for some time. Recently accumulating data indicate that the process also occurs in the evolution of eukaryotic genomes. However, there are large rate variations between groups of eukaryotes; animals and fungi seem to be largely unaffected, with a few exceptions, while lateral gene transfer frequently occurs in protists with phagotrophic lifestyles, possibly with rates comparable to prokaryotic organisms. Gene transfers often facilitate the acquisition of functions encoded in prokaryotic genomes by eukaryotic organisms, which may enable them to colonize new environments. Transfers between eukaryotes also occur, mainly into larger phagotrophic eukaryotes that ingest eukaryotic cells, but also between plant lineages. These findings have implications for eukaryotic genomic research in general, and studies of the origin and phylogeny of eukaryotes in particular.

  17. Isolation of ribosomes and polysomes.

    PubMed

    Rivera, Maria C; Maguire, Bruce; Lake, James A

    2015-03-01

    Here we describe a preparative differential centrifugation protocol for the isolation of ribosomes from a crude cell homogenate. The subcellular fraction obtained is enriched in ribosome monomers and polysomes. The protocol has been optimized for the homogenization and collection of the ribosomal fraction from prokaryotic cells, mammalian and plant tissues, reticulocytes, and chloroplasts. The quality of the ribosomal preparation is enhanced by the removal of the remaining cellular components and adsorbed proteins by pelleting through a sucrose cushion with a high concentration of monovalent salts, NH4Cl or KCl. The different components of the ribosomal fraction isolated using this protocol can be further purified by sucrose gradient centrifugation.

  18. Specialized yeast ribosomes: a customized tool for selective mRNA translation.

    PubMed

    Bauer, Johann W; Brandl, Clemens; Haubenreisser, Olaf; Wimmer, Bjoern; Weber, Manuela; Karl, Thomas; Klausegger, Alfred; Breitenbach, Michael; Hintner, Helmut; von der Haar, Tobias; Tuite, Mick F; Breitenbach-Koller, Lore

    2013-01-01

    Evidence is now accumulating that sub-populations of ribosomes - so-called specialized ribosomes - can favour the translation of subsets of mRNAs. Here we use a large collection of diploid yeast strains, each deficient in one or other copy of the set of ribosomal protein (RP) genes, to generate eukaryotic cells carrying distinct populations of altered 'specialized' ribosomes. We show by comparative protein synthesis assays that different heterologous mRNA reporters based on luciferase are preferentially translated by distinct populations of specialized ribosomes. These mRNAs include reporters carrying premature termination codons (PTC) thus allowing us to identify specialized ribosomes that alter the efficiency of translation termination leading to enhanced synthesis of the wild-type protein. This finding suggests that these strains can be used to identify novel therapeutic targets in the ribosome. To explore this further we examined the translation of the mRNA encoding the extracellular matrix protein laminin β3 (LAMB3) since a LAMB3-PTC mutant is implicated in the blistering skin disease Epidermolysis bullosa (EB). This screen identified specialized ribosomes with reduced levels of RP L35B as showing enhanced synthesis of full-length LAMB3 in cells expressing the LAMB3-PTC mutant. Importantly, the RP L35B sub-population of specialized ribosomes leave both translation of a reporter luciferase carrying a different PTC and bulk mRNA translation largely unaltered.

  19. Structural basis for stop codon recognition in eukaryotes.

    PubMed

    Brown, Alan; Shao, Sichen; Murray, Jason; Hegde, Ramanujan S; Ramakrishnan, V

    2015-08-27

    Termination of protein synthesis occurs when a translating ribosome encounters one of three universally conserved stop codons: UAA, UAG or UGA. Release factors recognize stop codons in the ribosomal A-site to mediate release of the nascent chain and recycling of the ribosome. Bacteria decode stop codons using two separate release factors with differing specificities for the second and third bases. By contrast, eukaryotes rely on an evolutionarily unrelated omnipotent release factor (eRF1) to recognize all three stop codons. The molecular basis of eRF1 discrimination for stop codons over sense codons is not known. Here we present cryo-electron microscopy (cryo-EM) structures at 3.5-3.8 Å resolution of mammalian ribosomal complexes containing eRF1 interacting with each of the three stop codons in the A-site. Binding of eRF1 flips nucleotide A1825 of 18S ribosomal RNA so that it stacks on the second and third stop codon bases. This configuration pulls the fourth position base into the A-site, where it is stabilized by stacking against G626 of 18S rRNA. Thus, eRF1 exploits two rRNA nucleotides also used during transfer RNA selection to drive messenger RNA compaction. In this compacted mRNA conformation, stop codons are favoured by a hydrogen-bonding network formed between rRNA and essential eRF1 residues that constrains the identity of the bases. These results provide a molecular framework for eukaryotic stop codon recognition and have implications for future studies on the mechanisms of canonical and premature translation termination.

  20. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  1. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  2. Ribosomes slide on lysine-encoding homopolymeric A stretches.

    PubMed

    Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel

    2015-01-01

    Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome 'sliding' represents an unexpected type of ribosome movement possible during translation.

  3. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  4. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  5. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  6. The Sec translocon mediated protein transport in prokaryotes and eukaryotes.

    PubMed

    Denks, Kärt; Vogt, Andreas; Sachelaru, Ilie; Petriman, Narcis-Adrian; Kudva, Renuka; Koch, Hans-Georg

    2014-01-01

    Protein transport via the Sec translocon represents an evolutionary conserved mechanism for delivering cytosolically-synthesized proteins to extra-cytosolic compartments. The Sec translocon has a three-subunit core, termed Sec61 in Eukaryotes and SecYEG in Bacteria. It is located in the endoplasmic reticulum of Eukaryotes and in the cytoplasmic membrane of Bacteria where it constitutes a channel that can be activated by multiple partner proteins. These partner proteins determine the mechanism of polypeptide movement across the channel. During SRP-dependent co-translational targeting, the ribosome threads the nascent protein directly into the Sec channel. This pathway is in Bacteria mainly dedicated for membrane proteins but in Eukaryotes also employed by secretory proteins. The alternative pathway, leading to post-translational translocation across the Sec translocon engages an ATP-dependent pushing mechanism by the motor protein SecA in Bacteria and a ratcheting mechanism by the lumenal chaperone BiP in Eukaryotes. Protein transport and biogenesis is also assisted by additional proteins at the lateral gate of SecY/Sec61α and in the lumen of the endoplasmic reticulum or in the periplasm of bacterial cells. The modular assembly enables the Sec complex to transport a vast array of substrates. In this review we summarize recent biochemical and structural information on the prokaryotic and eukaryotic Sec translocons and we describe the remarkably complex interaction network of the Sec complexes.

  7. A molecular time-scale for eukaryote evolution recalibrated with the continuous microfossil record

    PubMed Central

    Berney, Cédric; Pawlowski, Jan

    2006-01-01

    Recent attempts to establish a molecular time-scale of eukaryote evolution failed to provide a congruent view on the timing of the origin and early diversification of eukaryotes. The major discrepancies in molecular time estimates are related to questions concerning the calibration of the tree. To limit these uncertainties, we used here as a source of calibration points the rich and continuous microfossil record of dinoflagellates, diatoms and coccolithophorids. We calibrated a small-subunit ribosomal RNA tree of eukaryotes with four maximum and 22 minimum time constraints. Using these multiple calibration points in a Bayesian relaxed molecular clock framework, we inferred that the early radiation of eukaryotes occurred near the Mesoproterozoic–Neoproterozoic boundary, about 1100 million years ago. Our results indicate that most Proterozoic fossils of possible eukaryotic origin cannot be confidently assigned to extant lineages and should therefore not be used as calibration points in molecular dating. PMID:16822745

  8. Translational control by 5'-untranslated regions of eukaryotic mRNAs.

    PubMed

    Hinnebusch, Alan G; Ivanov, Ivaylo P; Sonenberg, Nahum

    2016-06-17

    The eukaryotic 5' untranslated region (UTR) is critical for ribosome recruitment to the messenger RNA (mRNA) and start codon choice and plays a major role in the control of translation efficiency and shaping the cellular proteome. The ribosomal initiation complex is assembled on the mRNA via a cap-dependent or cap-independent mechanism. We describe various mechanisms controlling ribosome scanning and initiation codon selection by 5' upstream open reading frames, translation initiation factors, and primary and secondary structures of the 5'UTR, including particular sequence motifs. We also discuss translational control via phosphorylation of eukaryotic initiation factor 2, which is implicated in learning and memory, neurodegenerative diseases, and cancer.

  9. Translational control by 5'-untranslated regions of eukaryotic mRNAs.

    PubMed

    Hinnebusch, Alan G; Ivanov, Ivaylo P; Sonenberg, Nahum

    2016-06-17

    The eukaryotic 5' untranslated region (UTR) is critical for ribosome recruitment to the messenger RNA (mRNA) and start codon choice and plays a major role in the control of translation efficiency and shaping the cellular proteome. The ribosomal initiation complex is assembled on the mRNA via a cap-dependent or cap-independent mechanism. We describe various mechanisms controlling ribosome scanning and initiation codon selection by 5' upstream open reading frames, translation initiation factors, and primary and secondary structures of the 5'UTR, including particular sequence motifs. We also discuss translational control via phosphorylation of eukaryotic initiation factor 2, which is implicated in learning and memory, neurodegenerative diseases, and cancer. PMID:27313038

  10. Mechanism of eIF6-mediated Inhibition of Ribosomal Subunit Joining*

    PubMed Central

    Gartmann, Marco; Blau, Michael; Armache, Jean-Paul; Mielke, Thorsten; Topf, Maya; Beckmann, Roland

    2010-01-01

    During the process of ribosomal assembly, the essential eukaryotic translation initiation factor 6 (eIF6) is known to act as a ribosomal anti-association factor. However, a molecular understanding of the anti-association activity of eIF6 is still missing. Here we present the cryo-electron microscopy reconstruction of a complex of the large ribosomal subunit with eukaryotic eIF6 from Saccharomyces cerevisiae. The structure reveals that the eIF6 binding site involves mainly rpL23 (L14p in Escherichia coli). Based on our structural data, we propose that the mechanism of the anti-association activity of eIF6 is based on steric hindrance of intersubunit bridge formation around the dynamic bridge B6. PMID:20356839

  11. Endosymbiotic theories for eukaryote origin.

    PubMed

    Martin, William F; Garg, Sriram; Zimorski, Verena

    2015-09-26

    For over 100 years, endosymbiotic theories have figured in thoughts about the differences between prokaryotic and eukaryotic cells. More than 20 different versions of endosymbiotic theory have been presented in the literature to explain the origin of eukaryotes and their mitochondria. Very few of those models account for eukaryotic anaerobes. The role of energy and the energetic constraints that prokaryotic cell organization placed on evolutionary innovation in cell history has recently come to bear on endosymbiotic theory. Only cells that possessed mitochondria had the bioenergetic means to attain eukaryotic cell complexity, which is why there are no true intermediates in the prokaryote-to-eukaryote transition. Current versions of endosymbiotic theory have it that the host was an archaeon (an archaebacterium), not a eukaryote. Hence the evolutionary history and biology of archaea increasingly comes to bear on eukaryotic origins, more than ever before. Here, we have compiled a survey of endosymbiotic theories for the origin of eukaryotes and mitochondria, and for the origin of the eukaryotic nucleus, summarizing the essentials of each and contrasting some of their predictions to the observations. A new aspect of endosymbiosis in eukaryote evolution comes into focus from these considerations: the host for the origin of plastids was a facultative anaerobe.

  12. Endosymbiotic theories for eukaryote origin

    PubMed Central

    Martin, William F.; Garg, Sriram; Zimorski, Verena

    2015-01-01

    For over 100 years, endosymbiotic theories have figured in thoughts about the differences between prokaryotic and eukaryotic cells. More than 20 different versions of endosymbiotic theory have been presented in the literature to explain the origin of eukaryotes and their mitochondria. Very few of those models account for eukaryotic anaerobes. The role of energy and the energetic constraints that prokaryotic cell organization placed on evolutionary innovation in cell history has recently come to bear on endosymbiotic theory. Only cells that possessed mitochondria had the bioenergetic means to attain eukaryotic cell complexity, which is why there are no true intermediates in the prokaryote-to-eukaryote transition. Current versions of endosymbiotic theory have it that the host was an archaeon (an archaebacterium), not a eukaryote. Hence the evolutionary history and biology of archaea increasingly comes to bear on eukaryotic origins, more than ever before. Here, we have compiled a survey of endosymbiotic theories for the origin of eukaryotes and mitochondria, and for the origin of the eukaryotic nucleus, summarizing the essentials of each and contrasting some of their predictions to the observations. A new aspect of endosymbiosis in eukaryote evolution comes into focus from these considerations: the host for the origin of plastids was a facultative anaerobe. PMID:26323761

  13. Structures and stabilization of kinetoplastid-specific split rRNAs revealed by comparing leishmanial and human ribosomes

    PubMed Central

    Zhang, Xing; Lai, Mason; Chang, Winston; Yu, Iris; Ding, Ke; Mrazek, Jan; Ng, Hwee L.; Yang, Otto O.; Maslov, Dmitri A.; Zhou, Z. Hong

    2016-01-01

    The recent success in ribosome structure determination by cryoEM has opened the door to defining structural differences between ribosomes of pathogenic organisms and humans and to understand ribosome-targeting antibiotics. Here, by direct electron-counting cryoEM, we have determined the structures of the Leishmania donovani and human ribosomes at 2.9 Å and 3.6 Å, respectively. Our structure of the leishmanial ribosome elucidates the organization of the six fragments of its large subunit rRNA (as opposed to a single 28S rRNA in most eukaryotes, including humans) and reveals atomic details of a unique 20 amino acid extension of the uL13 protein that pins down the ends of three of the rRNA fragments. The structure also fashions many large rRNA expansion segments. Direct comparison of our human and leishmanial ribosome structures at the decoding A-site sheds light on how the bacterial ribosome-targeting drug paromomycin selectively inhibits the eukaryotic L. donovani, but not human, ribosome. PMID:27752045

  14. Isolation of ribosomes by chromatography.

    PubMed

    Maguire, Bruce A

    2015-04-01

    Mixed-mode chromatography on cysteine-SulfoLink resin efficiently separates ribosomes from cell lysates and is particularly effective at rapidly removing endogenous proteases and nucleases, resulting in ribosomes of improved purity, integrity, and activity. Binding occurs partly by anion exchange of the RNA of the ribosomes, so that cells must be lysed in a buffer of moderate ionic strength (conductivity no more than 20 mS for chromatography of bacterial ribosomes) without any highly charged additives (e.g., heparin, which is used to inhibit RNases in yeast). A robust protocol for Escherichia coli is given here as an example.

  15. The Diversity of Eukaryotes.

    PubMed

    Patterson

    1999-10-01

    The discipline of evolutionary protistology has emerged in the past 30 yr. There is as yet no agreed view of how protists are interrelated or how they should be classified. The foundations of a stable taxonomic superstructure for the protists and other eukaryotes lie in cataloging the diversity of the major monophyletic lineages of these organisms. The use of common patterns of cell organization (ultrastructural identity) seems to provide us with the most robust hypotheses of such lineages. These lineages are placed in 71 groups without identifiable sister taxa. These groups are here referred to as "major building blocks." For the first time, the compositions, ultrastructural identities, synapomorphies (where available), and subgroups of the major building blocks are summarized. More than 200 further lineages without clear identities are listed. This catalog includes all known major elements of the comprehensive evolutionary tree of protists and eukaryotes. Different approaches among protistologists to issues of nomenclature, ranking, and definitions of these groups are discussed, with particular reference to two groups-the stramenopiles and the Archezoa. The concept of "extended in-group" is introduced to refer to in-groups and the most proximate sister group and to assist in identifying the hierarchical location of taxa.

  16. Following the signal sequence from ribosomal tunnel exit to signal recognition particle.

    PubMed

    Halic, Mario; Blau, Michael; Becker, Thomas; Mielke, Thorsten; Pool, Martin R; Wild, Klemens; Sinning, Irmgard; Beckmann, Roland

    2006-11-23

    Membrane and secretory proteins can be co-translationally inserted into or translocated across the membrane. This process is dependent on signal sequence recognition on the ribosome by the signal recognition particle (SRP), which results in targeting of the ribosome-nascent-chain complex to the protein-conducting channel at the membrane. Here we present an ensemble of structures at subnanometre resolution, revealing the signal sequence both at the ribosomal tunnel exit and in the bacterial and eukaryotic ribosome-SRP complexes. Molecular details of signal sequence interaction in both prokaryotic and eukaryotic complexes were obtained by fitting high-resolution molecular models. The signal sequence is presented at the ribosomal tunnel exit in an exposed position ready for accommodation in the hydrophobic groove of the rearranged SRP54 M domain. Upon ribosome binding, the SRP54 NG domain also undergoes a conformational rearrangement, priming it for the subsequent docking reaction with the NG domain of the SRP receptor. These findings provide the structural basis for improving our understanding of the early steps of co-translational protein sorting.

  17. Diverse roles of assembly factors revealed by structures of late nuclear pre-60S ribosomes.

    PubMed

    Wu, Shan; Tutuncuoglu, Beril; Yan, Kaige; Brown, Hailey; Zhang, Yixiao; Tan, Dan; Gamalinda, Michael; Yuan, Yi; Li, Zhifei; Jakovljevic, Jelena; Ma, Chengying; Lei, Jianlin; Dong, Meng-Qiu; Woolford, John L; Gao, Ning

    2016-05-25

    Ribosome biogenesis is a highly complex process in eukaryotes, involving temporally and spatially regulated ribosomal protein (r-protein) binding and ribosomal RNA remodelling events in the nucleolus, nucleoplasm and cytoplasm. Hundreds of assembly factors, organized into sequential functional groups, facilitate and guide the maturation process into productive assembly branches in and across different cellular compartments. However, the precise mechanisms by which these assembly factors function are largely unknown. Here we use cryo-electron microscopy to characterize the structures of yeast nucleoplasmic pre-60S particles affinity-purified using the epitope-tagged assembly factor Nog2. Our data pinpoint the locations and determine the structures of over 20 assembly factors, which are enriched in two areas: an arc region extending from the central protuberance to the polypeptide tunnel exit, and the domain including the internal transcribed spacer 2 (ITS2) that separates 5.8S and 25S ribosomal RNAs. In particular, two regulatory GTPases, Nog2 and Nog1, act as hub proteins to interact with multiple, distant assembly factors and functional ribosomal RNA elements, manifesting their critical roles in structural remodelling checkpoints and nuclear export. Moreover, our snapshots of compositionally and structurally different pre-60S intermediates provide essential mechanistic details for three major remodelling events before nuclear export: rotation of the 5S ribonucleoprotein, construction of the active centre and ITS2 removal. The rich structural information in our structures provides a framework to dissect molecular roles of diverse assembly factors in eukaryotic ribosome assembly.

  18. Diverse roles of assembly factors revealed by structures of late nuclear pre-60S ribosomes.

    PubMed

    Wu, Shan; Tutuncuoglu, Beril; Yan, Kaige; Brown, Hailey; Zhang, Yixiao; Tan, Dan; Gamalinda, Michael; Yuan, Yi; Li, Zhifei; Jakovljevic, Jelena; Ma, Chengying; Lei, Jianlin; Dong, Meng-Qiu; Woolford, John L; Gao, Ning

    2016-06-01

    Ribosome biogenesis is a highly complex process in eukaryotes, involving temporally and spatially regulated ribosomal protein (r-protein) binding and ribosomal RNA remodelling events in the nucleolus, nucleoplasm and cytoplasm. Hundreds of assembly factors, organized into sequential functional groups, facilitate and guide the maturation process into productive assembly branches in and across different cellular compartments. However, the precise mechanisms by which these assembly factors function are largely unknown. Here we use cryo-electron microscopy to characterize the structures of yeast nucleoplasmic pre-60S particles affinity-purified using the epitope-tagged assembly factor Nog2. Our data pinpoint the locations and determine the structures of over 20 assembly factors, which are enriched in two areas: an arc region extending from the central protuberance to the polypeptide tunnel exit, and the domain including the internal transcribed spacer 2 (ITS2) that separates 5.8S and 25S ribosomal RNAs. In particular, two regulatory GTPases, Nog2 and Nog1, act as hub proteins to interact with multiple, distant assembly factors and functional ribosomal RNA elements, manifesting their critical roles in structural remodelling checkpoints and nuclear export. Moreover, our snapshots of compositionally and structurally different pre-60S intermediates provide essential mechanistic details for three major remodelling events before nuclear export: rotation of the 5S ribonucleoprotein, construction of the active centre and ITS2 removal. The rich structural information in our structures provides a framework to dissect molecular roles of diverse assembly factors in eukaryotic ribosome assembly. PMID:27251291

  19. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript.

  20. Structural basis for stop codon recognition in eukaryotes

    PubMed Central

    Murray, Jason; Hegde, Ramanujan S.; Ramakrishnan, V.

    2015-01-01

    Termination of protein synthesis occurs when a translating ribosome encounters one of three universally conserved stop codons: UGA, UAA, or UAG. Release factors recognise stop codons in the ribosomal A site to mediate release of the nascent chain and recycling of the ribosome. Bacteria decode stop codons using two separate release factors with differing specificities for the second and third bases1. By contrast, eukaryotes rely on an evolutionarily unrelated omnipotent release factor (eRF1) to recognise all three stop codons2. The molecular basis of eRF1 discrimination for stop codons over sense codons is not known. Here, we present electron cryo-microscopy (cryo-EM) structures at 3.5 – 3.8 Å resolution of mammalian ribosomal complexes containing eRF1 interacting with each of the three stop codons in the A site. Binding of eRF1 flips nucleotide A1825 of 18S rRNA so that it stacks on the second and third stop codon bases. This configuration pulls the fourth position base into the A site, where it is stabilised by stacking against G626 of 18S rRNA. Thus, eRF1 exploits two rRNA nucleotides also used during tRNA selection to drive mRNA compaction. Stop codons are favoured in this compacted mRNA conformation by a hydrogen-bonding network with essential eRF1 residues that constrains the identity of the bases. These results provide a molecular framework for eukaryotic stop codon recognition and have implications for future studies on the mechanisms of canonical and premature translation termination3,4. PMID:26245381

  1. A novel Drosophila Minute locus ribosomal protein S13

    SciTech Connect

    Saeboe-Larssen, S.; Lambertsson, A.

    1996-06-01

    Minutes comprise >50 phenotypically similar Drosophila mutations believed to affect ribosomal protein genes. Common traits of the Minute phenotype are short and thin bristles, slow development, and recessive lethality. To further investigate the proposed Minute to ribosomal protein correspondence, loss-of-function Minute mutations were induced by P-element mutagenesis. Here, we report a previously undescribed Minute locus that maps to 32A on chromosome 2L; this Minute allele is named P(lacW)M(2)32A{sup 1} and the gene M(2)32A. Flies heterozygous for P(lacW)M(2)32A{sup 1} have a medium Minute phenotype. The gene interrupted by the P-element insertion was cloned. Sequence analyses revealed that it encodes the Drosophila homologue of eukaryotic ribosomal protein S13. It is a single-copy gene and the level of RPS13 transcript is reduced to {approximately}50% in P(lacW)M(2)32A{sup 1} heterozygotes. Both transcript level and phenotype are restored to wild type by remobilizing the P element, demonstrating that the mutation is caused by insertion of the P-element construct. These results further strengthen the notion that Minutes encode ribosomal proteins and demonstrate the P-element mutagenesis is a fruitful approach to use in these studies. 47 refs., 7 figs.

  2. Three distinct ribosome assemblies modulated by translation are the building blocks of polysomes.

    PubMed

    Viero, Gabriella; Lunelli, Lorenzo; Passerini, Andrea; Bianchini, Paolo; Gilbert, Robert J; Bernabò, Paola; Tebaldi, Toma; Diaspro, Alberto; Pederzolli, Cecilia; Quattrone, Alessandro

    2015-03-01

    Translation is increasingly recognized as a central control layer of gene expression in eukaryotic cells. The overall organization of mRNA and ribosomes within polysomes, as well as the possible role of this organization in translation are poorly understood. Here we show that polysomes are primarily formed by three distinct classes of ribosome assemblies. We observe that these assemblies can be connected by naked RNA regions of the transcript. We show that the relative proportions of the three classes of ribosome assemblies reflect, and probably dictate, the level of translational activity. These results reveal the existence of recurrent supra-ribosomal building blocks forming polysomes and suggest the presence of unexplored translational controls embedded in the polysome structure.

  3. Capillary electrophoresis of affinity complexes between subviral 80S particles of human rhinovirus and monoclonal antibody 2G2.

    PubMed

    Kremser, Leopold; Petsch, Martina; Blaas, Dieter; Kenndler, Ernst

    2006-07-01

    Human rhinoviruses (HRVs), the main etiologic agents of the common cold, transform into subviral B- or 80S particles (they sediment at 80S upon sucrose density gradient centrifugation) during infection and, in vitro, upon exposure to a temperature between 50 and 56 degrees C. With respect to the native virion they lack the genomic RNA and the viral capsid protein VP4. 80S particles are unstable and easily disintegrate into their components, VP1, VP2, and VP3 in buffers containing SDS. However, this detergent was found to be a necessary constituent of the BGE for the analysis of these viruses and their complexes with receptors and antibodies by CE. We here demonstrate that dodecylpoly(ethyleneglycol ether) (D-PEG) a nonionic detergent, is suitable for analysis of subviral particles as it preserves their integrity, in contrast to SDS. Electrophoresis of the 80S particles in borate buffer (pH 8.3, 100 mM) containing 10 mM D-PEG resulted in a well-defined electrophoretic peak. The identity of the peak was confirmed, among other means, by complexation with mAb 2G2, which recognizes a structural epitope exclusively present on subviral particles but not on native virus. Upon incubation of the 80S particles with mAb 2G2 the peak disappeared, but a new peak, attributed to the antibody complex emerged. The separation system allowed following the time course of the transformation of intact HRV serotype 2 into 80S particles upon incubation at temperatures between 40 and 65 degrees C. We also demonstrate that subviral particles derived from HRV2 labeled with the fluorescence dyes FITC or Cy3.5 were stable in the separation system containing D-PEG. Dye-modified particles were still recognized by mAb 2G2, suggesting that the exposed lysines that are derivatized by the reagent do not form part of the epitope of the antibody.

  4. Benthic eukaryotic diversity in the Guaymas Basin hydrothermal vent environment.

    PubMed

    Edgcomb, Virginia P; Kysela, David T; Teske, Andreas; de Vera Gomez, Alvin; Sogin, Mitchell L

    2002-05-28

    Molecular microbial ecology studies have revealed remarkable prokaryotic diversity in extreme hydrothermal marine environments. There are no comparable reports of culture-independent surveys of eukaryotic life in warm, anoxic marine sediments. By using sequence comparisons of PCR-amplified small subunit ribosomal RNAs, we characterized eukaryotic diversity in hydrothermal vent environments of Guaymas Basin in the Gulf of California. Many sequences from these anoxic sediments and the overlaying seawater represent previously uncharacterized protists, including early branching eukaryotic lineages or extended diversity within described taxa. At least two mechanisms, with overlapping consequences, account for the eukaryotic community structure of this environment. The adaptation to anoxic environments is evidenced by specific affinity of environmental sequences to aerotolerant anaerobic species in molecular trees. This pattern is superimposed against a background of widely distributed aerophilic and aerotolerant protists, some of which may migrate into and survive in the sediment whereas others (e.g., phototrophs) are simply deposited by sedimentary processes. In contrast, bacterial populations in these sediments are primarily characteristic of anoxic, reduced, hydrocarbon-rich sedimentary habitats.

  5. Benthic eukaryotic diversity in the Guaymas Basin hydrothermal vent environment

    PubMed Central

    Edgcomb, Virginia P.; Kysela, David T.; Teske, Andreas; de Vera Gomez, Alvin; Sogin, Mitchell L.

    2002-01-01

    Molecular microbial ecology studies have revealed remarkable prokaryotic diversity in extreme hydrothermal marine environments. There are no comparable reports of culture-independent surveys of eukaryotic life in warm, anoxic marine sediments. By using sequence comparisons of PCR-amplified small subunit ribosomal RNAs, we characterized eukaryotic diversity in hydrothermal vent environments of Guaymas Basin in the Gulf of California. Many sequences from these anoxic sediments and the overlaying seawater represent previously uncharacterized protists, including early branching eukaryotic lineages or extended diversity within described taxa. At least two mechanisms, with overlapping consequences, account for the eukaryotic community structure of this environment. The adaptation to anoxic environments is evidenced by specific affinity of environmental sequences to aerotolerant anaerobic species in molecular trees. This pattern is superimposed against a background of widely distributed aerophilic and aerotolerant protists, some of which may migrate into and survive in the sediment whereas others (e.g., phototrophs) are simply deposited by sedimentary processes. In contrast, bacterial populations in these sediments are primarily characteristic of anoxic, reduced, hydrocarbon-rich sedimentary habitats. PMID:12032339

  6. Parallel Structural Evolution of Mitochondrial Ribosomes and OXPHOS Complexes.

    PubMed

    van der Sluis, Eli O; Bauerschmitt, Heike; Becker, Thomas; Mielke, Thorsten; Frauenfeld, Jens; Berninghausen, Otto; Neupert, Walter; Herrmann, Johannes M; Beckmann, Roland

    2015-05-01

    The five macromolecular complexes that jointly mediate oxidative phosphorylation (OXPHOS) in mitochondria consist of many more subunits than those of bacteria, yet, it remains unclear by which evolutionary mechanism(s) these novel subunits were recruited. Even less well understood is the structural evolution of mitochondrial ribosomes (mitoribosomes): while it was long thought that their exceptionally high protein content would physically compensate for their uniquely low amount of ribosomal RNA (rRNA), this hypothesis has been refuted by structural studies. Here, we present a cryo-electron microscopy structure of the 73S mitoribosome from Neurospora crassa, together with genomic and proteomic analyses of mitoribosome composition across the eukaryotic domain. Surprisingly, our findings reveal that both structurally and compositionally, mitoribosomes have evolved very similarly to mitochondrial OXPHOS complexes via two distinct phases: A constructive phase that mainly acted early in eukaryote evolution, resulting in the recruitment of altogether approximately 75 novel subunits, and a reductive phase that acted during metazoan evolution, resulting in gradual length-reduction of mitochondrially encoded rRNAs and OXPHOS proteins. Both phases can be well explained by the accumulation of (slightly) deleterious mutations and deletions, respectively, in mitochondrially encoded rRNAs and OXPHOS proteins. We argue that the main role of the newly recruited (nuclear encoded) ribosomal- and OXPHOS proteins is to provide structural compensation to the mutationally destabilized mitochondrially encoded components. While the newly recruited proteins probably provide a selective advantage owing to their compensatory nature, and while their presence may have opened evolutionary pathways toward novel mitochondrion-specific functions, we emphasize that the initial events that resulted in their recruitment was nonadaptive in nature. Our framework is supported by population genetic

  7. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2010-09-14

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  8. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2009-10-27

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  9. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2009-11-17

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  10. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G

    2015-02-03

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  11. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2012-02-14

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  12. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2009-12-01

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  13. Expanding the eukaryotic genetic code

    SciTech Connect

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2013-01-22

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  14. Expanding the eukaryotic genetic code

    DOEpatents

    Chin, Jason W.; Cropp, T. Ashton; Anderson, J. Christopher; Schultz, Peter G.

    2012-05-08

    This invention provides compositions and methods for producing translational components that expand the number of genetically encoded amino acids in eukaryotic cells. The components include orthogonal tRNAs, orthogonal aminoacyl-tRNA synthetases, orthogonal pairs of tRNAs/synthetases and unnatural amino acids. Proteins and methods of producing proteins with unnatural amino acids in eukaryotic cells are also provided.

  15. Phylogenetic relationships of Cryptosporidium determined by ribosomal RNA sequence comparison.

    PubMed

    Johnson, A M; Fielke, R; Lumb, R; Baverstock, P R

    1990-04-01

    Reverse transcription of total cellular RNA was used to obtain a partial sequence of the small subunit ribosomal RNA of Cryptosporidium, a protist currently placed in the phylum Apicomplexa. The semi-conserved regions were aligned with homologous sequences in a range of other eukaryotes, and the evolutionary relationships of Cryptosporidium were determined by two different methods of phylogenetic analysis. The prokaryotes Escherichia coli and Halobacterium cuti were included as outgroups. The results do not show an especially close relationship of Cryptosporidium to other members of the phylum Apicomplexa. PMID:2332273

  16. Endosymbiosis and Eukaryotic Cell Evolution.

    PubMed

    Archibald, John M

    2015-10-01

    Understanding the evolution of eukaryotic cellular complexity is one of the grand challenges of modern biology. It has now been firmly established that mitochondria and plastids, the classical membrane-bound organelles of eukaryotic cells, evolved from bacteria by endosymbiosis. In the case of mitochondria, evidence points very clearly to an endosymbiont of α-proteobacterial ancestry. The precise nature of the host cell that partnered with this endosymbiont is, however, very much an open question. And while the host for the cyanobacterial progenitor of the plastid was undoubtedly a fully-fledged eukaryote, how - and how often - plastids moved from one eukaryote to another during algal diversification is vigorously debated. In this article I frame modern views on endosymbiotic theory in a historical context, highlighting the transformative role DNA sequencing played in solving early problems in eukaryotic cell evolution, and posing key unanswered questions emerging from the age of comparative genomics.

