Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae
Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine
2016-01-01
ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single
Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae.
Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine; Belyi, Yury
2016-01-01
The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5' untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62-K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62-K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62-K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62-K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62-K70 segment of Rps26 and the 5' untranslated region of mRNA. The data suggested a specific role of the Y62-K70 motif during translation initiation. Here, we report that single-site substitutions
Purification, characterization and crystallization of the human 80S ribosome
Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.
2014-01-01
Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798
Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo
2016-01-01
The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898
Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús
2016-01-01
The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. PMID:27422873
Fernández-Pevida, Antonio; Martín-Villanueva, Sara; Murat, Guillaume; Lacombe, Thierry; Kressler, Dieter; de la Cruz, Jesús
2016-09-19
The archaea-/eukaryote-specific 40S-ribosomal-subunit protein S31 is expressed as an ubiquitin fusion protein in eukaryotes and consists of a conserved body and a eukaryote-specific N-terminal extension. In yeast, S31 is a practically essential protein, which is required for cytoplasmic 20S pre-rRNA maturation. Here, we have studied the role of the N-terminal extension of the yeast S31 protein. We show that deletion of this extension partially impairs cell growth and 40S subunit biogenesis and confers hypersensitivity to aminoglycoside antibiotics. Moreover, the extension harbours a nuclear localization signal that promotes active nuclear import of S31, which associates with pre-ribosomal particles in the nucleus. In the absence of the extension, truncated S31 inefficiently assembles into pre-40S particles and two subpopulations of mature small subunits, one lacking and another one containing truncated S31, can be identified. Plasmid-driven overexpression of truncated S31 partially suppresses the growth and ribosome biogenesis defects but, conversely, slightly enhances the hypersensitivity to aminoglycosides. Altogether, these results indicate that the N-terminal extension facilitates the assembly of S31 into pre-40S particles and contributes to the optimal translational activity of mature 40S subunits but has only a minor role in cytoplasmic cleavage of 20S pre-rRNA at site D. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Quantitative studies of mRNA recruitment to the eukaryotic ribosome.
Fraser, Christopher S
2015-07-01
The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. Copyright © 2015 Elsevier B.V. and Société française de biochimie et biologie Moléculaire (SFBBM). All rights reserved.
Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes
NASA Technical Reports Server (NTRS)
Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.
1987-01-01
A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.
The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.
Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina
2016-05-22
During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. Copyright © 2016 Elsevier Ltd. All rights reserved.
Eukaryotic ribosome display with in situ DNA recovery.
He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J
2012-01-01
Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.
Getting ready to translate: cytoplasmic maturation of eukaryotic ribosomes.
Panse, Vikram Govind
2011-01-01
The ribosome is the 'universal ribozyme' that is responsible for the final step of decoding genetic information into proteins. While the function of the ribosome is being elucidated at the atomic level, in comparison, little is known regarding its assembly in vivo and intracellular transport. In contrast to prokaryotic ribosomes, the construction of eukaryotic ribosomes, which begins in the nucleolus, requires >200 evolutionary conserved non-ribosomal trans-acting factors, which transiently associate with pre-ribosomal subunits at distinct assembly stages and perform specific maturation steps. Notably, pre-ribosomal subunits are transported to the cytoplasm in a functionally inactive state where they undergo maturation prior to entering translation. In this review, I will summarize our current knowledge of the eukaryotic ribosome assembly pathway with emphasis on cytoplasmic maturation events that render pre-ribosomal subunits translation competent.
Gamalinda, Michael; Woolford, John L
2014-11-01
Numerous ribosomal proteins have a striking bipartite architecture: a globular body positioned on the ribosomal exterior and an internal loop buried deep into the rRNA core. In eukaryotes, a significant number of conserved r-proteins have evolved extra amino- or carboxy-terminal tail sequences, which thread across the solvent-exposed surface. The biological importance of these extended domains remains to be established. In this study, we have investigated the universally conserved internal loop and the eukaryote-specific extensions of yeast L4. We show that in contrast to findings with bacterial L4, deleting the internal loop of yeast L4 causes severely impaired growth and reduced levels of large ribosomal subunits. We further report that while depleting the entire L4 protein blocks early assembly steps in yeast, deletion of only its extended internal loop affects later steps in assembly, revealing a second role for L4 during ribosome biogenesis. Surprisingly, deletion of the entire eukaryote-specific carboxy-terminal tail of L4 has no effect on viability, production of 60S subunits, or translation. These unexpected observations provide impetus to further investigate the functions of ribosomal protein extensions, especially eukaryote-specific examples, in ribosome assembly and function. © 2014 Gamalinda and Woolford; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Ochs, Kerstin; Rust, René C.; Niepmann, Michael
1999-01-01
Most eukaryotic initiation factors (eIFs) are required for internal translation initiation at the internal ribosome entry site (IRES) of picornaviruses. eIF4B is incorporated into ribosomal 48S initiation complexes with the IRES RNA of foot-and-mouth disease virus (FMDV). In contrast to the weak interaction of eIF4B with capped cellular mRNAs and its release upon entry of the ribosomal 60S subunit, eIF4B remains tightly associated with the FMDV IRES during formation of complete 80S ribosomes. Binding of eIF4B to the IRES is energy dependent, and binding of the small ribosomal subunit to the IRES requires the previous energy-dependent association of initiation factors with the IRES. The interaction of eIF4B with the IRES in 48S and 80S complexes is independent of the location of the initiator AUG and thus independent of the mechanism by which the small ribosomal subunit is placed at the actual start codon, either by direct internal ribosomal entry or by scanning. eIF4B does not greatly rearrange its binding to the IRES upon entry of the ribosomal subunits, and the interaction of eIF4B with the IRES is independent of the polypyrimidine tract-binding protein, which enhances FMDV translation. PMID:10438840
Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'iaminova, A G; Karpova, G G
2008-01-01
Protein S15 is a characteristic component of the mammalian 80S ribosome that neighbors mRNA codon at the decoding site and the downstream triplets. In this study we determined S15 protein fragments located close to mRNA positions +4 to +12 with respect to the first nucleotide of the P site codon on the human ribosome. For cross-linking to ribosomal protein S15, a set of mRNA was used that contained triplet UUU/UUC at the 5'-termini and a perfluorophenyl azide-modified uridine in position 3' of this triplet. The locations of mRNA analogues on the ribosome were governed by tRNAPhe cognate to the UUU/UUC triplet targeted to the P site. Cross-linked S15 protein was isolated from the irradiated with mild UV light complexes of 80S ribosomes with tRNAPhe and mRNA analogues with subsequent cleavage with CNBr that splits polypeptide chain after methionines. Analysis of modified oligopeptides resulted from the cleavage revealed that in all cases cross-linking site was located in C-terminal fragment 111-145 of protein S15 indicating that this fragment is involved in formation of decoding site of the eukaryotic ribosome.
Xie, Qiang; Wang, Yanhui; Lin, Jinzhong; Qin, Yan; Wang, Ying; Bu, Wenjun
2012-01-01
In support of the hypothesis of the endosymbiotic origin of eukaryotes, much evidence has been found to support the idea that some organelles of eukaryotic cells originated from bacterial ancestors. Less attention has been paid to the identity of the host cell, although some biochemical and molecular genetic properties shared by archaea and eukaryotes have been documented. Through comparing 507 taxa of 16S-18S rDNA and 347 taxa of 23S-28S rDNA, we found that archaea and eukaryotes share twenty-six nucleotides signatures in ribosomal DNA. These signatures exist in all living eukaryotic organisms, whether protist, green plant, fungus, or animal. This evidence explicitly supports the archaeal origin of eukaryotes. In the ribosomal RNA, besides A2058 in Escherichia coli vs. G2400 in Saccharomyces cerevisiae, there still exist other twenties of sites, in which the bases are kingdom-specific. Some of these sites concentrate in the peptidyl transferase centre (PTC) of the 23S-28S rRNA. The results suggest potential key sites to explain the kingdom-specific spectra of drug resistance of ribosomes.
The activity of the acidic phosphoproteins from the 80 S rat liver ribosome.
MacConnell, W P; Kaplan, N O
1982-05-25
The selective removal of acidic phosphoproteins from the 80 S rat liver ribosome was accomplished by successive alcohol extractions at low salt concentration. The resulting core ribosomes lost over 90% of their translation activity and were unable to support the elongation factor 2 GTPase reaction. Both activities were partially restored when the dialyzed extracts were added back to the core ribosome. The binding of labeled adenosine diphosphoribosyl-elongation factor 2 to ribosomes was also affected by extraction and could be reconstituted, although not to the same extent as the GTPase activity associated with elongation factor 2 in the presence of the ribosome. The alcohol extracts of the 80 S ribosome contained mostly phosphoproteins P1 and P2 which could be dephosphorylated and rephosphorylated in solution by alkaline phosphatase and protein kinase, respectively. Dephosphorylation of the P1/P2 mixture in the extracts caused a decrease in the ability of these proteins to reactivate the polyphenylalanine synthesis activity of the core ribosome. However, treatment of the dephosphorylated proteins with the catalytic subunit of 3':5'-cAMP-dependent protein kinase in the presence of ATP reactivated the proteins when compared to the activity of the native extracts. Rabbit antisera raised against the alcohol-extracted proteins were capable of impairing both the polyphenylalanine synthesis reaction and the elongation factor 2-dependent GTPase reaction in the intact ribosomes.
Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu
2007-01-01
Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838
Graf, Michael; Arenz, Stefan; Huter, Paul; Dönhöfer, Alexandra; Nováček, Jiří
2017-01-01
Abstract Ribosomes are the protein synthesizing machines of the cell. Recent advances in cryo-EM have led to the determination of structures from a variety of species, including bacterial 70S and eukaryotic 80S ribosomes as well as mitoribosomes from eukaryotic mitochondria, however, to date high resolution structures of plastid 70S ribosomes have been lacking. Here we present a cryo-EM structure of the spinach chloroplast 70S ribosome, with an average resolution of 5.4 Å for the small 30S subunit and 3.6 Å for the large 50S ribosomal subunit. The structure reveals the location of the plastid-specific ribosomal proteins (RPs) PSRP1, PSRP4, PSRP5 and PSRP6 as well as the numerous plastid-specific extensions of the RPs. We discover many features by which the plastid-specific extensions stabilize the ribosome via establishing additional interactions with surrounding ribosomal RNA and RPs. Moreover, we identify a large conglomerate of plastid-specific protein mass adjacent to the tunnel exit site that could facilitate interaction of the chloroplast ribosome with the thylakoid membrane and the protein-targeting machinery. Comparing the Escherichia coli 70S ribosome with that of the spinach chloroplast ribosome provides detailed insight into the co-evolution of RP and rRNA. PMID:27986857
Kimura, J; Kimura, M
1987-09-05
The amino acid sequences of two ribosomal proteins, S14 and S16, from the archaebacterium Halobacterium marismortui have been determined. Sequence data were obtained by the manual and solid-phase sequencing of peptides derived from enzymatic digestions with trypsin, chymotrypsin, pepsin, and Staphylococcus aureus protease as well as by chemical cleavage with cyanogen bromide. Proteins S14 and S16 contain 109 and 126 amino acid residues and have Mr values of 11,964 and 13,515, respectively. Comparison of the sequences with those of ribosomal proteins from other organisms demonstrates that S14 has a significant homology with the rat liver ribosomal protein S11 (36% identity) as well as with the Escherichia coli ribosomal protein S17 (37%), and that S16 is related to the yeast ribosomal protein YS22 (40%) and proteins S8 from E. coli (28%) and Bacillus stearothermophilus (30%). A comparison of the amino acid residues in the homologous regions of halophilic and nonhalophilic ribosomal proteins reveals that halophilic proteins have more glutamic acids, asparatic acids, prolines, and alanines, and less lysines, arginines, and isoleucines than their nonhalophilic counterparts. These amino acid substitutions probably contribute to the structural stability of halophilic ribosomal proteins.
Kimura, M; Kimura, J; Hatakeyama, T
1988-11-21
The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).
Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul
2009-06-01
Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultantmore » fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.« less
Inhibition of Eukaryotic Translation by the Antitumor Natural Product Agelastatin A.
McClary, Brandon; Zinshteyn, Boris; Meyer, Mélanie; Jouanneau, Morgan; Pellegrino, Simone; Yusupova, Gulnara; Schuller, Anthony; Reyes, Jeremy Chris P; Lu, Junyan; Guo, Zufeng; Ayinde, Safiat; Luo, Cheng; Dang, Yongjun; Romo, Daniel; Yusupov, Marat; Green, Rachel; Liu, Jun O
2017-05-18
Protein synthesis plays an essential role in cell proliferation, differentiation, and survival. Inhibitors of eukaryotic translation have entered the clinic, establishing the translation machinery as a promising target for chemotherapy. A recently discovered, structurally unique marine sponge-derived brominated alkaloid, (-)-agelastatin A (AglA), possesses potent antitumor activity. Its underlying mechanism of action, however, has remained unknown. Using a systematic top-down approach, we show that AglA selectively inhibits protein synthesis. Using a high-throughput chemical footprinting method, we mapped the AglA-binding site to the ribosomal A site. A 3.5 Å crystal structure of the 80S eukaryotic ribosome from S. cerevisiae in complex with AglA was obtained, revealing multiple conformational changes of the nucleotide bases in the ribosome accompanying the binding of AglA. Together, these results have unraveled the mechanism of inhibition of eukaryotic translation by AglA at atomic level, paving the way for future structural modifications to develop AglA analogs into novel anticancer agents. Copyright © 2017 Elsevier Ltd. All rights reserved.
[Protein S3 in the human 80S ribosome adjoins mRNA from 3'-side of the A-site codon].
Molotkov, M V; Graĭfer, D M; Popugaeva, E A; Bulygin, K N; Meshchaninova, M I; Ven'iaminova, A G; Karpova, G G
2007-01-01
The protein environment of mRNA 3' of the A-site codon (the decoding site) in the human 80S ribosome was studied using a set of oligoribonucleotide derivatives bearing a UUU triplet at the 5'-end and a perfluoroarylazide group at one of the nucleotide residues at the 3'-end of this triplet. Analogues of mRNA were phased into the ribosome using binding at the tRNAPhe P-site, which recognizes the UUU codon. Mild UV irradiation of ribosome complexes with tRNAPhe and mRNA analogues resulted in the predominant crosslinking of the analogues with the 40S subunit components, mainly with proteins and, to a lesser extent, with rRNA. Among the 40S subunit ribosomal proteins, the S3 protein was the main target for modification in all cases. In addition, minor crosslinking with the S2 protein was observed. The crosslinking with the S3 and S2 proteins occurred both in triple complexes and in the absence of tRNA. Within triple complexes, crosslinking with S15 protein was also found, its efficiency considerably falling when the modified nucleotide was moved from positions +5 to +12 relative to the first codon nucleotide in the P-site. In some cases, crosslinking with the S30 protein was observed, it was most efficient for the derivative containing a photoreactive group at the +7 adenosine residue. The results indicate that the S3 protein in the human ribosome plays a key role in the formation of the mRNA binding site 3' of the codon in the decoding site.
Use of 16S Ribosomal RNA Sequences to Infer Relationships among Archaebacteria.
1987-04-16
the rRNAs of one or both other kingdoms , and among the archaebacteria there are also substantial variations) (1), echinoderms (5, 11), major...Security Classification) Ln Use of 16S Ribosomal RNA Sequences to infer Relationships among Archaebacteria : Annual Report (U) q 12 PERSONAL AUTHOR(S...FIELD GROUP SUB-GROUP Archaebacteria ; Eubacteria; Eukaryotes; 16S Ribosomal RNA; 08 I Phylogeny; rRNA; RNA Sequencing; Molecular Clock; Urkingdoms; r
[Immunochemistry of eukaryotic ribosomes].
Lopaczyński, W; Gałasiński, W
1990-01-01
Immunochemical investigations of ribosomes should correlate with basic knowledge of the function, structure and activity of organelles in the cell processes. Our paper presents data of immunochemical methods used to determine the structure, function and differences of ribosomes. We present the usefulness of immunochemical methods to test human ribosomes, diagnosis and therapy of many diseases.
Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria
2014-01-01
We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2’,3’-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2’- and 3’-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process. PMID:25191528
Hountondji, Codjo; Bulygin, Konstantin; Créchet, Jean-Bernard; Woisard, Anne; Tuffery, Pierre; Nakayama, Jun-Ichi; Frolova, Ludmila; Nierhaus, Knud H; Karpova, Galina; Baouz, Soria
2014-01-01
We have demonstrated previously that the E-site specific protein RPL36AL present in human ribosomes can be crosslinked with the CCA-end of a P-tRNA in situ. Here we report the following: (i) We modeled RPL36AL into the structure of the archaeal ortholog RPL44E extracted from the known X-ray structure of the 50S subunit of Haloarcula marismortui. Superimposing the obtained RPL36AL structure with that of P/E tRNA observed in eukaryotic 80S ribosomes suggested that RPL36AL might in addition to its CCA neighbourhood interact with the inner site of the tRNA elbow similar to an interaction pattern known from tRNA•synthetase pairs. (ii) Accordingly, we detected that the isolated recombinant protein RPL36AL can form a tight binary complex with deacylated tRNA, and even tRNA fragments truncated at their CCA end showed a high affinity in the nanomolar range supporting a strong interaction outside the CCA end. (iii) We constructed programmed 80S complexes containing the termination factor eRF1 (stop codon UAA at the A-site) and a 2',3'-dialdehyde tRNA (tRNAox) analog at the P-site. Surprisingly, we observed a crosslinked ternary complex containing the tRNA, eRF1 and RPL36AL crosslinked both to the aldehyde groups of tRNAox at the 2'- and 3'-positions of the ultimate A. We also demonstrated that, upon binding to the ribosomal A-site, eRF1 induces an alternative conformation of the ribosome and/or the tRNA, leading to a novel crosslink of tRNAox to another large-subunit ribosomal protein (namely L37) rather than to RPL36AL, both ribosomal proteins being labeled in a mutually exclusive fashion. Since the human 80S ribosome in complex with P-site bound tRNAox and A-site bound eRF1 corresponds to the post-termination state of the ribosome, the results represent the first biochemical evidence for the positioning of the CCA-arm of the P-tRNA in close proximity to both RPL36AL and eRF1 at the end of the translation process.
Shatsky, Ivan N; Dmitriev, Sergey E; Andreev, Dmitri E; Terenin, Ilya M
2014-01-01
The conventional paradigm of translation initiation in eukaryotes states that the cap-binding protein complex eIF4F (consisting of eIF4E, eIF4G and eIF4A) plays a central role in the recruitment of capped mRNAs to ribosomes. However, a growing body of evidence indicates that this paradigm should be revised. This review summarizes the data which have been mostly accumulated in a post-genomic era owing to revolutionary techniques of transcriptome-wide analysis. Unexpectedly, these techniques have uncovered remarkable diversity in the recruitment of cellular mRNAs to eukaryotic ribosomes. These data enable a preliminary classification of mRNAs into several groups based on their requirement for particular components of eIF4F. They challenge the widely accepted concept which relates eIF4E-dependence to the extent of secondary structure in the 5' untranslated regions of mRNAs. Moreover, some mRNA species presumably recruit ribosomes to their 5' ends without the involvement of either the 5' m(7)G-cap or eIF4F but instead utilize eIF4G or eIF4G-like auxiliary factors. The long-standing concept of internal ribosome entry site (IRES)-elements in cellular mRNAs is also discussed.
Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati
2016-01-01
In all life forms, decoding of messenger-RNA into polypeptide chain is accomplished by the ribosome. Several protein chaperones are known to bind at the exit of ribosomal tunnel to ensure proper folding of the nascent chain by inhibiting their premature folding in the densely crowded environment of the cell. However, accumulating evidence suggests that ribosome may play a chaperone role in protein folding events in vitro. Ribosome-mediated folding of denatured proteins by prokaryotic ribosomes has been studied extensively. The RNA-assisted chaperone activity of the prokaryotic ribosome has been attributed to the domain V, a span of 23S rRNA at the intersubunit side of the large subunit encompassing the Peptidyl Transferase Centre. Evidently, this functional property of ribosome is unrelated to the nascent chain protein folding at the exit of the ribosomal tunnel. Here, we seek to scrutinize whether this unique function is conserved in a primitive kinetoplastid group of eukaryotic species Leishmania donovani where the ribosome structure possesses distinct additional features and appears markedly different compared to other higher eukaryotic ribosomes. Bovine Carbonic Anhydrase II (BCAII) enzyme was considered as the model protein. Our results manifest that domain V of the large subunit rRNA of Leishmania ribosomes preserves chaperone activity suggesting that ribosome-mediated protein folding is, indeed, a conserved phenomenon. Further, we aimed to investigate the mechanism underpinning the ribosome-assisted protein reactivation process. Interestingly, the surface plasmon resonance binding analyses exhibit that rRNA guides productive folding by directly interacting with molten globule-like states of the protein. In contrast, native protein shows no notable affinity to the rRNA. Thus, our study not only confirms conserved, RNA-mediated chaperoning role of ribosome but also provides crucial insight into the mechanism of the process. PMID:27099964
Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús
2018-05-18
The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits.
Espinar-Marchena, Francisco; Rodríguez-Galán, Olga; Fernández-Fernández, José; Linnemann, Jan; de la Cruz, Jesús
2018-01-01
Abstract The contribution of most ribosomal proteins to ribosome synthesis has been quite well analysed in Saccharomyces cerevisiae. However, few yeast ribosomal proteins still await characterization. Herein, we show that L14, an essential 60S ribosomal protein, assembles in the nucleolus at an early stage into pre-60S particles. Depletion of L14 results in a deficit in 60S subunits and defective processing of 27SA2 and 27SA3 to 27SB pre-rRNAs. As a result, 27S pre-rRNAs are subjected to turnover and export of pre-60S particles is blocked. These phenotypes likely appear as the direct consequence of the reduced pre-60S particle association not only of L14 upon its depletion but also of a set of neighboring ribosomal proteins located at the solvent interface of 60S subunits and the adjacent region surrounding the polypeptide exit tunnel. These pre-60S intermediates also lack some essential trans-acting factors required for 27SB pre-rRNA processing but accumulate practically all factors required for processing of 27SA3 pre-rRNA. We have also analysed the functional interaction between the eukaryote-specific carboxy-terminal extensions of the neighboring L14 and L16 proteins. Our results indicate that removal of the most distal parts of these extensions cause slight translation alterations in mature 60S subunits. PMID:29788267
Choe, Junho; Oh, Nara; Park, Sungjin; Lee, Ye Kyung; Song, Ok-Kyu; Locker, Nicolas; Chi, Sung-Gil; Kim, Yoon Ki
2012-05-25
In the cytoplasm of mammalian cells, either cap-binding proteins 80 and 20 (CBP80/20) or eukaryotic translation initiation factor (eIF) 4E can direct the initiation of translation. Although the recruitment of ribosomes to mRNAs during eIF4E-dependent translation (ET) is well characterized, the molecular mechanism for CBP80/20-dependent translation (CT) remains obscure. Here, we show that CBP80/20-dependent translation initiation factor (CTIF), which has been shown to be preferentially involved in CT but not ET, specifically interacts with eIF3g, a component of the eIF3 complex involved in ribosome recruitment. By interacting with eIF3g, CTIF serves as an adaptor protein to bridge the CBP80/20 and the eIF3 complex, leading to efficient ribosome recruitment during CT. Accordingly, down-regulation of CTIF using a small interfering RNA causes a redistribution of CBP80 from polysome fractions to subpolysome fractions, without significant consequence to eIF4E distribution. In addition, down-regulation of eIF3g inhibits the efficiency of nonsense-mediated mRNA decay, which is tightly coupled to CT but not to ET. Moreover, the artificial tethering of CTIF to an intercistronic region of dicistronic mRNA results in translation of the downstream cistron in an eIF3-dependent manner. These findings support the idea that CT mechanistically differs from ET.
Szymanski, Maciej; Barciszewska, Miroslawa Z.; Barciszewski, Jan; Erdmann, Volker A.
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan. pl/5SData/index.html . This edition of the database contains 1985 primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms. PMID:10592212
5S ribosomal RNA database Y2K.
Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A
2000-01-01
This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.
Mapping of ribosomal 23S ribosomal RNA modifications in Clostridium sporogenes.
Kirpekar, Finn; Hansen, Lykke H; Mundus, Julie; Tryggedsson, Stine; Teixeira Dos Santos, Patrícia; Ntokou, Eleni; Vester, Birte
2018-06-27
All organisms contain RNA modifications in their ribosomal RNA (rRNA), but the importance, positions and exact function of these are still not fully elucidated. Various functions such as stabilising structures, controlling ribosome assembly and facilitating interactions have been suggested and in some cases substantiated. Bacterial rRNA contains much fewer modifications than eukaryotic rRNA. The rRNA modification patterns in bacteria differ from each other, but too few organisms have been mapped to draw general conclusions. This study maps 23S ribosomal RNA modifications in Clostridium sporogenes that can be characterised as a non-toxin producing Clostridium botulinum. Clostridia are able to sporulate and thereby survive harsh conditions, and are in general considered to be resilient to antibiotics. Selected regions of the 23S rRNA were investigated by mass spectrometry and by primer extension analysis to pinpoint modified sites and the nature of the modifications. Apparently, C. sporogenes 23S rRNA contains few modifications compared to other investigated bacteria. No modifications were identified in domain II and III of 23S rRNA. Three modifications were identified in domain IV, all of which have also been found in other organisms. Two unusual modifications were identified in domain V, methylated dihydrouridine at position U2449 and dihydrouridine at position U2500 (Escherichia coli numbering), in addition to four previously known modified positions. The enzymes responsible for the modifications were searched for in the C. sporogenes genome using BLAST with characterised enzymes as query. The search identified genes potentially coding for RNA modifying enzymes responsible for most of the found modifications.
mRNA 3' of the A site bound codon is located close to protein S3 on the human 80S ribosome.
Molotkov, Maxim V; Graifer, Dmitri M; Popugaeva, Elena A; Bulygin, Konstantin N; Meschaninova, Maria I; Ven'yaminova, Aliya G; Karpova, Galina G
2006-07-01
Ribosomal proteins neighboring the mRNA downstream of the codon bound at the decoding site of human 80S ribosomes were identified using three sets of mRNA analogues that contained a UUU triplet at the 5' terminus and a perfluorophenylazide cross-linker at guanosine, adenosine or uridine residues placed at various locations 3' of this triplet. The positions of modified mRNA nucleotides on the ribosome were governed by tRNA(Phe) cognate to the UUU triplet targeted to the P site. Upon mild UV-irradiation, the mRNA analogues cross-linked preferentially to the 40S subunit, to the proteins and to a lesser extent to the 18S rRNA. Cross-linked nucleotides of 18S rRNA were identified previously. In the present study, it is shown that among the proteins the main target for cross-linking with all the mRNA analogues tested was protein S3 (homologous to prokaryotic S3, S3p); minor cross-linking to protein S2 (S5p) was also detected. Both proteins cross-linked to mRNA analogues in the ternary complexes as well as in the binary complexes (without tRNA). In the ternary complexes protein S15 (S19p) also cross-linked, the yield of the cross-link decreased significantly when the modified nucleotide moved from position +5 to position +12 with respect to the first nucleotide of the P site bound codon. In several ternary complexes minor cross-linking to protein S30 was likewise detected. The results of this study indicate that S3 is a key protein at the mRNA binding site neighboring mRNA downstream of the codon at the decoding site in the human ribosome.
Sequential protein association with nascent 60S ribosomal particles.
Saveanu, Cosmin; Namane, Abdelkader; Gleizes, Pierre-Emmanuel; Lebreton, Alice; Rousselle, Jean-Claude; Noaillac-Depeyre, Jacqueline; Gas, Nicole; Jacquier, Alain; Fromont-Racine, Micheline
2003-07-01
Ribosome biogenesis in eukaryotes depends on the coordinated action of ribosomal and nonribosomal proteins that guide the assembly of preribosomal particles. These intermediate particles follow a maturation pathway in which important changes in their protein composition occur. The mechanisms involved in the coordinated assembly of the ribosomal particles are poorly understood. We show here that the association of preribosomal factors with pre-60S complexes depends on the presence of earlier factors, a phenomenon essential for ribosome biogenesis. The analysis of the composition of purified preribosomal complexes blocked in maturation at specific steps allowed us to propose a model of sequential protein association with, and dissociation from, early pre-60S complexes for several preribosomal factors such as Mak11, Ssf1, Rlp24, Nog1, and Nog2. The presence of either Ssf1 or Nog2 in complexes that contain the 27SB pre-rRNA defines novel, distinct pre-60S particles that contain the same pre-rRNA intermediates and that differ only by the presence or absence of specific proteins. Physical and functional interactions between Rlp24 and Nog1 revealed that the assembly steps are, at least in part, mediated by direct protein-protein interactions.
Spirin, Alexander S
2009-11-17
A model of the ATP-dependent unidirectional movement of the 43S ribosomal initiation complex (=40S ribosomal subunit + eIF1 + eIF1A + eIF2.GTP.Met-tRNA(i) + eIF3) during scanning of the 5'-untranslated region of eukaryotic mRNA is proposed. The model is based on the principles of molecular Brownian ratchet machines and explains several enigmatic data concerning the scanning complex. In this model, the one-dimensional diffusion of the ribosomal initiation complex along the mRNA chain is rectified into the net-unidirectional 5'-to-3' movement by the Feynman ratchet-and-pawl mechanism. The proposed mechanism is organized by the heterotrimeric protein eIF4F (=eIF4A + eIF4E + eIF4G), attached to the scanning ribosomal particle via eIF3, and the RNA-binding protein eIF4B that is postulated to play the role of the pawl. The energy for the useful work of the ratchet-and-pawl mechanism is supplied from ATP hydrolysis induced by the eIF4A subunit: ATP binding and its hydrolysis alternately change the affinities of eIF4A for eIF4B and for mRNA, resulting in the restriction of backward diffusional sliding of the 43S ribosomal complex along the mRNA chain, while stochastic movements ahead are allowed.
Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino; Pesole, Graziano
2018-01-04
A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
[Positioning of mRNA 3' of the a site bound codon on the human 80S ribosome].
Molotkov, M V; Graĭfer, D M; Demeshkina, N A; Repkova, M N; Ven'iaminova, A G; Karpova, G G
2005-01-01
Short mRNA analogues carrying a UUU triplet at the 5'-termini and a perfluorophenylazide group at either the N7 atom of the guanosine or the C5 atom of the uridine 3' of the triplet were applied to study positioning of mRNA 3' of the A site codon. Complexes of 80S ribosomes with the mRNA analogues were obtained in the presence of tRNAPhe that directed UUU codon to the P site and consequently provided placement of the nucleotide with cross-linker in positions +9 or +12 with respect to the first nucleotide of the P site bound codon. Both types mRNA analogues cross-linked to the 18S rRNA and 40S proteins under mild UV-irradiation. Cross-linking patterns in the complexes where modified nucleotides of the mRNA analogues were in position +7 were analyzed for comparison (cross-linking to the 18S rRNA in such complexes has been studied previously). The efficiency of cross-linking to the ribosomal components depended on the nature of the modified nucleotide in the mRNA analogue and its position on the ribosome, extent of cross-linking to the 18S rRNA being decreased drastically when the modified nucleotide was moved from position +7 to position +12. The nucleotides of 18S rRNA cross-linked to mRNA analogues were determined. Modified nucleotides in positions +9 and +12 cross-linked to the invariant dinucleotide A1824/A1825 and to variable A1823 in the 3'-minidomain of 18S rRNA as well as to protein S15. The same ribosomal components have been found earlier to cross-link to modified mRNA nucleotides in positions from +4 to +7. Besides, all mRNA analogues cross-linked to the invariant nucleotide c1698 in the 3'-minidomain and to and the conserved region 605-620 closing helix 18 in the 5'-domain.
Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D
2015-01-13
Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.
The Dedicated Chaperone Acl4 Escorts Ribosomal Protein Rpl4 to Its Nuclear Pre-60S Assembly Site
Pillet, Benjamin; García-Gómez, Juan J.; Pausch, Patrick; Falquet, Laurent; Bange, Gert; de la Cruz, Jesús; Kressler, Dieter
2015-01-01
Ribosomes are the highly complex macromolecular assemblies dedicated to the synthesis of all cellular proteins from mRNA templates. The main principles underlying the making of ribosomes are conserved across eukaryotic organisms and this process has been studied in most detail in the yeast Saccharomyces cerevisiae. Yeast ribosomes are composed of four ribosomal RNAs (rRNAs) and 79 ribosomal proteins (r-proteins). Most r-proteins need to be transported from the cytoplasm to the nucleus where they get incorporated into the evolving pre-ribosomal particles. Due to the high abundance and difficult physicochemical properties of r-proteins, their correct folding and fail-safe targeting to the assembly site depends largely on general, as well as highly specialized, chaperone and transport systems. Many r-proteins contain universally conserved or eukaryote-specific internal loops and/or terminal extensions, which were shown to mediate their nuclear targeting and association with dedicated chaperones in a growing number of cases. The 60S r-protein Rpl4 is particularly interesting since it harbours a conserved long internal loop and a prominent C-terminal eukaryote-specific extension. Here we show that both the long internal loop and the C-terminal eukaryote-specific extension are strictly required for the functionality of Rpl4. While Rpl4 contains at least five distinct nuclear localization signals (NLS), the C-terminal part of the long internal loop associates with a specific binding partner, termed Acl4. Absence of Acl4 confers a severe slow-growth phenotype and a deficiency in the production of 60S subunits. Genetic and biochemical evidence indicates that Acl4 can be considered as a dedicated chaperone of Rpl4. Notably, Acl4 localizes to both the cytoplasm and nucleus and it has the capacity to capture nascent Rpl4 in a co-translational manner. Taken together, our findings indicate that the dedicated chaperone Acl4 accompanies Rpl4 from the cytoplasm to its pre-60S
Santamaria, Monica; Fosso, Bruno; Licciulli, Flavio; Balech, Bachir; Larini, Ilaria; Grillo, Giorgio; De Caro, Giorgio; Liuni, Sabino
2018-01-01
Abstract A holistic understanding of environmental communities is the new challenge of metagenomics. Accordingly, the amplicon-based or metabarcoding approach, largely applied to investigate bacterial microbiomes, is moving to the eukaryotic world too. Indeed, the analysis of metabarcoding data may provide a comprehensive assessment of both bacterial and eukaryotic composition in a variety of environments, including human body. In this respect, whereas hypervariable regions of the 16S rRNA are the de facto standard barcode for bacteria, the Internal Transcribed Spacer 1 (ITS1) of ribosomal RNA gene cluster has shown a high potential in discriminating eukaryotes at deep taxonomic levels. As metabarcoding data analysis rely on the availability of a well-curated barcode reference resource, a comprehensive collection of ITS1 sequences supplied with robust taxonomies, is highly needed. To address this issue, we created ITSoneDB (available at http://itsonedb.cloud.ba.infn.it/) which in its current version hosts 985 240 ITS1 sequences spanning over 134 000 eukaryotic species. Each ITS1 is mapped on the NCBI reference taxonomy with its start and end positions precisely annotated. ITSoneDB has been developed in agreement to the FAIR guidelines by enabling the users to query and download its content through a simple web-interface and access relevant metadata by cross-linking to European Nucleotide Archive. PMID:29036529
Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.
Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar
2011-11-01
Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S
Protein-protein interactions within late pre-40S ribosomes.
Campbell, Melody G; Karbstein, Katrin
2011-01-20
Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.
Ribosome-inactivating proteins
Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M
2013-01-01
Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927
Camargo, Hendricka; Nusspaumer, Gretel; Abia, David; Briceño, Verónica; Remacha, Miguel; Ballesta, Juan P G
2011-05-01
The eukaryotic ribosomal proteins P1 and P2 bind to protein P0 through their N-terminal domain to form the essential ribosomal stalk. A mutational analysis points to amino acids at positions 2 and 3 as determinants for the drastic difference of Saccharomyces cerevisiae P1 and P2 half-life, and suggest different degradation mechanisms for each protein type. Moreover, the capacity to form P1/P2 heterodimers is drastically affected by mutations in the P2β four initial amino acids, while these mutations have no effect on P1β. Binding of P2β and, to a lesser extent, P1β to the ribosome is also seriously affected showing the high relevance of the amino acids in the first turn of the NTD α-helix 1 for the stalk assembly. The negative effect of some mutations on ribosome binding can be reversed by the presence of the second P1/P2 couple in the ribosome, indicating a stabilizing structural influence between the two heterodimers. Unexpectedly, some mutations totally abolish heterodimer formation but allow significant ribosome binding and, therefore, a previous P1 and P2 association seems not to be an absolute requirement for stalk assembly. Homology modeling of the protein complexes suggests that the mutated residues can affect the overall protein conformation. © The Author(s) 2011. Published by Oxford University Press.
Defective ribosome assembly in Shwachman-Diamond syndrome.
Wong, Chi C; Traynor, David; Basse, Nicolas; Kay, Robert R; Warren, Alan J
2011-10-20
Shwachman-Diamond syndrome (SDS), a recessive leukemia predisposition disorder characterized by bone marrow failure, exocrine pancreatic insufficiency, skeletal abnormalities and poor growth, is caused by mutations in the highly conserved SBDS gene. Here, we test the hypothesis that defective ribosome biogenesis underlies the pathogenesis of SDS. We create conditional mutants in the essential SBDS ortholog of the ancient eukaryote Dictyostelium discoideum using temperature-sensitive, self-splicing inteins, showing that mutant cells fail to grow at the restrictive temperature because ribosomal subunit joining is markedly impaired. Remarkably, wild type human SBDS complements the growth and ribosome assembly defects in mutant Dictyostelium cells, but disease-associated human SBDS variants are defective. SBDS directly interacts with the GTPase elongation factor-like 1 (EFL1) on nascent 60S subunits in vivo and together they catalyze eviction of the ribosome antiassociation factor eukaryotic initiation factor 6 (eIF6), a prerequisite for the translational activation of ribosomes. Importantly, lymphoblasts from SDS patients harbor a striking defect in ribosomal subunit joining whose magnitude is inversely proportional to the level of SBDS protein. These findings in Dictyostelium and SDS patient cells provide compelling support for the hypothesis that SDS is a ribosomopathy caused by corruption of an essential cytoplasmic step in 60S subunit maturation.
Protein-Protein Interactions within Late Pre-40S Ribosomes
Campbell, Melody G.; Karbstein, Katrin
2011-01-01
Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps. PMID:21283762
Wegrecki, Marcin; Rodríguez-Galán, Olga; de la Cruz, Jesús; Bravo, Jeronimo
2015-01-01
Ribosome biogenesis is one of the most essential pathways in eukaryotes although it is still not fully characterized. Given the importance of this process in proliferating cells, it is obvious that understanding the macromolecular details of the interactions that take place between the assembly factors, ribosomal proteins and nascent pre-rRNAs is essentially required for the development of new non-genotoxic treatments for cancer. Herein, we have studied the association between the WD40-repeat domains of Erb1 and Ytm1 proteins. These are essential factors for the biogenesis of 60S ribosomal subunits in eukaryotes that form a heterotrimeric complex together with the also essential Nop7 protein. We provide the crystal structure of a dimer formed by the C-terminal part of Erb1 and Ytm1 from Chaetomium thermophilum at 2.1 Å resolution. Using a multidisciplinary approach we show that the β-propeller domains of these proteins interact in a novel manner that leads to a high-affinity binding. We prove that a point mutation within the interface of the complex impairs the interaction between the two proteins and negatively affects growth and ribosome production in yeast. Our study suggests insights into the association of the Erb1-Ytm1 dimer with pre-ribosomal particles. PMID:26476442
Comparative study between prokaryotes and eukaryotes by chemical iodination of ribosomal proteins.
Bernabeu, C; Vázquez, D; Conde, F P
1979-04-25
Escherichia coli and Saccharomyces cerevisiae ribosomal proteins were chemically iodinated with 125I by chloramine T under conditions in which the proteins were denatured. The labelled proteins were subsequently separated by two-dimensional gel electrophoresis with an excess of untreated ribosomal proteins from the same species. The iodination did not change the electrophoretic mobility of the proteins as shown by the pattern of spots in the stained gel slabs and their autoradiography. The 125I radioactivity incorporated in the proteins was estimated by cutting out the gel spots from the two-dimensional electrophoresis gel slabs. The highest content of 125I was found in the ribosomal proteins L2, L11, L13, L20/S12, S4 and S9 from E. coli, and L2/L3, L4/L6/S7, L5, L19/L20, L22/S17, L29/S27, L35/L37 and S14/S15 from S. cerevisiae. Comparisons between the electrophoretic patterns of E. coli and S. cerevisiae ribosomal proteins were carried out by coelectrophoresis of labelled and unlabelled proteins from both species. E. coli ribosomal proteins L5, L11, L20, S2, S3 and S15/S16 were found to overlap with L15, L11/L16, L36/L37, S3, S10 and S33 from S. cerevisiae, respectively. Similar coelectrophoresis of E. coli 125I-labelled proteins with unlabelled rat liver and wheat germ ribosomal proteins showed the former to overlap with proteins L1, L11, L14, L16, L19, L20 and the latter with L2, L5, L6, L15, L17 from E. coli.
Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution
NASA Astrophysics Data System (ADS)
Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad
2015-07-01
Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.
A Plant 5S Ribosomal RNA Mimic Regulates Alternative Splicing of Transcription Factor IIIA Pre-mRNAs
Hammond, Ming C.; Wachter, Andreas; Breaker, Ronald R.
2009-01-01
Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with striking resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs (pre-mRNAs) from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. Since the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing. PMID:19377483
Hammond, Ming C; Wachter, Andreas; Breaker, Ronald R
2009-05-01
Transcription factor IIIA (TFIIIA) is required for eukaryotic synthesis of 5S ribosomal RNA by RNA polymerase III. Here we report the discovery of a structured RNA element with clear resemblance to 5S rRNA that is conserved within TFIIIA precursor mRNAs from diverse plant lineages. TFIIIA protein expression is controlled by alternative splicing of the exon containing the plant 5S rRNA mimic (P5SM). P5SM triggers exon skipping upon binding of ribosomal protein L5, a natural partner of 5S rRNA, which demonstrates the functional adaptation of its structural mimicry. As the exon-skipped splice product encodes full-length TFIIIA protein, these results reveal a ribosomal protein-mRNA interaction that is involved in 5S rRNA synthesis and has implications for cross-coordination of ribosomal components. This study also provides insight into the origin and function of a newfound class of structured RNA that regulates alternative splicing.
Mpp10 represents a platform for the interaction of multiple factors within the 90S pre-ribosome
Kharde, Satyavati; Ahmed, Yasar Luqman; Stier, Gunter; Kunze, Ruth; Sinning, Irmgard
2017-01-01
In eukaryotes, ribosome assembly is a highly complex process that involves more than 200 assembly factors that ensure the folding, modification and processing of the different rRNA species as well as the timely association of ribosomal proteins. One of these factors, Mpp10 associates with Imp3 and Imp4 to form a complex that is essential for the normal production of the 18S rRNA. Here we report the crystal structure of a complex between Imp4 and a short helical element of Mpp10 to a resolution of 1.88 Å. Furthermore, we extend the interaction network of Mpp10 and characterize two novel interactions. Mpp10 is able to bind the ribosome biogenesis factor Utp3/Sas10 through two conserved motifs in its N-terminal region. In addition, Mpp10 interacts with the ribosomal protein S5/uS7 using a short stretch within an acidic loop region. Thus, our findings reveal that Mpp10 provides a platform for the simultaneous interaction with multiple proteins in the 90S pre-ribosome. PMID:28813493
Principles of 60S ribosomal subunit assembly emerging from recent studies in yeast
Konikkat, Salini; Woolford, John L.
2017-01-01
Ribosome biogenesis requires the intertwined processes of folding, modification, and processing of ribosomal RNA, together with binding of ribosomal proteins. In eukaryotic cells, ribosome assembly begins in the nucleolus, continues in the nucleoplasm, and is not completed until after nascent particles are exported to the cytoplasm. The efficiency and fidelity of ribosome biogenesis are facilitated by >200 assembly factors and ~76 different small nucleolar RNAs. The pathway is driven forward by numerous remodeling events to rearrange the ribonucleoprotein architecture of pre-ribosomes. Here, we describe principles of ribosome assembly that have emerged from recent studies of biogenesis of the large ribosomal subunit in the yeast Saccharomyces cerevisiae. We describe tools that have empowered investigations of ribosome biogenesis, and then summarize recent discoveries about each of the consecutive steps of subunit assembly. PMID:28062837
Bengtsson, Johan; Eriksson, K Martin; Hartmann, Martin; Wang, Zheng; Shenoy, Belle Damodara; Grelet, Gwen-Aëlle; Abarenkov, Kessy; Petri, Anna; Rosenblad, Magnus Alm; Nilsson, R Henrik
2011-10-01
The ribosomal small subunit (SSU) rRNA gene has emerged as an important genetic marker for taxonomic identification in environmental sequencing datasets. In addition to being present in the nucleus of eukaryotes and the core genome of prokaryotes, the gene is also found in the mitochondria of eukaryotes and in the chloroplasts of photosynthetic eukaryotes. These three sets of genes are conceptually paralogous and should in most situations not be aligned and analyzed jointly. To identify the origin of SSU sequences in complex sequence datasets has hitherto been a time-consuming and largely manual undertaking. However, the present study introduces Metaxa ( http://microbiology.se/software/metaxa/ ), an automated software tool to extract full-length and partial SSU sequences from larger sequence datasets and assign them to an archaeal, bacterial, nuclear eukaryote, mitochondrial, or chloroplast origin. Using data from reference databases and from full-length organelle and organism genomes, we show that Metaxa detects and scores SSU sequences for origin with very low proportions of false positives and negatives. We believe that this tool will be useful in microbial and evolutionary ecology as well as in metagenomics.
Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors
Umaer, Khan; Ciganda, Martin
2014-01-01
Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018
An inhibitor of eIF2 activity in the sRNA pool of eukaryotic cells.
Centrella, Michael; Porter, David L; McCarthy, Thomas L
2011-08-15
Eukaryotic protein synthesis is a multi-step and highly controlled process that includes an early initiation complex containing eukaryotic initiation factor 2 (eIF2), GTP, and methionine-charged initiator methionyl-tRNA (met-tRNAi). During studies to reconstruct formation of the ternary complex containing these molecules, we detected a potent inhibitor in low molecular mass RNA (sRNA) preparations of eukaryotic tRNA. The ternary complex inhibitor (TCI) was retained in the total sRNA pool after met-tRNAi was charged by aminoacyl tRNA synthetase, co-eluted with sRNA by size exclusion chromatography, but resolved from met-tRNAi by ion exchange chromatography. The adverse effect of TCI was not overcome by high GTP or magnesium omission and was independent of GTP regeneration. Rather, TCI suppressed the rate of ternary complex formation, and disrupted protein synthesis and the accumulation of heavy polymeric ribosomes in reticulocyte lysates in vitro. Lastly, a component or components in ribosome depleted cell lysate significantly reversed TCI activity. Since assembly of the met-tRNAi/eIF2/GTP ternary complex is integral to protein synthesis, awareness of TCI is important to avoid confusion in studies of translation initiation. A clear definition of TCI may also allow a better appreciation of physiologic or pathologic situations, factors, and events that control protein synthesis in vivo. Copyright © 2011 Elsevier B.V. All rights reserved.
Al-Hadid, Qais; White, Jonelle; Clarke, Steven
2016-02-12
A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. Copyright © 2016 Elsevier Inc. All rights reserved.
Lalucque, Hervé; Silar, Philippe
2000-01-01
Background To date, in eukaryotes, ribosomal protein expression is known to be regulated at the transcriptional and/or translational levels. But other forms of regulation may be possible. Results Here, we report the successful tagging of functional ribosomal particles with a S7-GFP chimaeric protein, making it possible to observe in vivo ribosome dynamics in the filamentous fungus Podospora anserina. Microscopic observations revealed a novel kind of ribosomal protein regulation during the passage between cell growth and stationary phases, with a transient accumulation of ribosomal proteins and/or ribosome subunits in the nucleus, possibly the nucleolus, being observed at the beginning of stationary phase. Conclusion Nuclear sequestration can be another level of ribosomal protein regulation in eukaryotic cells.This may contribute to the regulation of cell growth and division. PMID:11112985
Structural characterization of ribosome recruitment and translocation by type IV IRES.
Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S
2016-05-09
Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation.
Structural characterization of ribosome recruitment and translocation by type IV IRES
Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S
2016-01-01
Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts the otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451
Gongadze, G M
2011-12-01
5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.
Crepin, Thibaut; Shalak, Vyacheslav F.; Yaremchuk, Anna D.; Vlasenko, Dmytro O.; McCarthy, Andrew; Negrutskii, Boris S.; Tukalo, Michail A.; El'skaya, Anna V.
2014-01-01
Eukaryotic elongation factor eEF1A transits between the GTP- and GDP-bound conformations during the ribosomal polypeptide chain elongation. eEF1A*GTP establishes a complex with the aminoacyl-tRNA in the A site of the 80S ribosome. Correct codon–anticodon recognition triggers GTP hydrolysis, with subsequent dissociation of eEF1A*GDP from the ribosome. The structures of both the ‘GTP’- and ‘GDP’-bound conformations of eEF1A are unknown. Thus, the eEF1A-related ribosomal mechanisms were anticipated only by analogy with the bacterial homolog EF-Tu. Here, we report the first crystal structure of the mammalian eEF1A2*GDP complex which indicates major differences in the organization of the nucleotide-binding domain and intramolecular movements of eEF1A compared to EF-Tu. Our results explain the nucleotide exchange mechanism in the mammalian eEF1A and suggest that the first step of eEF1A*GDP dissociation from the 80S ribosome is the rotation of the nucleotide-binding domain observed after GTP hydrolysis. PMID:25326326
Jakovljevic, Jelena; Ohmayer, Uli; Gamalinda, Michael; Talkish, Jason; Alexander, Lisa; Linnemann, Jan; Milkereit, Philipp; Woolford, John L.
2012-01-01
Ribosome biogenesis is a complex multistep process that involves alternating steps of folding and processing of pre-rRNAs in concert with assembly of ribosomal proteins. Recently, there has been increased interest in the roles of ribosomal proteins in eukaryotic ribosome biogenesis in vivo, focusing primarily on their function in pre-rRNA processing. However, much less is known about participation of ribosomal proteins in the formation and rearrangement of preribosomal particles as they mature to functional subunits. We have studied ribosomal proteins L7 and L8, which are required for the same early steps in pre-rRNA processing during assembly of 60S subunits but are located in different domains within ribosomes. Depletion of either leads to defects in processing of 27SA3 to 27SB pre-rRNA and turnover of pre-rRNAs destined for large ribosomal subunits. A specific subset of proteins is diminished from these residual assembly intermediates: six assembly factors required for processing of 27SA3 pre-rRNA and four ribosomal proteins bound to domain I of 25S and 5.8S rRNAs surrounding the polypeptide exit tunnel. In addition, specific sets of ribosomal proteins are affected in each mutant: In the absence of L7, proteins bound to domain II, L6, L14, L20, and L33 are greatly diminished, while proteins L13, L15, and L36 that bind to domain I are affected in the absence of L8. Thus, L7 and L8 might establish RNP structures within assembling ribosomes necessary for the stable association and function of the A3 assembly factors and for proper assembly of the neighborhoods containing domains I and II. PMID:22893726
Expanding the ribosomal universe.
Dinman, Jonathan D; Kinzy, Terri Goss
2009-12-09
In this issue of Structure, Taylor et al. (2009) present the most complete model of an eukaryotic ribosome to date. This achievement represents a critical milestone along the path to structurally defining the unique aspects of the eukaryotic protein synthetic machinery.
Reengineering ribosome export.
Lo, Kai-Yin; Johnson, Arlen W
2009-03-01
Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.
Lo, Kai-Yin
2009-01-01
Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820
Crepin, Thibaut; Shalak, Vyacheslav F; Yaremchuk, Anna D; Vlasenko, Dmytro O; McCarthy, Andrew; Negrutskii, Boris S; Tukalo, Michail A; El'skaya, Anna V
2014-11-10
Eukaryotic elongation factor eEF1A transits between the GTP- and GDP-bound conformations during the ribosomal polypeptide chain elongation. eEF1A*GTP establishes a complex with the aminoacyl-tRNA in the A site of the 80S ribosome. Correct codon-anticodon recognition triggers GTP hydrolysis, with subsequent dissociation of eEF1A*GDP from the ribosome. The structures of both the 'GTP'- and 'GDP'-bound conformations of eEF1A are unknown. Thus, the eEF1A-related ribosomal mechanisms were anticipated only by analogy with the bacterial homolog EF-Tu. Here, we report the first crystal structure of the mammalian eEF1A2*GDP complex which indicates major differences in the organization of the nucleotide-binding domain and intramolecular movements of eEF1A compared to EF-Tu. Our results explain the nucleotide exchange mechanism in the mammalian eEF1A and suggest that the first step of eEF1A*GDP dissociation from the 80S ribosome is the rotation of the nucleotide-binding domain observed after GTP hydrolysis. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pánek, Josef; Kolář, Michal; Vohradský, Jiří; Shivaya Valášek, Leoš
2013-01-01
There are several key mechanisms regulating eukaryotic gene expression at the level of protein synthesis. Interestingly, the least explored mechanisms of translational control are those that involve the translating ribosome per se, mediated for example via predicted interactions between the ribosomal RNAs (rRNAs) and mRNAs. Here, we took advantage of robustly growing large-scale data sets of mRNA sequences for numerous organisms, solved ribosomal structures and computational power to computationally explore the mRNA–rRNA complementarity that is statistically significant across the species. Our predictions reveal highly specific sequence complementarity of 18S rRNA sequences with mRNA 5′ untranslated regions (UTRs) forming a well-defined 3D pattern on the rRNA sequence of the 40S subunit. Broader evolutionary conservation of this pattern may imply that 5′ UTRs of eukaryotic mRNAs, which have already emerged from the mRNA-binding channel, may contact several complementary spots on 18S rRNA situated near the exit of the mRNA binding channel and on the middle-to-lower body of the solvent-exposed 40S ribosome including its left foot. We discuss physiological significance of this structurally conserved pattern and, in the context of previously published experimental results, propose that it modulates scanning of the 40S subunit through 5′ UTRs of mRNAs. PMID:23804757
Initiation of translation in bacteria by a structured eukaryotic IRES RNA.