  17. Length-dependent translation of messenger RNA by ribosomes

    NASA Astrophysics Data System (ADS)

    Valleriani, Angelo; Zhang, Gong; Nagar, Apoorva; Ignatova, Zoya; Lipowsky, Reinhard

    2011-04-01

    A simple measure for the efficiency of protein synthesis by ribosomes is provided by the steady state amount of protein per messenger RNA (mRNA), the so-called translational ratio, which is proportional to the translation rate. Taking the degradation of mRNA into account, we show theoretically that both the translation rate and the translational ratio decrease with increasing mRNA length, in agreement with available experimental data for the prokaryote Escherichia coli. We also show that, compared to prokaryotes, mRNA degradation in eukaryotes leads to a less rapid decrease of the translational ratio. This finding is consistent with the fact that, compared to prokaryotes, eukaryotes tend to have longer proteins.

  18. Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

    PubMed Central

    Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.

    2014-01-01

    All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

  19. Sequential domain assembly of ribosomal protein S3 drives 40S subunit maturation

    PubMed Central

    Mitterer, Valentin; Murat, Guillaume; Réty, Stéphane; Blaud, Magali; Delbos, Lila; Stanborough, Tamsyn; Bergler, Helmut; Leulliot, Nicolas; Kressler, Dieter; Pertschy, Brigitte

    2016-01-01

    Eukaryotic ribosomes assemble by association of ribosomal RNA with ribosomal proteins into nuclear precursor particles, which undergo a complex maturation pathway coordinated by non-ribosomal assembly factors. Here, we provide functional insights into how successive structural re-arrangements in ribosomal protein S3 promote maturation of the 40S ribosomal subunit. We show that S3 dimerizes and is imported into the nucleus with its N-domain in a rotated conformation and associated with the chaperone Yar1. Initial assembly of S3 with 40S precursors occurs via its C-domain, while the N-domain protrudes from the 40S surface. Yar1 is replaced by the assembly factor Ltv1, thereby fixing the S3 N-domain in the rotated orientation and preventing its 40S association. Finally, Ltv1 release, triggered by phosphorylation, and flipping of the S3 N-domain into its final position results in the stable integration of S3. Such a stepwise assembly may represent a new paradigm for the incorporation of ribosomal proteins. PMID:26831757

  20. Cap-dependent translation is mediated by 'RNA looping' rather than 'ribosome scanning'.

    PubMed

    Jang, Sung Key; Paek, Ki Young

    2016-01-01

    The 40S ribosomal subunit cannot directly recognize the start codon of eukaryotic mRNAs. Instead, it recognizes the start codon after its association with the 5'-cap structure via translation initiation factors. Base-by-base inspection of the 5'UTR by a scanning ribosome is the generally accepted hypothesis of start codon selection. As part of an effort to confirm the underlying mechanism of start codon selection by the 40S ribosome, we investigated the role of eIF4G, which participates in the recruitment of 40S ribosomes to various translation enhancers, such as 5'-cap structure, poly(A) tail, and several internal ribosome entry sites. We found that an artificial translation factor composed of recombinant eIF4G fused with MS2 greatly enhanced translation of an upstream reporter gene when it was tethered to the 3'UTR. These data suggest that the 40S ribosome recruited to a translation enhancer can find the start codon by looping of the intervening RNA segment. The 'RNA-looping' hypothesis of translation start codon recognition was further supported by an analysis of the effect of 5'UTR length on translation efficiency and the mathematically predicted probability of RNA-loop-mediated interactions between the start codon and the 40S ribosome associated at the 5'-end. PMID:26515582

  1. A liaison between mTOR signaling, ribosome biogenesis and cancer☆

    PubMed Central

    Gentilella, Antonio; Kozma, Sara C.; Thomas, George

    2016-01-01

    The ability to translate genetic information into functional proteins is considered a landmark in evolution. Ribosomes have evolved to take on this responsibility and, although there are some differences in their molecular make-up, both prokaryotes and eukaryotes share a common structural architecture and similar underlying mechanisms of protein synthesis. Understanding ribosome function and biogenesis has been the focus of extensive research since the early days of their discovery. In the last decade however, new and unexpected roles have emerged that place deregulated ribosome biogenesis and protein synthesis at the crossroads of pathological settings, particularly cancer, revealing a set of novel cellular checkpoints. Moreover, it is also becoming evident that mTOR signaling, which regulates an array of anabolic processes, including ribosome biogenesis, is often exploited by cancer cells to sustain proliferation through the upregulation of global protein synthesis. The use of pharmacological agents that interfere with ribosome biogenesis and mTOR signaling has proven to be an effective strategy to control cancer development clinically. Here we discuss the most recent findings concerning the underlying mechanisms by which mTOR signaling controls ribosome production and the potential impact of ribosome bio-genesis in tumor development. This article is part of a Special Issue entitled: Translation and Cancer. PMID:25735853

  2. A liaison between mTOR signaling, ribosome biogenesis and cancer.

    PubMed

    Gentilella, Antonio; Kozma, Sara C; Thomas, George

    2015-07-01

    The ability to translate genetic information into functional proteins is considered a landmark in evolution. Ribosomes have evolved to take on this responsibility and, although there are some differences in their molecular make-up, both prokaryotes and eukaryotes share a common structural architecture and similar underlying mechanisms of protein synthesis. Understanding ribosome function and biogenesis has been the focus of extensive research since the early days of their discovery. In the last decade however, new and unexpected roles have emerged that place deregulated ribosome biogenesis and protein synthesis at the crossroads of pathological settings, particularly cancer, revealing a set of novel cellular checkpoints. Moreover, it is also becoming evident that mTOR signaling, which regulates an array of anabolic processes, including ribosome biogenesis, is often exploited by cancer cells to sustain proliferation through the upregulation of global protein synthesis. The use of pharmacological agents that interfere with ribosome biogenesis and mTOR signaling has proven to be an effective strategy to control cancer development clinically. Here we discuss the most recent findings concerning the underlying mechanisms by which mTOR signaling controls ribosome production and the potential impact of ribosome biogenesis in tumor development. This article is part of a Special Issue entitled: Translation and Cancer.

  3. A liaison between mTOR signaling, ribosome biogenesis and cancer.

    PubMed

    Gentilella, Antonio; Kozma, Sara C; Thomas, George

    2015-07-01

    The ability to translate genetic information into functional proteins is considered a landmark in evolution. Ribosomes have evolved to take on this responsibility and, although there are some differences in their molecular make-up, both prokaryotes and eukaryotes share a common structural architecture and similar underlying mechanisms of protein synthesis. Understanding ribosome function and biogenesis has been the focus of extensive research since the early days of their discovery. In the last decade however, new and unexpected roles have emerged that place deregulated ribosome biogenesis and protein synthesis at the crossroads of pathological settings, particularly cancer, revealing a set of novel cellular checkpoints. Moreover, it is also becoming evident that mTOR signaling, which regulates an array of anabolic processes, including ribosome biogenesis, is often exploited by cancer cells to sustain proliferation through the upregulation of global protein synthesis. The use of pharmacological agents that interfere with ribosome biogenesis and mTOR signaling has proven to be an effective strategy to control cancer development clinically. Here we discuss the most recent findings concerning the underlying mechanisms by which mTOR signaling controls ribosome production and the potential impact of ribosome biogenesis in tumor development. This article is part of a Special Issue entitled: Translation and Cancer. PMID:25735853

  4. Proteome distribution between nucleoplasm and nucleolus and its relation to ribosome biogenesis in Arabidopsis thaliana.

    PubMed

    Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian

    2016-01-01

    Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast. PMID:26980300

  5. Synchronization of Eukaryotic Flagella

    NASA Astrophysics Data System (ADS)

    Goldstein, Raymond E.

    2012-11-01

    From unicellular organisms as small as a few microns to the largest vertebrates on earth we find groups of beating flagella or cilia that exhibit striking spatio-temporal organization. This may take the form of precise frequency and phase locking as frequently found in the swimming of green algae, or beating with long-wavelength phase modulations known as metachronal waves, seen in ciliates and in our respiratory systems. The remarkable similarity in the underlying molecular structure of flagella across the whole eukaryotic world leads naturally to the hypothesis that a similarly universal mechanism might be responsible for synchronization. Although this mechanism is poorly understood, one appealing hypothesis is that it results from hydrodynamic interactions between flagella. In this talk I will describe a synthesis of recent experimental and theoretical studies of this issue that have provided the strongest evidence to date for the hydrodynamic origin of flagellar synchronization. At the unicellular level this includes studies of the beating of the two flagella of the wild type unicellular alga Chlamydomonas reinhardtii in their native state and under conditions of regrowth following autotomy, and of the flagellar dominance mutant ptx1, which displays unusual anti-phase synchronization. Analysis of the related multicellular organism Volvox carteri shows it to be an ideal model organism for the study of metachronal waves. Supported by BBSRC, EPSRC, ERC, and The Wellcome Trust.

  6. Evolution of the holozoan ribosome biogenesis regulon

    PubMed Central

    Brown, Seth J; Cole, Michael D; Erives, Albert J

    2008-01-01

    Background The ribosome biogenesis (RiBi) genes encode a highly-conserved eukaryotic set of nucleolar proteins involved in rRNA transcription, assembly, processing, and export from the nucleus. While the mode of regulation of this suite of genes has been studied in the yeast, Saccharomyces cerevisiae, how this gene set is coordinately regulated in the larger and more complex metazoan genomes is not understood. Results Here we present genome-wide analyses indicating that a distinct mode of RiBi regulation co-evolved with the E(CG)-binding, Myc:Max bHLH heterodimer complex in a stem-holozoan, the ancestor of both Metazoa and Choanoflagellata, the protozoan group most closely related to animals. These results show that this mode of regulation, characterized by an E(CG)-bearing core-promoter, is specific to almost all of the known genes involved in ribosome biogenesis in these genomes. Interestingly, this holozoan RiBi promoter signature is absent in nematode genomes, which have not only secondarily lost Myc but are marked by invariant cell lineages typically producing small body plans of 1000 somatic cells. Furthermore, a detailed analysis of 10 fungal genomes shows that this holozoan signature in RiBi genes is not found in hemiascomycete fungi, which evolved their own unique regulatory signature for the RiBi regulon. Conclusion These results indicate that a Myc regulon, which is activated in proliferating cells during normal development as well as during tumor progression, has primordial roots in the evolution of an inducible growth regime in a protozoan ancestor of animals. Furthermore, by comparing divergent bHLH repertoires, we conclude that regulation by Myc but not by other bHLH genes is responsible for the evolutionary maintenance of E(CG) sites across the RiBi suite of genes. PMID:18816399

  7. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  8. The Ribosomal Database Project (RDP).

    PubMed

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree.

  9. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    SciTech Connect

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S.

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  10. The kissing-loop T-shaped structure translational enhancer of Pea enation mosaic virus can bind simultaneously to ribosomes and a 5' proximal hairpin.

    PubMed

    Gao, Feng; Gulay, Suna P; Kasprzak, Wojciech; Dinman, Jonathan D; Shapiro, Bruce A; Simon, Anne E

    2013-11-01

    The Pea enation mosaic virus (PEMV) 3' translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5'-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5' and 3' PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3' translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2'-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5' hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5' end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation.

  11. Evolutionary analyses of the 12-kDa acidic ribosomal P-proteins reveal a distinct protein of higher plant ribosomes

    PubMed Central

    Szick, Kathleen; Springer, Mark; Bailey-Serres, Julia

    1998-01-01

    The P-protein complex of eukaryotic ribosomes forms a lateral stalk structure in the active site of the large ribosomal subunit and is thought to assist in the elongation phase of translation by stimulating GTPase activity of elongation factor-2 and removal of deacylated tRNA. The complex in animals, fungi, and protozoans is composed of the acidic phosphoproteins P0 (35 kDa), P1 (11–12 kDa), and P2 (11–12 kDa). Previously we demonstrated by protein purification and microsequencing that ribosomes of maize (Zea mays L.) contain P0, one type of P1, two types of P2, and a distinct P1/P2 type protein designated P3. Here we implemented distance matrices, maximum parsimony, and neighbor-joining analyses to assess the evolutionary relationships between the 12 kDa P-proteins of maize and representative eukaryotic species. The analyses identify P3, found to date only in mono- and dicotyledonous plants, as an evolutionarily distinct P-protein. Plants possess three distinct groups of 12 kDa P-proteins (P1, P2, and P3), whereas animals, fungi, and protozoans possess only two distinct groups (P1 and P2). These findings demonstrate that the P-protein complex has evolved into a highly divergent complex with respect to protein composition despite its critical position within the active site of the ribosome. PMID:9482893

  12. Eukaryotic Richness in the Abyss: Insights from Pyrotag Sequencing

    PubMed Central

    Pawlowski, Jan; Christen, Richard; Lecroq, Béatrice; Bachar, Dipankar; Shahbazkia, Hamid Reza; Amaral-Zettler, Linda; Guillou, Laure

    2011-01-01

    Background The deep sea floor is considered one of the most diverse ecosystems on Earth. Recent environmental DNA surveys based on clone libraries of rRNA genes confirm this observation and reveal a high diversity of eukaryotes present in deep-sea sediment samples. However, environmental clone-library surveys yield only a modest number of sequences with which to evaluate the diversity of abyssal eukaryotes. Methodology/Principal Findings Here, we examined the richness of eukaryotic DNA in deep Arctic and Southern Ocean samples using massively parallel sequencing of the 18S ribosomal RNA (rRNA) V9 hypervariable region. In very small volumes of sediments, ranging from 0.35 to 0.7 g, we recovered up to 7,499 unique sequences per sample. By clustering sequences having up to 3 differences, we observed from 942 to 1756 Operational Taxonomic Units (OTUs) per sample. Taxonomic analyses of these OTUs showed that DNA of all major groups of eukaryotes is represented at the deep-sea floor. The dinoflagellates, cercozoans, ciliates, and euglenozoans predominate, contributing to 17%, 16%, 10%, and 8% of all assigned OTUs, respectively. Interestingly, many sequences represent photosynthetic taxa or are similar to those reported from the environmental surveys of surface waters. Moreover, each sample contained from 31 to 71 different metazoan OTUs despite the small sample volume collected. This indicates that a significant faction of the eukaryotic DNA sequences likely do not belong to living organisms, but represent either free, extracellular DNA or remains and resting stages of planktonic species. Conclusions/Significance In view of our study, the deep-sea floor appears as a global DNA repository, which preserves genetic information about organisms living in the sediment, as well as in the water column above it. This information can be used for future monitoring of past and present environmental changes. PMID:21483744

  13. Origins of Eukaryotic Sexual Reproduction

    PubMed Central

    2014-01-01

    Sexual reproduction is a nearly universal feature of eukaryotic organisms. Given its ubiquity and shared core features, sex is thought to have arisen once in the last common ancestor to all eukaryotes. Using the perspectives of molecular genetics and cell biology, we consider documented and hypothetical scenarios for the instantiation and evolution of meiosis, fertilization, sex determination, uniparental inheritance of organelle genomes, and speciation. PMID:24591519

  14. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  15. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.

    PubMed

    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku

    2016-01-01

    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism. PMID:26646291

  16. Characterization of silk gland ribosomes from a bivoltine caddisfly, Stenopsyche marmorata: translational suppression of a silk protein in cold conditions.

    PubMed

    Nomura, Takaomi; Ito, Miho; Kanamori, Mai; Shigeno, Yuta; Uchiumi, Toshio; Arai, Ryoichi; Tsukada, Masuhiro; Hirabayashi, Kimio; Ohkawa, Kousaku

    2016-01-01

    Larval Stenopsyche marmorata constructs food capture nets and fixed retreats underwater using self-produced proteinaceous silk fibers. In the Chikuma River (Nagano Prefecture, Japan) S. marmorata has a bivoltine life cycle; overwintering larvae grow slowly with reduced net spinning activity in winter. We recently reported constant transcript abundance of S. marmorata silk protein 1 (Smsp-1), a core S. marmorata silk fiber component, in all seasons, implying translational suppression in the silk gland during winter. Herein, we prepared and characterized silk gland ribosomes from seasonally collected S. marmorata larvae. Ribosomes from silk glands immediately frozen in liquid nitrogen (LN2) after dissection exhibited comparable translation elongation activity in spring, summer, and autumn. Conversely, silk glands obtained in winter did not contain active ribosomes and Smsp-1. Ribosomes from silk glands immersed in ice-cold physiological saline solution for approximately 4 h were translationally inactive, despite summer collection and Smsp-1 expression. The ribosomal inactivation occurs because of defects in the formation of 80S ribosomes, presumably due to splitting of 60S subunits containing 28S rRNA with central hidden break, in response to cold stress. These results suggest a novel-type ribosome-regulated translation control mechanism.

  17. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  18. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  19. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  20. The RDP-II (Ribosomal Database Project).

    PubMed

    Maidak, B L; Cole, J R; Lilburn, T G; Parker, C T; Saxman, P R; Farris, R J; Garrity, G M; Olsen, G J; Schmidt, T M; Tiedje, J M

    2001-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [Nucleic Acids Res. (2000), 28, 173-174], continued during the past year to add new rRNA sequences to the aligned data and to improve the analysis commands. Release 8.0 (June 1, 2000) consisted of 16 277 aligned prokaryotic small subunit (SSU) rRNA sequences while the number of eukaryotic and mitochondrial SSU rRNA sequences in aligned form remained at 2055 and 1503, respectively. The number of prokaryotic SSU rRNA sequences more than doubled from the previous release 14 months earlier, and approximately 75% are longer than 899 bp. An RDP-II mirror site in Japan is now available (http://wdcm.nig.ac.jp/RDP/html/index.h tml). RDP-II provides aligned and annotated rRNA sequences, derived phylogenetic trees and taxonomic hierarchies, and analysis services through its WWW server (http://rdp.cme.msu.edu/). Analysis services include rRNA probe checking, approximate phylogenetic placement of user sequences, screening user sequences for possible chimeric rRNA sequences, automated alignment, production of similarity matrices and services to plan and analyze terminal restriction fragment polymorphism experiments. The RDP-II email address for questions and comments has been changed from curator@cme.msu.edu to rdpstaff@msu.edu.

  1. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.

    PubMed

    Scheel, Bettina M; Hausdorf, Bernhard

    2014-07-01

    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome. PMID:24631858

  2. Ribosomal profiling adds new coding sequences to the proteome.

    PubMed

    Mumtaz, Muhammad Ali S; Couso, Juan Pablo

    2015-12-01

    Next generation sequencing (NGS) has enabled an in-depth look into genes, transcripts and their translation at the genomic scale. The application of NGS sequencing of ribosome footprints (Ribo-Seq) reveals translation with single nucleotide (nt) resolution, through the deep sequencing of ribosome-bound fragments (RBFs). Some results of Ribo-Seq challenge our understanding of the protein-coding potential of the genome. Earlier bioinformatic approaches had shown the presence of hundreds of thousands of putative small ORFs (smORFs) in eukaryotic genomes, but they had been largely ignored due to their large numbers and difficulty in determining their translation and function. Ribo-Seq has revealed that hundreds of putative smORFs within previously assumed long non-coding RNAs (lncRNAs) and UTRs of canonical mRNAs are associated with ribosomes, appearing to be translated. Here we review some of the approaches used to define translation within Ribo-Seq experiments and the challenges in defining translation of these novel smORFs in lncRNAs and UTRs. We also look at some of the bioinformatic and biochemical approaches used to independently corroborate these exciting new findings and elucidate real translation events.

  3. Dynamic evolution of mitochondrial ribosomal proteins in Holozoa.

    PubMed

    Scheel, Bettina M; Hausdorf, Bernhard

    2014-07-01

    We studied the highly dynamic evolution of mitochondrial ribosomal proteins (MRPs) in Holozoa. Most major clades within Holozoa are characterized by gains and/or losses of MRPs. The usefulness of gains of MRPs as rare genomic changes in phylogenetics is undermined by the high frequency of secondary losses. However, phylogenetic analyses of the MRP sequences provide evidence for the Acrosomata hypothesis, a sister group relationship between Ctenophora and Bilateria. An extensive restructuring of the mitochondrial genome and, as a consequence, of the mitochondrial ribosomes occurred in the ancestor of metazoans. The last MRP genes encoded in the mitochondrial genome were either moved to the nuclear genome or were lost. The strong decrease in size of the mitochondrial genome was probably caused by selection for rapid replication of mitochondrial DNA during oogenesis in the metazoan ancestor. A phylogenetic analysis of MRPL56 sequences provided evidence for a horizontal gene transfer of the corresponding MRP gene between metazoans and Dictyostelidae (Amoebozoa). The hypothesis that the requisition of additional MRPs compensated for a loss of rRNA segments in the mitochondrial ribosomes is corroborated by a significant negative correlation between the number of MRPs and length of the rRNA. Newly acquired MRPs evolved faster than bacterial MRPs and positions in eukaryote-specific MRPs were more strongly affected by coevolution than positions in prokaryotic MRPs in accordance with the necessity to fit these proteins into the pre-existing structure of the mitoribosome.

  4. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  5. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  6. Hierarchical recruitment into nascent ribosomes of assembly factors required for 27SB pre-rRNA processing in Saccharomyces cerevisiae

    PubMed Central

    Talkish, Jason; Zhang, Jingyu; Jakovljevic, Jelena; Horsey, Edward W.; Woolford, John L.

    2012-01-01

    To better define the roles of assembly factors required for eukaryotic ribosome biogenesis, we have focused on one specific step in maturation of yeast 60 S ribosomal subunits: processing of 27SB pre-ribosomal RNA. At least 14 assembly factors, the ‘B-factor’ proteins, are required for this step. These include most of the major functional classes of assembly factors: RNA-binding proteins, scaffolding protein, DEAD-box ATPases and GTPases. We have investigated the mechanisms by which these factors associate with assembling ribosomes. Our data establish a recruitment model in which assembly of the B-factors into nascent ribosomes ultimately leads to the recruitment of the GTPase Nog2. A more detailed analysis suggests that this occurs in a hierarchical manner via two largely independent recruiting pathways that converge on Nog2. Understanding recruitment has allowed us to better determine the order of association of all assembly factors functioning in one step of ribosome assembly. Furthermore, we have identified a novel subcomplex composed of the B-factors Nop2 and Nip7. Finally, we identified a means by which this step in ribosome biogenesis is regulated in concert with cell growth via the TOR protein kinase pathway. Inhibition of TOR kinase decreases association of Rpf2, Spb4, Nog1 and Nog2 with pre-ribosomes. PMID:22735702

  7. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses1[OPEN

    PubMed Central

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng

    2016-01-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  8. Universal and domain-specific sequences in 23S–28S ribosomal RNA identified by computational phylogenetics

    PubMed Central

    Doris, Stephen M.; Smith, Deborah R.; Beamesderfer, Julia N.; Raphael, Benjamin J.; Nathanson, Judith A.; Gerbi, Susan A.

    2015-01-01

    Comparative analysis of ribosomal RNA (rRNA) sequences has elucidated phylogenetic relationships. However, this powerful approach has not been fully exploited to address ribosome function. Here we identify stretches of evolutionarily conserved sequences, which correspond with regions of high functional importance. For this, we developed a structurally aligned database, FLORA (full-length organismal rRNA alignment) to identify highly conserved nucleotide elements (CNEs) in 23S–28S rRNA from each phylogenetic domain (Eukarya, Bacteria, and Archaea). Universal CNEs (uCNEs) are conserved in sequence and structural position in all three domains. Those in regions known to be essential for translation validate our approach. Importantly, some uCNEs reside in areas of unknown function, thus identifying novel sequences of likely great importance. In contrast to uCNEs, domain-specific CNEs (dsCNEs) are conserved in just one phylogenetic domain. This is the first report of conserved sequence elements in rRNA that are domain-specific; they are largely a eukaryotic phenomenon. The locations of the eukaryotic dsCNEs within the structure of the ribosome suggest they may function in nascent polypeptide transit through the ribosome tunnel and in tRNA exit from the ribosome. Our findings provide insights and a resource for ribosome function studies. PMID:26283689

  9. Death of a dogma: eukaryotic mRNAs can code for more than one protein.

    PubMed

    Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier

    2016-01-01

    mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5' UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3' UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma.

  10. Death of a dogma: eukaryotic mRNAs can code for more than one protein.

    PubMed

    Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier

    2016-01-01

    mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5' UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3' UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. PMID:26578573

  11. Pan-eukaryote ITS2 homologies revealed by RNA secondary structure

    PubMed Central

    Coleman, Annette W.

    2007-01-01

    For evolutionary comparisons, phylogenetics and evaluation of potential interbreeding taxa of a species, various loci have served for animals and plants and protistans. One [second internal transcribed spacer (ITS2) of the nuclear ribosomal DNA] is highly suitable for all. Its sequence is species specific. It has already been used extensively and very successfully for plants and some protistans, and a few animals (where historically, the mitochondrial genes have dominated species studies). Despite initial impressions that ITS2 is too variable, it has proven to provide useful biological information at higher taxonomic levels, even across all eukaryotes, thanks to the conserved aspects of its transcript secondary structure. The review of all eukaryote groups reveals that ITS2 is expandable, but always retains in its RNA transcript a common core structure of two helices with hallmark characteristics important for ribosomal RNA processing. This aspect of its RNA transcript secondary structure can rescue difficult alignment problems, making the ITS2 a more powerful tool for phylogenetics. Equally important, the recognition of eukaryote-wide homology regions provides extensive and detailed information to test experimental studies of ribosomal rRNA processing. PMID:17459886

  12. Two-step model of stop codon recognition by eukaryotic release factor eRF1

    PubMed Central

    Kryuchkova, Polina; Grishin, Alexander; Eliseev, Boris; Karyagina, Anna; Frolova, Ludmila; Alkalaeva, Elena

    2013-01-01

    Release factor eRF1 plays a key role in the termination of protein synthesis in eukaryotes. The eRF1 consists of three domains (N, M and C) that perform unique roles in termination. Previous studies of eRF1 point mutants and standard/variant code eRF1 chimeras unequivocally demonstrated a direct involvement of the highly conserved N-domain motifs (NIKS, YxCxxxF and GTx) in stop codon recognition. In the current study, we extend this work by investigating the role of the 41 invariant and conserved N-domain residues in stop codon decoding by human eRF1. Using a combination of the conservative and non-conservative amino acid substitutions, we measured the functional activity of >80 mutant eRF1s in an in vitro reconstituted eukaryotic translation system and selected 15 amino acid residues essential for recognition of different stop codon nucleotides. Furthermore, toe-print analyses provide evidence of a conformational rearrangement of ribosomal complexes that occurs during binding of eRF1 to messenger RNA and reflects stop codon decoding activity of eRF1. Based on our experimental data and molecular modelling of the N-domain at the ribosomal A site, we propose a two-step model of stop codon decoding in the eukaryotic ribosome. PMID:23435318

  13. Death of a dogma: eukaryotic mRNAs can code for more than one protein

    PubMed Central

    Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier

    2016-01-01

    mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5′ UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3′ UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. PMID:26578573

  14. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  15. The evolution of the Vahlkampfiidae as deduced from 16S-like ribosomal RNA analysis.

    PubMed

    Hinkle, G; Sogin, M L

    1993-01-01

    The amoebae, a phenotypically diverse, paraphyletic group of protists, have been largely neglected by molecular phylogeneticists. To better understand the evolution of amoebae, we sequenced and analyzed the 16S-like ribosomal RNA genes of three vahlkampfiid amoebae: Paratetramitus jugosus, Tetramitus rostratus and Vahlkampfia lobospinosa. The Vahlkampfiidae lineage is monophyletic, branches early along the eukaryotic line of descent, and is not a close relative of the multicellular amoebae that also reversibly transform from amoebae to flagellates.

  16. Crystal Structure of Ribosome-Inactivating Protein Ricin A Chain in Complex with the C-Terminal Peptide of the Ribosomal Stalk Protein P2

    PubMed Central

    Shi, Wei-Wei; Tang, Yun-Sang; Sze, See-Yuen; Zhu, Zhen-Ning; Wong, Kam-Bo; Shaw, Pang-Chui

    2016-01-01

    Ricin is a type 2 ribosome-inactivating protein (RIP), containing a catalytic A chain and a lectin-like B chain. It inhibits protein synthesis by depurinating the N-glycosidic bond at α-sarcin/ricin loop (SRL) of the 28S rRNA, which thereby prevents the binding of elongation factors to the GTPase activation center of the ribosome. Here, we present the 1.6 Å crystal structure of Ricin A chain (RTA) complexed to the C-terminal peptide of the ribosomal stalk protein P2, which plays a crucial role in specific recognition of elongation factors and recruitment of eukaryote-specific RIPs to the ribosomes. Our structure reveals that the C-terminal GFGLFD motif of P2 peptide is inserted into a hydrophobic pocket of RTA, while the interaction assays demonstrate the structurally untraced SDDDM motif of P2 peptide contributes to the interaction with RTA. This interaction mode of RTA and P protein is in contrast to that with trichosanthin (TCS), Shiga-toxin (Stx) and the active form of maize RIP (MOD), implying the flexibility of the P2 peptide-RIP interaction, for the latter to gain access to ribosome. PMID:27754366

  17. Selective ribosome profiling as a tool to study the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes

    PubMed Central

    Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd

    2014-01-01

    A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347

  18. Selective ribosome profiling as a tool for studying the interaction of chaperones and targeting factors with nascent polypeptide chains and ribosomes.

    PubMed

    Becker, Annemarie H; Oh, Eugene; Weissman, Jonathan S; Kramer, Günter; Bukau, Bernd

    2013-11-01

    A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors and enzymes. Many factors act co-translationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling (RP)), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor-RNC interactions are stabilized by cross-linking; the resulting factor-RNC adducts are nuclease-treated to generate monosomes, and then they are affinity purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor (TF) and is readily adaptable to other co-translationally acting factors, including eukaryotic factors. Factor-RNC purification and sequencing library preparation takes 7-8 d, and sequencing and data analysis can be completed in 5-6 d.

  19. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  20. Drug resistance in eukaryotic microorganisms.

    PubMed

    Fairlamb, Alan H; Gow, Neil A R; Matthews, Keith R; Waters, Andrew P

    2016-06-24

    Eukaryotic microbial pathogens are major contributors to illness and death globally. Although much of their impact can be controlled by drug therapy as with prokaryotic microorganisms, the emergence of drug resistance has threatened these treatment efforts. Here, we discuss the challenges posed by eukaryotic microbial pathogens and how these are similar to, or differ from, the challenges of prokaryotic antibiotic resistance. The therapies used for several major eukaryotic microorganisms are then detailed, and the mechanisms that they have evolved to overcome these therapies are described. The rapid emergence of resistance and the restricted pipeline of new drug therapies pose considerable risks to global health and are particularly acute in the developing world. Nonetheless, we detail how the integration of new technology, biological understanding, epidemiology and evolutionary analysis can help sustain existing therapies, anticipate the emergence of resistance or optimize the deployment of new therapies.

  1. Drug resistance in eukaryotic microorganisms.

    PubMed

    Fairlamb, Alan H; Gow, Neil A R; Matthews, Keith R; Waters, Andrew P

    2016-01-01

    Eukaryotic microbial pathogens are major contributors to illness and death globally. Although much of their impact can be controlled by drug therapy as with prokaryotic microorganisms, the emergence of drug resistance has threatened these treatment efforts. Here, we discuss the challenges posed by eukaryotic microbial pathogens and how these are similar to, or differ from, the challenges of prokaryotic antibiotic resistance. The therapies used for several major eukaryotic microorganisms are then detailed, and the mechanisms that they have evolved to overcome these therapies are described. The rapid emergence of resistance and the restricted pipeline of new drug therapies pose considerable risks to global health and are particularly acute in the developing world. Nonetheless, we detail how the integration of new technology, biological understanding, epidemiology and evolutionary analysis can help sustain existing therapies, anticipate the emergence of resistance or optimize the deployment of new therapies. PMID:27572976

  2. The revised classification of eukaryotes.

    PubMed

    Adl, Sina M; Simpson, Alastair G B; Lane, Christopher E; Lukeš, Julius; Bass, David; Bowser, Samuel S; Brown, Matthew W; Burki, Fabien; Dunthorn, Micah; Hampl, Vladimir; Heiss, Aaron; Hoppenrath, Mona; Lara, Enrique; Le Gall, Line; Lynn, Denis H; McManus, Hilary; Mitchell, Edward A D; Mozley-Stanridge, Sharon E; Parfrey, Laura W; Pawlowski, Jan; Rueckert, Sonja; Shadwick, Laura; Shadwick, Lora; Schoch, Conrad L; Smirnov, Alexey; Spiegel, Frederick W

    2012-09-01

    This revision of the classification of eukaryotes, which updates that of Adl et al. [J. Eukaryot. Microbiol. 52 (2005) 399], retains an emphasis on the protists and incorporates changes since 2005 that have resolved nodes and branches in phylogenetic trees. Whereas the previous revision was successful in re-introducing name stability to the classification, this revision provides a classification for lineages that were then still unresolved. The supergroups have withstood phylogenetic hypothesis testing with some modifications, but despite some progress, problematic nodes at the base of the eukaryotic tree still remain to be statistically resolved. Looking forward, subsequent transformations to our understanding of the diversity of life will be from the discovery of novel lineages in previously under-sampled areas and from environmental genomic information.