Colussi, Timothy M; Costantino, David A; Zhu, Jianyu; Donohue, John Paul; Korostelev, Andrei A; Jaafar, Zane A; Plank, Terra-Dawn M; Noller, Harry F; Kieft, Jeffrey S
2015-03-05
The central dogma of gene expression (DNA to RNA to protein) is universal, but in different domains of life there are fundamental mechanistic differences within this pathway. For example, the canonical molecular signals used to initiate protein synthesis in bacteria and eukaryotes are mutually exclusive. However, the core structures and conformational dynamics of ribosomes that are responsible for the translation steps that take place after initiation are ancient and conserved across the domains of life. We wanted to explore whether an undiscovered RNA-based signal might be able to use these conserved features, bypassing mechanisms specific to each domain of life, and initiate protein synthesis in both bacteria and eukaryotes. Although structured internal ribosome entry site (IRES) RNAs can manipulate ribosomes to initiate translation in eukaryotic cells, an analogous RNA structure-based mechanism has not been observed in bacteria. Here we report our discovery that a eukaryotic viral IRES can initiate translation in live bacteria. We solved the crystal structure of this IRES bound to a bacterial ribosome to 3.8 Å resolution, revealing that despite differences between bacterial and eukaryotic ribosomes this IRES binds directly to both and occupies the space normally used by transfer RNAs. Initiation in both bacteria and eukaryotes depends on the structure of the IRES RNA, but in bacteria this RNA uses a different mechanism that includes a form of ribosome repositioning after initial recruitment. This IRES RNA bridges billions of years of evolutionary divergence and provides an example of an RNA structure-based translation initiation signal capable of operating in two domains of life.
Lamichhane, Tek N; Abeydeera, N Dinuka; Duc, Anne-Cécile E; Cunningham, Philip R; Chow, Christine S
2011-01-28
Ribosomal RNA is the catalytic portion of ribosomes, and undergoes a variety of conformational changes during translation. Structural changes in ribosomal RNA can be facilitated by the presence of modified nucleotides. Helix 31 of bacterial 16S ribosomal RNA harbors two modified nucleotides, m²G966 and m⁵C967, that are highly conserved among bacteria, though the degree and nature of the modifications in this region are different in eukaryotes. Contacts between helix 31 and the P-site tRNA, initiation factors, and ribosomal proteins highlight the importance of this region in translation. In this work, a heptapeptide M13 phage-display library was screened for ligands that target the wild-type, naturally modified bacterial helix 31. Several peptides, including TYLPWPA, CVRPFAL, TLWDLIP, FVRPFPL, ATPLWLK, and DIRTQRE, were found to be prevalent after several rounds of screening. Several of the peptides exhibited moderate affinity (in the high nM to low µM range) to modified helix 31 in biophysical assays, including surface plasmon resonance (SPR), and were also shown to bind 30S ribosomal subunits. These peptides also inhibited protein synthesis in cell-free translation assays.
Ciganda, Martin; Williams, Noreen
2012-01-01
The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041
Dobrenel, Thomas; Mancera-Martínez, Eder; Forzani, Céline; Azzopardi, Marianne; Davanture, Marlène; Moreau, Manon; Schepetilnikov, Mikhail; Chicher, Johana; Langella, Olivier; Zivy, Michel; Robaglia, Christophe; Ryabova, Lyubov A.; Hanson, Johannes; Meyer, Christian
2016-01-01
Protein translation is an energy consuming process that has to be fine-tuned at both the cell and organism levels to match the availability of resources. The target of rapamycin kinase (TOR) is a key regulator of a large range of biological processes in response to environmental cues. In this study, we have investigated the effects of TOR inactivation on the expression and regulation of Arabidopsis ribosomal proteins at different levels of analysis, namely from transcriptomic to phosphoproteomic. TOR inactivation resulted in a coordinated down-regulation of the transcription and translation of nuclear-encoded mRNAs coding for plastidic ribosomal proteins, which could explain the chlorotic phenotype of the TOR silenced plants. We have identified in the 5′ untranslated regions (UTRs) of this set of genes a conserved sequence related to the 5′ terminal oligopyrimidine motif, which is known to confer translational regulation by the TOR kinase in other eukaryotes. Furthermore, the phosphoproteomic analysis of the ribosomal fraction following TOR inactivation revealed a lower phosphorylation of the conserved Ser240 residue in the C-terminal region of the 40S ribosomal protein S6 (RPS6). These results were confirmed by Western blot analysis using an antibody that specifically recognizes phosphorylated Ser240 in RPS6. Finally, this antibody was used to follow TOR activity in plants. Our results thus uncover a multi-level regulation of plant ribosomal genes and proteins by the TOR kinase. PMID:27877176
Kahvejian, Avak; Svitkin, Yuri V; Sukarieh, Rami; M'Boutchou, Marie-Noël; Sonenberg, Nahum
2005-01-01
Translation initiation is a multistep process involving several canonical translation factors, which assemble at the 5'-end of the mRNA to promote the recruitment of the ribosome. Although the 3' poly(A) tail of eukaryotic mRNAs and its major bound protein, the poly(A)-binding protein (PABP), have been studied extensively, their mechanism of action in translation is not well understood and is confounded by differences between in vivo and in vitro systems. Here, we provide direct evidence for the involvement of PABP in key steps of the translation initiation pathway. Using a new technique to deplete PABP from mammalian cell extracts, we show that extracts lacking PABP exhibit dramatically reduced rates of translation, reduced efficiency of 48S and 80S ribosome initiation complex formation, and impaired interaction of eIF4E with the mRNA cap structure. Supplementing PABP-depleted extracts with wild-type PABP completely rectified these deficiencies, whereas a mutant of PABP, M161A, which is incapable of interacting with eIF4G, failed to restore translation. In addition, a stronger inhibition (approximately twofold) of 80S as compared to 48S ribosome complex formation (approximately 65% vs. approximately 35%, respectively) by PABP depletion suggests that PABP plays a direct role in 60S subunit joining. PABP can thus be considered a canonical translation initiation factor, integral to initiation complex formation at the 5'-end of mRNA.
Kahvejian, Avak; Svitkin, Yuri V.; Sukarieh, Rami; M'Boutchou, Marie-Noël; Sonenberg, Nahum
2005-01-01
Translation initiation is a multistep process involving several canonical translation factors, which assemble at the 5′-end of the mRNA to promote the recruitment of the ribosome. Although the 3′ poly(A) tail of eukaryotic mRNAs and its major bound protein, the poly(A)-binding protein (PABP), have been studied extensively, their mechanism of action in translation is not well understood and is confounded by differences between in vivo and in vitro systems. Here, we provide direct evidence for the involvement of PABP in key steps of the translation initiation pathway. Using a new technique to deplete PABP from mammalian cell extracts, we show that extracts lacking PABP exhibit dramatically reduced rates of translation, reduced efficiency of 48S and 80S ribosome initiation complex formation, and impaired interaction of eIF4E with the mRNA cap structure. Supplementing PABP-depleted extracts with wild-type PABP completely rectified these deficiencies, whereas a mutant of PABP, M161A, which is incapable of interacting with eIF4G, failed to restore translation. In addition, a stronger inhibition (approximately twofold) of 80S as compared to 48S ribosome complex formation (∼65% vs. ∼35%, respectively) by PABP depletion suggests that PABP plays a direct role in 60S subunit joining. PABP can thus be considered a canonical translation initiation factor, integral to initiation complex formation at the 5′-end of mRNA. PMID:15630022
Evolution of prokaryote and eukaryote lines inferred from sequence evidence
NASA Technical Reports Server (NTRS)
Hunt, L. T.; George, D. G.; Yeh, L.-S.; Dayhoff, M. O.
1984-01-01
This paper describes the evolution of prokaryotes and early eukaryotes, including their symbiotic relationships, as inferred from phylogenetic trees of bacterial ferredoxin, 5S ribosomal RNA, ribulose-1,5-biphosphate carboxylase large chain, and mitochondrial cytochrome oxidase polypeptide II.
Ribosome-inactivating proteins: potent poisons and molecular tools.
Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M
2013-11-15
Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms.
Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes
2014-12-01
During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying
2013-11-15
Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletionmore » and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.« less
The Expansion Segments of 28S Ribosomal RNA Extensively Match Human Messenger RNAs
Parker, Michael S.; Balasubramaniam, Ambikaipakan; Sallee, Floyd R.; Parker, Steven L.
2018-01-01
Eukaryote ribosomal RNAs (rRNAs) have expanded in the course of phylogeny by addition of nucleotides in specific insertion areas, the expansion segments. These number about 40 in the larger (25–28S) rRNA (up to 2,400 nucleotides), and about 12 in the smaller (18S) rRNA (<700 nucleotides). Expansion of the larger rRNA shows a clear phylogenetic increase, with a dramatic rise in mammals and especially in hominids. Substantial portions of expansion segments in this RNA are not bound to ribosomal proteins, and may engage extraneous interactants, including messenger RNAs (mRNAs). Studies on the ribosome-mRNA interaction have focused on proteins of the smaller ribosomal subunit, with some examination of 18S rRNA. However, the expansion segments of human 28S rRNA show much higher density and numbers of mRNA matches than those of 18S rRNA, and also a higher density and match numbers than its own core parts. We have studied that with frequent and potentially stable matches containing 7–15 nucleotides. The expansion segments of 28S rRNA average more than 50 matches per mRNA even assuming only 5% of their sequence as available for such interaction. Large expansion segments 7, 15, and 27 of 28S rRNA also have copious long (≥10-nucleotide) matches to most human mRNAs, with frequencies much higher than in other 28S rRNA parts. Expansion segments 7 and 27 and especially segment 15 of 28S rRNA show large size increase in mammals compared to other metazoans, which could reflect a gain of function related to interaction with non-ribosomal partners. The 28S rRNA expansion segment 15 shows very high increments in size, guanosine, and cytidine nucleotide content and mRNA matching in mammals, and especially in hominids. With these segments (but not with other 28S rRNA or any 18S rRNA expansion segments) the density and number of matches are much higher in 5′-terminal than in 3′-terminal untranslated mRNA regions, which may relate to mRNA mobilization via 5′ termini. Matches
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang Yongmin; IgE Therapeutics, Inc., San Diego, CA 92121-2233; Barankiewicz, Teresa J.
2007-07-27
Ribosome display is a cell-free system permitting gene selection through the physical association of genetic material (mRNA) and its phenotypic (protein) product. While often used to select single-chain antibodies from large libraries by panning against immobilized antigens, we have adapted ribosome display for use in the 'reverse' format in order to select high affinity antigenic determinants against solid-phase antibody. To create an antigenic scaffold, DNA encoding green fluorescent protein (GFP) was fused to a light chain constant domain (C{kappa}) with stop codon deleted, and with 5' signals (T7 promoter, Kozak) enabling coupled transcription/translation in a eukaryotic cell-free system. Epitopes onmore » either GFP (5') or C{kappa} (3') were selected by anti-GFP or anti-C{kappa} antibodies, respectively, coupled to magnetic beads. After selection, mRNA was amplified directly from protein-ribosome-mRNA (PRM) complexes by in situ PCR followed by internal amplification and reassembly PCR. As little as 10 fg of the 1 kb DNA construct, i.e. approximately 7500 molecules, could be recovered following a single round of interaction with solid-phase anti-GFP antibody. This platform is highly specific and sensitive for the antigen-antibody interaction and may permit selection and reshaping of high affinity antigenic variants of scaffold proteins.« less
The path from nucleolar 90S to cytoplasmic 40S pre-ribosomes.
Schäfer, Thorsten; Strauss, Daniela; Petfalski, Elisabeth; Tollervey, David; Hurt, Ed
2003-03-17
Recent reports have increased our knowledge of the consecutive steps during 60S ribosome biogenesis substantially, but 40S subunit formation is less well understood. Here, we investigate the maturation of nucleolar 90S pre-ribosomes into cytoplasmic 40S pre-ribosomes. During the transition from 90S to 40S particles, the majority of non-ribosomal proteins (approximately 30 species) dissociate, and significantly fewer factors associate with 40S pre-ribosomes. Notably, some of these components are part of both early 90S and intermediate 40S pre-particles in the nucleolus (e.g. Enp1p, Dim1p and Rrp12p), whereas others (e.g. Rio2p and Nob1p) are found mainly on late cytoplasmic pre-40S subunits. Finally, temperature-sensitive mutants mapping either in earlier (enp1-1) or later (rio2-1) components exhibit defects in the formation and nuclear export of pre-40S subunits. Our data provide an initial biochemical map of the pre-40S ribosomal subunit on its path from the nucleolus to the cytoplasm. This pathway involves fewer changes in composition than seen during 60S biogenesis.
Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago
2016-12-01
Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.
Szymanski, Maciej; Karlowski, Wojciech M
2016-01-01
In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.
Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit
NASA Astrophysics Data System (ADS)
Hashem, Yaser; Des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U. T.; Frank, Joachim
2013-11-01
Hepatitis C virus (HCV) and classical swine fever virus (CSFV) messenger RNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5'-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound initiator methionyl transfer RNA to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF3 (refs 2, 5, 6, 7, 9, 10, 11, 12), but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF3 and the HCV IRES revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components. Here we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Remarkably, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S-IRES binary complex, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favouring translation of viral mRNAs.
Role of Mex67-Mtr2 in the Nuclear Export of 40S Pre-Ribosomes
Occhipinti, Laura; Kemmler, Stefan; Panse, Vikram G.
2012-01-01
Nuclear export of mRNAs and pre-ribosomal subunits (pre40S and pre60S) is fundamental to all eukaryotes. While genetic approaches in budding yeast have identified bona fide export factors for mRNAs and pre60S subunits, little is known regarding nuclear export of pre40S subunits. The yeast heterodimeric transport receptor Mex67-Mtr2 (TAP-p15 in humans) binds mRNAs and pre60S subunits in the nucleus and facilitates their passage through the nuclear pore complex (NPC) into the cytoplasm by interacting with Phe-Gly (FG)-rich nucleoporins that line its transport channel. By exploiting a combination of genetic, cell-biological, and biochemical approaches, we uncovered an unanticipated role of Mex67-Mtr2 in the nuclear export of 40S pre-ribosomes. We show that recruitment of Mex67-Mtr2 to pre40S subunits requires loops emanating from its NTF2-like domains and that the C-terminal FG-rich nucleoporin interacting UBA-like domain within Mex67 contributes to the transport of pre40S subunits to the cytoplasm. Remarkably, the same loops also recruit Mex67-Mtr2 to pre60S subunits and to the Nup84 complex, the respective interactions crucial for nuclear export of pre60S subunits and mRNAs. Thus Mex67-Mtr2 is a unique transport receptor that employs a common interaction surface to participate in the nuclear export of both pre-ribosomal subunits and mRNAs. Mex67-Mtr2 could engage a regulatory crosstalk among the three major export pathways for optimal cellular growth and proliferation. PMID:22956913
Cryo-EM structure of a late pre-40S ribosomal subunit from Saccharomyces cerevisiae
Schmidt, Christian; Berninghausen, Otto; Becker, Thomas
2017-01-01
Mechanistic understanding of eukaryotic ribosome formation requires a detailed structural knowledge of the numerous assembly intermediates, generated along a complex pathway. Here, we present the structure of a late pre-40S particle at 3.6 Å resolution, revealing in molecular detail how assembly factors regulate the timely folding of pre-18S rRNA. The structure shows that, rather than sterically blocking 40S translational active sites, the associated assembly factors Tsr1, Enp1, Rio2 and Pno1 collectively preclude their final maturation, thereby preventing untimely tRNA and mRNA binding and error prone translation. Moreover, the structure explains how Pno1 coordinates the 3’end cleavage of the 18S rRNA by Nob1 and how the late factor’s removal in the cytoplasm ensures the structural integrity of the maturing 40S subunit. PMID:29155690
NASA Astrophysics Data System (ADS)
Kravchenko, O. V.; Mitroshin, I. V.; Gabdulkhakov, A. G.; Nikonov, S. V.; Garber, M. B.
2011-07-01
Lateral L12-stalk (P1-stalk in Archaea, P1/P2-stalk in eukaryotes) is an obligatory morphological element of large ribosomal subunits in all organisms studied. This stalk is composed of the complex of ribosomal proteins L10(P0) and L12(P1) and interacts with 23S rRNA through the protein L10(P0). L12(P1)-stalk is involved in the formation of GTPase center of the ribosome and plays an important role in the ribosome interaction with translation factors. High mobility of this stalk puts obstacles in determination of its structure within the intact ribosome. Crystals of a two-domain N-terminal fragment of ribosomal protein L10(P0) from the archaeon Methanococcus jannaschii in complex with a specific fragment of rRNA from the same organism have been obtained. The crystals diffract X-rays at 3.2 Å resolution.
Replication and Transcription of Eukaryotic DNA in Esherichia coli
Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.
1974-01-01
Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264
Komar, Anton A; Gross, Stephane R; Barth-Baus, Diane; Strachan, Ryan; Hensold, Jack O; Goss Kinzy, Terri; Merrick, William C
2005-04-22
Eukaryotic initiation factor 2A (eIF2A) has been shown to direct binding of the initiator methionyl-tRNA (Met-tRNA(i)) to 40 S ribosomal subunits in a codon-dependent manner, in contrast to eIF2, which requires GTP but not the AUG codon to bind initiator tRNA to 40 S subunits. We show here that yeast eIF2A genetically interacts with initiation factor eIF4E, suggesting that both proteins function in the same pathway. The double eIF2A/eIF4E-ts mutant strain displays a severe slow growth phenotype, which correlated with the accumulation of 85% of the double mutant cells arrested at the G(2)/M border. These cells also exhibited a disorganized actin cytoskeleton and elevated actin levels, suggesting that eIF2A might be involved in controlling the expression of genes involved in morphogenic processes. Further insights into eIF2A function were gained from the studies of eIF2A distribution in ribosomal fractions obtained from either an eIF5BDelta (fun12Delta) strain or a eIF3b-ts (prt1-1) strain. It was found that the binding of eIF2A to 40 and 80 S ribosomes was not impaired in either strain. We also found that eIF2A functions as a suppressor of Ure2p internal ribosome entry site-mediated translation in yeast cells. The regulation of expression from the URE2 internal ribosome entry site appears to be through the levels of eIF2A protein, which has been found to be inherently unstable with a half-life of approximately 17 min. It was hypothesized that this instability allows for translational control through the level of eIF2A protein in yeast cells.
Yu, Shoukai; Lemos, Bernardo
2016-12-31
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Lindström, Mikael S.
2012-01-01
Biogenesis of eukaryotic ribosomes occurs mainly in a specific subnuclear compartment, the nucleolus, and involves the coordinated assembly of ribosomal RNA and ribosomal proteins. Identification of amino acid sequences mediating nucleolar localization of ribosomal proteins may provide important clues to understand the early steps in ribosome biogenesis. Human ribosomal protein S9 (RPS9), known in prokaryotes as RPS4, plays a critical role in ribosome biogenesis and directly binds to ribosomal RNA. RPS9 is targeted to the nucleolus but the regions in the protein that determine its localization remains unknown. Cellular expression of RPS9 deletion mutants revealed that it has three regions capable of driving nuclear localization of a fused enhanced green fluorescent protein (EGFP). The first region was mapped to the RPS9 N-terminus while the second one was located in the proteins C-terminus. The central and third region in RPS9 also behaved as a strong nucleolar localization signal and was hence sufficient to cause accumulation of EGFP in the nucleolus. RPS9 was previously shown to interact with the abundant nucleolar chaperone NPM1 (nucleophosmin). Evaluating different RPS9 fragments for their ability to bind NPM1 indicated that there are two binding sites for NPM1 on RPS9. Enforced expression of NPM1 resulted in nucleolar accumulation of a predominantly nucleoplasmic RPS9 mutant. Moreover, it was found that expression of a subset of RPS9 deletion mutants resulted in altered nucleolar morphology as evidenced by changes in the localization patterns of NPM1, fibrillarin and the silver stained nucleolar organizer regions. In conclusion, RPS9 has three regions that each are competent for nuclear localization, but only the central region acted as a potent nucleolar localization signal. Interestingly, the RPS9 nucleolar localization signal is residing in a highly conserved domain corresponding to a ribosomal RNA binding site. PMID:23285058
Yu, Shoukai; Lemos, Bernardo
2016-01-01
Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. PMID:27797956
RNA Export through the NPC in Eukaryotes.
Okamura, Masumi; Inose, Haruko; Masuda, Seiji
2015-03-20
In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC.
Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M
1991-06-01
Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.
Duval, Mélodie; Korepanov, Alexey; Fuchsbauer, Olivier; Fechter, Pierre; Haller, Andrea; Fabbretti, Attilio; Choulier, Laurence; Micura, Ronald; Klaholz, Bruno P.; Romby, Pascale; Springer, Mathias; Marzi, Stefano
2013-01-01
Regulation of translation initiation is well appropriate to adapt cell growth in response to stress and environmental changes. Many bacterial mRNAs adopt structures in their 5′ untranslated regions that modulate the accessibility of the 30S ribosomal subunit. Structured mRNAs interact with the 30S in a two-step process where the docking of a folded mRNA precedes an accommodation step. Here, we used a combination of experimental approaches in vitro (kinetic of mRNA unfolding and binding experiments to analyze mRNA–protein or mRNA–ribosome complexes, toeprinting assays to follow the formation of ribosomal initiation complexes) and in vivo (genetic) to monitor the action of ribosomal protein S1 on the initiation of structured and regulated mRNAs. We demonstrate that r-protein S1 endows the 30S with an RNA chaperone activity that is essential for the docking and the unfolding of structured mRNAs, and for the correct positioning of the initiation codon inside the decoding channel. The first three OB-fold domains of S1 retain all its activities (mRNA and 30S binding, RNA melting activity) on the 30S subunit. S1 is not required for all mRNAs and acts differently on mRNAs according to the signals present at their 5′ ends. This work shows that S1 confers to the ribosome dynamic properties to initiate translation of a large set of mRNAs with diverse structural features. PMID:24339747
Shi, Wei-Wei; Tang, Yun-Sang; Sze, See-Yuen; Zhu, Zhen-Ning; Wong, Kam-Bo; Shaw, Pang-Chui
2016-10-13
Ricin is a type 2 ribosome-inactivating protein (RIP), containing a catalytic A chain and a lectin-like B chain. It inhibits protein synthesis by depurinating the N-glycosidic bond at α-sarcin/ricin loop (SRL) of the 28S rRNA, which thereby prevents the binding of elongation factors to the GTPase activation center of the ribosome. Here, we present the 1.6 Å crystal structure of Ricin A chain (RTA) complexed to the C-terminal peptide of the ribosomal stalk protein P2, which plays a crucial role in specific recognition of elongation factors and recruitment of eukaryote-specific RIPs to the ribosomes. Our structure reveals that the C-terminal GFGLFD motif of P2 peptide is inserted into a hydrophobic pocket of RTA, while the interaction assays demonstrate the structurally untraced SDDDM motif of P2 peptide contributes to the interaction with RTA. This interaction mode of RTA and P protein is in contrast to that with trichosanthin (TCS), Shiga-toxin (Stx) and the active form of maize RIP (MOD), implying the flexibility of the P2 peptide-RIP interaction, for the latter to gain access to ribosome.
Phosphorylation of Wheat Germ Initiation Factors and Ribosomal Proteins 1
Browning, Karen S.; Yan, Tyan Fuh J.; Lauer, Stephen J.; Aquino, Lu Ann; Tao, Mariano; Ravel, Joanne M.
1985-01-01
The ability of the wheat germ initiation factors and ribosomes to serve as substrates for a wheat germ protein kinase (Yan and Tao 1982 J Biol Chem 257: 7037-7043) has been investigated. The wheat germ kinase catalyzes the phosphorylation of the 42,000 dalton subunit of eukaryotic initiation factor (eIF)-2 and the 107,000 dalton subunit of eIF-3. Other initiation factors, eIF-4B and eIF-4A, and elongation factors, EF-1 and EF-2, are not phosphorylated by the kinase. Quantitative analysis indicates that the kinase catalyzes the incorporation of about 0.5 to 0.6 mole of phosphate per mole of the 42,000 dalton subunit of eIF-2 and about 6 moles of phosphate per mole of the 107,000 dalton subunit of eIF-3. Three proteins (Mr = 38,000, 14,800, and 12,600) of the 60S ribosomal subunit are phosphorylated by the kinase, but none of the 40S ribosomal proteins are substrates of the kinase. No effects of phosphorylation on the activities of eIF-2, eIF-3, or 60S ribosomal subunits could be demonstrated in vitro. Images Fig. 1 Fig. 3 Fig. 4 PMID:16664060
Death of a dogma: eukaryotic mRNAs can code for more than one protein.
Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier
2016-01-08
mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5' UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3' UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Turkina, Maria V; Klang Årstrand, Hanna; Vener, Alexander V
2011-01-01
Protein synthesis in plants is characterized by increase in the translation rates for numerous proteins and central metabolic enzymes during the day phase of the photoperiod. The detailed molecular mechanisms of this diurnal regulation are unknown, while eukaryotic protein translation is mainly controlled at the level of ribosomal initiation complexes, which also involves multiple events of protein phosphorylation. We characterized the extent of protein phosphorylation in cytosolic ribosomes isolated from leaves of the model plant Arabidopsis thaliana harvested during day or night. Proteomic analyses of preparations corresponding to both phases of the photoperiod detected phosphorylation at eight serine residues in the C-termini of six ribosomal proteins: S2-3, S6-1, S6-2, P0-2, P1 and L29-1. This included previously unknown phosphorylation of the 40S ribosomal protein S6 at Ser-231. Relative quantification of the phosphorylated peptides using stable isotope labeling and mass spectrometry revealed a 2.2 times increase in the day/night phosphorylation ratio at this site. Phosphorylation of the S6-1 and S6-2 variants of the same protein at Ser-240 increased by the factors of 4.2 and 1.8, respectively. The 1.6 increase in phosphorylation during the day was also found at Ser-58 of the 60S ribosomal protein L29-1. It is suggested that differential phosphorylation of the ribosomal proteins S6-1, S6-2 and L29-1 may contribute to modulation of the diurnal protein synthesis in plants.
RNA Export through the NPC in Eukaryotes
Okamura, Masumi; Inose, Haruko; Masuda, Seiji
2015-01-01
In eukaryotic cells, RNAs are transcribed in the nucleus and exported to the cytoplasm through the nuclear pore complex. The RNA molecules that are exported from the nucleus into the cytoplasm include messenger RNAs (mRNAs), ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), micro RNAs (miRNAs), and viral mRNAs. Each RNA is transported by a specific nuclear export receptor. It is believed that most of the mRNAs are exported by Nxf1 (Mex67 in yeast), whereas rRNAs, snRNAs, and a certain subset of mRNAs are exported in a Crm1/Xpo1-dependent manner. tRNAs and miRNAs are exported by Xpot and Xpo5. However, multiple export receptors are involved in the export of some RNAs, such as 60S ribosomal subunit. In addition to these export receptors, some adapter proteins are required to export RNAs. The RNA export system of eukaryotic cells is also used by several types of RNA virus that depend on the machineries of the host cell in the nucleus for replication of their genome, therefore this review describes the RNA export system of two representative viruses. We also discuss the NPC anchoring-dependent mRNA export factors that directly recruit specific genes to the NPC. PMID:25802992
Morphological and ecological complexity in early eukaryotic ecosystems.
Javaux, E J; Knoll, A H; Walter, M R
2001-07-05
Molecular phylogeny and biogeochemistry indicate that eukaryotes differentiated early in Earth history. Sequence comparisons of small-subunit ribosomal RNA genes suggest a deep evolutionary divergence of Eukarya and Archaea; C27-C29 steranes (derived from sterols synthesized by eukaryotes) and strong depletion of 13C (a biogeochemical signature of methanogenic Archaea) in 2,700 Myr old kerogens independently place a minimum age on this split. Steranes, large spheroidal microfossils, and rare macrofossils of possible eukaryotic origin occur in Palaeoproterozoic rocks. Until now, however, evidence for morphological and taxonomic diversification within the domain has generally been restricted to very late Mesoproterozoic and Neoproterozoic successions. Here we show that the cytoskeletal and ecological prerequisites for eukaryotic diversification were already established in eukaryotic microorganisms fossilized nearly 1,500 Myr ago in shales of the early Mesoproterozoic Roper Group in northern Australia.
Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.
2014-01-01
All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383
Mazroui, Rachid; Sukarieh, Rami; Bordeleau, Marie-Eve; Kaufman, Randal J; Northcote, Peter; Tanaka, Junichi; Gallouzi, Imed; Pelletier, Jerry
2006-10-01
Cytoplasmic aggregates known as stress granules (SGs) arise as a consequence of cellular stress and contain stalled translation preinitiation complexes. These foci are thought to serve as sites of mRNA storage or triage during the cell stress response. SG formation has been shown to require induction of eukaryotic initiation factor (eIF)2alpha phosphorylation. Herein, we investigate the potential role of other initiation factors in this process and demonstrate that interfering with eIF4A activity, an RNA helicase required for the ribosome recruitment phase of translation initiation, induces SG formation and that this event is not dependent on eIF2alpha phosphorylation. We also show that inhibition of eIF4A activity does not impair the ability of eIF2alpha to be phosphorylated under stress conditions. Furthermore, we observed SG assembly upon inhibition of cap-dependent translation after poliovirus infection. We propose that SG modeling can occur via both eIF2alpha phosphorylation-dependent and -independent pathways that target translation initiation.
Mazroui, Rachid; Sukarieh, Rami; Bordeleau, Marie-Eve; Kaufman, Randal J.; Northcote, Peter; Tanaka, Junichi; Gallouzi, Imed
2006-01-01
Cytoplasmic aggregates known as stress granules (SGs) arise as a consequence of cellular stress and contain stalled translation preinitiation complexes. These foci are thought to serve as sites of mRNA storage or triage during the cell stress response. SG formation has been shown to require induction of eukaryotic initiation factor (eIF)2α phosphorylation. Herein, we investigate the potential role of other initiation factors in this process and demonstrate that interfering with eIF4A activity, an RNA helicase required for the ribosome recruitment phase of translation initiation, induces SG formation and that this event is not dependent on eIF2α phosphorylation. We also show that inhibition of eIF4A activity does not impair the ability of eIF2α to be phosphorylated under stress conditions. Furthermore, we observed SG assembly upon inhibition of cap-dependent translation after poliovirus infection. We propose that SG modeling can occur via both eIF2α phosphorylation-dependent and -independent pathways that target translation initiation. PMID:16870703
Svitkin, Yuri V.; Herdy, Barbara; Costa-Mattioli, Mauro; Gingras, Anne-Claude; Raught, Brian; Sonenberg, Nahum
2005-01-01
Translation of m7G-capped cellular mRNAs is initiated by recruitment of ribosomes to the 5′ end of mRNAs via eukaryotic translation initiation factor 4F (eIF4F), a heterotrimeric complex comprised of a cap-binding subunit (eIF4E) and an RNA helicase (eIF4A) bridged by a scaffolding molecule (eIF4G). Internal translation initiation bypasses the requirement for the cap and eIF4E and occurs on viral and cellular mRNAs containing internal ribosomal entry sites (IRESs). Here we demonstrate that eIF4E availability plays a critical role in the switch from cap-dependent to IRES-mediated translation in picornavirus-infected cells. When both capped and IRES-containing mRNAs are present (as in intact cells or in vitro translation extracts), a decrease in the amount of eIF4E associated with the eIF4F complex elicits a striking increase in IRES-mediated viral mRNA translation. This effect is not observed in translation extracts depleted of capped mRNAs, indicating that capped mRNAs compete with IRES-containing mRNAs for translation. These data explain numerous reported observations where viral mRNAs are preferentially translated during infection. PMID:16287867
Svitkin, Yuri V; Herdy, Barbara; Costa-Mattioli, Mauro; Gingras, Anne-Claude; Raught, Brian; Sonenberg, Nahum
2005-12-01
Translation of m7G-capped cellular mRNAs is initiated by recruitment of ribosomes to the 5' end of mRNAs via eukaryotic translation initiation factor 4F (eIF4F), a heterotrimeric complex comprised of a cap-binding subunit (eIF4E) and an RNA helicase (eIF4A) bridged by a scaffolding molecule (eIF4G). Internal translation initiation bypasses the requirement for the cap and eIF4E and occurs on viral and cellular mRNAs containing internal ribosomal entry sites (IRESs). Here we demonstrate that eIF4E availability plays a critical role in the switch from cap-dependent to IRES-mediated translation in picornavirus-infected cells. When both capped and IRES-containing mRNAs are present (as in intact cells or in vitro translation extracts), a decrease in the amount of eIF4E associated with the eIF4F complex elicits a striking increase in IRES-mediated viral mRNA translation. This effect is not observed in translation extracts depleted of capped mRNAs, indicating that capped mRNAs compete with IRES-containing mRNAs for translation. These data explain numerous reported observations where viral mRNAs are preferentially translated during infection.
RNase MRP and the RNA processing cascade in the eukaryotic ancestor.
Woodhams, Michael D; Stadler, Peter F; Penny, David; Collins, Lesley J
2007-02-08
Within eukaryotes there is a complex cascade of RNA-based macromolecules that process other RNA molecules, especially mRNA, tRNA and rRNA. An example is RNase MRP processing ribosomal RNA (rRNA) in ribosome biogenesis. One hypothesis is that this complexity was present early in eukaryotic evolution; an alternative is that an initial simpler network later gained complexity by gene duplication in lineages that led to animals, fungi and plants. Recently there has been a rapid increase in support for the complexity-early theory because the vast majority of these RNA-processing reactions are found throughout eukaryotes, and thus were likely to be present in the last common ancestor of living eukaryotes, herein called the Eukaryotic Ancestor. We present an overview of the RNA processing cascade in the Eukaryotic Ancestor and investigate in particular, RNase MRP which was previously thought to have evolved later in eukaryotes due to its apparent limited distribution in fungi and animals and plants. Recent publications, as well as our own genomic searches, find previously unknown RNase MRP RNAs, indicating that RNase MRP has a wide distribution in eukaryotes. Combining secondary structure and promoter region analysis of RNAs for RNase MRP, along with analysis of the target substrate (rRNA), allows us to discuss this distribution in the light of eukaryotic evolution. We conclude that RNase MRP can now be placed in the RNA-processing cascade of the Eukaryotic Ancestor, highlighting the complexity of RNA-processing in early eukaryotes. Promoter analyses of MRP-RNA suggest that regulation of the critical processes of rRNA cleavage can vary, showing that even these key cellular processes (for which we expect high conservation) show some species-specific variability. We present our consensus MRP-RNA secondary structure as a useful model for further searches.
Yamaguchi, K; von Knoblauch, K; Subramanian, A R
2000-09-15
Identification of all the protein components of a plastid (chloroplast) ribosomal 30 S subunit has been achieved, using two-dimensional gel electropholesis, high performance liquid chromatography purification, N-terminal sequencing, polymerase chain reaction-based screening of cDNA library, nucleotide sequencing, and mass spectrometry (electrospray ionization, matrix-assisted laser desorption/ionization time-of-flight, and reversed-phase HPLC coupled with electrospray ionization mass spectrometry). 25 proteins were identified, of which 21 are orthologues of all Escherichia coli 30 S ribosomal proteins (S1-S21), and 4 are plastid-specific ribosomal proteins (PSRPs) that have no homologues in the mitochondrial, archaebacterial, or cytosolic ribosomal protein sequences in data bases. 12 of the 25 plastid 30 S ribosomal proteins (PRPs) are encoded in the plastid genome, whereas the remaining 13 are encoded by the nuclear genome. Post-translational transit peptide cleavage sites for the maturation of the 13 cytosolically synthesized PRPs, and post-translational N-terminal processing in the maturation of the 12 plastid synthesized PRPs are described. Post-translational modifications in several PRPs were observed: alpha-N-acetylation of S9, N-terminal processings leading to five mature forms of S6 and two mature forms of S10, C-terminal and/or internal modifications in S1, S14, S18, and S19, leading to two distinct forms differing in mass and/or charge (the corresponding modifications are not observed in E. coli). The four PSRPs in spinach plastid 30 S ribosomal subunit (PSRP-1, 26.8 kDa, pI 6.2; PSRP-2, 21.7 kDa, pI 5.0; PSRP-3, 13.8 kDa, pI 4.9; PSRP-4, 5.2 kDa, pI 11.8) comprise 16% (67.6 kDa) of the total protein mass of the 30 S subunit (429.3 kDa). PSRP-1 and PSRP-3 show sequence similarities with hypothetical photosynthetic bacterial proteins, indicating their possible origins in photosynthetic bacteria. We propose the hypothesis that PSRPs form a "plastid
Khaĭrulina, Iu S; Molotkov, M V; Bulygin, K N; Graĭfer, D M; Ven'yaminova, A G; Frolova, L Iu; Stahl, J; Karpova, G G
2008-01-01
Protein S3 fragments were determined that crosslink to modified mRNA analogues in positions +5 to +12 relative to the first nucleotide in the P-site binding codon in model complexes mimicking states of ribosomes at the elongation and translation termination steps. The mRNA analogues contained a Phe codon UUU/UUC at the 5'-termini that could predetermine the position of the tRNA(Phe) on the ribosome by the location of P-site binding and perfluorophenylazidobenzoyl group at a nucleotide in various positions 3' of the UUU/UUC codon. The crosslinked S3 protein was isolated from 80S ribosomal complexes irradiated with mild UV light and subjected to cyanogen bromide-induced cleavage at methionine residues with subsequent identification of the crosslinked oligopeptides. An analysis of the positions of modified oligopeptides resulting from the cleavage showed that, in dependence on the positions of modified nucleotides in the mRNA analogue, the crosslinking sites were found in the N-terminal half of the protein (fragment 2-127) and/or in the C-terminal fragment 190-236; the latter reflects a new peculiarity in the structure of the mRNA binding center in the ribosome, unknown to date. The results of crosslinking did not depend on the type of A-site codon or on the presence of translation termination factor eRF1.
Ribosome profiling: a Hi-Def monitor for protein synthesis at the genome-wide scale
Michel, Audrey M; Baranov, Pavel V
2013-01-01
Ribosome profiling or ribo-seq is a new technique that provides genome-wide information on protein synthesis (GWIPS) in vivo. It is based on the deep sequencing of ribosome protected mRNA fragments allowing the measurement of ribosome density along all RNA molecules present in the cell. At the same time, the high resolution of this technique allows detailed analysis of ribosome density on individual RNAs. Since its invention, the ribosome profiling technique has been utilized in a range of studies in both prokaryotic and eukaryotic organisms. Several studies have adapted and refined the original ribosome profiling protocol for studying specific aspects of translation. Ribosome profiling of initiating ribosomes has been used to map sites of translation initiation. These studies revealed the surprisingly complex organization of translation initiation sites in eukaryotes. Multiple initiation sites are responsible for the generation of N-terminally extended and truncated isoforms of known proteins as well as for the translation of numerous open reading frames (ORFs), upstream of protein coding ORFs. Ribosome profiling of elongating ribosomes has been used for measuring differential gene expression at the level of translation, the identification of novel protein coding genes and ribosome pausing. It has also provided data for developing quantitative models of translation. Although only a dozen or so ribosome profiling datasets have been published so far, they have already dramatically changed our understanding of translational control and have led to new hypotheses regarding the origin of protein coding genes. © 2013 John Wiley & Sons, Ltd. PMID:23696005
Factors Affecting Nuclear Export of the 60S Ribosomal Subunit In Vivo
Stage-Zimmermann, Tracy; Schmidt, Ute; Silver, Pamela A.
2000-01-01
In Saccharomyces cerevisiae, the 60S ribosomal subunit assembles in the nucleolus and then is exported to the cytoplasm, where it joins the 40S subunit for translation. Export of the 60S subunit from the nucleus is known to be an energy-dependent and factor-mediated process, but very little is known about the specifics of its transport. To begin to address this problem, an assay was developed to follow the localization of the 60S ribosomal subunit in S. cerevisiae. Ribosomal protein L11b (Rpl11b), one of the ∼45 ribosomal proteins of the 60S subunit, was tagged at its carboxyl terminus with the green fluorescent protein (GFP) to enable visualization of the 60S subunit in living cells. A panel of mutant yeast strains was screened for their accumulation of Rpl11b–GFP in the nucleus as an indicator of their involvement in ribosome synthesis and/or transport. This panel included conditional alleles of several rRNA-processing factors, nucleoporins, general transport factors, and karyopherins. As predicted, conditional alleles of rRNA-processing factors that affect 60S ribosomal subunit assembly accumulated Rpl11b–GFP in the nucleus. In addition, several of the nucleoporin mutants as well as a few of the karyopherin and transport factor mutants also mislocalized Rpl11b–GFP. In particular, deletion of the previously uncharacterized karyopherin KAP120 caused accumulation of Rpl11b–GFP in the nucleus, whereas ribosomal protein import was not impaired. Together, these data further define the requirements for ribosomal subunit export and suggest a biological function for KAP120. PMID:11071906
5SRNAdb: an information resource for 5S ribosomal RNAs.
Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M
2016-01-04
Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Translational control of ribosomal protein S15.
Portier, C; Philippe, C; Dondon, L; Grunberg-Manago, M; Ebel, J P; Ehresmann, B; Ehresmann, C
1990-08-27
The expression of ribosomal protein S15 is shown to be translationally and negatively autocontrolled using a fusion within a reporter gene. Isolation and characterization of several deregulated mutants indicate that the regulatory site (the translational operator site) overlaps the ribosome loading site of the S15 messenger. In this region, three domains, each exhibiting a stem-loop structure, were determined using chemical and enzymatic probes. The most downstream hairpin carries the Shine-Dalgarno sequence and the initiation codon. Genetic and structural data derived from mutants constructed by site-directed mutagenesis show that the operator is a dynamic structure, two domains of which can form a pseudoknot. Binding of S15 to these two domains suggests that the pseudoknot could be stabilized by S15. A model is presented in which two alternative structures would explain the molecular basis of the S15 autocontrol.
sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-04
With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Rust, Aleksander; Partridge, Lynda J.; Davletov, Bazbek
2017-01-01
Ribosome inactivating proteins (RIPs) form a class of toxins that was identified over a century ago. They continue to fascinate scientists and the public due to their very high activity and long-term stability which might find useful applications in the therapeutic killing of unwanted cells but can also be used in acts of terror. We will focus our review on the canonical plant-derived RIPs which display ribosomal RNA N-glycosidase activity and irreversibly inhibit protein synthesis by cleaving the 28S ribosomal RNA of the large 60S subunit of eukaryotic ribosomes. We will place particular emphasis on therapeutic applications and the generation of immunotoxins by coupling antibodies to RIPs in an attempt to target specific cells. Several generations of immunotoxins have been developed and we will review their optimisation as well as their use and limitations in pre-clinical and clinical trials. Finally, we endeavour to provide a perspective on potential future developments for the therapeutic use of immunotoxins. PMID:29076988
sORFs.org: a repository of small ORFs identified by ribosome profiling
Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben
2016-01-01
With the advent of ribosome profiling, a next generation sequencing technique providing a “snap-shot’’ of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these ‘sORFs’, indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. PMID:26527729
[Structure and function of eukaryotic nuclear DNA-dependent RNA polymerase I].
Shematorova, E K; Shpakovskiĭ, G V
2002-01-01
In the eukaryotic cell, normal protein biosynthesis is sustained by several million ribosomes, which contain rRNA as an essential component. The high-molecular-weight precursor of large and 5.8S rRNAs is synthesized by DNA-dependent RNA polymerase I (Pol I) in the nucleolus. Data on DNA regulatory elements, protein factors involved in rDNA transcription by Pol I, subunit composition of Pol I, and on the interactions and possible functions of individual subunits are summarized.
Molecular Mechanism of Scanning and Start Codon Selection in Eukaryotes
Hinnebusch, Alan G.
2011-01-01
Summary: The correct translation of mRNA depends critically on the ability to initiate at the right AUG codon. For most mRNAs in eukaryotic cells, this is accomplished by the scanning mechanism, wherein the small (40S) ribosomal subunit attaches to the 5′ end of the mRNA and then inspects the leader base by base for an AUG in a suitable context, using complementarity with the anticodon of methionyl initiator tRNA (Met-tRNAiMet) as the key means of identifying AUG. Over the past decade, a combination of yeast genetics, biochemical analysis in reconstituted systems, and structural biology has enabled great progress in deciphering the mechanism of ribosomal scanning. A robust molecular model now exists, describing the roles of initiation factors, notably eukaryotic initiation factor 1 (eIF1) and eIF1A, in stabilizing an “open” conformation of the 40S subunit with Met-tRNAiMet bound in a low-affinity state conducive to scanning and in triggering rearrangement into a “closed” conformation incompatible with scanning, which features Met-tRNAiMet more tightly bound to the “P” site and base paired with AUG. It has also emerged that multiple DEAD-box RNA helicases participate in producing a single-stranded “landing pad” for the 40S subunit and in removing the secondary structure to enable the mRNA to traverse the 40S mRNA-binding channel in the single-stranded form for base-by-base inspection in the P site. PMID:21885680
An archaeal origin of eukaryotes supports only two primary domains of life.
Williams, Tom A; Foster, Peter G; Cox, Cymon J; Embley, T Martin
2013-12-12
The discovery of the Archaea and the proposal of the three-domains 'universal' tree, based on ribosomal RNA and core genes mainly involved in protein translation, catalysed new ideas for cellular evolution and eukaryotic origins. However, accumulating evidence suggests that the three-domains tree may be incorrect: evolutionary trees made using newer methods place eukaryotic core genes within the Archaea, supporting hypotheses in which an archaeon participated in eukaryotic origins by founding the host lineage for the mitochondrial endosymbiont. These results provide support for only two primary domains of life--Archaea and Bacteria--because eukaryotes arose through partnership between them.
Ribosome flow model with positive feedback
Margaliot, Michael; Tuller, Tamir
2013-01-01
Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parfrey, Laura Wegener; Walters, William A.; Lauber, Christian L.
2014-06-19
Eukaryotic microbes (protists) residing in the vertebrate gut influence host health and disease, but their diversity and distribution in healthy hosts is poorly understood. Protists found in the gut are typically considered parasites, but many are commensal and some are beneficial. Further, the hygiene hypothesis predicts that association with our co-evolved microbial symbionts may be important to overall health. It is therefore imperative that we understand the normal diversity of our eukaryotic gut microbiota to test for such effects and avoid eliminating commensal organisms. We assembled a dataset of healthy individuals from two populations, one with traditional, agrarian lifestyles andmore » a second with modern, westernized lifestyles, and characterized the human eukaryotic microbiota via high-throughput sequencing. To place the human gut microbiota within a broader context our dataset also includes gut samples from diverse mammals and samples from other aquatic and terrestrial environments. We curated the SILVA ribosomal database to reflect current knowledge of eukaryotic taxonomy and employ it as a phylogenetic framework to compare eukaryotic diversity across environment. We show that adults from the non-western population harbor a diverse community of protists, and diversity in the human gut is comparable to that in other mammals. However, the eukaryotic microbiota of the western population appears depauperate. The distribution of symbionts found in mammals reflects both host phylogeny and diet. Eukaryotic microbiota in the gut are less diverse and more patchily distributed than bacteria. More broadly, we show that eukaryotic communities in the gut are less diverse than in aquatic and terrestrial habitats, and few taxa are shared across habitat types, and diversity patterns of eukaryotes are correlated with those observed for bacteria. These results outline the distribution and diversity of microbial eukaryotic communities in the mammalian gut and across
Li, Hongmei; Hu, Chuansheng; Bai, Ling; Li, Hua; Li, Mingfa; Zhao, Xiaodong; Czajkowsky, Daniel M; Shao, Zhifeng
2016-12-01
There is growing recognition that small open reading frames (sORFs) encoding peptides shorter than 100 amino acids are an important class of functional elements in the eukaryotic genome, with several already identified to play critical roles in growth, development, and disease. However, our understanding of their biological importance has been hindered owing to the significant technical challenges limiting their annotation. Here we combined ultra-deep sequencing of ribosome-associated poly-adenylated RNAs with rigorous conservation analysis to identify a comprehensive population of translated sORFs during early Drosophila embryogenesis. In total, we identify 399 sORFs, including those previously annotated but without evidence of translational capacity, those found within transcripts previously classified as non-coding, and those not previously known to be transcribed. Further, we find, for the first time, evidence for translation of many sORFs with different isoforms, suggesting their regulation is as complex as longer ORFs. Furthermore, many sORFs are found not associated with ribosomes in late-stage Drosophila S2 cells, suggesting that many of the translated sORFs may have stage-specific functions during embryogenesis. These results thus provide the first comprehensive annotation of the sORFs present during early Drosophila embryogenesis, a necessary basis for a detailed delineation of their function in embryogenesis and other biological processes. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Ribosomal RNA and ribosomal proteins in corynebacteria.
Martín, Juan F; Barreiro, Carlos; González-Lavado, Eva; Barriuso, Mónica
2003-09-04
Ribosomal RNAs (rRNAs) (16S, 23S, 5S) encoded by the rrn operons and ribosomal proteins play a very important role in the formation of ribosomes and in the control of translation. Five copies of the rrn operon were reported by hybridization studies in Brevibacterium (Corynebacterium) lactofermentum but the genome sequence of Corynebacterium glutamicum provided evidence for six rrn copies. All six copies of the C. glutamicum 16S rRNA have a size of 1523 bp and each of the six copies of the 5S contain 120 bp whereas size differences are found between the six copies of the 23S rRNA. The anti-Shine-Dalgarno sequence at the 3'-end of the 16S rRNA was 5'-CCUCCUUUC-3'. Each rrn operon is transcribed as a large precursor rRNA (pre-rRNA) that is processed by RNaseIII and other RNases at specific cleavage boxes that have been identified in the C. glutamicum pre-rRNA. A secondary structure of the C. glutamicum 16S rRNA is proposed. The 16S rRNA sequence has been used as a molecular evolution clock allowing the deduction of a phylogenetic tree of all Corynebacterium species. In C. glutamicum, there are 11 ribosomal protein gene clusters encoding 42 ribosomal proteins. The organization of some of the ribosomal protein gene cluster is identical to that of Escherichia coli whereas in other clusters the organization of the genes is rather different. Some specific ribosomal protein genes are located in a different cluster in C. glutamicum when compared with E. coli, indicating that the control of expression of these genes is different in E. coli and C. glutamicum.
Biedka, Stephanie; Micic, Jelena; Wilson, Daniel; Brown, Hailey; Diorio-Toth, Luke; Woolford, John L
2018-04-24
Ribosome biogenesis involves numerous preribosomal RNA (pre-rRNA) processing events to remove internal and external transcribed spacer sequences, ultimately yielding three mature rRNAs. Removal of the internal transcribed spacer 2 spacer RNA is the final step in large subunit pre-rRNA processing and begins with endonucleolytic cleavage at the C 2 site of 27SB pre-rRNA. C 2 cleavage requires the hierarchical recruitment of 11 ribosomal proteins and 14 ribosome assembly factors. However, the function of these proteins in C 2 cleavage remained unclear. In this study, we have performed a detailed analysis of the effects of depleting proteins required for C 2 cleavage and interpreted these results using cryo-electron microscopy structures of assembling 60S subunits. This work revealed that these proteins are required for remodeling of several neighborhoods, including two major functional centers of the 60S subunit, suggesting that these remodeling events form a checkpoint leading to C 2 cleavage. Interestingly, when C 2 cleavage is directly blocked by depleting or inactivating the C 2 endonuclease, assembly progresses through all other subsequent steps. © 2018 Biedka et al.