  3. Apramycin Recognition by the Human Ribosomal Decoding Site

    SciTech Connect

    Hermann,T.; Tereshko, V.; Skripkin, E.; Patel, D.

    2007-01-01

    Aminoglycoside antibiotics bind specifically to the bacterial ribosomal decoding-site RNA and thereby interfere with fidelity but not efficiency of translation. Apramycin stands out among aminoglycosides for its mechanism of action which is based on blocking translocation and its ability to bind also to the eukaryotic decoding site despite differences in key residues required for apramycin recognition by the bacterial target. To elucidate molecular recognition of the eukaryotic decoding site by apramycin we have determined the crystal structure of an oligoribonucleotide containing the human sequence free and in complex with the antibiotic at 1.5 {angstrom} resolution. The drug binds in the deep groove of the RNA which forms a continuously stacked helix comprising non-canonical C{center_dot}A and G{center_dot}A base pairs and a bulged-out adenine. The binding mode of apramycin at the human decoding-site RNA is distinct from aminoglycoside recognition of the bacterial target, suggesting a molecular basis for the actions of apramycin in eukaryotes and bacteria.

  4. Structure of Monomeric Yeast and Mammalian Sec61 Complexes Interacting with the Translating Ribosome

    PubMed Central

    Becker, Thomas; Bhushan, Shashi; Jarasch, Alexander; Armache, Jean-Paul; Funes, Soledad; Jossinet, Fabrice; Gumbart, James; Mielke, Thorsten; Berninghausen, Otto; Schulten, Klaus; Westhof, Eric; Gilmore, Reid; Mandon, Elisabet; Beckmann, Roland

    2010-01-01

    The trimeric Sec61/SecY complex is a protein-conducting channel (PCC) for secretory and membrane proteins. Although Sec complexes can form oligomers, it has been suggested that a single copy may serve as an active PCC. We determined sub-nanometer resolution cryo-electron microscopy structures of eukaryotic ribosome-Sec61 complexes. In combination with biochemical data we found that in both idle and active states, the Sec complex is not oligomeric and interacts mainly via two cytoplasmic loops with the universal ribosomal adaptor site. In the active state the ribosomal tunnel and a central pore of the monomeric PCC were occupied by the nascent chain contacting loop 6 of the Sec complex. This provides a structural basis for the activity of a solitary Sec complex in cotranslational protein translocation. PMID:19933108

  5. The Drug Diazaborine Blocks Ribosome Biogenesis by Inhibiting the AAA-ATPase Drg1*

    PubMed Central

    Loibl, Mathias; Klein, Isabella; Prattes, Michael; Schmidt, Claudia; Kappel, Lisa; Zisser, Gertrude; Gungl, Anna; Krieger, Elmar; Pertschy, Brigitte; Bergler, Helmut

    2014-01-01

    The drug diazaborine is the only known inhibitor of ribosome biogenesis and specifically blocks large subunit formation in eukaryotic cells. However, the target of this drug and the mechanism of inhibition were unknown. Here we identify the AAA-ATPase Drg1 as a target of diazaborine. Inhibitor binding into the second AAA domain of Drg1 requires ATP loading and results in inhibition of ATP hydrolysis in this site. As a consequence the physiological activity of Drg1, i.e. the release of Rlp24 from pre-60S particles, is blocked, and further progression of cytoplasmic preribosome maturation is prevented. Our results identify the first target of an inhibitor of ribosome biogenesis and provide the mechanism of inhibition of a key step in large ribosomal subunit formation. PMID:24371142

  6. Synaptic view of eukaryotic cell

    NASA Astrophysics Data System (ADS)

    Baluška, František; Mancuso, Stefano

    2014-10-01

    Synapses are stable adhesive domains between two neighbouring cells of the multicellular organisms which serve for cell-cell communication as well as for information processing and storing. The synaptic concept was developed over more than 100 years specifically for neuronal cell-cell communication. In the last ten years, this concept was adapted to embrace other cell-cell communication phenomena. Here, we focus on the recently emerged phagocytic synapse and propose new endosymbiotic synapses and "intracellular organellar synapses". All these synapses of eukaryotic cells are in a good position to explain the high capacity of eukaryotic cells for integration of diverse signalling inputs into coherent cellular behaviour.

  7. The N-terminal extension of yeast ribosomal protein L8 is involved in two major remodeling events during late nuclear stages of 60S ribosomal subunit assembly.

    PubMed

    Tutuncuoglu, Beril; Jakovljevic, Jelena; Wu, Shan; Gao, Ning; Woolford, John L

    2016-09-01

    Assaying effects on pre-rRNA processing and ribosome assembly upon depleting individual ribosomal proteins (r-proteins) provided an initial paradigm for assembly of eukaryotic ribosomes in vivo-that each structural domain of ribosomal subunits assembles in a hierarchical fashion. However, two features suggest that a more complex pathway may exist: (i) Some r-proteins contain extensions that reach long distances across ribosomes to interact with multiple rRNA domains as well as with other r-proteins. (ii) Individual r-proteins may assemble in a stepwise fashion. For example, the globular domain of an r-protein might assemble separately from its extensions. Thus, these extensions might play roles in assembly that could not be revealed by depleting the entire protein. Here, we show that deleting or mutating extensions of r-proteins L7 (uL30) and L35 (uL29) from yeast reveal important roles in early and middle steps during 60S ribosomal subunit biogenesis. Detailed analysis of the N-terminal terminal extension of L8 (eL8) showed that it is necessary for late nuclear stages of 60S subunit assembly involving two major remodeling events: removal of the ITS2 spacer; and reorganization of the central protuberance (CP) containing 5S rRNA and r-proteins L5 (uL18) and L11 (uL5). Mutations in the L8 extension block processing of 7S pre-rRNA, prevent release of assembly factors Rpf2 and Rrs1 from pre-ribosomes, which is required for rotation of the CP, and block association of Sda1, the Rix1 complex, and the Rea1 ATPase involved in late steps of remodeling. PMID:27390266

  8. The N-terminal extension of yeast ribosomal protein L8 is involved in two major remodeling events during late nuclear stages of 60S ribosomal subunit assembly.

    PubMed

    Tutuncuoglu, Beril; Jakovljevic, Jelena; Wu, Shan; Gao, Ning; Woolford, John L

    2016-09-01

    Assaying effects on pre-rRNA processing and ribosome assembly upon depleting individual ribosomal proteins (r-proteins) provided an initial paradigm for assembly of eukaryotic ribosomes in vivo-that each structural domain of ribosomal subunits assembles in a hierarchical fashion. However, two features suggest that a more complex pathway may exist: (i) Some r-proteins contain extensions that reach long distances across ribosomes to interact with multiple rRNA domains as well as with other r-proteins. (ii) Individual r-proteins may assemble in a stepwise fashion. For example, the globular domain of an r-protein might assemble separately from its extensions. Thus, these extensions might play roles in assembly that could not be revealed by depleting the entire protein. Here, we show that deleting or mutating extensions of r-proteins L7 (uL30) and L35 (uL29) from yeast reveal important roles in early and middle steps during 60S ribosomal subunit biogenesis. Detailed analysis of the N-terminal terminal extension of L8 (eL8) showed that it is necessary for late nuclear stages of 60S subunit assembly involving two major remodeling events: removal of the ITS2 spacer; and reorganization of the central protuberance (CP) containing 5S rRNA and r-proteins L5 (uL18) and L11 (uL5). Mutations in the L8 extension block processing of 7S pre-rRNA, prevent release of assembly factors Rpf2 and Rrs1 from pre-ribosomes, which is required for rotation of the CP, and block association of Sda1, the Rix1 complex, and the Rea1 ATPase involved in late steps of remodeling.

  9. Interaction of neomycin with ribosomes and ribosomal ribonucleic acid.

    PubMed

    Dahlberg, A E; Horodyski, F; Keller, P

    1978-02-01

    Neomycin binds ribosomes and ribosomal ribonucleic acid (rRNA) in vivo and in vitro producing changes detectable by increases in gel electrophoretic mobility. These changes were observed in gels that contain ethylenediaminetetraacetic acid or no added magnesium ion. The progressive increase in gel electrophoretic mobility with increasing antibiotic concentrations suggests that neomycin is binding at multiple sites on RNA. The binding was reversible but sufficiently stable to survive dialysis and electrophoresis. It is proposed that bound neomycin stabilizes the ribosome and RNA structures, restricting the unfolding of the particles during electrophoresis and thus allowing for a more rapid migration in the gel. Gentamicin produced an effect similar to that of neomycin. Paromomycin, differing from neomycin by only one amino group, had considerably less effect on ribosome and rRNA mobilities. The binding of neomycin to rRNA improved the linearity of the plot of log molecular weight versus mobility and thus may be of benefit in providing a more accurate estimation of molecular weights of large RNAs.

  10. Ribosome Binding to a 5′ Translational Enhancer Is Altered in the Presence of the 3′ Untranslated Region in Cap-Independent Translation of Turnip Crinkle Virus ▿

    PubMed Central

    Stupina, Vera A.; Yuan, Xuefeng; Meskauskas, Arturas; Dinman, Jonathan D.; Simon, Anne E.

    2011-01-01

    Plus-strand RNA viruses without 5′ caps require noncanonical mechanisms for ribosome recruitment. A translational enhancer in the 3′ untranslated region (UTR) of Turnip crinkle virus (TCV) contains an internal T-shaped structure (TSS) that binds to 60S ribosomal subunits. We now report that the 63-nucleotide (nt) 5′ UTR of TCV contains a 19-nt pyrimidine-rich element near the initiation codon that supports translation of an internal open reading frame (ORF) independent of upstream 5′ UTR sequences. Addition of 80S ribosomes to the 5′ UTR reduced the flexibility of the polypyrimidine residues and generated a toeprint consistent with binding to this region. Binding of salt-washed 40S ribosomal subunits was reduced 6-fold when the pyrimidine-rich sequence was mutated. 40S subunit binding generated the same toeprint as 80S ribosomes but also additional ones near the 5′ end. Generation of out-of-frame AUGs upstream of the polypyrimidine region reduced translation, which suggests that 5′-terminal entry of 40S subunits is followed by scanning and that the polypyrimidine region is needed for an alternative function that requires ribosome binding. No evidence for RNA-RNA interactions between 5′ and 3′ sequences was found, suggesting that TCV utilizes an alternative means for circularizing its genome. Combining 5′ and 3′ UTR fragments in vitro had no discernible effect on the structures of the RNAs. In contrast, when 80S ribosomes were added to both fragments, structural changes were found in the 5′ UTR polypyrimidine tract that were not evident when ribosomes interacted with the individual fragments. This suggests that ribosomes can promote an interaction between the 5′ and 3′ UTRs of TCV. PMID:21389125

  11. Structure and dynamics of the mammalian ribosomal pre-translocation complex

    PubMed Central

    Budkevich, Tatyana; Giesebrecht, Jan; Altman, Roger B.; Munro, James B.; Mielke, Thorsten; Nierhaus, Knud H.; Blanchard, Scott C.; Spahn, Christian M.T.

    2011-01-01

    Although the structural core of the ribosome is conserved in all kingdoms of life, eukaryotic ribosomes are significantly larger and more complex than their bacterial counterparts. The extent to which these differences influence the molecular mechanism of translation remains elusive. Multiparticle cryo-electron microscopy and single-molecule FRET investigations of the mammalian pre-translocation complex reveal spontaneous, large-scale conformational changes including an inter-subunit rotation of the ribosomal subunits. Through structurally related processes, tRNA substrates oscillate between classical and at least two distinct hybrid configurations facilitated by localized changes in their L-shaped fold. Hybrid states are favoured within the mammalian complex. However, classical tRNA positions can be restored by tRNA binding to the E site or by the eukaryotic-specific antibiotic and translocation inhibitor, cycloheximide. These findings reveal critical distinctions in the structural and energetic features of bacterial and mammalian ribosomes, providing a mechanistic basis for divergent translation regulation strategies and species-specific antibiotic action. PMID:22017870

  12. Distinct types of translation termination generate substrates for ribosome-associated quality control.

    PubMed

    Shcherbik, Natalia; Chernova, Tatiana A; Chernoff, Yury O; Pestov, Dimitri G

    2016-08-19

    Cotranslational degradation of polypeptide nascent chains plays a critical role in quality control of protein synthesis and the rescue of stalled ribosomes. In eukaryotes, ribosome stalling triggers release of 60S subunits with attached nascent polypeptides, which undergo ubiquitination by the E3 ligase Ltn1 and proteasomal degradation facilitated by the ATPase Cdc48. However, the identity of factors acting upstream in this process is less clear. Here, we examined how the canonical release factors Sup45-Sup35 (eRF1-eRF3) and their paralogs Dom34-Hbs1 affect the total population of ubiquitinated nascent chains associated with yeast ribosomes. We found that the availability of the functional release factor complex Sup45-Sup35 strongly influences the amount of ubiquitinated polypeptides associated with 60S ribosomal subunits, while Dom34-Hbs1 generate 60S-associated peptidyl-tRNAs that constitute a relatively minor fraction of Ltn1 substrates. These results uncover two separate pathways that target nascent polypeptides for Ltn1-Cdc48-mediated degradation and suggest that in addition to canonical termination on stop codons, eukaryotic release factors contribute to cotranslational protein quality control. PMID:27325745

  13. Satratoxin G Interaction with 40S and 60S Ribosomal Subunits Precedes Apoptosis in the Macrophage

    PubMed Central

    Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul; Pestka, James J.

    2011-01-01

    Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultant fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min. and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis. PMID:19306889

  14. Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage

    SciTech Connect

    Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul; Pestka, James J.

    2009-06-01

    Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultant fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.

  15. Cytonuclear interactions and relaxed selection accelerate sequence evolution in organelle ribosomes.

    PubMed

    Sloan, Daniel B; Triant, Deborah A; Wu, Martin; Taylor, Douglas R

    2014-03-01

    Many mitochondrial and plastid protein complexes contain subunits that are encoded in different genomes. In animals, nuclear-encoded mitochondrial proteins often exhibit rapid sequence evolution, which has been hypothesized to result from selection for mutations that compensate for changes in interacting subunits encoded in mutation-prone animal mitochondrial DNA. To test this hypothesis, we analyzed nuclear genes encoding cytosolic and organelle ribosomal proteins in flowering plants. The model angiosperm genus Arabidopsis exhibits low organelle mutation rates, typical of most plants. Nevertheless, we found that (nuclear-encoded) subunits of organelle ribosomes in Arabidopsis have higher amino acid sequence polymorphism and divergence than their counterparts in cytosolic ribosomes, suggesting that organelle ribosomes experience relaxed functional constraint. However, the observed difference between organelle and cytosolic ribosomes was smaller than in animals and could be partially attributed to rapid evolution in N-terminal organelle-targeting peptides that are not involved in ribosome function. To test the role of organelle mutation more directly, we used transcriptomic data from an angiosperm genus (Silene) with highly variable rates of organelle genome evolution. We found that Silene species with unusually fast-evolving mitochondrial and plastid DNA exhibited increased amino acid sequence divergence in ribosomal proteins targeted to the organelles but not in those that function in cytosolic ribosomes. Overall, these findings support the hypothesis that rapid organelle genome evolution has selected for compensatory mutations in nuclear-encoded proteins. We conclude that coevolution between interacting subunits encoded in different genomic compartments within the eukaryotic cell is an important determinant of variation in rates of protein sequence evolution.

  16. Active eukaryotes in microbialites from Highborne Cay, Bahamas, and Hamelin Pool (Shark Bay), Australia.

    PubMed

    Edgcomb, Virginia P; Bernhard, Joan M; Summons, Roger E; Orsi, William; Beaudoin, David; Visscher, Pieter T

    2014-02-01

    Microbialites are organosedimentary structures that are formed through the interaction of benthic microbial communities and sediments and include mineral precipitation. These lithifying microbial mat structures include stromatolites and thrombolites. Exuma Sound in the Bahamas, and Hamelin Pool in Shark Bay, Western Australia, are two locations where significant stands of modern microbialites exist. Although prokaryotic diversity in these structures is reasonably well documented, little is known about the eukaryotic component of these communities and their potential to influence sedimentary fabrics through grazing, binding and burrowing activities. Accordingly, comparisons of eukaryotic communities in modern stromatolitic and thrombolitic mats can potentially provide insight into the coexistence of both laminated and clotted mat structures in close proximity to one another. Here we examine this possibility by comparing eukaryotic diversity based on Sanger and high-throughput pyrosequencing of small subunit ribosomal RNA (18S rRNA) genes. Analyses were based on total RNA extracts as template to minimize input from inactive or deceased organisms. Results identified diverse eukaryotic communities particularly stramenopiles, Alveolata, Metazoa, Amoebozoa and Rhizaria within different mat types at both locations, as well as abundant and diverse signatures of eukaryotes with <80% sequence similarity to sequences in GenBank. This suggests the presence of significant novel eukaryotic diversity, particularly in hypersaline Hamelin Pool. There was evidence of vertical structuring of protist populations and foraminiferal diversity was highest in bioturbated/clotted thrombolite mats of Highborne Cay.

  17. Active eukaryotes in microbialites from Highborne Cay, Bahamas, and Hamelin Pool (Shark Bay), Australia

    PubMed Central

    Edgcomb, Virginia P; Bernhard, Joan M; Summons, Roger E; Orsi, William; Beaudoin, David; Visscher, Pieter T

    2014-01-01

    Microbialites are organosedimentary structures that are formed through the interaction of benthic microbial communities and sediments and include mineral precipitation. These lithifying microbial mat structures include stromatolites and thrombolites. Exuma Sound in the Bahamas, and Hamelin Pool in Shark Bay, Western Australia, are two locations where significant stands of modern microbialites exist. Although prokaryotic diversity in these structures is reasonably well documented, little is known about the eukaryotic component of these communities and their potential to influence sedimentary fabrics through grazing, binding and burrowing activities. Accordingly, comparisons of eukaryotic communities in modern stromatolitic and thrombolitic mats can potentially provide insight into the coexistence of both laminated and clotted mat structures in close proximity to one another. Here we examine this possibility by comparing eukaryotic diversity based on Sanger and high-throughput pyrosequencing of small subunit ribosomal RNA (18S rRNA) genes. Analyses were based on total RNA extracts as template to minimize input from inactive or deceased organisms. Results identified diverse eukaryotic communities particularly stramenopiles, Alveolata, Metazoa, Amoebozoa and Rhizaria within different mat types at both locations, as well as abundant and diverse signatures of eukaryotes with <80% sequence similarity to sequences in GenBank. This suggests the presence of significant novel eukaryotic diversity, particularly in hypersaline Hamelin Pool. There was evidence of vertical structuring of protist populations and foraminiferal diversity was highest in bioturbated/clotted thrombolite mats of Highborne Cay. PMID:23924782

  18. Ribosomal oxygenases are structurally conserved from prokaryotes to humans.

    PubMed

    Chowdhury, Rasheduzzaman; Sekirnik, Rok; Brissett, Nigel C; Krojer, Tobias; Ho, Chia-Hua; Ng, Stanley S; Clifton, Ian J; Ge, Wei; Kershaw, Nadia J; Fox, Gavin C; Muniz, Joao R C; Vollmar, Melanie; Phillips, Claire; Pilka, Ewa S; Kavanagh, Kathryn L; von Delft, Frank; Oppermann, Udo; McDonough, Michael A; Doherty, Aidan J; Schofield, Christopher J

    2014-06-19

    2-Oxoglutarate (2OG)-dependent oxygenases have important roles in the regulation of gene expression via demethylation of N-methylated chromatin components and in the hydroxylation of transcription factors and splicing factor proteins. Recently, 2OG-dependent oxygenases that catalyse hydroxylation of transfer RNA and ribosomal proteins have been shown to be important in translation relating to cellular growth, TH17-cell differentiation and translational accuracy. The finding that ribosomal oxygenases (ROXs) occur in organisms ranging from prokaryotes to humans raises questions as to their structural and evolutionary relationships. In Escherichia coli, YcfD catalyses arginine hydroxylation in the ribosomal protein L16; in humans, MYC-induced nuclear antigen (MINA53; also known as MINA) and nucleolar protein 66 (NO66) catalyse histidine hydroxylation in the ribosomal proteins RPL27A and RPL8, respectively. The functional assignments of ROXs open therapeutic possibilities via either ROX inhibition or targeting of differentially modified ribosomes. Despite differences in the residue and protein selectivities of prokaryotic and eukaryotic ROXs, comparison of the crystal structures of E. coli YcfD and Rhodothermus marinus YcfD with those of human MINA53 and NO66 reveals highly conserved folds and novel dimerization modes defining a new structural subfamily of 2OG-dependent oxygenases. ROX structures with and without their substrates support their functional assignments as hydroxylases but not demethylases, and reveal how the subfamily has evolved to catalyse the hydroxylation of different residue side chains of ribosomal proteins. Comparison of ROX crystal structures with those of other JmjC-domain-containing hydroxylases, including the hypoxia-inducible factor asparaginyl hydroxylase FIH and histone N(ε)-methyl lysine demethylases, identifies branch points in 2OG-dependent oxygenase evolution and distinguishes between JmjC-containing hydroxylases and demethylases

  19. Slow growth and unstable ribosomal RNA lacking pseudouridine in mouse embryonic fibroblast cells expressing catalytically inactive dyskerin

    PubMed Central

    Gu, Bai-Wei; Ge, Jingping; Fan, Jian-Meng; Bessler, Monica; Mason, Philip J.

    2013-01-01

    Pseudouridine is the most abundant modified nucleotide in ribosomal RNA throughout eukaryotes and archaea but its role is not known. Here we produced mouse embryonic fibroblast cells expressing only catalytically inactive dyskerin, the pseudouridine synthase that converts uridine to pseudouridine in ribosomal RNA. The mutant dyskerin protein, D125A, was extremely unstable but cells were able to divide and grow very slowly. Abnormalities in ribosome RNA synthesis were apparent but mature cytoplasmic RNAs lacking pseudouridine were produced and were very unstable. We conclude that pseudouridine is required to stabilize the secondary structure of ribosomal RNA that is essential for its function. Structured summary of protein interactions∷ fibrillarin and Dkc1 colocalize by fluorescence microscopy (View interaction) PMID:23726835

  20. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  1. Changing ideas about eukaryotic origins.

    PubMed

    Williams, Tom A; Embley, T Martin

    2015-09-26

    The origin of eukaryotic cells is one of the most fascinating challenges in biology, and has inspired decades of controversy and debate. Recent work has led to major upheavals in our understanding of eukaryotic origins and has catalysed new debates about the roles of endosymbiosis and gene flow across the tree of life. Improved methods of phylogenetic analysis support scenarios in which the host cell for the mitochondrial endosymbiont was a member of the Archaea, and new technologies for sampling the genomes of environmental prokaryotes have allowed investigators to home in on closer relatives of founding symbiotic partners. The inference and interpretation of phylogenetic trees from genomic data remains at the centre of many of these debates, and there is increasing recognition that trees built using inadequate methods can prove misleading, whether describing the relationship of eukaryotes to other cells or the root of the universal tree. New statistical approaches show promise for addressing these questions but they come with their own computational challenges. The papers in this theme issue discuss recent progress on the origin of eukaryotic cells and genomes, highlight some of the ongoing debates, and suggest possible routes to future progress.

  2. Changing ideas about eukaryotic origins

    PubMed Central

    Williams, Tom A.; Embley, T. Martin

    2015-01-01

    The origin of eukaryotic cells is one of the most fascinating challenges in biology, and has inspired decades of controversy and debate. Recent work has led to major upheavals in our understanding of eukaryotic origins and has catalysed new debates about the roles of endosymbiosis and gene flow across the tree of life. Improved methods of phylogenetic analysis support scenarios in which the host cell for the mitochondrial endosymbiont was a member of the Archaea, and new technologies for sampling the genomes of environmental prokaryotes have allowed investigators to home in on closer relatives of founding symbiotic partners. The inference and interpretation of phylogenetic trees from genomic data remains at the centre of many of these debates, and there is increasing recognition that trees built using inadequate methods can prove misleading, whether describing the relationship of eukaryotes to other cells or the root of the universal tree. New statistical approaches show promise for addressing these questions but they come with their own computational challenges. The papers in this theme issue discuss recent progress on the origin of eukaryotic cells and genomes, highlight some of the ongoing debates, and suggest possible routes to future progress. PMID:26323752

  3. Eukaryotic organisms in Proterozoic oceans.

    PubMed

    Knoll, A H; Javaux, E J; Hewitt, D; Cohen, P

    2006-06-29

    The geological record of protists begins well before the Ediacaran and Cambrian diversification of animals, but the antiquity of that history, its reliability as a chronicle of evolution and the causal inferences that can be drawn from it remain subjects of debate. Well-preserved protists are known from a relatively small number of Proterozoic formations, but taphonomic considerations suggest that they capture at least broad aspects of early eukaryotic evolution. A modest diversity of problematic, possibly stem group protists occurs in ca 1800-1300 Myr old rocks. 1300-720 Myr fossils document the divergence of major eukaryotic clades, but only with the Ediacaran-Cambrian radiation of animals did diversity increase within most clades with fossilizable members. While taxonomic placement of many Proterozoic eukaryotes may be arguable, the presence of characters used for that placement is not. Focus on character evolution permits inferences about the innovations in cell biology and development that underpin the taxonomic and morphological diversification of eukaryotic organisms.

  4. The early eukaryotic fossil record.

    PubMed

    Javaux, Emmanuelle J

    2007-01-01

    The Precambrian era records the evolution of the domain Eucarya. Although the taxonomy of fossils is often impossible to resolve beyond the level of domain, their morphology and chemistry indicate the evolution of major biological innovations. The late Archean record for eukaryotes is limited to trace amounts of biomarkers. Morphological evidence appears in late Paleoproterozoic and early Mesoproterozoic (1800-1300 Ma) rocks. The moderate diversity of preservable eukaryotic organisms includes cell walls without surface ornament (but with complex ultrastructure), with regularly distributed surface ornamentation, and with irregularly or regularly arranged processes. Collectively, these fossils suggest that eukaryotes with flexible membranes and cytoskeletons existed in mid-Proterozoic oceans. The late Mesoproterozoic-early Neoproterozoic (1300-750 Ma) is a time of diversification and evolution when direct evidence for important biological innovations occurs in the fossil record such as multicellularity, sex, photosynthesis, biomineralization, predation, and heterotrophy. Members of extant clades can be recognized and include bangiophyte red algae, xanthophyte algae, cladophorale green algae, euglyphid, lobose, and filose amoebae and possible fungi. In the late Neoproterozoic, besides more diversification of ornamented fossils, florideophyte red algae and brown algae diversify, and animals take the stage. The record of biological innovations documented by the fossils shows that eukaryotes had evolved most cytological and molecular complexities very early in the Proterozoic but environmental conditions delayed their diversification within clades until oxygen level and predation pressure increased significantly. PMID:17977455

  5. Eukaryotic organisms in Proterozoic oceans

    PubMed Central

    Knoll, A.H; Javaux, E.J; Hewitt, D; Cohen, P

    2006-01-01

    The geological record of protists begins well before the Ediacaran and Cambrian diversification of animals, but the antiquity of that history, its reliability as a chronicle of evolution and the causal inferences that can be drawn from it remain subjects of debate. Well-preserved protists are known from a relatively small number of Proterozoic formations, but taphonomic considerations suggest that they capture at least broad aspects of early eukaryotic evolution. A modest diversity of problematic, possibly stem group protists occurs in ca 1800–1300 Myr old rocks. 1300–720 Myr fossils document the divergence of major eukaryotic clades, but only with the Ediacaran–Cambrian radiation of animals did diversity increase within most clades with fossilizable members. While taxonomic placement of many Proterozoic eukaryotes may be arguable, the presence of characters used for that placement is not. Focus on character evolution permits inferences about the innovations in cell biology and development that underpin the taxonomic and morphological diversification of eukaryotic organisms. PMID:16754612

  6. Snapshots of pre-rRNA structural flexibility reveal eukaryotic 40S assembly dynamics at nucleotide resolution

    PubMed Central

    Hector, Ralph D.; Burlacu, Elena; Aitken, Stuart; Bihan, Thierry Le; Tuijtel, Maarten; Zaplatina, Alina; Cook, Atlanta G.; Granneman, Sander

    2014-01-01

    Ribosome assembly in eukaryotes involves the activity of hundreds of assembly factors that direct the hierarchical assembly of ribosomal proteins and numerous ribosomal RNA folding steps. However, detailed insights into the function of assembly factors and ribosomal RNA folding events are lacking. To address this, we have developed ChemModSeq, a method that combines structure probing, high-throughput sequencing and statistical modeling, to quantitatively measure RNA structural rearrangements during the assembly of macromolecular complexes. By applying ChemModSeq to purified 40S assembly intermediates we obtained nucleotide-resolution maps of ribosomal RNA flexibility revealing structurally distinct assembly intermediates and mechanistic insights into assembly dynamics not readily observed in cryo-electron microscopy reconstructions. We show that RNA restructuring events coincide with the release of assembly factors and predict that completion of the head domain is required before the Rio1 kinase enters the assembly pathway. Collectively, our results suggest that 40S assembly factors regulate the timely incorporation of ribosomal proteins by delaying specific folding steps in the 3′ major domain of the 20S pre-ribosomal RNA. PMID:25200078

  7. Sequence of the 16S ribosomal RNA from Halobacterium volcanii, an archaebacterium

    NASA Technical Reports Server (NTRS)

    Gupta, R.; Lanter, J. M.; Woese, C. R.

    1983-01-01

    The sequence of the 16S ribosomal RNA (rRNA) from the archaebacterium Halobacterium volcanii has been determined by DNA sequencing methods. The archaebacterial rRNA is similar to its eubacterial counterpart in secondary structure. Although it is closer in sequence to the eubacterial 16S rRNA than to the eukaryotic 16S-like rRNA, the H. volcanii sequence also shows certain points of specific similarity to its eukaryotic counterpart. Since the H. volcanii sequence is closer to both the eubacterial and the eukaryotic sequences than these two are to one another, it follows that the archaebacterial sequence resembles their common ancestral sequence more closely than does either of the other two versions.

  8. The molecular structure of the left-handed supra-molecular helix of eukaryotic polyribosomes

    NASA Astrophysics Data System (ADS)

    Myasnikov, Alexander G.; Afonina, Zhanna A.; Ménétret, Jean-François; Shirokov, Vladimir A.; Spirin, Alexander S.; Klaholz, Bruno P.

    2014-11-01

    During protein synthesis, several ribosomes bind to a single messenger RNA (mRNA) forming large macromolecular assemblies called polyribosomes. Here we report the detailed molecular structure of a 100 MDa eukaryotic poly-ribosome complex derived from cryo electron tomography, sub-tomogram averaging and pseudo-atomic modelling by crystal structure fitting. The structure allowed the visualization of the three functional parts of the polysome assembly, the central core region that forms a rather compact left-handed supra-molecular helix, and the more open regions that harbour the initiation and termination sites at either ends. The helical region forms a continuous mRNA channel where the mRNA strand bridges neighbouring exit and entry sites of the ribosomes and prevents mRNA looping between ribosomes. This structure provides unprecedented insights into protein- and RNA-mediated inter-ribosome contacts that involve conserved sites through 40S subunits and long protruding RNA expansion segments, suggesting a role in stabilizing the overall polyribosomal assembly.

  9. The molecular structure of the left-handed supra-molecular helix of eukaryotic polyribosomes.

    PubMed

    Myasnikov, Alexander G; Afonina, Zhanna A; Ménétret, Jean-François; Shirokov, Vladimir A; Spirin, Alexander S; Klaholz, Bruno P

    2014-11-07

    During protein synthesis, several ribosomes bind to a single messenger RNA (mRNA) forming large macromolecular assemblies called polyribosomes. Here we report the detailed molecular structure of a 100 MDa eukaryotic poly-ribosome complex derived from cryo electron tomography, sub-tomogram averaging and pseudo-atomic modelling by crystal structure fitting. The structure allowed the visualization of the three functional parts of the polysome assembly, the central core region that forms a rather compact left-handed supra-molecular helix, and the more open regions that harbour the initiation and termination sites at either ends. The helical region forms a continuous mRNA channel where the mRNA strand bridges neighbouring exit and entry sites of the ribosomes and prevents mRNA looping between ribosomes. This structure provides unprecedented insights into protein- and RNA-mediated inter-ribosome contacts that involve conserved sites through 40S subunits and long protruding RNA expansion segments, suggesting a role in stabilizing the overall polyribosomal assembly.

  10. The ribosomal protein Asc1/RACK1 is required for efficient translation of short mRNAs

    PubMed Central

    Thompson, Mary K; Rojas-Duran, Maria F; Gangaramani, Paritosh; Gilbert, Wendy V

    2016-01-01

    Translation is a core cellular process carried out by a highly conserved macromolecular machine, the ribosome. There has been remarkable evolutionary adaptation of this machine through the addition of eukaryote-specific ribosomal proteins whose individual effects on ribosome function are largely unknown. Here we show that eukaryote-specific Asc1/RACK1 is required for efficient translation of mRNAs with short open reading frames that show greater than average translational efficiency in diverse eukaryotes. ASC1 mutants in S. cerevisiae display compromised translation of specific functional groups, including cytoplasmic and mitochondrial ribosomal proteins, and display cellular phenotypes consistent with their gene-specific translation defects. Asc1-sensitive mRNAs are preferentially associated with the translational ‘closed loop’ complex comprised of eIF4E, eIF4G, and Pab1, and depletion of eIF4G mimics the translational defects of ASC1 mutants. Together our results reveal a role for Asc1/RACK1 in a length-dependent initiation mechanism optimized for efficient translation of genes with important housekeeping functions. DOI: http://dx.doi.org/10.7554/eLife.11154.001 PMID:27117520

  11. Study of mammalian ribosomal protein reactivity in situ. II. - Effect of glutaraldehyde and salts.

    PubMed

    Reboud, A M; Buisson, M; Madjar, J J; Reboud, J P

    1975-01-01

    Results concerning ribosomal protein sensitivity to glutaraldehyde were compared to protein depletion studies using LiCl centrifugation. The relative degree of reactivity of the different proteins was determined by two-dimensional acrylamide gel electrophoresis, and the activity of the reacted subunits was measured. The results obtained mostly confirmed the studies of methoxynitrotropone reactivity reported earlier. For example, L16, L25, L29, L30, L31, S18, S20 appeared to be definitely exposed to both NH2-reagents and LiCl. Some interesting points emerged from this study regarding protein topography in both subunits: (1) with few exceptions, almost all ribosomal proteins were accessible to the surrounding medium; (2) the sensitivity of the 40S proteins to the three reagents used was lower than was that of the 60S proteins; (3) the reactivities of the subunit components changed when subunits were associated: L8 was more reactive with glutaraldehyde in 60S subunits than in 80S ribosomes. In contrast, S14, S15 and S19 were more exposed in ribosomes than in the 40S subunits.

  12. Evolution: Steps on the road to eukaryotes

    NASA Astrophysics Data System (ADS)

    Embley, T. Martin; Williams, Tom A.

    2015-05-01

    A new archaeal phylum represents the closest known relatives of eukaryotes, the group encompassing all organisms that have nucleated cells. The discovery holds promise for a better understanding of eukaryotic origins. See Article p.173

  13. Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.

    PubMed

    Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C

    2015-10-01

    The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a.

  14. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  15. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  16. The Synthesis of Ribosomes in E. coli

    PubMed Central

    Britten, R. J.; McCarthy, B. J.; Roberts, R. B.

    1962-01-01

    The incorporation of C14 leucine into the protein moiety of ribosomes has been studied as a sequel to the studies of ribosomal RNA synthesis. In contrast to the latter studies, labeled leucine is incorporated directly into 50S and 30S ribosomes without measurable delay by precursor stages. There is, however, evidence of some transfer of radioactivity from the 43S group of particles to the 50S. The inhibition of protein synthesis by chloramphenicol results in the accumulation of material similar to the eosome—the primary precursor in ribosome synthesis. There is also evidence for the synthesis of some neosome. The results of the studies of ribosomal RNA and protein synthesis are combined into a model of ribosome synthesis. Finally, consideration is made of the significance of these studies of ribosome synthesis for general problems of protein synthesis and information transfer. PMID:13873182

  17. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  18. Pathways to Specialized Ribosomes: The Brussels Lecture.

    PubMed

    Dinman, Jonathan D

    2016-05-22

    "Specialized ribosomes" is a topic of intense debate and research whose provenance can be traced to the earliest days of molecular biology. Here, the history of this idea is reviewed, and critical literature in which the specialized ribosomes have come to be presently defined is discussed. An argument supporting the evolution of a variety of ribosomes with specialized functions as a consequence of selective pressures acting on a near-infinite set of possible ribosomes is presented, leading to a discussion of how this may also serve as a biological buffering mechanism. The possible relationship between specialized ribosomes and human health is explored. A set of criteria and possible approaches are also presented to help guide the definitive identification of "specialized" ribosomes, and this is followed by a discussion of how synthetic biology approaches might be used to create new types of special ribosomes.

  19. Ribosomal targets for antibiotic drug discovery

    DOEpatents

    Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R

    2016-09-13

    The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.

  20. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  1. Pathways to Specialized Ribosomes: The Brussels Lecture.

    PubMed

    Dinman, Jonathan D

    2016-05-22

    "Specialized ribosomes" is a topic of intense debate and research whose provenance can be traced to the earliest days of molecular biology. Here, the history of this idea is reviewed, and critical literature in which the specialized ribosomes have come to be presently defined is discussed. An argument supporting the evolution of a variety of ribosomes with specialized functions as a consequence of selective pressures acting on a near-infinite set of possible ribosomes is presented, leading to a discussion of how this may also serve as a biological buffering mechanism. The possible relationship between specialized ribosomes and human health is explored. A set of criteria and possible approaches are also presented to help guide the definitive identification of "specialized" ribosomes, and this is followed by a discussion of how synthetic biology approaches might be used to create new types of special ribosomes. PMID:26764228

  2. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    PubMed

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. PMID:26709046

  3. PTRF/Cavin-1 promotes efficient ribosomal RNA transcription in response to metabolic challenges

    PubMed Central

    Liu, Libin; Pilch, Paul F

    2016-01-01

    Ribosomal RNA transcription mediated by RNA polymerase I represents the rate-limiting step in ribosome biogenesis. In eukaryotic cells, nutrients and growth factors regulate ribosomal RNA transcription through various key factors coupled to cell growth. We show here in mature adipocytes, ribosomal transcription can be acutely regulated in response to metabolic challenges. This acute response is mediated by PTRF (polymerase I transcription and release factor, also known as cavin-1), which has previously been shown to play a critical role in caveolae formation. The caveolae–independent rDNA transcriptional role of PTRF not only explains the lipodystrophy phenotype observed in PTRF deficient mice and humans, but also highlights its crucial physiological role in maintaining adipocyte allostasis. Multiple post-translational modifications of PTRF provide mechanistic bases for its regulation. The role of PTRF in ribosomal transcriptional efficiency is likely relevant to many additional physiological situations of cell growth and organismal metabolism. DOI: http://dx.doi.org/10.7554/eLife.17508.001 PMID:27528195

  4. The size and conformation of Artemia (brine-shrimp) ribosomal RNA free in solution.

    PubMed Central

    Donceel, K; Nieuwenhuysen, P; Clauwaert, J

    1982-01-01

    The RNA was isolated from the large ribosomal subunits of the brine shrimp Artemia, and its conformation free in solution was studied by determining its sedimentation and diffusion coefficients. A comparison was made of the hydrodynamic radius of the ribosomal subunit and its isolated RNA in various buffers. The conformation of the rRNA free in solution is more extended than when it is incorporated in the ribosome. This is not only the case when the rRNA solution lacks bivalent and polyvalent cations, but even in the presence of Mg2+ and spermidine, which cause a tightening of RNA. Thus the ribosomal proteins should induce a further tightening of the rRNA during the assembly of the ribosome. In the discussion, the reported data on Escherichia coli rRNA species are presented in such a way that large discrepancies between various studied are revealed, and that they can be compared with the data reported here on the larger rRNA of an eukaryote. PMID:7150228

  5. Through the '80s: thinking globally, acting locally. [Combined Canadian Futures Society and Third General Assembly of World Future Society

    SciTech Connect

    Feather, F.

    1980-01-01

    This volume was prepared in conjunction with the First Global Conference on the Future, held in Toronto, Canada, July 20-24, 1980. The conference combined the Third General Assembly of the World Future Society and the fifth annual conference of the Canadian Futures Society. The 59 papers presented here were selected from the very large number submitted to the conference committee; space limitations permitted only a small number of papers to be published in this volume. Included also are: the foreword, Mystery of the Future, by Edward R. Schreyer, Governor General of Canada; preface, A Time for Action, by Maurice F. Strong; introduction, Transition to Harmonic Globalism, by Frank Feather; conclusion, What We Must Do: An Agenda for Futurists; and postscript, The Challenge of the '80s, by Aurelio Peccei. The papers were presented under the following topics: The Trauma of Change (4); A Global Perspective (7); Inventorying Our Resources (7); The International Context (8); Economics: Getting Down to Business (9); Human Values: Personal, Social, Religious (6); Communications: Connecting Ourselves Together (4); Education: Learning to Meet Tomorrow (4); Health: New Approaches to Staying Fit (3); Futurism as a Way of Life (5); and Dreams into Action: Methods and Real-Life Experience (2).

  6. Conformation transitions of eukaryotic polyribosomes during multi-round translation.

    PubMed

    Afonina, Zhanna A; Myasnikov, Alexander G; Shirokov, Vladimir A; Klaholz, Bruno P; Spirin, Alexander S

    2015-01-01

    Using sedimentation and cryo electron tomography techniques, the conformations of eukaryotic polyribosomes formed in a long-term cell-free translation system were analyzed over all the active system lifetime (20-30 translation rounds during 6-8 h in wheat germ extract at 25°C). Three distinct types of the conformations were observed: (i) circular polyribosomes, varying from ring-shaped forms to circles collapsed into double rows, (ii) linear polyribosomes, tending to acquire planar zigzag-like forms and (iii) densely packed 3D helices. At the start, during the first two rounds of translation mostly the circular (ring-shaped and double-row) polyribosomes and the linear (free-shaped and zigzag-like) polyribosomes were formed ('juvenile phase'). The progressive loading of the polyribosomes with translating ribosomes induced the opening of the circular polyribosomes and the transformation of a major part of the linear polyribosomes into the dense 3D helices ('transitional phase'). After 2 h from the beginning (about 8-10 rounds of translation) this compact form of polyribosomes became predominant, whereas the circular and linear polyribosome fractions together contained less than half of polysomal ribosomes ('steady-state phase'). The latter proportions did not change for several hours. Functional tests showed a reduced translational activity in the fraction of the 3D helical polyribosomes.

  7. Hydrogenosomes: eukaryotic adaptations to anaerobic environments.

    PubMed

    Hackstein, J H; Akhmanova, A; Boxma, B; Harhangi, H R; Voncken, F G

    1999-11-01

    Like mitochondria, hydrogenosomes compartmentalize crucial steps of eukaryotic energy metabolism; however, this compartmentalization differs substantially between mitochondriate aerobes and hydrogenosome-containing anaerobes. Because hydrogenosomes have arisen independently in different lineages of eukaryotic microorganisms, comparative analysis of the various types of hydrogenosomes can provide insights into the functional and evolutionary aspects of compartmentalized energy metabolism in unicellular eukaryotes.

  8. The revised classification of eukaryotes

    PubMed Central

    Adl, Sina M.; Simpson, Alastair. G.; Lane, Christopher E.; Lukeš, Julius; Bass, David; Bowser, Samuel S.; Brown, Matt; Burki, Fabien; Dunthorn, Micah; Hampl, Vladimir; Heiss, Aaron; Hoppenrath, Mona; Lara, Enrique; leGall, Line; Lynn, Denis H.; McManus, Hilary; Mitchell, Edward A. D.; Mozley-Stanridge, Sharon E.; Parfrey, Laura Wegener; Pawlowski, Jan; Rueckert, Sonja; Shadwick, Lora; Schoch, Conrad; Smirnov, Alexey; Spiegel, Frederick W.

    2012-01-01

    This revision of the classification of eukaryotes, which updates that of Adl et al. (2005), retains an emphasis on the protists and incorporates changes since 2005 that have resolved nodes and branches in phylogenetic trees. Whereas the previous revision was successful in re-introducing name stability to the classification, this revision provides a classification for lineages that were then still unresolved. The supergroups have withstood phylogenetic hypothesis testing with some modifications, but despite some progress, problematic nodes at the base of the eukaryotic tree still remain to be statistically resolved. Looking forward, subsequent transformations to our understanding of the diversity of life will be from the discovery of novel lineages in previously under-sampled areas and from environmental genomic information. PMID:23020233

  9. The unusually long small subunit ribosomal RNA of Phreatamoeba balamuthi.

    PubMed Central

    Hinkle, G; Leipe, D D; Nerad, T A; Sogin, M L

    1994-01-01

    The small subunit ribosomal RNA (rRNA) of the anaerobic amoeba Phreatamoeba balamuthi is the longest 16S-like rRNA sequenced to date. Secondary structure analysis suggests that the additional sequence is incorporated in canonical eukaryotic expansion regions and is not due to the presence of introns. Reverse transcriptase sequencing of total RNA extracts confirmed that two uncommonly long expansion regions are present in native P. balamuthi 16S-like rRNA. Primary sequence comparison and similar secondary structure indicate a 61 base stem and loop repeat within an expansion region; a mechanism whereby the repeat may have been incorporated is presented. P. balamuthi provides further evidence that 16S-like rRNA length does not correlate with phylogenetic position. PMID:8127686

  10. Replicating Damaged DNA in Eukaryotes

    PubMed Central

    Chatterjee, Nimrat; Siede, Wolfram

    2013-01-01

    DNA damage is one of many possible perturbations that challenge the mechanisms that preserve genetic stability during the copying of the eukaryotic genome in S phase. This short review provides, in the first part, a general introduction to the topic and an overview of checkpoint responses. In the second part, the mechanisms of error-free tolerance in response to fork-arresting DNA damage will be discussed in some detail. PMID:24296172

  11. Replicating damaged DNA in eukaryotes.

    PubMed

    Chatterjee, Nimrat; Siede, Wolfram

    2013-12-01

    DNA damage is one of many possible perturbations that challenge the mechanisms that preserve genetic stability during the copying of the eukaryotic genome in S phase. This short review provides, in the first part, a general introduction to the topic and an overview of checkpoint responses. In the second part, the mechanisms of error-free tolerance in response to fork-arresting DNA damage will be discussed in some detail.

  12. Defensins: antifungal lessons from eukaryotes

    PubMed Central

    Silva, Patrícia M.; Gonçalves, Sónia; Santos, Nuno C.

    2014-01-01

    Over the last years, antimicrobial peptides (AMPs) have been the focus of intense research toward the finding of a viable alternative to current antifungal drugs. Defensins are one of the major families of AMPs and the most represented among all eukaryotic groups, providing an important first line of host defense against pathogenic microorganisms. Several of these cysteine-stabilized peptides present a relevant effect against fungi. Defensins are the AMPs with the broader distribution across all eukaryotic kingdoms, namely, Fungi, Plantae, and Animalia, and were recently shown to have an ancestor in a bacterial organism. As a part of the host defense, defensins act as an important vehicle of information between innate and adaptive immune system and have a role in immunomodulation. This multidimensionality represents a powerful host shield, hard for microorganisms to overcome using single approach resistance strategies. Pathogenic fungi resistance to conventional antimycotic drugs is becoming a major problem. Defensins, as other AMPs, have shown to be an effective alternative to the current antimycotic therapies, demonstrating potential as novel therapeutic agents or drug leads. In this review, we summarize the current knowledge on some eukaryotic defensins with antifungal action. An overview of the main targets in the fungal cell and the mechanism of action of these AMPs (namely, the selectivity for some fungal membrane components) are presented. Additionally, recent works on antifungal defensins structure, activity, and cytotoxicity are also reviewed. PMID:24688483

  13. Dosage Sensitivity of RPL9 and Concerted Evolution of Ribosomal Protein Genes in Plants

    PubMed Central

    Devis, Deborah; Firth, Sue M.; Liang, Zhe; Byrne, Mary E.

    2015-01-01

    The ribosome in higher eukaryotes is a large macromolecular complex composed of four rRNAs and eighty different ribosomal proteins. In plants, each ribosomal protein is encoded by multiple genes. Duplicate genes within a family are often necessary to provide a threshold dose of a ribosomal protein but in some instances appear to have non-redundant functions. Here, we addressed whether divergent members of the RPL9 gene family are dosage sensitive or whether these genes have non-overlapping functions. The RPL9 family in Arabidopsis thaliana comprises two nearly identical members, RPL9B and RPL9C, and a more divergent member, RPL9D. Mutations in RPL9C and RPL9D genes lead to delayed growth early in development, and loss of both genes is embryo lethal, indicating that these are dosage-sensitive and redundant genes. Phylogenetic analysis of RPL9 as well as RPL4, RPL5, RPL27a, RPL36a, and RPS6 family genes in the Brassicaceae indicated that multicopy ribosomal protein genes have been largely retained following whole genome duplication. However, these gene families also show instances of tandem duplication, small scale deletion, and evidence of gene conversion. Furthermore, phylogenetic analysis of RPL9 genes in angiosperm species showed that genes within a species are more closely related to each other than to RPL9 genes in other species, suggesting ribosomal protein genes undergo convergent evolution. Our analysis indicates that ribosomal protein gene retention following whole genome duplication contributes to the number of genes in a family. However, small scale rearrangements influence copy number and likely drive concerted evolution of these dosage-sensitive genes. PMID:26734020

  14. Reprogramming eukaryotic translation with ligand-responsive synthetic RNA switches.

    PubMed

    Anzalone, Andrew V; Lin, Annie J; Zairis, Sakellarios; Rabadan, Raul; Cornish, Virginia W

    2016-05-01

    Protein synthesis in eukaryotes is regulated by diverse reprogramming mechanisms that expand the coding capacity of individual genes. Here, we exploit one such mechanism, termed -1 programmed ribosomal frameshifting (-1 PRF), to engineer ligand-responsive RNA switches that regulate protein expression. First, efficient -1 PRF stimulatory RNA elements were discovered by in vitro selection; then, ligand-responsive switches were constructed by coupling -1 PRF stimulatory elements to RNA aptamers using rational design and directed evolution in Saccharomyces cerevisiae. We demonstrate that -1 PRF switches tightly control the relative stoichiometry of two distinct protein outputs from a single mRNA, exhibiting consistent ligand response across whole populations of cells. Furthermore, -1 PRF switches were applied to build single-mRNA logic gates and an apoptosis module in yeast. Together, these results showcase the potential for harnessing translation-reprogramming mechanisms for synthetic biology, and they establish -1 PRF switches as powerful RNA tools for controlling protein synthesis in eukaryotes. PMID:26999002

  15. Reprogramming Eukaryotic Translation with Ligand-Responsive Synthetic RNA Switches

    PubMed Central

    Anzalone, Andrew V.; Lin, Annie J.; Zairis, Sakellarios; Rabadan, Raul; Cornish, Virginia W.

    2016-01-01

    Protein synthesis in eukaryotes is regulated by diverse reprogramming mechanisms that expand the coding capacity of individual genes. Here, we exploit one such mechanism termed −1 programmed ribosomal frameshifting (−1 PRF) to engineer ligand-responsive RNA switches that regulate protein expression. First, efficient −1 PRF stimulatory RNA elements were discovered by in vitro selection; then, ligand-responsive switches were constructed by coupling −1 PRF stimulatory elements to RNA aptamers using rational design and in vivo directed evolution. We demonstrate that −1 PRF switches tightly control the relative stoichiometry of two distinct protein outputs from a single mRNA, exhibiting consistent ligand response across whole populations of cells. Furthermore, −1 PRF switches were applied to build single-mRNA logic gates and an apoptosis module in yeast. Together, these results showcase the potential for harnessing translation-reprogramming mechanisms for synthetic biology, and establish −1 PRF switches as powerful RNA tools for controlling protein synthesis in eukaryotes. PMID:26999002

  16. Genetic Diversity of Microbial Eukaryotes in Anoxic Sediment of the Saline Meromictic Lake Namako-ike (Japan): On the Detection of Anaerobic or Anoxic-tolerant Lineages of Eukaryotes.

    PubMed

    Takishita, Kiyotaka; Tsuchiya, Masashi; Kawato, Masaru; Oguri, Kazumasa; Kitazato, Hiroshi; Maruyama, Tadashi

    2007-01-01

    Available sequence data on eukaryotic small-subunit ribosomal DNA (SSU rDNA) directly retrieved from various environments have increased recently, and the diversity of microbial eukaryotes (protists) has been shown to be much greater than previously expected. However, the molecular information accumulated to date does still not thoroughly reveal ecological distribution patterns of microbial eukaryotes. In the ongoing challenge to detect anaerobic or anoxic-tolerant lineages of eukaryotes, we directly extracted DNA from the anoxic sediment of a saline meromictic lake, constructed genetic libraries of PCR-amplified SSU rDNA, and performed phylogenetic analyses with the cloned SSU rDNA sequences. Although a few sequences could not be confidently assigned to any major eukaryotic groups in the analyses and are debatable regarding their taxonomic positions, most sequences obtained have affiliations with known major lineages of eukaryotes (Cercozoa, Alveolata, Stramenopiles, and Opisthokonta). Among these sequences, some branched with lineages predominantly composed of uncultured environmental clones retrieved from other anoxic environments, while others were closely related to those of eukaryotic parasites (e.g. Phytomyxea of Cercozoa, Gregarinea of Alveolata, and Ichthyosporea of Opisthokonta).

  17. Changing perspectives on the origin of eukaryotes.

    PubMed

    Katz, L A

    1998-12-01

    From the initial application of molecular techniques to the study of microbial organisms, three domains of life emerged, with eukaryotes and archaea as sister taxa. However, recent analyses of an expanding molecular data set reveal that the eukaryotic genome is chimeric with respect to archaea and bacteria. Moreover, there is now evidence that the primitive eukaryotic group `Archezoa' once harbored mitochondia. These discoveries have challenged the traditional stepwise model of the evolution of eukaryotes, in which the nucleus and microtubules evolve before the acquisition of mitochondria, and consequently compel a revision of existing models of the origin of eukaryotic cells. PMID:21238406

  18. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    SciTech Connect

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-15

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Angstrom-Sign resolution.

  19. Crystallization of the two-domain N-terminal fragment of the archaeal ribosomal protein L10(P0) in complex with a specific fragment of 23S rRNA

    NASA Astrophysics Data System (ADS)

    Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.

    2011-07-01

    Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.

  20. Re-analysis of cryoEM data on HCV IRES bound to 40S subunit of human ribosome integrated with recent structural information suggests new contact regions between ribosomal proteins and HCV RNA

    PubMed Central

    Joseph, Agnel Praveen; Bhat, Prasanna; Das, Saumitra; Srinivasan, Narayanaswamy

    2014-01-01

    In this study, we combine available high resolution structural information on eukaryotic ribosomes with low resolution cryo-EM data on the Hepatitis C Viral RNA (IRES) human ribosome complex. Aided further by the prediction of RNA-protein interactions and restrained docking studies, we gain insights on their interaction at the residue level. We identified the components involved at the major and minor contact regions, and propose that there are energetically favorable local interactions between 40S ribosomal proteins and IRES domains. Domain II of the IRES interacts with ribosomal proteins S5 and S25 while the pseudoknot and the downstream domain IV region bind to ribosomal proteins S26, S28 and S5. We also provide support using UV cross-linking studies to validate our proposition of interaction between the S5 and IRES domains II and IV. We found that domain IIIe makes contact with the ribosomal protein S3a (S1e). Our model also suggests that the ribosomal protein S27 interacts with domain IIIc while S7 has a weak contact with a single base RNA bulge between junction IIIabc and IIId. The interacting residues are highly conserved among mammalian homologs while IRES RNA bases involved in contact do not show strict conservation. IRES RNA binding sites for S25 and S3a show the best conservation among related viral IRESs. The new contacts identified between ribosomal proteins and RNA are consistent with previous independent studies on RNA-binding properties of ribosomal proteins reported in literature, though information at the residue level is not available in previous studies. PMID:25268799

  1. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  2. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  3. Early-branching or fast-evolving eukaryotes? An answer based on slowly evolving positions.

    PubMed

    Philippe, H; Lopez, P; Brinkmann, H; Budin, K; Germot, A; Laurent, J; Moreira, D; Müller, M; Le Guyader, H

    2000-06-22

    The current paradigm of eukaryotic evolution is based primarily on comparative analysis of ribosomal RNA sequences. It shows several early-emerging lineages, mostly amitochondriate, which might be living relics of a progressive assembly of the eukaryotic cell. However, the analysis of slow-evolving positions, carried out with the newly developed slow-fast method, reveals that these lineages are, in terms of nucleotide substitution, fast-evolving ones, misplaced at the base of the tree by a long branch attraction artefact. Since the fast-evolving groups are not always the same, depending on which macromolecule is used as a marker, this explains most of the observed incongruent phylogenies. The current paradigm of eukaryotic evolution thus has to be seriously re-examined as the eukaryotic phylogeny is presently best summarized by a multifurcation. This is consistent with the Big Bang hypothesis that all extant eukaryotic lineages are the result of multiple cladogeneses within a relatively brief period, although insufficiency of data is also a possible explanation for the lack of resolution. For further resolution, rare evolutionary events such as shared insertions and/or deletions or gene fusions might be helpful.

  4. The twilight of Heliozoa and rise of Rhizaria, an emerging supergroup of amoeboid eukaryotes

    PubMed Central

    Nikolaev, Sergey I.; Berney, Cédric; Fahrni, José F.; Bolivar, Ignacio; Polet, Stephane; Mylnikov, Alexander P.; Aleshin, Vladimir V.; Petrov, Nikolai B.; Pawlowski, Jan

    2004-01-01

    Recent molecular phylogenetic studies revealed the extraordinary diversity of single-celled eukaryotes. However, the proper assessment of this diversity and accurate reconstruction of the eukaryote phylogeny are still impeded by the lack of molecular data for some major groups of easily identifiable and cultivable protists. Among them, amoeboid eukaryotes have been notably absent from molecular phylogenies, despite their diversity, complexity, and abundance. To partly fill this phylogenetic gap, we present here combined small-subunit ribosomal RNA and actin sequence data for the three main groups of “Heliozoa” (Actinophryida, Centrohelida, and Desmothoracida), the heliozoan-like Sticholonche, and the radiolarian group Polycystinea. Phylogenetic analyses of our sequences demonstrate the polyphyly of heliozoans, which branch either as an independent eukaryotic lineage (Centrohelida), within stramenopiles (Actinophryida), or among cercozoans (Desmothoracida), in broad agreement with previous ultrastructure-based studies. Our data also provide solid evidence for the existence of the Rhizaria, an emerging supergroup of mainly amoeboid eukaryotes that includes desmothoracid heliozoans, all radiolarians, Sticholonche, and foraminiferans, as well as various filose and reticulose amoebae and some flagellates. PMID:15148395

  5. The twilight of Heliozoa and rise of Rhizaria, an emerging supergroup of amoeboid eukaryotes.

    PubMed

    Nikolaev, Sergey I; Berney, Cédric; Fahrni, José F; Bolivar, Ignacio; Polet, Stephane; Mylnikov, Alexander P; Aleshin, Vladimir V; Petrov, Nikolai B; Pawlowski, Jan

    2004-05-25

    Recent molecular phylogenetic studies revealed the extraordinary diversity of single-celled eukaryotes. However, the proper assessment of this diversity and accurate reconstruction of the eukaryote phylogeny are still impeded by the lack of molecular data for some major groups of easily identifiable and cultivable protists. Among them, amoeboid eukaryotes have been notably absent from molecular phylogenies, despite their diversity, complexity, and abundance. To partly fill this phylogenetic gap, we present here combined small-subunit ribosomal RNA and actin sequence data for the three main groups of "Heliozoa" (Actinophryida, Centrohelida, and Desmothoracida), the heliozoan-like Sticholonche, and the radiolarian group Polycystinea. Phylogenetic analyses of our sequences demonstrate the polyphyly of heliozoans, which branch either as an independent eukaryotic lineage (Centrohelida), within stramenopiles (Actinophryida), or among cercozoans (Desmothoracida), in broad agreement with previous ultrastructure-based studies. Our data also provide solid evidence for the existence of the Rhizaria, an emerging supergroup of mainly amoeboid eukaryotes that includes desmothoracid heliozoans, all radiolarians, Sticholonche, and foraminiferans, as well as various filose and reticulose amoebae and some flagellates.

  6. Early-branching or fast-evolving eukaryotes? An answer based on slowly evolving positions.

    PubMed Central

    Philippe, H; Lopez, P; Brinkmann, H; Budin, K; Germot, A; Laurent, J; Moreira, D; Müller, M; Le Guyader, H

    2000-01-01

    The current paradigm of eukaryotic evolution is based primarily on comparative analysis of ribosomal RNA sequences. It shows several early-emerging lineages, mostly amitochondriate, which might be living relics of a progressive assembly of the eukaryotic cell. However, the analysis of slow-evolving positions, carried out with the newly developed slow-fast method, reveals that these lineages are, in terms of nucleotide substitution, fast-evolving ones, misplaced at the base of the tree by a long branch attraction artefact. Since the fast-evolving groups are not always the same, depending on which macromolecule is used as a marker, this explains most of the observed incongruent phylogenies. The current paradigm of eukaryotic evolution thus has to be seriously re-examined as the eukaryotic phylogeny is presently best summarized by a multifurcation. This is consistent with the Big Bang hypothesis that all extant eukaryotic lineages are the result of multiple cladogeneses within a relatively brief period, although insufficiency of data is also a possible explanation for the lack of resolution. For further resolution, rare evolutionary events such as shared insertions and/or deletions or gene fusions might be helpful. PMID:10902687

  7. Length variation in eukaryotic rRNAs: small subunit rRNAs from the protists Acanthamoeba castellanii and Euglena gracilis.

    PubMed

    Gunderson, J H; Sogin, M L

    1986-01-01

    We have sequenced the region of the Acanthamoeba castellanii ribosomal RNA transcription unit which encodes the mature small subunit ribosomal RNA (SSU rRNA). It, like the SSU rRNA coding regions of Euglena gracilis and kinetoplastids, is approx. 30% larger than those reported from other eukaryotes. The extra nucleotides are present in highly variable regions of the rRNA genes. Direct sequence analysis of the corresponding variable regions in the rRNA of A. castellanii and E. gracilis demonstrates that the extra nucleotides are present in the mature rRNA; no post-transcriptional modification of the rRNAs occurs to reduce them to a size more typical of eukaryotes. The extra elements present in the rRNAs of these two organisms are not homologous; they have independent evolutionary origins.

  8. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  9. An overabundance of phase 0 introns immediately after the start codon in eukaryotic genes

    PubMed Central

    Nielsen, Henrik; Wernersson, Rasmus

    2006-01-01

    Background A knowledge of the positions of introns in eukaryotic genes is important for understanding the evolution of introns. Despite this, there has been relatively little focus on the distribution of intron positions in genes. Results In proteins with signal peptides, there is an overabundance of phase 1 introns around the region of the signal peptide cleavage site. This has been described before. But in proteins without signal peptides, a novel phenomenon is observed: There is a sharp peak of phase 0 intron positions immediately following the start codon, i.e. between codons 1 and 2. This effect is seen in a wide range of eukaryotes: Vertebrates, arthropods, fungi, and flowering plants. Proteins carrying this start codon intron are found to comprise a special class of relatively short, lysine-rich and conserved proteins with an overrepresentation of ribosomal proteins. In addition, there is a peak of phase 0 introns at position 5 in Drosophila genes with signal peptides, predominantly representing cuticle proteins. Conclusion There is an overabundance of phase 0 introns immediately after the start codon in eukaryotic genes, which has been described before only for human ribosomal proteins. We give a detailed description of these start codon introns and the proteins that contain them. PMID:17034638

  10. Topology of mRNA chain in isolated eukaryotic double-row polyribosomes.

    PubMed

    Afonina, Zh A; Myasnikov, A G; Khabibullina, N F; Belorusova, A Yu; Menetret, J-F; Vasiliev, V D; Klaholz, B P; Shirokov, V A; Spirin, A S

    2013-05-01

    In the process of protein synthesis, the translating ribosomes of eukaryotic cells form polyribosomes that are found to be multiplex functional complexes possessing elements of ordered spatial organization. As revealed by a number of electron microscopy studies, the predominant visible configurations of the eukaryotic polyribosomes are circles (circular polyribosomes) and two-stranded formations (so-called double-row polyribosomes). The "long" (i.e. heavy loaded) polyribosomes are usually represented by double-row structures, which can be interpreted as either topologically circular ("collapsed rings"), or topologically linear (zigzags or helices). In the present work we have analyzed the mRNA path within the eukaryotic polyribosomes, isolated from a wheat germ cell-free translation system, by integrating two approaches: the visualization of mRNA ends in polyribosomes by marking them with gold nanoparticles (3'-end) and initiating 40S subunits (5'-end), as well as by the cryoelectron tomography. Examination of the location of the mRNA markers in polyribosomes and mutual orientation of ribosomes in them has shown that the double-row polyribosomes of the same sample can have both circular and linear arrangements of their mRNA.