The Ribosomal RNA is a Useful Marker to Visualize Rhizobia Interacting with Legume Plants
ERIC Educational Resources Information Center
Rinaudi, Luciana; Isola, Maria C.; Giordano, Walter
2004-01-01
Symbiosis between rhizobia and leguminous plants leads to the formation of nitrogen-fixing root nodules. In the present article, we recommend the use of the ribosomal RNA (rRNA) isolated from legume nodules in an experimental class with the purpose of introducing students to the structure of eukaryotic and prokaryotic ribosomes and of…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shigeno, Yuta; Uchiumi, Toshio; Nomura, Takaomi, E-mail: nomurat@shinshu-u.ac.jp
Ribosomal protein L6, an essential component of the large (50S) subunit, primarily binds to helix 97 of 23S rRNA and locates near the sarcin/ricin loop of helix 95 that directly interacts with GTPase translation factors. Although L6 is believed to play important roles in factor-dependent ribosomal function, crucial biochemical evidence for this hypothesis has not been obtained. We constructed and characterized an Escherichia coli mutant bearing a chromosomal L6 gene (rplF) disruption and carrying a plasmid with an arabinose-inducible L6 gene. Although this ΔL6 mutant grew more slowly than its wild-type parent, it proliferated in the presence of arabinose. Interestingly,more » cell growth in the absence of arabinose was biphasic. Early growth lasted only a few generations (LI-phase) and was followed by a suspension of growth for several hours (S-phase). This suspension was followed by a second growth phase (LII-phase). Cells harvested at both LI- and S-phases contained ribosomes with reduced factor-dependent GTPase activity and accumulated 50S subunit precursors (45S particles). The 45S particles completely lacked L6. Complete 50S subunits containing L6 were observed in all growth phases regardless of the L6-depleted condition, implying that the ΔL6 mutant escaped death because of a leaky expression of L6 from the complementing plasmid. We conclude that L6 is essential for the assembly of functional 50S subunits at the late stage. We thus established conditions for the isolation of L6-depleted 50S subunits, which are essential to study the role of L6 in translation. - Highlights: • We constructed an in vivo functional assay system for Escherichia coli ribosomal protein L6. • Growth of an E. coli ΔL6 mutant was biphasic when L6 levels were depleted. • The ΔL6 mutant accumulated 50S ribosomal subunit precursors that sedimented at 45S. • L6 is a key player in the late stage of E. coli 50S subunit assembly.« less
The 5S RNP Couples p53 Homeostasis to Ribosome Biogenesis and Nucleolar Stress
Sloan, Katherine E.; Bohnsack, Markus T.; Watkins, Nicholas J.
2013-01-01
Summary Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14ARF, a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. PMID:24120868
Ribosomes slide on lysine-encoding homopolymeric A stretches
Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel
2015-01-01
Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637
Pseudoknot and translational control in the expression of the S15 ribosomal protein.
Bénard, L; Philippe, C; Ehresmann, B; Ehresmann, C; Portier, C
1996-01-01
Translational autocontrol of the expression of the ribosomal protein S15 proceeds through the transitory formation of a pseudoknot. A synopsis of the known data is used to propose a molecular model of the mechanism involved and for the role of the pseudoknot. This latter structure is able to recruit 30S ribosomal subunits to initiate translation, but also to bind S15 and to stop translation by trapping the ribosome on its loading site. Information on the S15 protein recognition of the messenger RNA site was deduced from mutational analyses and chemical probing. A comparison of this messenger site with the S15 ribosomal binding site was conducted by analysing hydroxyl radical footprintings of these two sites. The existence of two subsites in 16S RNA suggests that the ribosomal protein S15 might present either two different binding sites or at least one common subsite. Clues for the presence of a common site between the messenger and 16S RNA are given which cannot rule out that recognition specificity is linked to a few other determinants. Whether these determinants are different or not remains an open question.
Biogenesis of cytosolic ribosomes requires the essential iron–sulphur protein Rli1p and mitochondria
Kispal, Gyula; Sipos, Katalin; Lange, Heike; Fekete, Zsuzsanna; Bedekovics, Tibor; Janáky, Tamás; Bassler, Jochen; Aguilar Netz, Daili J; Balk, Janneke; Rotte, Carmen; Lill, Roland
2005-01-01
Mitochondria perform a central function in the biogenesis of cellular iron–sulphur (Fe/S) proteins. It is unknown to date why this biosynthetic pathway is indispensable for life, the more so as no essential mitochondrial Fe/S proteins are known. Here, we show that the soluble ATP-binding cassette (ABC) protein Rli1p carries N-terminal Fe/S clusters that require the mitochondrial and cytosolic Fe/S protein biogenesis machineries for assembly. Mutations in critical cysteine residues of Rli1p abolish association with Fe/S clusters and lead to loss of cell viability. Hence, the essential character of Fe/S clusters in Rli1p explains the indispensable character of mitochondria in eukaryotes. We further report that Rli1p is associated with ribosomes and with Hcr1p, a protein involved in rRNA processing and translation initiation. Depletion of Rli1p causes a nuclear export defect of the small and large ribosomal subunits and subsequently a translational arrest. Thus, ribosome biogenesis and function are intimately linked to the crucial role of mitochondria in the maturation of the essential Fe/S protein Rli1p. PMID:15660134
The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.
Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J
2013-10-17
Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Hatakeyama, T; Hatakeyama, T
1990-07-06
The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.
Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans
Holdt, Lesca M.; Stahringer, Anika; Sass, Kristina; Pichler, Garwin; Kulak, Nils A.; Wilfert, Wolfgang; Kohlmaier, Alexander; Herbst, Andreas; Northoff, Bernd H.; Nicolaou, Alexandros; Gäbel, Gabor; Beutner, Frank; Scholz, Markus; Thiery, Joachim; Musunuru, Kiran; Krohn, Knut; Mann, Matthias; Teupser, Daniel
2016-01-01
Circular RNAs (circRNAs) are broadly expressed in eukaryotic cells, but their molecular mechanism in human disease remains obscure. Here we show that circular antisense non-coding RNA in the INK4 locus (circANRIL), which is transcribed at a locus of atherosclerotic cardiovascular disease on chromosome 9p21, confers atheroprotection by controlling ribosomal RNA (rRNA) maturation and modulating pathways of atherogenesis. CircANRIL binds to pescadillo homologue 1 (PES1), an essential 60S-preribosomal assembly factor, thereby impairing exonuclease-mediated pre-rRNA processing and ribosome biogenesis in vascular smooth muscle cells and macrophages. As a consequence, circANRIL induces nucleolar stress and p53 activation, resulting in the induction of apoptosis and inhibition of proliferation, which are key cell functions in atherosclerosis. Collectively, these findings identify circANRIL as a prototype of a circRNA regulating ribosome biogenesis and conferring atheroprotection, thereby showing that circularization of long non-coding RNAs may alter RNA function and protect from human disease. PMID:27539542
Welle, Stephen; Burgess, Kerri; Mehta, Sangeeta
2009-03-01
Knocking out myostatin activity during development increases the rate of muscle protein synthesis. The present study was done to determine whether postdevelopmental loss of myostatin activity stimulates myofibrillar protein synthesis and the phosphorylation of some of the proteins involved in regulation of protein synthesis rate. Myostatin activity was inhibited for 4 days, in 4- to 5-mo-old male mice, with injections of an anti-myostatin antibody (JA16). The mean myofibrillar synthesis rate increased 19% (P < 0.01) relative to the mean rate in saline-treated mice, as determined by incorporation of deuterium-labeled phenylalanine. JA16 increased phosphorylation of p70 S6 kinase (S6K) and ribosomal protein S6 (rpS6) 1.9-fold (P < 0.05). It did not affect phosphorylation of eukaryotic initiation factor 4E-binding protein-1 or Akt. Microarrays and real-time PCR analyses indicated that JA16 administration did not selectively enrich levels of mRNAs encoding myofibrillar proteins, ribosomal proteins, or translation initiation and elongation factors. Rapamycin treatment did not affect the rate of myofibrillar protein synthesis whether or not the mice received JA16 injections, although it eliminated the phosphorylation of S6K and rpS6. We conclude that the normal level of myostatin activity in mature muscle is sufficient to inhibit myofibrillar synthesis rate and phosphorylation of S6K and rpS6. Reversal of the inhibition of myofibrillar synthesis with an anti-myostatin antibody is not dependent on mTOR activation.
Hypermethylation of 28S ribosomal RNA in β-thalassemia trait carriers.
Sornjai, Wannapa; Lithanatudom, Pathrapol; Erales, Jenny; Joly, Philippe; Francina, Alain; Hacot, Sabine; Fucharoen, Suthat; Svasti, Saovaros; Diaz, Jean Jacques; Mertani, Hichem C; Smith, Duncan R
2017-01-01
Ribosome biogenesis is the process of synthesis of the cellular ribosomes which mediate protein translation. Integral with the ribosomes are four cytoplasmic ribosomal RNAs (rRNAs) which show extensive post-transcriptional modifications including 2'-O-methylation and pseudouridylation. Several hereditary hematologic diseases including Diamond-Blackfan anemia have been shown to be associated with defects in ribosome biogenesis. Thalassemia is the most important hematologic inherited genetic disease worldwide, and this study examined the post-transcriptional ribose methylation status of three specific active sites of the 28S rRNA molecule at positions 1858, 4197 and 4506 of β-thalassemia trait carriers and normal controls. Samples from whole blood and cultured erythroid cells were examined. Results showed that site 4506 was hypermethylated in β-thalassemia trait carriers in both cohorts. Expression of fibrillarin, the ribosomal RNA methyltransferase as well as snoRNAs were additionally quantified by RT-qPCR and evidence of dysregulation was seen. Hemoglobin E trait carriers also showed evidence of dysregulation. These results provide the first evidence that ribosome biogenesis is dysregulated in β-thalassemia trait carriers. Copyright © 2016 Elsevier B.V. All rights reserved.
Death of a dogma: eukaryotic mRNAs can code for more than one protein
Mouilleron, Hélène; Delcourt, Vivian; Roucou, Xavier
2016-01-01
mRNAs carry the genetic information that is translated by ribosomes. The traditional view of a mature eukaryotic mRNA is a molecule with three main regions, the 5′ UTR, the protein coding open reading frame (ORF) or coding sequence (CDS), and the 3′ UTR. This concept assumes that ribosomes translate one ORF only, generally the longest one, and produce one protein. As a result, in the early days of genomics and bioinformatics, one CDS was associated with each protein-coding gene. This fundamental concept of a single CDS is being challenged by increasing experimental evidence indicating that annotated proteins are not the only proteins translated from mRNAs. In particular, mass spectrometry (MS)-based proteomics and ribosome profiling have detected productive translation of alternative open reading frames. In several cases, the alternative and annotated proteins interact. Thus, the expression of two or more proteins translated from the same mRNA may offer a mechanism to ensure the co-expression of proteins which have functional interactions. Translational mechanisms already described in eukaryotic cells indicate that the cellular machinery is able to translate different CDSs from a single viral or cellular mRNA. In addition to summarizing data showing that the protein coding potential of eukaryotic mRNAs has been underestimated, this review aims to challenge the single translated CDS dogma. PMID:26578573
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets
Ribosomes are optimized for autocatalytic production
NASA Astrophysics Data System (ADS)
Reuveni, Shlomi; Ehrenberg, Måns; Paulsson, Johan
2017-07-01
Many fine-scale features of ribosomes have been explained in terms of function, revealing a molecular machine that is optimized for error-correction, speed and control. Here we demonstrate mathematically that many less well understood, larger-scale features of ribosomes—such as why a few ribosomal RNA molecules dominate the mass and why the ribosomal protein content is divided into 55-80 small, similarly sized segments—speed up their autocatalytic production.
Becker, Annemarie H.; Oh, Eugene; Weissman, Jonathan S.; Kramer, Günter; Bukau, Bernd
2014-01-01
A plethora of factors is involved in the maturation of newly synthesized proteins, including chaperones, membrane targeting factors, and enzymes. Many factors act cotranslationally through association with ribosome-nascent chain complexes (RNCs), but their target specificities and modes of action remain poorly understood. We developed selective ribosome profiling (SeRP) to identify substrate pools and points of RNC engagement of these factors. SeRP is based on sequencing mRNA fragments covered by translating ribosomes (general ribosome profiling, RP), combined with a procedure to selectively isolate RNCs whose nascent polypeptides are associated with the factor of interest. Factor–RNC interactions are stabilized by crosslinking, the resulting factor–RNC adducts are then nuclease-treated to generate monosomes, and affinity-purified. The ribosome-extracted mRNA footprints are converted to DNA libraries for deep sequencing. The protocol is specified for general RP and SeRP in bacteria. It was first applied to the chaperone trigger factor and is readily adaptable to other cotranslationally acting factors, including eukaryotic factors. Factor–RNC purification and sequencing library preparation takes 7–8 days, sequencing and data analysis can be completed in 5–6 days. PMID:24136347
Transcriptional mapping of the ribosomal RNA region of mouse L-cell mitochondrial DNA.
Nagley, P; Clayton, D A
1980-01-01
The map positions in mouse mitochondrial DNA of the two ribosomal RNA genes and adjacent genes coding several small transcripts have been determined precisely by application of a procedure in which DNA-RNA hybrids have been subjected to digestion by S1 nuclease under conditions of varying severity. Digestion of the DNA-RNA hybrids with S1 nuclease yielded a series of species which were shown to contain ribosomal RNA molecules together with adjacent transcripts hybridized conjointly to a continuous segment of mitochondrial DNA. There is one small transcript about 60 bases long whose gene adjoins the sequences coding the 5'-end of the small ribosomal RNA (950 bases) and which lies approximately 200 nucleotides from the D-loop origin of heavy strand mitochondrial DNA synthesis. An 80-base transcript lies between the small and large ribosomal RNA genes, and genes for two further short transcript (each about 80 bases in length) abut the sequences coding the 3'-end of the large ribosomal RNA (approximately 1500 bases). The ability to isolate a discrete DNA-RNA hybrid species approximately 2700 base pairs in length containing all these transcripts suggests that there can be few nucleotides in this region of mouse mitochondrial DNA which are not represented as stable RNA species. Images PMID:6253898
Aguilar, Maria; Richardson, Elisabeth; Tan, BoonFei; Walker, Giselle; Dunfield, Peter F; Bass, David; Nesbø, Camilla; Foght, Julia; Dacks, Joel B
2016-11-01
Tailings ponds in the Athabasca oil sands (Canada) contain fluid wastes, generated by the extraction of bitumen from oil sands ores. Although the autochthonous prokaryotic communities have been relatively well characterized, almost nothing is known about microbial eukaryotes living in the anoxic soft sediments of tailings ponds or in the thin oxic layer of water that covers them. We carried out the first next-generation sequencing study of microbial eukaryotic diversity in oil sands tailings ponds. In metagenomes prepared from tailings sediment and surface water, we detected very low numbers of sequences encoding eukaryotic small subunit ribosomal RNA representing seven major taxonomic groups of protists. We also produced and analysed three amplicon-based 18S rRNA libraries prepared from sediment samples. These revealed a more diverse set of taxa, 169 different OTUs encompassing up to eleven higher order groups of eukaryotes, according to detailed classification using homology searching and phylogenetic methods. The 10 most abundant OTUs accounted for > 90% of the total of reads, vs. large numbers of rare OTUs (< 1% abundance). Despite the anoxic and hydrocarbon-enriched nature of the environment, the tailings ponds harbour complex communities of microbial eukaryotes indicating that these organisms should be taken into account when studying the microbiology of the oil sands. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.
Evaluation of ribosomal RNA removal protocols for Salmonella RNA-Seq projects
USDA-ARS?s Scientific Manuscript database
Next generation sequencing is a powerful technology and its application to sequencing entire RNA populations of food-borne pathogens will provide valuable insights. A problem unique to prokaryotic RNA-Seq is the massive abundance of ribosomal RNA. Unlike eukaryotic messenger RNA (mRNA), bacterial ...
Pellegrino, Simone; Demeshkina, Natalia; Mancera-Martinez, Eder; Melnikov, Sergey; Simonetti, Angelita; Myasnikov, Alexander; Yusupov, Marat; Yusupova, Gulnara; Hashem, Yaser
2018-06-07
One of the most critical steps of protein biosynthesis is the coupled movement of messenger RNA (mRNA), that encodes genetic information, with transfer RNAs (tRNAs) on the ribosome. In eukaryotes this process is catalyzed by a conserved G-protein, the elongation factor 2 (eEF2), which carries a unique post-translational modification, called diphthamide, found in all eukaryotic species. Here we present near-atomic resolution cryo-EM structures of yeast 80S ribosome complexes containing mRNA, tRNA and eEF2 trapped in different GTP-hydrolysis states which provide further structural insights on the role of diphthamide in the mechanism of translation fidelity in eukaryotes. Copyright © 2018. Published by Elsevier Ltd.
The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.
Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J
2016-08-15
Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. © 2016 The Author(s).
Cuchalová, Lucie; Kouba, Tomás; Herrmannová, Anna; Dányi, István; Chiu, Wen-Ling; Valásek, Leos
2010-10-01
Recent reports have begun unraveling the details of various roles of individual eukaryotic translation initiation factor 3 (eIF3) subunits in translation initiation. Here we describe functional characterization of two essential Saccharomyces cerevisiae eIF3 subunits, g/Tif35 and i/Tif34, previously suggested to be dispensable for formation of the 48S preinitiation complexes (PICs) in vitro. A triple-Ala substitution of conserved residues in the RRM of g/Tif35 (g/tif35-KLF) or a single-point mutation in the WD40 repeat 6 of i/Tif34 (i/tif34-Q258R) produces severe growth defects and decreases the rate of translation initiation in vivo without affecting the integrity of eIF3 and formation of the 43S PICs in vivo. Both mutations also diminish induction of GCN4 expression, which occurs upon starvation via reinitiation. Whereas g/tif35-KLF impedes resumption of scanning for downstream reinitiation by 40S ribosomes terminating at upstream open reading frame 1 (uORF1) in the GCN4 mRNA leader, i/tif34-Q258R prevents full GCN4 derepression by impairing the rate of scanning of posttermination 40S ribosomes moving downstream from uORF1. In addition, g/tif35-KLF reduces processivity of scanning through stable secondary structures, and g/Tif35 specifically interacts with Rps3 and Rps20 located near the ribosomal mRNA entry channel. Together these results implicate g/Tif35 and i/Tif34 in stimulation of linear scanning and, specifically in the case of g/Tif35, also in proper regulation of the GCN4 reinitiation mechanism.
Has1 regulates consecutive maturation and processing steps for assembly of 60S ribosomal subunits
Dembowski, Jill A.; Kuo, Benjamin; Woolford, John L.
2013-01-01
Ribosome biogenesis requires ∼200 assembly factors in Saccharomyces cerevisiae. The pre-ribosomal RNA (rRNA) processing defects associated with depletion of most of these factors have been characterized. However, how assembly factors drive the construction of ribonucleoprotein neighborhoods and how structural rearrangements are coupled to pre-rRNA processing are not understood. Here, we reveal ATP-independent and ATP-dependent roles of the Has1 DEAD-box RNA helicase in consecutive pre-rRNA processing and maturation steps for construction of 60S ribosomal subunits. Has1 associates with pre-60S ribosomes in an ATP-independent manner. Has1 binding triggers exonucleolytic trimming of 27SA3 pre-rRNA to generate the 5′ end of 5.8S rRNA and drives incorporation of ribosomal protein L17 with domain I of 5.8S/25S rRNA. ATP-dependent activity of Has1 promotes stable association of additional domain I ribosomal proteins that surround the polypeptide exit tunnel, which are required for downstream processing of 27SB pre-rRNA. Furthermore, in the absence of Has1, aberrant 27S pre-rRNAs are targeted for irreversible turnover. Thus, our data support a model in which Has1 helps to establish domain I architecture to prevent pre-rRNA turnover and couples domain I folding with consecutive pre-rRNA processing steps. PMID:23788678
Cukras, Anthony R; Southworth, Daniel R; Brunelle, Julie L; Culver, Gloria M; Green, Rachel
2003-08-01
Translocation of the mRNA:tRNA complex through the ribosome is promoted by elongation factor G (EF-G) during the translation cycle. Previous studies established that modification of ribosomal proteins with thiol-specific reagents promotes this event in the absence of EF-G. Here we identify two small subunit interface proteins S12 and S13 that are essential for maintenance of a pretranslocation state. Omission of these proteins using in vitro reconstitution procedures yields ribosomal particles that translate in the absence of enzymatic factors. Conversely, replacement of cysteine residues in these two proteins yields ribosomal particles that are refractive to stimulation with thiol-modifying reagents. These data support a model where S12 and S13 function as control elements for the more ancient rRNA- and tRNA-driven movements of translocation.
Sonousi, Amr; Sarpe, Vikram A; Brilkova, Margarita; Schacht, Jochen; Vasella, Andrea; Böttger, Erik C; Crich, David
2018-05-10
Syntheses of the 6'- N-(2-hydroxyethyl) and 1- N-(4-amino-2 S-hydroxybutyryl) derivatives of the 4,6-aminoglycoside sisomicin and that of the doubly modified 1- N-(4-amino-2 S-hydroxybutyryl)-6'- N-(2-hydroxyethyl) derivative known as plazomicin are reported together with their antibacterial and antiribosomal activities and selectivities. The 6'- N-(2-hydroxyethyl) modification results in a moderate increase in prokaryotic/eukaryotic ribosomal selectivity, whereas the 1- N-(4-amino-2 S-hydroxybutyryl) modification has the opposite effect. When combined in plazomicin, the effects of the two groups on ribosomal selectivity cancel each other out, leading to the prediction that plazomicin will exhibit ototoxicity comparable to those of the parent and the current clinical aminoglycoside antibiotics gentamicin and tobramycin, as borne out by ex vivo studies with mouse cochlear explants. The 6'- N-(2-hydroxyethyl) modification restores antibacterial activity in the presence of the AAC(6') aminoglycoside-modifying enzymes, while the 1- N-(4-amino-2 S-hydroxybutyryl) modification overcomes resistance to the AAC(2') class but is still affected to some extent by the AAC(3) class. Neither modification is able to circumvent the ArmA ribosomal methyltransferase-induced aminoglycoside resistance. The use of phenyltriazenyl protection for the secondary amino group of sisomicin facilitates the synthesis of each derivative and their characterization through the provision of sharp NMR spectra for all intermediates.
On the intracellular trafficking of mouse S5 ribosomal protein from cytoplasm to nucleoli.
Matragkou, Ch; Papachristou, H; Karetsou, Z; Papadopoulos, G; Papamarcaki, T; Vizirianakis, I S; Tsiftsoglou, A S; Choli-Papadopoulou, T
2009-10-09
The non-ribosomal functions of mammalian ribosomal proteins have recently attracted worldwide attention. The mouse ribosomal protein S5 (rpS5) derived from ribosomal material is an assembled non-phosphorylated protein. The free form of rpS5 protein, however, undergoes phosphorylation. In this study, we have (a) investigated the potential role of phosphorylation in rpS5 protein transport into the nucleus and then into nucleoli and (b) determined which of the domains of rpS5 are involved in this intracellular trafficking. In vitro PCR mutagenesis of mouse rpS5 cDNA, complemented by subsequent cloning and expression of rpS5 truncated recombinant forms, produced in fusion with green fluorescent protein, permitted the investigation of rpS5 intracellular trafficking in HeLa cells using confocal microscopy complemented by Western blot analysis. Our results indicate the following: (a) rpS5 protein enters the nucleus via the region 38-50 aa that forms a random coil as revealed by molecular dynamic simulation. (b) Immunoprecipitation of rpS5 with casein kinase II and immobilized metal affinity chromatography analysis complemented by in vitro kinase assay revealed that phosphorylation of rpS5 seems to be indispensable for its transport from nucleus to nucleoli; upon entering the nucleus, Thr-133 phosphorylation triggers Ser-24 phosphorylation by casein kinase II, thus promoting entrance of rpS5 into the nucleoli. Another important role of rpS5 N-terminal region is proposed to be the regulation of protein's cellular level. The repetitively co-appearance of a satellite C-terminal band below the entire rpS5 at the late stationary phase, and not at the early logarithmic phase, of cell growth suggests a specific degradation balancing probably the unassembled ribosomal protein molecules with those that are efficiently assembled to ribosomal subunits. Overall, these data provide new insights on the structural and functional domains within the rpS5 molecule that contribute to its
Johnson, W
1972-06-01
The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein.
Characterization of a novel RNA-binding region of eIF4GI critical for ribosomal scanning
Prévôt, Déborah; Décimo, Didier; Herbreteau, Cécile H.; Roux, Florence; Garin, Jérôme; Darlix, Jean-Luc; Ohlmann, Théophile
2003-01-01
The eukaryotic translation initiation factor eIF4GI binds several proteins and acts as a scaffold to promote preinitiation complex formation on the mRNA molecule (48S). Following mRNA attachment this complex scans along the messenger in a 5′ to 3′ direction until it locates and recognizes the initiation start codon. By using a combination of retroviral and picornaviral proteases (HIV-2 and L respectively) in the reticulocyte lysate system, we have characterized a 40 amino acid (aa) region of eIF4GI (aa 642–681) that exhibits general RNA-binding properties. Removal of this domain by proteolytic processing followed by translational assays showed virtually no inhibition of internal ribosome entry on the encephalomyocarditis virus, but resulted in drastic impairment of ribosome scanning as demonstrated by studying poliovirus and foot-and-mouth disease virus translation. Based on these findings, we propose that this 40 aa motif of eIF4GI is critical for ribosome scanning. PMID:12682023
Johnson, William
1972-01-01
The immunogenicity of ribosomes and ribosomal subfractions isolated from Yersina pestis and Salmonella typhimurium has been studied. Ribosomes and ribosomal protein isolated from S. typhimurium protected mice against lethal challenge. Ribosomal ribonucleic acid isolated by phenol extraction failed to induce any significant level of protection in mice. None of the ribosomes or ribosomal subfractions isolated from Y. pestis were effective in inducing immunity to lethal challenge. These results suggest that the immunogen of the ribosomal vaccine is protein. Images PMID:4564407
Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome.
Sharma, Divya; Cukras, Anthony R; Rogers, Elizabeth J; Southworth, Daniel R; Green, Rachel
2007-12-07
The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl-tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S ribosomal RNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit, referred to as "closure." Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a "restrictive" phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity-modulating binding site for paromomycin in the 16S ribosomal RNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations.
Méthot, N; Song, M S; Sonenberg, N
1996-01-01
The binding of mRNA to the ribosome is mediated by eukaryotic initiation factors eukaryotic initiation factor 4F (eIF4F), eIF4B, eIF4A, and eIF3, eIF4F binds to the mRNA cap structure and, in combination with eIF4B, is believed to unwind the secondary structure in the 5' untranslated region to facilitate ribosome binding. eIF3 associates with the 40S ribosomal subunit prior to mRNA binding. eIF4B copurifies with eIF3 and eIF4F through several purification steps, suggesting the involvement of a multisubunit complex during translation initiation. To understand the mechanism by which eIF4B promotes 40S ribosome binding to the mRNA, we studied its interactions with partner proteins by using a filter overlay (protein-protein [far Western]) assay and the two-hybrid system. In this report, we show that eIF4B self-associates and also interacts directly with the p170 subunit of eIF3. A region rich in aspartic acid, arginine, tyrosine, and glycine, termed the DRYG domain, is sufficient for self-association of eIF4B, both in vitro and in vivo, and for interaction with the p170 subunit of eIF3. These experiments suggest that eIF4B participates in mRNA-ribosome binding by acting as an intermediary between the mRNA and eIF3, via a direct interaction with the p170 subunit of eIF3. PMID:8816444
Goniometer-based femtosecond X-ray diffraction of mutant 30S ribosomal subunit crystals
Dao, E. Han; Sierra, Raymond G.; Laksmono, Hartawan; ...
2015-04-30
In this work, we collected radiation-damage-free data from a set of cryo-cooled crystals for a novel 30S ribosomal subunit mutant using goniometer-based femtosecond crystallography. Crystal quality assessment for these samples was conducted at the X-ray Pump Probe end-station of the Linac Coherent Light Source (LCLS) using recently introduced goniometer-based instrumentation. These 30S subunit crystals were genetically engineered to omit a 26-residue protein, Thx, which is present in the wild-type Thermus thermophilus 30S ribosomal subunit. We are primarily interested in elucidating the contribution of this ribosomal protein to the overall 30S subunit structure. To assess the viability of this study, femtosecondmore » X-ray diffraction patterns from these crystals were recorded at the LCLS during a protein crystal screening beam time. During our data collection, we successfully observed diffraction from these difficult-to-grow 30S ribosomal subunit crystals. Most of our crystals were found to diffract to low resolution, while one crystal diffracted to 3.2 Å resolution. These data suggest the feasibility of pursuing high-resolution data collection as well as the need to improve sample preparation and handling in order to collect a complete radiation-damage-free data set using an X-ray Free Electron Laser.« less
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L
2013-02-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2.
Gamalinda, Michael; Jakovljevic, Jelena; Babiano, Reyes; Talkish, Jason; de la Cruz, Jesús; Woolford, John L.
2013-01-01
Ribosome synthesis involves the coordinated folding and processing of pre-rRNAs with assembly of ribosomal proteins. In eukaryotes, these events are facilitated by trans-acting factors that propel ribosome maturation from the nucleolus to the cytoplasm. However, there is a gap in understanding how ribosomal proteins configure pre-ribosomes in vivo to enable processing to occur. Here, we have examined the role of adjacent yeast r-proteins L17, L35 and L37 in folding and processing of pre-rRNAs, and binding of other proteins within assembling ribosomes. These three essential ribosomal proteins, which surround the polypeptide exit tunnel, are required for 60S subunit formation as a consequence of their role in removal of the ITS2 spacer from 27SB pre-rRNA. L17-, L35- and L37-depleted cells exhibit turnover of aberrant pre-60S assembly intermediates. Although the structure of ITS2 does not appear to be grossly affected in their absence, these three ribosomal proteins are necessary for efficient recruitment of factors required for 27SB pre-rRNA processing, namely, Nsa2 and Nog2, which associate with pre-60S ribosomal particles containing 27SB pre-rRNAs. Altogether, these data support that L17, L35 and L37 are specifically required for a recruiting step immediately preceding removal of ITS2. PMID:23268442
Xue, Yuanyuan; Chen, Huihuang; Yang, Jun R; Liu, Min; Huang, Bangqin; Yang, Jun
2018-06-13
Plankton communities normally consist of few abundant and many rare species, yet little is known about the ecological role of rare planktonic eukaryotes. Here we used a 18S ribosomal DNA sequencing approach to investigate the dynamics of rare planktonic eukaryotes, and to explore the co-occurrence patterns of abundant and rare eukaryotic plankton in a subtropical reservoir following a cyanobacterial bloom event. Our results showed that the bloom event significantly altered the eukaryotic plankton community composition and rare plankton diversity without affecting the diversity of abundant plankton. The similarities of both abundant and rare eukaryotic plankton subcommunities significantly declined with the increase in time-lag, but stronger temporal turnover was observed in rare taxa. Further, species turnover of both subcommunities explained a higher percentage of the community variation than species richness. Both deterministic and stochastic processes significantly influenced eukaryotic plankton community assembly, and the stochastic pattern (e.g., ecological drift) was particularly pronounced for rare taxa. Co-occurrence network analysis revealed that keystone taxa mainly belonged to rare species, which may play fundamental roles in network persistence. Importantly, covariations between rare and non-rare taxa were predominantly positive, implying multispecies cooperation might contribute to the stability and resilience of the microbial community. Overall, these findings expand current understanding of the ecological mechanisms and microbial interactions underlying plankton dynamics in changing aquatic ecosystems.
Large variability of bathypelagic microbial eukaryotic communities across the world's oceans.
Pernice, Massimo C; Giner, Caterina R; Logares, Ramiro; Perera-Bel, Júlia; Acinas, Silvia G; Duarte, Carlos M; Gasol, Josep M; Massana, Ramon
2016-04-01
In this work, we study the diversity of bathypelagic microbial eukaryotes (0.8-20 μm) in the global ocean. Seawater samples from 3000 to 4000 m depth from 27 stations in the Atlantic, Pacific and Indian Oceans were analyzed by pyrosequencing the V4 region of the 18S ribosomal DNA. The relative abundance of the most abundant operational taxonomic units agreed with the results of a parallel metagenomic analysis, suggesting limited PCR biases in the tag approach. Although rarefaction curves for single stations were seldom saturated, the global analysis of all sequences together suggested an adequate recovery of bathypelagic diversity. Community composition presented a large variability among samples, which was poorly explained by linear geographic distance. In fact, the similarity between communities was better explained by water mass composition (26% of the variability) and the ratio in cell abundance between prokaryotes and microbial eukaryotes (21%). Deep diversity appeared dominated by four taxonomic groups (Collodaria, Chrysophytes, Basidiomycota and MALV-II) appearing in different proportions in each sample. Novel diversity amounted to 1% of the pyrotags and was lower than expected. Our study represents an essential step in the investigation of bathypelagic microbial eukaryotes, indicating dominating taxonomic groups and suggesting idiosyncratic assemblages in distinct oceanic regions.
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A.; Thomas, George
2013-01-01
SUMMARY Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. PMID:23831031
Donati, Giulio; Peddigari, Suresh; Mercer, Carol A; Thomas, George
2013-07-11
Recently, we demonstrated that RPL5 and RPL11 act in a mutually dependent manner to inhibit Hdm2 and stabilize p53 following impaired ribosome biogenesis. Given that RPL5 and RPL11 form a preribosomal complex with noncoding 5S ribosomal RNA (rRNA) and the three have been implicated in the p53 response, we reasoned they may be part of an Hdm2-inhibitory complex. Here, we show that small interfering RNAs directed against 5S rRNA have no effect on total or nascent levels of the noncoding rRNA, though they prevent the reported Hdm4 inhibition of p53. To achieve efficient inhibition of 5S rRNA synthesis, we targeted TFIIIA, a specific RNA polymerase III cofactor, which, like depletion of either RPL5 or RPL11, did not induce p53. Instead, 5S rRNA acts in a dependent manner with RPL5 and RPL11 to inhibit Hdm2 and stabilize p53. Moreover, depletion of any one of the three components abolished the binding of the other two to Hdm2, explaining their common dependence. Finally, we demonstrate that the RPL5/RPL11/5S rRNA preribosomal complex is redirected from assembly into nascent 60S ribosomes to Hdm2 inhibition as a consequence of impaired ribosome biogenesis. Thus, the activation of the Hdm2-inhibitory complex is not a passive but a regulated event, whose potential role in tumor suppression has been recently noted. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Translational autocontrol of the Escherichia coli ribosomal protein S15.
Portier, C; Dondon, L; Grunberg-Manago, M
1990-01-20
When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.
Gerrard, Gareth; Valgañón, Mikel; Foong, Hui En; Kasperaviciute, Dalia; Iskander, Deena; Game, Laurence; Müller, Michael; Aitman, Timothy J; Roberts, Irene; de la Fuente, Josu; Foroni, Letizia; Karadimitris, Anastasios
2013-08-01
Diamond-Blackfan anaemia (DBA) is caused by inactivating mutations in ribosomal protein (RP) genes, with mutations in 13 of the 80 RP genes accounting for 50-60% of cases. The remaining 40-50% cases may harbour mutations in one of the remaining RP genes, but the very low frequencies render conventional genetic screening as challenging. We, therefore, applied custom enrichment technology combined with high-throughput sequencing to screen all 80 RP genes. Using this approach, we identified and validated inactivating mutations in 15/17 (88%) DBA patients. Target enrichment combined with high-throughput sequencing is a robust and improved methodology for the genetic diagnosis of DBA. © 2013 John Wiley & Sons Ltd.
Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R
2013-02-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.
Dupont, A Ö C; Griffiths, R I; Bell, T; Bass, D
2016-06-01
A recent large-scale assessment of bacterial communities across a range of UK soil types showed that bacterial community structure was strongly determined by soil pH. We analysed a data set of eukaryotic 454 sequencing 18S rDNA from the surveyed samples and showed significant differences in eukaryotic assemblages according to pH class, mostly between low pH and higher pH soils. Soil eukaryote communities (per sample) differed most at the taxonomic rank approximating to order level. Taxonomies assigned with the Protist Ribosomal Reference and the Silva 119 databases were taxonomically inconsistent, mostly due to differing 18S annotations, although general structure and composition according to pH were coherent. A relatively small number of lineages, mostly putative parasitic protists and fungi, drive most differences between pH classes, with weaker contributions from bacterivores and autotrophs. Overall, soil parasites included a large diversity of alveolates, in particular apicomplexans. Phylogenetic analysis of alveolate lineages demonstrates a large diversity of unknown gregarines, novel perkinsids, coccidians, colpodellids and uncharacterized alveolates. Other novel and/or divergent lineages were revealed across the eukaryote tree of life. Our study provides an in-depth taxonomic evaluation of micro-eukaryotic diversity, and reveals novel lineages and insights into their relationships with environmental variables across soil gradients. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Kasprzyk, Marta; Twardowski, Tomasz
2016-01-01
Recently, a number of ribosome-associated non-coding RNAs (rancRNAs) have been discovered in all three domains of life. In our previous studies, we have described several types of rancRNAs in Saccharomyces cerevisiae, derived from many cellular RNAs, including mRNAs, rRNAs, tRNAs and snoRNAs. Here, we present the evidence that the tRNA fragments from simple eukaryotic organism S. cerevisiae directly bind to the ribosomes. Interestingly, rancRNA-tRFs in yeast are derived from both, 5′- and 3′-part of the tRNAs and both types of tRFs associate with the ribosomes in vitro. The location of tRFs within the ribosomes is distinct from classical A- and P-tRNA binding sites. Moreover, 3′-tRFs bind to the distinct site than 5′-tRFs. These interactions are stress dependent and as a consequence, provoke regulation of protein biosynthesis. We observe strong correlation between tRF binding to the ribosomes and inhibition of protein biosynthesis in particular environmental conditions. These results implicate the existence of an ancient and conserved mechanism of translation regulation with the involvement of ribosome-associating tRNA-derived fragments. PMID:27609601
Mechanisms of In Vivo Ribosome Maintenance Change in Response to Nutrient Signals*
Mathis, Andrew D.; Naylor, Bradley C.; Carson, Richard H.; Evans, Eric; Harwell, Justin; Knecht, Jared; Hexem, Eric; Peelor, Fredrick F.; Miller, Benjamin F.; Hamilton, Karyn L.; Transtrum, Mark K.; Bikman, Benjamin T.; Price, John C.
2017-01-01
Control of protein homeostasis is fundamental to the health and longevity of all organisms. Because the rate of protein synthesis by ribosomes is a central control point in this process, regulation, and maintenance of ribosome function could have amplified importance in the overall regulatory circuit. Indeed, ribosomal defects are commonly associated with loss of protein homeostasis, aging, and disease (1–4), whereas improved protein homeostasis, implying optimal ribosomal function, is associated with disease resistance and increased lifespan (5–7). To maintain a high-quality ribosome population within the cell, dysfunctional ribosomes are targeted for autophagic degradation. It is not known if complete degradation is the only mechanism for eukaryotic ribosome maintenance or if they might also be repaired by replacement of defective components. We used stable-isotope feeding and protein mass spectrometry to measure the kinetics of turnover of ribosomal RNA (rRNA) and 71 ribosomal proteins (r-proteins) in mice. The results indicate that exchange of individual proteins and whole ribosome degradation both contribute to ribosome maintenance in vivo. In general, peripheral r-proteins and those with more direct roles in peptide-bond formation are replaced multiple times during the lifespan of the assembled structure, presumably by exchange with a free cytoplasmic pool, whereas the majority of r-proteins are stably incorporated for the lifetime of the ribosome. Dietary signals impact the rates of both new ribosome assembly and component exchange. Signal-specific modulation of ribosomal repair and degradation could provide a mechanistic link in the frequently observed associations among diminished rates of protein synthesis, increased autophagy, and greater longevity (5, 6, 8, 9). PMID:27932527
Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3.
Ng, C Leong; Lang, Kathrin; Meenan, Nicola Ag; Sharma, Amit; Kelley, Ann C; Kleanthous, Colin; Ramakrishnan, V
2010-10-01
The toxin colicin E3 targets the 30S subunit of bacterial ribosomes and cleaves a phosphodiester bond in the decoding center. We present the crystal structure of the 70S ribosome in complex with the cytotoxic domain of colicin E3 (E3-rRNase). The structure reveals how the rRNase domain of colicin binds to the A site of the decoding center in the 70S ribosome and cleaves the 16S ribosomal RNA (rRNA) between A1493 and G1494. The cleavage mechanism involves the concerted action of conserved residues Glu62 and His58 of the cytotoxic domain of colicin E3. These residues activate the 16S rRNA for 2' OH-induced hydrolysis. Conformational changes observed for E3-rRNase, 16S rRNA and helix 69 of 23S rRNA suggest that a dynamic binding platform is required for colicin E3 binding and function.
Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.
2007-01-01
The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376
Ogawa, Atsushi; Murashige, Yuta; Takahashi, Hajime
2018-06-19
We have found that OFF-riboswitches that ligand-dependently downregulate the canonical translation in a higher eukaryotic expression system (wheat germ extract) can be easily created by inserting a single aptamer into the 5' untranslated region (UTR) of mRNA, even if its ligand is as small as theophylline. The key is the position of the inserted aptamer: the 5' end (+0 position) is much better than other positions for inhibiting canonical translation with the aptamer-ligand complex. The data showed that ribosome loading is suppressed by a rigid structure in the 5' end, and this suppression is dependent on the structure's stability but not on its size. Although this preference of aptamer insertion point contradicts the results in a lower eukaryote, it accords with the fact that the 5'-end structural hindrance is more effective for blocking the ribosome in higher eukaryotes. Therefore, the present type of OFF-riboswitch would function in various higher eukaryotic expression systems. Copyright © 2018 Elsevier Ltd. All rights reserved.
Ribosomal proteins: functions beyond the ribosome.
Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua
2015-04-01
Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS. All rights reserved.
Barendt, Pamela A.; Shah, Najaf A.; Barendt, Gregory A.; Kothari, Parth A.; Sarkar, Casim A.
2013-01-01
While the ribosome has evolved to function in complex intracellular environments, these contexts do not easily allow for the study of its inherent capabilities. We have used a synthetic, well-defined, Escherichia coli (E. coli)-based translation system in conjunction with ribosome display, a powerful in vitro selection method, to identify ribosome binding sites (RBSs) that can promote the efficient translation of messenger RNAs (mRNAs) with a leader length representative of natural E. coli mRNAs. In previous work, we used a longer leader sequence and unexpectedly recovered highly efficient cytosine-rich sequences with complementarity to the 16S ribosomal RNA (rRNA) and similarity to eukaryotic RBSs. In the current study, Shine-Dalgarno (SD) sequences were prevalent but non-SD sequences were also heavily enriched and were dominated by novel guanine- and uracil-rich motifs which showed statistically significant complementarity to the 16S rRNA. Additionally, only SD motifs exhibited position-dependent decreases in sequence entropy, indicating that non-SD motifs likely operate by increasing the local concentration of ribosomes in the vicinity of the start codon, rather than by a position-dependent mechanism. These results further support the putative generality of mRNA-rRNA complementarity in facilitating mRNA translation, but also suggest that context (e.g., leader length and composition) dictates the specific subset of possible RBSs that are used for efficient translation of a given transcript. PMID:23427812
Oxidative damage of 18S and 5S ribosomal RNA in digestive gland of mussels exposed to trace metals.
Kournoutou, Georgia G; Giannopoulou, Panagiota C; Sazakli, Eleni; Leotsinidis, Michel; Kalpaxis, Dimitrios L
2017-11-01
Numerous studies have shown the ability of trace metals to accumulate in marine organisms and cause oxidative stress that leads to perturbations in many important intracellular processes, including protein synthesis. This study is mainly focused on the exploration of structural changes, like base modifications, scissions, and conformational changes, caused in 18S and 5S ribosomal RNA (rRNA) isolated from the mussel Mytilus galloprovincialis exposed to 40μg/L Cu, 30μg/L Hg, or 100μg/L Cd, for 5 or 15days. 18S rRNA and 5S rRNA are components of the small and large ribosomal subunit, respectively, found in complex with ribosomal proteins, translation factors and other auxiliary components (metal ions, toxins etc). 18S rRNA plays crucial roles in all stages of protein synthesis, while 5S rRNA serves as a master signal transducer between several functional regions of 28S rRNA. Therefore, structural changes in these ribosomal constituents could affect the basic functions of ribosomes and hence the normal metabolism of cells. Especially, 18S rRNA along with ribosomal proteins forms the decoding centre that ensures the correct codon-anticodon pairing. As exemplified by ELISA, primer extension analysis and DMS footprinting analysis, each metal caused oxidative damage to rRNA, depending on the nature of metal ion and the duration of exposure. Interestingly, exposure of mussels to Cu or Hg caused structural alterations in 5S rRNA, localized in paired regions and within loops A, B, C, and E, leading to a continuous progressive loss of the 5S RNA structural integrity. In contrast, structural impairments of 5S rRNA in mussels exposed to Cd were accumulating for the initial 5days, and then progressively decreased to almost the normal level by day 15, probably due to the parallel elevation of metallothionein content that depletes the pools of free Cd. Regions of interest in 18S rRNA, such as the decoding centre, sites implicated in the binding of tRNAs (A- and P-sites) or
De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y
1992-01-01
The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081
Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs
NASA Technical Reports Server (NTRS)
Delihas, N.; Fox, G. E.
1987-01-01
In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.
Grant, Susan; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun
2006-01-01
Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at -20 degrees C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes.
Grant, Susan; Grant, William D.; Cowan, Don A.; Jones, Brian E.; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun
2006-01-01
Here we describe the application of metagenomic technologies to construct cDNA libraries from RNA isolated from environmental samples. RNAlater (Ambion) was shown to stabilize RNA in environmental samples for periods of at least 3 months at −20°C. Protocols for library construction were established on total RNA extracted from Acanthamoeba polyphaga trophozoites. The methodology was then used on algal mats from geothermal hot springs in Tengchong county, Yunnan Province, People's Republic of China, and activated sludge from a sewage treatment plant in Leicestershire, United Kingdom. The Tenchong libraries were dominated by RNA from prokaryotes, reflecting the mainly prokaryote microbial composition. The majority of these clones resulted from rRNA; only a few appeared to be derived from mRNA. In contrast, many clones from the activated sludge library had significant similarity to eukaryote mRNA-encoded protein sequences. A library was also made using polyadenylated RNA isolated from total RNA from activated sludge; many more clones in this library were related to eukaryotic mRNA sequences and proteins. Open reading frames (ORFs) up to 378 amino acids in size could be identified. Some resembled known proteins over their full length, e.g., 36% match to cystatin, 49% match to ribosomal protein L32, 63% match to ribosomal protein S16, 70% to CPC2 protein. The methodology described here permits the polyadenylated transcriptome to be isolated from environmental samples with no knowledge of the identity of the microorganisms in the sample or the necessity to culture them. It has many uses, including the identification of novel eukaryotic ORFs encoding proteins and enzymes. PMID:16391035
Structure of Ribosomal Silencing Factor Bound to Mycobacterium tuberculosis Ribosome.
Li, Xiaojun; Sun, Qingan; Jiang, Cai; Yang, Kailu; Hung, Li-Wei; Zhang, Junjie; Sacchettini, James C
2015-10-06
The ribosomal silencing factor RsfS slows cell growth by inhibiting protein synthesis during periods of diminished nutrient availability. The crystal structure of Mycobacterium tuberculosis (Mtb) RsfS, together with the cryo-electron microscopy (EM) structure of the large subunit 50S of Mtb ribosome, reveals how inhibition of protein synthesis by RsfS occurs. RsfS binds to the 50S at L14, which, when occupied, blocks the association of the small subunit 30S. Although Mtb RsfS is a dimer in solution, only a single subunit binds to 50S. The overlap between the dimer interface and the L14 binding interface confirms that the RsfS dimer must first dissociate to a monomer in order to bind to L14. RsfS interacts primarily through electrostatic and hydrogen bonding to L14. The EM structure shows extended rRNA density that it is not found in the Escherichia coli ribosome, the most striking of these being the extended RNA helix of H54a. Copyright © 2015 Elsevier Ltd. All rights reserved.
Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.
Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B
1978-01-01
A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229
Type 1 ribosome-inactivating proteins depurinate plant 25S rRNA without species specificity.
Prestle, J; Schönfelder, M; Adam, G; Mundry, K W
1992-01-01
Four different type 1 ribosome-inactivating proteins (RIPs) with RNA N-glycosidase activity were tested for their ability to attack the large rRNA of plant ribosomes derived from tobacco plants, as well as from the plant species from which the particular RIP had been isolated. Incubation of tobacco ribosomes with RIPs isolated from either Phytolacca americana L. (pokeweed), Dianthus barbatus L. (carnation), Spinacia oleracea L. (spinach) or Chenopodium amaranthicolor Coste and Reyn. (chenopodium) rendered the 25S rRNA sensitive to aniline-catalyzed hydrolysis, generating a single rRNA-fragment of about 350 nucleotides. The same fragment was generated when rRNAs from pokeweed, carnation, spinach or chenopodium ribosomes were aniline-treated without any deliberate treatment of the ribosomes with the respective RIP. This indicated that ribosomes from all RIP-producing plants were already inactivated by their own RIPs during preparation. These results demonstrate that plant ribosomes are generally susceptible to RIP attack, including modification by their own RIPs. Direct sequencing of the newly generated fragments revealed that a single N-glycosidic bond at an adenosine residue within the highly conserved sequence 5'-AGUACGAGAGGA-3' was cleaved by all of the RIPs investigated, a situation also found in animal, yeast and Escherichia coli ribosomes. Images PMID:1620614
Concerted removal of the Erb1–Ytm1 complex in ribosome biogenesis relies on an elaborate interface
Thoms, Matthias; Ahmed, Yasar Luqman; Maddi, Karthik; Hurt, Ed; Sinning, Irmgard
2016-01-01
The complicated process of eukaryotic ribosome biogenesis involves about 200 assembly factors that transiently associate with the nascent pre-ribosome in a spatiotemporally ordered way. During the early steps of 60S subunit formation, several proteins, collectively called A3 cluster factors, participate in the removal of the internal transcribed spacer 1 (ITS1) from 27SA3 pre-rRNA. Among these factors is the conserved hetero-trimeric Nop7–Erb1–Ytm1 complex (or human Pes1–Bop1–Wdr12), which is removed from the evolving pre-60S particle by the AAA ATPase Rea1 to allow progression in the pathway. Here, we clarify how Ytm1 and Erb1 interact, which has implications for the release mechanism of both factors from the pre-ribosome. Biochemical studies show that Ytm1 and Erb1 bind each other via their ß-propeller domains. The crystal structure of the Erb1–Ytm1 heterodimer determined at 2.67Å resolution reveals an extended interaction surface between the propellers in a rarely observed binding mode. Structure-based mutations in the interface that impair the Erb1–Ytm1 interaction do not support growth, with specific defects in 60S subunit synthesis. Under these mutant conditions, it becomes clear that an intact Erb1–Ytm1 complex is required for 60S maturation and that loss of this stable interaction prevents ribosome production. PMID:26657628
Concerted copy number variation balances ribosomal DNA dosage in human and mouse genomes
Gibbons, John G.; Branco, Alan T.; Godinho, Susana A.; Yu, Shoukai; Lemos, Bernardo
2015-01-01
Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in mammals, and encode functionally interdependent RNA components of the ribosome. Here we show that the 5S and 45S rDNA arrays exhibit concerted CN variation (cCNV). Despite 5S and 45S rDNA elements residing on different chromosomes and lacking sequence similarity, cCNV between these loci is strong, evolutionarily conserved in humans and mice, and manifested across individual genotypes in natural populations and pedigrees. Finally, we observe that bisphenol A induces rapid and parallel modulation of 5S and 45S rDNA CN. Our observations reveal a novel mode of genome variation, indicate that natural selection contributed to the evolution and conservation of cCNV, and support the hypothesis that 5S CN is partly determined by the requirement of dosage balance with the 45S rDNA array. We suggest that human disease variation might be traced to disrupted rDNA dosage balance in the genome. PMID:25583482
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association.
Pulk, Arto; Maiväli, Ulo; Remme, Jaanus
2006-05-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts.
Identification of nucleotides in E. coli 16S rRNA essential for ribosome subunit association
Pulk, Arto; Maiväli, Ülo; Remme, Jaanus
2006-01-01
The ribosome consists of two unequal subunits, which associate via numerous intersubunit contacts. Medium-resolution structural studies have led to grouping of the intersubunit contacts into 12 directly visualizable intersubunit bridges. Most of the intersubunit interactions involve RNA. We have used an RNA modification interference approach to determine Escherichia coli 16S rRNA positions that are essential for the association of functionally active 70S ribosomes. Modification of the N1 position of A702, A1418, and A1483 with DMS, and of the N3 position of U793, U1414, and U1495 with CMCT in 30S subunits strongly interferes with 70S ribosome formation. Five of these positions localize into previously recognized intersubunit bridges, namely, B2a (U1495), B2b (U793), B3 (A1483), B5 (A1418), and B7a (A702). The remaining position displaying interference, U1414, forms a base pair with G1486, which is a part of bridge B3. We contend that these five intersubunit bridges are essential for reassociation of the 70S ribosome, thus forming the functional core of the intersubunit contacts. PMID:16556933
A congruent phylogenomic signal places eukaryotes within the Archaea.
Williams, Tom A; Foster, Peter G; Nye, Tom M W; Cox, Cymon J; Embley, T Martin
2012-12-22
Determining the relationships among the major groups of cellular life is important for understanding the evolution of biological diversity, but is difficult given the enormous time spans involved. In the textbook 'three domains' tree based on informational genes, eukaryotes and Archaea share a common ancestor to the exclusion of Bacteria. However, some phylogenetic analyses of the same data have placed eukaryotes within the Archaea, as the nearest relatives of different archaeal lineages. We compared the support for these competing hypotheses using sophisticated phylogenetic methods and an improved sampling of archaeal biodiversity. We also employed both new and existing tests of phylogenetic congruence to explore the level of uncertainty and conflict in the data. Our analyses suggested that much of the observed incongruence is weakly supported or associated with poorly fitting evolutionary models. All of our phylogenetic analyses, whether on small subunit and large subunit ribosomal RNA or concatenated protein-coding genes, recovered a monophyletic group containing eukaryotes and the TACK archaeal superphylum comprising the Thaumarchaeota, Aigarchaeota, Crenarchaeota and Korarchaeota. Hence, while our results provide no support for the iconic three-domain tree of life, they are consistent with an extended eocyte hypothesis whereby vital components of the eukaryotic nuclear lineage originated from within the archaeal radiation.
TIF-IA: An oncogenic target of pre-ribosomal RNA synthesis.
Jin, Rui; Zhou, Wei
2016-12-01
Cancer cells devote the majority of their energy consumption to ribosome biogenesis, and pre-ribosomal RNA transcription accounts for 30-50% of all transcriptional activity. This aberrantly elevated biological activity is an attractive target for cancer therapeutic intervention if approaches can be developed to circumvent the development of side effects in normal cells. TIF-IA is a transcription factor that connects RNA polymerase I with the UBF/SL-1 complex to initiate the transcription of pre-ribosomal RNA. Its function is conserved in eukaryotes from yeast to mammals, and its activity is promoted by the phosphorylation of various oncogenic kinases in cancer cells. The depletion of TIF-IA induces cell death in lung cancer cells and mouse embryonic fibroblasts but not in several other normal tissue types evaluated in knock-out studies. Furthermore, the nuclear accumulation of TIF-IA under UTP down-regulated conditions requires the activity of LKB1 kinase, and LKB1-inactivated cancer cells are susceptible to cell death under such stress conditions. Therefore, TIF-IA may be a unique target to suppress ribosome biogenesis without significantly impacting the survival of normal tissues. Copyright © 2016 Elsevier B.V. All rights reserved.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Nmd3p Is a Crm1p-Dependent Adapter Protein for Nuclear Export of the Large Ribosomal Subunit
Ho, Jennifer Hei-Ngam; Kallstrom, George; Johnson, Arlen W.
2000-01-01
In eukaryotic cells, nuclear export of nascent ribosomal subunits through the nuclear pore complex depends on the small GTPase Ran. However, neither the nuclear export signals (NESs) for the ribosomal subunits nor the receptor proteins, which recognize the NESs and mediate export of the subunits, have been identified. We showed previously that Nmd3p is an essential protein from yeast that is required for a late step in biogenesis of the large (60S) ribosomal subunit. Here, we show that Nmd3p shuttles and that deletion of the NES from Nmd3p leads to nuclear accumulation of the mutant protein, inhibition of the 60S subunit biogenesis, and inhibition of the nuclear export of 60S subunits. Moreover, the 60S subunits that accumulate in the nucleus can be coimmunoprecipitated with the NES-deficient Nmd3p. 60S subunit biogenesis and export of truncated Nmd3p were restored by the addition of an exogenous NES. To identify the export receptor for Nmd3p we show that Nmd3p shuttling and 60S export is blocked by the Crm1p-specific inhibitor leptomycin B. These results identify Crm1p as the receptor for Nmd3p export. Thus, export of the 60S subunit is mediated by the adapter protein Nmd3p in a Crm1p-dependent pathway. PMID:11086007
Expanding the Entamoeba Universe: New Hosts Yield Novel Ribosomal Lineages.
Jacob, Alison S; Busby, Eloise J; Levy, Abigail D; Komm, Natasha; Clark, C Graham
2016-01-01
Removing the requirement for cell culture has led to a substantial increase in the number of lineages of Entamoeba recognized as distinct. Surveying the range of potential host species for this parasite genus has barely been started and it is clear that additional sampling of the same host in different locations often identifies additional diversity. In this study, using small subunit ribosomal RNA gene sequencing, we identify four new lineages of Entamoeba, including the first report of Entamoeba from an elephant, and extend the host range of some previously described lineages. In addition, examination of microbiome data from a number of host animals suggests that substantial Entamoeba diversity remains to be uncovered. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.
Zhang, Junxiang; Yuan, Hui; Yang, Yong; Fish, Tara; Lyi, Sangbom M.; Thannhauser, Theodore W; Zhang, Lugang; Li, Li
2016-01-01
Plastid ribosomal proteins are essential components of protein synthesis machinery and have diverse roles in plant growth and development. Mutations in plastid ribosomal proteins lead to a range of developmental phenotypes in plants. However, how they regulate these processes is not fully understood, and the functions of some individual plastid ribosomal proteins remain unknown. To identify genes responsible for chloroplast development, we isolated and characterized a mutant that exhibited pale yellow inner leaves with a reduced growth rate in Arabidopsis. The mutant (rps5) contained a missense mutation of plastid ribosomal protein S5 (RPS5), which caused a dramatically reduced abundance of chloroplast 16S rRNA and seriously impaired 16S rRNA processing to affect ribosome function and plastid translation. Comparative proteomic analysis revealed that the rps5 mutation suppressed the expression of a large number of core components involved in photosystems I and II as well as many plastid ribosomal proteins. Unexpectedly, a number of proteins associated with cold stress responses were greatly decreased in rps5, and overexpression of the plastid RPS5 improved plant cold stress tolerance. Our results indicate that RPS5 is an important constituent of the plastid 30S subunit and affects proteins involved in photosynthesis and cold stress responses to mediate plant growth and development. PMID:27006483
Hierlmeier, Thomas; Merl, Juliane; Sauert, Martina; Perez-Fernandez, Jorge; Schultz, Patrick; Bruckmann, Astrid; Hamperl, Stephan; Ohmayer, Uli; Rachel, Reinhard; Jacob, Anja; Hergert, Kristin; Deutzmann, Rainer; Griesenbeck, Joachim; Hurt, Ed; Milkereit, Philipp; Baßler, Jochen; Tschochner, Herbert
2013-01-01
Eukaryotic ribosome biogenesis requires more than 150 auxiliary proteins, which transiently interact with pre-ribosomal particles. Previous studies suggest that several of these biogenesis factors function together as modules. Using a heterologous expression system, we show that the large ribosomal subunit (LSU) biogenesis factor Noc1p of Saccharomyces cerevisiae can simultaneously interact with the LSU biogenesis factor Noc2p and Rrp5p, a factor required for biogenesis of the large and the small ribosomal subunit. Proteome analysis of RNA polymerase-I-associated chromatin and chromatin immunopurification experiments indicated that all members of this protein module and a specific set of LSU biogenesis factors are co-transcriptionally recruited to nascent ribosomal RNA (rRNA) precursors in yeast cells. Further ex vivo analyses showed that all module members predominantly interact with early pre-LSU particles after the initial pre-rRNA processing events have occurred. In yeast strains depleted of Noc1p, Noc2p or Rrp5p, levels of the major LSU pre-rRNAs decreased and the respective other module members were associated with accumulating aberrant rRNA fragments. Therefore, we conclude that the module exhibits several binding interfaces with pre-ribosomes. Taken together, our results suggest a co- and post-transcriptional role of the yeast Rrp5p–Noc1p–Noc2p module in the structural organization of early LSU precursors protecting them from non-productive RNase activity. PMID:23209026
Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18
Smirnov, Alexandre; Entelis, Nina; Martin, Robert P.; Tarassov, Ivan
2011-01-01
5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes. PMID:21685364
Walker, Sarah E.; Zhou, Fujun; Mitchell, Sarah F.; Larson, Victoria S.; Valasek, Leos; Hinnebusch, Alan G.; Lorsch, Jon R.
2013-01-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B’s domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome’s mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192
Bactobolin resistance is conferred by mutations in the L2 ribosomal protein.
Chandler, Josephine R; Truong, Thao T; Silva, Patricia M; Seyedsayamdost, Mohammad R; Carr, Gavin; Radey, Matthew; Jacobs, Michael A; Sims, Elizabeth H; Clardy, Jon; Greenberg, E Peter
2012-12-18
Burkholderia thailandensis produces a family of polyketide-peptide molecules called bactobolins, some of which are potent antibiotics. We found that growth of B. thailandensis at 30°C versus that at 37°C resulted in increased production of bactobolins. We purified the three most abundant bactobolins and determined their activities against a battery of bacteria and mouse fibroblasts. Two of the three compounds showed strong activities against both bacteria and fibroblasts. The third analog was much less potent in both assays. These results suggested that the target of bactobolins might be conserved across bacteria and mammalian cells. To learn about the mechanism of bactobolin activity, we isolated four spontaneous bactobolin-resistant Bacillus subtilis mutants. We used genomic sequencing technology to show that each of the four resistant variants had mutations in rplB, which codes for the 50S ribosome-associated L2 protein. Ectopic expression of a mutant rplB gene in wild-type B. subtilis conferred bactobolin resistance. Finally, the L2 mutations did not confer resistance to other antibiotics known to interfere with ribosome function. Our data indicate that bactobolins target the L2 protein or a nearby site and that this is not the target of other antibiotics. We presume that the mammalian target of bactobolins involves the eukaryotic homolog of L2 (L8e). Currently available antibiotics target surprisingly few cellular functions, and there is a need to identify novel antibiotic targets. We have been interested in the Burkholderia thailandensis bactobolins, and we sought to learn about the target of bactobolin activity by mapping spontaneous resistance mutations in the bactobolin-sensitive Bacillus subtilis. Our results indicate that the bactobolin target is the 50S ribosome-associated L2 protein or a region of the ribosome affected by L2. Bactobolin-resistant mutants are not resistant to other known ribosome inhibitors. Our evidence indicates that bactobolins
Functional dynamics within the human ribosome regulate the rate of active protein synthesis
Ferguson, Angelica; Wang, Leyi; Altman, Roger B.; Terry, Daniel S.; Juette, Manuel F.; Burnett, Benjamin J.; Alejo, Jose L.; Dass, Randall A.; Parks, Matthew M.; Vincent, Theresa C.; Blanchard, Scott C.
2015-01-01
SUMMARY The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule FRET methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. PMID:26593721
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-07-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. © 2015 Madru et al.; Published by Cold Spring Harbor Laboratory Press.
Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas
2015-01-01
In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998
A universal strategy for regulating mRNA translation in prokaryotic and eukaryotic cells.
Cao, Jicong; Arha, Manish; Sudrik, Chaitanya; Mukherjee, Abhirup; Wu, Xia; Kane, Ravi S
2015-04-30
We describe a simple strategy to control mRNA translation in both prokaryotic and eukaryotic cells which relies on a unique protein-RNA interaction. Specifically, we used the Pumilio/FBF (PUF) protein to repress translation by binding in between the ribosome binding site (RBS) and the start codon (in Escherichia coli), or by binding to the 5' untranslated region of target mRNAs (in mammalian cells). The design principle is straightforward, the extent of translational repression can be tuned and the regulator is genetically encoded, enabling the construction of artificial signal cascades. We demonstrate that this approach can also be used to regulate polycistronic mRNAs; such regulation has rarely been achieved in previous reports. Since the regulator used in this study is a modular RNA-binding protein, which can be engineered to target different 8-nucleotide RNA sequences, our strategy could be used in the future to target endogenous mRNAs for regulating metabolic flows and signaling pathways in both prokaryotic and eukaryotic cells. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Pratte, Dagmar; Singh, Ujjwala; Murat, Guillaume; Kressler, Dieter
2013-01-01
Ribosomes are the molecular machines that translate mRNAs into proteins. The synthesis of ribosomes is therefore a fundamental cellular process and consists in the ordered assembly of 79 ribosomal proteins (r-proteins) and four ribosomal RNAs (rRNAs) into a small 40S and a large 60S ribosomal subunit that form the translating 80S ribosomes. Most of our knowledge concerning this dynamic multi-step process comes from studies with the yeast Saccharomyces cerevisiae, which have shown that assembly and maturation of pre-ribosomal particles, as they travel from the nucleolus to the cytoplasm, relies on a multitude (>200) of biogenesis factors. Amongst these are many energy-consuming enzymes, including 19 ATP-dependent RNA helicases and three AAA-ATPases. We have previously shown that the AAA-ATPase Rix7 promotes the release of the essential biogenesis factor Nsa1 from late nucleolar pre-60S particles. Here we show that mutant alleles of genes encoding the DEAD-box RNA helicase Mak5, the C/D-box snoRNP component Nop1 and the rRNA-binding protein Nop4 bypass the requirement for Nsa1. Interestingly, dominant-negative alleles of RIX7 retain their phenotype in the absence of Nsa1, suggesting that Rix7 may have additional nuclear substrates besides Nsa1. Mak5 is associated with the Nsa1 pre-60S particle and synthetic lethal screens with mak5 alleles identified the r-protein Rpl14 and the 60S biogenesis factors Ebp2, Nop16 and Rpf1, which are genetically linked amongst each other. We propose that these ’Mak5 cluster’ factors orchestrate the structural arrangement of a eukaryote-specific 60S subunit surface composed of Rpl6, Rpl14 and Rpl16 and rRNA expansion segments ES7L and ES39L. Finally, over-expression of Rix7 negatively affects growth of mak5 and ebp2 mutant cells both in the absence and presence of Nsa1, suggesting that Rix7, at least when excessively abundant, may act on structurally defective pre-60S subunits and may subject these to degradation. PMID:24312670
A ribosome-dependent GTPase from yeast distinct from elongation factor 2.
Skogerson, L; Wakatama, E
1976-01-01
Three proteins required for poly(U)-directed polyphenylalanine synthesis have been separated from yeast. Two of the factors correspond to the elongation factors 1 and 2 described for other eukaryotic systems, according to the criteria of phenylalanyl-tRNA binding and diphtheria toxin-catalyzed ADP-ribosylation. The third protein, while absolutely required for polyphenylalanine synthesis, was a more active ribosome-dependent GTPase than elongation factor 2. PMID:174100
[Family of ribosomal proteins S1 contains unique conservative domain].
Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N
2010-01-01
Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.
Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome
NASA Astrophysics Data System (ADS)
Poirot, Olivier; Timsit, Youri
2016-05-01
From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing.
Erales, Jenny; Marchand, Virginie; Panthu, Baptiste; Gillot, Sandra; Belin, Stéphane; Ghayad, Sandra E; Garcia, Maxime; Laforêts, Florian; Marcel, Virginie; Baudin-Baillieu, Agnès; Bertin, Pierre; Couté, Yohann; Adrait, Annie; Meyer, Mélanie; Therizols, Gabriel; Yusupov, Marat; Namy, Olivier; Ohlmann, Théophile; Motorin, Yuri; Catez, Frédéric; Diaz, Jean-Jacques
2017-12-05
Ribosomal RNAs (rRNAs) are main effectors of messenger RNA (mRNA) decoding, peptide-bond formation, and ribosome dynamics during translation. Ribose 2'-O-methylation (2'-O-Me) is the most abundant rRNA chemical modification, and displays a complex pattern in rRNA. 2'-O-Me was shown to be essential for accurate and efficient protein synthesis in eukaryotic cells. However, whether rRNA 2'-O-Me is an adjustable feature of the human ribosome and a means of regulating ribosome function remains to be determined. Here we challenged rRNA 2'-O-Me globally by inhibiting the rRNA methyl-transferase fibrillarin in human cells. Using RiboMethSeq, a nonbiased quantitative mapping of 2'-O-Me, we identified a repertoire of 2'-O-Me sites subjected to variation and demonstrate that functional domains of ribosomes are targets of 2'-O-Me plasticity. Using the cricket paralysis virus internal ribosome entry site element, coupled to in vitro translation, we show that the intrinsic capability of ribosomes to translate mRNAs is modulated through a 2'-O-Me pattern and not by nonribosomal actors of the translational machinery. Our data establish rRNA 2'-O-Me plasticity as a mechanism providing functional specificity to human ribosomes.
Hatakeyama, T; Hatakeyama, T; Kimura, M
1988-11-21
The complete amino acid sequences of ribosomal proteins L16, L23 and L33 from the archaebacterium Halobacterium marismortui were determined. The sequences were established by manual sequencing of peptides produced with several proteases as well as by cleavage with dilute HCl. Proteins L16, L23 and L33 consist of 119, 154 and 69 amino acid residues, and their molecular masses are 13,538, 16,812 and 7620 Da, respectively. The comparison of their sequences with those of ribosomal proteins from other organisms revealed that L23 and L33 are related to eubacterial ribosomal proteins from Escherichia coli and Bacillus stearothermophilus, while protein L16 was found to be homologous to a eukaryotic ribosomal protein from yeast. These results provide information about the special phylogenetic position of archaebacteria.
Roger, Andrew J; Hug, Laura A
2006-01-01
Determining the relationships among and divergence times for the major eukaryotic lineages remains one of the most important and controversial outstanding problems in evolutionary biology. The sequencing and phylogenetic analyses of ribosomal RNA (rRNA) genes led to the first nearly comprehensive phylogenies of eukaryotes in the late 1980s, and supported a view where cellular complexity was acquired during the divergence of extant unicellular eukaryote lineages. More recently, however, refinements in analytical methods coupled with the availability of many additional genes for phylogenetic analysis showed that much of the deep structure of early rRNA trees was artefactual. Recent phylogenetic analyses of a multiple genes and the discovery of important molecular and ultrastructural phylogenetic characters have resolved eukaryotic diversity into six major hypothetical groups. Yet relationships among these groups remain poorly understood because of saturation of sequence changes on the billion-year time-scale, possible rapid radiations of major lineages, phylogenetic artefacts and endosymbiotic or lateral gene transfer among eukaryotes. Estimating the divergence dates between the major eukaryote lineages using molecular analyses is even more difficult than phylogenetic estimation. Error in such analyses comes from a myriad of sources including: (i) calibration fossil dates, (ii) the assumed phylogenetic tree, (iii) the nucleotide or amino acid substitution model, (iv) substitution number (branch length) estimates, (v) the model of how rates of evolution change over the tree, (vi) error inherent in the time estimates for a given model and (vii) how multiple gene data are treated. By reanalysing datasets from recently published molecular clock studies, we show that when errors from these various sources are properly accounted for, the confidence intervals on inferred dates can be very large. Furthermore, estimated dates of divergence vary hugely depending on the methods
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-17
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA.
Ribosome profiling reveals pervasive and regulated stop codon readthrough in Drosophila melanogaster
Dunn, Joshua G; Foo, Catherine K; Belletier, Nicolette G; Gavis, Elizabeth R; Weissman, Jonathan S
2013-01-01
Ribosomes can read through stop codons in a regulated manner, elongating rather than terminating the nascent peptide. Stop codon readthrough is essential to diverse viruses, and phylogenetically predicted to occur in a few hundred genes in Drosophila melanogaster, but the importance of regulated readthrough in eukaryotes remains largely unexplored. Here, we present a ribosome profiling assay (deep sequencing of ribosome-protected mRNA fragments) for Drosophila melanogaster, and provide the first genome-wide experimental analysis of readthrough. Readthrough is far more pervasive than expected: the vast majority of readthrough events evolved within D. melanogaster and were not predicted phylogenetically. The resulting C-terminal protein extensions show evidence of selection, contain functional subcellular localization signals, and their readthrough is regulated, arguing for their importance. We further demonstrate that readthrough occurs in yeast and humans. Readthrough thus provides general mechanisms both to regulate gene expression and function, and to add plasticity to the proteome during evolution. DOI: http://dx.doi.org/10.7554/eLife.01179.001 PMID:24302569
Functional Dynamics within the Human Ribosome Regulate the Rate of Active Protein Synthesis.
Ferguson, Angelica; Wang, Leyi; Altman, Roger B; Terry, Daniel S; Juette, Manuel F; Burnett, Benjamin J; Alejo, Jose L; Dass, Randall A; Parks, Matthew M; Vincent, C Theresa; Blanchard, Scott C
2015-11-05
The regulation of protein synthesis contributes to gene expression in both normal physiology and disease, yet kinetic investigations of the human translation mechanism are currently lacking. Using single-molecule fluorescence imaging methods, we have quantified the nature and timing of structural processes in human ribosomes during single-turnover and processive translation reactions. These measurements reveal that functional complexes exhibit dynamic behaviors and thermodynamic stabilities distinct from those observed for bacterial systems. Structurally defined sub-states of pre- and post-translocation complexes were sensitive to specific inhibitors of the eukaryotic ribosome, demonstrating the utility of this platform to probe drug mechanism. The application of three-color single-molecule fluorescence resonance energy transfer (smFRET) methods further revealed a long-distance allosteric coupling between distal tRNA binding sites within ribosomes bearing three tRNAs, which contributed to the rate of processive translation. Copyright © 2015 Elsevier Inc. All rights reserved.
Ridgeway, William K.; Millar, David P.; Williamson, James R.
2012-01-01
The self-assembly of bacterial 30S ribosomes involves a large number of RNA folding and RNA-protein binding steps. The sequence of steps determines the overall assembly mechanism and the structure of the mechanism has ramifications for the robustness of biogenesis and resilience against kinetic traps. Thermodynamic interdependencies of protein binding inferred from omission-reconstitution experiments are thought to preclude certain assembly pathways and thus enforce ordered assembly, but this concept is at odds with kinetic data suggesting a more parallel assembly landscape. A major challenge is deconvolution of the statistical distribution of intermediates that are populated during assembly at high concentrations approaching in vivo assembly conditions. To specifically resolve the intermediates formed by binding of three ribosomal proteins to the full length 16S rRNA, we introduce Fluorescence Triple-Correlation Spectroscopy (F3CS). F3CS identifies specific ternary complexes by detecting coincident fluctuations in three-color fluorescence data. Triple correlation integrals quantify concentrations and diffusion kinetics of triply labeled species, and F3CS data can be fit alongside auto-correlation and cross-correlation data to quantify the populations of 10 specific ribosome assembly intermediates. The distribution of intermediates generated by binding three ribosomal proteins to the entire native 16S rRNA included significant populations of species that were not previously thought to be thermodynamically accessible, questioning the current interpretation of the classic omission-reconstitution experiments. F3CS is a general approach for analyzing assembly and function of macromolecular complexes, especially those too large for traditional biophysical methods. PMID:22869699
Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes.
Milbury, Coren A; Lee, Jung C; Cannone, Jamie J; Gaffney, Patrick M; Gutell, Robin R
2010-09-02
Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA) genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.
Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †
Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L.; Cooper, Rebecca E.; Wilson, Lindsay A.; Stoneley, Mark; Coldwell, Mark J.; Poncet, Didier; Shen, Ya-Ching; Morley, Simon J.; Bushell, Martin; Willis, Anne E.
2009-01-01
Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5′ end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5′ untranslated region (5′-UTR) of the mRNA. However, it is not well understood how cellular IRESs function to recruit the ribosome or how the 40S ribosomal subunits translocate from the initial recruitment site on the mRNA to the AUG initiation codon. We have investigated the canonical factors that are required by the IRESs found in the 5′-UTRs of c-, L-, and N-myc, using specific inhibitors and a tissue culture-based assay system, and have shown that they differ considerably in their requirements. The L-myc IRES requires the eIF4F complex and the association of PABP and eIF3 with eIF4G for activity. The minimum requirements of the N- and c-myc IRESs are the C-terminal domain of eIF4G to which eIF4A is bound and eIF3, although interestingly this protein does not appear to be recruited to the IRES RNA via eIF4G. Finally, our data show that all three IRESs require a ternary complex, although in contrast to c- and L-myc IRESs, the N-myc IRES has a lesser requirement for a ternary complex. PMID:19124605
Of blood, bones, and ribosomes: is Swachman-Diamond syndrome a ribosomopathy?
Johnson, Arlen W; Ellis, Steve R
2011-05-01
Mutations in the human SBDS (Shwachman-Bodian-Diamond syndrome) gene are the most common cause of Shwachman-Diamond syndrome, an inherited bone marrow failure syndrome. In this issue of Genes & Development, Finch and colleagues (pp. 917-929) establish that SBDS functions in ribosome synthesis by promoting the recycling of eukaryotic initiation factor 6 (eIF6) in a GTP-dependent manner. This work supports the idea that a ribosomopathy may underlie this syndrome.
Mitochondrial ribosome assembly in health and disease
De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni
2015-01-01
The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272
Alternative Ways to Think about Cellular Internal Ribosome Entry*
Gilbert, Wendy V.
2010-01-01
Internal ribosome entry sites (IRESs) are specialized mRNA elements that allow recruitment of eukaryotic ribosomes to naturally uncapped mRNAs or to capped mRNAs under conditions in which cap-dependent translation is inhibited. Putative cellular IRESs have been proposed to play crucial roles in stress responses, development, apoptosis, cell cycle control, and neuronal function. However, most of the evidence for cellular IRES activity rests on bicistronic reporter assays, the reliability of which has been questioned. Here, the mechanisms underlying cap-independent translation of cellular mRNAs and the contributions of such translation to cellular protein synthesis are discussed. I suggest that the division of cellular mRNAs into mutually exclusive categories of “cap-dependent” and “IRES-dependent” should be reconsidered and that the implications of cellular IRES activity need to be incorporated into our models of cap-dependent initiation. PMID:20576611
Onofrillo, Carmine; Galbiati, Alice; Montanaro, Lorenzo; Derenzini, Massimo
2017-01-01
Pre-ribosomal complex RPL5/RPL11/5S rRNA (5S RNP) is considered the central MDM2 inhibitory complex that control p53 stabilization during ribosome biogenesis inhibition. Despite its role is well defined, the dynamic of 5S RNP assembly still requires further characterization. In the present work, we report that MDM2 inhibition is dependent by a pre-existing population of 5S rRNA. PMID:28032591
Houchens, Christopher R.; Perreault, Audrey; Bachand, François; Kelly, Thomas J.
2008-01-01
The initiation of eukaryotic DNA replication is preceded by the assembly of prereplication complexes (pre-RCs) at chromosomal origins of DNA replication. Pre-RC assembly requires the essential DNA replication proteins ORC, Cdc6, and Cdt1 to load the MCM DNA helicase onto chromatin. Saccharomyces cerevisiae Noc3 (ScNoc3), an evolutionarily conserved protein originally implicated in 60S ribosomal subunit trafficking, has been proposed to be an essential regulator of DNA replication that plays a direct role during pre-RC formation in budding yeast. We have cloned Schizosaccharomyces pombe noc3+ (Spnoc3+), the S. pombe homolog of the budding yeast ScNOC3 gene, and functionally characterized the requirement for the SpNoc3 protein during ribosome biogenesis, cell cycle progression, and DNA replication in fission yeast. We showed that fission yeast SpNoc3 is a functional homolog of budding yeast ScNoc3 that is essential for cell viability and ribosome biogenesis. We also showed that SpNoc3 is required for the normal completion of cell division in fission yeast. However, in contrast to the proposal that ScNoc3 plays an essential role during DNA replication in budding yeast, we demonstrated that fission yeast cells do enter and complete S phase in the absence of SpNoc3, suggesting that SpNoc3 is not essential for DNA replication in fission yeast. PMID:18606828
Reductive alkylation of ribosomes as a probe to the topography of ribosomal proteins*
Moore, Graham; Crichton, Robert R.
1974-01-01
Escherichia coli ribosomes were treated with a number of different aldehydes of various sizes in the presence of NaBH4. After incorporation of either 3H or 14C, the ribosomal proteins were separated by two-dimensional polyacrylamide-gel electrophoresis and the extent of alkylation of the lysine residues in each protein was measured. The same pattern of alkylation was observed with the four reagents used, namely formaldehyde, acetone, benzaldehyde and 3,4,5-trimethoxybenzaldehyde. Every protein in 30S and 50S subunits was modified, although there was considerable variation in the degree of alkylation of individual proteins. A topographical classification of ribosomal proteins is presented, based on the degree of exposure of lysine residues. The data indicate that every protein of the ribosome has at least one lysine residue exposed at or near the surface of the ribonucleo-protein complex. PMID:4462744
Ribonucleic Acid and Ribosomes of Bacillus stearothermophilus1
Saunders, Grady F.; Campbell, L. Leon
1966-01-01
Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332–339. 1966.—The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10−2m MgCl2–10−2m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg++ concentration to 10−3m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10−2m Mg++ to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a Tm at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a Tm of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. Images PMID:5903099
High-resolution structure of the Escherichia coli ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.
Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less
High-resolution structure of the Escherichia coli ribosome
Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; ...
2015-03-16
Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. Inmore » conclusion, this structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development.« less
Cukras, Anthony R; Green, Rachel
2005-05-27
The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.
Sun, Linxiao; Yu, Yonghua; Hu, Weiqin; Min, Qiming; Kang, Huiling; Li, Yilu; Hong, Yue; Wang, Xuemin; Hong, Yueyun
2016-07-01
Ribosomal protein S6 kinase (S6K) functions as a key component in the target of rapamycin (TOR) pathway involved in multiple processes in eukaryotes. The role and regulation of TOR-S6K in lipid metabolism remained unknown in plants. Here we provide genetic and pharmacological evidence that TOR-Raptor2-S6K1 is important for thylakoid galactolipid biosynthesis and thylakoid grana modeling in rice (Oryza sativa L.). Genetic suppression of S6K1 caused pale yellow-green leaves, defective thylakoid grana architecture. S6K1 directly interacts with Raptor2, a core component in TOR signaling, and S6K1 activity is regulated by Raptor2 and TOR. Plants with suppressed Raptor2 expression or reduced TOR activity by inhibitors mimicked the S6K1-deficient phenotype. A significant reduction in galactolipid content was found in the s6k1, raptor2 mutant or TOR-inhibited plants, which was accompanied by decreased transcript levels of the set of genes such as lipid phosphate phosphatase α5 (LPPα5), MGDG synthase 1 (MGD1), and DGDG synthase 1 (DGD1) involved in galactolipid synthesis, compared to the control plants. Moreover, loss of LPPα5 exhibited a similar phenotype with pale yellow-green leaves. These results suggest that TOR-Raptor2-S6K1 is important for modulating thylakoid membrane lipid biosynthesis, homeostasis, thus enhancing thylakoid grana architecture and normal photosynthesis ability in rice. Copyright © 2016 Elsevier B.V. All rights reserved.
Research on ribosome-inactivating proteins from angiospermae to gymnospermae and cryptogamia
Liu, Wang-Yi
2017-01-01
Ribosome-inactivating Proteins (RIPs) are a group of cytotoxin proteins that usually contain a RNA N-glycosidase domain, which irreversibly inactivates ribosome, thus inhibiting protein synthesis. During the past 14 years (1990-2004), the studies conducted in our laboratory had been focusing on the structure and enzymatic mechanism of several PIPs. Herein, we briefly described a summary of the studies conducted mainly in our laboratory on RIPs from angiospermae to gymnospermae and cryptogamia as follows. (1) Cinnamomin is a novel type II RIP isolated from mature seeds of camphor tree. Like ricin, it specifically removes the adenine at A4324 in rat liver 28S rRNA. We systematically studied this low-toxic RIP in term of its enzymatic mechanism, the primary and crystal structure and the nucleotide sequence of its gene, the genetic expression, and its physiological role in the seed cell and the toxicity to human cancer cells and insect larvae. The cleavage of supercoiled double-stranded DNA was its intrinsic property of cinnamomin A-chain, its N- and C-terminal regions were found to be required for deadenylation of rRNA and also necessary for deadenylation of supercoiled double-stranded circular DNA. These results strongly excluded the possibility that cleavage of supercoiled DNA was due to nuclease contamination. (2) Trichosanthin, an abortifacient protein, was purified from the Chinese medicinal herb, Tian-hua-fen, obtained from root tubers of Chinese trichosanthes plant. We proved that trichosanthin was a RNA N-glycosidase, inactivating eukaryotic ribosome by hydrolyzing the N-C glycosidic bond of the adenose at site 4324 in rat 28S rRNA, and inhibited protein synthesis in vitro. (3) A unique Biota orientalis RNase (RNase Bo) was extracted from the mature seeds of the cypress cypress tree (Oriental arborvita), which was gymnospermae plant. It cleaved only a specific phosphodiester bond between C4453 and A4454 of 28S RNA in rat ribosomes, producing a small RNA
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Park, Sang-Wook; Stevens, Noah M; Vivanco, Jorge M
2002-12-01
Ribosome-inactivating proteins (RIPs) are enzymes that cleave a specific adenine base from the highly conserved sarcin/ricin (S/R) loop of the large ribosomal RNA, thus arresting protein synthesis at the translocation step. In the present study, we employed three RIPs to dissect the antifungal activity of RIPs as plant defense proteins. We measured the catalytic activity of RAT (the catalytic A-chain of ricin from Ricinus communis L.), saporin-S6 (from Saponaria officinalis L.), and ME (RIP from Mirabilis expansa R&P) against intact ribosomal substrates isolated from various pathogenic fungi. We further determined the enzymatic specificity of these three RIPs against fungal ribosomes, from Rhizoctonia solani Kuhn, Alternaria solani Sorauer, Trichoderma reesei Simmons and Candida albicans Berkhout, and correlated the data with antifungal activity. RAT showed the strongest toxicity against all tested fungal ribosomes, except for the ribosomes isolated from C. albicans, which were most susceptible to saporin. RAT and saporin showed higher enzymatic activity than ME against ribosomes from all of the fungal species assayed, but did not show detectable antifungal activity. In contrast, ME showed substantial inhibitory activity against fungal growth. Using N-hydroxysuccinimide-fluorescein labeling of RIPs and fluorescence microscopy, we determined that ME was targeted to the surface of fungal cells and transferred into the cells. Thus, ME caused ribosome depurination and subsequent fungal mortality. In contrast, saporin did not interact with fungal cells, correlating with its lack of antifungal activity.
DNA replication stress restricts ribosomal DNA copy number
Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin
2017-01-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237
DNA replication stress restricts ribosomal DNA copy number.
Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L
2017-09-01
Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.
Ribosome binding induces repositioning of the signal recognition particle receptor on the translocon
Kuhn, Patrick; Draycheva, Albena; Vogt, Andreas; Petriman, Narcis-Adrian; Sturm, Lukas; Drepper, Friedel; Warscheid, Bettina; Wintermeyer, Wolfgang
2015-01-01
Cotranslational protein targeting delivers proteins to the bacterial cytoplasmic membrane or to the eukaryotic endoplasmic reticulum membrane. The signal recognition particle (SRP) binds to signal sequences emerging from the ribosomal tunnel and targets the ribosome-nascent-chain complex (RNC) to the SRP receptor, termed FtsY in bacteria. FtsY interacts with the fifth cytosolic loop of SecY in the SecYEG translocon, but the functional role of the interaction is unclear. By using photo-cross-linking and fluorescence resonance energy transfer measurements, we show that FtsY–SecY complex formation is guanosine triphosphate independent but requires a phospholipid environment. Binding of an SRP–RNC complex exposing a hydrophobic transmembrane segment induces a rearrangement of the SecY–FtsY complex, which allows the subsequent contact between SecY and ribosomal protein uL23. These results suggest that direct RNC transfer to the translocon is guided by the interaction between SRP and translocon-bound FtsY in a quaternary targeting complex. PMID:26459600
Machida, Kodai; Mikami, Satoshi; Masutani, Mamiko; Mishima, Kurumi; Kobayashi, Tominari; Imataka, Hiroaki
2014-01-01
The genomic RNA of encephalomyocarditis virus (EMCV) encodes a single polyprotein, and the primary scission of the polyprotein occurs between nonstructural proteins 2A and 2B by an unknown mechanism. To gain insight into the mechanism of 2A-2B processing, we first translated the 2A-2B region in vitro with eukaryotic and prokaryotic translation systems. The 2A-2B processing occurred only in the eukaryotic systems, not in the prokaryotic systems, and the unprocessed 2A-2B protein synthesized by a prokaryotic system remained uncleaved when incubated with a eukaryotic cell extract. These results suggest that 2A-2B processing is a eukaryote-specific, co-translational event. To define the translation factors required for 2A-2B processing, we constituted a protein synthesis system with eukaryotic elongation factors 1 and 2, eukaryotic release factors 1 and 3 (eRF1 and eRF3), aminoacyl-tRNA synthetases, tRNAs, ribosome subunits, and a plasmid template that included the hepatitis C virus internal ribosome entry site. We successfully reproduced 2A-2B processing in the reconstituted system even without eRFs. Our results indicate that this unusual event occurs in the elongation phase of translation. PMID:25258322
Patarca, R; Dorta, B; Ramirez, J L
1982-01-01
As part of a project pertaining the organization of ribosomal genes in Kinetoplastidae, we have created a data base for published sequences of ribosomal nucleic acids, with information in Spanish. As a first step in their processing, we have written a computer program which introduces the new feature of determining the length of the fragments produced after single or multiple digestion with any of the known restriction enzymes. With this information we have detected conserved SAU 3A sites: (i) at the 5' end of the 5.8S rRNA and at the 3' end of the small subunit rRNA, both included in similar larger sequences; (ii) in the 5.8S rRNA of vertebrates (a second one), which is not present in lower eukaryotes, showing a clear evolutive divergence; and, (iii) at the 5' terminal of the small subunit rRNA, included in a larger conserved sequence. The possible biological importance of these sequences is discussed. PMID:6278402
Identification of a Recently Active Mammalian SINE Derived from Ribosomal RNA
Longo, Mark S.; Brown, Judy D.; Zhang, Chu; O’Neill, Michael J.; O’Neill, Rachel J.
2015-01-01
Complex eukaryotic genomes are riddled with repeated sequences whose derivation does not coincide with phylogenetic history and thus is often unknown. Among such sequences, the capacity for transcriptional activity coupled with the adaptive use of reverse transcription can lead to a diverse group of genomic elements across taxa, otherwise known as selfish elements or mobile elements. Short interspersed nuclear elements (SINEs) are nonautonomous mobile elements found in eukaryotic genomes, typically derived from cellular RNAs such as tRNAs, 7SL or 5S rRNA. Here, we identify and characterize a previously unknown SINE derived from the 3′-end of the large ribosomal subunit (LSU or 28S rDNA) and transcribed via RNA polymerase III. This new element, SINE28, is represented in low-copy numbers in the human reference genome assembly, wherein we have identified 27 discrete loci. Phylogenetic analysis indicates these elements have been transpositionally active within primate lineages as recently as 6 MYA while modern humans still carry transcriptionally active copies. Moreover, we have identified SINE28s in all currently available assembled mammalian genome sequences. Phylogenetic comparisons indicate that these elements are frequently rederived from the highly conserved LSU rRNA sequences in a lineage-specific manner. We propose that this element has not been previously recognized as a SINE given its high identity to the canonical LSU, and that SINE28 likely represents one of possibly many unidentified, active transposable elements within mammalian genomes. PMID:25637222
Molecular cloning of low-temperature-inducible ribosomal proteins from soybean.
Kim, Kee-Young; Park, Seong-Whan; Chung, Young-Soo; Chung, Chung-Han; Kim, Jung-In; Lee, Jai-Heon
2004-05-01
Three ribosomal protein genes induced by low-temperature treatment were isolated from soybean. GmRPS13 (742 bp) encodes a 17.1 kDa protein which has 95% identity with the 40S ribosomal protein S13 of Panax ginseng (AB043974). GmRPS6 (925 bp) encodes a 28.1 kDa protein which has 94% identity with the 40S ribosomal protein S6 of Asparagus officinalis (AJ277533). GmRPL37 (494 bp) encodes a 10.7 kDa protein which has 85% identity with the 60S ribosomal protein L37 of Arabidopsis thaliana (AF370216). The expression of these ribosomal protein genes started to increase 3 d after low-temperature treatment, whereas the cold-stress protein src1 was highly induced from the first day. Such late response of these ribosomal protein genes may be due to secondary signals during cold adaptation. The induction of ribosomal protein genes might enhance the translation process or help proper ribosome functioning under low-temperature conditions.
A functional network involved in the recycling of nucleocytoplasmic pre-60S factors
Lebreton, Alice; Saveanu, Cosmin; Decourty, Laurence; Rain, Jean-Christophe; Jacquier, Alain; Fromont-Racine, Micheline
2006-01-01
Eukaryotic pre-ribosomes go through cytoplasmic maturation steps before entering translation. The nucleocytoplasmic proteins participating in these late stages of maturation are reimported to the nucleus. In this study, we describe a functional network focused on Rei1/Ybr267w, a strictly cytoplasmic pre-60S factor indirectly involved in nuclear 27S pre-ribosomal RNA processing. In the absence of Rei1, the nuclear import of at least three other pre-60S factors is impaired. The accumulation in the cytoplasm of a small complex formed by the association of Arx1 with a novel factor, Alb1/Yjl122w, inhibits the release of the putative antiassociation factor Tif6 from the premature large ribosomal subunits and its recycling to the nucleus. We propose a model in which Rei1 is a key factor for the coordinated dissociation and recycling of the last pre-60S factors before newly synthesized large ribosomal subunits enter translation. PMID:16651379
Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth A.; Contreras, Nataly; Hertz, Marla I.; Olivares, Eduardo; Cáceres, C. Joaquín; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R.; López-Lastra, Marcelo
2016-01-01
The 5′leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work we examine the internal ribosome entry site (IRES) located in the 5′leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5′leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. PMID:27191820
Ribosomal targets for antibiotic drug discovery
Blanchard, Scott C.; Feldman, Michael Brian; Wang, Leyi; Doudna Cate, James H.; Pulk, Arto; Altman, Roger B.; Wasserman, Michael R
2016-09-13
The present invention relates to methods to identify molecules that binds in the neomycin binding pocket of a bacterial ribosome using structures of an intact bacterial ribosome that reveal how the ribosome binds tRNA in two functionally distinct states, determined by x-ray crystallography. One state positions tRNA in the peptidyl-tRNA binding site. The second, a fully rotated state, is stabilized by ribosome recycling factor (RRF) and binds tRNA in a highly bent conformation in a hybrid peptidyl/exit (P/E) site. Additionally, the invention relates to various assays, including single-molecule assay for ribosome recycling, and methods to identify compounds that interfere with ribosomal function by detecting newly identified intermediate FRET states using known and novel FRET pairs on the ribosome. The invention also provides vectors and compositions with an N-terminally tagged S13 protein.
Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.
Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca
2017-11-23
DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya
2007-11-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less
Arenz, Stefan; Graf, Michael; Nguyen, Fabian; Huter, Paul; Polikanov, Yury S.; Blanchard, Scott C.; Wilson, Daniel N.
2016-01-01
The ribosome is one of the major targets for therapeutic antibiotics; however, the rise in multidrug resistance is a growing threat to the utility of our current arsenal. The orthosomycin antibiotics evernimicin (EVN) and avilamycin (AVI) target the ribosome and do not display cross-resistance with any other classes of antibiotics, suggesting that they bind to a unique site on the ribosome and may therefore represent an avenue for development of new antimicrobial agents. Here we present cryo-EM structures of EVN and AVI in complex with the Escherichia coli ribosome at 3.6- to 3.9-Å resolution. The structures reveal that EVN and AVI bind to a single site on the large subunit that is distinct from other known antibiotic binding sites on the ribosome. Both antibiotics adopt an extended conformation spanning the minor grooves of helices 89 and 91 of the 23S rRNA and interacting with arginine residues of ribosomal protein L16. This binding site overlaps with the elbow region of A-site bound tRNA. Consistent with this finding, single-molecule FRET (smFRET) experiments show that both antibiotics interfere with late steps in the accommodation process, wherein aminoacyl-tRNA enters the peptidyltransferase center of the large ribosomal subunit. These data provide a structural and mechanistic rationale for how these antibiotics inhibit the elongation phase of protein synthesis. PMID:27330110
Mallik, Saurav; Kundu, Sudip
2013-01-01
Here we compare the structural and evolutionary attributes of Thermus thermophilus and Escherichia coli small ribosomal subunits (SSU). Our results indicate that with few exceptions, thermophilic 16S ribosomal RNA (16S rRNA) is densely packed compared to that of mesophilic at most of the analogous spatial regions. In addition, we have located species-specific cavity clusters (SSCCs) in both species. E. coli SSCCs are numerous and larger compared to T. thermophilus SSCCs, which again indicates densely packed thermophilic 16S rRNA. Thermophilic ribosomal proteins (r-proteins) have longer disordered regions than their mesophilic homologs and they experience larger disorder-to-order transitions during SSU-assembly. This is reflected in the predicted higher conformational changes of thermophilic r-proteins compared to their mesophilic homologs during SSU-assembly. This high conformational change of thermophilic r-proteins may help them to associate with the 16S ribosomal RNA with high complementary interfaces, larger interface areas, and denser molecular contacts, compared to those of mesophilic. Thus, thermophilic protein-rRNA interfaces are tightly associated with 16S rRNA than their mesophilic homologs. Densely packed 16S rRNA interior and tight protein-rRNA binding of T. thermophilus (compared to those of E. coli) are likely the signatures of its thermal adaptation. We have found a linear correlation between the free energy of protein-RNA interface formation, interface size, and square of conformational changes, which is followed in both prokaryotic and eukaryotic SSU. Disorder is associated with high protein-RNA interface polarity. We have found an evolutionary tendency to maintain high polarity (thereby disorder) at protein-rRNA interfaces, than that at rest of the protein structures. However, some proteins exhibit exceptions to this general trend. PMID:23940533
Comprehensive Occupational Data Analysis Programs 80 (CODAP80) User’s Manual.
1984-01-01
8217 -____ ____ ___ - -- -- -~--- - PA"m: 84/006a 5, -(,0 i 4. TH IkdmS. lbne ISCOMlPREHENS IVE OCCUPATIONAL DATA ANALYSIS PROGRAMS 80 (CODAP80) JAUARY 1984 User s Manua 7. Auw...AD-A144 125 COMPEHIENSIVE OCCUPATIONAL DATA ANALYSIS PROGRAMS 80 ’i (CODAP8OI USES MANUAtfUD NAVY OCCUPATIONAL DEVELOPMENT AND ANALYSIS CENTER...e COMPREVENSIVE OCCUPATIONAL DATA ANALYSIS PROGRAMS 80 (CODAP80) JANUARY 1984Uer s Manual 7. Author(s) L. pt, t wis ONapetion ft.p No. N/A 9
Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian
2016-01-01
Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast.
Palm, Denise; Simm, Stefan; Darm, Katrin; Weis, Benjamin L.; Ruprecht, Maike; Schleiff, Enrico; Scharf, Christian
2016-01-01
ABSTRACT Ribosome biogenesis is an essential process initiated in the nucleolus. In eukaryotes, multiple ribosome biogenesis factors (RBFs) can be found in the nucleolus, the nucleus and in the cytoplasm. They act in processing, folding and modification of the pre-ribosomal (r)RNAs, incorporation of ribosomal proteins (RPs), export of pre-ribosomal particles to the cytoplasm, and quality control mechanisms. Ribosome biogenesis is best established for Saccharomyces cerevisiae. Plant ortholog assignment to yeast RBFs revealed the absence of about 30% of the yeast RBFs in plants. In turn, few plant specific proteins have been identified by biochemical experiments to act in plant ribosome biogenesis. Nevertheless, a complete inventory of plant RBFs has not been established yet. We analyzed the proteome of the nucleus and nucleolus of Arabidopsis thaliana and the post-translational modifications of these proteins. We identified 1602 proteins in the nucleolar and 2544 proteins in the nuclear fraction with an overlap of 1429 proteins. For a randomly selected set of proteins identified by the proteomic approach we confirmed the localization inferred from the proteomics data by the localization of GFP fusion proteins. We assigned the identified proteins to various complexes and functions and found about 519 plant proteins that have a potential to act as a RBFs, but which have not been experimentally characterized yet. Last, we compared the distribution of RBFs and RPs in the various fractions with the distribution established for yeast. PMID:26980300
Compilation of small ribosomal subunit RNA structures.
Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R
1993-01-01
The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525
Sashital, Dipali G; Greeman, Candacia A; Lyumkis, Dmitry; Potter, Clinton S; Carragher, Bridget; Williamson, James R
2014-01-01
Ribosome assembly is a complex process involving the folding and processing of ribosomal RNAs (rRNAs), concomitant binding of ribosomal proteins (r-proteins), and participation of numerous accessory cofactors. Here, we use a quantitative mass spectrometry/electron microscopy hybrid approach to determine the r-protein composition and conformation of 30S ribosome assembly intermediates in Escherichia coli. The relative timing of assembly of the 3′ domain and the formation of the central pseudoknot (PK) structure depends on the presence of the assembly factor RimP. The central PK is unstable in the absence of RimP, resulting in the accumulation of intermediates in which the 3′-domain is unanchored and the 5′-domain is depleted for r-proteins S5 and S12 that contact the central PK. Our results reveal the importance of the cofactor RimP in central PK formation, and introduce a broadly applicable method for characterizing macromolecular assembly in cells. DOI: http://dx.doi.org/10.7554/eLife.04491.001 PMID:25313868
5S rRNA gene arrangements in protists: a case of nonadaptive evolution.
Drouin, Guy; Tsang, Corey
2012-06-01
Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.
Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio
2016-04-15
We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.
How many novel eukaryotic 'kingdoms'? Pitfalls and limitations of environmental DNA surveys
Berney, Cédric; Fahrni, José; Pawlowski, Jan
2004-01-01
Background Over the past few years, the use of molecular techniques to detect cultivation-independent, eukaryotic diversity has proven to be a powerful approach. Based on small-subunit ribosomal RNA (SSU rRNA) gene analyses, these studies have revealed the existence of an unexpected variety of new phylotypes. Some of them represent novel diversity in known eukaryotic groups, mainly stramenopiles and alveolates. Others do not seem to be related to any molecularly described lineage, and have been proposed to represent novel eukaryotic kingdoms. In order to review the evolutionary importance of this novel high-level eukaryotic diversity critically, and to test the potential technical and analytical pitfalls and limitations of eukaryotic environmental DNA surveys (EES), we analysed 484 environmental SSU rRNA gene sequences, including 81 new sequences from sediments of the small river, the Seymaz (Geneva, Switzerland). Results Based on a detailed screening of an exhaustive alignment of eukaryotic SSU rRNA gene sequences and the phylogenetic re-analysis of previously published environmental sequences using Bayesian methods, our results suggest that the number of novel higher-level taxa revealed by previously published EES was overestimated. Three main sources of errors are responsible for this situation: (1) the presence of undetected chimeric sequences; (2) the misplacement of several fast-evolving sequences; and (3) the incomplete sampling of described, but yet unsequenced eukaryotes. Additionally, EES give a biased view of the diversity present in a given biotope because of the difficult amplification of SSU rRNA genes in some taxonomic groups. Conclusions Environmental DNA surveys undoubtedly contribute to reveal many novel eukaryotic lineages, but there is no clear evidence for a spectacular increase of the diversity at the kingdom level. After re-analysis of previously published data, we found only five candidate lineages of possible novel high-level eukaryotic
ERIC Educational Resources Information Center
Pirbhoy, Patricia Salgado; Farris, Shannon; Steward, Oswald
2016-01-01
Previous studies have shown that induction of long-term potentiation (LTP) induces phosphorylation of ribosomal protein S6 (rpS6) in postsynaptic neurons, but the functional significance of rpS6 phosphorylation is poorly understood. Here, we show that synaptic stimulation that induces perforant path LTP triggers phosphorylation of rpS6 (p-rpS6)…
Carvajal, Felipe; Vallejos, Maricarmen; Walters, Beth; Contreras, Nataly; Hertz, Marla I; Olivares, Eduardo; Cáceres, Carlos J; Pino, Karla; Letelier, Alejandro; Thompson, Sunnie R; López-Lastra, Marcelo
2016-07-01
The 5' leader of the HIV-1 genomic RNA is a multifunctional region that folds into secondary/tertiary structures that regulate multiple processes during viral replication including translation initiation. In this work, we examine the internal ribosome entry site (IRES) located in the 5' leader that drives translation initiation of the viral Gag protein under conditions that hinder cap-dependent translation initiation. We show that activity of the HIV-1 IRES relies on ribosomal protein S25 (eS25). Additionally, a mechanistic and mutational analysis revealed that the HIV-1 IRES is modular in nature and that once the 40S ribosomal subunit is recruited to the IRES, translation initiates without the need of ribosome scanning. These findings elucidate a mechanism of initiation by the HIV-1 IRES whereby a number of highly structured sites present within the HIV-1 5' leader leads to the recruitment of the 40S subunit directly at the site of initiation of protein synthesis. © 2016 Federation of European Biochemical Societies.
3-D Ultrastructure of O. tauri: Electron Cryotomography of an Entire Eukaryotic Cell
Henderson, Gregory P.; Gan, Lu; Jensen, Grant J.
2007-01-01
The hallmark of eukaryotic cells is their segregation of key biological functions into discrete, membrane-bound organelles. Creating accurate models of their ultrastructural complexity has been difficult in part because of the limited resolution of light microscopy and the artifact-prone nature of conventional electron microscopy. Here we explored the potential of the emerging technology electron cryotomography to produce three-dimensional images of an entire eukaryotic cell in a near-native state. Ostreococcus tauri was chosen as the specimen because as a unicellular picoplankton with just one copy of each organelle, it is the smallest known eukaryote and was therefore likely to yield the highest resolution images. Whole cells were imaged at various stages of the cell cycle, yielding 3-D reconstructions of complete chloroplasts, mitochondria, endoplasmic reticula, Golgi bodies, peroxisomes, microtubules, and putative ribosome distributions in-situ. Surprisingly, the nucleus was seen to open long before mitosis, and while one microtubule (or two in some predivisional cells) was consistently present, no mitotic spindle was ever observed, prompting speculation that a single microtubule might be sufficient to segregate multiple chromosomes. PMID:17710148
Revealing Nature’s Synthetic Potential Through the Study of Ribosomal Natural Product Biosynthesis
Dunbar, Kyle L.; Mitchell, Douglas A.