  11. Arterio-Venous Fistula: Is it Critical for Prolonged Survival in the over 80's Starting Haemodialysis?

    PubMed Central

    Jakes, Adam D.; Jani, Poonam; Allgar, Victoria; Lamplugh, Archie; Zeidan, Ahmed; Bhandari, Sunil

    2016-01-01

    Background Dialysis in elderly patients (>80-years-old) carries a poor prognosis, but little is known about the most effective vascular access method in this age group. An arteriovenous fistula (AVF) is both time-consuming and initially expensive, requiring surgical insertion. A central venous catheter (CVC) is initially a cheaper alternative, but carries a higher risk of infection. We examined whether vascular access affected 1-year and 2-year mortality in elderly patients commencing haemodialysis. Methods Initial vascular access, demographic and survival data for elective haemodialysis patients >80-years was collated using regional databases. A cohort of conservatively managed patients was included for comparison. A log-rank test was used to compare survival between groups and a chi-square test was used to compare 1-year and 2-year survival. Results 167 patients (61% male) were included: CVC (101), AVF (25) and conservative management (41). Mean age (median) of starting haemodialysis (eGFR ≤10mL/min/1.73m2): CVC; 83.4 (2.3) and AVF; 82.3 (1.8). Mean age of conservatively managed patients reaching an eGFR ≤10mL/min/1.73m2 was 85.8 (3.6). Mean (median) survival on dialysis was 2.2 (1.8) years for AVF patients, 2.1 (1.2) for CVC patients, and 1.5 (0.9) for conservatively managed patients (p = 0.107, controlling for age/sex p = 0.519). 1-year and 2-year mortality: AVF (28%/52%); CVC (49%/57%), and conservative management (54%/68%). There was no significant difference between the groups at 1-year (p = 0.108) or 2-years (p = 0.355). Conclusion These results suggest that there is no significant survival benefit over a 2-year period when comparing vascular access methods. In comparison to conservative management, survival benefit was marginal. The decision of whether and how (choice of their vascular access method) to dialysis the over 80s is multifaceted and requires a tailored, multidisciplinary approach. PMID:27684071

  12. The nucleolus and transcription of ribosomal genes.

    PubMed

    Raska, Ivan; Koberna, Karel; Malínský, Jan; Fidlerová, Helena; Masata, Martin

    2004-10-01

    Ribosome biogenesis is a highly dynamic, steady-state nucleolar process that involves synthesis and maturation of rRNA, its transient interactions with non-ribosomal proteins and RNPs and assembly with ribosomal proteins. In the few years of the 21st century, an exciting progress in the molecular understanding of rRNA and ribosome biogenesis has taken place. In this review, we discuss the recent results on the regulation of rRNA synthesis in relation to the functional organization of the nucleolus, and put an emphasis on the situation encountered in mammalian somatic cells.

  13. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  14. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  15. Ribosomal stress activates eEF2K–eEF2 pathway causing translation elongation inhibition and recruitment of Terminal Oligopyrimidine (TOP) mRNAs on polysomes

    PubMed Central

    Gismondi, Angelo; Caldarola, Sara; Lisi, Gaia; Juli, Giada; Chellini, Lidia; Iadevaia, Valentina; Proud, Christopher G.; Loreni, Fabrizio

    2014-01-01

    The synthesis of adequate amounts of ribosomes is an essential task for the cell. It is therefore not surprising that regulatory circuits exist to organize the synthesis of ribosomal components. It has been shown that defect in ribosome biogenesis (ribosomal stress) induces apoptosis or cell cycle arrest through activation of the tumor suppressor p53. This mechanism is thought to be implicated in the pathophysiology of a group of genetic diseases such as Diamond Blackfan Anemia which are called ribosomopathies. We have identified an additional response to ribosomal stress that includes the activation of eukaryotic translation elongation factor 2 kinase with a consequent inhibition of translation elongation. This leads to a translational reprogramming in the cell that involves the structurally defined group of messengers called terminal oligopyrimidine (TOP) mRNAs which encode ribosomal proteins and translation factors. In fact, while general protein synthesis is decreased by the impairment of elongation, TOP mRNAs are recruited on polysomes causing a relative increase in the synthesis of TOP mRNA-encoded proteins compared to other proteins. Therefore, in response to ribosomal stress, there is a change in the translation pattern of the cell which may help restore a sufficient level of ribosomes. PMID:25332393

  16. Ribosomal stress activates eEF2K-eEF2 pathway causing translation elongation inhibition and recruitment of terminal oligopyrimidine (TOP) mRNAs on polysomes.

    PubMed

    Gismondi, Angelo; Caldarola, Sara; Lisi, Gaia; Juli, Giada; Chellini, Lidia; Iadevaia, Valentina; Proud, Christopher G; Loreni, Fabrizio

    2014-11-10

    The synthesis of adequate amounts of ribosomes is an essential task for the cell. It is therefore not surprising that regulatory circuits exist to organize the synthesis of ribosomal components. It has been shown that defect in ribosome biogenesis (ribosomal stress) induces apoptosis or cell cycle arrest through activation of the tumor suppressor p53. This mechanism is thought to be implicated in the pathophysiology of a group of genetic diseases such as Diamond Blackfan Anemia which are called ribosomopathies. We have identified an additional response to ribosomal stress that includes the activation of eukaryotic translation elongation factor 2 kinase with a consequent inhibition of translation elongation. This leads to a translational reprogramming in the cell that involves the structurally defined group of messengers called terminal oligopyrimidine (TOP) mRNAs which encode ribosomal proteins and translation factors. In fact, while general protein synthesis is decreased by the impairment of elongation, TOP mRNAs are recruited on polysomes causing a relative increase in the synthesis of TOP mRNA-encoded proteins compared to other proteins. Therefore, in response to ribosomal stress, there is a change in the translation pattern of the cell which may help restore a sufficient level of ribosomes. PMID:25332393

  17. The Structures of Antibiotics Bound to the E Site Region of the 50 S Ribosomal Subunit of Haloarcula marismortui: 13-Deoxytedanolide and Girodazole

    SciTech Connect

    Schroeder,S.; Blaha, G.; Tirado-Rives, J.; Steitz, T.; Moore, P.

    2007-01-01

    Crystal structures of the 50 S ribosomal subunit from Haloarcula marismortui complexed with two antibiotics have identified new sites at which antibiotics interact with the ribosome and inhibit protein synthesis. 13-Deoxytedanolide binds to the E site of the 50 S subunit at the same location as the CCA of tRNA, and thus appears to inhibit protein synthesis by competing with deacylated tRNAs for E site binding. Girodazole binds near the E site region, but is somewhat buried and may inhibit tRNA binding by interfering with conformational changes that occur at the E site. The specificity of 13-deoxytedanolide for eukaryotic ribosomes is explained by its extensive interactions with protein L44e, which is an E site component of archaeal and eukaryotic ribosomes, but not of eubacterial ribosomes. In addition, protein L28, which is unique to the eubacterial E site, overlaps the site occupied by 13-deoxytedanolide, precluding its binding to eubacterial ribosomes. Girodazole is specific for eukarytes and archaea because it makes interactions with L15 that are not possible in eubacteria.

  18. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  19. Signal processing in eukaryotic chemotaxis

    NASA Astrophysics Data System (ADS)

    Segota, Igor; Rachakonda, Archana; Franck, Carl

    2013-03-01

    Unlike inanimate condensed matter, living cells depend upon the detection of chemical signals for their existence. First, we experimentally determined the chemotaxis response of eukaryotic Dictyostelium cells to static folic acid gradients and show that they can respond to gradients as shallow as 0.2% across the cell body. Second, using Shannon's information theory, we showed that the information cells receive about the gradient exceeds the theoretically predicted information at the receptor-ligand binding step, resulting in the violation of the data processing inequality. Finally, we analyzed how eukaryotic cells can affect the gradient signals by secreting enzymes that degrade the signal. We analyzed this effect with a focus on a well described Dictyostelium cAMP chemotaxis system where cAMP signals are affected by an extracellular cAMP phosphodiesterase (PDE) and its inhibitor (PDI). Using a reaction-diffusion model of this set of interactions in the extracellular space, we show that cells can effectively sense much steeper chemical gradients than naively expected (up to a factor of 12). We also found that the rough estimates of experimental PDE and PDI secretion rates are close to the optimal values for gradient sensing as predicted by our model.

  20. Extrachromosomal elements in lower eukaryotes:

    SciTech Connect

    Wickner, R.B.; Hinnebusch, A.; Lambowitz, A.M.; Gunsalus, I.C.; Hollaender, A.

    1986-01-01

    While most genes are chromosomal, the nonchromosomal genes have played a disproportionate role in molecular biology, in part because of their easy accessibility and in part because they represent the most mobile portion of a cell's genome. Fungi, yeasts, protozoa, slime molds, algae, and other single-celled nucleated species, have recently gained dramatic popularity with the development of transformation methods for Saccharomyces, Neurospora, Schizosaccharomyces, Dictyostelium, and others of this group. The realization that Saccharomyces has oncogenes, RNA tumor viruses, intervening sequences, and all the mitotic, mitochondrial, and other structures typical of so-called ''higher'' eukaryotic organisms has confirmed the use of such organisms as model systems. Their use in biotechnology also shows great promise. The study in lower eukaryotes of mitochondria and chloroplasts has yielded many insights into similar structures in higher organisms as well as many unexpected finds, such as mechanisms of intron excision and the biology of introns, RNA catalysis, variation of the genetic code, and mechanisms of protein import across membranes.

  1. The global translation profile in a ribosomal protein mutant resembles that of an eIF3 mutant

    PubMed Central

    2013-01-01

    represent the first genome-wide analysis of translation in a eukaryote defective in the large ribosomal subunit. RPL24 and eIF3h play similar but non-identical roles in eukaryotic translation. The data also shed light on the fine structure of the regulon of ribosomal protein mRNAs. PMID:24377433

  2. The relative ages of eukaryotes and akaryotes.

    PubMed

    Penny, David; Collins, Lesley J; Daly, Toni K; Cox, Simon J

    2014-12-01

    The Last Eukaryote Common Ancestor (LECA) appears to have the genetics required for meiosis, mitosis, nucleus and nuclear substructures, an exon/intron gene structure, spliceosomes, many centres of DNA replication, etc. (and including mitochondria). Most of these features are not generally explained by models for the origin of the Eukaryotic cell based on the fusion of an Archeon and a Bacterium. We find that the term 'prokaryote' is ambiguous and the non-phylogenetic term akaryote should be used in its place because we do not yet know the direction of evolution between eukaryotes and akaryotes. We use the term 'protoeukaryote' for the hypothetical stem group ancestral eukaryote that took up a bacterium as an endosymbiont that formed the mitochondrion. It is easier to make detailed models with a eukaryote to an akaryote transition, rather than vice versa. So we really are at a phylogenetic impasse in not being confident about the direction of change between eukaryotes and akaryotes.

  3. Open Questions on the Origin of Eukaryotes.

    PubMed

    López-García, Purificación; Moreira, David

    2015-11-01

    Despite recent progress, the origin of the eukaryotic cell remains enigmatic. It is now known that the last eukaryotic common ancestor was complex and that endosymbiosis played a crucial role in eukaryogenesis at least via the acquisition of the alphaproteobacterial ancestor of mitochondria. However, the nature of the mitochondrial host is controversial, although the recent discovery of an archaeal lineage phylogenetically close to eukaryotes reinforces models proposing archaea-derived hosts. We argue that, in addition to improved phylogenomic analyses with more comprehensive taxon sampling to pinpoint the closest prokaryotic relatives of eukaryotes, determining plausible mechanisms and selective forces at the origin of key eukaryotic features, such as the nucleus or the bacterial-like eukaryotic membrane system, is essential to constrain existing models.

  4. A Eukaryote without a Mitochondrial Organelle.

    PubMed

    Karnkowska, Anna; Vacek, Vojtěch; Zubáčová, Zuzana; Treitli, Sebastian C; Petrželková, Romana; Eme, Laura; Novák, Lukáš; Žárský, Vojtěch; Barlow, Lael D; Herman, Emily K; Soukal, Petr; Hroudová, Miluše; Doležal, Pavel; Stairs, Courtney W; Roger, Andrew J; Eliáš, Marek; Dacks, Joel B; Vlček, Čestmír; Hampl, Vladimír

    2016-05-23

    The presence of mitochondria and related organelles in every studied eukaryote supports the view that mitochondria are essential cellular components. Here, we report the genome sequence of a microbial eukaryote, the oxymonad Monocercomonoides sp., which revealed that this organism lacks all hallmark mitochondrial proteins. Crucially, the mitochondrial iron-sulfur cluster assembly pathway, thought to be conserved in virtually all eukaryotic cells, has been replaced by a cytosolic sulfur mobilization system (SUF) acquired by lateral gene transfer from bacteria. In the context of eukaryotic phylogeny, our data suggest that Monocercomonoides is not primitively amitochondrial but has lost the mitochondrion secondarily. This is the first example of a eukaryote lacking any form of a mitochondrion, demonstrating that this organelle is not absolutely essential for the viability of a eukaryotic cell.

  5. A Eukaryote without a Mitochondrial Organelle.

    PubMed

    Karnkowska, Anna; Vacek, Vojtěch; Zubáčová, Zuzana; Treitli, Sebastian C; Petrželková, Romana; Eme, Laura; Novák, Lukáš; Žárský, Vojtěch; Barlow, Lael D; Herman, Emily K; Soukal, Petr; Hroudová, Miluše; Doležal, Pavel; Stairs, Courtney W; Roger, Andrew J; Eliáš, Marek; Dacks, Joel B; Vlček, Čestmír; Hampl, Vladimír

    2016-05-23

    The presence of mitochondria and related organelles in every studied eukaryote supports the view that mitochondria are essential cellular components. Here, we report the genome sequence of a microbial eukaryote, the oxymonad Monocercomonoides sp., which revealed that this organism lacks all hallmark mitochondrial proteins. Crucially, the mitochondrial iron-sulfur cluster assembly pathway, thought to be conserved in virtually all eukaryotic cells, has been replaced by a cytosolic sulfur mobilization system (SUF) acquired by lateral gene transfer from bacteria. In the context of eukaryotic phylogeny, our data suggest that Monocercomonoides is not primitively amitochondrial but has lost the mitochondrion secondarily. This is the first example of a eukaryote lacking any form of a mitochondrion, demonstrating that this organelle is not absolutely essential for the viability of a eukaryotic cell. PMID:27185558

  6. Open questions on the origin of eukaryotes

    PubMed Central

    López-García, Purificación; Moreira, David

    2015-01-01

    Despite recent progress, the origin of the eukaryotic cell remains enigmatic. It is now known that the last eukaryotic common ancestor was complex and that endosymbiosis played a crucial role in eukaryogenesis at least via the acquisition of the alphaproteobacterial ancestor of mitochondria. However, the nature of the mitochondrial host is controversial, although the recent discovery of an archaeal lineage phylogenetically close to eukaryotes reinforces models proposing archaea-derived hosts. We argue that, in addition to improved phylogenomic analyses with more comprehensive taxon sampling to pinpoint the closest prokaryotic relatives of eukaryotes, determining plausible mechanisms and selective forces at the origin of key eukaryotic features, such as the nucleus or the bacterial-like eukaryotic membrane system, is essential to constrain existing models. PMID:26455774

  7. The origin and diversification of eukaryotes: problems with molecular phylogenetics and molecular clock estimation

    PubMed Central

    Roger, Andrew J; Hug, Laura A

    2006-01-01

    Determining the relationships among and divergence times for the major eukaryotic lineages remains one of the most important and controversial outstanding problems in evolutionary biology. The sequencing and phylogenetic analyses of ribosomal RNA (rRNA) genes led to the first nearly comprehensive phylogenies of eukaryotes in the late 1980s, and supported a view where cellular complexity was acquired during the divergence of extant unicellular eukaryote lineages. More recently, however, refinements in analytical methods coupled with the availability of many additional genes for phylogenetic analysis showed that much of the deep structure of early rRNA trees was artefactual. Recent phylogenetic analyses of a multiple genes and the discovery of important molecular and ultrastructural phylogenetic characters have resolved eukaryotic diversity into six major hypothetical groups. Yet relationships among these groups remain poorly understood because of saturation of sequence changes on the billion-year time-scale, possible rapid radiations of major lineages, phylogenetic artefacts and endosymbiotic or lateral gene transfer among eukaryotes. Estimating the divergence dates between the major eukaryote lineages using molecular analyses is even more difficult than phylogenetic estimation. Error in such analyses comes from a myriad of sources including: (i) calibration fossil dates, (ii) the assumed phylogenetic tree, (iii) the nucleotide or amino acid substitution model, (iv) substitution number (branch length) estimates, (v) the model of how rates of evolution change over the tree, (vi) error inherent in the time estimates for a given model and (vii) how multiple gene data are treated. By reanalysing datasets from recently published molecular clock studies, we show that when errors from these various sources are properly accounted for, the confidence intervals on inferred dates can be very large. Furthermore, estimated dates of divergence vary hugely depending on the methods

  8. How and Why DNA Barcodes Underestimate the Diversity of Microbial Eukaryotes

    PubMed Central

    Piganeau, Gwenael; Eyre-Walker, Adam; Grimsley, Nigel; Moreau, Hervé

    2011-01-01

    Background Because many picoplanktonic eukaryotic species cannot currently be maintained in culture, direct sequencing of PCR-amplified 18S ribosomal gene DNA fragments from filtered sea-water has been successfully used to investigate the astounding diversity of these organisms. The recognition of many novel planktonic organisms is thus based solely on their 18S rDNA sequence. However, a species delimited by its 18S rDNA sequence might contain many cryptic species, which are highly differentiated in their protein coding sequences. Principal Findings Here, we investigate the issue of species identification from one gene to the whole genome sequence. Using 52 whole genome DNA sequences, we estimated the global genetic divergence in protein coding genes between organisms from different lineages and compared this to their ribosomal gene sequence divergences. We show that this relationship between proteome divergence and 18S divergence is lineage dependant. Unicellular lineages have especially low 18S divergences relative to their protein sequence divergences, suggesting that 18S ribosomal genes are too conservative to assess planktonic eukaryotic diversity. We provide an explanation for this lineage dependency, which suggests that most species with large effective population sizes will show far less divergence in 18S than protein coding sequences. Conclusions There is therefore a trade-off between using genes that are easy to amplify in all species, but which by their nature are highly conserved and underestimate the true number of species, and using genes that give a better description of the number of species, but which are more difficult to amplify. We have shown that this trade-off differs between unicellular and multicellular organisms as a likely consequence of differences in effective population sizes. We anticipate that biodiversity of microbial eukaryotic species is underestimated and that numerous “cryptic species” will become discernable with the future

  9. Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

    SciTech Connect

    Nishimura, Mitsuhiro; Kaminishi, Tatsuya; Kawazoe, Masahito; Shirouzu, Mikako; Takemoto, Chie; Yokoyama, Shigeyuki; Tanaka, Akiko; Sugano, Sumio; Yoshida, Takuya; Ohkubo, Tadayasu; Kobayashi, Yuji

    2007-11-01

    A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to space group P3{sub 1}21 or P3{sub 2}21.

  10. Asc1, homolog of human RACK1, prevents frameshifting in yeast by ribosomes stalled at CGA codon repeats.

    PubMed

    Wolf, Andrew S; Grayhack, Elizabeth J

    2015-05-01

    Quality control systems monitor and stop translation at some ribosomal stalls, but it is unknown if halting translation at such stalls actually prevents synthesis of abnormal polypeptides. In yeast, ribosome stalling occurs at Arg CGA codon repeats, with even two consecutive CGA codons able to reduce translation by up to 50%. The conserved eukaryotic Asc1 protein limits translation through internal Arg CGA codon repeats. We show that, in the absence of Asc1 protein, ribosomes continue translating at CGA codons, but undergo substantial frameshifting with dramatically higher levels of frameshifting occurring with additional repeats of CGA codons. Frameshifting depends upon the slow or inefficient decoding of these codons, since frameshifting is suppressed by increased expression of the native tRNA(Arg(ICG)) that decodes CGA codons by wobble decoding. Moreover, the extent of frameshifting is modulated by the position of the CGA codon repeat relative to the translation start site. Thus, translation fidelity depends upon Asc1-mediated quality control.

  11. Primary structures of three highly acidic ribosomal proteins S6, S12 and S15 from the archaebacterium Halobacterium marismortui.

    PubMed

    Kimura, J; Arndt, E; Kimura, M

    1987-11-16

    The amino acid sequences of three extremely acidic ribosomal proteins, S6, S12, and S15, from Halobacterium marismortui have been determined. The sequences were obtained by the sequence analysis of peptides derived by enzymatic digestion with trypsin. Stapylococcus aureus protease and chymotrypsin, as well as by cleavage with dilute HCl. The proteins, S6, S12 and S15, consist of 116, 147 and 102 amino acid residues, and have molecular masses of 12,251, 16,440 and 11,747 Da, respectively. Comparison of the amino acid sequences of these proteins with ribosomal protein sequences of other organisms revealed that halobacterial protein S12 has homology with the eukaryotic protein S16A from Saccharomyces cerevisiae, while S15 is significantly related to the Xenopus laevis S19 protein. No homology was found between these halobacterial proteins and any eubacterial ribosomal proteins.

  12. Origin and evolution of the eukaryotic SSU processome revealed by a comprehensive genomic analysis and implications for the origin of the nucleolus.

    PubMed

    Feng, Jin-Mei; Tian, Hai-Feng; Wen, Jian-Fan

    2013-01-01

    As a nucleolar complex for small-subunit (SSU) ribosomal RNA processing, SSU processome has been extensively studied mainly in Saccharomyces cerevisiae but not in diverse organisms, leaving open the question of whether it is a ubiquitous mechanism across eukaryotes and how it evolved in the course of the evolution of eukaryotes. Genome-wide survey and identification of SSU processome components showed that the majority of all 77 yeast SSU processome proteins possess homologs in almost all of the main eukaryotic lineages, and 14 of them have homologs in archaea but few in bacteria, suggesting that the complex is ubiquitous in eukaryotes, and its evolutionary history began with abundant protein homologs being present in archaea and then a fairly complete form of the complex emerged in the last eukaryotic common ancestor (LECA). Phylogenetic analysis indicated that ancient gene duplication and functional divergence of the protein components of the complex occurred frequently during the evolutionary origin of the LECA from prokaryotes. We found that such duplications not only increased the complex's components but also produced some new functional proteins involved in other nucleolar functions, such as ribosome biogenesis and even some nonnucleolar (but nuclear) proteins participating in pre-mRNA splicing, implying the evolutionary emergence of the subnuclear compartment-the nucleolus-has occurred in the LECA. Therefore, the LECA harbored not only complicated SSU processomes but also a nucleolus. Our analysis also revealed that gene duplication, innovation, and loss, caused further divergence of the complex during the divergence of eukaryotes.

  13. Eukaryotic tRNA paradox.

    PubMed

    Mitra, Sanga; Samadder, Arpa; Das, Pijush; Das, Smarajit; Chakrabarti, Jayprokas

    2015-01-01

    tRNAs are widely believed to segregate into two classes, I and II. Computational analysis of eukaryotic tRNA entries in Genomic tRNA Database, however, leads to new, albeit paradoxical, presence of more than a thousand class-I tRNAs with uncharacteristic long variable arms (V-arms), like in class-II. Out of 62,202 tRNAs from 69 eukaryotes, as many as 1431 class-I tRNAs have these novel extended V-arms, and we refer to them as paradoxical tRNAs (pxtRNAs). A great majority of these 1431 pxtRNA genes are located in intergenic regions, about 18% embedded in introns of genes or ESTs, and just one in 3'UTR. A check on the conservations of 2D and 3D base pairs for each position of these pxtRNAs reveals a few variations, but they seem to have almost all the known features (already known identity and conserved elements of tRNA). Analyses of the A-Box and B-Box of these pxtRNA genes in eukaryotes display salient deviations from the previously annotated conserved features of the standard promoters, whereas the transcription termination signals are just canonical and non-canonical runs of thymidine, similar to the ones in standard tRNA genes. There is just one such pxtRNA(ProAGG) gene in the entire human genome, and the availability of data allows epigenetic analysis of this human pxtRNA(ProAGG) in three different cell lines, H1 hESC, K562, and NHEK, to assess the level of its expression. Histone acetylation and methylation of this lone pxtRNA(ProAGG) gene in human differ from that of the nine standard human tRNA(ProAGG) genes. The V-arm nucleotide sequences and their secondary structures in pxtRNA differ from that of class-II tRNA. Considering these differences, hypotheses of alternative splicing, non-canonical intron and gene transfer are examined to partially improve the Cove scores of these pxtRNAs and to critically question their antecedence and novelty. PMID:25692737

  14. Picobiliphytes: a marine picoplanktonic algal group with unknown affinities to other eukaryotes.

    PubMed

    Not, Fabrice; Valentin, Klaus; Romari, Khadidja; Lovejoy, Connie; Massana, Ramon; Töbe, Kerstin; Vaulot, Daniel; Medlin, Linda K

    2007-01-12

    Environmental sequencing has revealed unimagined diversity among eukaryotic picoplankton. A distinct picoplanktonic algal group, initially detected from 18S ribosomal DNA (rDNA) sequences, was hybridized with rRNA-targeted probes, detected by tyramide signal amplification-fluorescent in situ hybridization, and showed an organelle-like body with orange fluorescence indicative of phycobilins. Using this fluorescence signal, cells were sorted by flow cytometry and probed. Hybridized cells contained a 4',6'-diamidino-2-phenylindole-stained organelle resembling a plastid with a nucleomorph. This suggests that they may be secondary endosymbiotic algae. Pending the isolation of living cells and their formal description, these algae have been termed picobiliphytes.

  15. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  16. Ribosomes: lifting the nuclear export ban.

    PubMed

    Johnson, Arlen W

    2014-02-01

    A recent study shows that nuclear export of the large ribosomal subunit is regulated by a GTPase that blocks recruitment of the nuclear export factor Nmd3 until remodeling of the pre-ribosome by the AAA-ATPase Rea1 (Midasin).

  17. A conserved quality-control pathway that mediates degradation of unassembled ribosomal proteins

    PubMed Central

    Sung, Min-Kyung; Porras-Yakushi, Tanya R; Reitsma, Justin M; Huber, Ferdinand M; Sweredoski, Michael J; Hoelz, André; Hess, Sonja; Deshaies, Raymond J

    2016-01-01

    Overproduced yeast ribosomal protein (RP) Rpl26 fails to assemble into ribosomes and is degraded in the nucleus/nucleolus by a ubiquitin-proteasome system quality control pathway comprising the E2 enzymes Ubc4/Ubc5 and the ubiquitin ligase Tom1. tom1 cells show reduced ubiquitination of multiple RPs, exceptional accumulation of detergent-insoluble proteins including multiple RPs, and hypersensitivity to imbalances in production of RPs and rRNA, indicative of a profound perturbation to proteostasis. Tom1 directly ubiquitinates unassembled RPs primarily via residues that are concealed in mature ribosomes. Together, these data point to an important role for Tom1 in normal physiology and prompt us to refer to this pathway as ERISQ, for excess ribosomal protein quality control. A similar pathway, mediated by the Tom1 homolog Huwe1, restricts accumulation of overexpressed hRpl26 in human cells. We propose that ERISQ is a key element of the quality control machinery that sustains protein homeostasis and cellular fitness in eukaryotes. DOI: http://dx.doi.org/10.7554/eLife.19105.001 PMID:27552055

  18. A conserved quality-control pathway that mediates degradation of unassembled ribosomal proteins.

    PubMed

    Sung, Min-Kyung; Porras-Yakushi, Tanya R; Reitsma, Justin M; Huber, Ferdinand M; Sweredoski, Michael J; Hoelz, André; Hess, Sonja; Deshaies, Raymond J

    2016-01-01

    Overproduced yeast ribosomal protein (RP) Rpl26 fails to assemble into ribosomes and is degraded in the nucleus/nucleolus by a ubiquitin-proteasome system quality control pathway comprising the E2 enzymes Ubc4/Ubc5 and the ubiquitin ligase Tom1. tom1 cells show reduced ubiquitination of multiple RPs, exceptional accumulation of detergent-insoluble proteins including multiple RPs, and hypersensitivity to imbalances in production of RPs and rRNA, indicative of a profound perturbation to proteostasis. Tom1 directly ubiquitinates unassembled RPs primarily via residues that are concealed in mature ribosomes. Together, these data point to an important role for Tom1 in normal physiology and prompt us to refer to this pathway as ERISQ, for excess ribosomal protein quality control. A similar pathway, mediated by the Tom1 homolog Huwe1, restricts accumulation of overexpressed hRpl26 in human cells. We propose that ERISQ is a key element of the quality control machinery that sustains protein homeostasis and cellular fitness in eukaryotes. PMID:27552055

  19. Group I twintrons: genetic elements in myxomycete and schizopyrenid amoeboflagellate ribosomal DNAs.

    PubMed

    Einvik, C; Elde, M; Johansen, S

    1998-09-17

    Protists are unicellular eukaryotes which represent a significant fraction of the global biodiversity. The myxomycete Didymium and the schizopyrenid amoeboflagellate Naegleria are distantly related protists. However, we have noted several striking similarities in life cycle, cell morphology, and ribosomal DNA organization between these organisms. Both have multicopy nuclear extrachromosomal ribosomal DNAs. Here the small subunit ribosomal RNA genes are interrupted by an optional group I twintron, a novel category among the group I introns. Group I twintrons are mobile self-splicing introns of 1.3-1.4 kb in size, with a complex organization at the RNA level. A group I twintron consists of two distinct ribozymes (catalytic RNAs) with different functions in RNA processing, and an open reading frame encoding a functional homing endonuclease--all with prospects of application as molecular tools in biotechnology. Updated RNA secondary structure models of group I twintrons, as well as an example of in vitro ribozyme activity, are presented. We suggest that the group I twintrons have been independently established in myxomycetes and schizopyrenid amoeboflagellates by horizontal gene transfer due to a combination of the phagocytotic behavior in natural environments and the extrachromosomal multicopy nature of ribosomal DNA.

  20. X-ray Analyses of the Ribosomal A-Site Molecular Switches

    NASA Astrophysics Data System (ADS)

    Kondo, Jiro

    The aminoacyl-tRNA decoding site (A-site) on the small ribosomal subunit is an RNA molecular switch guaranteeing high translation fidelity. Due to the similarity of the secondary structure of the A-site, it has long been believed that the functional characteristics and tertiary structure of the A-site molecular switch are basically conserved in three main cell types, bacteria, mitochondria and eukaryotic cytoplasm. However, these three cell types are noticeably different in their biological properties such as life cycle, genome size, structural component of ribosome and number of tRNA species. In our structural studies, we have shown how a small difference of nucleotide sequences affects the dynamics of the A-site molecular switches underlying the decoding mechanism adapted to their biological properties and environments. The observed structural insights into the decoding process allowed us to understand molecular mechanisms of non-syndromic hearing loss and toxicity mechanism of aminoglycoside antibiotics.

  1. Solution Structure of Ribosomal Protein S28E From Methanobacterium Thermoautotrophicum

    SciTech Connect

    Wu, Bin; Yee, Adelinda; Pineda-Lucena, Antonio; Semesi, Anthony; Ramelot, Theresa A.; Cort, John R.; Jung, Jin-Won; Edwards, Aled M.; Lee, Weontae; Kennedy, Michael A.; Arrowsmith, Cheryl H.