2013-01-01
Ribosomally synthesized posttranslationally modified peptides (RiPPs) are a rapidly growing class of natural products with diverse structures and activities. In recent years, a great deal of progress has been made in elucidating the biosynthesis of various RiPP family members. As with the study of nonribosomal peptide and polyketide biosynthetic enzymes, these investigations have led to the discovery of entirely new biological chemistry. With each unique enzyme investigated, a more complex picture of Nature’s synthetic potential is revealed. This review focuses on recent reports (since 2008) that have changed the way that we think about ribosomal natural product biosynthesis and the enzymology of complex bond-forming reactions. PMID:23286465
Heilek, G M; Noller, H F
1996-01-01
Directed hydroxyl radical probing was used to probe the rRNA neighborhood around protein S13 in the 30S ribosomal subunit. The unique cysteine at position 84 of S13 served as a tethering site for attachment of Fe(II)-1-(p-bromoacetamidobenzyl)-EDTA. Derivatized S13 (Fe-C84-S13) was then assembled into 30S ribosomal subunits by in vitro reconstitution with 16S rRNA and a mixture of the remaining 30S subunit proteins. Hydroxyl radicals generated from the tethered Fe(II) resulted in cleavage of the RNA backbone in two localized regions of the 3' major domain of 16S rRNA. One region spans nt 1308-1333 and is close to a site previously crosslinked to S13. A second set of cleavages is found in the 950/1230 helix. Both regions have been implicated in binding of S13 by previous chemical footprinting studies using base-specific chemical probes and solution-based hydroxyl radical probing. These results place both regions of 16S rRNA in proximity to position C84 of S13 in the three-dimensional structure of the 30S ribosomal subunit. PMID:8718688
Targeting ricin to the ribosome.
May, Kerrie L; Yan, Qing; Tumer, Nilgun E
2013-07-01
The plant toxin ricin is highly toxic for mammalian cells and is of concern for bioterrorism. Ricin belongs to a family of functionally related toxins, collectively referred to as ribosome inactivating proteins (RIPs), which disable ribosomes and halt protein synthesis. Currently there are no specific antidotes against ricin or related RIPs. The catalytic subunit of ricin is an N-glycosidase that depurinates a universally conserved adenine residue within the sarcin/ricin loop (SRL) of the 28S rRNA. This depurination activity inhibits translation and its biochemistry has been intensively studied. Yet, recent developments paint a more complex picture of toxicity, with ribosomal proteins and cellular signaling pathways contributing to the potency of ricin. In particular, several studies have now established the importance of the ribosomal stalk structure in facilitating the depurination activity and ribosome specificity of ricin and other RIPs. This review highlights recent developments defining toxin-ribosome interactions and examines the significance of these interactions for toxicity and therapeutic intervention. Copyright © 2013 Elsevier Ltd. All rights reserved.
Mallik, Saurav; Basu, Sudipto; Hait, Suman; Kundu, Sudip
2018-04-21
Do coding and regulatory segments of a gene co-evolve with each-other? Seeking answers to this question, here we analyze the case of Escherichia coli ribosomal protein S15, that represses its own translation by specifically binding its messenger RNA (rpsO mRNA) and stabilizing a pseudoknot structure at the upstream untranslated region, thus trapping the ribosome into an incomplete translation initiation complex. In the absence of S15, ribosomal protein S1 recognizes rpsO and promotes translation by melting this very pseudoknot. We employ a robust statistical method to detect signatures of positive epistasis between residue site pairs and find that biophysical constraints of translational regulation (S15-rpsO and S1-rpsO recognition, S15-mediated rpsO structural rearrangement, and S1-mediated melting) are strong predictors of positive epistasis. Transforming the epistatic pairs into a network, we find that signatures of two different, but interconnected regulatory cascades are imprinted in the sequence-space and can be captured in terms of two dense network modules that are sparsely connected to each other. This network topology further reflects a general principle of how functionally coupled components of biological networks are interconnected. These results depict a model case, where translational regulation drives characteristic residue-level epistasis-not only between a protein and its own mRNA but also between a protein and the mRNA of an entirely different protein. © 2018 Wiley Periodicals, Inc.
Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M
2014-08-01
5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.
Molecular events regulating messenger RNA stability in eukaryotes.
Saini, K S; Summerhayes, I C; Thomas, P
1990-07-17
The regulation of mRNA turnover plays a major role in the overall control of gene expression. Transcriptional control of eukaryotic gene regulation by external and/or internal stimuli has received considerable attention and the purpose of this review is to highlight recent work elucidating the mechanisms underlying the steady-state levels of mRNAs in the cytoplasm. Protection of mRNA from the action of nucleases as it passes from the nucleus to the ribosomes for translation is achieved, at least in part, by its union with mRNA binding proteins and the presence of poly(A) tail. The half-life of a message represents a balance between the transcriptional activity and intracellular degradative processes. These properties can be modulated by the presence of specific nucleotide sequences in a mRNA along with cis- and trans-acting elements and accompanied by post-translational feed back mechanisms. Presently, various regulatory mechanisms involved in the mRNA decay process are ill-defined. The work described here illustrates the complexity of this emerging field of study and outlines its contribution to our understanding of gene regulation in eukaryotes.
Viral factor TAV recruits TOR/S6K1 signalling to activate reinitiation after long ORF translation
Schepetilnikov, Mikhail; Kobayashi, Kappei; Geldreich, Angèle; Caranta, Carole; Robaglia, Christophe; Keller, Mario; Ryabova, Lyubov A
2011-01-01
The protein kinase TOR (target-of-rapamycin) upregulates translation initiation in eukaryotes, but initiation restart after long ORF translation is restricted by largely unknown pathways. The plant viral reinitiation factor transactivator–viroplasmin (TAV) exceptionally promotes reinitiation through a mechanism involving retention on 80S and reuse of eIF3 and the host factor reinitiation-supporting protein (RISP) to regenerate reinitiation-competent ribosomal complexes. Here, we show that TAV function in reinitiation depends on physical association with TOR, with TAV–TOR binding being critical for both translation reinitiation and viral fitness. Consistently, TOR-deficient plants are resistant to viral infection. TAV triggers TOR hyperactivation and S6K1 phosphorylation in planta. When activated, TOR binds polyribosomes concomitantly with polysomal accumulation of eIF3 and RISP—a novel and specific target of TOR/S6K1—in a TAV-dependent manner, with RISP being phosphorylated. TAV mutants defective in TOR binding fail to recruit TOR, thereby abolishing RISP phosphorylation in polysomes and reinitiation. Thus, activation of reinitiation after long ORF translation is more complex than previously appreciated, with TOR/S6K1 upregulation being the key event in the formation of reinitiation-competent ribosomal complexes. PMID:21343906
Root-Bernstein, Robert; Root-Bernstein, Meredith
2016-05-21
We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their
The CRM domain: an RNA binding module derived from an ancient ribosome-associated protein.
Barkan, Alice; Klipcan, Larik; Ostersetzer, Oren; Kawamura, Tetsuya; Asakura, Yukari; Watkins, Kenneth P
2007-01-01
The CRS1-YhbY domain (also called the CRM domain) is represented as a stand-alone protein in Archaea and Bacteria, and in a family of single- and multidomain proteins in plants. The function of this domain is unknown, but structural data and the presence of the domain in several proteins known to interact with RNA have led to the proposal that it binds RNA. Here we describe a phylogenetic analysis of the domain, its incorporation into diverse proteins in plants, and biochemical properties of a prokaryotic and eukaryotic representative of the domain family. We show that a bacterial member of the family, Escherichia coli YhbY, is associated with pre-50S ribosomal subunits, suggesting that YhbY functions in ribosome assembly. GFP fused to a single-domain CRM protein from maize localizes to the nucleolus, suggesting that an analogous activity may have been retained in plants. We show further that an isolated maize CRM domain has RNA binding activity in vitro, and that a small motif shared with KH RNA binding domains, a conserved "GxxG" loop, contributes to its RNA binding activity. These and other results suggest that the CRM domain evolved in the context of ribosome function prior to the divergence of Archaea and Bacteria, that this function has been maintained in extant prokaryotes, and that the domain was recruited to serve as an RNA binding module during the evolution of plant genomes.
Effects of detergents on ribosomal precursor subunits of Bacillus megaterium.
Body, A; Brownstein, B H
1978-01-01
Cell extracts prepared by osmotic lysis of protoplasts were analyzed by sucrose gradient sedimentation. In the absence of detergents, ribosomal precursor particles were found in a gradient fraction which sedimented faster than mature 50S subunits and in two other fractions coincident with mature 50S and 30S ribosomal subunits. Phospholipid, an indicator of membrane, was shown to be associated with only the fastest-sedimenting ribosomal precursor particle fraction. After the extracts were treated with detergents, all phospholipid was found at the top of the gradients. Brij 58, Triton X-100, and Nonidet P-40 did not cause a change in the sedimentation values of precursors; however, the detergents deoxycholate or LOC (Amway Corp.) disrupted the fastest-sedimenting precursor and converted the ribosomal precursor subunits which sedimented at the 50S and 30S positions to five different classes of more slowly sedimenting particles. Earlier reports on the in vivo assembly of ribosomal subunits have shown that several stages of ribosomal precursor subunits exist, and, in the presence of the detergents deoxycholate and LOC, which had been used to prepare cell extracts, the precursors sedimented more slowly. Our data are consistent with the hypothesis that those detergents selectively modify the structure of ribosomal precursors and lend further support to the hypothesis that the in vivo ribosomal precursor subunits have 50S and 30S sedimentation values. In addition, these data support the idea that the ribosomal precursor particles found in the fast-sedimenting fraction may constitute a unique precursor fraction.
Effects of Detergents on Ribosomal Precursor Subunits of Bacillus megaterium
Body, Barbara A.; Brownstein, Bernard H.
1978-01-01
Cell extracts prepared by osmotic lysis of protoplasts were analyzed by sucrose gradient sedimentation. In the absence of detergents, ribosomal precursor particles were found in a gradient fraction which sedimented faster than mature 50S subunits and in two other fractions coincident with mature 50S and 30S ribosomal subunits. Phospholipid, an indicator of membrane, was shown to be associated with only the fastest-sedimenting ribosomal precursor particle fraction. After the extracts were treated with detergents, all phospholipid was found at the top of the gradients. Brij 58, Triton X-100, and Nonidet P-40 did not cause a change in the sedimentation values of precursors; however, the detergents deoxycholate or LOC (Amway Corp.) disrupted the fastest-sedimenting precursor and converted the ribosomal precursor subunits which sedimented at the 50S and 30S positions to five different classes of more slowly sedimenting particles. Earlier reports on the in vivo assembly of ribosomal subunits have shown that several stages of ribosomal precursor subunits exist, and, in the presence of the detergents deoxycholate and LOC, which had been used to prepare cell extracts, the precursors sedimented more slowly. Our data are consistent with the hypothesis that those detergents selectively modify the structure of ribosomal precursors and lend further support to the hypothesis that the in vivo ribosomal precursor subunits have 50S and 30S sedimentation values. In addition, these data support the idea that the ribosomal precursor particles found in the fast-sedimenting fraction may constitute a unique precursor fraction. PMID:412833
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stanley, R.; Blaha, G; Grodzicki, R
2010-01-01
Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stanley, Robin E.; Blaha, Gregor; Grodzicki, Robert L.
2010-05-03
Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan; Polacek, Norbert
2017-06-20
The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson-Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Netterling, Sakura; Vaitkevicius, Karolis; Nord, Stefan; Johansson, Jörgen
2012-08-01
Listeria monocytogenes, a Gram-positive food-borne human pathogen, is able to grow at temperatures close to 0°C and is thus of great concern for the food industry. In this work, we investigated the physiological role of one DExD-box RNA helicase in Listeria monocytogenes. The RNA helicase Lmo1722 was required for optimal growth at low temperatures, whereas it was dispensable at 37°C. A Δlmo1722 strain was less motile due to downregulation of the major subunit of the flagellum, FlaA, caused by decreased flaA expression. By ribosomal fractionation experiments, it was observed that Lmo1722 was mainly associated with the 50S subunit of the ribosome. Absence of Lmo1722 decreased the fraction of 50S ribosomal subunits and mature 70S ribosomes and affected the processing of the 23S precursor rRNA. The ribosomal profile could be restored to wild-type levels in a Δlmo1722 strain expressing Lmo1722. Interestingly, the C-terminal part of Lmo1722 was redundant for low-temperature growth, motility, 23S rRNA processing, and appropriate ribosomal maturation. However, Lmo1722 lacking the C terminus showed a reduced affinity for the 50S and 70S fractions, suggesting that the C terminus is important for proper guidance of Lmo1722 to the 50S subunit. Taken together, our results show that the Listeria RNA helicase Lmo1722 is essential for growth at low temperatures, motility, and rRNA processing and is important for ribosomal maturation, being associated mainly with the 50S subunit of the ribosome.
NASA Astrophysics Data System (ADS)
Lee, Sang-Rae; Song, Eun Hye; Lee, Tongsup
2018-03-01
Organisms entering the East Sea (Sea of Japan) through the Korea Strait, together with water, salt, and energy, affect the East Sea ecosystem. In this study, we report on the biodiversity of eukaryotic plankton found in the Western Channel of the Korea Strait for the first time using small subunit ribosomal RNA gene (18S rDNA) sequences. We also discuss the characteristics of water masses and their physicochemical factors. Diverse taxonomic groups were recovered from 18S rDNA clone libraries, including putative novel, higher taxonomic entities affiliated with Cercozoa, Raphidophyceae, Picozoa, and novel marine Stramenopiles. We also found that there was cryptic genetic variation at both the intraspecific and interspecific levels among arthropods, diatoms, and green algae. Specific plankton assemblages were identified at different sampling depths and they may provide useful information that could be used to interpret the origin and the subsequent mixing history of the water masses that contribute to the Tsushima Warm Current waters. Furthermore, the biological information highlighted in this study may help improve our understanding about the complex water mass interactions that were highlighted in the Korea Strait.
Variant ribosomal RNA alleles are conserved and exhibit tissue-specific expression
Parks, Matthew M.; Kurylo, Chad M.; Dass, Randall A.; Bojmar, Linda; Lyden, David; Vincent, C. Theresa; Blanchard, Scott C.
2018-01-01
The ribosome, the integration point for protein synthesis in the cell, is conventionally considered a homogeneous molecular assembly that only passively contributes to gene expression. Yet, epigenetic features of the ribosomal DNA (rDNA) operon and changes in the ribosome’s molecular composition have been associated with disease phenotypes, suggesting that the ribosome itself may possess inherent regulatory capacity. Analyzing whole-genome sequencing data from the 1000 Genomes Project and the Mouse Genomes Project, we find that rDNA copy number varies widely across individuals, and we identify pervasive intra- and interindividual nucleotide variation in the 5S, 5.8S, 18S, and 28S ribosomal RNA (rRNA) genes of both human and mouse. Conserved rRNA sequence heterogeneities map to functional centers of the assembled ribosome, variant rRNA alleles exhibit tissue-specific expression, and ribosomes bearing variant rRNA alleles are present in the actively translating ribosome pool. These findings provide a critical framework for exploring the possibility that the expression of genomically encoded variant rRNA alleles gives rise to physically and functionally heterogeneous ribosomes that contribute to mammalian physiology and human disease. PMID:29503865
Jaako, P; Ugale, A; Wahlestedt, M; Velasco-Hernandez, T; Cammenga, J; Lindström, M S; Bryder, D
2017-01-01
Mutations resulting in constitutive activation of signaling pathways that regulate ribosome biogenesis are among the most common genetic events in acute myeloid leukemia (AML). However, whether ribosome biogenesis presents as a therapeutic target to treat AML remains unexplored. Perturbations in ribosome biogenesis trigger the 5S ribonucleoprotein particle (RNP)-Mdm2-p53 ribosomal stress pathway, and induction of this pathway has been shown to have therapeutic efficacy in Myc-driven lymphoma. In the current study we address the physiological and therapeutic role of the 5S RNP-Mdm2-p53 pathway in AML. By utilizing mice that have defective ribosome biogenesis due to downregulation of ribosomal protein S19 (Rps19), we demonstrate that induction of the 5S RNP-Mdm2-p53 pathway significantly delays the initiation of AML. However, even a severe Rps19 deficiency that normally results in acute bone marrow failure has no consistent efficacy on already established disease. Finally, by using mice that harbor a mutation in the Mdm2 gene disrupting its binding to 5S RNP, we show that loss of the 5S RNP-Mdm2-p53 pathway is dispensable for development of AML. Our study suggests that induction of the 5S RNP-Mdm2-p53 ribosomal stress pathway holds limited potential as a single-agent therapy in the treatment of AML.
Galián, J A; Rosato, M; Rosselló, J A
2012-06-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.
Metabarcoding analysis of eukaryotic microbiota in the gut of HIV-infected patients.
Hamad, Ibrahim; Abou Abdallah, Rita; Ravaux, Isabelle; Mokhtari, Saadia; Tissot-Dupont, Hervé; Michelle, Caroline; Stein, Andreas; Lagier, Jean-Christophe; Raoult, Didier; Bittar, Fadi
2018-01-01
Research on the relationship between changes in the gut microbiota and human disease, including AIDS, is a growing field. However, studies on the eukaryotic component of the intestinal microbiota have just begun and have not yet been conducted in HIV-infected patients. Moreover, eukaryotic community profiling is influenced by the use of different methodologies at each step of culture-independent techniques. Herein, initially, four DNA extraction protocols were compared to test the efficiency of each method in recovering eukaryotic DNA from fecal samples. Our results revealed that recovering eukaryotic components from fecal samples differs significantly among DNA extraction methods. Subsequently, the composition of the intestinal eukaryotic microbiota was evaluated in HIV-infected patients and healthy volunteers through clone sequencing, high-throughput sequencing of nuclear ribosomal internal transcribed spacers 1 (ITS1) and 2 (ITS2) amplicons and real-time PCRs. Our results revealed that not only richness (Chao-1 index) and alpha diversity (Shannon diversity) differ between HIV-infected patients and healthy volunteers, depending on the molecular strategy used, but also the global eukaryotic community composition, with little overlapping taxa found between techniques. Moreover, our results based on cloning libraries and ITS1/ITS2 metabarcoding sequencing showed significant differences in fungal composition between HIV-infected patients and healthy volunteers, but without distinct clusters separating the two groups. Malassezia restricta was significantly more prevalent in fecal samples of HIV-infected patients, according to cloning libraries, whereas operational taxonomic units (OTUs) belonging to Candida albicans and Candida tropicalis were significantly more abundant in fecal samples of HIV-infected patients compared to healthy subjects in both ITS subregions. Finally, real-time PCR showed the presence of Microsporidia, Giardia lamblia, Blastocystis and
Ribosomal DNA Organization Before and After Magnification in Drosophila melanogaster
Bianciardi, Alessio; Boschi, Manuela; Swanson, Ellen E.; Belloni, Massimo; Robbins, Leonard G.
2012-01-01
In all eukaryotes, the ribosomal RNA genes are stably inherited redundant elements. In Drosophila melanogaster, the presence of a Ybb− chromosome in males, or the maternal presence of the Ribosomal exchange (Rex) element, induces magnification: a heritable increase of rDNA copy number. To date, several alternative classes of mechanisms have been proposed for magnification: in situ replication or extra-chromosomal replication, either of which might act on short or extended strings of rDNA units, or unequal sister chromatid exchange. To eliminate some of these hypotheses, none of which has been clearly proven, we examined molecular-variant composition and compared genetic maps of the rDNA in the bb2 mutant and in some magnified bb+ alleles. The genetic markers used are molecular-length variants of IGS sequences and of R1 and R2 mobile elements present in many 28S sequences. Direct comparison of PCR products does not reveal any particularly intensified electrophoretic bands in magnified alleles compared to the nonmagnified bb2 allele. Hence, the increase of rDNA copy number is diluted among multiple variants. We can therefore reject mechanisms of magnification based on multiple rounds of replication of short strings. Moreover, we find no changes of marker order when pre- and postmagnification maps are compared. Thus, we can further restrict the possible mechanisms to two: replication in situ of an extended string of rDNA units or unequal exchange between sister chromatids. PMID:22505623
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lipson, Rebecca S.; Webb, Kristofor J.; Clarke, Steven G., E-mail: clarke@mbi.ucla.edu
2010-01-22
Rps2/rpS2 is a well conserved protein of the eukaryotic ribosomal small subunit. Rps2 has previously been shown to contain asymmetric dimethylarginine residues, the addition of which is catalyzed by zinc-finger-containing arginine methyltransferase 3 (Rmt3) in the fission yeast Schizosaccharomyces pombe and protein arginine methyltransferase 3 (PRMT3) in mammalian cells. Here, we demonstrate that despite the lack of a zinc-finger-containing homolog of Rmt3/PRMT3 in the budding yeast Saccharomyces cerevisiae, Rps2 is partially modified to generate asymmetric dimethylarginine and monomethylarginine residues. We find that this modification of Rps2 is dependent upon the major arginine methyltransferase 1 (Rmt1) in S. cerevisiae. These resultsmore » are suggestive of a role for Rmt1 in modifying the function of Rps2 in a manner distinct from that occurring in S. pombe and mammalian cells.« less
Ribosomal protein S6 kinase 1 signaling regulates mammalian lifespan
Selman, Colin; Tullet, Jennifer M.A.; Wieser, Daniela; Irvine, Elaine; Lingard, Steven J.; Choudhury, Agharul I.; Claret, Marc; Al-Qassab, Hind; Carmignac, Danielle; Ramadani, Faruk; Woods, Angela; Robinson, Iain C.A.; Schuster, Eugene; Batterham, Rachel L.; Kozma, Sara C.; Thomas, George; Carling, David; Okkenhaug, Klaus; Thornton, Janet M.; Partridge, Linda; Gems, David; Withers, Dominic J.
2016-01-01
Caloric restriction (CR) protects against aging and disease but the mechanisms by which this affects mammalian lifespan are unclear. We show in mice that deletion of the nutrient-responsive mTOR (mammalian target of rapamycin) signaling pathway component ribosomal S6 protein kinase 1 (S6K1) led to increased lifespan and resistance to age-related pathologies such as bone, immune and motor dysfunction and loss of insulin sensitivity. Deletion of S6K1 induced gene expression patterns similar to those seen in CR or with pharmacological activation of adenosine monophosphate (AMP)-activated protein kinase (AMPK), a conserved regulator of the metabolic response to CR. Our results demonstrate that S6K1 influences healthy mammalian lifespan, and suggest therapeutic manipulation of S6K1 and AMPK might mimic CR and provide broad protection against diseases of aging. PMID:19797661
A computer model for the 30S ribosome subunit.
Kuntz, I D; Crippen, G M
1980-01-01
We describe a computer-generated model for the locations of the 21 proteins of the 30S subunit of the E. coli ribosome. The model uses a new method of incorporating experimental measurements based on a mathematical technique called distance geometry. In this paper, we use data from two sources: immunoelectron microscopy and neutron-scattering studies. The data are generally self-consistent and lead to a set of relatively well-defined structures in which individual protein coordinates differ by approximately 20 A from one structure to another. Two important features of this calculation are the use of extended proteins rather than just the centers of mass, and the ability to confine the protein locations within an arbitrary boundary surface so that only solutions with an approximate 30S "shape" are permitted. PMID:7020786
Neutron Scattering and the 30 S Ribosomal Subunit of E. Coli
DOE R&D Accomplishments Database
Moore, P. B.; Engelman, D. M.; Langer, J. A.; Ramakrishnan, V. R.; Schindler, D. G.; Schoenborn, B. P.; Sillers, I. Y.; Yabuki, S.
1982-06-01
This paper reviews the progress made in the study of the internal organization of the 30 S ribosomal subunit of E. coli by neutron scattering since 1975. A map of that particle showing the position of 14 of the subunit's 21 proteins is presented, and the methods currently used for collecting and analyzing such data are discussed. Also discussed is the possibility of extending the interpretation of neutron mapping data beyond the limits practical today.
Ahmed, Tofayel; Shi, Jian
2017-01-01
Abstract Chloroplastic translation is mediated by a bacterial-type 70S chloroplast ribosome. During the evolution, chloroplast ribosomes have acquired five plastid-specific ribosomal proteins or PSRPs (cS22, cS23, bTHXc, cL37 and cL38) which have been suggested to play important regulatory roles in translation. However, their exact locations on the chloroplast ribosome remain elusive due to lack of a high-resolution structure, hindering our progress to understand their possible roles. Here we present a cryo-EM structure of the 70S chloroplast ribosome from spinach resolved to 3.4 Å and focus our discussion mainly on the architecture of the 30S small subunit (SSU) which is resolved to 3.7 Å. cS22 localizes at the SSU foot where it seems to compensate for the deletions in 16S rRNA. The mRNA exit site is highly remodeled due to the presence of cS23 suggesting an alternative mode of translation initiation. bTHXc is positioned at the SSU head and appears to stabilize the intersubunit bridge B1b during thermal fluctuations. The translation factor plastid pY binds to the SSU on the intersubunit side and interacts with the conserved nucleotide bases involved in decoding. Most of the intersubunit bridges are conserved compared to the bacteria, except for a new bridge involving uL2c and bS6c. PMID:28582576
Evolution of ribosomal proteins in Enterobacteriaceae.
Hori, H; Osawa, S
1978-01-01
The evolution of ribosomal proteins of about 70 bacterial strains belonging to the family Enterobacteriaceae has been studied by use of previously reported data (S. Osawa, T. Itoh, and E. Otaka, J. Bacteriol. 107:168-178, 1971) and those obtained in this paper. The proximity of the bacteria was quantified by co-chromatographing the differentially labeled ribosomal proteins from two strains on a column of carboxymethyl cellulose in various combinations. The were then classified into 12 groups (=species?) according to their ribosomal protein compositions and were placed in a phylogenic tree. PMID:346556
Characterization of Ribosomes from Neurospora crassa
Storck, R.
1963-01-01
Ribosomes isolated from growing hyphae of Neurospora crassa contain 53 per cent protein and 47 per cent RNA and have a sedimentation coefficient of 81S at 20°C and infinite dilution. These ribosomes are stable at pH 7.4 in the presence of 0.01 M and 0.002 M MgCl2 but undergo a dissociation into smaller particles if the MgCl2 concentration is lowered to 0.0001 M. Two types of RNA with sedimentation coefficients of 19S2050 and 13S2050 have been extracted from the 81S particles. PMID:13984420
Martínez, Fernando; Daròs, José-Antonio
2014-09-01
The genus Potyvirus comprises a large group of positive-strand RNA plant viruses whose genome encodes a large polyprotein processed by three viral proteinases. P1 protein, the most amino-terminal product of the polyprotein, is an accessory factor stimulating viral genome amplification whose role during infection is not well understood. We infected plants with Tobacco etch virus (TEV; genus Potyvirus) clones in which P1 was tagged with a fluorescent protein to track its expression and subcellular localization or with an affinity tag to identify host proteins involved in complexes in which P1 also takes part during infection. Our results showed that TEV P1 exclusively accumulates in infected cells at an early stage of infection and that the protein displays a dynamic subcellular localization, trafficking in and out of the nucleus and nucleolus during infection. Inside the nucleolus, P1 particularly targets the dense granular component. Consistently, we found functional nucleolar localization and nuclear export signals in TEV P1 sequence. Our results also indicated that TEV P1 physically interacts with the host 80S cytoplasmic ribosomes and specifically binds to the 60S ribosomal subunits during infection. In vitro translation assays of reporter proteins suggested that TEV P1 stimulates protein translation, particularly when driven from the TEV internal ribosome entry site. These in vitro assays also suggested that TEV helper-component proteinase (HC-Pro) inhibits protein translation. Based on these findings, we propose that TEV P1 stimulates translation of viral proteins in infected cells. In this work, we researched the role during infection of tobacco etch virus P1 protease. P1 is the most mysterious protein of potyviruses, a relevant group of RNA viruses infecting plants. Our experiments showed that the viral P1 protein exclusively accumulates in infected cells at an early stage of infection and moves in and out of the nucleus of infected cells, particularly
Gogain, Joseph C; Paule, Marvin R
2005-01-01
Large amounts of energy are expended for the construction of the ribosome during both transcription and processing, so it is of utmost importance for the cell to efficiently regulate ribosome production. Understanding how this regulation occurs will provide important insights into cellular growth control and into the coordination of gene expression mediated by all three transcription systems. Ribosomal RNA (rRNA) transcription rates closely parallel the need for protein synthesis; as a cell approaches stationary phase or encounters conditions that negatively affect either growth rate or protein synthesis, rRNA transcription is decreased. In eukaryotes, the interaction of RNA polymerase I (pol I) with the essential transcription initiation factor IA (TIF-IA) has been implicated in this downregulation of transcription. In agreement with the first observation that rRNA transcription is regulated by altering recruitment of pol I to the promoter in Acanthamoeba castellanii, we show here that pol I and an 80-kDa homologue of TIF-IA are found tightly associated in pol I fractions competent for specific transcription. Disruption of the pol I-TIF-IA complex is mediated by a specific dephosphorylation of either pol I or TIF-IA. Phosphatase treatment of TIF-IA-containing A. castellanii pol I fractions results in a downregulation of both transcriptional activity and promoter binding, reminiscent of the inactive pol I fractions purified from encysted cells. The fraction of pol I competent for promoter recruitment is enriched in TIF-IA relative to that not bound by immobilized promoter DNA. This downregulation coincides with an altered electrophoretic mobility of TIF-IA, suggesting at least it is phosphorylated.
Hashem, Yaser; Frank, Joachim
2018-03-01
Translation initiation in eukaryotes is a highly regulated and rate-limiting process. It results in the assembly and disassembly of numerous transient and intermediate complexes involving over a dozen eukaryotic initiation factors (eIFs). This process culminates in the accommodation of a start codon marking the beginning of an open reading frame at the appropriate ribosomal site. Although this process has been extensively studied by hundreds of groups for nearly half a century, it has been only recently, especially during the last decade, that we have gained deeper insight into the mechanics of the eukaryotic translation initiation process. This advance in knowledge is due in part to the contributions of structural biology, which have shed light on the molecular mechanics underlying the different functions of various eukaryotic initiation factors. In this review, we focus exclusively on the contribution of structural biology to the understanding of the eukaryotic initiation process, a long-standing jigsaw puzzle that is just starting to yield the bigger picture. Expected final online publication date for the Annual Review of Biophysics Volume 47 is May 20, 2018. Please see http://www.annualreviews.org/page/journal/pubdates for revised estimates.
Galián, J A; Rosato, M; Rosselló, J A
2012-01-01
In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S–5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S–5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S–5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S–5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary. PMID:22354111
Llácer, Jose L.; Hussain, Tanweer; Marler, Laura; Aitken, Colin Echeverría; Thakur, Anil; Lorsch, Jon R.; Hinnebusch, Alan G.; Ramakrishnan, V.
2015-01-01
Summary Translation initiation in eukaryotes begins with the formation of a pre-initiation complex (PIC) containing the 40S ribosomal subunit, eIF1, eIF1A, eIF3, ternary complex (eIF2-GTP-Met-tRNAi), and eIF5. The PIC, in an open conformation, attaches to the 5′ end of the mRNA and scans to locate the start codon, whereupon it closes to arrest scanning. We present single particle cryo-electron microscopy (cryo-EM) reconstructions of 48S PICs from yeast in these open and closed states, at 6.0 Å and 4.9 Å, respectively. These reconstructions show eIF2β as well as a configuration of eIF3 that appears to encircle the 40S, occupying part of the subunit interface. Comparison of the complexes reveals a large conformational change in the 40S head from an open mRNA latch conformation to a closed one that constricts the mRNA entry channel and narrows the P site to enclose tRNAi, thus elucidating key events in start codon recognition. PMID:26212456
D’Archivio, Simon
2017-01-01
Kinetochores are multiprotein complexes that couple eukaryotic chromosomes to the mitotic spindle to ensure proper segregation. The model for kinetochore assembly is conserved between humans and yeast, and homologues of several components are widely distributed in eukaryotes, but key components are absent in some lineages. The recent discovery in a lineage of protozoa called kinetoplastids of unconventional kinetochores with no apparent homology to model organisms suggests that more than one system for eukaryotic chromosome segregation may exist. In this study, we report a new family of proteins distantly related to outer kinetochore proteins Ndc80 and Nuf2. The family member in kinetoplastids, KKT-interacting protein 1 (KKIP1), associates with the kinetochore, and its depletion causes severe defects in karyokinesis, loss of individual chromosomes, and gross defects in spindle assembly or stability. Immunopurification of KKIP1 from stabilized kinetochores identifies six further components, which form part of a trypanosome outer kinetochore complex. These findings suggest that kinetochores in organisms such as kinetoplastids are built from a divergent, but not ancestrally distinct, set of components and that Ndc80/Nuf2-like proteins are universal in eukaryotic division. PMID:28034897
Superresolution Imaging of Ribosomes and RNA Polymerase in Live Escherichia coli Cells
Bakshi, Somenath; Siryaporn, Albert; Goulian, Mark; Weisshaar, James C.
2012-01-01
Summary Quantitative spatial distributions of ribosomes (S2-YFP) and RNA polymerase (β′-yGFP) in live E. coli are measured by superresolution fluorescence microscopy. In moderate growth conditions, Nucleoid-ribosome segregation is strong, and RNAP localizes to the nucleoid lobes. The mean copy numbers per cell are 4600 RNAPs and 55,000 ribosomes. Only 10–15% of the ribosomes lie within the densest part of the nucleoid lobes, and at most 4% of the RNAPs lie in the two ribosome-rich endcaps. The predominant observed diffusion coefficient of ribosomes is Dribo = 0.04 μm2/s, attributed to free mRNA being translated by one or more 70S ribosomes. We find no clear evidence of sub-diffusion, as would arise from tethering of ribosomes. The degree of DNA-ribosome segregation strongly suggests that in E. coli most translation occurs on free mRNA transcripts that have diffused into the ribosome-rich regions. Both RNAP and ribosome radial distributions extend to the cytoplasmic membrane, consistent with the transertion hypothesis. However, few if any RNAP copies lie near the membrane of the endcaps. This suggests that if transertion occurs, it exerts a direct radially expanding force on the nucleoid, but not a direct axially expanding force. PMID:22624875
Watson, K L; Konrad, K D; Woods, D F; Bryant, P J
1992-01-01
The tumor suppressor gene lethal(1)aberrant immune response 8 (air8) of Drosophila melanogaster encodes a homolog of the human S6 ribosomal protein. P element insertions that prevent expression of this gene cause overgrowth of the lymph glands (the hematopoietic organs), abnormal blood cell differentiation, and melanotic tumor formation. They also cause delayed development, inhibit growth of most of the larval organs, and lead to larval lethality. Mitotic recombination experiments indicate that the normal S6 gene is required for clone survival in the germ line and imaginal discs. The S6 gene produces a 1.1-kilobase transcript that is abundant throughout development in wild-type animals and in revertants derived from the insertional mutants but is barely detectable in the mutant larvae. cDNAs corresponding to this transcript show a 248-amino acid open reading frame with 75.4% identity and 94.8% similarity to both human and rat S6 ribosomal protein sequences. The results reveal a regulatory function of this ribosomal protein in the hematopoietic system of Drosophila that may be related to its developmentally regulated phosphorylation. Images PMID:1454811
Non-canonical mechanism for translational control in bacteria: synthesis of ribosomal protein S1
Boni, Irina V.; Artamonova, Valentina S.; Tzareva, Nina V.; Dreyfus, Marc
2001-01-01
Translation initiation region (TIR) of the rpsA mRNA encoding ribosomal protein S1 is one of the most efficient in Escherichia coli despite the absence of a canonical Shine–Dalgarno-element. Its high efficiency is under strong negative autogenous control, a puzzling phenomenon as S1 has no strict sequence specificity. To define sequence and structural elements responsible for translational efficiency and autoregulation of the rpsA mRNA, a series of rpsA′–′lacZ chromosomal fusions bearing various mutations in the rpsA TIR was created and tested for β-galactosidase activity in the absence and presence of excess S1. These in vivo results, as well as data obtained by in vitro techniques and phylogenetic comparison, allow us to propose a model for the structural and functional organization of the rpsA TIR specific for proteobacteria related to E.coli. According to the model, the high efficiency of translation initiation is provided by a specific fold of the rpsA leader forming a non-contiguous ribosome entry site, which is destroyed upon binding of free S1 when it acts as an autogenous repressor. PMID:11483525
Kobayashi, Kan; Ishitani, Ryuichiro; Nureki, Osamu
2013-01-01
In the translation process, translating ribosomes usually move on an mRNA until they reach the stop codon. However, when ribosomes translate an aberrant mRNA, they stall. Then, ribosomes are rescued from the aberrant mRNA, and the aberrant mRNA is subsequently degraded. In eukaryotes, Pelota (Dom34 in yeast) and Hbs1 are responsible for solving general problems of ribosomal stall in translation. In archaea, aPelota and aEF1α, homologous to Pelota and Hbs1, respectively, are considered to be involved in that process. In recent years, great progress has been made in determining structures of Dom34/aPelota and Hbs1/aEF1α. In this review, we focus on the functional roles of Dom34/aPelota and Hbs1/aEF1α in ribosome rescue, based on recent structural studies of them. We will also present questions to be answered by future work. PMID:27493551
RNA and ribosomal protein patterns during aerial spore germination in Streptomyces granaticolor.
Mikulík, K; Janda, I; Weiser, J; Stastná, J; Jiránová, A
1984-12-03
Disruption of the external sheath of Streptomyces granaticolor aerial spores and subsequent cultivation in a rich medium result in a synchronous germination. This method was used to analyze RNA and protein patterns during the germination. The germination process took place through a sequence of time-ordered events. RNA and protein synthesis started during the first 5 min and net DNA synthesis at 60-70 min of germination. Within the first 10 min of germination, synthesis of RNA was not sensitive to the inhibitory effect of rifamycin. During this period rRNA and other species including 4-5-S RNA were synthesized. Dormant spores contained populations of ribosomes or ribosomal precursors that were structurally and functionally defective. The ribosomal particles bound a sporulation pigment(s) of the melanine type. The ribosomal proteins complexed to the pigments formed insoluble aggregates which were easily removed from the ribosomes by one wash with 1 M NH4Cl. During the first 10 min of germination, pigment(s) were liberated from the complexes with the ribosomes and protein extracts of the washed ribosomes had essentially the same pattern as the extracts of ribosomes of vegetative cells. These structural alterations were accompanied by enhancement of the ribosome activities in polypeptide synthesis in vivo and in vitro. When the spores were incubated with a 14C-labelled amino acid mixture in the presence of rifamycin, only three proteins (GS1, GL1 and GS9) were identified to be radiolabelled in the extracts from the washed ribosomes. These experiments indicate that liberation of the sporulation pigment(s) from the complexes with ribosomal proteins and assembly of de novo synthesized proteins and proteins from a preexisting pool in the spore are involved in the reactivation of the ribosomes of dormant spores of S. granaticolor.
Koch, Miriam; Willi, Jessica; Pradère, Ugo; Hall, Jonathan
2017-01-01
Abstract The nascent peptide exit tunnel has recently been identified as a functional region of ribosomes contributing to translation regulation and co-translational protein folding. Inducible expression of the erm resistance genes depends on ribosome stalling at specific codons of an upstream open reading frame in the presence of an exit tunnel-bound macrolide antibiotic. The molecular basis for this translation arrest is still not fully understood. Here, we used a nucleotide analog interference approach to unravel important functional groups on 23S rRNA residues in the ribosomal exit tunnel for ribosome stalling on the ErmC leader peptide. By replacing single nucleobase functional groups or even single atoms we were able to demonstrate the importance of A2062, A2503 and U2586 for drug-dependent ribosome stalling. Our data show that the universally conserved A2062 and A2503 are capable of forming a non-Watson–Crick base pair that is critical for sensing and transmitting the stalling signal from the exit tunnel back to the peptidyl transferase center of the ribosome. The nucleobases of A2062, A2503 as well as U2586 do not contribute significantly to the overall mechanism of protein biosynthesis, yet their elaborate role for co-translational monitoring of nascent peptide chains inside the exit tunnel can explain their evolutionary conservation. PMID:28369621
Choi, Sang Ki; Olsen, DeAnne S.; Roll-Mecak, Antonina; Martung, Agnes; Remo, Keith L.; Burley, Stephen K.; Hinnebusch, Alan G.; Dever, Thomas E.
2000-01-01
To initiate protein synthesis, a ribosome with bound initiator methionyl-tRNA must be assembled at the start codon of an mRNA. This process requires the coordinated activities of three translation initiation factors (IF) in prokaryotes and at least 12 translation initiation factors in eukaryotes (eIF). The factors eIF1A and eIF5B from eukaryotes show extensive amino acid sequence similarity to the factors IF1 and IF2 from prokaryotes. By a combination of two-hybrid, coimmunoprecipitation, and in vitro binding assays eIF1A and eIF5B were found to interact directly, and the eIF1A binding site was mapped to the C-terminal region of eIF5B. This portion of eIF5B was found to be critical for growth in vivo and for translation in vitro. Overexpression of eIF1A exacerbated the slow-growth phenotype of yeast strains expressing C-terminally truncated eIF5B. These findings indicate that the physical interaction between the evolutionarily conserved factors eIF1A and eIF5B plays an important role in translation initiation, perhaps to direct or stabilize the binding of methionyl-tRNA to the ribosomal P site. PMID:10982835
A Novel Association between Two Trypanosome-Specific Factors and the Conserved L5-5S rRNA Complex
Ciganda, Martin; Prohaska, Kimberly; Hellman, Kristina; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are involved in and essential for ribosome biogenesis. The proteins interact with the 5S rRNA with nearly identical binding characteristics. We have shown that this interaction is achieved mainly through the LoopA region of the RNA, but P34 and P37 also protect the L5 binding site located on LoopC. We now provide evidence to show that these factors form a novel pre-ribosomal particle through interactions with both 5S rRNA and the L5 ribosomal protein. Further in silico and in vitro analysis of T. brucei L5 indicates a lower affinity for 5S rRNA than expected, based on other eukaryotic L5 proteins. We hypothesize that P34 and P37 complement L5 and bridge the interaction with 5S rRNA, stabilizing it and aiding in the early steps of ribosome biogenesis. PMID:22859981
Tanzawa, Takehito; Kato, Koji; Girodat, Dylan; Ose, Toyoyuki; Kumakura, Yuki; Wieden, Hans-Joachim; Uchiumi, Toshio; Tanaka, Isao; Yao, Min
2018-04-06
Archaea and eukaryotes have ribosomal P stalks composed of anchor protein P0 and aP1 homodimers (archaea) or P1•P2 heterodimers (eukaryotes). These P stalks recruit translational GTPases to the GTPase-associated center in ribosomes to provide energy during translation. The C-terminus of the P stalk is known to selectively recognize GTPases. Here we investigated the interaction between the P stalk and elongation factor 2 by determining the structures of Pyrococcus horikoshii EF-2 (PhoEF-2) in the Apo-form, GDP-form, GMPPCP-form (GTP-form), and GMPPCP-form bound with 11 C-terminal residues of P1 (P1C11). Helical structured P1C11 binds to a hydrophobic groove between domain G and subdomain G' of PhoEF-2, where is completely different from that of aEF-1α in terms of both position and sequence, implying that such interaction characteristic may be requested by how GTPases perform their functions on the ribosome. Combining PhoEF-2 P1-binding assays with a structural comparison of current PhoEF-2 structures and molecular dynamics model of a P1C11-bound GDP form, the conformational changes of the P1C11-binding groove in each form suggest that in response to the translation process, the groove has three states: closed, open, and release for recruiting and releasing GTPases.
Wang, Shuzhen; Zheng, Yinzhen; Yan, Junjie; Zhu, Zhixuan; Wu, Zhihua; Ding, Yi
2013-11-01
Ribosome-inactivating proteins (RIPs) function to inhibit protein synthesis through the removal of specific adenine residues from eukaryotic ribosomal RNA and rending the 60S subunit unable to bind elongation factor 2. They have received much attention in biological and biomedical research due to their unique activities toward tumor cells, as well as the important roles in plant defense. Alpha-momorcharin (α-MC), a member of the type I family of RIPs, is rich in the seeds of Momordica charantia L. Previous studies demonstrated that α-MC is an effective antifungal and antibacterial protein. In this study, a detailed analysis of the DNase-like activity of α-MC was conducted. Results showed that the DNase-like activity toward plasmid DNA was time-dependent, temperature-related, and pH-stable. Moreover, a requirement for divalent metal ions in the catalytic domain of α-MC was confirmed. Additionally, Tyr(93) was found to be a critical residue for the DNase-like activity, while Tyr(134), Glu(183), Arg(186), and Trp(215) were activity-related residues. This study on the chemico-physical properties and mechanism of action of α-MC will improve its utilization in scientific research, as well as its potential industrial uses. These results may also assist in the characterization and elucidation of the DNase-like enzymatic properties of other RIPs.
The RNA-binding protein Hfq is important for ribosome biogenesis and affects translation fidelity.
Andrade, José M; Dos Santos, Ricardo F; Chelysheva, Irina; Ignatova, Zoya; Arraiano, Cecília M
2018-06-01
Ribosome biogenesis is a complex process involving multiple factors. Here, we show that the widely conserved RNA chaperone Hfq, which can regulate sRNA-mRNA basepairing, plays a critical role in rRNA processing and ribosome assembly in Escherichia coli Hfq binds the 17S rRNA precursor and facilitates its correct processing and folding to mature 16S rRNA Hfq assists ribosome assembly and associates with pre-30S particles but not with mature 30S subunits. Inactivation of Hfq strikingly decreases the pool of mature 70S ribosomes. The reduction in ribosome levels depends on residues located in the distal face of Hfq but not on residues found in the proximal and rim surfaces which govern interactions with the sRNAs. Our results indicate that Hfq-mediated regulation of ribosomes is independent of its function as sRNA-regulator. Furthermore, we observed that inactivation of Hfq compromises translation efficiency and fidelity, both features of aberrantly assembled ribosomes. Our work expands the functions of the Sm-like protein Hfq beyond its function in small RNA-mediated regulation and unveils a novel role of Hfq as crucial in ribosome biogenesis and translation. © 2018 The Authors.
Romes, Erin M.; Sobhany, Mack; Stanley, Robin E.
2016-01-01
The synthesis of eukaryotic ribosomes is a complex, energetically demanding process requiring the aid of numerous non-ribosomal factors, such as the PeBoW complex. The mammalian PeBoW complex, composed of Pes1, Bop1, and WDR12, is essential for the processing of the 32S preribosomal RNA. Previous work in Saccharomyces cerevisiae has shown that release of the homologous proteins in this complex (Nop7, Erb1, and Ytm1, respectively) from preribosomal particles requires Rea1 (midasin or MDN1 in humans), a large dynein-like protein. Midasin contains a C-terminal metal ion-dependent adhesion site (MIDAS) domain that interacts with the N-terminal ubiquitin-like (UBL) domain of Ytm1/WDR12 as well as the UBL domain of Rsa4/Nle1 in a later step in the ribosome maturation pathway. Here we present the crystal structure of the UBL domain of the WDR12 homologue from S. cerevisiae at 1.7 Å resolution and demonstrate that human midasin binds to WDR12 as well as Nle1 through their respective UBL domains. Midasin contains a well conserved extension region upstream of the MIDAS domain required for binding WDR12 and Nle1, and the interaction is dependent upon metal ion coordination because removal of the metal or mutation of residues that coordinate the metal ion diminishes the interaction. Mammalian WDR12 displays prominent nucleolar localization that is dependent upon active ribosomal RNA transcription. Based upon these results, we propose that release of the PeBoW complex and subsequent release of Nle1 by midasin is a well conserved step in the ribosome maturation pathway in both yeast and mammalian cells. PMID:26601951
NASA Technical Reports Server (NTRS)
Zhang, Zhengdong; Willson, Richard C.; Fox, George E.
2002-01-01
MOTIVATION: The phylogenetic structure of the bacterial world has been intensively studied by comparing sequences of 16S ribosomal RNA (16S rRNA). This database of sequences is now widely used to design probes for the detection of specific bacteria or groups of bacteria one at a time. The success of such methods reflects the fact that there are local sequence segments that are highly characteristic of particular organisms or groups of organisms. It is not clear, however, the extent to which such signature sequences exist in the 16S rRNA dataset. A better understanding of the numbers and distribution of highly informative oligonucleotide sequences may facilitate the design of hybridization arrays that can characterize the phylogenetic position of an unknown organism or serve as the basis for the development of novel approaches for use in bacterial identification. RESULTS: A computer-based algorithm that characterizes the extent to which any individual oligonucleotide sequence in 16S rRNA is characteristic of any particular bacterial grouping was developed. A measure of signature quality, Q(s), was formulated and subsequently calculated for every individual oligonucleotide sequence in the size range of 5-11 nucleotides and for 15mers with reference to each cluster and subcluster in a 929 organism representative phylogenetic tree. Subsequently, the perfect signature sequences were compared to the full set of 7322 sequences to see how common false positives were. The work completed here establishes beyond any doubt that highly characteristic oligonucleotides exist in the bacterial 16S rRNA sequence dataset in large numbers. Over 16,000 15mers were identified that might be useful as signatures. Signature oligonucleotides are available for over 80% of the nodes in the representative tree.
RNA regulators responding to ribosomal protein S15 are frequent in sequence space
Slinger, Betty L.; Meyer, Michelle M.
2016-01-01
There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716
Crystal structure of bacillus subtilis YdaF protein : a putative ribosomal N-acetyltransferase.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brunzelle, J. S.; Wu, R.; Korolev, S. V.
2004-12-01
Comparative sequence analysis suggests that the ydaF gene encodes a protein (YdaF) that functions as an N-acetyltransferase, more specifically, a ribosomal N-acetyltransferase. Sequence analysis using basic local alignment search tool (BLAST) suggests that YdaF belongs to a large family of proteins (199 proteins found in 88 unique species of bacteria, archaea, and eukaryotes). YdaF also belongs to the COG1670, which includes the Escherichia coli RimL protein that is known to acetylate ribosomal protein L12. N-acetylation (NAT) has been found in all kingdoms. NAT enzymes catalyze the transfer of an acetyl group from acetyl-CoA (AcCoA) to a primary amino group. Formore » example, NATs can acetylate the N-terminal {alpha}-amino group, the {epsilon}-amino group of lysine residues, aminoglycoside antibiotics, spermine/speridine, or arylalkylamines such as serotonin. The crystal structure of the alleged ribosomal NAT protein, YdaF, from Bacillus subtilis presented here was determined as a part of the Midwest Center for Structural Genomics. The structure maintains the conserved tertiary structure of other known NATs and a high sequence similarity in the presumed AcCoA binding pocket in spite of a very low overall level of sequence identity to other NATs of known structure.« less
Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G
1979-01-01
The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.
Toxin effect on protein biosynthesis in eukaryotic cells: a simple kinetic model.
Skakauskas, Vladas; Katauskis, Pranas; Skvortsov, Alex; Gray, Peter
2015-03-01
A model for toxin inhibition of protein synthesis inside eukaryotic cells is presented. Mitigation of this effect by introduction of an antibody is also studied. Antibody and toxin (ricin) initially are delivered outside the cell. The model describes toxin internalization from the extracellular into the intracellular domain, its transport to the endoplasmic reticulum (ER) and the cleavage inside the ER into the RTA and RTB chains, the release of RTA into the cytosol, inactivation (depurination) of ribosomes, and the effect on translation. The model consists of a set of ODEs which are solved numerically. Numerical results are illustrated by figures and discussed. Copyright © 2015 Elsevier Inc. All rights reserved.
McCluskey, Andrew J.; Bolewska-Pedyczak, Eleonora; Jarvik, Nick; Chen, Gang; Sidhu, Sachdev S.; Gariépy, Jean
2012-01-01
Shiga-like toxins are ribosome-inactivating proteins (RIP) produced by pathogenic E. coli strains that are responsible for hemorrhagic colitis and hemolytic uremic syndrome. The catalytic A1 chain of Shiga-like toxin 1 (SLT-1), a representative RIP, first docks onto a conserved peptide SD[D/E]DMGFGLFD located at the C-terminus of all three eukaryotic ribosomal stalk proteins and halts protein synthesis through the depurination of an adenine base in the sarcin-ricin loop of 28S rRNA. Here, we report that the A1 chain of SLT-1 rapidly binds to and dissociates from the C-terminal peptide with a monomeric dissociation constant of 13 µM. An alanine scan performed on the conserved peptide revealed that the SLT-1 A1 chain interacts with the anionic tripeptide DDD and the hydrophobic tetrapeptide motif FGLF within its sequence. Based on these 2 peptide motifs, SLT-1 A1 variants were generated that displayed decreased affinities for the stalk protein C-terminus and also correlated with reduced ribosome-inactivating activities in relation to the wild-type A1 chain. The toxin-peptide interaction and subsequent toxicity were shown to be mediated by cationic and hydrophobic docking surfaces on the SLT-1 catalytic domain. These docking surfaces are located on the opposite face of the catalytic cleft and suggest that the docking of the A1 chain to SDDDMGFGLFD may reorient its catalytic domain to face its RNA substrate. More importantly, both the delineated A1 chain ribosomal docking surfaces and the ribosomal peptide itself represent a target and a scaffold, respectively, for the design of generic inhibitors to block the action of RIPs. PMID:22355345
RISSC: a novel database for ribosomal 16S–23S RNA genes spacer regions
García-Martínez, Jesús; Bescós, Ignacio; Rodríguez-Sala, Jesús Javier; Rodríguez-Valera, Francisco
2001-01-01
A novel database, under the acronym RISSC (Ribosomal Intergenic Spacer Sequence Collection), has been created. It compiles more than 1600 entries of edited DNA sequence data from the 16S–23S ribosomal spacers present in most prokaryotes and organelles (e.g. mitochondria and chloroplasts) and is accessible through the Internet (http://ulises.umh.es/RISSC), where systematic searches for specific words can be conducted, as well as BLAST-type sequence searches. Additionally, a characteristic feature of this region, the presence/absence and nature of tRNA genes within the spacer, is included in all the entries, even when not previously indicated in the original database. All these combined features could provide a useful documentation tool for studies on evolution, identification, typing and strain characterization, among others. PMID:11125084
A Plasma Protein Indistinguishable from Ribosomal Protein S19
Semba, Umeko; Chen, Jun; Ota, Yoshihiko; Jia, Nan; Arima, Hidetoshi; Nishiura, Hiroshi; Yamamoto, Tetsuro
2010-01-01
A monocyte-chemoattracting factor is generated during blood coagulation and during clotting of platelet-rich plasma. This chemotactic factor attracts monocytes as a ligand of the C5a receptor; however, it inhibits C5a-induced neutrophil chemotaxis as an apparent receptor antagonist. The curious dual function of the serum monocyte chemotactic factor resembles that of the cross-linked homodimer of ribosomal protein S19 (RP S19). Indeed, the inactive precursor of the monocyte chemotactic factor was present in plasma, and the precursor molecule and RP S19, as well as the active form and the RP S19 dimer, were indistinguishable in terms of immunological reactivity and molecular size. Coagulation factor XIIIa, plasma transglutaminase, and membrane phosphatidylserine on the activated platelets were required for conversion of the precursor to the active form. In addition, the precursor molecule in plasma could be replaced by wild-type recombinant RP S19 but not by mutant forms of it. These results indicate that a molecule indistinguishable from RP S19 was present in plasma, and that the RP S19-like molecule was converted to the active form by a transglutaminase-catalyzed reaction on a scaffold that included the phosphatidylserine-exposed platelet membrane. PMID:20093496
Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David
2012-01-01
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494
Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen
2012-04-17
Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.
Decelle, Johan; Romac, Sarah; Stern, Rowena F; Bendif, El Mahdi; Zingone, Adriana; Audic, Stéphane; Guiry, Michael D; Guillou, Laure; Tessier, Désiré; Le Gall, Florence; Gourvil, Priscillia; Dos Santos, Adriana L; Probert, Ian; Vaulot, Daniel; de Vargas, Colomban; Christen, Richard
2015-11-01
Photosynthetic eukaryotes have a critical role as the main producers in most ecosystems of the biosphere. The ongoing environmental metabarcoding revolution opens the perspective for holistic ecosystems biological studies of these organisms, in particular the unicellular microalgae that often lack distinctive morphological characters and have complex life cycles. To interpret environmental sequences, metabarcoding necessarily relies on taxonomically curated databases containing reference sequences of the targeted gene (or barcode) from identified organisms. To date, no such reference framework exists for photosynthetic eukaryotes. In this study, we built the PhytoREF database that contains 6490 plastidial 16S rDNA reference sequences that originate from a large diversity of eukaryotes representing all known major photosynthetic lineages. We compiled 3333 amplicon sequences available from public databases and 879 sequences extracted from plastidial genomes, and generated 411 novel sequences from cultured marine microalgal strains belonging to different eukaryotic lineages. A total of 1867 environmental Sanger 16S rDNA sequences were also included in the database. Stringent quality filtering and a phylogeny-based taxonomic classification were applied for each 16S rDNA sequence. The database mainly focuses on marine microalgae, but sequences from land plants (representing half of the PhytoREF sequences) and freshwater taxa were also included to broaden the applicability of PhytoREF to different aquatic and terrestrial habitats. PhytoREF, accessible via a web interface (http://phytoref.fr), is a new resource in molecular ecology to foster the discovery, assessment and monitoring of the diversity of photosynthetic eukaryotes using high-throughput sequencing. © 2015 John Wiley & Sons Ltd.
Nop9 is a PUF-like protein that prevents premature cleavage to correctly process pre-18S rRNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Jun; McCann, Kathleen L.; Qiu, Chen
Numerous factors direct eukaryotic ribosome biogenesis, and defects in a single ribosome assembly factor may be lethal or produce tissue-specific human ribosomopathies. Pre-ribosomal RNAs (pre-rRNAs) must be processed stepwise and at the correct subcellular locations to produce the mature rRNAs. Nop9 is a conserved small ribosomal subunit biogenesis factor, essential in yeast. Here we report a 2.1-Å crystal structure of Nop9 and a small-angle X-ray-scattering model of a Nop9:RNA complex that reveals a ‘C’-shaped fold formed from 11 Pumilio repeats. We show that Nop9 recognizes sequence and structural features of the 20S pre-rRNA near the cleavage site of the nuclease,more » Nob1. We further demonstrate that Nop9 inhibits Nob1 cleavage, the final processing step to produce mature small ribosomal subunit 18S rRNA. Together, our results suggest that Nop9 is critical for timely cleavage of the 20S pre-rRNA. Moreover, the Nop9 structure exemplifies a new class of Pumilio repeat proteins.« less
Structural insights into cell cycle control by essential GTPase Era.
Ji, Xinhua
Era (Escherichia coli Ras-like protein), essential for bacterial cell viability, is composed of an N-terminal GTPase domain and a C-terminal KH domain. In bacteria, it is required for the processing of 16S ribosomal RNA (rRNA) and maturation of 30S (small) ribosomal subunit. Era recognizes 10 nucleotides ( 1530 GAUCACCUCC 1539 ) near the 3' end of 16S rRNA and interacts with helix 45 (h45, nucleotides 1506-1529). GTP binding enables Era to bind RNA, RNA binding stimulates Era's GTP-hydrolyzing activity, and GTP hydrolysis releases Era from matured 30S ribosomal subunit. As such, Era controls cell growth rate via regulating the maturation of the 30S ribosomal subunit. Ribosomes manufacture proteins in all living organisms. The GAUCA sequence and h45 are highly conserved in all three kingdoms of life. Homologues of Era are present in eukaryotic cells. Hence, the mechanism of bacterial Era action also sheds light on the cell cycle control of eukaryotes.
Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae
Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.
2005-01-01
5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201
NASA Technical Reports Server (NTRS)
Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.
1985-01-01
The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.
Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes
NASA Technical Reports Server (NTRS)
Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.
1976-01-01
Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.
NASA Technical Reports Server (NTRS)
Broeze, R. J.; Pope, D. H.
1978-01-01
The inhibition of translation which is observed after shifting Escherichia coli to low temperature was investigated. 70 S ribosomes were isolated from E. coli 8 hours after a shift to 5 C synthesized protein in the absence of added mRNA (i.e., endogenous protein synthesis by 70 S monosomes) at a rate which was three times greater than the rate of endogenous protein synthesis by 70 S ribosomes which were isolated at the time of the shift to 5 C. Calculations based on the rates of endogenous protein synthesis and polyphenylalanine synthesis indicate that 70 S monosomes comprise only 0.1% of the total E. coli 70 S ribosome population after 8 hours at 5 c. Experiments designed to test initiation complex formation on ApUpG or formaldehyde treated MS-2 viral RNA demonstrated that, although the rate of formation of 30 S initiation complexes was not inhibited, the rate of formation of active 70 S initiation complexes, able to react with puromycin, was inhibited to a great extent at 5 C. A model depicting the effects of low temperature on the E. coli translation system is proposed.
Structure of ratcheted ribosomes with tRNAs in hybrid states
Julián, Patricia; Konevega, Andrey L.; Scheres, Sjors H. W.; Lázaro, Melisa; Gil, David; Wintermeyer, Wolfgang; Rodnina, Marina V.; Valle, Mikel
2008-01-01
During protein synthesis, tRNAs and mRNA move through the ribosome between aminoacyl (A), peptidyl (P), and exit (E) sites of the ribosome in a process called translocation. Translocation is accompanied by the displacement of the tRNAs on the large ribosomal subunit toward the hybrid A/P and P/E states and by a rotational movement (ratchet) of the ribosomal subunits relative to one another. So far, the structure of the ratcheted state has been observed only when translation factors were bound to the ribosome. Using cryo-electron microscopy and classification, we show here that ribosomes can spontaneously adopt a ratcheted conformation with tRNAs in their hybrid states. The peptidyl-tRNA molecule in the A/P state, which is visualized here, is not distorted compared with the A/A state except for slight adjustments of its acceptor end, suggesting that the displacement of the A-site tRNA on the 50S subunit is passive and is induced by the 30S subunit rotation. Simultaneous subunit ratchet and formation of the tRNA hybrid states precede and may promote the subsequent rapid and coordinated tRNA translocation on the 30S subunit catalyzed by elongation factor G. PMID:18971332
Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales
2010-08-16
In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy
2010-01-01
Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units
Evolutionary trends in animal ribosomal DNA loci: introduction to a new online database.
Sochorová, Jana; Garcia, Sònia; Gálvez, Francisco; Symonová, Radka; Kovařík, Aleš
2018-03-01
Ribosomal DNA (rDNA) loci encoding 5S and 45S (18S-5.8S-28S) rRNAs are important components of eukaryotic chromosomes. Here, we set up the animal rDNA database containing cytogenetic information about these loci in 1343 animal species (264 families) collected from 542 publications. The data are based on in situ hybridisation studies (both radioactive and fluorescent) carried out in major groups of vertebrates (fish, reptiles, amphibians, birds, and mammals) and invertebrates (mostly insects and mollusks). The database is accessible online at www.animalrdnadatabase.com . The median number of 45S and 5S sites was close to two per diploid chromosome set for both rDNAs despite large variation (1-74 for 5S and 1-54 for 45S sites). No significant correlation between the number of 5S and 45S rDNA loci was observed, suggesting that their distribution and amplification across the chromosomes follow independent evolutionary trajectories. Each group, irrespective of taxonomic classification, contained rDNA sites at any chromosome location. However, the distal and pericentromeric positions were the most prevalent (> 75% karyotypes) for 45S loci, while the position of 5S loci was more variable. We also examined potential relationships between molecular attributes of rDNA (homogenisation and expression) and cytogenetic parameters such as rDNA positions, chromosome number, and morphology.
Co-translational capturing of nascent ribosomal proteins by their dedicated chaperones
Pausch, Patrick; Singh, Ujjwala; Ahmed, Yasar Luqman; Pillet, Benjamin; Murat, Guillaume; Altegoer, Florian; Stier, Gunter; Thoms, Matthias; Hurt, Ed; Sinning, Irmgard; Bange, Gert; Kressler, Dieter
2015-01-01
Exponentially growing yeast cells produce every minute >160,000 ribosomal proteins. Owing to their difficult physicochemical properties, the synthesis of assembly-competent ribosomal proteins represents a major challenge. Recent evidence highlights that dedicated chaperone proteins recognize the N-terminal regions of ribosomal proteins and promote their soluble expression and delivery to the assembly site. Here we explore the intuitive possibility that ribosomal proteins are captured by dedicated chaperones in a co-translational manner. Affinity purification of four chaperones (Rrb1, Syo1, Sqt1 and Yar1) selectively enriched the mRNAs encoding their specific ribosomal protein clients (Rpl3, Rpl5, Rpl10 and Rps3). X-ray crystallography reveals how the N-terminal, rRNA-binding residues of Rpl10 are shielded by Sqt1's WD-repeat β-propeller, providing mechanistic insight into the incorporation of Rpl10 into pre-60S subunits. Co-translational capturing of nascent ribosomal proteins by dedicated chaperones constitutes an elegant mechanism to prevent unspecific interactions and aggregation of ribosomal proteins on their road to incorporation. PMID:26112308
Chen, Jun; Kaitsuka, Taku; Fujino, Rika; Araki, Kimi; Tomizawa, Kazuhito; Yamamoto, Tetsuro
2016-08-26
Ribosomal protein S19 (RP S19) possesses ribosomal function as RP S19 monomer and extraribosomal function as cross-linked RP S19 oligomers which function as a ligand of the complement 5a (C5a) receptor (CD88). We have generated a Gln137Glu-RP S19 knock-in (KI) mouse, which is shown to possess the weakened extraribosomal function of RP S19. Because whether the extraribosomal function of RP S19 has a role in brain function had been unclear, we performed behavioral analysis on these mice and demonstrated that KI mice displayed an increased grooming behavior during open-field test and elevated plus maze test and an enhanced freezing behavior in contextual fear conditioning test. These results suggest an involvement of RP S19 oligomers in some anxiety-like behavior, especially grooming behavior. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
A universal strategy for regulating mRNA translation in prokaryotic and eukaryotic cells
Cao, Jicong; Arha, Manish; Sudrik, Chaitanya; Mukherjee, Abhirup; Wu, Xia; Kane, Ravi S.
2015-01-01
We describe a simple strategy to control mRNA translation in both prokaryotic and eukaryotic cells which relies on a unique protein–RNA interaction. Specifically, we used the Pumilio/FBF (PUF) protein to repress translation by binding in between the ribosome binding site (RBS) and the start codon (in Escherichia coli), or by binding to the 5′ untranslated region of target mRNAs (in mammalian cells). The design principle is straightforward, the extent of translational repression can be tuned and the regulator is genetically encoded, enabling the construction of artificial signal cascades. We demonstrate that this approach can also be used to regulate polycistronic mRNAs; such regulation has rarely been achieved in previous reports. Since the regulator used in this study is a modular RNA-binding protein, which can be engineered to target different 8-nucleotide RNA sequences, our strategy could be used in the future to target endogenous mRNAs for regulating metabolic flows and signaling pathways in both prokaryotic and eukaryotic cells. PMID:25845589
He, M; Taussig, M J
1997-01-01
We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries. PMID:9396828
He, M; Taussig, M J
1997-12-15
We describe a rapid, eukaryotic, in vitro method for selection and evolution of antibody combining sites using antibody-ribosome-mRNA (ARM) complexes as selection particles. ARMs carrying single-chain (VH/K) binding fragments specific for progesterone were selected using antigen-coupled magnetic beads; selection simultaneously captured the genetic information as mRNA, making it possible to generate and amplify cDNA by single-step RT-PCR on the ribosome-bound mRNA for further manipulation. Using mutant libraries, antigen-binding ARMs were enriched by a factor of 10(4)-10(5)-fold in a single cycle, with further enrichment in repeated cycles. While demonstrated here for antibodies, the method has the potential to be applied equally for selection of receptors or peptides from libraries.
An update on sORFs.org: a repository of small ORFs identified by ribosome profiling.
Olexiouk, Volodimir; Van Criekinge, Wim; Menschaert, Gerben
2018-01-04
sORFs.org (http://www.sorfs.org) is a public repository of small open reading frames (sORFs) identified by ribosome profiling (RIBO-seq). This update elaborates on the major improvements implemented since its initial release. sORFs.org now additionally supports three more species (zebrafish, rat and Caenorhabditis elegans) and currently includes 78 RIBO-seq datasets, a vast increase compared to the three that were processed in the initial release. Therefore, a novel pipeline was constructed that also enables sORF detection in RIBO-seq datasets comprising solely elongating RIBO-seq data while previously, matching initiating RIBO-seq data was necessary to delineate the sORFs. Furthermore, a novel noise filtering algorithm was designed, able to distinguish sORFs with true ribosomal activity from simulated noise, consequently reducing the false positive identification rate. The inclusion of other species also led to the development of an inner BLAST pipeline, assessing sequence similarity between sORFs in the repository. Building on the proof of concept model in the initial release of sORFs.org, a full PRIDE-ReSpin pipeline was now released, reprocessing publicly available MS-based proteomics PRIDE datasets, reporting on true translation events. Next to reporting those identified peptides, sORFs.org allows visual inspection of the annotated spectra within the Lorikeet MS/MS viewer, thus enabling detailed manual inspection and interpretation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Miyaoka, Yuma; Hatamoto, Masashi; Yamaguchi, Takashi; Syutsubo, Kazuaki
2017-05-01
In this study, changes in eukaryotic community structure and water quality were investigated in an aerobic trickling filter (down-flow hanging sponge, DHS) treating domestic sewage under different organic loading rates (OLRs). The OLR clearly influenced both sponge pore water quality and relative flagellates and ciliates (free-swimming, carnivorous, crawling, and stalked protozoa) abundances in the retained sludge. Immediately after the OLR was increased from 1.05 to 1.97 kg chemical oxygen demand (COD) m -3 day -1 , COD and NH 4 + -N treatment efficiencies both deteriorated, and relative flagellates and ciliates abundances then increased from 2-8 % to 51-65 % total cells in the middle-bottom part of the DHS reactor. In a continuous operation at a stable OLR (2.01 kg COD m -3 day -1 ), effluent water quality improved, and relative flagellates and ciliates abundances decreased to 15-46 % total cells in the middle-bottom part of the DHS reactor. This result may indicate that flagellates and ciliates preferentially graze on dispersed bacteria, thus, stabilizing effluent water quality. Additionally, to investigate eukaryotic community structure, clone libraries based on the 18S ribosomal ribonucleic acid (rRNA) gene of the retained sludge were constructed. The predominant group was Nucletmycea phylotypes, representing approximately 29-56 % total clones. Furthermore, a large proportion of the clones had <97 % sequence identity in the NCBI database. This result indicates that phylogenetically unknown eukaryotes were present in the DHS reactor. These results provide insights into eukaryotic community shift in the DHS reactor treating domestic sewage.
Ribosome A and P sites revealed by length analysis of ribosome profiling data
Martens, Andrew T.; Taylor, James; Hilser, Vincent J.
2015-01-01
The high-throughput sequencing of nuclease-protected mRNA fragments bound to ribosomes, a technique known as ribosome profiling, quantifies the relative frequencies with which different regions of transcripts are translated. This technique has revealed novel translation initiation sites with unprecedented scope and has furthered investigations into the connections between codon biases and translation rates. Yet the location of the codon being decoded in ribosome footprints is still unknown, and has been complicated by the recent observation of footprints with non-canonical lengths. Here we show how taking into account the variations in ribosome footprint lengths can reveal the ribosome aminoacyl (A) and peptidyl (P) site locations. These location assignments are in agreement with the proposed mechanisms for various ribosome pauses and further enhance the resolution of the profiling data. We also show that GC-rich motifs at the 5′ ends of footprints are found in yeast, calling into question the anti-Shine-Dalgarno effect's role in ribosome pausing. PMID:25805170
Revisiting the structures of several antibiotics bound to the bacterial ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bulkley, David; Innis, C. Axel; Blaha, Gregor
2010-10-08
The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less
Revisiting the Structures of Several Antibiotics Bound to the Bacterial Ribosome
DOE Office of Scientific and Technical Information (OSTI.GOV)
D Bulkley; C Innis; G Blaha
2011-12-31
The increasing prevalence of antibiotic-resistant pathogens reinforces the need for structures of antibiotic-ribosome complexes that are accurate enough to enable the rational design of novel ribosome-targeting therapeutics. Structures of many antibiotics in complex with both archaeal and eubacterial ribosomes have been determined, yet discrepancies between several of these models have raised the question of whether these differences arise from species-specific variations or from experimental problems. Our structure of chloramphenicol in complex with the 70S ribosome from Thermus thermophilus suggests a model for chloramphenicol bound to the large subunit of the bacterial ribosome that is radically different from the prevailing model.more » Further, our structures of the macrolide antibiotics erythromycin and azithromycin in complex with a bacterial ribosome are indistinguishable from those determined of complexes with the 50S subunit of Haloarcula marismortui, but differ significantly from the models that have been published for 50S subunit complexes of the eubacterium Deinococcus radiodurans. Our structure of the antibiotic telithromycin bound to the T. thermophilus ribosome reveals a lactone ring with a conformation similar to that observed in the H. marismortui and D. radiodurans complexes. However, the alkyl-aryl moiety is oriented differently in all three organisms, and the contacts observed with the T. thermophilus ribosome are consistent with biochemical studies performed on the Escherichia coli ribosome. Thus, our results support a mode of macrolide binding that is largely conserved across species, suggesting that the quality and interpretation of electron density, rather than species specificity, may be responsible for many of the discrepancies between the models.« less
32 CFR 728.80 - U.S. Government employees.
Code of Federal Regulations, 2014 CFR
2014-07-01
... 32 National Defense 5 2014-07-01 2014-07-01 false U.S. Government employees. 728.80 Section 728.80... FOR ELIGIBLE PERSONS AT NAVY MEDICAL DEPARTMENT FACILITIES Other Persons § 728.80 U.S. Government... Government who sustain injuries while in the performance of duty, including diseases proximately caused by...
Ribosome protection by antibiotic resistance ATP-binding cassette protein.
Su, Weixin; Kumar, Veerendra; Ding, Yichen; Ero, Rya; Serra, Aida; Lee, Benjamin Sian Teck; Wong, Andrew See Weng; Shi, Jian; Sze, Siu Kwan; Yang, Liang; Gao, Yong-Gui
2018-05-15
The ribosome is one of the richest targets for antibiotics. Unfortunately, antibiotic resistance is an urgent issue in clinical practice. Several ATP-binding cassette family proteins confer resistance to ribosome-targeting antibiotics through a yet unknown mechanism. Among them, MsrE has been implicated in macrolide resistance. Here, we report the cryo-EM structure of ATP form MsrE bound to the ribosome. Unlike previously characterized ribosomal protection proteins, MsrE is shown to bind to ribosomal exit site. Our structure reveals that the domain linker forms a unique needle-like arrangement with two crossed helices connected by an extended loop projecting into the peptidyl-transferase center and the nascent peptide exit tunnel, where numerous antibiotics bind. In combination with biochemical assays, our structure provides insight into how MsrE binding leads to conformational changes, which results in the release of the drug. This mechanism appears to be universal for the ABC-F type ribosome protection proteins. Copyright © 2018 the Author(s). Published by PNAS.
HOGG, TANIS; MENDEL, JAMESON T.; LAVEZO, JONATHAN L.
2015-01-01
Pokeweed antiviral protein (PAP) belongs to the family of type I ribosome-inactivating proteins (RIPs): Ribotoxins, which function by depurinating the sarcin-ricin loop of ribosomal RNA. In addition to its antibacterial and antifungal properties, PAP has shown promise in antiviral and targeted tumor therapy owing to its ability to depurinate viral RNA and eukaryotic rRNA. Several PAP genes are differentially expressed across pokeweed tissues, with natively isolated seed forms of PAP exhibiting the greatest cytotoxicity. To help elucidate the molecular basis of increased cytotoxicity of PAP isoenzymes from seeds, the present study used protein sequencing, mass spectroscopy and X-ray crystallography to determine the complete covalent structure and 1.7 Å X-ray crystal structure of PAP-S1aci isolated from seeds of Asian pokeweed (Phytolacca acinosa). PAP-S1aci shares ~95% sequence identity with PAP-S1 from P. americana and contains the signature catalytic residues of the RIP superfamily, corresponding to Tyr72, Tyr122, Glu175 and Arg178 in PAP-S1aci. A rare proline substitution (Pro174) was identified in the active site of PAP-S1aci, which has no effect on catalytic Glu175 positioning or overall active-site topology, yet appears to come at the expense of strained main-chain geometry at the pre-proline residue Val173. Notably, a rare type of N-glycosylation was detected consisting of N-acetyl-D-glucosamine monosaccharide residues linked to Asn10, Asn44 and Asn255 of PAP-S1aci. Of note, our modeling studies suggested that the ribosome depurination activity of seed PAPs would be adversely affected by the N-glycosylation of Asn44 and Asn255 with larger and more typical oligosaccharide chains, as they would shield the rRNA-binding sites on the protein. These results, coupled with evidence gathered from the literature, suggest that this type of minimal N-glycosylation in seed PAPs and other type I seed RIPs may serve to enhance cytotoxicity by exploiting receptor
Klebsazolicin inhibits 70S ribosome by obstructing the peptide exit tunnel
DOE Office of Scientific and Technical Information (OSTI.GOV)
Metelev, Mikhail; Osterman, Ilya A.; Ghilarov, Dmitry
Whereas screening of the small-molecule metabolites produced by most cultivatable microorganisms often results in the rediscovery of known compounds, genome-mining programs allow researchers to harness much greater chemical diversity, and result in the discovery of new molecular scaffolds. Here we report the genome-guided identification of a new antibiotic, klebsazolicin (KLB), from Klebsiella pneumoniae that inhibits the growth of sensitive cells by targeting ribosomes. A ribosomally synthesized post-translationally modified peptide (RiPP), KLB is characterized by the presence of a unique N-terminal amidine ring that is essential for its activity. Biochemical in vitro studies indicate that KLB inhibits ribosomes by interfering withmore » translation elongation. Structural analysis of the ribosome–KLB complex showed that the compound binds in the peptide exit tunnel overlapping with the binding sites of macrolides or streptogramin-B. KLB adopts a compact conformation and largely obstructs the tunnel. Engineered KLB fragments were observed to retain in vitro activity, and thus have the potential to serve as a starting point for the development of new bioactive compounds.« less
Kinase Mediated Regulation of 40S Ribosome Assembly in Human Breast Cancer
2017-02-01
Ribosome assembly • Autophagy • CRISPR /Cas9 6 ACCOMPLISHMENTS Major goals The major goals in this reporting period were to use the CRISPR ...defects on ribosome assembly, drug sensitivity etc. Accomplishments under these goals To set up the CRISPR /Cas9 experiment, the Karbstein...recombinant Cas9, and then assayed CRISPR /Cas9 mediated cleavage of a PCR-generated DNA. This demonstrated that the guide RNAs we had designed based on
Fabbrini, Maria Serena; Katayama, Miku; Nakase, Ikuhiko; Vago, Riccardo
2017-01-01
Plant ribosome-inactivating protein (RIP) toxins are EC3.2.2.22 N-glycosidases, found among most plant species encoded as small gene families, distributed in several tissues being endowed with defensive functions against fungal or viral infections. The two main plant RIP classes include type I (monomeric) and type II (dimeric) as the prototype ricin holotoxin from Ricinus communis that is composed of a catalytic active A chain linked via a disulphide bridge to a B-lectin domain that mediates efficient endocytosis in eukaryotic cells. Plant RIPs can recognize a universally conserved stem-loop, known as the α-sarcin/ ricin loop or SRL structure in 23S/25S/28S rRNA. By depurinating a single adenine (A4324 in 28S rat rRNA), they can irreversibly arrest protein translation and trigger cell death in the intoxicated mammalian cell. Besides their useful application as potential weapons against infected/tumor cells, ricin was also used in bio-terroristic attacks and, as such, constitutes a major concern. In this review, we aim to summarize past studies and more recent progresses made studying plant RIPs and discuss successful approaches that might help overcoming some of the bottlenecks encountered during the development of their biomedical applications. PMID:29023422
Maier, Uwe-G; Zauner, Stefan; Woehle, Christian; Bolte, Kathrin; Hempel, Franziska; Allen, John F.; Martin, William F.
2013-01-01
Plastid and mitochondrial genomes have undergone parallel evolution to encode the same functional set of genes. These encode conserved protein components of the electron transport chain in their respective bioenergetic membranes and genes for the ribosomes that express them. This highly convergent aspect of organelle genome evolution is partly explained by the redox regulation hypothesis, which predicts a separate plastid or mitochondrial location for genes encoding bioenergetic membrane proteins of either photosynthesis or respiration. Here we show that convergence in organelle genome evolution is far stronger than previously recognized, because the same set of genes for ribosomal proteins is independently retained by both plastid and mitochondrial genomes. A hitherto unrecognized selective pressure retains genes for the same ribosomal proteins in both organelles. On the Escherichia coli ribosome assembly map, the retained proteins are implicated in 30S and 50S ribosomal subunit assembly and initial rRNA binding. We suggest that ribosomal assembly imposes functional constraints that govern the retention of ribosomal protein coding genes in organelles. These constraints are subordinate to redox regulation for electron transport chain components, which anchor the ribosome to the organelle genome in the first place. As organelle genomes undergo reduction, the rRNAs also become smaller. Below size thresholds of approximately 1,300 nucleotides (16S rRNA) and 2,100 nucleotides (26S rRNA), all ribosomal protein coding genes are lost from organelles, while electron transport chain components remain organelle encoded as long as the organelles use redox chemistry to generate a proton motive force. PMID:24259312
Eukaryotes first: how could that be?
Mariscal, Carlos; Doolittle, W Ford
2015-09-26
In the half century since the formulation of the prokaryote : eukaryote dichotomy, many authors have proposed that the former evolved from something resembling the latter, in defiance of common (and possibly common sense) views. In such 'eukaryotes first' (EF) scenarios, the last universal common ancestor is imagined to have possessed significantly many of the complex characteristics of contemporary eukaryotes, as relics of an earlier 'progenotic' period or RNA world. Bacteria and Archaea thus must have lost these complex features secondarily, through 'streamlining'. If the canonical three-domain tree in which Archaea and Eukarya are sisters is accepted, EF entails that Bacteria and Archaea are convergently prokaryotic. We ask what this means and how it might be tested. © 2015 The Author(s).
Cooling-induced SUMOylation of EXOSC10 down-regulates ribosome biogenesis
Bastide, Amandine; Peretti, Diego; Roobol, Anne; Roobol, Jo; Mallucci, Giovanna R.; Smales, C. Mark; Willis, Anne E.
2016-01-01
The RNA exosome is essential for 3′ processing of functional RNA species and degradation of aberrant RNAs in eukaryotic cells. Recent reports have defined the substrates of the exosome catalytic domains and solved the multimeric structure of the exosome complex. However, regulation of exosome activity remains poorly characterized, especially in response to physiological stress. Following the observation that cooling of mammalian cells results in a reduction in 40S:60S ribosomal subunit ratio, we uncover regulation of the nuclear exosome as a result of reduced temperature. Using human cells and an in vivo model system allowing whole-body cooling, we observe reduced EXOSC10 (hRrp6, Pm/Scl-100) expression in the cold. In parallel, both models of cooling increase global SUMOylation, leading to the identification of specific conjugation of SUMO1 to EXOSC10, a process that is increased by cooling. Furthermore, we define the major SUMOylation sites in EXOSC10 by mutagenesis and show that overexpression of SUMO1 alone is sufficient to suppress EXOSC10 abundance. Reducing EXOSC10 expression by RNAi in human cells correlates with the 3′ preribosomal RNA processing defects seen in the cold as well as reducing the 40S:60S ratio, a previously uncharacterized consequence of EXOSC10 suppression. Together, this work illustrates that EXOSC10 can be modified by SUMOylation and identifies a physiological stress where this regulation is prevalent both in vitro and in vivo. PMID:26857222
Fernandez-Pol, J Alberto
2016-01-01
The ribosomal protein metallopanstimulin-1 (MPS1/S27) serves critical survival purposes in cell division, in normal and cancerous cells; for this reason, selective pressures of evolution have conserved the DNA sequences encoding MPS1/S27 in Archaea and Eukariotic cells. The expression of MPS1/S27 protein in human adult cerebellum has not been established. The presence of MPS1/S27, was screened in paraffin-embedded human adult brain specimens processed for tissue inmunohistochemistry. Affinity-purified specific antibodies were directed against the N-terminus of MPS1. The antibodies to MPS1 detected Purkinje cells (PC) and their dendrites. In PC, MPS1 antigen-positive staining was found in: the nucleolus, which was strongly stained; ribosomes attached to the external nuclear membrane; cytoplasm of PC, with strong staining in a punctuate fashion; the soma-attached large dendrite trunks of PC, which were MPS1 antigen-positive; and the granular cell layer, where cellular staining in a few cells that appeared to resemble smaller PC was observed. Since MPS1 is involved in cell division, DNA repair, and ribosomal biogenesis, it may be a useful antigen for studying processes such as protein synthesis, oncogenesis, regeneration, aging, and perhaps diseases of the human cerebellum. Copyright© 2016, International Institute of Anticancer Research (Dr. John G. Delinasios), All rights reserved.
A statistical anomaly indicates symbiotic origins of eukaryotic membranes
Bansal, Suneyna; Mittal, Aditya
2015-01-01
Compositional analyses of nucleic acids and proteins have shed light on possible origins of living cells. In this work, rigorous compositional analyses of ∼5000 plasma membrane lipid constituents of 273 species in the three life domains (archaea, eubacteria, and eukaryotes) revealed a remarkable statistical paradox, indicating symbiotic origins of eukaryotic cells involving eubacteria. For lipids common to plasma membranes of the three domains, the number of carbon atoms in eubacteria was found to be similar to that in eukaryotes. However, mutually exclusive subsets of same data show exactly the opposite—the number of carbon atoms in lipids of eukaryotes was higher than in eubacteria. This statistical paradox, called Simpson's paradox, was absent for lipids in archaea and for lipids not common to plasma membranes of the three domains. This indicates the presence of interaction(s) and/or association(s) in lipids forming plasma membranes of eubacteria and eukaryotes but not for those in archaea. Further inspection of membrane lipid structures affecting physicochemical properties of plasma membranes provides the first evidence (to our knowledge) on the symbiotic origins of eukaryotic cells based on the “third front” (i.e., lipids) in addition to the growing compositional data from nucleic acids and proteins. PMID:25631820
Feldman, Sanford H; Ntenda, Abraham M
2011-01-01
We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574
Lupus autoantibodies target ribosomal P proteins
1985-01-01
All nine SLE (systemic lupus erythematosus) sera with antiribosomal antibody activity targeted the same three ribosomal protein antigens, of molecular masses 38 and 17/19 kD when analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blotting. One serum reacted with an additional protein of approximately kD. Ribosomal subunit fractionation by composite gel electrophoresis and sucrose density ultracentrifugation showed that these proteins were part of the large subunit. Isoelectric focusing in agarose, and two-dimensional polyacrylamide gel electrophoresis revealed that the antigens had pI between 4.5 and 6.5, but that the 17/19 kD antigens were more acidic than the 38 kD antigen. Similarities in the molecular masses, charges, as well as the presence of highly conserved crossreactive epitopes, failure to bind to carboxymethylcellulose at pH 4.2, and extractability of the 17/19 kD proteins by 400 mM NH4Cl-ethanol at 0 degrees C indicated that these antigens were analogous to the proteins P0 (38 kD) and P1/P2 (17/19 kD) described previously (25, 36). Co-identity was confirmed using reference antibodies and antigen. Although antibodies to these proteins were only found in 5-10% of more than 50 sera screened by radioimmunoassay or Western blotting, the selective production of antibodies to epitopes on three (out of a total of more than 80) ribosomal proteins may provide further clues to autoantibody induction of SLE. PMID:2410526
Kiosze-Becker, Kristin; Ori, Alessandro; Gerovac, Milan; Heuer, André; Nürenberg-Goloub, Elina; Rashid, Umar Jan; Becker, Thomas; Beckmann, Roland; Beck, Martin; Tampé, Robert
2016-01-01
Ribosome recycling orchestrated by the ATP binding cassette (ABC) protein ABCE1 can be considered as the final—or the first—step within the cyclic process of protein synthesis, connecting translation termination and mRNA surveillance with re-initiation. An ATP-dependent tweezer-like motion of the nucleotide-binding domains in ABCE1 transfers mechanical energy to the ribosome and tears the ribosome subunits apart. The post-recycling complex (PRC) then re-initiates mRNA translation. Here, we probed the so far unknown architecture of the 1-MDa PRC (40S/30S·ABCE1) by chemical cross-linking and mass spectrometry (XL-MS). Our study reveals ABCE1 bound to the translational factor-binding (GTPase) site with multiple cross-link contacts of the helix–loop–helix motif to the S24e ribosomal protein. Cross-linking of the FeS cluster domain to the ribosomal protein S12 substantiates an extreme lever-arm movement of the FeS cluster domain during ribosome recycling. We were thus able to reconstitute and structurally analyse a key complex in the translational cycle, resembling the link between translation initiation and ribosome recycling. PMID:27824037
The ribosomal subunit assembly line
Dlakić, Mensur
2005-01-01
Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363
Non-AUG translation: a new start for protein synthesis in eukaryotes
Kearse, Michael G.; Wilusz, Jeremy E.
2017-01-01
Although it was long thought that eukaryotic translation almost always initiates at an AUG start codon, recent advancements in ribosome footprint mapping have revealed that non-AUG start codons are used at an astonishing frequency. These non-AUG initiation events are not simply errors but instead are used to generate or regulate proteins with key cellular functions; for example, during development or stress. Misregulation of non-AUG initiation events contributes to multiple human diseases, including cancer and neurodegeneration, and modulation of non-AUG usage may represent a novel therapeutic strategy. It is thus becoming increasingly clear that start codon selection is regulated by many trans-acting initiation factors as well as sequence/structural elements within messenger RNAs and that non-AUG translation has a profound impact on cellular states. PMID:28982758
Yates, J L; Arfsten, A E; Nomura, M
1980-01-01
Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562
HCV-like IRESs displace eIF3 to gain access to the 40S subunit
Hashem, Yaser; des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U.T.; Frank, Joachim
2014-01-01
Hepatitis C virus (HCV) and Classical swine fever virus (CSFV) mRNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5’-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs1. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit2–8, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound Met-tRNAiMet to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF32,5–7,9–12, but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF313 and the HCV IRES8 revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components13. Here, we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Strikingly, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S/IRES binary complex8, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favoring translation of viral mRNAs. PMID:24185006
Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.
Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F
2000-08-01
Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.
25S ribosomal RNA homologies of basidiomycetous yeasts: taxonomic and phylogenetic implications
NASA Technical Reports Server (NTRS)
Baharaeen, S.; Vishniac, H. S.
1984-01-01
Genera, families, and possibly orders of basidiomycetous yeasts can be defined by 25S rRNA homology and correlated phenotypic characters. The teleomorphic genera Filobasidium, Leucosporidium, and Rhodosporidium have greater than 96 relative binding percent (rb%) intrageneric 25S rRNA homology and significant intergeneric separation from each other and from Filobasidiella. The anamorphic genus Cryptococcus can be defined by morphology (monopolar budding), colony color, and greater than 75 rb% intrageneric homology; Vanrija is heterogeneous. Agaricostilbum (Phragmobasidiomycetes, Auriculariales), Hansenula (Ascomycotera, Endomycota), Tremella (Phragmobasidiomycetes, Tremellales), and Ustilago (Ustomycota, Ustilaginales) appear equally unrelated to the Cryptococcus, Filobasidiella, and Rhodosporidium spp. used as probes. The Filobasidiaceae and Sporidiaceae, Filobasidiales and Sporidiales, form coherent homology groups which appear to have undergone convergent 25S rRNA evolution, since their relatedness is much greater than that indicated by 5S rRNA homology. Ribosomal RNA homologies do not appear to measure evolutionary distance.
Metabolism of ribosomal proteins microinjected into the oocytes of Xenopus laevis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tsurugi, K.; Motizuki, M.; Mitsui, K.
1988-01-01
When the total proteins from Xenopus laevis 60 S ribosomal subunits (TP60) were /sup 3/H-labeled in vitro and injected back into X. laevis oocytes, most /sup 3/H-TP60 are integrated into the cytoplasmic 60 S subunits via the nucleus during 16 h of incubation. In the oocytes whose rRNA synthesis is inhibited, /sup 3/H-TP60 are rapidly degraded with a half-life of 2-3 h. This degradation ceased as soon as rRNA synthesis was resumed, suggesting that ribosomal proteins unassociated with nascent rRNA are unstable in the oocytes. The degradation of /sup 3/H-TP60 in the absence of RNA synthesis was inhibited by iodoacetamide,more » a cysteine protease inhibitor, resulting in the accumulation of /sup 3/H-TP60 in the nucleus reaching about a threefold concentration in the cytoplasm. Considering the results with enucleated oocytes, we suggest that the X. laevis nucleus has a limited capacity to accumulate ribosomal proteins in an active manner but that those ribosomal proteins accumulated in excess over rRNA synthesis are degraded by a cysteine protease in the nucleus. By contrast, ribosomal proteins from Escherichia coli only equilibrate between the nucleus and the cytoplasm and are degraded by serine protease(s) in the cytoplasm without being integrated in the form of ribosomes in the nucleus.« less
The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen
2010-04-26
Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less
The fluctuating ribosome: thermal molecular dynamics characterized by neutron scattering
NASA Astrophysics Data System (ADS)
Zaccai, Giuseppe; Natali, Francesca; Peters, Judith; Řihová, Martina; Zimmerman, Ella; Ollivier, J.; Combet, J.; Maurel, Marie-Christine; Bashan, Anat; Yonath, Ada
2016-11-01
Conformational changes associated with ribosome function have been identified by X-ray crystallography and cryo-electron microscopy. These methods, however, inform poorly on timescales. Neutron scattering is well adapted for direct measurements of thermal molecular dynamics, the ‘lubricant’ for the conformational fluctuations required for biological activity. The method was applied to compare water dynamics and conformational fluctuations in the 30 S and 50 S ribosomal subunits from Haloarcula marismortui, under high salt, stable conditions. Similar free and hydration water diffusion parameters are found for both subunits. With respect to the 50 S subunit, the 30 S is characterized by a softer force constant and larger mean square displacements (MSD), which would facilitate conformational adjustments required for messenger and transfer RNA binding. It has been shown previously that systems from mesophiles and extremophiles are adapted to have similar MSD under their respective physiological conditions. This suggests that the results presented are not specific to halophiles in high salt but a general property of ribosome dynamics under corresponding, active conditions. The current study opens new perspectives for neutron scattering characterization of component functional molecular dynamics within the ribosome.
Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.
Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G
1987-11-01
Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.
Endosymbiotic theories for eukaryote origin
Martin, William F.; Garg, Sriram; Zimorski, Verena
2015-01-01
For over 100 years, endosymbiotic theories have figured in thoughts about the differences between prokaryotic and eukaryotic cells. More than 20 different versions of endosymbiotic theory have been presented in the literature to explain the origin of eukaryotes and their mitochondria. Very few of those models account for eukaryotic anaerobes. The role of energy and the energetic constraints that prokaryotic cell organization placed on evolutionary innovation in cell history has recently come to bear on endosymbiotic theory. Only cells that possessed mitochondria had the bioenergetic means to attain eukaryotic cell complexity, which is why there are no true intermediates in the prokaryote-to-eukaryote transition. Current versions of endosymbiotic theory have it that the host was an archaeon (an archaebacterium), not a eukaryote. Hence the evolutionary history and biology of archaea increasingly comes to bear on eukaryotic origins, more than ever before. Here, we have compiled a survey of endosymbiotic theories for the origin of eukaryotes and mitochondria, and for the origin of the eukaryotic nucleus, summarizing the essentials of each and contrasting some of their predictions to the observations. A new aspect of endosymbiosis in eukaryote evolution comes into focus from these considerations: the host for the origin of plastids was a facultative anaerobe. PMID:26323761
The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...
Cis-regulatory RNA elements that regulate specialized ribosome activity.
Xue, Shifeng; Barna, Maria
2015-01-01
Recent evidence has shown that the ribosome itself can play a highly regulatory role in the specialized translation of specific subpools of mRNAs, in particular at the level of ribosomal proteins (RP). However, the mechanism(s) by which this selection takes place has remained poorly understood. In our recent study, we discovered a combination of unique RNA elements in the 5'UTRs of mRNAs that allows for such control by the ribosome. These mRNAs contain a Translation Inhibitory Element (TIE) that inhibits general cap-dependent translation, and an Internal Ribosome Entry Site (IRES) that relies on a specific RP for activation. The unique combination of an inhibitor of general translation and an activator of specialized translation is key to ribosome-mediated control of gene expression. Here we discuss how these RNA regulatory elements provide a new level of control to protein expression and their implications for gene expression, organismal development and evolution.
Macrolide antibiotic interaction and resistance on the bacterial ribosome.
Poehlsgaard, Jacob; Douthwaite, Stephen
2003-02-01
Our understanding of the fine structure of many antibiotic target sites has reached a new level of enlightenment in the last couple of years due to the advent, by X-ray crystallography, of high-resolution structures of the bacterial ribosome. Many classes of clinically useful antibiotics bind to the ribosome to inhibit bacterial protein synthesis. Macrolide, lincosamide and streptogramin B (MLSB) antibiotics form one of the largest groups, and bind to the same site on the 50S ribosomal subunit. Here, we review the molecular details of the ribosomal MLSB site to put into perspective the main points from a wealth of biochemical and genetic data that have been collected over several decades. The information is now available to understand, at atomic resolution, how macrolide antibiotics interact with their ribosomal target, how the target is altered to confer resistance, and in which directions we need to look if we are to rationally design better drugs to overcome the extant resistance mechanisms.
A Synthetic Biology Framework for Programming Eukaryotic Transcription Functions
Khalil, Ahmad S.; Lu, Timothy K.; Bashor, Caleb J.; Ramirez, Cherie L.; Pyenson, Nora C.; Joung, J. Keith; Collins, James J.
2013-01-01
SUMMARY Eukaryotic transcription factors (TFs) perform complex and combinatorial functions within transcriptional networks. Here, we present a synthetic framework for systematically constructing eukaryotic transcription functions using artificial zinc fingers, modular DNA-binding domains found within many eukaryotic TFs. Utilizing this platform, we construct a library of orthogonal synthetic transcription factors (sTFs) and use these to wire synthetic transcriptional circuits in yeast. We engineer complex functions, such as tunable output strength and transcriptional cooperativity, by rationally adjusting a decomposed set of key component properties, e.g., DNA specificity, affinity, promoter design, protein-protein interactions. We show that subtle perturbations to these properties can transform an individual sTF between distinct roles (activator, cooperative factor, inhibitory factor) within a transcriptional complex, thus drastically altering the signal processing behavior of multi-input systems. This platform provides new genetic components for synthetic biology and enables bottom-up approaches to understanding the design principles of eukaryotic transcriptional complexes and networks. PMID:22863014
Chen, Zhong; Jolley, Blair; Caldwell, Christian; Gallie, Daniel R.
2014-01-01
The eukaryotic translation initiation factor (eIF) 4G is a scaffold protein that organizes the assembly of those initiation factors needed to recruit the 40 S ribosomal subunit to an mRNA. Plants, like many eukaryotes, express two eIF4G isoforms. eIFiso4G, one of the isoforms specific to plants, is unique among eukaryotic eIF4G proteins in that it is highly divergent and unusually small in size, raising the possibility of functional specialization. In this study, the role of eIFiso4G in plant growth was investigated using null mutants for the eIF4G isoforms in Arabidopsis. eIFiso4G loss of function mutants exhibited smaller cell, leaf, plant size, and biomass accumulation that correlated with its reduced photosynthetic activity, phenotypes not observed with the eIF4G loss of function mutant. Although no change in photorespiration or dark respiration was observed in the eIFiso4G loss of function mutant, a reduction in chlorophyll levels and an increase in the level of nonphotochemical quenching were observed. An increase in xanthophyll cycle activity and the generation of reactive oxygen species contributed to the qE and qI components of nonphotochemical quenching, respectively. An increase in the transcript and protein levels of violaxanthin de-epoxidase in the eIFiso4G loss of function mutant and an increase in its xanthophyll de-epoxidation state correlated with the higher qE associated with loss of eIFiso4G expression. These observations indicate that eIFiso4G expression is required to regulate violaxanthin de-epoxidase expression and to support photosynthetic activity. PMID:24706761
Chen, Jun; Fujino, Rika; Zhao, Rui; Semba, Umeko; Araki, Kimi; Yamamoto, Tetsuro
2014-11-01
Sera of human, guinea pig or mouse contain a strong monocyte chemoattractant capacity that is attributed to the ribosomal protein S19 (RP S19) oligomers generated during blood coagulation. In contrast, sera prepared from Gln137Glu-RP S19 gene knock-in mice contained negligible chemoattractant capacity. When coagula that had been pre-formed from the blood of both the wild type and knock-in mice were intraperitoneally inserted into host mice, after 3 days of recovery, the knock-in mouse coagula remained larger than the wild type mouse coagula. The wild type mouse coagula were covered by multiple macrophage layers at the surface and were infiltrated inside by macrophages. Knock-in mouse coagula exhibited less macrophage involvement. When coagula of knock-in mice and coagula of knock-in mice containing C5a/RP S19, an artificial substitute of the RP S19 oligomers, were intraperitoneally inserted as pairs, the C5a/RP S19 containing coagulum was more rapidly absorbed, concomitant with increased macrophage involvement. Finally, when the knock-in mouse and wild type mouse coagula pairs were inserted into mice in which macrophages had been depleted using clodronate liposome, the size difference of recovered coagula was reversed. These results indicate the importance of the RP S19 oligomer-induced macrophage recruitment in coagulum resorption. © 2014 Japanese Society of Pathology and Wiley Publishing Asia Pty Ltd.
Lill, R; Robertson, J M; Wintermeyer, W
1989-01-01
A key event in ribosomal protein synthesis is the translocation of deacylated tRNA, peptidyl tRNA and mRNA, which is catalyzed by elongation factor G (EF-G) and requires GTP. To address the molecular mechanism of the reaction we have studied the functional role of a tRNA exit site (E site) for tRNA release during translocation. We show that modifications of the 3' end of tRNAPhe, which considerably decrease the affinity of E-site binding, lower the translocation rate up to 40-fold. Furthermore, 3'-end modifications lower or abolish the stimulation by P site-bound tRNA of the GTPase activity of EF-G on the ribosome. The results suggest that a hydrogen-bonding interaction of the 3'-terminal adenine of the leaving tRNA in the E site, most likely base-pairing with 23S rRNA, is essential for the translocation reaction. Furthermore, this interaction stimulates the GTP hydrolyzing activity of EF-G on the ribosome. We propose the following molecular model of translocation: after the binding of EF-G.GTP, the P site-bound tRNA, by a movement of the 3'-terminal single-stranded ACCA tail, establishes an interaction with 23S rRNA in the adjacent E site, thereby initiating the tRNA transfer from the P site to the E site and promoting GTP hydrolysis. The co-operative interaction between the E site and the EF-G binding site, which are distantly located on the 50S ribosomal subunit, is probably mediated by a conformational change of 23S rRNA. PMID:2583120
Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448
Li, Bin; Pacey, Marissa P.
2017-01-01
We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308
Synthesis, Delivery and Regulation of Eukaryotic Heme and Fe-S Cluster Cofactors
Barupala, Dulmini P.; Dzul, Stephen P.; Riggs-Gelasco, Pamela Jo; Stemmler, Timothy L.
2016-01-01
In humans, the bulk of iron in the body (over 75%) is directed towards heme- or Fe-S cluster cofactor synthesis, and the complex, highly regulated pathways in place to accomplish biosynthesis have evolved to safely assemble and load these cofactors into apoprotein partners. In eukaryotes, heme biosynthesis is both initiated and finalized within the mitochondria, while cellular Fe-S cluster assembly is controlled by correlated pathways both within the mitochondria and within the cytosol. Iron plays a vital role in a wide array of metabolic processes and defects in iron cofactor assembly leads to human diseases. This review describes progress towards our molecular-level understanding of cellular heme and Fe-S cluster biosynthesis, focusing on the regulation and mechanistic details that are essential for understanding human disorders related to the breakdown in these essential pathways. PMID:26785297
Phosphorylation of ribosomal protein S6 mediates compensatory renal hypertrophy
Xu, Jinxian; Chen, Jianchun; Dong, Zheng; Meyuhas, Oded; Chen, Jian-Kang
2014-01-01
The molecular mechanism underlying renal hypertrophy and progressive nephron damage remains poorly understood. Here we generated congenic ribosomal protein S6 (rpS6) knockin mice expressing non-phosphorylatable rpS6 and found that uninephrectomy-induced renal hypertrophy was significantly blunted in these knockin mice. Uninephrectomy-induced increases in cyclin D1 and decreases in cyclin E in the remaining kidney were attenuated in the knockin mice compared to their wild-type littermates. Uninephrectomy induced rpS6 phosphorylation in the wild type mice; however, no rpS6 phosphorylation was detected in uninephrectomized or sham-operated knockin mice. Nonetheless, uninephrectomy stimulated comparable 4E-BP1 phosphorylation in both knockin and wild type mice, indicating that mTORC1 was still activated in the knockin mice. Moreover, the mTORC1 inhibitor rapamycin prevented both rpS6 and 4E-BP1 phosphorylation, significantly blunted uninephrectomy-induced renal hypertrophy in wild type mice, but did not prevent residual renal hypertrophy despite inhibiting 4E-BP1 phosphorylation in uninephrectomized knockin mice. Thus, both genetic and pharmacological approaches unequivocally demonstrate that phosphorylated rpS6 is a downstream effector of the mTORC1-S6K1 signaling pathway mediating renal hypertrophy. Hence, rpS6 phosphorylation facilitates the increase in cyclin D1 and decrease in cyclin E1 that underlie the hypertrophic nature of uninephrectomy-induced kidney growth. PMID:25229342
Graham, Linda E; Knack, Jennifer J; Graham, Melissa E; Graham, James M; Zulkifly, Shahrizim
2015-06-01
Periphyton dominated by the cellulose-rich filamentous green alga Cladophora forms conspicuous growths along rocky marine and freshwater shorelines worldwide, providing habitat for diverse epibionts. Bacterial epibionts have been inferred to display diverse functions of biogeochemical significance: N-fixation and other redox reactions, phosphorus accumulation, and organic degradation. Here, we report taxonomic diversity of eukaryotic and prokaryotic epibionts and diversity of genes associated with materials cycling in a Cladophora metagenome sampled from Lake Mendota, Dane Co., WI, USA, during the growing season of 2012. A total of 1,060 distinct 16S, 173 18S, and 351 28S rRNA operational taxonomic units, from which >220 genera or species of bacteria (~60), protists (~80), fungi (6), and microscopic metazoa (~80), were distinguished with the use of reference databases. We inferred the presence of several algal taxa generally associated with marine systems and detected Jaoa, a freshwater periphytic ulvophyte previously thought endemic to China. We identified six distinct nifH gene sequences marking nitrogen fixation, >25 bacterial and eukaryotic cellulases relevant to sedimentary C-cycling and technological applications, and genes encoding enzymes in aerobic and anaerobic pathways for vitamin B12 biosynthesis. These results emphasize the importance of Cladophora in providing habitat for microscopic metazoa, fungi, protists, and bacteria that are often inconspicuous, yet play important roles in ecosystem biogeochemistry. © 2015 Phycological Society of America.