    2003-12-01

    The ribosomal protein S28E from the archaeon Methanobacterium thermoautotrophicum is a component of the 30S ribosomal subunit. Sequence homologs of S28E are found only in archaea and eukaryotes. Here we report the three-dimensional solution structure of S28E by NMR spectroscopy. S28E contains a globular region and a long C-terminal tail protruding from the core. The globular region consists of four antiparallel {beta}-strands which are arranged in a Greek-key topology. Unique features of S28E include an extended loop L2-3 that folds back onto the protein and a 12-residue charged C-terminal tail with no regular secondary structure and greater flexibility relative to the rest of the protein.

  2. Eukaryotic picoplankton in surface oceans.

    PubMed

    Massana, Ramon

    2011-01-01

    The eukaryotic picoplankton is a heterogeneous collection of small protists 1 to 3 ?m in size populating surface oceans at abundances of 10(2) to 10(4) cells ml(-1). Pigmented cells are important primary producers that are at the base of food webs. Colorless cells are mostly bacterivores and play key roles in channeling bacteria to higher trophic levels as well as in nutrient recycling. Mixotrophy and parasitism are relevant but less investigated trophic paths. Molecular surveys of picoeukaryotes have unveiled a large phylogenetic diversity and new lineages, and it is critical to understand the ecological and evolutionary significance of this large and novel diversity. A main goal is to assess how individuals are organized in taxonomic units and how they participate in ecological processes. Picoeukaryotes are convincingly integral members of marine ecosystems in terms of cell abundance, biomass, activity, and diversity and they play crucial roles in food webs and biogeochemical cycles.

  3. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  4. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  5. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  6. Protein synthesis by ribosomes with tethered subunits.

    PubMed

    Orelle, Cédric; Carlson, Erik D; Szal, Teresa; Florin, Tanja; Jewett, Michael C; Mankin, Alexander S

    2015-08-01

    The ribosome is a ribonucleoprotein machine responsible for protein synthesis. In all kingdoms of life it is composed of two subunits, each built on its own ribosomal RNA (rRNA) scaffold. The independent but coordinated functions of the subunits, including their ability to associate at initiation, rotate during elongation, and dissociate after protein release, are an established model of protein synthesis. Furthermore, the bipartite nature of the ribosome is presumed to be essential for biogenesis, since dedicated assembly factors keep immature ribosomal subunits apart and prevent them from translation initiation. Free exchange of the subunits limits the development of specialized orthogonal genetic systems that could be evolved for novel functions without interfering with native translation. Here we show that ribosomes with tethered and thus inseparable subunits (termed Ribo-T) are capable of successfully carrying out protein synthesis. By engineering a hybrid rRNA composed of both small and large subunit rRNA sequences, we produced a functional ribosome in which the subunits are covalently linked into a single entity by short RNA linkers. Notably, Ribo-T was not only functional in vitro, but was also able to support the growth of Escherichia coli cells even in the absence of wild-type ribosomes. We used Ribo-T to create the first fully orthogonal ribosome-messenger RNA system, and demonstrate its evolvability by selecting otherwise dominantly lethal rRNA mutations in the peptidyl transferase centre that facilitate the translation of a problematic protein sequence. Ribo-T can be used for exploring poorly understood functions of the ribosome, enabling orthogonal genetic systems, and engineering ribosomes with new functions.

  7. The Kissing-Loop T-Shaped Structure Translational Enhancer of Pea Enation Mosaic Virus Can Bind Simultaneously to Ribosomes and a 5′ Proximal Hairpin

    PubMed Central

    Gao, Feng; Gulay, Suna P.; Kasprzak, Wojciech; Dinman, Jonathan D.

    2013-01-01

    The Pea Enation Mosaic Virus (PEMV) 3′ translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5′-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5′ and 3′ PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3′ translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2′-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5′ hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5′ end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  8. Genetic diversity of eukaryotic microorganisms in Lake Taihu, a large shallow subtropical lake in china.

    PubMed

    Chen, Meijun; Chen, Feizhou; Yu, Yang; Ji, Jian; Kong, Fanxiang

    2008-10-01

    We investigated the genetic diversity of eukaryotic microorganisms (0.8-20 microm) by sequencing cloned 18S rRNA genes in six genetic libraries constructed from six locations in Lake Taihu, a large shallow subtropical lake in China. Genetic libraries of eukaryotic ribosomal RNA were screened by restriction fragment length polymorphism (RFLP) analysis, and one clone representative of each RFLP pattern was partially sequenced. A total of 528 clones were clustered into 165 RFLP patterns and finally into 131 operational taxonomic unit (OTUs). Phylogenetic analysis revealed that each library included many unique OTUs, as well as members of distantly related phylogenetic groups. A majority of the clones were from alveolates, stramenopiles, cercozoa, cryptophytes, chlorophytes, and fungi, with members of choanoflagellida, euglenida, centroheliozoa, ancyromonadidae, ichthyosporea, and kathablepharid representing a minor fraction of the library. Six OTUs (15 clones) were not related to any known eukaryotic group. Canonical correspondence analysis suggested that the differences in eukaryotic microorganism community composition of in the six regions were partially related to trophic status, sediment resuspension, and top-down regulation by metazooplankton.

  9. Biology wars: the eukaryotes strike back.

    PubMed

    Dunning Hotopp, Julie C; Estes, Anne M

    2014-12-10

    It is increasingly clear that eukaryotes have acquired bacterial DNA and function through horizontal gene transfer (HGT). In this issue of Cell Host & Microbe, Chou et al. (2014) and Metcalf et al. (2014) report multiple HGTs of bacterial tae and lysozyme genes, respectively, to diverse eukaryotic and archaeal hosts that may complement their response to bacteria.

  10. The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site

    PubMed Central

    Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter

    2015-01-01

    Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S

  11. Ribosomes and Ribosomal Protein from Neurospora crassa I. Physical, Chemical, and Immunochemical Properties1

    PubMed Central

    Alberghina, F. A. M.; Suskind, S. R.

    1967-01-01

    Ribosomes from Neurospora crassa, initially characterized by ultracentrifugal and immunochemical analyses, have been used to prepare ribosomal protein for physical, chemical, and immunochemical study. The acrylamide gel disc electrophoretic profiles of Neurospora ribosomal protein exhibit a degree of heterogeneity comparable to what has been observed in other systems. Only by chemical modification or by aggregation of the protein do alterations in the profile become apparent. Disulfide-bond formation appears to play a role in the aggregation of ribosomal protein to complexes of S20,w = 200. The aggregation can be prevented by alkylation of −SH groups, and protein treated in this fashion has a subunit molecular weight of about 20,000 as determined by equilibrium centrifugation. Finger-printing of tryptic peptides indicates that more than one unique sequence of amino acids must be present in ribosomal protein, although gross primary structural heterogeneity is questioned. Antigenic heterogeneity is much less apparent; only a few precipitin bands are resolved by immunodiffusion tests, although complete reactivity of total ribosomal protein is suggested by quantitative precipitin analysis. The antigenically active ribosomal protein components appear to reside in at least two fractions; one is removed readily from the ribosome by CsC1 treatment. Ribosomal protein of N. crassa possesses antigenic determinants present in E. coli ribosomal protein as judged by spur formation in immunodiffusion tests. Images PMID:4962303

  12. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  13. Comparative Genomics and Molecular Dynamics of DNA Repeats in Eukaryotes

    PubMed Central

    Richard, Guy-Franck; Kerrest, Alix; Dujon, Bernard

    2008-01-01

    Summary: Repeated elements can be widely abundant in eukaryotic genomes, composing more than 50% of the human genome, for example. It is possible to classify repeated sequences into two large families, “tandem repeats” and “dispersed repeats.” Each of these two families can be itself divided into subfamilies. Dispersed repeats contain transposons, tRNA genes, and gene paralogues, whereas tandem repeats contain gene tandems, ribosomal DNA repeat arrays, and satellite DNA, itself subdivided into satellites, minisatellites, and microsatellites. Remarkably, the molecular mechanisms that create and propagate dispersed and tandem repeats are specific to each class and usually do not overlap. In the present review, we have chosen in the first section to describe the nature and distribution of dispersed and tandem repeats in eukaryotic genomes in the light of complete (or nearly complete) available genome sequences. In the second part, we focus on the molecular mechanisms responsible for the fast evolution of two specific classes of tandem repeats: minisatellites and microsatellites. Given that a growing number of human neurological disorders involve the expansion of a particular class of microsatellites, called trinucleotide repeats, a large part of the recent experimental work on microsatellites has focused on these particular repeats, and thus we also review the current knowledge in this area. Finally, we propose a unified definition for mini- and microsatellites that takes into account their biological properties and try to point out new directions that should be explored in a near future on our road to understanding the genetics of repeated sequences. PMID:19052325

  14. Origin and evolution of the ribosome.

    PubMed

    Fox, George E

    2010-09-01

    The modern ribosome was largely formed at the time of the last common ancestor, LUCA. Hence its earliest origins likely lie in the RNA world. Central to its development were RNAs that spawned the modern tRNAs and a symmetrical region deep within the large ribosomal RNA, (rRNA), where the peptidyl transferase reaction occurs. To understand pre-LUCA developments, it is argued that events that are coupled in time are especially useful if one can infer a likely order in which they occurred. Using such timing events, the relative age of various proteins and individual regions within the large rRNA are inferred. An examination of the properties of modern ribosomes strongly suggests that the initial peptides made by the primitive ribosomes were likely enriched for l-amino acids, but did not completely exclude d-amino acids. This has implications for the nature of peptides made by the first ribosomes. From the perspective of ribosome origins, the immediate question regarding coding is when did it arise rather than how did the assignments evolve. The modern ribosome is very dynamic with tRNAs moving in and out and the mRNA moving relative to the ribosome. These movements may have become possible as a result of the addition of a template to hold the tRNAs. That template would subsequently become the mRNA, thereby allowing the evolution of the code and making an RNA genome useful. Finally, a highly speculative timeline of major events in ribosome history is presented and possible future directions discussed. PMID:20534711

  15. Stimulation of -1 programmed ribosomal frameshifting by a metabolite-responsive RNA pseudoknot.

    PubMed

    Chou, Ming-Yuan; Lin, Szu-Chieh; Chang, Kung-Yao

    2010-06-01

    Specific recognition of metabolites by functional RNA motifs within mRNAs has emerged as a crucial regulatory strategy for feedback control of biochemical reactions. Such riboswitches have been demonstrated to regulate different gene expression processes, including transcriptional termination and translational initiation in prokaryotic cells, as well as splicing in eukaryotic cells. The regulatory process is usually mediated by modulating the accessibility of specific sequence information of the expression platforms via metabolite-induced RNA conformational rearrangement. In eukaryotic systems, viral and the more limited number of cellular decoding -1 programmed ribosomal frameshifting (PRF) are commonly promoted by a 3' mRNA pseudoknot. In addition, such -1 PRF is generally constitutive rather than being regulatory, and usually results in a fixed ratio of products. We report here an RNA pseudoknot capable of stimulating -1 PRF whose efficiency can be tuned in response to the concentration of S-adenosylhomocysteine (SAH), and the improvement of its frameshifting efficiency by RNA engineering. In addition to providing an alternative approach for small-molecule regulation of gene expression in eukaryotic cells, such a metabolite-responsive pseudoknot suggests a plausible mechanism for metabolite-driven translational regulation of gene expression in eukaryotic systems. PMID:20435898

  16. Intersubunit Bridges of the Bacterial Ribosome.

    PubMed

    Liu, Qi; Fredrick, Kurt

    2016-05-22

    The ribosome is a large two-subunit ribonucleoprotein machine that translates the genetic code in all cells, synthesizing proteins according to the sequence of the mRNA template. During translation, the primary substrates, transfer RNAs, pass through binding sites formed between the two subunits. Multiple interactions between the ribosomal subunits, termed intersubunit bridges, keep the ribosome intact and at the same time govern dynamics that facilitate the various steps of translation such as transfer RNA-mRNA movement. Here, we review the molecular nature of these intersubunit bridges, how they change conformation during translation, and their functional roles in the process.

  17. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  18. Circular RNAs in Eukaryotic Cells.

    PubMed

    Chen, Liang; Huang, Chuan; Wang, Xiaolin; Shan, Ge

    2015-10-01

    Circular RNAs (circRNAs) are now recognized as large species of transcripts in eukaryotic cells. From model organisms such as C. elegans, Drosophila, mice to human beings, thousands of circRNAs formed from back-splicing of exons have been identified. The known complexity of transcriptome has been greatly expanded upon the discovery of these RNAs. Studies about the biogenesis and physiological functions have yielded substantial knowledge for the circRNAs, and they are now more likely to be viewed as regulatory elements coded by the genome rather than unavoidable noise of gene expression. Certain human diseases may also relate to circRNAs. These circRNAs show diversifications in features such as sequence composition and cellular localization, and thus we propose that they may be divided into subtypes such as cytoplasmic circRNAs, nuclear circRNAs, and exon-intron circRNAs (EIciRNAs). Here we summarize and discuss knowns and unknowns for these RNAs, and we need to keep in mind that the whole field is still at the beginning of exciting explorations.

  19. Redox compartmentalization in eukaryotic cells

    PubMed Central

    Go, Young-Mi; Jones, Dean P.

    2008-01-01

    Diverse functions of eukaryotic cells are optimized by organization of compatible chemistries into distinct compartments defined by the structures of lipid-containing membranes, multiprotein complexes and oligomeric structures of saccharides and nucleic acids. This structural and chemical organization is coordinated, in part, through cysteine residues of proteins which undergo reversible oxidation-reduction and serve as chemical/structural transducing elements. The central thiol/disulfide redox couples, thioredoxin-1, thioredoxin-2, GSH/GSSG and cysteine/cystine (Cys/CySS), are not in equilibrium with each other and are maintained at distinct, non-equilibrium potentials in mitochondria, nuclei, the secretory pathway and the extracellular space. Mitochondria contain the most reducing compartment, have the highest rates of electron transfer and are highly sensitive to oxidation. Nuclei also have more reduced redox potentials but are relatively resistant to oxidation. The secretory pathway contains oxidative systems which introduce disulfides into proteins for export. The cytoplasm contains few metabolic oxidases and this maintains an environment for redox signaling dependent upon NADPH oxidases and NO synthases. Extracellular compartments are maintained at stable oxidizing potentials. Controlled changes in cytoplasmic GSH/GSSG redox potential are associated with functional state, varying with proliferation, differentiation and apoptosis. Variation in extracellular Cys/CySS redox potential is also associated with proliferation, cell adhesion and apoptosis. Thus, cellular redox biology is inseparable from redox compartmentalization. Further elucidation of the redox control networks within compartments will improve the mechanistic understanding of cell functions and their disruption in disease. PMID:18267127

  20. A lamin in lower eukaryotes?

    PubMed Central

    Batsios, Petros; Peter, Tatjana; Baumann, Otto; Stick, Reimer; Meyer, Irene; Gräf, Ralph

    2012-01-01

    Lamins are the major components of the nuclear lamina and serve not only as a mechanical support, but are also involved in chromatin organization, epigenetic regulation, transcription and mitotic events. Despite these universal tasks, lamins have so far been found only in metazoans. Yet, recently we have identified Dictyostelium NE81 as the first lamin-like protein in a lower eukaryote. Based on the current knowledge, we draw a model for nuclear envelope organization in Dictyostelium in this Extra View and we review the experimental data that justified this classification. Furthermore we provide unpublished data underscoring the requirement of posttranslational CaaX-box processing for proper protein localization at the nuclear envelope. Sequence comparison of NE81 sequences from four Dictyostelia with bona fide lamins illustrates the evolutional relationship between these proteins. Under certain conditions these usually unicellular social amoebae congregate to form a multicellular body. We propose that the evolution of the lamin-like NE81 went along with the invention of multicellularity. PMID:22572958

  1. Mechanochemical coupling in eukaryotic flagella.

    PubMed

    Omoto, C K

    1989-03-21

    Quantitative analyses of ATP hydrolysis coupled to movement of eukaryotic flagella is important for understanding the relationship between ATP hydrolysis and movement. The difference in ATPase activity between intact motile axonemes (that is the cytoskeletal core of flagella) and homogenized or immotile axonemes has been assumed to be coupled to movement. However, recent findings on rates of steps in the dynein ATPase cycle and the effect of interaction with microtubules on those steps call for reassessment of movement-coupled ATPase. From these studies, it is clear that dynein ATPase activity is not as tightly coupled to interaction with microtubules as myosin ATPase activity is coupled to interaction with actin. The method by which axonemal movement is inhibited will critically affect the interpretation of difference in ATPase activity. If the homogenization or similar methods uncouple dynein, the difference in ATPase activity is not a useful measurement. Greater understanding of the relationship between dynein kinetics and axonemal movement may be obtained by use of conditions and substrates with known effects at specific steps in the dynein mechanochemical cycle and quantitating their effects on movement.

  2. Regulation of Eukaryotic Flagellar Motility

    NASA Astrophysics Data System (ADS)

    Mitchell, David R.

    2005-03-01

    The central apparatus is essential for normal eukaryotic flagellar bend propagation as evidenced by the paralysis associated with mutations that prevent central pair (CP) assembly. Interactions between doublet-associated radial spokes and CP projections are thought to modulate spoke-regulated protein kinases and phosphatases on outer doublets, and these enzymes in turn modulate dynein activity. To better understand CP control mechanisms, we determined the three-dimensional structure of the Chlamydomonas reinhardtii CP complex and analyzed CP orientation during formation and propagation of flagellar bending waves. We show that a single CP microtubule, C1, is near the outermost doublet in curved regions of the flagellum, and this orientation is maintained by twists between successive principal and reverse bends. The Chlamydomonas CP is inherently twisted; twists are not induced by bend formation, and do not depend on forces or signals transmitted through spoke-central pair interactions. We hypothesize that CP orientation passively responds to bend formation, and that bend propagation drives rotation of the CP and maintains a constant CP orientation in bends, which in turn permits signal transduction between specific CP projections and specific doublet-associated dyneins through radial spokes. The central pair kinesin, Klp1, although essential for normal motility, is therefore not the motor that drives CP rotation. The CP also acts as a scaffold for enzymes that maintain normal intraflagellar ATP concentration.

  3. The eukaryotic fossil record in deep time

    NASA Astrophysics Data System (ADS)

    Butterfield, N.

    2011-12-01

    Eukaryotic organisms are defining constituents of the Phanerozoic biosphere, but they also extend well back into the Proterozoic record, primarily in the form of microscopic body fossils. Criteria for identifying pre-Ediacaran eukaryotes include large cell size, morphologically complex cell walls and/or the recognition of diagnostically eukaryotic cell division patterns. The oldest unambiguous eukaryote currently on record is an acanthomorphic acritarch (Tappania) from the Palaeoproterozoic Semri Group of central India. Older candidate eukaryotes are difficult to distinguish from giant bacteria, prokaryotic colonies or diagenetic artefacts. In younger Meso- and Neoproterozoic strata, the challenge is to recognize particular grades and clades of eukaryotes, and to document their macro-evolutionary expression. Distinctive unicellular forms include mid-Neoproterozoic testate amoebae and phosphate biomineralizing 'scale-microfossils' comparable to an extant green alga. There is also a significant record of seaweeds, possible fungi and problematica from this interval, documenting multiple independent experiments in eukaryotic multicellularity. Taxonomically resolved forms include a bangiacean red alga and probable vaucheriacean chromalveolate algae from the late Mesoproterozoic, and populations of hydrodictyacean and siphonocladalean green algae of mid Neoproterozoic age. Despite this phylogenetic breadth, however, or arguments from molecular clocks, there is no convincing evidence for pre-Ediacaran metazoans or metaphytes. The conspicuously incomplete nature of the Proterozoic record makes it difficult to resolve larger-scale ecological and evolutionary patterns. Even so, both body fossils and biomarker data point to a pre-Ediacaran biosphere dominated overwhelming by prokaryotes. Contemporaneous eukaryotes appear to be limited to conspicuously shallow water environments, and exhibit fundamentally lower levels of morphological diversity and evolutionary turnover than

  4. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  5. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    PubMed Central

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  6. Functional reconstitution of human eukaryotic translation initiation factor 3 (eIF3).

    PubMed

    Sun, Chaomin; Todorovic, Aleksandar; Querol-Audí, Jordi; Bai, Yun; Villa, Nancy; Snyder, Monica; Ashchyan, John; Lewis, Christopher S; Hartland, Abbey; Gradia, Scott; Fraser, Christopher S; Doudna, Jennifer A; Nogales, Eva; Cate, Jamie H D

    2011-12-20

    Protein fate in higher eukaryotes is controlled by three complexes that share conserved architectural elements: the proteasome, COP9 signalosome, and eukaryotic translation initiation factor 3 (eIF3). Here we reconstitute the 13-subunit human eIF3 in Escherichia coli, revealing its structural core to be the eight subunits with conserved orthologues in the proteasome lid complex and COP9 signalosome. This structural core in eIF3 binds to the small (40S) ribosomal subunit, to translation initiation factors involved in mRNA cap-dependent initiation, and to the hepatitis C viral (HCV) internal ribosome entry site (IRES) RNA. Addition of the remaining eIF3 subunits enables reconstituted eIF3 to assemble intact initiation complexes with the HCV IRES. Negative-stain EM reconstructions of reconstituted eIF3 further reveal how the approximately 400 kDa molecular mass structural core organizes the highly flexible 800 kDa molecular mass eIF3 complex, and mediates translation initiation.

  7. Endogenous Synthesis of Coenzyme Q in Eukaryotes

    PubMed Central

    Tran, UyenPhuong C.; Clarke, Catherine F.

    2007-01-01

    Coenzyme Q (Q) functions in the mitochondrial respiratory chain and serves as a lipophilic antioxidant. There is increasing interest in the use of Q as a nutritional supplement. Although the physiological significance of Q is extensively investigated in eukaryotes, ranging from yeast to human, the eukaryotic Q biosynthesis pathway is best characterized in the budding yeast Saccharomyces cerevisiae. At least ten genes (COQ1-COQ10) have been shown to be required for Q biosynthesis and function in respiration. This review highlights recent knowledge about the endogenous synthesis of Q in eukaryotes, with emphasis on S. cerevisiae as a model system. PMID:17482885

  8. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  9. The tmRNA ribosome rescue system

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2012-01-01

    The bacterial tmRNA quality control system monitors protein synthesis and recycles stalled translation complexes in a process termed “ribosome rescue”. During rescue, tmRNA acts first as a transfer RNA to bind stalled ribosomes, then as a messenger RNA to add the ssrA peptide tag to the C-terminus of the nascent polypeptide chain. The ssrA peptide targets tagged peptides for proteolysis, ensuring rapid degradation of potentially deleterious truncated polypeptides. Ribosome rescue also facilitates turnover of the damaged messages responsible for translational arrest. Thus, tmRNA increases the fidelity of gene expression by promoting the synthesis of full-length proteins. In addition to serving as a global quality control system, tmRNA also plays important roles in bacterial development, pathogenesis and environmental stress responses. This review focuses on the mechanism of tmRNA-mediated ribosome rescue and the role of tmRNA in bacterial physiology. PMID:22243584

  10. From archaeon to eukaryote: the evolutionary dark ages of the eukaryotic cell.

    PubMed

    Martijn, Joran; Ettema, Thijs J G

    2013-02-01

    The evolutionary origin of the eukaryotic cell represents an enigmatic, yet largely incomplete, puzzle. Several mutually incompatible scenarios have been proposed to explain how the eukaryotic domain of life could have emerged. To date, convincing evidence for these scenarios in the form of intermediate stages of the proposed eukaryogenesis trajectories is lacking, presenting the emergence of the complex features of the eukaryotic cell as an evolutionary deus ex machina. However, recent advances in the field of phylogenomics have started to lend support for a model that places a cellular fusion event at the basis of the origin of eukaryotes (symbiogenesis), involving the merger of an as yet unknown archaeal lineage that most probably belongs to the recently proposed 'TACK superphylum' (comprising Thaumarchaeota, Aigarchaeota, Crenarchaeota and Korarchaeota) with an alphaproteobacterium (the protomitochondrion). Interestingly, an increasing number of so-called ESPs (eukaryotic signature proteins) is being discovered in recently sequenced archaeal genomes, indicating that the archaeal ancestor of the eukaryotic cell might have been more eukaryotic in nature than presumed previously, and might, for example, have comprised primitive phagocytotic capabilities. In the present paper, we review the evolutionary transition from archaeon to eukaryote, and propose a new model for the emergence of the eukaryotic cell, the 'PhAT (phagocytosing archaeon theory)', which explains the emergence of the cellular and genomic features of eukaryotes in the light of a transiently complex phagocytosing archaeon.

  11. Potential extra-ribosomal functions of ribosomal proteins in Saccharomyces cerevisiae.

    PubMed

    Lu, Hui; Zhu, Yi-Fei; Xiong, Juan; Wang, Rong; Jia, Zhengping

    2015-08-01

    Ribosomal proteins (RPs), are essential components of the ribosomes, the molecular machines that turn mRNA blueprints into proteins, as they serve to stabilize the structure of the rRNA, thus improving protein biosynthesis. In addition, growing evidence suggests that RPs can function in other cellular roles. In the present review, we summarize several potential extra-ribosomal functions of RPs in ribosomal biogenesis, transcription activity, translation process, DNA repair, replicative life span, adhesive growth, and morphological transformation in Saccharomyces cerevisiae. However, the future in-depth studies are needed to identify these novel secondary functions of RPs in S. cerevisiae.

  12. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  13. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins.

  14. Prokaryotic and eukaryotic unicellular chronomics

    PubMed Central

    Halberg, F.; Cornélissen, G.; Faraone, P.; Poeggeler, B.; Hardeland, R.; Katinas, G.; Schwartzkopff, O.; Otsuka, K.; Bakken, E. E.

    2008-01-01

    An impeccable time series, published in 1930, consisting of hourly observations on colony advance in a fluid culture of E. coli, was analyzed by a periodogram and power spectrum in 1961. While the original senior author had emphasized specifically periodicity with no estimate of period length, he welcomed further analyses. After consulting his technician, he knew of no environmental periodicity related to human schedules other than an hourly photography. A periodogram analysis in 1961 showed a 20.75-h period. It was emphasized that “… the circadian period disclosed is not of exactly 24-h length.” Confirmations notwithstanding, a committee ruled out microbial circadian rhythms based on grounds that could have led to a different conclusion, namely first, the inability of some committee members to see (presumably by eyeballing) the rhythms in their own data, and second, what hardly follows, that there were “too many analyses” in the published papers. Our point in dealing with microbes and humans is that analyses are indispensable for quantification and for discovering a biologically novel spectrum of cyclicities, matching physical ones. The scope of circadian organization estimated in 1961 has become broader, including about 7-day, about half-yearly, about-yearly and ex-yearly and decadal periodisms, among others. Microbial circadians have become a field of their own with eyeballing, yet time-microscopy can quantify characteristics with their uncertainties and can assess broad chronomes (time structures) with features beyond circadians. As yet only suggestive differences between eukaryotes and prokaryotes further broaden the perspective and may lead to life’s sites of origin and to new temporal aspects of life’ s development as a chronomic tree by eventual rhythm dating in ontogeny and phylogeny. PMID:16275493

  15. [Molecular karyotyping of eukaryotic microorganisms].

    PubMed

    Nasonova, E S

    2012-01-01

    In many fungi and protists small size and weak morphological differentiation of chromosomes embarrass the study of karyotypes using microscopical tools. Molecular karyotyping based on the fractionation of intact chromosomal DNAs by pulsed field gel electrophoresis (PFGE) provides an alternative approach to the analysis of chromosomal sets in such organisms. To assign the bands observed in PFGE gel to the individual chromosomes the following methods of chromosome identification are applied: densitometric analysis of the bands; Southern hybridization with chromosome- and telomere-specific probes, which often is combined with comparative karyotyping of a series of strains with pronounced size polymorphism of chromosomes; comparison of the patterns of restriction fragments of chromosomal DNAs fractioned by KARD 2-D PFGE; comparison with the strains with well-studied interchromosomal rearrangements. Besides estimation of the number and the size of chromosomes, molecular karyotyping allows assessment of haploid genome size and ploidy level, study of genome dynamics, identification of chromosomal rearrangements and associated chromosomal polymorphism. The analysis of karyotype and dynamics of the genomes is important for the study of intra- and interspecial variability, investigation of the chromosome evolution in closely related species and elaboration of the models of speciation. The comparison of molecular karyotypes among isolates of different origin is of great practical importance for clinical diagnostics and for agricultural microbiology. In this review we discuss: 1) the methods of karyotyping and their application to the analysis of chromosomal sets in eukaryotic microorganisms; 2) the specificity of the methods used for extraction and fractionation of intact chromosomal DNAs; 3) the reasons for difficulties in interpretation of molecular karyotypes and the ways of their overcoming; 4) fields of application of molecular karyotyping; 5) the definition of

  16. The emerging roles of inositol pyrophosphates in eukaryotic cell physiology.

    PubMed

    Thota, Swarna Gowri; Bhandari, Rashna

    2015-09-01

    Inositol pyrophosphates are water soluble derivatives of inositol that contain pyrophosphate or diphosphate moieties in addition to monophosphates. The best characterised inositol pyrophosphates, are IP7 (diphosphoinositol pentakisphosphate or PP-IP5), and IP8 (bisdiphosphoinositol tetrakisphosphate or (PP)2-IP4). These energy-rich small molecules are present in all eukaryotic cells, from yeast to mammals, and are involved in a wide range of cellular functions including apoptosis, vesicle trafficking, DNA repair, osmoregulation, phosphate homeostasis, insulin sensitivity, immune signalling, cell cycle regulation, and ribosome synthesis. Identified more than 20 years ago, there is still only a rudimentary understanding of the mechanisms by which inositol pyrophosphates participate in these myriad pathways governing cell physiology and homeostasis. The unique stereochemical and bioenergetic properties these molecules possess as a consequence of the presence of one or two pyrophosphate moieties in the vicinity of densely packed monophosphates are likely to form the molecular basis for their participation in multiple signalling and metabolic pathways. The aim of this review is to provide first time researchers in this area with an introduction to inositol pyrophosphates and a comprehensive overview on their cellular functions.

  17. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  18. The Eukaryotic Replisome Goes Under the Microscope.

    PubMed

    O'Donnell, Mike; Li, Huilin

    2016-03-21

    The machinery at the eukaryotic replication fork has seen many new structural advances using electron microscopy and crystallography. Recent structures of eukaryotic replisome components include the Mcm2-7 complex, the CMG helicase, DNA polymerases, a Ctf4 trimer hub and the first look at a core replisome of 20 different proteins containing the helicase, primase, leading polymerase and a lagging strand polymerase. The eukaryotic core replisome shows an unanticipated architecture, with one polymerase sitting above the helicase and the other below. Additionally, structures of Mcm2 bound to an H3/H4 tetramer suggest a direct role of the replisome in handling nucleosomes, which are important to DNA organization and gene regulation. This review provides a summary of some of the many recent advances in the structure of the eukaryotic replisome.

  19. Eukaryotic diversity in historical soil samples.

    PubMed

    Moon-van der Staay, Seung Yeo; Tzeneva, Vesela A; van der Staay, Georg W M; de Vos, Willem M; Smidt, Hauke; Hackstein, Johannes H P

    2006-09-01

    The eukaryotic biodiversity in historical air-dried samples of Dutch agricultural soil has been assessed by random sequencing of an 18S rRNA gene library and by denaturing gradient gel electrophoresis. Representatives of nearly all taxa of eukaryotic soil microbes could be identified, demonstrating that it is possible to study eukaryotic microbiota in samples from soil archives that have been stored for more than 30 years at room temperature. In a pilot study, 41 sequences were retrieved that could be assigned to fungi and a variety of aerobic and anaerobic protists such as cercozoans, ciliates, xanthophytes (stramenopiles), heteroloboseans, and amoebozoans. A PCR-denaturing gradient gel electrophoresis analysis of samples collected between 1950 and 1975 revealed significant changes in the composition of the eukaryotic microbiota.

  20. Paleobiological Perspectives on Early Eukaryotic Evolution

    PubMed Central

    Knoll, Andrew H.

    2014-01-01

    Eukaryotic organisms radiated in Proterozoic oceans with oxygenated surface waters, but, commonly, anoxia at depth. Exceptionally preserved fossils of red algae favor crown group emergence more than 1200 million years ago, but older (up to 1600–1800 million years) microfossils could record stem group eukaryotes. Major eukaryotic diversification ∼800 million years ago is documented by the increase in the taxonomic richness of complex, organic-walled microfossils, including simple coenocytic and multicellular forms, as well as widespread tests comparable to those of extant testate amoebae and simple foraminiferans and diverse scales comparable to organic and siliceous scales formed today by protists in several clades. Mid-Neoproterozoic establishment or expansion of eukaryophagy provides a possible mechanism for accelerating eukaryotic diversification long after the origin of the domain. Protists continued to diversify along with animals in the more pervasively oxygenated oceans of the Phanerozoic Eon. PMID:24384569

  1. The Eukaryotic Replisome Goes Under the Microscope

    PubMed Central

    O’Donnell, Mike; Li, Huilin

    2016-01-01

    The machinery at the eukaryotic replication fork has seen many new structural advances using electron microscopy and crystallography. Recent structures of eukaryotic replisome components include the Mcm2-7 complex, the CMG helicase, DNA polymerases, a Ctf4 trimer hub and the first look at a core replisome of 20 different proteins containing the helicase, primase, leading polymerase and a lagging strand polymerase. The eukaryotic core replisome shows an unanticipated architecture, with one polymerase sitting above the helicase and the other below. Additionally, structures of Mcm2 bound to an H3/H4 tetramer suggest a direct role of the replisome in handling nucleosomes, which are important to DNA organization and gene regulation. This review provides a summary of some of the many recent advances in the structure of the eukaryotic replisome. PMID:27003891

  2. Paleobiological perspectives on early eukaryotic evolution.

    PubMed

    Knoll, Andrew H

    2014-01-01

    Eukaryotic organisms radiated in Proterozoic oceans with oxygenated surface waters, but, commonly, anoxia at depth. Exceptionally preserved fossils of red algae favor crown group emergence more than 1200 million years ago, but older (up to 1600-1800 million years) microfossils could record stem group eukaryotes. Major eukaryotic diversification ~800 million years ago is documented by the increase in the taxonomic richness of complex, organic-walled microfossils, including simple coenocytic and multicellular forms, as well as widespread tests comparable to those of extant testate amoebae and simple foraminiferans and diverse scales comparable to organic and siliceous scales formed today by protists in several clades. Mid-Neoproterozoic establishment or expansion of eukaryophagy provides a possible mechanism for accelerating eukaryotic diversification long after the origin of the domain. Protists continued to diversify along with animals in the more pervasively oxygenated oceans of the Phanerozoic Eon.

  3. Differences in soil micro-eukaryotic communities over soil pH gradients are strongly driven by parasites and saprotrophs.

    PubMed

    Dupont, A Ö C; Griffiths, R I; Bell, T; Bass, D

    2016-06-01

    A recent large-scale assessment of bacterial communities across a range of UK soil types showed that bacterial community structure was strongly determined by soil pH. We analysed a data set of eukaryotic 454 sequencing 18S rDNA from the surveyed samples and showed significant differences in eukaryotic assemblages according to pH class, mostly between low pH and higher pH soils. Soil eukaryote communities (per sample) differed most at the taxonomic rank approximating to order level. Taxonomies assigned with the Protist Ribosomal Reference and the Silva 119 databases were taxonomically inconsistent, mostly due to differing 18S annotations, although general structure and composition according to pH were coherent. A relatively small number of lineages, mostly putative parasitic protists and fungi, drive most differences between pH classes, with weaker contributions from bacterivores and autotrophs. Overall, soil parasites included a large diversity of alveolates, in particular apicomplexans. Phylogenetic analysis of alveolate lineages demonstrates a large diversity of unknown gregarines, novel perkinsids, coccidians, colpodellids and uncharacterized alveolates. Other novel and/or divergent lineages were revealed across the eukaryote tree of life. Our study provides an in-depth taxonomic evaluation of micro-eukaryotic diversity, and reveals novel lineages and insights into their relationships with environmental variables across soil gradients.

  4. Metabolic Constraints on the Eukaryotic Transition

    NASA Astrophysics Data System (ADS)

    Wallace, Rodrick

    2009-04-01

    Mutualism, obligate mutualism, symbiosis, and the eukaryotic ‘fusion’ of Serial Endosymbiosis Theory represent progressively more rapid and less distorted real-time communication between biological structures instantiating information sources. Such progression in accurate information transmission requires, in turn, progressively greater channel capacity that, through the homology between information source uncertainty and free energy density, requires ever more energetic metabolism. The eukaryotic transition, according to this model, may have been entrained by an ecosystem resilience shift from anaerobic to aerobic metabolism.

  5. [Eukaryotes devoid of the most important cellular organelles (flagella, Golgi apparatus, mitochondria) and the main task of organellology].

    PubMed

    Seravin, L N

    1992-01-01

    Comparative evidence on the lack of three important organelles (flagella, Golgi-complex, mitochondria) in cells and organisms at the cellular level of organization has been summarized for all the four eukaryotic kingdoms--Protista, Fungi, Plantae and Animalia (Metazoa). It is established that in the course of evolution these organelles may undergo the total reduction. There is no cellular organelle to be regarded as universal, indispensable. There are only three main obligatory cell components--the plasmalemma, nucleus and cytoplasm (with applied cytoskeleton, cytomembranes and ribosomes). The reduction of flagella (cilia) is occurring in different taxa independent of the transition of protists from the flagellate type of locomotion to the amoeboid, gliding of metabolizing ones, and in the number of metazoan cells. The members of Protista and Fungi, which line in microaerobic or anaerobic conditions, nearly inevitably lose their mitochondria. The tendency to lose Golgi-complex is demonstrated in protists with parasitic mode of life, especially in combination with anaerobiosis. There is so far no satisfied morphological criterium that could say with certainty whether the lacking of flagella, Golgi complex or mitochondria in the low eukaryotes may be primary or secondary (as the result of reduction). Data on the composition, structure and RNA nucleotide sequences cannot be either the straight evidence. A comparative analysis of these data shows that the ribosomes of the primary eukaryotes were, presumably, of a prokaryotic type. Their eukaryotization was carried out for a long time during the evolution of the low eukaryotes (Protista and Fungi), probably, independently in different phylogenetic lines. It is unknown at what steps and in what main phylogenetic lines the three above mentioned organelles may have appeared. It is proposed to single out a special division of cytology--organellology (organoidology)--as an individual science whose main purpose may be

  6. Transfer of DNA from Bacteria to Eukaryotes.

    PubMed

    Lacroix, Benoît; Citovsky, Vitaly

    2016-01-01

    Historically, the members of the Agrobacterium genus have been considered the only bacterial species naturally able to transfer and integrate DNA into the genomes of their eukaryotic hosts. Yet, increasing evidence suggests that this ability to genetically transform eukaryotic host cells might be more widespread in the bacterial world. Indeed, analyses of accumulating genomic data reveal cases of horizontal gene transfer from bacteria to eukaryotes and suggest that it represents a significant force in adaptive evolution of eukaryotic species. Specifically, recent reports indicate that bacteria other than Agrobacterium, such as Bartonella henselae (a zoonotic pathogen), Rhizobium etli (a plant-symbiotic bacterium related to Agrobacterium), or even Escherichia coli, have the ability to genetically transform their host cells under laboratory conditions. This DNA transfer relies on type IV secretion systems (T4SSs), the molecular machines that transport macromolecules during conjugative plasmid transfer and also during transport of proteins and/or DNA to the eukaryotic recipient cells. In this review article, we explore the extent of possible transfer of genetic information from bacteria to eukaryotic cells as well as the evolutionary implications and potential applications of this transfer. PMID:27406565

  7. Transfer of DNA from Bacteria to Eukaryotes

    PubMed Central

    2016-01-01

    ABSTRACT Historically, the members of the Agrobacterium genus have been considered the only bacterial species naturally able to transfer and integrate DNA into the genomes of their eukaryotic hosts. Yet, increasing evidence suggests that this ability to genetically transform eukaryotic host cells might be more widespread in the bacterial world. Indeed, analyses of accumulating genomic data reveal cases of horizontal gene transfer from bacteria to eukaryotes and suggest that it represents a significant force in adaptive evolution of eukaryotic species. Specifically, recent reports indicate that bacteria other than Agrobacterium, such as Bartonella henselae (a zoonotic pathogen), Rhizobium etli (a plant-symbiotic bacterium related to Agrobacterium), or even Escherichia coli, have the ability to genetically transform their host cells under laboratory conditions. This DNA transfer relies on type IV secretion systems (T4SSs), the molecular machines that transport macromolecules during conjugative plasmid transfer and also during transport of proteins and/or DNA to the eukaryotic recipient cells. In this review article, we explore the extent of possible transfer of genetic information from bacteria to eukaryotic cells as well as the evolutionary implications and potential applications of this transfer. PMID:27406565

  8. Repetitive DNA in eukaryotic genomes.

    PubMed

    Biscotti, Maria Assunta; Olmo, Ettore; Heslop-Harrison, J S Pat

    2015-09-01

    Repetitive DNA--sequence motifs repeated hundreds or thousands of times in the genome--makes up the major proportion of all the nuclear DNA in most eukaryotic genomes. However, the significance of repetitive DNA in the genome is not completely understood, and it has been considered to have both structural and functional roles, or perhaps even no essential role. High-throughput DNA sequencing reveals huge numbers of repetitive sequences. Most bioinformatic studies focus on low-copy DNA including genes, and hence, the analyses collapse repeats in assemblies presenting only one or a few copies, often masking out and ignoring them in both DNA and RNA read data. Chromosomal studies are proving vital to examine the distribution and evolution of sequences because of the challenges of analysis of sequence data. Many questions are open about the origin, evolutionary mode and functions that repetitive sequences might have in the genome. Some, the satellite DNAs, are present in long arrays of similar motifs at a small number of sites, while others, particularly the transposable elements (DNA transposons and retrotranposons), are dispersed over regions of the genome; in both cases, sequence motifs may be located at relatively specific chromosome domains such as centromeres or subtelomeric regions. Here, we overview a range of works involving detailed characterization of the nature of all types of repetitive sequences, in particular their organization, abundance, chromosome localization, variation in sequence within and between chromosomes, and, importantly, the investigation of their transcription or expression activity. Comparison of the nature and locations of sequences between more, and less, related species is providing extensive information about their evolution and amplification. Some repetitive sequences are extremely well conserved between species, while others are among the most variable, defining differences between even closely relative species. These data suggest

  9. An inhibitor of eIF2 activity in the sRNA pool of eukaryotic cells.

    PubMed

    Centrella, Michael; Porter, David L; McCarthy, Thomas L

    2011-08-15

    Eukaryotic protein synthesis is a multi-step and highly controlled process that includes an early initiation complex containing eukaryotic initiation factor 2 (eIF2), GTP, and methionine-charged initiator methionyl-tRNA (met-tRNAi). During studies to reconstruct formation of the ternary complex containing these molecules, we detected a potent inhibitor in low molecular mass RNA (sRNA) preparations of eukaryotic tRNA. The ternary complex inhibitor (TCI) was retained in the total sRNA pool after met-tRNAi was charged by aminoacyl tRNA synthetase, co-eluted with sRNA by size exclusion chromatography, but resolved from met-tRNAi by ion exchange chromatography. The adverse effect of TCI was not overcome by high GTP or magnesium omission and was independent of GTP regeneration. Rather, TCI suppressed the rate of ternary complex formation, and disrupted protein synthesis and the accumulation of heavy polymeric ribosomes in reticulocyte lysates in vitro. Lastly, a component or components in ribosome depleted cell lysate significantly reversed TCI activity. Since assembly of the met-tRNAi/eIF2/GTP ternary complex is integral to protein synthesis, awareness of TCI is important to avoid confusion in studies of translation initiation. A clear definition of TCI may also allow a better appreciation of physiologic or pathologic situations, factors, and events that control protein synthesis in vivo.

  10. Distribution of dwell times of a ribosome: effects of infidelity, kinetic proofreading and ribosome crowding

    NASA Astrophysics Data System (ADS)

    Sharma, Ajeet K.; Chowdhury, Debashish

    2011-04-01

    Ribosome is a molecular machine that polymerizes a protein where the sequence of the amino acid residues, the monomers of the protein, is dictated by the sequence of codons (triplets of nucleotides) on a messenger RNA (mRNA) that serves as the template. The ribosome is a molecular motor that utilizes the template mRNA strand also as the track. Thus, in each step the ribosome moves forward by one codon and, simultaneously, elongates the protein by one amino acid. We present a theoretical model that captures most of the main steps in the mechanochemical cycle of a ribosome. The stochastic movement of the ribosome consists of an alternating sequence of pause and translocation; the sum of the durations of a pause and the following translocation is the time of dwell of the ribosome at the corresponding codon. We derive the analytical expression for the distribution of the dwell times of a ribosome in our model. Wherever experimental data are available, our theoretical predictions are consistent with those results. We suggest appropriate experiments to test the new predictions of our model, particularly the effects of the quality control mechanism of the ribosome and that of their crowding on the mRNA track.

  11. Studies on ribosomal RNA genes of mycobacteria including M. leprae.

    PubMed

    Katoch, V M; Shivannavar, C T; Datta, A K

    1989-01-01

    Information about specific genes specially of pathogenic mycobacteria could be used to unequivocally identify isolates of mycobacteria which are of clinical interest. Both eukaryotic and prokaryotic ribosomal RNA (rRNA) genes have been shown to comprise sequences which are conserved and others which are divergent. In the present study, rRNA genes from several cultivable mycobacteria including M. tuberculosis and armadillo derived M. leprae have been investigated. rRNA was isolated, made radioactive in vitro and then used to identify restriction fragments of DNA containing rRNA gene sequences. It was observed that restriction endonuclease patterns of rRNA genes are characteristic. By probing with homologous and heterologous rRNA probes, fragments hybridizing maximum with homologous probes could be identified and it appears that sequences flanking the rRNA genes are not identical. These fragments need to be further sequenced to identify the nucleotide sequences specific to rRNA gene cluster. It would also be necessary to analyse several isolates of each species including armadillo derived M. leprae before reaching any conclusions.

  12. Evolutionary Mobility of the Ribosomal DNA Array in Yeasts

    PubMed Central

    Proux-Wéra, Estelle; Byrne, Kevin P.; Wolfe, Kenneth H.

    2013-01-01

    The ribosomal DNA (rDNA) of eukaryotes is organized as large tandem arrays. Here, we compare the genomic locations of rDNA among yeast species and show that, despite its huge size (>1 Mb), the rDNA array has moved around the genome several times within the family Saccharomycetaceae. We identify an ancestral, nontelomeric, rDNA site that is conserved across many species including Saccharomyces cerevisiae. Within the genus Lachancea, however, the rDNA apparently transposed from the ancestral site to a new site internal to a different chromosome, becoming inserted into a short intergenic region beside a tRNA gene. In at least four other yeast lineages, the rDNA moved from the ancestral site to telomeric locations. Remarkably, both the ancestral rDNA site and the new site in Lachancea are adjacent to protein-coding genes whose products maintain the specialized chromatin structure of rDNA (HMO1 and CDC14, respectively). In almost every case where the rDNA was lost from the ancestral site, the entire array disappeared without any other rearrangements in the region, leaving just an intergenic spacer of less than 2 kb. The mechanism by which this large and complex locus moves around the genome is unknown, but we speculate that it may involve the formation of double-strand DNA breaks by Fob1 protein or the formation of extrachromosomal rDNA circles. PMID:23419706

  13. DNA homologies of ribosomal RNA genes of Neurospora species

    SciTech Connect

    Mukhopadhyay, D.K.; Mimiko, R.; Dutta, S.K.

    1980-01-01

    Ribosomal RNA genes (rDNAs) of Neurospora crassa contain DNA sequences which code for 17S, 5.8S, and 26S rRNAs, in addition to internal and external spacers. As has been reported for many eukaryotes, the DNA sequences which code for 17S, 5.8S, and 26S rRNAs in Neurospora species are probably conserved while the internal and external spacer regions are probably variable sequences. Extensive electron microscopic studies of 45S precursor rRNA of several cold and warm blooded animals confirm that spacer regions vary extensively from species to species. It was desirable to know whether such differences in rDNA sequences exist between Neurospora species. Any such difference should be detectable using standard procedures for DNA homology studies rDNA sequences were isolated from N. crassa mycelial cells using the procedure described previously. The purified rDNA was /sup 3/H-labeled (by nick translation) and reassociated with total DNA isolated from the heterothallic species N. crassa and from three homothalliospecies: N. dodgei, N. lineolata, and N. africana. In addition, /sup 32/P-labeled total DNA of N. crassa was reannealed with unlabeled bulk DNA from N. crassa, N. dodgei, and N. lineolata.

  14. 60S ribosomal protein L35 regulates β-casein translational elongation and secretion in bovine mammary epithelial cells.

    PubMed

    Jiang, Nan; Hu, Lijun; Liu, Chaonan; Gao, Xueli; Zheng, Shimin

    2015-10-01

    60S ribosomal protein L35 (RPL35) is an important component of the 60S ribosomal subunit and has a role in protein translation and endoplasmic reticulum (ER) docking. However, few studies have investigated RPL35 in eukaryotes and much remains to be learned. Here, we analyzed the function of RPL35 in β-casein (CSN2) synthesis and secretion in bovine mammary epithelial cells (BMECs). We found that methionine (Met) could promote the expressions of CSN2 and RPL35. Analysis of overexpression and inhibition of RPL35 confirmed that it could mediate the Met signal and regulate CSN2 expression. The mechanism of CSN2 regulation by RPL35 was analyzed by coimmunoprecipitation (Co-IP), colocalization, fluorescence resonance energy transfer (FRET) and gene mutation. We found that RPL35 could control ribosome translational elongation during synthesis of CSN2 by interacting with eukaryotic translational elongation factor 2 (eEF2), and that eEF2 was the signaling molecule downstream of RPL35 controlling this process. RPL35 could also control the secretion of CSN2 by locating it to the ER. Taken together, these results revealed that, RPL35 was an important positive regulatory factor involving in the Met-mediated regulation of CSN2 translational elongation and secretion.

  15. Solution Structure of Ribosomal Protein L40E, a Unique C4 Zinc Finger Protein Encoded by Archaeon Sulfolobus Solfataricus

    SciTech Connect

    Wu, Bin; Lukin, Jonathan A.; Yee, Adelinda; Lemak, Alexander; Semesi, Anthony; Ramelot, Theresa A.; Kennedy, Michael A.; Arrowsmith, Cheryl H.

    2008-01-31

    The ribosomal protein L40E from archaeon Sulfolobus solfataricus is a component of the 50S ribosomal subunit. L40E is a 56-residue, highly basic protein that contains a C4 zinc finger motif, CRKC_X10_CRRC. Homologs are found in both archaea and eukaryotes but are not present in bacteria. Eukaryotic genomes encode L40E as a ubiquitin-fusion protein. L40E was absent from the crystal structure of euryarchaeota 50S ribosomal subunit. Here we report the three-dimensional solution structure of L40E by NMR spectroscopy. The structure of L40E is a three-stranded b-sheet with a simple b2b1b3 topology. There are two unique characteristics revealed by the structure. First, a large and ordered b2–b3 loop twists to pack across the one side of the protein. L40E contains a buried polar cluster comprising Lys19, Lys20, Cys22, Asn29, and Cys36. Second, the surface of L40E is almost entirely positively charged. Ten conserved basic residues are positioned on the two sides of the surface. It is likely that binding of zinc is essential in stabilizing the tertiary structure of L40E to act as a scaffold to create a broad positively charged surface for RNA and/or protein recognition. A portion of this work was performed in the Environmental Molecular Sciences Facility, a DOE national scientific user facility.

  16. Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans

    PubMed Central

    Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel

    2016-01-01

    Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542

  17. Crystal structure of bacillus subtilis YdaF protein : a putative ribosomal N-acetyltransferase.

    SciTech Connect

    Brunzelle, J. S.; Wu, R.; Korolev, S. V.; Collart, F. R.; Joachimiak, A.; Anderson, W. F.; Biosciences Division; Northwestern Univ.; Saint Louis Univ. School of Medicine

    2004-12-01

    Comparative sequence analysis suggests that the ydaF gene encodes a protein (YdaF) that functions as an N-acetyltransferase, more specifically, a ribosomal N-acetyltransferase. Sequence analysis using basic local alignment search tool (BLAST) suggests that YdaF belongs to a large family of proteins (199 proteins found in 88 unique species of bacteria, archaea, and eukaryotes). YdaF also belongs to the COG1670, which includes the Escherichia coli RimL protein that is known to acetylate ribosomal protein L12. N-acetylation (NAT) has been found in all kingdoms. NAT enzymes catalyze the transfer of an acetyl group from acetyl-CoA (AcCoA) to a primary amino group. For example, NATs can acetylate the N-terminal {alpha}-amino group, the {epsilon}-amino group of lysine residues, aminoglycoside antibiotics, spermine/speridine, or arylalkylamines such as serotonin. The crystal structure of the alleged ribosomal NAT protein, YdaF, from Bacillus subtilis presented here was determined as a part of the Midwest Center for Structural Genomics. The structure maintains the conserved tertiary structure of other known NATs and a high sequence similarity in the presumed AcCoA binding pocket in spite of a very low overall level of sequence identity to other NATs of known structure.

  18. Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster

    PubMed Central

    Dunn, Joshua G; Foo, Catherine K; Belletier, Nicolette G; Gavis, Elizabeth R; Weissman, Jonathan S

    2013-01-01

    Ribosomes can read through stop codons in a regulated manner, elongating rather than terminating the nascent peptide. Stop codon readthrough is essential to diverse viruses, and phylogenetically predicted to occur in a few hundred genes in Drosophila melanogaster, but the importance of regulated readthrough in eukaryotes remains largely unexplored. Here, we present a ribosome profiling assay (deep sequencing of ribosome-protected mRNA fragments) for Drosophila melanogaster, and provide the first genome-wide experimental analysis of readthrough. Readthrough is far more pervasive than expected: the vast majority of readthrough events evolved within D. melanogaster and were not predicted phylogenetically. The resulting C-terminal protein extensions show evidence of selection, contain functional subcellular localization signals, and their readthrough is regulated, arguing for their importance. We further demonstrate that readthrough occurs in yeast and humans. Readthrough thus provides general mechanisms both to regulate gene expression and function, and to add plasticity to the proteome during evolution. DOI: http://dx.doi.org/10.7554/eLife.01179.001 PMID:24302569

  19. A Ribosome-Bound Quality Control Complex Triggers Degradation of Nascent Peptides and Signals Translation Stress

    PubMed Central

    Brandman, Onn; Stewart-Ornstein, Jacob; Wong, Daisy; Larson, Adam; Williams, Christopher C.; Li, Gene-Wei; Zhou, Sharleen; King, David; Shen, Peter S.; Weibezahn, Jimena; Dunn, Joshua G.; Rouskin, Silvi; Inada, Toshifumi; Frost, Adam; Weissman, Jonathan S.

    2012-01-01

    Summary The conserved transcriptional regulator Heat Shock Factor 1 (Hsf1) is a key sensor of proteotoxic and other stress in the eukaryotic cytosol, yet its regulation is poorly understood. We surveyed Hsf1 activity in a genome-wide loss-of-function library in Saccaromyces cerevisiae as well as ~78,000 double mutants and found Hsf1 activity to be modulated by highly diverse stresses. These included disruption of a ribosome-bound complex we named the Ribosome Quality Control Complex (RQC) comprising the Ltn1 E3 ubiquitin ligase, two highly conserved but poorly characterized proteins (Tae2 and Rqc1), and Cdc48 and its cofactors. Electron microscopy and biochemical analyses revealed that the RQC forms a stable complex with 60S ribosomal subunits containing stalled polypeptides and triggers their degradation. A negative feedback loop regulates the RQC and Hsf1 senses an RQC-mediated translation stress signal distinctly from other stresses. Our work reveals the range of stresses Hsf1 monitors and elucidates a conserved cotranslational protein quality control mechanism. PMID:23178123

  20. Comparison of Ribosomal RNA Removal Methods for Transcriptome Sequencing Workflows in Teleost Fish.

    PubMed

    Abernathy, Jason; Overturf, Ken

    2016-01-01

    RNA sequencing (RNA-Seq) is becoming the standard for transcriptome analysis. Removal of contaminating ribosomal RNA (rRNA) is a priority in the preparation of libraries suitable for sequencing. These methods have been well documented in mammals but typically require some optimization for lower vertebrates. Three commercial kits, including Dynabeads mRNA Purification Kit, RiboMinus Eukaryote System v2, and Ribo-Zero Gold rRNA Removal Kit were examined for the ability to remove rRNAs from rainbow trout (Oncorhynchus mykiss) RNA isolations. Total RNA was isolated from liver and muscle tissue samples (n = 24) and rRNAs removed using one of the three kits. Samples were analyzed visually on the Agilent Bioanalyzer and by Illumina RNA-seq, screening for Oncorhynchus rRNAs. There were significant differences between the kits in regards to their ability to remove rRNA, ranging from 2.74% - 10.94% rRNA sequences left behind per kit on average. Using the Bioanalyzer to evaluate ribosomal contamination in rRNA-depleted samples for RNA-Seq was good for detecting samples with higher concentrations of rRNA (>5%), but not very accurate at lower levels. Although all three kits were able to remove a substantial portion of the rRNA from different fish tissues, the Ribo-Zero Gold rRNA Removal Kit eliminated significantly more contaminating ribosomal RNAs than the others.

  1. Crystal structure of prokaryotic ribosomal protein L9: a bi-lobed RNA-binding protein.

    PubMed Central

    Hoffman, D W; Davies, C; Gerchman, S E; Kycia, J H; Porter, S J; White, S W; Ramakrishnan, V

    1994-01-01

    The crystal structure of protein L9 from the Bacillus stearothermophilus ribosome has been determined at 2.8 A resolution using X-ray diffraction methods. This primary RNA-binding protein has a highly elongated and unusual structure consisting of two separated domains joined by a long exposed alpha-helix. Conserved, positively charged and aromatic amino acids on the surfaces of both domains probably represent the sites of specific interactions with 23S rRNA. Comparisons with other prokaryotic L9 sequences show that while the length of the connecting alpha-helix is invariant, the sequence within the exposed central region is not conserved. This suggests that the alpha-helix has an architectural role and serves to fix the relative separation and orientation of the N- and C-terminal domains within the ribosome. The N-terminal domain has structural homology to the smaller ribosomal proteins L7/L12 and L30, and the eukaryotic RNA recognition motif (RRM). Images PMID:8306963

  2. The DEAD box protein Mrh4 functions in the assembly of the mitochondrial large ribosomal subunit.

    PubMed

    De Silva, Dasmanthie; Fontanesi, Flavia; Barrientos, Antoni

    2013-11-01

    Proteins in a cell are universally synthesized by ribosomes. Mitochondria contain their own ribosomes, which specialize in the synthesis of a handful of proteins required for oxidative phosphorylation. The pathway of mitoribosomal biogenesis and factors involved are poorly characterized. An example is the DEAD box proteins, widely known to participate in the biogenesis of bacterial and cytoplasmic eukaryotic ribosomes as either RNA helicases or RNA chaperones, whose mitochondrial counterparts remain completely unknown. Here, we have identified the Saccharomyces cerevisiae mitochondrial DEAD box protein Mrh4 as essential for large mitoribosome subunit biogenesis. Mrh4 interacts with the 21S rRNA, mitoribosome subassemblies, and fully assembled mitoribosomes. In the absence of Mrh4, the 21S rRNA is matured and forms part of a large on-pathway assembly intermediate missing proteins Mrpl16 and Mrpl39. We conclude that Mrh4 plays an essential role during the late stages of mitoribosome assembly by promoting remodeling of the 21S rRNA-protein interactions.

  3. Substitution rate calibration of small subunit ribosomal RNA identifies chlorarachniophyte endosymbionts as remnants of green algae.

    PubMed Central

    Van de Peer, Y; Rensing, S A; Maier, U G; De Wachter, R

    1996-01-01

    Chlorarachniophytes are amoeboid algae with chlorophyll a and b containing plastids that are surrounded by four membranes instead of two as in plants and green algae. These extra membranes form important support for the hypothesis that chlorarachniophytes have acquired their plastids by the ingestion of another eukaryotic plastid-containing alga. Chlorarachniophytes also contain a small nucleus-like structure called the nucleomorph situated between the two inner and the two outer membranes surrounding the plastid. This nucleomorph is a remnant of the endosymbiont's nucleus and encodes, among other molecules, small subunit ribosomal RNA. Previous phylogenetic analyses on the basis of this molecule provided unexpected and contradictory evidence for the origin of the chlorarachniophyte endosymbiont. We developed a new method for measuring the substitution rates of the individual nucleotides of small subunit ribosomal RNA. From the resulting substitution rate distribution, we derived an equation that gives a more realistic relationship between sequence dissimilarity and evolutionary distance than equations previously available. Phylogenetic trees constructed on the basis of evolutionary distances computed by this new method clearly situate the chlorarachniophyte nucleomorphs among the green algae. Moreover, this relationship is confirmed by transversion analysis of the Chlorarachnion plastid small subunit ribosomal RNA. PMID:8755544

  4. HflX is a ribosome-splitting factor rescuing stalled ribosomes under stress conditions.

    PubMed

    Zhang, Yanqing; Mandava, Chandra Sekhar; Cao, Wei; Li, Xiaojing; Zhang, Dejiu; Li, Ningning; Zhang, Yixiao; Zhang, Xiaoxiao; Qin, Yan; Mi, Kaixia; Lei, Jianlin; Sanyal, Suparna; Gao, Ning

    2015-11-01

    Adverse cellular conditions often lead to nonproductive translational stalling and arrest of ribosomes on mRNAs. Here, we used fast kinetics and cryo-EM to characterize Escherichia coli HflX, a GTPase with unknown function. Our data reveal that HflX is a heat shock-induced ribosome-splitting factor capable of dissociating vacant as well as mRNA-associated ribosomes with deacylated tRNA in the peptidyl site. Structural data demonstrate that the N-terminal effector domain of HflX binds to the peptidyl transferase center in a strikingly similar manner as that of the class I release factors and induces dramatic conformational changes in central intersubunit bridges, thus promoting subunit dissociation. Accordingly, loss of HflX results in an increase in stalled ribosomes upon heat shock. These results suggest a primary role of HflX in rescuing translationally arrested ribosomes under stress conditions. PMID:26458047

  5. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  6. HflX is a ribosome-splitting factor rescuing stalled ribosomes under stress conditions.

    PubMed

    Zhang, Yanqing; Mandava, Chandra Sekhar; Cao, Wei; Li, Xiaojing; Zhang, Dejiu; Li, Ningning; Zhang, Yixiao; Zhang, Xiaoxiao; Qin, Yan; Mi, Kaixia; Lei, Jianlin; Sanyal, Suparna; Gao, Ning

    2015-11-01

    Adverse cellular conditions often lead to nonproductive translational stalling and arrest of ribosomes on mRNAs. Here, we used fast kinetics and cryo-EM to characterize Escherichia coli HflX, a GTPase with unknown function. Our data reveal that HflX is a heat shock-induced ribosome-splitting factor capable of dissociating vacant as well as mRNA-associated ribosomes with deacylated tRNA in the peptidyl site. Structural data demonstrate that the N-terminal effector domain of HflX binds to the peptidyl transferase center in a strikingly similar manner as that of the class I release factors and induces dramatic conformational changes in central intersubunit bridges, thus promoting subunit dissociation. Accordingly, loss of HflX results in an increase in stalled ribosomes upon heat shock. These results suggest a primary role of HflX in rescuing translationally arrested ribosomes under stress conditions.

  7. The mRNA of human cytoplasmic arginyl-tRNA synthetase recruits prokaryotic ribosomes independently.

    PubMed

    Yang, Fang; Ji, Quan-Quan; Ruan, Liang-Liang; Ye, Qing; Wang, En-Duo

    2014-07-25

    There are two isoforms of cytoplasmic arginyl-tRNA synthetase (hcArgRS) in human cells. The long form is a component of the multiple aminoacyl-tRNA synthetase complex, and the other is an N-terminal truncated form (NhcArgRS), free in the cytoplasm. It has been shown that the two forms of ArgRS arise from alternative translational initiation in a single mRNA. The short form is produced from the initiation at a downstream, in-frame AUG start codon. Interestingly, our data suggest that the alternative translational initiation of hcArgRS mRNA also takes place in Escherichia coli transformants. When the gene encoding full-length hcArgRS was overexpressed in E. coli, two forms of hcArgRS were observed. The N-terminal sequencing experiment identified that the short form was identical to the NhcArgRS in human cytoplasm. By constructing a bicistronic system, our data support that the mRNA encoding the N-terminal extension of hcArgRS has the capacity of independently recruiting E. coli ribosomes. Furthermore, two critical elements for recruiting prokaryotic ribosomes were identified, the “AGGA” core of the Shine-Dalgarno sequence and the “A-rich” sequence located just proximal to the alternative in-frame initiation site. Although the mechanisms of prokaryotic and eukaryotic translational initiation are distinct, they share some common features. The ability of the hcArgRS mRNA to recruit the prokaryotic ribosome may provide clues for shedding light on the mechanism of alternative translational initiation of hcArgRS mRNA in eukaryotic cells.

  8. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  9. [Study of the surface of Escherichia coli ribosomes and ribosomal particles by the tritium bombardment method].

    PubMed

    Iusupov, M M; Spirin, A S

    1986-11-01

    A new technique of atomic tritium bombardment has been used to study the surface topography of Escherichia coli ribosomes and ribosomal subunits. The technique provides for the labeling of proteins exposed on the surface of ribosomal particles, the extent of protein labeling being proportional to the degree of exposure. The following proteins were considerably tritiated in the 70S ribosomes: S1, S4, S7, S9 and/or S11, S12 and/or L20, S13, S18, S20, S21, L1, L5, L6, L7/L12, L10, L11, L16, L17, L24, L26 and L27. A conclusion is drawn that these proteins are exposed on the ribosome surface to an essentially greater extent than the others. Dissociation of 70S ribosomes into the ribosomal subunits by decreasing Mg2+ concentration does not lead to the exposure of additional ribosomal proteins. This implies that there are no proteins on the contacting surfaces of the subunits. However, if a mixture of subunits has been subjected to centrifugation in a low Mg2+ concentration at high concentrations of a monovalent cation, proteins S3, S5, S7, S14, S18 and L16 are more exposed on the surface of the isolated 30S and 50S subunits than in the subunit mixture or in the 70S ribosomes. The exposure of additional proteins is explained by distortion of the native quaternary structure of ribosomal subunits as a result of the separation procedure. Reassociation of isolated subunits at high Mg2+ concentration results in shielding of proteins S3, S5, S7 and S18 and can be explained by reconstitution of the intact 30S subunit structure. PMID:3542056

  10. The extent of protist diversity: insights from molecular ecology of freshwater eukaryotes.

    PubMed

    Slapeta, Jan; Moreira, David; López-García, Purificación

    2005-10-01

    Classical studies on protist diversity of freshwater environments worldwide have led to the idea that most species of microbial eukaryotes are known. One exemplary case would be constituted by the ciliates, which have been claimed to encompass a few thousands of ubiquitous species, most of them already described. Recently, molecular methods have revealed an unsuspected protist diversity, especially in oceanic as well as some extreme environments, suggesting the occurrence of a hidden diversity of eukaryotic lineages. In order to test if this holds also for freshwater environments, we have carried out a molecular survey of small subunit ribosomal RNA genes in water and sediment samples of two ponds, one oxic and another suboxic, from the same geographic area. Our results show that protist diversity is very high. The majority of phylotypes affiliated within a few well established eukaryotic kingdoms or phyla, including alveolates, cryptophytes, heterokonts, Cercozoa, Centroheliozoa and haptophytes, although a few sequences did not display a clear taxonomic affiliation. The diversity of sequences within groups was very large, particularly that of ciliates, and a number of them were very divergent from known species, which could define new intra-phylum groups. This suggests that, contrary to current ideas, the diversity of freshwater protists is far from being completely described. PMID:16191619

  11. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity.

    PubMed

    Moon-van der Staay, S Y; De Wachter, R; Vaulot, D

    2001-02-01

    Picoplankton--cells with a diameter of less than 3 microm--are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75 m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  12. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity

    NASA Astrophysics Data System (ADS)

    Moon-van der Staay, Seung Yeo; De WachterRDanielVaulot, RupertDe WachterR.Daniel

    2001-02-01

    Picoplankton-cells with a diameter of less than 3µm-are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  13. Large variability of bathypelagic microbial eukaryotic communities across the world's oceans.

    PubMed

    Pernice, Massimo C; Giner, Caterina R; Logares, Ramiro; Perera-Bel, Júlia; Acinas, Silvia G; Duarte, Carlos M; Gasol, Josep M; Massana, Ramon

    2016-04-01

    In this work, we study the diversity of bathypelagic microbial eukaryotes (0.8-20 μm) in the global ocean. Seawater samples from 3000 to 4000 m depth from 27 stations in the Atlantic, Pacific and Indian Oceans were analyzed by pyrosequencing the V4 region of the 18S ribosomal DNA. The relative abundance of the most abundant operational taxonomic units agreed with the results of a parallel metagenomic analysis, suggesting limited PCR biases in the tag approach. Although rarefaction curves for single stations were seldom saturated, the global analysis of all sequences together suggested an adequate recovery of bathypelagic diversity. Community composition presented a large variability among samples, which was poorly explained by linear geographic distance. In fact, the similarity between communities was better explained by water mass composition (26% of the variability) and the ratio in cell abundance between prokaryotes and microbial eukaryotes (21%). Deep diversity appeared dominated by four taxonomic groups (Collodaria, Chrysophytes, Basidiomycota and MALV-II) appearing in different proportions in each sample. Novel diversity amounted to 1% of the pyrotags and was lower than expected. Our study represents an essential step in the investigation of bathypelagic microbial eukaryotes, indicating dominating taxonomic groups and suggesting idiosyncratic assemblages in distinct oceanic regions. PMID:26451501

  14. The extent of protist diversity: insights from molecular ecology of freshwater eukaryotes.

    PubMed

    Slapeta, Jan; Moreira, David; López-García, Purificación

    2005-10-01

    Classical studies on protist diversity of freshwater environments worldwide have led to the idea that most species of microbial eukaryotes are known. One exemplary case would be constituted by the ciliates, which have been claimed to encompass a few thousands of ubiquitous species, most of them already described. Recently, molecular methods have revealed an unsuspected protist diversity, especially in oceanic as well as some extreme environments, suggesting the occurrence of a hidden diversity of eukaryotic lineages. In order to test if this holds also for freshwater environments, we have carried out a molecular survey of small subunit ribosomal RNA genes in water and sediment samples of two ponds, one oxic and another suboxic, from the same geographic area. Our results show that protist diversity is very high. The majority of phylotypes affiliated within a few well established eukaryotic kingdoms or phyla, including alveolates, cryptophytes, heterokonts, Cercozoa, Centroheliozoa and haptophytes, although a few sequences did not display a clear taxonomic affiliation. The diversity of sequences within groups was very large, particularly that of ciliates, and a number of them were very divergent from known species, which could define new intra-phylum groups. This suggests that, contrary to current ideas, the diversity of freshwater protists is far from being completely described.

  15. Ribonuclease H: the enzymes in Eukaryotes

    PubMed Central

    Cerritelli, Susana M.; Crouch, Robert J.

    2009-01-01

    Summary Ribonucleases H are enzymes that cleave the RNA of RNA/DNA hybrids that form during replication and repair and which could lead to DNA instability if they were not processed. There are two main types of RNases H, and at least one of them is present in most organisms. Eukaryotic RNases H are larger and more complex than their prokaryotic counterparts. Eukaryotic RNase H1 has acquired a Hybrid Binding Domain that confers processivity and affinity for the substrate, while eukaryotic RNase H2 is composed of three different proteins: the catalytic subunit (2A), similar to the monomeric prokaryotic RNase HII, and two other subunits (2B and 2C) that have no prokaryotic counterparts and as yet unknown functions, but that are necessary for catalysis. In this review, we discuss some of the most recent findings on eukaryotic RNases H1 and H2, focusing on the structural data on complexes between human RNase H1 and RNA/DNA hybrids that had provided great detail of how the Hybrid Binding- and RNase H-domains recognize and cleave the RNA strand of the hybrid substrates. We also describe the progress made in understanding the in vivo function of eukaryotic RNases H. While prokayotes and some single-cell eukaryotes do not require RNases H for viability, in higher eukaryotes RNases H are essential. Rnaseh1 null mice arrest development around E8.5 because RNase H1 is necessary during embryogenesis for mitochondrial DNA replication. Mutations in any of the three subunits of human RNase H2 cause Aicardi-Goutiéres Syndrome (AGS), a human neurological disorder with devastating consequences. PMID:19228196

  16. tRNA-derived short RNAs bind to Saccharomyces cerevisiae ribosomes in a stress-dependent manner and inhibit protein synthesis in vitro

    PubMed Central

    Bąkowska-Żywicka, Kamilla; Kasprzyk, Marta; Twardowski, Tomasz

    2016-01-01

    Recently, a number of ribosome-associated non-coding RNAs (rancRNAs) have been discovered in all three domains of life. In our previous studies, we have described several types of rancRNAs in Saccharomyces cerevisiae, derived from many cellular RNAs, including mRNAs, rRNAs, tRNAs and snoRNAs. Here, we present the evidence that the tRNA fragments from simple eukaryotic organism S. cerevisiae directly bind to the ribosomes. Interestingly, rancRNA-tRFs in yeast are derived from both, 5′- and 3′-part of the tRNAs and both types of tRFs associate with the ribosomes in vitro. The location of tRFs within the ribosomes is distinct from classical A- and P-tRNA binding sites. Moreover, 3′-tRFs bind to the distinct site than 5′-tRFs. These interactions are stress dependent and as a consequence, provoke regulation of protein biosynthesis. We observe strong correlation between tRF binding to the ribosomes and inhibition of protein biosynthesis in particular environmental conditions. These results implicate the existence of an ancient and conserved mechanism of translation regulation with the involvement of ribosome-associating tRNA-derived fragments. PMID:27609601

  17. Ribosomes in the squid giant axon.

    PubMed

    Bleher, R; Martin, R

    2001-01-01

    Ribosome clusters, referred to as endoaxoplasmic plaques, were documented and quantitatively analyzed in the squid giant axon at the light and electron microscopic levels. The methods included nonspecific high affinity fluorescence staining of RNA by YOYO-1, specific immunofluorescence labeling of ribosomal RNA, electron energy loss spectroscopic mapping of ribosomal phosphorus, and conventional transmission electron microscopy. The endoaxoplasmic plaques were sharply defined, oval in shape, and less than 2 microm in diameter. While they were very numerous in the postsynaptic axonal area of the giant synapse, the frequency of occurrence was much lower in the peripheral giant axon, with a density of about 1 plaque/1000 microm3. Their distribution was random within axoplasm, with no preferential localization near the membrane. The several thousand ribosomes in a plaque usually were not membrane bound, but vesicular structures were observed in or near plaques; plaques were often surrounded by mitochondria. We conclude that ribosomes, a requisite machinery for protein synthesis, are present in the squid giant axon in discrete configurations.

  18. Contribution of the 80s loop of HIV-1 protease to the multidrug-resistance mechanism: crystallographic study of MDR769 HIV-1 protease variants

    SciTech Connect

    Yedidi, Ravikiran S.; Proteasa, Georghe; Martinez, Jorge L.; Vickrey, John F.; Martin, Philip D.; Wawrzak, Zdzislaw; Liu, Zhigang; Kovari, Iulia A.; Kovari, Ladislau C.

    2011-09-06

    The flexible flaps and the 80s loops (Pro79-Ile84) of HIV-1 protease are crucial in inhibitor binding. Previously, it was reported that the crystal structure of multidrug-resistant 769 (MDR769) HIV-1 protease shows a wide-open conformation of the flaps owing to conformational rigidity acquired by the accumulation of mutations. In the current study, the effect of mutations on the conformation of the 80s loop of MDR769 HIV-1 protease variants is reported. Alternate conformations of Pro81 (proline switch) with a root-mean-square deviation of 3-4.8 {angstrom} in the C{alpha} atoms of the I10V mutant and a side chain with a 'flipped-out' conformation in the A82F mutant cause distortion in the S1/S1' binding pockets that affects inhibitor binding. The A82S and A82T mutants show local changes in the electrostatics of inhibitor binding owing to the mutation from nonpolar to polar residues. In summary, the crystallographic studies of four variants of MDR769 HIV-1 protease presented in this article provide new insights towards understanding the drug-resistance mechanism as well as a basis for design of future protease inhibitors with enhanced potency.

  19. Sequence analysis of genes encoding ribosomal proteins of amitochondriate protists: L1 of Trichomonas vaginalis and L29 of Giardia lamblia.

    PubMed

    Wu, G; Hashimoto, T

    1999-08-01

    Two genes encoding the ribosomal proteins were cloned and sequenced from amitochondriate protists, L1 (L10a in mammalian nomenclature) from Trichomonas vaginalis and L29 (L35 in mammalian nomenclature) from Giardia lamblia. The deduced amino acid sequences were analyzed by sequence alignments and phylogenetic reconstructions. Both the T. vaginalis L1 and the G. lamblia L29 displayed eukaryotic sequence features, when compared with all the homologs from the three primary kingdoms.

  20. Evolution of proteasome regulators in eukaryotes.

    PubMed

    Fort, Philippe; Kajava, Andrey V; Delsuc, Fredéric; Coux, Olivier

    2015-05-01

    All living organisms require protein degradation to terminate biological processes and remove damaged proteins. One such machine is the 20S proteasome, a specialized barrel-shaped and compartmentalized multicatalytic protease. The activity of the 20S proteasome generally requires the binding of regulators/proteasome activators (PAs), which control the entrance of substrates. These include the PA700 (19S complex), which assembles with the 20S and forms the 26S proteasome and allows the efficient degradation of proteins usually labeled by ubiquitin tags, PA200 and PA28, which are involved in proteolysis through ubiquitin-independent mechanisms and PI31, which was initially identified as a 20S inhibitor in vitro. Unlike 20S proteasome, shown to be present in all Eukaryotes and Archaea, the evolutionary history of PAs remained fragmentary. Here, we made a comprehensive survey and phylogenetic analyses of the four types of regulators in 17 clades covering most of the eukaryotic supergroups. We found remarkable conservation of each PA700 subunit in all eukaryotes, indicating that the current complex PA700 structure was already set up in the last eukaryotic common ancestor (LECA). Also present in LECA, PA200, PA28, and PI31 showed a more contrasted evolutionary picture, because many lineages have subsequently lost one or two of them. The paramount conservation of PA700 composition in all eukaryotes and the dynamic evolution of PA200, PA28, and PI31 are discussed in the light of current knowledge on their physiological roles.

  1. Evolution of Proteasome Regulators in Eukaryotes

    PubMed Central

    Fort, Philippe; Kajava, Andrey V.; Delsuc, Fredéric; Coux, Olivier

    2015-01-01

    All living organisms require protein degradation to terminate biological processes and remove damaged proteins. One such machine is the 20S proteasome, a specialized barrel-shaped and compartmentalized multicatalytic protease. The activity of the 20S proteasome generally requires the binding of regulators/proteasome activators (PAs), which control the entrance of substrates. These include the PA700 (19S complex), which assembles with the 20S and forms the 26S proteasome and allows the efficient degradation of proteins usually labeled by ubiquitin tags, PA200 and PA28, which are involved in proteolysis through ubiquitin-independent mechanisms and PI31, which was initially identified as a 20S inhibitor in vitro. Unlike 20S proteasome, shown to be present in all Eukaryotes and Archaea, the evolutionary history of PAs remained fragmentary. Here, we made a comprehensive survey and phylogenetic analyses of the four types of regulators in 17 clades covering most of the eukaryotic supergroups. We found remarkable conservation of each PA700 subunit in all eukaryotes, indicating that the current complex PA700 structure was already set up in the last eukaryotic common ancestor (LECA). Also present in LECA, PA200, PA28, and PI31 showed a more contrasted evolutionary picture, because many lineages have subsequently lost one or two of them. The paramount conservation of PA700 composition in all eukaryotes and the dynamic evolution of PA200, PA28, and PI31 are discussed in the light of current knowledge on their physiological roles. PMID:25943340

  2. Comparative genomics and evolution of eukaryotic phospholipidbiosynthesis

    SciTech Connect

    Lykidis, Athanasios

    2006-12-01

    Phospholipid biosynthetic enzymes produce diverse molecular structures and are often present in multiple forms encoded by different genes. This work utilizes comparative genomics and phylogenetics for exploring the distribution, structure and evolution of phospholipid biosynthetic genes and pathways in 26 eukaryotic genomes. Although the basic structure of the pathways was formed early in eukaryotic evolution, the emerging picture indicates that individual enzyme families followed unique evolutionary courses. For example, choline and ethanolamine kinases and cytidylyltransferases emerged in ancestral eukaryotes, whereas, multiple forms of the corresponding phosphatidyltransferases evolved mainly in a lineage specific manner. Furthermore, several unicellular eukaryotes maintain bacterial-type enzymes and reactions for the synthesis of phosphatidylglycerol and cardiolipin. Also, base-exchange phosphatidylserine synthases are widespread and ancestral enzymes. The multiplicity of phospholipid biosynthetic enzymes has been largely generated by gene expansion in a lineage specific manner. Thus, these observations suggest that phospholipid biosynthesis has been an actively evolving system. Finally, comparative genomic analysis indicates the existence of novel phosphatidyltransferases and provides a candidate for the uncharacterized eukaryotic phosphatidylglycerol phosphate phosphatase.

  3. Atypical mitochondrial inheritance patterns in eukaryotes.

    PubMed

    Breton, Sophie; Stewart, Donald T

    2015-10-01

    Mitochondrial DNA (mtDNA) is predominantly maternally inherited in eukaryotes. Diverse molecular mechanisms underlying the phenomenon of strict maternal inheritance (SMI) of mtDNA have been described, but the evolutionary forces responsible for its predominance in eukaryotes remain to be elucidated. Exceptions to SMI have been reported in diverse eukaryotic taxa, leading to the prediction that several distinct molecular mechanisms controlling mtDNA transmission are present among the eukaryotes. We propose that these mechanisms will be better understood by studying the deviations from the predominating pattern of SMI. This minireview summarizes studies on eukaryote species with unusual or rare mitochondrial inheritance patterns, i.e., other than the predominant SMI pattern, such as maternal inheritance of stable heteroplasmy, paternal leakage of mtDNA, biparental and strictly paternal inheritance, and doubly uniparental inheritance of mtDNA. The potential genes and mechanisms involved in controlling mitochondrial inheritance in these organisms are discussed. The linkage between mitochondrial inheritance and sex determination is also discussed, given that the atypical systems of mtDNA inheritance examined in this minireview are frequently found in organisms with uncommon sexual systems such as gynodioecy, monoecy, or andromonoecy. The potential of deviations from SMI for facilitating a better understanding of a number of fundamental questions in biology, such as the evolution of mtDNA inheritance, the coevolution of nuclear and mitochondrial genomes, and, perhaps, the role of mitochondria in sex determination, is considerable.

  4. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5' UTRs and its implications for eukaryotic gene translation regulation.

    PubMed

    Pánek, Josef; Kolár, Michal; Vohradský, Jirí; Shivaya Valásek, Leos

    2013-09-01

    There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA-rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5' untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5' UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5' UTRs of mRNAs.

  5. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  6. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements.

  7. Single-molecule observations of ribosome function.

    PubMed

    Blanchard, Scott C

    2009-02-01

    Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors and potentially many other cellular ligands that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events.

  8. What was the real contribution of endosymbionts to the eukaryotic nucleus? Insights from photosynthetic eukaryotes.

    PubMed

    Moreira, David; Deschamps, Philippe

    2014-07-01

    Eukaryotic genomes are composed of genes of different evolutionary origins. This is especially true in the case of photosynthetic eukaryotes, which, in addition to typical eukaryotic genes and genes of mitochondrial origin, also contain genes coming from the primary plastids and, in the case of secondary photosynthetic eukaryotes, many genes provided by the nuclei of red or green algal endosymbionts. Phylogenomic analyses have been applied to detect those genes and, in some cases, have led to proposing the existence of cryptic, no longer visible endosymbionts. However, detecting them is a very difficult task because, most often, those genes were acquired a long time ago and their phylogenetic signal has been heavily erased. We revisit here two examples, the putative cryptic endosymbiosis of green algae in diatoms and chromerids and of Chlamydiae in the first photosynthetic eukaryotes. We show that the evidence sustaining them has been largely overestimated, and we insist on the necessity of careful, accurate phylogenetic analyses to obtain reliable results.

  9. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  10. Methylation of ribosomal protein S10 by protein-arginine methyltransferase 5 regulates ribosome biogenesis.

    PubMed

    Ren, Jinqi; Wang, Yaqing; Liang, Yuheng; Zhang, Yongqing; Bao, Shilai; Xu, Zhiheng

    2010-04-23

    Modulation of ribosomal assembly is a fine tuning mechanism for cell number and organ size control. Many ribosomal proteins undergo post-translational modification, but their exact roles remain elusive. Here, we report that ribosomal protein s10 (RPS10) is a novel substrate of an oncoprotein, protein-arginine methyltransferase 5 (PRMT5). We show that PRMT5 interacts with RPS10 and catalyzes its methylation at the Arg(158) and Arg(160) residues. The methylation of RPS10 at Arg(158) and Arg(160) plays a role in the proper assembly of ribosomes, protein synthesis, and optimal cell proliferation. The RPS10-R158K/R160K mutant is not efficiently assembled into ribosomes and is unstable and prone to degradation by the proteasomal pathway. In nucleoli, RPS10 interacts with nucleophosmin/B23 and is predominantly concentrated in the granular component region, which is required for ribosome assembly. The RPS10 methylation mutant interacts weakly with nucleophosmin/B23 and fails to concentrate in the granular component region. Our results suggest that PRMT5 is likely to regulate cell proliferation through the methylation of ribosome proteins, and thus reveal a novel mechanism for PRMT5 in tumorigenesis.

  11. Challenges for the 80's

    SciTech Connect

    Lesch, J.R.

    1980-09-01

    Finding and developing the necessary petroleum reserves in the 1980's will require drilling deeper wells in more hostile environments, drilling in increasing water depths, drilling in hostile Arctic areas and in waters where icebergs must be dealt with, and exploring deeper onshore horizons in more difficult topographical areas. These conditions impose severe demands on drilling and production equipment. The deeper wells will challenge drilling and production capabilities because of higher down-hole temperatures, greater capacity requirements on surface equipment, and more critical demands on the associated down-hole equipment. Drilling fluids, tools, and elastomers will need to withstand higher temperatures and greater stresses. Drilling in deeper waters will require the development and refinement of better and more economical drilling and production platforms. Increased drilling from platforms will necessitate improved drilling fluids to minimize torque, drill string, and casing wear in highly deviated holes. Another technological challenge is rig automation to minimize the physical work and injury factors associated with tripping and to reduce personnel requirements on the drilling rig.

  12. Prototypes for the 80s.

    ERIC Educational Resources Information Center

    Instructor, 1980

    1980-01-01

    Presented are brief descriptions of the winning entries in this magazine's contest for existing programs to serve as prototypes for wide-scale use in elementary schools of the 1980s. Top prizes went to computer literacy, energy education, and nutrition projects. Twenty runners-up are also described. Project addresses are included. (SJL)

  13. Structure and function of eukaryotic chromosomes

    SciTech Connect

    Hennig, W.

    1987-01-01

    Contents: Introduction; Polytene Chromosomel Giant Chromosomes in Ciliates; The sp-I Genes in the Balbiani Rings of Chironomus Salivary Glands; The White Locus of Drosophila Melanogaster; The Genetic and Molecular Organization of the Dense Cluster of Functionally Related Vital Genes in the DOPA Decarboxylase Region of the Drosophila melanogaster Genome; Heat Shock Puffs and Response to Environmental Stress; The Y Chromosomal Lampbrush Loops of Drosophila; Contributions of Electron Microscopic Spreading Preparations (''Miller Spreads'') to the Analysis of Chromosome Structure; Replication of DNA in Eukaryotic Chromosomes; Gene Amplification in Dipteran Chromosomes; The Significance of Plant Transposable Elements in Biologically Relevant Processes; Arrangement of Chromosomes in Interphase Cell Nuclei; Heterochromatin and the Phenomenon of Chromosome Banding; Multiple Nonhistone Protein-DNA Complexes in Chromatin Regulate the Cell- and Stage-Specific Activity of an Eukaryotic Gene; Genetics of Sex Determination in Eukaryotes; Application of Basic Chromosome Research in Biotechnology and Medicine. This book presents an overview of various aspects of chromosome research.

  14. Force generation in a regrowing eukaryotic flagellum

    NASA Astrophysics Data System (ADS)

    Polin, Marco; Bruneau, Bastien; Johnson, Thomas; Goldstein, Raymond

    2012-02-01

    Flagella are whip-like organelles with a complex internal structure, the axoneme, highly conserved across eukaryotic species. The highly regulated activity of motor proteins arranged along the axoneme moves the flagellum in the surrounding fluid, generating forces that can be used for swimming or fluid propulsion. Although our understanding of the general mechanism behind flagellar motion is well established, the details of its implementation in a real axoneme is still poorly understood. Here we explore the inner working of the eukaryotic flagellum using a uniflagellated mutant of the unicellular green alga Chlamydomonas reinhardtii to investigate in detail the force and power generated by a moving flagellum during axonemal regrowth after deflagellation. These experiments will contribute to our understanding of the inner working of the eukaryotic flagellum.

  15. Osmosensing and osmoregulation in unicellular eukaryotes.

    PubMed

    Suescún-Bolívar, Luis Parmenio; Thomé, Patricia Elena

    2015-03-01

    Eukaryotic microorganisms possess mechanisms to detect osmotic variations in their surroundings, from specialized receptors and membrane transporters, to sophisticated systems such as two-component histidine kinases. Osmotic stimuli are transduced through conserved phosphorylation cascades that result in a rapid response to mitigate stress. This response allows for the maintenance of an optimal biochemical environment for cell functioning, as well as a suitable recovery in suboptimal environments that would otherwise endanger cell survival. The molecular basis of these responses has been largely studied in yeasts and bacteria. However, fewer studies have been published concerning the molecular basis of osmoregulation in other eukaryotic microorganisms such as protozoans and microalgae. Here, we review the main osmosensors reported in unicellular eukaryotic microorganisms (yeasts, microalgae and protozoa) and the pathways that maintain homeostasis in cells encountering hyperosmotic challenges.

  16. Reinitiation enhances reliable transcriptional responses in eukaryotes.

    PubMed

    Liu, Bo; Yuan, Zhanjiang; Aihara, Kazuyuki; Chen, Luonan

    2014-08-01

    Gene transcription is a noisy process carried out by the transcription machinery recruited to the promoter. Noise reduction is a fundamental requirement for reliable transcriptional responses which in turn are crucial for signal transduction. Compared with the relatively simple transcription initiation in prokaryotes, eukaryotic transcription is more complex partially owing to its additional reinitiation mechanism. By theoretical analysis, we showed that reinitiation reduces noise in eukaryotic transcription independent of the transcription level. Besides, a higher reinitiation rate enables a stable scaffold complex an advantage in noise reduction. Finally, we showed that the coupling between scaffold formation and transcription can further reduce transcription noise independent of the transcription level. Furthermore, compared with the reinitiation mechanism, the noise reduction effect of the coupling can be of more significance in the case that the transcription level is low and the intrinsic noise dominates. Our results uncover a mechanistic route which eukaryotes may use to facilitate a more reliable response in the noisy transcription process. PMID:24850905

  17. Mitochondrion-related organelles in eukaryotic protists.

    PubMed

    Shiflett, April M; Johnson, Patricia J

    2010-01-01

    The discovery of mitochondrion-type genes in organisms thought to lack mitochondria led to the demonstration that hydrogenosomes share a common ancestry with mitochondria, as well as the discovery of mitosomes in multiple eukaryotic lineages. No examples of examined eukaryotes lacking a mitochondrion-related organelle exist, implying that the endosymbiont that gave rise to the mitochondrion was present in the first eukaryote. These organelles, known as hydrogenosomes, mitosomes, or mitochondrion-like organelles, are typically reduced, both structurally and biochemically, relative to classical mitochondria. However, despite their diversification and adaptation to different niches, all appear to play a role in Fe-S cluster assembly, as observed for mitochondria. Although evidence supports the use of common protein targeting mechanisms in the biogenesis of these diverse organelles, divergent features are also apparent. This review examines the metabolism and biogenesis of these organelles in divergent unicellular microbes, with a focus on parasitic protists.

  18. A translation system reconstituted with human factors proves that processing of encephalomyocarditis virus proteins 2A and 2B occurs in the elongation phase of translation without eukaryotic release factors.

    PubMed

    Machida, Kodai; Mikami, Satoshi; Masutani, Mamiko; Mishima, Kurumi; Kobayashi, Tominari; Imataka, Hiroaki

    2014-11-14

    The genomic RNA of encephalomyocarditis virus (EMCV) encodes a single polyprotein, and the primary scission of the polyprotein occurs between nonstructural proteins 2A and 2B by an unknown mechanism. To gain insight into the mechanism of 2A-2B processing, we first translated the 2A-2B region in vitro with eukaryotic and prokaryotic translation systems. The 2A-2B processing occurred only in the eukaryotic systems, not in the prokaryotic systems, and the unprocessed 2A-2B protein synthesized by a prokaryotic system remained uncleaved when incubated with a eukaryotic cell extract. These results suggest that 2A-2B processing is a eukaryote-specific, co-translational event. To define the translation factors required for 2A-2B processing, we constituted a protein synthesis system with eukaryotic elongation factors 1 and 2, eukaryotic release factors 1 and 3 (eRF1 and eRF3), aminoacyl-tRNA synthetases, tRNAs, ribosome subunits, and a plasmid template that included the hepatitis C virus internal ribosome entry site. We successfully reproduced 2A-2B processing in the reconstituted system even without eRFs. Our results indicate that this unusual event occurs in the elongation phase of translation.

  19. The eukaryotic translation initiation regulator CDC123 defines a divergent clade of ATP-grasp enzymes with a predicted role in novel protein modifications.

    PubMed

    Burroughs, A Maxwell; Zhang, Dapeng; Aravind, L

    2015-05-15

    Deciphering the origin of uniquely eukaryotic features of sub-cellular systems, such as the translation apparatus, is critical in reconstructing eukaryogenesis. One such feature is the highly conserved, but poorly understood, eukaryotic protein CDC123, which regulates the abundance of the eukaryotic translation initiation eIF2 complex and binds one of its components eIF2γ. We show that the eukaryotic protein CDC123 defines a novel clade of ATP-grasp enzymes distinguished from all other members of the superfamily by a RAGNYA domain with two conserved lysines (henceforth the R2K clade). Combining the available biochemical and genetic data on CDC123 with the inferred enzymatic function, we propose that the eukaryotic CDC123 proteins are likely to function as ATP-dependent protein-peptide ligases which modify proteins by ribosome-independent addition of an oligopeptide tag. We also show that the CDC123 family emerged first in bacteria where it appears to have diversified along with the two other families of the R2K clade. The bacterial CDC123 family members are of two distinct types, one found as part of type VI secretion systems which deliver polymorphic toxins and the other functioning as potential effectors delivered to amoeboid eukaryotic hosts. Representatives of the latter type have also been independently transferred to phylogenetically unrelated amoeboid eukaryotes and their nucleo-cytoplasmic large DNA viruses. Similarly, the two other prokaryotic R2K clade families are also proposed to participate in biological conflicts between bacteriophages and their hosts. These findings add further evidence to the recently proposed hypothesis that the horizontal transfer of enzymatic effectors from the bacterial endosymbionts of the stem eukaryotes played a fundamental role in the emergence of the characteristically eukaryotic regulatory systems and sub-cellular structures.

  20. Saccharomyces cerevisiae Nip7p is required for efficient 60S ribosome subunit biogenesis.

    PubMed Central

    Zanchin, N I; Roberts, P; DeSilva, A; Sherman, F; Goldfarb, D S

    1997-01-01

    The Saccharomyces cerevisiae temperature-sensitive (ts) allele nip7-1 exhibits phenotypes associated with defects in the translation apparatus, including hypersensitivity to paromomycin and accumulation of halfmer polysomes. The cloned NIP7+ gene complemented the nip7-1 ts growth defect, the paromomycin hypersensitivity, and the halfmer defect. NIP7 encodes a 181-amino-acid protein (21 kDa) with homology to predicted products of open reading frames from humans, Caenorhabditis elegans, and Arabidopsis thaliana, indicating that Nip7p function is evolutionarily conserved. Gene disruption analysis demonstrated that NIP7 is essential for growth. A fraction of Nip7p cosedimented through sucrose gradients with free 60S ribosomal subunits but not with 80S monosomes or polysomal ribosomes, indicating that it is not a ribosomal protein. Nip7p was found evenly distributed throughout the cytoplasm and nucleus by indirect immunofluorescence; however, in vivo localization of a Nip7p-green fluorescent protein fusion protein revealed that a significant amount of Nip7p is present inside the nucleus, most probably in the nucleolus. Depletion of Nip7-1p resulted in a decrease in protein synthesis rates, accumulation of halfmers, reduced levels of 60S subunits, and, ultimately, cessation of growth. Nip7-1p-depleted cells showed defective pre-rRNA processing, including accumulation of the 35S rRNA precursor, presence of a 23S aberrant precursor, decreased 20S pre-rRNA levels, and accumulation of 27S pre-rRNA. Delayed processing of 27S pre-rRNA appeared to be the cause of reduced synthesis of 25S rRNA relative to 18S rRNA, which may be responsible for the deficit of 60S subunits in these cells. PMID:9271378