The Vaginal Eukaryotic DNA Virome and Preterm Birth.
Wylie, Kristine M; Wylie, Todd N; Cahill, Alison G; Macones, George A; Tuuli, Methodius G; Stout, Molly J
2018-05-05
Despite decades of attempts to link infectious agents to preterm birth, an exact causative microbe or community of microbes remains elusive. Culture-independent sequencing of vaginal bacterial communities demonstrates community characteristics are associated with preterm birth, although none are specific enough to apply clinically. Viruses are important components of the vaginal microbiome and have dynamic relationships with vaginal bacterial communities. We hypothesized that vaginal eukaryotic DNA viral communities (the "vaginal virome") either alone or in the context of bacterial communities are associated with preterm birth. The objective of this study was to use high-throughput sequencing to examine the vaginal eukaryotic DNA virome in a cohort of pregnant women and examine associations between vaginal community characteristics and preterm birth. This is a nested case-control study within a prospective cohort study of women with singleton pregnancies, not on supplemental progesterone, and without cervical cerclage in situ. Serial mid-vaginal swabs were obtained at routine prenatal visits. DNA was extracted, bacterial communities were characterized by 16S rRNA gene sequencing, and eukaryotic viral communities were characterized by enrichment of viral nucleic acid with the ViroCap targeted sequence capture panel followed by nucleic acid sequencing. Viral communities were analyzed according to presence/absence of viruses, diversity, dynamics over time, and association with bacterial community data obtained from the same specimens. Sixty subjects contributed 128 vaginal swabs longitudinally across pregnancy. Twenty-four patients delivered preterm. Participants were predominantly African-American (65%). Six families of eukaryotic DNA viruses were detected in the vaginal samples. At least 1 virus was detected in 80% of women. No specific virus or group of viruses was associated with preterm delivery. Higher viral richness was significantly associated with preterm
Modelling toxin effects on protein biosynthesis in eukaryotic cells.
Skakauskas, Vladas; Katauskis, Pranas
2017-08-01
We present a rather generic model for toxin (ricin) inhibition of protein biosynthesis in eukaryotic cells. We also study reduction of the ricin toxic effects with application of antibodies against the RTB subunit of ricin molecules. Both species initially are delivered extracellularly. The model accounts for the pinocytotic and receptor-mediated toxin endocytosis and the intact toxin exocytotic removal out of the cell. The model also includes the lysosomal toxin destruction, the intact toxin motion to the endoplasmic reticulum (ER) for separation of its molecules into the RTA and RTB subunits, and the RTA chain translocation into the cytosol. In the cytosol, one portion of the RTA undergoes degradation via the ERAD. The other its portion can inactivate ribosomes at a large rate. The model is based on a system of deterministic ODEs. The influence of the kinetic parameters on the protein concentration and antibody protection factor is studied in detail. Copyright © 2017 Elsevier Ltd. All rights reserved.
Picking, W D; Hackstadt, T; Paretsky, D
1989-01-01
Guinea pig endotoxicosis induced by lipopolysaccharide from Coxiella burnetii Nine Mile phase I stimulates phosphorylation of liver ribosomal protein S6, with a 50% increase at 12 h postinoculation. The responsible protein kinase (S6PK) has been partially purified from liver; its activity is independent of cyclic AMP and of Ca2+ plus phosphatidyl serine or diacylglycerol. The preparation has an apparent optimum concentration of 20 mM Mg2+, while Ca2+ and Mn2+ are each inhibitory at 2 mM. The apparent Km for ATP is 30 microM with intact ribosomes. Because of the central role of phosphorylation in metabolic regulation and a purported role of phosphorylated S6 in protein synthesis, the lipopolysaccharide-induced stimulation of S6PK suggests a significant regulatory role of such enzymes in the pathobiochemistry of Q fever infection and endotoxicosis. Images PMID:2807543
Hellyer, Nathan J.; Nokleby, Jessica J.; Thicke, Bethany M.; Zhan, Wen-Zhi; Sieck, Gary C.; Mantilla, Carlos B.
2011-01-01
The purpose of the present study was to investigate moderate intensity progressive resistance exercise (PRE) in growing adolescent rats and its effect on muscle hypertrophy (defined as an increase in fiber cross-sectional area). We hypothesized that in adolescent animals moderate intensity PRE would increase: 1) fiber cross-sectional area (CSA); 2) myosin heavy chain (MyHC) content; and 3) expression and phosphorylation of cell signaling molecules involved in translational regulation, compared to age-matched sedentary controls (SED). In the PRE group, three-week old male rats were trained to climb a vertical ladder as a mode of PRE training such that by 10 weeks, all animals in the PRE group had progressed to carry an additional 80% of body weight per climb. In agreement with our hypotheses, we observed that 10 weeks of moderate PRE in adolescent animals was sufficient to increase CSA of muscle fibers and increase MyHC content. Average muscle fiber CSA increased by greater than 10% and total MyHC content increased by 35% (p<0.05) in the PRE group compared to SED animals. Concurrently, we investigated sustained changes in the expression and phosphorylation of key signaling molecules that are previously identified regulators of hypertrophy in adult animal models. Contrary to our hypotheses, expression and phosphorylation of the translational regulators mTOR and Akt were not increased in the PRE group. In addition, we observed that the ratio of phosphorylated-to-unphosphorylated ribosomal protein S6 (rpS6) was reduced over six-fold in PRE animals (p<0.05) and total rpS6 protein levels were unchanged between PRE and sedentary animals (p>0.05). We conclude that moderate intensity PRE is sufficient to induce muscle hypertrophy in adolescent animals while the signaling mechanisms associated with muscle hypertrophy may differ between growing adolescents and adults. PMID:22614147
Puchta, Olga; Lubas, Michal; Lipinski, Kamil A; Piatkowski, Jakub; Malecki, Michal; Golik, Pawel
2010-04-01
Pentatricopeptide repeat (PPR) proteins form the largest known RNA-binding protein family and are found in all eukaryotes, being particularly abundant in higher plants. PPR proteins localize mostly in mitochondria and chloroplasts, where they modulate organellar genome expression on the post-transcriptional level. The Saccharomyces cerevisiae DMR1 (CCM1, YGR150C) encodes a PPR protein that localizes to mitochondria. Deletion of DMR1 results in a complete and irreversible loss of respiratory capacity and loss of wild-type mtDNA by conversion to rho(-)/rho(0) petites, regardless of the presence of introns in mtDNA. The phenotype of the dmr1Delta mitochondria is characterized by fragmentation of the small subunit mitochondrial rRNA (15S rRNA), that can be reversed by wild-type Dmr1p. Other mitochondrial transcripts, including the large subunit mitochondrial rRNA (21S rRNA), are not affected by the lack of Dmr1p. The purified Dmr1 protein specifically binds to different regions of 15S rRNA in vitro, consistent with the deletion phenotype. Dmr1p is therefore the first yeast PPR protein, which has an rRNA target and is probably involved in the biogenesis of mitochondrial ribosomes and translation.
Characterization of a Novel Association between Two Trypanosome-Specific Proteins and 5S rRNA
Ciganda, Martin; Williams, Noreen
2012-01-01
P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC. PMID:22253864
Chang, F. N.; Flaks, Joel G.
1972-01-01
The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and
Synthesis, delivery and regulation of eukaryotic heme and Fe-S cluster cofactors.
Barupala, Dulmini P; Dzul, Stephen P; Riggs-Gelasco, Pamela Jo; Stemmler, Timothy L
2016-02-15
In humans, the bulk of iron in the body (over 75%) is directed towards heme- or Fe-S cluster cofactor synthesis, and the complex, highly regulated pathways in place to accomplish biosynthesis have evolved to safely assemble and load these cofactors into apoprotein partners. In eukaryotes, heme biosynthesis is both initiated and finalized within the mitochondria, while cellular Fe-S cluster assembly is controlled by correlated pathways both within the mitochondria and within the cytosol. Iron plays a vital role in a wide array of metabolic processes and defects in iron cofactor assembly leads to human diseases. This review describes progress towards our molecular-level understanding of cellular heme and Fe-S cluster biosynthesis, focusing on the regulation and mechanistic details that are essential for understanding human disorders related to the breakdown in these essential pathways. Copyright © 2016 Elsevier Inc. All rights reserved.
The ribosome as a missing link in the evolution of life.
Root-Bernstein, Meredith; Root-Bernstein, Robert
2015-02-21
Many steps in the evolution of cellular life are still mysterious. We suggest that the ribosome may represent one important missing link between compositional (or metabolism-first), RNA-world (or genes-first) and cellular (last universal common ancestor) approaches to the evolution of cells. We present evidence that the entire set of transfer RNAs for all twenty amino acids are encoded in both the 16S and 23S rRNAs of Escherichia coli K12; that nucleotide sequences that could encode key fragments of ribosomal proteins, polymerases, ligases, synthetases, and phosphatases are to be found in each of the six possible reading frames of the 16S and 23S rRNAs; and that every sequence of bases in rRNA has information encoding more than one of these functions in addition to acting as a structural component of the ribosome. Ribosomal RNA, in short, is not just a structural scaffold for proteins, but the vestigial remnant of a primordial genome that may have encoded a self-organizing, self-replicating, auto-catalytic intermediary between macromolecules and cellular life. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
In vitro degradation of ribosomes.
Mora, G; Rivas, A
1976-12-01
The cytoplasmic ribosomes from Euglena gracilis var. bacillaris are found to be of two types taking into consideration their stability "in vitro". In the group of unstable ribosomes the large subunit is degraded. The other group apparently does not suffer any degradation under the conditions described. However the RNAs extracted from both types of ribosomes are degraded during sucrose density gradients. The degradation of the largest RNA species has been reported previously, but no comment has been made about the stability of the ribosome itself.
Evolutionary connections of biological kingdoms based on protein and nucleic acid sequence evidence
NASA Technical Reports Server (NTRS)
Dayhoff, M. O.
1983-01-01
Prokaryotic and eukaryotic evolutionary trees are developed from protein and nucleic-acid sequences by the methods of numerical taxonomy. Trees are presented for bacterial ferredoxins, 5S ribosomal RNA, c-type cytochromes , cytochromes c2 and c', and 5.8S ribosomal RNA; the implications for early evolution are discussed; and a composite tree showing the branching of the anaerobes, aerobes, archaebacteria, and eukaryotes is shown. Single lines are found for all oxygen-evolving photosynthetic forms and for the salt-loving and high-temperature forms of archaebacteria. It is argued that the eukaryote mitochondria, chloroplasts, and cytoplasmic host material are descended from free-living prokaryotes that formed symbiotic associations, with more than one symbiotic event involved in the evolution of each organelle.
Fan, Yi; Dai, Yazhuang; Hou, Meijing; Wang, Huilin; Yao, Hongwei; Guo, Chenyun; Lin, Donghai; Liao, Xinli
2017-05-27
Ribosomal protein S1 (RpsA), the largest 30S protein in ribosome, plays a significant role in translation and trans-translation. In Mycobacterium tuberculosis, the C-terminus of RpsA is known as tuberculosis drug target of pyrazinoic acid, which inhibits the interaction between MtRpsA and tmRNA in trans-translation. However, the molecular mechanism underlying the interaction of MtRpsA with tmRNA remains unknown. We herein analyzed the interaction of the C-terminal domain of MtRpsA with three RNA fragments poly(A), sMLD and pre-sMLD. NMR titration analysis revealed that the RNA binding sites on MtRpsA CTD are mainly located in the β2, β3 and β5 strands and the adjacent L3 loop of the S1 domain. Fluorescence experiments determined the MtRpsA CTD binding to RNAs are in the micromolar affinity range. Sequence analysis also revealed conserved residues in the mapped RNA binding region. Residues L304, V305, G308, F310, H322, I323, R357 and I358 were verified to be the key residues influencing the interaction between MtRpsA CTD and pre-sMLD. Molecular docking further confirmed that the poly(A)-like sequence and sMLD of tmRNA are all involved in the protein-RNA interaction, through charged interaction and hydrogen bonds. The results will be beneficial for designing new anti-tuberculosis drugs. Copyright © 2017 Elsevier Inc. All rights reserved.
Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S
2008-07-01
Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.
Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site
Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard
2018-01-01
Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred
Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B
1982-01-01
1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129
Inhibition of eukaryotic translation elongation by the antitumor natural product Mycalamide B.
Dang, Yongjun; Schneider-Poetsch, Tilman; Eyler, Daniel E; Jewett, John C; Bhat, Shridhar; Rawal, Viresh H; Green, Rachel; Liu, Jun O
2011-08-01
Mycalamide B (MycB) is a marine sponge-derived natural product with potent antitumor activity. Although it has been shown to inhibit protein synthesis, the molecular mechanism of action by MycB remains incompletely understood. We verified the inhibition of translation elongation by in vitro HCV IRES dual luciferase assays, ribosome assembly, and in vivo [(35)S]methinione labeling experiments. Similar to cycloheximide (CHX), MycB inhibits translation elongation through blockade of eEF2-mediated translocation without affecting the eEF1A-mediated loading of tRNA onto the ribosome, AUG recognition, or dipeptide synthesis. Using chemical footprinting, we identified the MycB binding site proximal to the C3993 28S rRNA residue on the large ribosomal subunit. However, there are also subtle, but significant differences in the detailed mechanisms of action of MycB and CHX. First, MycB arrests the ribosome on the mRNA one codon ahead of CHX. Second, MycB specifically blocked tRNA binding to the E-site of the large ribosomal subunit. Moreover, they display different polysome profiles in vivo. Together, these observations shed new light on the mechanism of inhibition of translation elongation by MycB.
Symbiosis in eukaryotic evolution.
López-García, Purificación; Eme, Laura; Moreira, David
2017-12-07
Fifty years ago, Lynn Margulis, inspiring in early twentieth-century ideas that put forward a symbiotic origin for some eukaryotic organelles, proposed a unified theory for the origin of the eukaryotic cell based on symbiosis as evolutionary mechanism. Margulis was profoundly aware of the importance of symbiosis in the natural microbial world and anticipated the evolutionary significance that integrated cooperative interactions might have as mechanism to increase cellular complexity. Today, we have started fully appreciating the vast extent of microbial diversity and the importance of syntrophic metabolic cooperation in natural ecosystems, especially in sediments and microbial mats. Also, not only the symbiogenetic origin of mitochondria and chloroplasts has been clearly demonstrated, but improvement in phylogenomic methods combined with recent discoveries of archaeal lineages more closely related to eukaryotes further support the symbiogenetic origin of the eukaryotic cell. Margulis left us in legacy the idea of 'eukaryogenesis by symbiogenesis'. Although this has been largely verified, when, where, and specifically how eukaryotic cells evolved are yet unclear. Here, we shortly review current knowledge about symbiotic interactions in the microbial world and their evolutionary impact, the status of eukaryogenetic models and the current challenges and perspectives ahead to reconstruct the evolutionary path to eukaryotes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Huang, Shijie; Zhu, Xuechen; Melançon, Charles E
2016-01-15
The ribosome is the quintessential antibacterial drug target, with many structurally and mechanistically distinct classes of antibacterial agents acting by inhibiting ribosome function. Detecting and quantifying ribosome inhibition by small molecules and investigating their binding modes and mechanisms of action are critical to antibacterial drug discovery and development efforts. To develop a ribosome inhibition assay that is operationally simple, yet provides direct information on the drug target and the mechanism of action, we have developed engineered E. coli strains harboring an orthogonal ribosome-controlled green fluorescent protein (GFP) reporter that produce fluorescent signal when the orthogonal ribosome is inhibited. As a proof of concept, we demonstrate that these strains, when coexpressing homogeneous populations of aminoglycoside resistant ribosomes, act as sensitive and quantitative detectors of ribosome inhibition by a set of 12 structurally diverse aminoglycoside antibiotics. We suggest that this strategy can be extended to quantifying ribosome inhibition by other drug classes.
Censusing marine eukaryotic diversity in the twenty-first century
Knowlton, Nancy
2016-01-01
The ocean constitutes one of the vastest and richest biomes on our planet. Most recent estimations, all based on indirect approaches, suggest that there are millions of marine eukaryotic species. Moreover, a large majority of these are small (less than 1 mm), cryptic and still unknown to science. However, this knowledge gap, caused by the lack of diagnostic morphological features in small organisms and the limited sampling of the global ocean, is currently being filled, thanks to new DNA-based approaches. The molecular technique of PCR amplification of homologous gene regions combined with high-throughput sequencing, routinely used to census unculturable prokaryotes, is now also being used to characterize whole communities of marine eukaryotes. Here, we review how this methodological advancement has helped to better quantify the magnitude and patterns of marine eukaryotic diversity, with an emphasis on taxonomic groups previously largely overlooked. We then discuss obstacles remaining to achieve a global understanding of marine eukaryotic diversity. In particular, we argue that 18S variable regions do not provide sufficient taxonomic resolution to census marine life, and suggest combining broad eukaryotic surveys targeting the 18S rRNA region with more taxon-focused analyses of hypervariable regions to improve our understanding of the diversity of species, the functional units of marine ecosystems. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481783
Fedyukina, Daria V.; Jennaro, Theodore S.; Cavagnero, Silvia
2014-01-01
Ribosomes are large and highly charged macromolecular complexes consisting of RNA and proteins. Here, we address the electrostatic and nonpolar properties of ribosomal proteins that are important for ribosome assembly and interaction with other cellular components and may influence protein folding on the ribosome. We examined 50 S ribosomal subunits from 10 species and found a clear distinction between the net charge of ribosomal proteins from halophilic and non-halophilic organisms. We found that ∼67% ribosomal proteins from halophiles are negatively charged, whereas only up to ∼15% of ribosomal proteins from non-halophiles share this property. Conversely, hydrophobicity tends to be lower for ribosomal proteins from halophiles than for the corresponding proteins from non-halophiles. Importantly, the surface electrostatic potential of ribosomal proteins from all organisms, especially halophiles, has distinct positive and negative regions across all the examined species. Positively and negatively charged residues of ribosomal proteins tend to be clustered in buried and solvent-exposed regions, respectively. Hence, the majority of ribosomal proteins is characterized by a significant degree of intramolecular charge segregation, regardless of the organism of origin. This key property enables the ribosome to accommodate proteins within its complex scaffold regardless of their overall net charge. PMID:24398678
Sugihara, Yoshihiko; Honda, Hiroki; Iida, Tomoharu; Morinaga, Takuma; Hino, Shingo; Okajima, Tetsuya; Matsuda, Tsukasa; Nadano, Daita
2010-03-05
Heterogeneity of ribosome structure, due to variations in ribosomal protein composition, has been shown to be of physiological significance in plants and yeast. Mammalian genomics have demonstrated numerous genes that are paralogous to genes encoding ribosomal proteins. Although the vast majority are considered to be pseudogenes, mRNA expression of a few paralogues, such as human ribosomal protein L39-like/L39-2, has been reported. In the present study, ribosomes from the liver, mammary gland, and testis of rodents were analyzed using a combination of two-dimensional gel electrophoresis under radical-free and highly reducing conditions, and mass spectrometry. This system allowed identification of 78 ribosomal proteins and Rack1 from a single gel. The degree of heterogeneity was far less than that reported for plant and yeast ribosomes, and was in accord with published biochemical and genetic data for mammalian ribosomes. Nevertheless, an uncharacterized paralogue of ribosomal protein L22, ribosomal protein L22-like 1, was identified as a minor ribosomal component. Ribosomal proteins L10-like and L39-like, paralogues of ribosomal proteins L10 and L39, respectively, were found in ribosomes only from the testis. Reverse transcription-polymerase chain reaction yielded supportive evidence for specific expression of L10-like and L39-like in the testis. Newly synthesized L39-like is likely to be transported to the nucleolus, where ribosome biosynthesis occurs, and then incorporated into translating ribosomes in the cytoplasm. Heterogeneity of mammalian testicular ribosomes is structurally non-negligible, and may offer valuable insights into the function of the customized ribosome.
Peeling the onion: ribosomes are ancient molecular fossils.
Hsiao, Chiaolong; Mohan, Srividya; Kalahar, Benson K; Williams, Loren Dean
2009-11-01
We describe a method to establish chronologies of ancient ribosomal evolution. The method uses structure-based and sequence-based comparison of the large subunits (LSUs) of Haloarcula marismortui and Thermus thermophilus. These are the highest resolution ribosome structures available and represent disparate regions of the evolutionary tree. We have sectioned the superimposed LSUs into concentric shells, like an onion, using the site of peptidyl transfer as the origin (the PT-origin). This spherical approximation combined with a shell-by-shell comparison captures significant information along the evolutionary time line revealing, for example, that sequence and conformational similarity of the 23S rRNAs are greatest near the PT-origin and diverge smoothly with distance from it. The results suggest that the conformation and interactions of both RNA and protein can be described as changing, in an observable manner, over evolutionary time. The tendency of macromolecules to assume regular secondary structural elements such as A-form helices with Watson-Crick base pairs (RNA) and alpha-helices and beta-sheets (protein) is low at early time points but increases as time progresses. The conformations of ribosomal protein components near the PT-origin suggest that they may be molecular fossils of the peptide ancestors of ribosomal proteins. Their abbreviated length may have proscribed formation of secondary structure, which is indeed nearly absent from the region of the LSU nearest the PT-origin. Formation and evolution of the early PT center may have involved Mg(2+)-mediated assembly of at least partially single-stranded RNA oligomers or polymers. As one moves from center to periphery, proteins appear to replace magnesium ions. The LSU is known to have undergone large-scale conformation changes upon assembly. The T. thermophilus LSU analyzed here is part of a fully assembled ribosome, whereas the H. marismortui LSU analyzed here is dissociated from other ribosomal components
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeSantis, Todd Z.; Stone, Carol E.; Murray, Sonya R.
2005-02-22
A microarray has been designed using 62,358 probes matched to both prokaryotic and eukaryotic small-subunit ribosomal RNA genes. The array categorized environmental DNA to specific phylogenetic clusters in under 9 h. To a background of DNA generated from natural outdoor aerosols, known quantities of rRNA gene copies from distinct organisms were added producing corresponding hybridization intensity scores that correlated well with their concentrations (r=0.917). Reproducible differences in microbial community composition were observed by altering the genomic DNA extraction method. Notably, gentle extractions produced peak intensities for Mycoplasmatales and Burkholderiales, whereas a vigorous disruption produced peak intensities for Vibrionales,Clostridiales, and Bacillales.
RRP1B Targets PP1 to Mammalian Cell Nucleoli and Is Associated with Pre-60S Ribosomal Subunits
Chamousset, Delphine; De Wever, Veerle; Moorhead, Greg B.; Chen, Yan; Boisvert, Francois-Michel; Lamond, Angus I.
2010-01-01
A pool of protein phosphatase 1 (PP1) accumulates within nucleoli and accounts for a large fraction of the serine/threonine protein phosphatase activity in this subnuclear structure. Using a combination of fluorescence imaging with quantitative proteomics, we mapped the subnuclear localization of the three mammalian PP1 isoforms stably expressed as GFP-fusions in live cells and identified RRP1B as a novel nucleolar targeting subunit that shows a specificity for PP1β and PP1γ. RRP1B, one of two mammalian orthologues of the yeast Rrp1p protein, shows an RNAse-dependent localization to the granular component of the nucleolus and distributes in a similar manner throughout the cell cycle to proteins involved in later steps of rRNA processing. Quantitative proteomic analysis of complexes containing both RRP1B and PP1γ revealed enrichment of an overlapping subset of large (60S) ribosomal subunit proteins and pre-60S nonribosomal proteins involved in mid-late processing. Targeting of PP1 to this complex by RRP1B in mammalian cells is likely to contribute to modulation of ribosome biogenesis by mechanisms involving reversible phosphorylation events, thus playing a role in the rapid transduction of cellular signals that call for regulation of ribosome production in response to cellular stress and/or changes in growth conditions. PMID:20926688
Unitary circular code motifs in genomes of eukaryotes.
El Soufi, Karim; Michel, Christian J
A set X of 20 trinucleotides was identified in genes of bacteria, eukaryotes, plasmids and viruses, which has in average the highest occurrence in reading frame compared to its two shifted frames (Michel, 2015; Arquès and Michel, 1996). This set X has an interesting mathematical property as X is a circular code (Arquès and Michel, 1996). Thus, the motifs from this circular code X, called X motifs, have the property to always retrieve, synchronize and maintain the reading frame in genes. The origin of this circular code X in genes is an open problem since its discovery in 1996. Here, we first show that the unitary circular codes (UCC), i.e. sets of one word, allow to generate unitary circular code motifs (UCC motifs), i.e. a concatenation of the same motif (simple repeats) leading to low complexity DNA. Three classes of UCC motifs are studied here: repeated dinucleotides (D + motifs), repeated trinucleotides (T + motifs) and repeated tetranucleotides (T + motifs). Thus, the D + , T + and T + motifs allow to retrieve, synchronize and maintain a frame modulo 2, modulo 3 and modulo 4, respectively, and their shifted frames (1 modulo 2; 1 and 2 modulo 3; 1, 2 and 3 modulo 4 according to the C 2 , C 3 and C 4 properties, respectively) in the DNA sequences. The statistical distribution of the D + , T + and T + motifs is analyzed in the genomes of eukaryotes. A UCC motif and its comp lementary UCC motif have the same distribution in the eukaryotic genomes. Furthermore, a UCC motif and its complementary UCC motif have increasing occurrences contrary to their number of hydrogen bonds, very significant with the T + motifs. The longest D + , T + and T + motifs in the studied eukaryotic genomes are also given. Surprisingly, a scarcity of repeated trinucleotides (T + motifs) in the large eukaryotic genomes is observed compared to the D + and T + motifs. This result has been investigated and may be explained by two outcomes. Repeated trinucleotides (T + motifs) are identified
A 5.8S nuclear ribosomal RNA gene sequence database: applications to ecology and evolution
NASA Technical Reports Server (NTRS)
Cullings, K. W.; Vogler, D. R.
1998-01-01
We complied a 5.8S nuclear ribosomal gene sequence database for animals, plants, and fungi using both newly generated and GenBank sequences. We demonstrate the utility of this database as an internal check to determine whether the target organism and not a contaminant has been sequenced, as a diagnostic tool for ecologists and evolutionary biologists to determine the placement of asexual fungi within larger taxonomic groups, and as a tool to help identify fungi that form ectomycorrhizae.
Interaction of tetracycline with RNA: photoincorporation into ribosomal RNA of Escherichia coli.
Oehler, R; Polacek, N; Steiner, G; Barta, A
1997-01-01
Photolysis of [3H]tetracycline in the presence of Escherichia coli ribosomes results in an approximately 1:1 ratio of labelling ribosomal proteins and RNAs. In this work we characterize crosslinks to both 16S and 23S RNAs. Previously, the main target of photoincorporation of [3H]tetracycline into ribosomal proteins was shown to be S7, which is also part of the one strong binding site of tetracycline on the 30S subunit. The crosslinks on 23S RNA map exclusively to the central loop of domain V (G2505, G2576 and G2608) which is part of the peptidyl transferase region. However, experiments performed with chimeric ribosomal subunits demonstrate that peptidyltransferase activity is not affected by tetracycline crosslinked solely to the 50S subunits. Three different positions are labelled on the 16S RNA, G693, G1300 and G1338. The positions of these crosslinked nucleotides correlate well with footprints on the 16S RNA produced either by tRNA or the protein S7. This suggests that the nucleotides are labelled by tetracycline bound to the strong binding site on the 30S subunit. In addition, our results demonstrate that the well known inhibition of tRNA binding to the A-site is solely due to tetracycline crosslinked to 30S subunits and furthermore suggest that interactions of the antibiotic with 16S RNA might be involved in its mode of action. PMID:9092632
The gut eukaryotic microbiota influences the growth performance among cohabitating shrimp.
Dai, Wenfang; Yu, Weina; Zhang, Jinjie; Zhu, Jinyong; Tao, Zhen; Xiong, Jinbo
2017-08-01
Increasing evidence has revealed a close interplay between the gut bacterial communities and host growth performance. However, until recently, studies generally ignored the contribution of eukaryotes, endobiotic organisms. To fill this gap, we used Illumina sequencing technology on eukaryotic 18S rRNA gene to compare the structures of gut eukaryotic communities among cohabitating retarded, overgrown, and normal shrimp obtained from identically managed ponds. Results showed that a significant difference between gut eukaryotic communities differed significantly between water and intestine and among three shrimp categories. Structural equation modeling revealed that changes in the gut eukaryotic community were positively related to digestive enzyme activities, which in turn influenced shrimp growth performance (λ = 0.97, P < 0.001). Overgrown shrimp exhibited a more complex and cooperative gut eukaryotic interspecies interaction than retarded and normal shrimp, which may facilitate their nutrient acquisition efficiency. Notably, the distribution of dominant eukaryotic genera and shifts in keystone species were closely concordant with shrimp growth performance. In summary, this study provides an integrated overview on direct roles of gut eukaryotic communities in shrimp growth performance instead of well-studied bacterial assembly.
Ribosome Biogenesis in the Yeast Saccharomyces cerevisiae
Woolford, John L.; Baserga, Susan J.
2013-01-01
Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922
Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5.
Vanegas, N; Castañeda, V; Santamaría, D; Hernández, P; Schvartzman, J B; Krimer, D B
1997-06-05
We describe the isolation and characterization of a cDNA encoding the mouse S5 ribosomal protein. It was isolated from a MEL (murine erythroleukemia) cell cDNA library by differential hybridization as a down regulated sequence during HMBA-induced differentiation. Northern series analysis showed that S5 mRNA expression is reduced 5-fold throughout the differentiation process. The mouse S5 mRNA is 760 bp long and encodes for a 204 amino acid protein with 94% homology with the human and rat S5.
Thurlow, D L; Ehresmann, C; Ehresmann, B
1983-01-01
Nucleotides in 16S rRNA which are required in unmodified form for specific recognition of ribosomal protein S8 from Escherichia coli were identified using a damage-selection experimental approach. Prior to complex formation with S8, 16S rRNA was treated under fully denaturing conditions with either diethyl pyrocarbonate or 25% hydrazine. Following separation of bound from unbound fragments of RNA, those associated with S8 were analyzed for their content of modified bases by treatment with aniline. Nucleotides found to be consistently unmodified in such fragments were located near the base of a stable helix (encompassing bases 581-656) or near the apex of the helix on the 3' proximal side. A minor S8 ribonucleoprotein particle was found to contain fragments which extended in the 3' direction to position 671. Images PMID:6356037
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-12-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit.
Perederina, Anna; Nevskaya, Natalia; Nikonov, Oleg; Nikulin, Alexei; Dumas, Philippe; Yao, Min; Tanaka, Isao; Garber, Maria; Gongadze, George; Nikonov, Stanislav
2002-01-01
The crystal structure of ribosomal protein L5 from Thermus thermophilus complexed with a 34-nt fragment comprising helix III and loop C of Escherichia coli 5S rRNA has been determined at 2.5 A resolution. The protein specifically interacts with the bulged nucleotides at the top of loop C of 5S rRNA. The rRNA and protein contact surfaces are strongly stabilized by intramolecular interactions. Charged and polar atoms forming the network of conserved intermolecular hydrogen bonds are located in two narrow planar parallel layers belonging to the protein and rRNA, respectively. The regions, including these atoms conserved in Bacteria and Archaea, can be considered an RNA-protein recognition module. Comparison of the T. thermophilus L5 structure in the RNA-bound form with the isolated Bacillus stearothermophilus L5 structure shows that the RNA-recognition module on the protein surface does not undergo significant changes upon RNA binding. In the crystal of the complex, the protein interacts with another RNA molecule in the asymmetric unit through the beta-sheet concave surface. This protein/RNA interface simulates the interaction of L5 with 23S rRNA observed in the Haloarcula marismortui 50S ribosomal subunit. PMID:12515387
Thermodynamics of the pseudo-knot in helix 18 of 16S ribosomal RNA.
Wojciechowska, Monika; Dudek, Marta; Trylska, Joanna
2018-04-01
A fragment of E. coli 16S rRNA formed by nucleotides 500 to 545 is termed helix 18. Nucleotides 505-507 and 524-526 form a pseudo-knot and its distortion affects ribosome function. Helix 18 isolated from the ribosome context is thus an interesting fragment to investigate the structural properties and folding of RNA with pseudo-knots. With all-atom molecular dynamics simulations, spectroscopic and gel electrophoresis experiments, we investigated thermodynamics of helix 18, with a focus on its pseudo-knot. In solution studies at ambient conditions we observed dimerization of helix 18. We proposed that the loop, containing nucleotides forming the pseudo-knot, interacts with another monomer of helix 18. The native dimer is difficult to break but introducing mutations in the pseudo-knot indeed assured a monomeric form of helix 18. Molecular dynamics simulations at 310 K confirmed the stability of the pseudo-knot but at elevated temperatures this pseudo-knot was the first part of helix 18 to lose the hydrogen bond pattern. To further determine helix 18 stability, we analyzed the interactions of helix 18 with short oligomers complementary to a nucleotide stretch containing the pseudo-knot. The formation of higher-order structures by helix 18 impacts hybridization efficiency of peptide nucleic acid and 2'-O methyl RNA oligomers. © 2018 Wiley Periodicals, Inc.
Abolhassani, Mohsen; Roux, Kenneth H
2009-06-01
Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.
Widespread presence of "bacterial-like" PPP phosphatases in eukaryotes.
Andreeva, Alexandra V; Kutuzov, Mikhail A
2004-11-19
In eukaryotes, PPP (protein phosphatase P) family is one of the two known protein phosphatase families specific for Ser and Thr. The role of PPP phosphatases in multiple signaling pathways in eukaryotic cell has been extensively studied. Unlike eukaryotic PPP phosphatases, bacterial members of the family have broad substrate specificity or may even be Tyr-specific. Moreover, one group of bacterial PPPs are diadenosine tetraphosphatases, indicating that bacterial PPP phosphatases may not necessarily function as protein phosphatases. We describe the presence in eukaryotes of three groups of expressed genes encoding "non-conventional" phosphatases of the PPP family. These enzymes are more closely related to bacterial PPP phosphatases than to the known eukaryotic members of the family. One group, found exclusively in land plants, is most closely related to PPP phosphatases from some alpha-Proteobacteria, including Rhizobiales, Rhodobacterales and Rhodospirillaceae. This group is therefore termed Rhizobiales / Rhodobacterales / Rhodospirillaceae-like phosphatases, or Rhilphs. Phosphatases of the other group are found in Viridiplantae, Rhodophyta, Trypanosomatidae, Plasmodium and some fungi. They are structurally related to phosphatases from psychrophilic bacteria Shewanella and Colwellia, and are termed Shewanella-like phosphatases, or Shelphs. Phosphatases of the third group are distantly related to ApaH, bacterial diadenosine tetraphosphatases, and are termed ApaH-like phosphatases, or Alphs. Patchy distribution of Alphs in animals, plants, fungi, diatoms and kinetoplasts suggests that these phosphatases were present in the common ancestor of eukaryotes but were independently lost in many lineages. Rhilphs, Shelphs and Alphs form PPP clades, as divergent from "conventional" eukaryotic PPP phosphatases as they are from each other and from major bacterial clades. In addition, comparison of primary structures revealed a previously unrecognised (I/L/V)D(S/T)G motif
Yang-Kolodji, Gloria; Mumenthaler, Shannon M; Mehta, Arjun; Ji, Lingyun; Tripathy, Debu
2015-01-01
To identify clinically relevant predictive biomarkers of trastuzumab resistance. MTT, FACS assays, immunoblotting and immunocytochemistry were used to phenotypically characterize drug responses of two cell models BT474R and SKBR3R. Student's t-test and Spearman's correlation were applied for statistic analysis. The activity of a downstream effector of the HER2 pathway phosphorylated ribosomal protein S6 (p-rpS6), was suppressed by trastuzumab in the parental cell lines yet remained unchanged in the resistant cells following treatment. The level of p-rpS6 was inversely correlated to the drug induced growth inhibition of trastuzumab-resistant cells when they are treated with selected HER2 targeting drugs. p-rpS6 is a robust post-treatment indicator of HER2 pathway-targeted therapy resistance.
Ribosomes in the sea: a window on taxon-specific lysis
NASA Astrophysics Data System (ADS)
Suttle, C.; Zhong, X.; Wirth, J.
2016-02-01
Microbes are estimated to comprise more than 90% of the biomass in the world's oceans, are major drivers of biogeochemical cycles, and have turnover rates ranging from hours to days. Despite the central role that microbes play in marine ecosystems, there is no robust method to evaluate taxon-specific mortality rates. Here, we report a method that employs extracellular free-ribosomes as a proxy to evaluate taxon-specific microbial lysis. The method was validated with laboratory cultures of the marine heterotrophic bacterium Vibrio natriegens strain PWH3a and the photoautotroph Synechococcus strain DC2, with and without grazers or viruses, to identify the origin and fate of the extracellular free-ribosomes. Our results showed both viral lysis and programmed-cell-death (PCD) contribute to free-ribosome production. Ribosomes were not released when cells were grazed, but grazers could consume free-ribosomes. We show that extracellular free-ribosomes can be used to evaluate microbial mortality caused by viral lysis and PCD. This approach was applied to environmental samples by examining the taxonomic composition and relative abundance of free 16S-ribosomes in seawater samples collected from the Strait of Georgia and Saanich Inlet, British Columbia, Canada. Based on the presence of free ribosomes, lysis was detected in 2198 out of 4013 prokaryotic taxa, representing 22 bacterial and three archaeal phyla. Of these, lysis of 140 taxa could be detected in all nine samples. Based on the ratio of free ribosomes to cellular ribosomes, some taxa associated with specific ecological niches appeared to be subject to high rates of lysis, including the genera Achromobacter, Chryseobacterium, Clostridium, Delftia, Ferruginibacter, Lactobacillus, Marinomonas, Massilia, Microbacterium, Ochrobactrum, Paenibacillus, Phyllobacterium, Pseudomonas, Rhodobacter, and Stenotrophomonas. Our results showed high-lysis coupled with low-abundance, suggesting that taxa in lower abundance are subject
New Universal Rules of Eukaryotic Translation Initiation Fidelity
Zur, Hadas; Tuller, Tamir
2013-01-01
The accepted model of eukaryotic translation initiation begins with the scanning of the transcript by the pre-initiation complex from the 5′end until an ATG codon with a specific nucleotide (nt) context surrounding it is recognized (Kozak rule). According to this model, ATG codons upstream to the beginning of the ORF should affect translation. We perform for the first time, a genome-wide statistical analysis, uncovering a new, more comprehensive and quantitative, set of initiation rules for improving the cost of translation and its efficiency. Analyzing dozens of eukaryotic genomes, we find that in all frames there is a universal trend of selection for low numbers of ATG codons; specifically, 16–27 codons upstream, but also 5–11 codons downstream of the START ATG, include less ATG codons than expected. We further suggest that there is selection for anti optimal ATG contexts in the vicinity of the START ATG. Thus, the efficiency and fidelity of translation initiation is encoded in the 5′UTR as required by the scanning model, but also at the beginning of the ORF. The observed nt patterns suggest that in all the analyzed organisms the pre-initiation complex often misses the START ATG of the ORF, and may start translation from an alternative initiation start-site. Thus, to prevent the translation of undesired proteins, there is selection for nucleotide sequences with low affinity to the pre-initiation complex near the beginning of the ORF. With the new suggested rules we were able to obtain a twice higher correlation with ribosomal density and protein levels in comparison to the Kozak rule alone (e.g. for protein levels r = 0.7 vs. r = 0.31; p<10−12). PMID:23874179
Montacié, Charlotte; Durut, Nathalie; Opsomer, Alison; Palm, Denise; Comella, Pascale; Picart, Claire; Carpentier, Marie-Christine; Pontvianne, Frederic; Carapito, Christine; Schleiff, Enrico; Sáez-Vásquez, Julio
2017-01-01
In all eukaryotic cells, the nucleolus is functionally and structurally linked to rRNA synthesis and ribosome biogenesis. This compartment contains as well factors involved in other cellular activities, but the functional interconnection between non-ribosomal activities and the nucleolus (structure and function) still remains an open question. Here, we report a novel mass spectrometry analysis of isolated nucleoli from Arabidopsis thaliana plants using the FANoS (Fluorescence Assisted Nucleolus Sorting) strategy. We identified many ribosome biogenesis factors (RBF) and proteins non-related with ribosome biogenesis, in agreement with the recognized multi-functionality of the nucleolus. Interestingly, we found that 26S proteasome subunits localize in the nucleolus and demonstrated that proteasome activity and nucleolus organization are intimately linked to each other. Proteasome subunits form discrete foci in the disorganized nucleolus of nuc1.2 plants. Nuc1.2 protein extracts display reduced proteasome activity in vitro compared to WT protein extracts. Remarkably, proteasome activity in nuc1.2 is similar to proteasome activity in WT plants treated with proteasome inhibitors (MG132 or ALLN). Finally, we show that MG132 treatment induces disruption of nucleolar structures in WT but not in nuc1.2 plants. Altogether, our data suggest a functional interconnection between nucleolus structure and proteasome activity. PMID:29104584
Entrapping ribosomes for viral translation: tRNA mimicry as a molecular Trojan horse.
Barends, Sharief; Bink, Hugo H J; van den Worm, Sjoerd H E; Pleij, Cornelis W A; Kraal, Barend
2003-01-10
Turnip yellow mosaic virus (TYMV) has a genomic plus-strand RNA with a 5' cap followed by overlapping and different reading frames for the movement protein and polyprotein, while the distal coat protein cistron is translated from a subgenomic RNA. The 3'-untranslated region harbors a tRNA-like structure (TLS) to which a valine moiety can be added and it is indispensable for virus viability. Here, we report about a surprising interaction between TYMV-RNA-programmed ribosomes and 3'-valylated TLS that yields polyprotein with the valine N terminally incorporated by a translation mechanism resistant to regular initiation inhibitors. Disruption of the TLS exclusively abolishes polyprotein synthesis, which can be restored by adding excess TLS in trans. Our observations imply a novel eukaryotic mechanism for internal initiation of mRNA translation.
Microbial eukaryotic distributions and diversity patterns in a deep-sea methane seep ecosystem.
Pasulka, Alexis L; Levin, Lisa A; Steele, Josh A; Case, David H; Landry, Michael R; Orphan, Victoria J
2016-09-01
Although chemosynthetic ecosystems are known to support diverse assemblages of microorganisms, the ecological and environmental factors that structure microbial eukaryotes (heterotrophic protists and fungi) are poorly characterized. In this study, we examined the geographic, geochemical and ecological factors that influence microbial eukaryotic composition and distribution patterns within Hydrate Ridge, a methane seep ecosystem off the coast of Oregon using a combination of high-throughput 18S rRNA tag sequencing, terminal restriction fragment length polymorphism fingerprinting, and cloning and sequencing of full-length 18S rRNA genes. Microbial eukaryotic composition and diversity varied as a function of substrate (carbonate versus sediment), activity (low activity versus active seep sites), sulfide concentration, and region (North versus South Hydrate Ridge). Sulfide concentration was correlated with changes in microbial eukaryotic composition and richness. This work also revealed the influence of oxygen content in the overlying water column and water depth on microbial eukaryotic composition and diversity, and identified distinct patterns from those previously observed for bacteria, archaea and macrofauna in methane seep ecosystems. Characterizing the structure of microbial eukaryotic communities in response to environmental variability is a key step towards understanding if and how microbial eukaryotes influence seep ecosystem structure and function. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H.; Mills, Jason A.; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M.; Podsakoff, Gregory M.; Gadue, Paul; French, Deborah L.; Mason, Philip J.; Bessler, Monica
2013-01-01
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the “safe harbor” AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells. PMID:23744582
Garçon, Loïc; Ge, Jingping; Manjunath, Shwetha H; Mills, Jason A; Apicella, Marisa; Parikh, Shefali; Sullivan, Lisa M; Podsakoff, Gregory M; Gadue, Paul; French, Deborah L; Mason, Philip J; Bessler, Monica; Weiss, Mitchell J
2013-08-08
Diamond Blackfan anemia (DBA) is a congenital disorder with erythroid (Ery) hypoplasia and tissue morphogenic abnormalities. Most DBA cases are caused by heterozygous null mutations in genes encoding ribosomal proteins. Understanding how haploinsufficiency of these ubiquitous proteins causes DBA is hampered by limited availability of tissues from affected patients. We generated induced pluripotent stem cells (iPSCs) from fibroblasts of DBA patients carrying mutations in RPS19 and RPL5. Compared with controls, DBA fibroblasts formed iPSCs inefficiently, although we obtained 1 stable clone from each fibroblast line. RPS19-mutated iPSCs exhibited defects in 40S (small) ribosomal subunit assembly and production of 18S ribosomal RNA (rRNA). Upon induced differentiation, the mutant clone exhibited globally impaired hematopoiesis, with the Ery lineage affected most profoundly. RPL5-mutated iPSCs exhibited defective 60S (large) ribosomal subunit assembly, accumulation of 12S pre-rRNA, and impaired erythropoiesis. In both mutant iPSC lines, genetic correction of ribosomal protein deficiency via complementary DNA transfer into the "safe harbor" AAVS1 locus alleviated abnormalities in ribosome biogenesis and hematopoiesis. Our studies show that pathological features of DBA are recapitulated by iPSCs, provide a renewable source of cells to model various tissue defects, and demonstrate proof of principle for genetic correction strategies in patient stem cells.
Vergnano, Marta; Wan, Chris
2017-01-01
ABSTRACT We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. PMID:28743817
Feng, Jin-Mei; Sun, Jun; Xin, De-Dong; Wen, Jian-Fan
2012-01-01
5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features.
Xin, De-Dong; Wen, Jian-Fan
2012-01-01
Background 5S rRNA is a highly conserved ribosomal component. Eukaryotic 5S rRNA and its associated proteins (5S rRNA system) have become very well understood. Giardia lamblia was thought by some researchers to be the most primitive extant eukaryote while others considered it a highly evolved parasite. Previous reports have indicated that some aspects of its 5S rRNA system are simpler than that of common eukaryotes. We here explore whether this is true to its entire system, and whether this simplicity is a primitive or parasitic feature. Methodology/Principal Findings By collecting and confirming pre-existing data and identifying new data, we obtained almost complete datasets of the system of three isolates of G. lamblia, two other parasitic excavates (Trichomonas vaginalis, Trypanosoma cruzi), and one free-living one (Naegleria gruberi). After comprehensively comparing each aspect of the system among these excavates and also with those of archaea and common eukaryotes, we found all the three Giardia isolates to harbor a same simplified 5S rRNA system, which is not only much simpler than that of common eukaryotes but also the simplest one among those of these excavates, and is surprisingly very similar to that of archaea; we also found among these excavates the system in parasitic species is not necessarily simpler than that in free-living species, conversely, the system of free-living species is even simpler in some respects than those of parasitic ones. Conclusion/Significance The simplicity of Giardia 5S rRNA system should be considered a primitive rather than parasitically-degenerated feature. Therefore, Giardia 5S rRNA system might be a primitive system that is intermediate between that of archaea and the common eukaryotic model system, and it may reflect the evolutionary history of the eukaryotic 5S rRNA system from the archaeal form. Our results also imply G. lamblia might be a primitive eukaryote with secondary parasitically-degenerated features. PMID
Hippuristanol - A potent steroid inhibitor of eukaryotic initiation factor 4A
Cencic, Regina; Pelletier, Jerry
2016-01-01
ABSTRACT Protein synthesis and its regulatory signaling pathways play essential roles in the initiation and maintenance of the cancer phenotype. Insight obtained over the last 3 decades on the mechanisms regulating translation in normal and transformed cells have revealed that perturbed control in cancer cells may offer an Achilles' heel for the development of novel anti-neoplastic agents. Several small molecule inhibitors have been identified and characterized that target translation initiation – more specifically, the rate-limiting step where ribosomes are recruited to mRNA templates. Among these, hippuristanol, a polyhydroxysteroid from the gorgonian Isis hippuris has been found to inhibit translation initiation by blocking the activity of eukaryotic initiation factor (eIF) 4A, an essential RNA helicase involved in this process. Herein, we highlight the biological properties of this compound, its potential development as an anti-cancer agent, and its use to validate eIF4A as an anti-neoplastic target. PMID:27335721
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)
Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo
2013-01-01
Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700
Magalhães Cruz, Leonardo; Maltempi de Souza, Emanuel; Weber, Olmar Baler; Baldani, José Ivo; Döbereiner, Johanna; de Oliveira Pedrosa, Fábio
2001-01-01
Nitrogen-fixing bacteria isolated from banana (Musa spp.) and pineapple (Ananas comosus (L.) Merril) were characterized by amplified 16S ribosomal DNA restriction analysis and 16S rRNA sequence analysis. Herbaspirillum seropedicae, Herbaspirillum rubrisubalbicans, Burkholderia brasilensis, and Burkholderia tropicalis were identified. Eight other types were placed in close proximity to these genera and other alpha and beta Proteobacteria. PMID:11319127
Sawicka, Kirsty; Pyronneau, Alexander; Chao, Miranda; Bennett, Michael V L; Zukin, R Suzanne
2016-10-11
Fragile X syndrome (FXS) is the most common heritable cause of intellectual disability and a leading genetic form of autism. The Fmr1 KO mouse, a model of FXS, exhibits elevated translation in the hippocampus and the cortex. ERK (extracellular signal-regulated kinase) and mTOR (mechanistic target of rapamycin) signaling regulate protein synthesis by activating downstream targets critical to translation initiation and elongation and are known to contribute to hippocampal defects in fragile X. Here we show that the effect of loss of fragile X mental retardation protein (FMRP) on these pathways is brain region specific. In contrast to the hippocampus, ERK (but not mTOR) signaling is elevated in the neocortex of fragile X mice. Phosphorylation of ribosomal protein S6, typically a downstream target of mTOR, is elevated in the neocortex, despite normal mTOR activity. This is significant in that S6 phosphorylation facilitates translation, correlates with neuronal activation, and is altered in neurodevelopmental disorders. We show that in fragile X mice, S6 is regulated by ERK via the "alternative" S6 kinase p90-ribosomal S6 kinase (RSK), as evidenced by the site of elevated phosphorylation and the finding that ERK inhibition corrects elevated RSK and S6 activity. These findings indicate that signaling networks are altered in the neocortex of fragile X mice such that S6 phosphorylation receives aberrant input from ERK/RSK. Importantly, an RSK inhibitor reduces susceptibility to audiogenic seizures in fragile X mice. Our findings identify RSK as a therapeutic target for fragile X and suggest the therapeutic potential of drugs for the treatment of FXS may vary in a brain-region-specific manner.
Thiergart, Thorsten; Landan, Giddy; Schenk, Marc; Dagan, Tal; Martin, William F.
2012-01-01
To test the predictions of competing and mutually exclusive hypotheses for the origin of eukaryotes, we identified from a sample of 27 sequenced eukaryotic and 994 sequenced prokaryotic genomes 571 genes that were present in the eukaryote common ancestor and that have homologues among eubacterial and archaebacterial genomes. Maximum-likelihood trees identified the prokaryotic genomes that most frequently contained genes branching as the sister to the eukaryotic nuclear homologues. Among the archaebacteria, euryarchaeote genomes most frequently harbored the sister to the eukaryotic nuclear gene, whereas among eubacteria, the α-proteobacteria were most frequently represented within the sister group. Only 3 genes out of 571 gave a 3-domain tree. Homologues from α-proteobacterial genomes that branched as the sister to nuclear genes were found more frequently in genomes of facultatively anaerobic members of the rhiozobiales and rhodospirilliales than in obligate intracellular ricketttsial parasites. Following α-proteobacteria, the most frequent eubacterial sister lineages were γ-proteobacteria, δ-proteobacteria, and firmicutes, which were also the prokaryote genomes least frequently found as monophyletic groups in our trees. Although all 22 higher prokaryotic taxa sampled (crenarchaeotes, γ-proteobacteria, spirochaetes, chlamydias, etc.) harbor genes that branch as the sister to homologues present in the eukaryotic common ancestor, that is not evidence of 22 different prokaryotic cells participating at eukaryote origins because prokaryotic “lineages” have laterally acquired genes for more than 1.5 billion years since eukaryote origins. The data underscore the archaebacterial (host) nature of the eukaryotic informational genes and the eubacterial (mitochondrial) nature of eukaryotic energy metabolism. The network linking genes of the eukaryote ancestor to contemporary homologues distributed across prokaryotic genomes elucidates eukaryote gene origins in a
Endosymbiosis and Eukaryotic Cell Evolution.
Archibald, John M
2015-10-05
Understanding the evolution of eukaryotic cellular complexity is one of the grand challenges of modern biology. It has now been firmly established that mitochondria and plastids, the classical membrane-bound organelles of eukaryotic cells, evolved from bacteria by endosymbiosis. In the case of mitochondria, evidence points very clearly to an endosymbiont of α-proteobacterial ancestry. The precise nature of the host cell that partnered with this endosymbiont is, however, very much an open question. And while the host for the cyanobacterial progenitor of the plastid was undoubtedly a fully-fledged eukaryote, how - and how often - plastids moved from one eukaryote to another during algal diversification is vigorously debated. In this article I frame modern views on endosymbiotic theory in a historical context, highlighting the transformative role DNA sequencing played in solving early problems in eukaryotic cell evolution, and posing key unanswered questions emerging from the age of comparative genomics. Copyright © 2015 Elsevier Ltd. All rights reserved.
Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G
2017-07-25
We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected
Germot, A; Philippe, H; Le Guyader, H
1996-12-10
Molecular phylogenetic analyses, based mainly on ribosomal RNA, show that three amitochondriate protist lineages, diplomonads, microsporidia, and trichomonads, emerge consistently at the base of the eukaryotic tree before groups having mitochondria. This suggests that these groups could have diverged before the mitochondrial endosymbiosis. Nevertheless, since all these organisms live in anaerobic environments, the absence of mitochondria might be due to secondary loss, as demonstrated for the later emerging eukaryote Entamoeba histolytica. We have now isolated from Trichomonas vaginalis a gene encoding a chaperone protein (HSP70) that in other lineages is addressed to the mitochondrial compartment. The phylogenetic reconstruction unambiguously located this HSP70 within a large set of mitochondrial sequences, itself a sister-group of alpha-purple bacteria. In addition, the T. vaginalis protein exhibits the GDAWV sequence signature, so far exclusively found in mitochondrial HSP70 and in proteobacterial dnaK. Thus mitochondrial endosymbiosis could have occurred earlier than previously assumed. The trichomonad double membrane-bounded organelles, the hydrogenosomes, could have evolved from mitochondria.
A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling.
Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal
2017-01-01
Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein-EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here.
A Possible Role of the Full-Length Nascent Protein in Post-Translational Ribosome Recycling
Das, Debasis; Samanta, Dibyendu; Bhattacharya, Arpita; Basu, Arunima; Das, Anindita; Ghosh, Jaydip; Chakrabarti, Abhijit; Das Gupta, Chanchal
2017-01-01
Each cycle of translation initiation in bacterial cell requires free 50S and 30S ribosomal subunits originating from the post-translational dissociation of 70S ribosome from the previous cycle. Literature shows stable dissociation of 70S from model post-termination complexes by the concerted action of Ribosome Recycling Factor (RRF) and Elongation Factor G (EF-G) that interact with the rRNA bridge B2a/B2b joining 50S to 30S. In such experimental models, the role of full-length nascent protein was never considered seriously. We observed relatively slow release of full-length nascent protein from 50Sof post translation ribosome, and in that process, its toe prints on the rRNA in vivo and in in vitro translation with E.coli S30 extract. We reported earlier that a number of chemically unfolded proteins like bovine carbonic anhydrase (BCA), lactate dehydrogenase (LDH), malate dehydrogenase (MDH), lysozyme, ovalbumin etc., when added to free 70Sin lieu of the full length nascent proteins, also interact with identical RNA regions of the 23S rRNA. Interestingly the rRNA nucleotides that slow down release of the C-terminus of full-length unfolded protein were found in close proximity to the B2a/B2b bridge. It indicated a potentially important chemical reaction conserved throughout the evolution. Here we set out to probe that conserved role of unfolded protein conformation in splitting the free or post-termination 70S. How both the RRF-EFG dependent and the plausible nascent protein–EFG dependent ribosome recycling pathways might be relevant in bacteria is discussed here. PMID:28099529
The archaebacterial origin of eukaryotes.
Cox, Cymon J; Foster, Peter G; Hirt, Robert P; Harris, Simon R; Embley, T Martin
2008-12-23
The origin of the eukaryotic genetic apparatus is thought to be central to understanding the evolution of the eukaryotic cell. Disagreement about the source of the relevant genes has spawned competing hypotheses for the origins of the eukaryote nuclear lineage. The iconic rooted 3-domains tree of life shows eukaryotes and archaebacteria as separate groups that share a common ancestor to the exclusion of eubacteria. By contrast, the eocyte hypothesis has eukaryotes originating within the archaebacteria and sharing a common ancestor with a particular group called the Crenarchaeota or eocytes. Here, we have investigated the relative support for each hypothesis from analysis of 53 genes spanning the 3 domains, including essential components of the eukaryotic nucleic acid replication, transcription, and translation apparatus. As an important component of our analysis, we investigated the fit between model and data with respect to composition. Compositional heterogeneity is a pervasive problem for reconstruction of ancient relationships, which, if ignored, can produce an incorrect tree with strong support. To mitigate its effects, we used phylogenetic models that allow for changing nucleotide or amino acid compositions over the tree and data. Our analyses favor a topology that supports the eocyte hypothesis rather than archaebacterial monophyly and the 3-domains tree of life.
Albert, Benjamin; Knight, Britta; Merwin, Jason; Martin, Victoria; Ottoz, Diana; Gloor, Yvonne; Bruzzone, Maria Jessica; Rudner, Adam; Shore, David
2016-11-17
Cell growth potential is determined by the rate of ribosome biogenesis, a complex process that requires massive and coordinated transcriptional output. In the yeast Saccharomyces cerevisiae, ribosome biogenesis is highly regulated at the transcriptional level. Although evidence for a system that coordinates ribosomal RNA (rRNA) and ribosomal protein gene (RPG) transcription has been described, the molecular mechanisms remain poorly understood. Here we show that an interaction between the RPG transcriptional activator Ifh1 and the rRNA processing factor Utp22 serves to coordinate RPG transcription with that of rRNA. We demonstrate that Ifh1 is rapidly released from RPG promoters by a Utp22-independent mechanism following growth inhibition, but that its long-term dissociation requires Utp22. We present evidence that RNA polymerase I activity inhibits the ability of Utp22 to titrate Ifh1 from RPG promoters and propose that a dynamic Ifh1-Utp22 interaction fine-tunes RPG expression to coordinate RPG and rRNA transcription. Copyright © 2016 Elsevier Inc. All rights reserved.
Firth, A E; Jagger, B W; Wise, H M; Nelson, C C; Parsawar, K; Wills, N M; Napthine, S; Taubenberger, J K; Digard, P; Atkins, J F
2012-10-01
Programmed ribosomal frameshifting is used in the expression of many virus genes and some cellular genes. In eukaryotic systems, the most well-characterized mechanism involves -1 tandem tRNA slippage on an X_XXY_YYZ motif. By contrast, the mechanisms involved in programmed +1 (or -2) slippage are more varied and often poorly characterized. Recently, a novel gene, PA-X, was discovered in influenza A virus and found to be expressed via a shift to the +1 reading frame. Here, we identify, by mass spectrometric analysis, both the site (UCC_UUU_CGU) and direction (+1) of the frameshifting that is involved in PA-X expression. Related sites are identified in other virus genes that have previously been proposed to be expressed via +1 frameshifting. As these viruses infect insects (chronic bee paralysis virus), plants (fijiviruses and amalgamaviruses) and vertebrates (influenza A virus), such motifs may form a new class of +1 frameshift-inducing sequences that are active in diverse eukaryotes.
Firth, A. E.; Jagger, B. W.; Wise, H. M.; Nelson, C. C.; Parsawar, K.; Wills, N. M.; Napthine, S.; Taubenberger, J. K.; Digard, P.; Atkins, J. F.
2012-01-01
Programmed ribosomal frameshifting is used in the expression of many virus genes and some cellular genes. In eukaryotic systems, the most well-characterized mechanism involves –1 tandem tRNA slippage on an X_XXY_YYZ motif. By contrast, the mechanisms involved in programmed +1 (or −2) slippage are more varied and often poorly characterized. Recently, a novel gene, PA-X, was discovered in influenza A virus and found to be expressed via a shift to the +1 reading frame. Here, we identify, by mass spectrometric analysis, both the site (UCC_UUU_CGU) and direction (+1) of the frameshifting that is involved in PA-X expression. Related sites are identified in other virus genes that have previously been proposed to be expressed via +1 frameshifting. As these viruses infect insects (chronic bee paralysis virus), plants (fijiviruses and amalgamaviruses) and vertebrates (influenza A virus), such motifs may form a new class of +1 frameshift-inducing sequences that are active in diverse eukaryotes. PMID:23155484
Kinetic analysis of pre-ribosome structure in vivo
Swiatkowska, Agata; Wlotzka, Wiebke; Tuck, Alex; Barrass, J. David; Beggs, Jean D.; Tollervey, David
2012-01-01
Pre-ribosomal particles undergo numerous structural changes during maturation, but their high complexity and short lifetimes make these changes very difficult to follow in vivo. In consequence, pre-ribosome structure and composition have largely been inferred from purified particles and analyzed in vitro. Here we describe techniques for kinetic analyses of the changes in pre-ribosome structure in living cells of Saccharomyces cerevisiae. To allow this, in vivo structure probing by DMS modification was combined with affinity purification of newly synthesized 20S pre-rRNA over a time course of metabolic labeling with 4-thiouracil. To demonstrate that this approach is generally applicable, we initially analyzed the accessibility of the region surrounding cleavage site D site at the 3′ end of the mature 18S rRNA region of the pre-rRNA. This revealed a remarkably flexible structure throughout 40S subunit biogenesis, with little stable RNA–protein interaction apparent. Analysis of folding in the region of the 18S central pseudoknot was consistent with previous data showing U3 snoRNA–18S rRNA interactions. Dynamic changes in the structure of the hinge between helix 28 (H28) and H44 of pre-18S rRNA were consistent with recently reported interactions with the 3′ guide region of U3 snoRNA. Finally, analysis of the H18 region indicates that the RNA structure matures early, but additional protection appears subsequently, presumably reflecting protein binding. The structural analyses described here were performed on total, affinity-purified, newly synthesized RNA, so many classes of RNA and RNA–protein complex are potentially amenable to this approach. PMID:23093724
Amicoumacin A inhibits translation by stabilizing mRNA interaction with the ribosome
Polikanov, Yury S.; Osterman, Ilya A.; Szal, Teresa; Tashlitsky, Vadim N.; Serebryakova, Marina V.; Kusochek, Pavel; Bulkley, David; Malanicheva, Irina A.; Efimenko, Tatyana A.; Efremenkova, Olga V.; Konevega, Andrey L.; Shaw, Karen J.; Bogdanov, Alexey A.; Rodnina, Marina V.; Dontsova, Olga A.; Mankin, Alexander S.; Steitz, Thomas A.; Sergiev, Petr V.
2014-01-01
SUMMARY We demonstrate that the antibiotic amicoumacin A (AMI) whose cellular target was unknown, is a potent inhibitor of protein synthesis. Resistance mutations in helix 24 of the 16S rRNA mapped the AMI binding site to the small ribosomal subunit. The crystal structure of bacterial ribosome in complex with AMI solved at 2.4 Å resolution revealed that the antibiotic makes contacts with universally conserved nucleotides of 16S rRNA in the E site and the mRNA backbone. Simultaneous interactions of AMI with 16S rRNA and mRNA and the in vivo experimental evidence suggest that it may inhibit the progression of the ribosome along mRNA. Consistent with this proposal, binding of AMI interferes with translocation in vitro. The inhibitory action of AMI can be partly compensated by mutations in the translation elongation factor G. PMID:25306919
Sloan, Katherine E.; Bohnsack, Markus T.; Schneider, Claudia; Watkins, Nicholas J.
2014-01-01
During eukaryotic ribosome biogenesis, three of the mature ribosomal (r)RNAs are released from a single precursor transcript (pre-rRNA) by an ordered series of endonucleolytic cleavages and exonucleolytic processing steps. Production of the 18S rRNA requires the removal of the 5′ external transcribed spacer (5′ETS) by endonucleolytic cleavages at sites A0 and A1/site 1. In metazoans, an additional cleavage in the 5′ETS, at site A′, upstream of A0, has also been reported. Here, we have investigated how A′ processing is coordinated with assembly of the early preribosomal complex. We find that only the tUTP (UTP-A) complex is critical for A′ cleavage, while components of the bUTP (UTP-B) and U3 snoRNP are important, but not essential, for efficient processing at this site. All other factors involved in the early stages of 18S rRNA processing that were tested here function downstream from this processing step. Interestingly, we show that the RNA surveillance factors XRN2 and MTR4 are also involved in A′ cleavage in humans. A′ cleavage is largely bypassed when XRN2 is depleted, and we also discover that A′ cleavage is not always the initial processing event in all cell types. Together, our data suggest that A′ cleavage is not a prerequisite for downstream pre-rRNA processing steps and may, in fact, represent a quality control step for initial pre-rRNA transcripts. Furthermore, we show that components of the RNA surveillance machinery, including the exosome and TRAMP complexes, also play key roles in the recycling of excised spacer fragments and degradation of aberrant pre-rRNAs in human cells. PMID:24550520
Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).
Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo
2013-01-01
Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies.
Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei
Kamina, Anyango D.; Jaremko, Daniel; Christen, Linda
2017-01-01
ABSTRACT Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei, the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T. brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei. IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as
Essential Assembly Factor Rpf2 Forms Novel Interactions within the 5S RNP in Trypanosoma brucei.
Kamina, Anyango D; Jaremko, Daniel; Christen, Linda; Williams, Noreen
2017-01-01
Ribosome biogenesis is a highly complex and conserved cellular process that is responsible for making ribosomes. During this process, there are several assembly steps that function as regulators to ensure proper ribosome formation. One of these steps is the assembly of the 5S ribonucleoprotein particle (5S RNP) in the central protuberance of the 60S ribosomal subunit. In eukaryotes, the 5S RNP is composed of 5S rRNA, ribosomal proteins L5 and L11, and assembly factors Rpf2 and Rrs1. Our laboratory previously showed that in Trypanosoma brucei , the 5S RNP is composed of 5S rRNA, L5, and trypanosome-specific RNA binding proteins P34 and P37. In this study, we characterize an additional component of the 5S RNP, the T. brucei homolog of Rpf2. This is the first study to functionally characterize interactions mediated by Rpf2 in an organism other than fungi. T . brucei Rpf2 (TbRpf2) was identified from tandem affinity purification using extracts prepared from protein A-tobacco etch virus (TEV)-protein C (PTP)-tagged L5, P34, and P37 cell lines, followed by mass spectrometry analysis. We characterized the binding interactions between TbRpf2 and the previously characterized members of the T. brucei 5S RNP. Our studies show that TbRpf2 mediates conserved binding interactions with 5S rRNA and L5 and that TbRpf2 also interacts with trypanosome-specific proteins P34 and P37. We performed RNA interference (RNAi) knockdown of TbRpf2 and showed that this protein is essential for the survival of the parasites and is critical for proper ribosome formation. These studies provide new insights into a critical checkpoint in the ribosome biogenesis pathway in T. brucei . IMPORTANCE Trypanosoma brucei is the parasitic protozoan that causes African sleeping sickness. Ribosome assembly is essential for the survival of this parasite through the different host environments it encounters during its life cycle. The assembly of the 5S ribonucleoprotein particle (5S RNP) functions as one of
Functional 5' UTR mRNA structures in eukaryotic translation regulation and how to find them.
Leppek, Kathrin; Das, Rhiju; Barna, Maria
2018-03-01
RNA molecules can fold into intricate shapes that can provide an additional layer of control of gene expression beyond that of their sequence. In this Review, we discuss the current mechanistic understanding of structures in 5' untranslated regions (UTRs) of eukaryotic mRNAs and the emerging methodologies used to explore them. These structures may regulate cap-dependent translation initiation through helicase-mediated remodelling of RNA structures and higher-order RNA interactions, as well as cap-independent translation initiation through internal ribosome entry sites (IRESs), mRNA modifications and other specialized translation pathways. We discuss known 5' UTR RNA structures and how new structure probing technologies coupled with prospective validation, particularly compensatory mutagenesis, are likely to identify classes of structured RNA elements that shape post-transcriptional control of gene expression and the development of multicellular organisms.
Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus.
Hansen, T S; Andreasen, P H; Dreisig, H; Højrup, P; Nielsen, H; Engberg, J; Kristiansen, K
1991-09-15
We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.
Systematic analysis and evolution of 5S ribosomal DNA in metazoans.
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-11-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.
Systematic analysis and evolution of 5S ribosomal DNA in metazoans
Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M
2013-01-01
Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12 766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades. PMID:23838690
Prp43p Is a DEAH-Box Spliceosome Disassembly Factor Essential for Ribosome Biogenesis
Combs, D. Joshua; Nagel, Roland J.; Ares, Manuel; Stevens, Scott W.
2006-01-01
The known function of the DEXH/D-box protein Prp43p is the removal of the U2, U5, and U6 snRNPs from the postsplicing lariat-intron ribonucleoprotein complex. We demonstrate that affinity-purified Prp43p-associated material includes the expected spliceosomal components; however, we also identify several preribosomal complexes that are specifically purified with Prp43p. Conditional prp43 mutant alleles confer a 35S pre-rRNA processing defect, with subsequent depletion of 27S and 20S precursors. Upon a shift to a nonpermissive temperature, both large and small-ribosomal-subunit proteins accumulate in the nucleolus of prp43 mutants. Pulse-chase analysis demonstrates delayed kinetics of 35S, 27S, and 20S pre-rRNA processing with turnover of these intermediates. Microarray analysis of pre-mRNA splicing defects in prp43 mutants shows a very mild effect, similar to that of nonessential pre-mRNA splicing factors. Prp43p is the first DEXH/D-box protein shown to function in both RNA polymerase I and polymerase II transcript metabolism. Its essential function is in its newly characterized role in ribosome biogenesis of both ribosomal subunits, positioning Prp43p to regulate both pre-mRNA splicing and ribosome biogenesis. PMID:16382144
Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette
2012-07-01
Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J; Ehresmann, Chantal; Portier, Claude
2004-05-01
The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G*U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO-lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G*U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15-rpsO mRNA interactions can also be found, probably with A(-46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited.
NASA Astrophysics Data System (ADS)
Tamura, Hiroto; Hotta, Yudai; Sato, Hiroaki
2013-08-01
Matrix-assisted laser-desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) is one of the most widely used mass-based approaches for bacterial identification and classification because of the simple sample preparation and extremely rapid analysis within a few minutes. To establish the accurate MALDI-TOF MS bacterial discrimination method at strain level, the ribosomal subunit proteins coded in the S 10-spc-alpha operon, which encodes half of the ribosomal subunit protein and is highly conserved in eubacterial genomes, were selected as reliable biomarkers. This method, named the S10-GERMS method, revealed that the strains of genus Pseudomonas were successfully identified and discriminated at species and strain levels, respectively; therefore, the S10-GERMS method was further applied to discriminate the pathovar of P. syringae. The eight selected biomarkers (L24, L30, S10, S12, S14, S16, S17, and S19) suggested the rapid discrimination of P. syringae at the strain (pathovar) level. The S10-GERMS method appears to be a powerful tool for rapid and reliable bacterial discrimination and successful phylogenetic characterization. In this article, an overview of the utilization of results from the S10-GERMS method is presented, highlighting the characterization of the Lactobacillus casei group and discrimination of the bacteria of genera Bacillus and Sphingopyxis despite only two and one base difference in the 16S rRNA gene sequence, respectively.
Emerging players in the initiation of eukaryotic DNA replication
2012-01-01
Faithful duplication of the genome in eukaryotes requires ordered assembly of a multi-protein complex called the pre-replicative complex (pre-RC) prior to S phase; transition to the pre-initiation complex (pre-IC) at the beginning of DNA replication; coordinated progression of the replisome during S phase; and well-controlled regulation of replication licensing to prevent re-replication. These events are achieved by the formation of distinct protein complexes that form in a cell cycle-dependent manner. Several components of the pre-RC and pre-IC are highly conserved across all examined eukaryotic species. Many of these proteins, in addition to their bona fide roles in DNA replication are also required for other cell cycle events including heterochromatin organization, chromosome segregation and centrosome biology. As the complexity of the genome increases dramatically from yeast to human, additional proteins have been identified in higher eukaryotes that dictate replication initiation, progression and licensing. In this review, we discuss the newly discovered components and their roles in cell cycle progression. PMID:23075259
Goris, Marianne; Magin, Robert S; Foyn, Håvard; Myklebust, Line M; Varland, Sylvia; Ree, Rasmus; Drazic, Adrian; Bhambra, Parminder; Støve, Svein I; Baumann, Markus; Haug, Bengt Erik; Marmorstein, Ronen; Arnesen, Thomas
2018-04-24
N-terminal (Nt) acetylation is a major protein modification catalyzed by N-terminal acetyltransferases (NATs). Methionine acidic N termini, including actin, are cotranslationally Nt acetylated by NatB in all eukaryotes, but animal actins containing acidic N termini, are additionally posttranslationally Nt acetylated by NAA80. Actin Nt acetylation was found to regulate cytoskeletal dynamics and motility, thus making NAA80 a potential target for cell migration regulation. In this work, we developed potent and selective bisubstrate inhibitors for NAA80 and determined the crystal structure of NAA80 in complex with such an inhibitor, revealing that NAA80 adopts a fold similar to other NAT enzymes but with a more open substrate binding region. Furthermore, in contrast to most other NATs, the substrate specificity of NAA80 is mainly derived through interactions between the enzyme and the acidic amino acids at positions 2 and 3 of the actin substrate and not residues 1 and 2. A yeast model revealed that ectopic expression of NAA80 in a strain lacking NatB activity partially restored Nt acetylation of NatB substrates, including yeast actin. Thus, NAA80 holds intrinsic capacity to posttranslationally Nt acetylate NatB-type substrates in vivo. In sum, the presence of a dominant cotranslational NatB in all eukaryotes, the specific posttranslational actin methionine removal in animals, and finally, the unique structural features of NAA80 leave only the processed actins as in vivo substrates of NAA80. Together, this study reveals the molecular and cellular basis of NAA80 Nt acetylation and provides a scaffold for development of inhibitors for the regulation of cytoskeletal properties. Copyright © 2018 the Author(s). Published by PNAS.
The human insulin receptor mRNA contains a functional internal ribosome entry segment
Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth
2009-01-01
Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240
Ribosomal S6 kinase (RSK) modulators: a patent review.
Ludwik, Katarzyna A; Lannigan, Deborah A
2016-09-01
The p90 ribosomal S6 kinases (RSK) are a family of Ser/Thr protein kinases that are downstream effectors of MEK1/2-ERK1/2. Increased RSK activation is implicated in the etiology of multiple pathologies, including numerous types of cancers, cardiovascular disease, liver and lung fibrosis, and infections. The review summarizes the patent and scientific literature on small molecule modulators of RSK and their potential use as therapeutics. The patents were identified using World Intellectual Property Organization and United States Patent and Trademark Office databases. The compounds described are predominantly RSK inhibitors, but a RSK activator is also described. The majority of the inhibitors are not RSK-specific. Based on the overwhelming evidence that RSK is involved in a number of diseases that have high mortalities it seems surprising that there are no RSK modulators that have pharmacokinetic properties suitable for in vivo use. MEK1/2 inhibitors are in the clinic, but the efficacy of these compounds appears to be limited by their side effects. We hypothesize that targeting the downstream effectors of MEK1/2, like RSK, are an untapped source of drug targets and that they will generate less side effects than MEK1/2 inhibitors because they regulate fewer effectors.
Kaempfer, Raymond; Kaufman, Jennifer
1972-01-01
The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325
Methylation of yeast ribosomal protein Rpl3 promotes translational elongation fidelity.
Al-Hadid, Qais; Roy, Kevin; Chanfreau, Guillaume; Clarke, Steven G
2016-04-01
Rpl3, a highly conserved ribosomal protein, is methylated at histidine 243 by the Hpm1 methyltransferase in Saccharomyces cerevisiae. Histidine 243 lies close to the peptidyl transferase center in a functionally important region of Rpl3 designated as the basic thumb that coordinates the decoding, peptidyl transfer, and translocation steps of translation elongation. Hpm1 was recently implicated in ribosome biogenesis and translation. However, the biological role of methylation of its Rpl3 substrate has not been identified. Here we interrogate the role of Rpl3 methylation at H243 by investigating the functional impact of mutating this histidine residue to alanine (rpl3-H243A). Akin to Hpm1-deficient cells, rpl3-H243A cells accumulate 35S and 23S pre-rRNA precursors to a similar extent, confirming an important role for histidine methylation in pre-rRNA processing. In contrast, Hpm1-deficient cells but not rpl3-H243A mutants show perturbed levels of ribosomal subunits. We show that Hpm1 has multiple substrates in different subcellular fractions, suggesting that methylation of proteins other than Rpl3 may be important for controlling ribosomal subunit levels. Finally, translational fidelity assays demonstrate that like Hpm1-deficient cells, rpl3-H243A mutants have defects in translation elongation resulting in decreased translational accuracy. These data suggest that Rpl3 methylation at H243 is playing a significant role in translation elongation, likely via the basic thumb, but has little impact on ribosomal subunit levels. Hpm1 is therefore a multifunctional methyltransferase with independent roles in ribosome biogenesis and translation. © 2016 Al-Hadid et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze
2013-01-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775
Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun
2013-10-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.
Structural Characterization of an Alternative Mode of Tigecycline Binding to the Bacterial Ribosome
Schedlbauer, Andreas; Kaminishi, Tatsuya; Ochoa-Lizarralde, Borja; Dhimole, Neha; Zhou, Shu; López-Alonso, Jorge P.
2015-01-01
Although both tetracycline and tigecycline inhibit protein synthesis by sterically hindering the binding of tRNA to the ribosomal A site, tigecycline shows increased efficacy in both in vitro and in vivo activity assays and escapes the most common resistance mechanisms associated with the tetracycline class of antibiotics. These differences in activities are attributed to the tert-butyl-glycylamido side chain found in tigecycline. Our structural analysis by X-ray crystallography shows that tigecycline binds the bacterial 30S ribosomal subunit with its tail in an extended conformation and makes extensive interactions with the 16S rRNA nucleotide C1054. These interactions restrict the mobility of C1054 and contribute to the antimicrobial activity of tigecycline, including its resistance to the ribosomal protection proteins. PMID:25753625
Baumgardt, Kathrin; Gilet, Laetitia; Figaro, Sabine; Condon, Ciarán
2018-06-05
Ribosomal RNAs are processed from primary transcripts containing 16S, 23S and 5S rRNAs in most bacteria. Maturation generally occurs in a two-step process, consisting of a first crude separation of the major species by RNase III during transcription, followed by precise trimming of 5' and 3' extensions on each species upon accurate completion of subunit assembly. The various endo- and exoribonucleases involved in the final processing reactions are strikingly different in Escherichia coli and Bacillus subtilis, the two best studied representatives of Gram-negative and Gram-positive bacteria, respectively. Here, we show that the one exception to this rule is the protein involved in the maturation of the 3' end of 16S rRNA. Cells depleted for the essential B. subtilis YqfG protein, a homologue of E. coli YbeY, specifically accumulate 16S rRNA precursors bearing 3' extensions. Remarkably, the essential nature of YqfG can be suppressed by deleting the ribosomal RNA degrading enzyme RNase R, i.e. a ΔyqfG Δrnr mutant is viable. Our data suggest that 70S ribosomes containing 30S subunits with 3' extensions of 16S rRNA are functional to a degree, but become substrates for degradation by RNase R and are eliminated.
Taoka, Masato; Nobe, Yuko; Hori, Masayuki; Takeuchi, Aiko; Masaki, Shunpei; Yamauchi, Yoshio; Nakayama, Hiroshi; Takahashi, Nobuhiro; Isobe, Toshiaki
2015-01-01
We present a liquid chromatography–mass spectrometry (LC-MS)-based method for comprehensive quantitative identification of post-transcriptional modifications (PTMs) of RNA. We incorporated an in vitro-transcribed, heavy isotope-labeled reference RNA into a sample RNA solution, digested the mixture with a number of RNases and detected the post-transcriptionally modified oligonucleotides quantitatively based on shifts in retention time and the MS signal in subsequent LC-MS. This allowed the determination and quantitation of all PTMs in Schizosaccharomyces pombe ribosomal (r)RNAs and generated the first complete PTM maps of eukaryotic rRNAs at single-nucleotide resolution. There were 122 modified sites, most of which appear to locate at the interface of ribosomal subunits where translation takes place. We also identified PTMs at specific locations in rRNAs that were altered in response to growth conditions of yeast cells, suggesting that the cells coordinately regulate the modification levels of RNA. PMID:26013808
Gałasiński, W
1996-05-01
The structural and functional characteristics of the elongation system (ribosomes and elongation factors) are presented. The immunochemical and diagnostic meaning of the ribosome investigations is considered. Evidence of the participation of ribosomes in the first step of protein glycosylation is presented. The heterogeneous elongation factor eEF-1, isolated from Guerin epithelioma, can be separated into three fractions: one of them functionally corresponds to EF-1 alpha, the second on to EF-1 beta gamma, and the third is an unidentified, active aggregate named EF-1B, which contains the subunit forms EF-1 alpha and EF-1 beta gamma, and other polypeptides showing protein kinase activity. The aggregate EF-1B can be autophosphorylated, while the subunit forms EF-1 alpha and EF-1 beta gamma can neither become autophosphorylated nor phosphorylate other polypeptides. The subunit form EF-beta gamma consists from two polypeptides of 32 and 51 kDa, corresponding to other eukaryotic beta and gamma polypeptides, respectively. EF-1 beta gamma is thermostable and protects against thermal inactivation of EF-1 alpha in the EF-1 alpha-EF-1 beta gamma complex. Pure eEF-2 preparations isolated from normal and neoplastic tissues show different structural features. The existence of eEF-2 in multiple forms, differing in molecular mass, have been found. The eEF-2 with molecular weight of about 100 kDa can be phosphorylated, while eEF-2 of about 65 kDa was not phosphorylated by protein kinase eEF-2. The phosphorylated eEF-2 lost its activity, and this effect was reversed by dephosphorylation. The eEF-2 (65 kDa) was isolated from the active polyribosomes, and it may directly participate in the translocation step of the peptide elongation. It was noted that the components of elongation system can be inhibited, in separate steps, by the substances isolated from various sources of plant origin. Alkaloids emetine and cepheline, cardiac remedy digoxin, saponin glycoside, and its aglycon
Voices of Chinese Post-80s Students in English Academic Writing
ERIC Educational Resources Information Center
Que, Hua; Li, Xuemei
2015-01-01
This study looks into the changing voice of Chinese Post-80s' students in English academic writing. Data were collected qualitatively through interviews with four Chinese Post-80s overseas graduate students and through an examination of their English essays with a focus on discursive features. Findings indicate that Chinese Post-80s' voice is…
Aitken, Colin Echeverría; Beznosková, Petra; Vlčkova, Vladislava; Chiu, Wen-Ling; Zhou, Fujun; Valášek, Leoš Shivaya; Hinnebusch, Alan G; Lorsch, Jon R
2016-01-01
Eukaryotic translation initiation factor 3 (eIF3) is a central player in recruitment of the pre-initiation complex (PIC) to mRNA. We probed the effects on mRNA recruitment of a library of S. cerevisiae eIF3 functional variants spanning its 5 essential subunits using an in vitro-reconstituted system. Mutations throughout eIF3 disrupt its interaction with the PIC and diminish its ability to accelerate recruitment to a native yeast mRNA. Alterations to the eIF3a CTD and eIF3b/i/g significantly slow mRNA recruitment, and mutations within eIF3b/i/g destabilize eIF2•GTP•Met-tRNAi binding to the PIC. Using model mRNAs lacking contacts with the 40S entry or exit channels, we uncovered a critical role for eIF3 requiring the eIF3a NTD, in stabilizing mRNA interactions at the exit channel, and an ancillary role at the entry channel requiring residues of the eIF3a CTD. These functions are redundant: defects at each channel can be rescued by filling the other channel with mRNA. DOI: http://dx.doi.org/10.7554/eLife.20934.001 PMID:27782884
G-protein control of the ribosome-associated stress response protein SpoT.
Jiang, Mengxi; Sullivan, Susan M; Wout, Patrice K; Maddock, Janine R
2007-09-01
The bacterial response to stress is controlled by two proteins, RelA and SpoT. RelA generates the alarmone (p)ppGpp under amino acid starvation, whereas SpoT is responsible for (p)ppGpp hydrolysis and for synthesis of (p)ppGpp under a variety of cellular stress conditions. It is widely accepted that RelA is associated with translating ribosomes. The cellular location of SpoT, however, has been controversial. SpoT physically interacts with the ribosome-associated GTPase CgtA, and we show here that, under an optimized salt condition, SpoT is also associated with a pre-50S particle. Analysis of spoT and cgtA mutants and strains overexpressing CgtA suggests that the ribosome associations of SpoT and CgtA are mutually independent. The steady-state level of (p)ppGpp is increased in a cgtA mutant, but the accumulation of (p)ppGpp during amino acid starvation is not affected, providing strong evidence that CgtA regulates the (p)ppGpp level during exponential growth but not during the stringent response. We show that CgtA is not associated with pre-50S particles during amino acid starvation, indicating that under these conditions in which (p)ppGpp accumulates, CgtA is not bound either to the pre-50S particle or to SpoT. We propose that, in addition to its role as a 50S assembly factor, CgtA promotes SpoT (p)ppGpp degradation activity on the ribosome and that the loss of CgtA from the ribosome is necessary for maximal (p)ppGpp accumulation under stress conditions. Intriguingly, we found that in the absence of spoT and relA, cgtA is still an essential gene in Escherichia coli.
Tummala, Hemanth; Walne, Amanda J; Williams, Mike; Bockett, Nicholas; Collopy, Laura; Cardoso, Shirleny; Ellison, Alicia; Wynn, Rob; Leblanc, Thierry; Fitzgibbon, Jude; Kelsell, David P; van Heel, David A; Payne, Elspeth; Plagnol, Vincent; Dokal, Inderjeet; Vulliamy, Tom
2016-07-07
A substantial number of individuals with bone marrow failure (BMF) present with one or more extra-hematopoietic abnormality. This suggests a constitutional or inherited basis, and yet many of them do not fit the diagnostic criteria of the known BMF syndromes. Through exome sequencing, we have now identified a subgroup of these individuals, defined by germline biallelic mutations in DNAJC21 (DNAJ homolog subfamily C member 21). They present with global BMF, and one individual developed a hematological cancer (acute myeloid leukemia) in childhood. We show that the encoded protein associates with rRNA and plays a highly conserved role in the maturation of the 60S ribosomal subunit. Lymphoblastoid cells obtained from an affected individual exhibit increased sensitivity to the transcriptional inhibitor actinomycin D and reduced amounts of rRNA. Characterization of mutations revealed impairment in interactions with cofactors (PA2G4, HSPA8, and ZNF622) involved in 60S maturation. DNAJC21 deficiency resulted in cytoplasmic accumulation of the 60S nuclear export factor PA2G4, aberrant ribosome profiles, and increased cell death. Collectively, these findings demonstrate that mutations in DNAJC21 cause a cancer-prone BMF syndrome due to corruption of early nuclear rRNA biogenesis and late cytoplasmic maturation of the 60S subunit. Copyright © 2016. Published by Elsevier Inc.
Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA
Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus
2018-01-01
One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017
Telomere and ribosomal DNA repeats are chromosomal targets of the bloom syndrome DNA helicase
Schawalder, James; Paric, Enesa; Neff, Norma F
2003-01-01
Background Bloom syndrome is one of the most cancer-predisposing disorders and is characterized by genomic instability and a high frequency of sister chromatid exchange. The disorder is caused by loss of function of a 3' to 5' RecQ DNA helicase, BLM. The exact role of BLM in maintaining genomic integrity is not known but the helicase has been found to associate with several DNA repair complexes and some DNA replication foci. Results Chromatin immunoprecipitation of BLM complexes recovered telomere and ribosomal DNA repeats. The N-terminus of BLM, required for NB localization, is the same as the telomere association domain of BLM. The C-terminus is required for ribosomal DNA localization. BLM localizes primarily to the non-transcribed spacer region of the ribosomal DNA repeat where replication forks initiate. Bloom syndrome cells expressing the deletion alleles lacking the ribosomal DNA and telomere association domains have altered cell cycle populations with increased S or G2/M cells relative to normal. Conclusion These results identify telomere and ribosomal DNA repeated sequence elements as chromosomal targets for the BLM DNA helicase during the S/G2 phase of the cell cycle. BLM is localized in nuclear bodies when it associates with telomeric repeats in both telomerase positive and negative cells. The BLM DNA helicase participates in genomic stability at ribosomal DNA repeats and telomeres. PMID:14577841
Harmsen, Dag; Singer, Christian; Rothgänger, Jörg; Tønjum, Tone; Sybren de Hoog, Gerrit; Shah, Haroun; Albert, Jürgen; Frosch, Matthias
2001-01-01
Fast and reliable identification of microbial isolates is a fundamental goal of clinical microbiology. However, in the case of some fastidious gram-negative bacterial species, classical phenotype identification based on either metabolic, enzymatic, or serological methods is difficult, time-consuming, and/or inadequate. 16S or 23S ribosomal DNA (rDNA) bacterial sequencing will most often result in accurate speciation of isolates. Therefore, the objective of this study was to find a hypervariable rDNA stretch, flanked by strongly conserved regions, which is suitable for molecular species identification of members of the Neisseriaceae and Moraxellaceae. The inter- and intrageneric relationships were investigated using comparative sequence analysis of PCR-amplified partial 16S and 23S rDNAs from a total of 94 strains. When compared to the type species of the genera Acinetobacter, Moraxella, and Neisseria, an average of 30 polymorphic positions was observed within the partial 16S rDNA investigated (corresponding to Escherichia coli positions 54 to 510) for each species and an average of 11 polymorphic positions was observed within the 202 nucleotides of the 23S rDNA gene (positions 1400 to 1600). Neisseria macacae and Neisseria mucosa subsp. mucosa (ATCC 19696) had identical 16S and 23S rDNA sequences. Species clusters were heterogeneous in both genes in the case of Acinetobacter lwoffii, Moraxella lacunata, and N. mucosa. Neisseria meningitidis isolates failed to cluster only in the 23S rDNA subset. Our data showed that the 16S rDNA region is more suitable than the partial 23S rDNA for the molecular diagnosis of Neisseriaceae and Moraxellaceae and that a reference database should include more than one strain of each species. All sequence chromatograms and taxonomic and disease-related information are available as part of our ribosomal differentiation of medical microorganisms (RIDOM) web-based service (http://www.ridom.hygiene.uni-wuerzburg.de/). Users can submit a
Paszkiewicz-Gadek, A; Porowska, H; Gałasiński, W
1992-01-01
UDP-N-acetylglucosamine can be bound by pure ribosomes. The part of N-acetylglucosamine-1-P can be transferred from the complex ribosome-UDP-N-acetylglucosamine onto dolichol phosphate. Evidence is presented that N-acetylglucosamine bound to dolichol phosphate can be transferred to the nascent peptide synthesized on the ribosome.
Insights into the Initiation of Eukaryotic DNA Replication.
Bruck, Irina; Perez-Arnaiz, Patricia; Colbert, Max K; Kaplan, Daniel L
2015-01-01
The initiation of DNA replication is a highly regulated event in eukaryotic cells to ensure that the entire genome is copied once and only once during S phase. The primary target of cellular regulation of eukaryotic DNA replication initiation is the assembly and activation of the replication fork helicase, the 11-subunit assembly that unwinds DNA at a replication fork. The replication fork helicase, called CMG for Cdc45-Mcm2-7, and GINS, assembles in S phase from the constituent Cdc45, Mcm2-7, and GINS proteins. The assembly and activation of the CMG replication fork helicase during S phase is governed by 2 S-phase specific kinases, CDK and DDK. CDK stimulates the interaction between Sld2, Sld3, and Dpb11, 3 initiation factors that are each required for the initiation of DNA replication. DDK, on the other hand, phosphorylates the Mcm2, Mcm4, and Mcm6 subunits of the Mcm2-7 complex. Sld3 recruits Cdc45 to Mcm2-7 in a manner that depends on DDK, and recent work suggests that Sld3 binds directly to Mcm2-7 and also to single-stranded DNA. Furthermore, recent work demonstrates that Sld3 and its human homolog Treslin substantially stimulate DDK phosphorylation of Mcm2. These data suggest that the initiation factor Sld3/Treslin coordinates the assembly and activation of the eukaryotic replication fork helicase by recruiting Cdc45 to Mcm2-7, stimulating DDK phosphorylation of Mcm2, and binding directly to single-stranded DNA as the origin is melted.
Minimum requirements for the function of eukaryotic translation initiation factor 2.
Erickson, F L; Nika, J; Rippel, S; Hannig, E M
2001-01-01
Eukaryotic translation initiation factor 2 (eIF2) is a G protein heterotrimer required for GTP-dependent delivery of initiator tRNA to the ribosome. eIF2B, the nucleotide exchange factor for eIF2, is a heteropentamer that, in yeast, is encoded by four essential genes and one nonessential gene. We found that increased levels of wild-type eIF2, in the presence of sufficient levels of initiator tRNA, overcome the requirement for eIF2B in vivo. Consistent with bypassing eIF2B, these conditions also suppress the lethal effect of overexpressing the mammalian tumor suppressor PKR, an eIF2alpha kinase. The effects described are further enhanced in the presence of a mutation in the G protein (gamma) subunit of eIF2, gcd11-K250R, which mimics the function of eIF2B in vitro. Interestingly, the same conditions that bypass eIF2B also overcome the requirement for the normally essential eIF2alpha structural gene (SUI2). Our results suggest that the eIF2betagamma complex is capable of carrying out the essential function(s) of eIF2 in the absence of eIF2alpha and eIF2B and are consistent with the idea that the latter function primarily to regulate the level of eIF2.GTP.Met-tRNA(i)(Met) ternary complexes in vivo. PMID:11333223
Gawryluk, Ryan M R; Chisholm, Kenneth A; Pinto, Devanand M; Gray, Michael W
2014-09-23
We present a combined proteomic and bioinformatic investigation of mitochondrial proteins from the amoeboid protist Acanthamoeba castellanii, the first such comprehensive investigation in a free-living member of the supergroup Amoebozoa. This protist was chosen both for its phylogenetic position (as a sister to animals and fungi) and its ecological ubiquity and physiological flexibility. We report 1033 A. castellanii mitochondrial protein sequences, 709 supported by mass spectrometry data (676 nucleus-encoded and 33 mitochondrion-encoded), including two previously unannotated mtDNA-encoded proteins, which we identify as highly divergent mitochondrial ribosomal proteins. Other notable findings include duplicate proteins for all of the enzymes of the tricarboxylic acid (TCA) cycle-which, along with the identification of a mitochondrial malate synthase-isocitrate lyase fusion protein, suggests the interesting possibility that the glyoxylate cycle operates in A. castellanii mitochondria. Additionally, the A. castellanii genome encodes an unusually high number (at least 29) of mitochondrion-targeted pentatricopeptide repeat (PPR) proteins, organellar RNA metabolism factors in other organisms. We discuss several key mitochondrial pathways, including DNA replication, transcription and translation, protein degradation, protein import and Fe-S cluster biosynthesis, highlighting similarities and differences in these pathways in other eukaryotes. In compositional and functional complexity, the mitochondrial proteome of A. castellanii rivals that of multicellular eukaryotes. Comprehensive proteomic surveys of mitochondria have been undertaken in a limited number of predominantly multicellular eukaryotes. This phylogenetically narrow perspective constrains and biases our insights into mitochondrial function and evolution, as it neglects protists, which account for most of the evolutionary and functional diversity within eukaryotes. We report here the first comprehensive
Mathy, Nathalie; Pellegrini, Olivier; Serganov, Alexander; Patel, Dinshaw J.; Ehresmann, Chantal; Portier, Claude
2015-01-01
Summary The ribosomal protein S15 binds to 16S rRNA, during ribosome assembly, and to its own mRNA (rpsO mRNA), affecting autocontrol of its expression. In both cases, the RNA binding site is bipartite with a common subsite consisting of a G•U/G-C motif. The second subsite is located in a three-way junction in 16S rRNA and in the distal part of a stem forming a pseudoknot in Escherichia coli rpsO mRNA. To determine the extent of mimicry between these two RNA targets, we determined which amino acids interact with rpsO mRNA. A plasmid carrying rpsO (the S15 gene) was mutagenized and introduced into a strain lacking S15 and harbouring an rpsO–lacZ translational fusion. Analysis of deregulated mutants shows that each subsite of rpsO mRNA is recognized by a set of amino acids known to interact with 16S rRNA. In addition to the G•U/G-C motif, which is recognized by the same amino acids in both targets, the other subsite interacts with amino acids also involved in contacts with helix H22 of 16S rRNA, in the region adjacent to the three-way junction. However, specific S15–rpsO mRNA interactions can also be found, probably with A(−46) in loop L1 of the pseudoknot, demonstrating that mimicry between the two targets is limited. PMID:15101974
Wang, Lili; Yang, Jingang; Li, Changling; Xing, Sining; Yu, Ying; Liu, Shuo; Zhao, Song; Ma, Dongchu
2016-10-01
Objective To investigate regulatory role of ribosomal protein S6 kinase 1 (S6K1) in the polyploidization of different megakaryocytic leukemia cell lines at the different differentiation stages. Methods Megakaryocytic leukemia cell lines (Dami, Meg-01 and HEL cells) were induced towards polyploidization by SP600125, a c-Jun N-terminal kinase (JNK) inhibitor. The SP600125-inducing process was blocked by H-89, a cAMP-dependent protein kinase (PKA) inhibitor. The phenotype (CD41a, CD42a and CD42b) and DNA ploidy were detected by flow cytometry. The expression and phosphorylation of S6K1 and related proteins were detected by Western blotting. Results SP600125 induced polyploidization and increased the phosphorylation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1) in Dami, Meg-01 and HEL cells. However, the effect of SP600125 on polyploidization of the three cell lines was different, with the strongest effect on Dami cells and the weakest on Meg-01 cells. Moreover, SP600125 increased the phosphorylation of S6K1 Thr421/Ser424 and decreased the phosphorylation of Thr389 in Dami cells. However, it only increased the phosphorylation of Thr389 in HEL cells and had no effect on the phosphorylation of S6K1 in Meg-01 cells. Interestingly, H-89 only partially blocked the polyploidization of Dami cells, although it decreased the phosphorylation of 4E-BP1 in all SP600125-induced three cell lines. Noticeably, H-89 decreased the phosphorylation of S6K1 Thr421/Ser424 and increased the phosphorylation of Thr389 in Dami cells. However, H-89 had no effect on the phosphorylation of Thr421/Ser424, although it increased the phosphorylation of Thr389 in Meg-01 and HEL cells. Phenotypic analysis showed that the three cell lines were at different levels of differentiation in megakaryocytic lineage, with the highest differentiation in Dami and the lowest in Meg-01 cells. Conclusion SP600125-induced polyploidization of megakaryocytic leukemia cell lines is dependent on the effect
Guimond, A; Moss, T
1999-02-01
We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.
HATAKEYAMA, YOSHINORI; SHIBUYA, NORIHIRO; NISHIYAMA, TAKASHI; NAKASHIMA, NOBUHIKO
2004-01-01
The intergenic region (IGR) located upstream of the capsid protein gene in dicistroviruses contains an internal ribosome entry site (IRES). Translation initiation mediated by the IRES does not require initiator methionine tRNA. Comparison of the IGRs among dicistroviruses suggested that Taura syndrome virus (TSV) and acute bee paralysis virus have an extra side stem loop in the predicted IRES. We examined whether the side stem is responsible for translation activity mediated by the IGR using constructs with compensatory mutations. In vitro translation analysis showed that TSV has an IGR-IRES that is structurally distinct from those previously described. Because IGR-IRES elements determine the translation initiation site by virtue of their own tertiary structure formation, the discovery of this initiation mechanism suggests the possibility that eukaryotic mRNAs might have more extensive coding regions than previously predicted. To test this hypothesis, we searched full-length cDNA databases and whole genome sequences of eukaryotes using the pattern matching program, Scan For Matches, with parameters that can extract sequences containing secondary structure elements resembling those of IGR-IRES. Our search yielded several sequences, but their predicted secondary structures were suggested to be unstable in comparison to those of dicistroviruses. These results suggest that RNAs structurally similar to dicistroviruses are not common. If some eukaryotic mRNAs are translated independently of an initiator methionine tRNA, their structures are likely to be significantly distinct from those of dicistroviruses. PMID:15100433
The Circadian Clock Coordinates Ribosome Biogenesis
Symul, Laura; Martin, Eva; Atger, Florian; Naef, Felix; Gachon, Frédéric
2013-01-01
Biological rhythms play a fundamental role in the physiology and behavior of most living organisms. Rhythmic circadian expression of clock-controlled genes is orchestrated by a molecular clock that relies on interconnected negative feedback loops of transcription regulators. Here we show that the circadian clock exerts its function also through the regulation of mRNA translation. Namely, the circadian clock influences the temporal translation of a subset of mRNAs involved in ribosome biogenesis by controlling the transcription of translation initiation factors as well as the clock-dependent rhythmic activation of signaling pathways involved in their regulation. Moreover, the circadian oscillator directly regulates the transcription of ribosomal protein mRNAs and ribosomal RNAs. Thus the circadian clock exerts a major role in coordinating transcription and translation steps underlying ribosome biogenesis. PMID:23300384
Peláez Sánchez, Ronald G.; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad
2017-01-01
It is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)–high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira. Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR–HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri/Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri/L. yanagawae (four). The species verification was 100% concordant between PCR–HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR–HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates. PMID:28500802
The COG database: an updated version includes eukaryotes
Tatusov, Roman L; Fedorova, Natalie D; Jackson, John D; Jacobs, Aviva R; Kiryutin, Boris; Koonin, Eugene V; Krylov, Dmitri M; Mazumder, Raja; Mekhedov, Sergei L; Nikolskaya, Anastasia N; Rao, B Sridhar; Smirnov, Sergei; Sverdlov, Alexander V; Vasudevan, Sona; Wolf, Yuri I; Yin, Jodie J; Natale, Darren A
2003-01-01
Background The availability of multiple, essentially complete genome sequences of prokaryotes and eukaryotes spurred both the demand and the opportunity for the construction of an evolutionary classification of genes from these genomes. Such a classification system based on orthologous relationships between genes appears to be a natural framework for comparative genomics and should facilitate both functional annotation of genomes and large-scale evolutionary studies. Results We describe here a major update of the previously developed system for delineation of Clusters of Orthologous Groups of proteins (COGs) from the sequenced genomes of prokaryotes and unicellular eukaryotes and the construction of clusters of predicted orthologs for 7 eukaryotic genomes, which we named KOGs after eukaryotic orthologous groups. The COG collection currently consists of 138,458 proteins, which form 4873 COGs and comprise 75% of the 185,505 (predicted) proteins encoded in 66 genomes of unicellular organisms. The eukaryotic orthologous groups (KOGs) include proteins from 7 eukaryotic genomes: three animals (the nematode Caenorhabditis elegans, the fruit fly Drosophila melanogaster and Homo sapiens), one plant, Arabidopsis thaliana, two fungi (Saccharomyces cerevisiae and Schizosaccharomyces pombe), and the intracellular microsporidian parasite Encephalitozoon cuniculi. The current KOG set consists of 4852 clusters of orthologs, which include 59,838 proteins, or ~54% of the analyzed eukaryotic 110,655 gene products. Compared to the coverage of the prokaryotic genomes with COGs, a considerably smaller fraction of eukaryotic genes could be included into the KOGs; addition of new eukaryotic genomes is expected to result in substantial increase in the coverage of eukaryotic genomes with KOGs. Examination of the phyletic patterns of KOGs reveals a conserved core represented in all analyzed species and consisting of ~20% of the KOG set. This conserved portion of the KOG set is much greater
A Binary Segmentation Approach for Boxing Ribosome Particles in Cryo EM Micrographs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Adiga, Umesh P.S.; Malladi, Ravi; Baxter, William
Three-dimensional reconstruction of ribosome particles from electron micrographs requires selection of many single-particle images. Roughly 100,000 particles are required to achieve approximately 10 angstrom resolution. Manual selection of particles, by visual observation of the micrographs on a computer screen, is recognized as a bottleneck in automated single particle reconstruction. This paper describes an efficient approach for automated boxing of ribosome particles in micrographs. Use of a fast, anisotropic non-linear reaction-diffusion method to pre-process micrographs and rank-leveling to enhance the contrast between particles and the background, followed by binary and morphological segmentation constitute the core of this technique. Modifying the shapemore » of the particles to facilitate segmentation of individual particles within clusters and boxing the isolated particles is successfully attempted. Tests on a limited number of micrographs have shown that over 80 percent success is achieved in automatic particle picking.« less
Multi-perspective smFRET reveals rate-determining late intermediates of ribosomal translocation
Wasserman, Michael R.; Alejo, Jose L.; Altman, Roger B.; Blanchard, Scott C.
2016-01-01
Directional translocation of the ribosome through the messenger RNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of transfer and messenger RNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we have tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations reveal direct evidence of structurally and kinetically distinct, late intermediates during substrate movement, whose resolution is rate-determining to the translocation mechanism. These steps involve intra-molecular events within the EFG(GDP)-bound ribosome, including exaggerated, reversible fluctuations of the small subunit head domain, which ultimately facilitate peptidyl-tRNA’s movement into its final post-translocation position. PMID:26926435
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Valjent, Emmanuel; Bertran-Gonzalez, Jesus; Bowling, Heather; Lopez, Sébastien; Santini, Emanuela; Matamales, Miriam; Bonito-Oliva, Alessandra; Hervé, Denis; Hoeffer, Charles; Klann, Eric; Girault, Jean-Antoine; Fisone, Gilberto
2011-01-01
Administration of typical antipsychotic drugs, such as haloperidol, promotes cAMP-dependent signaling in the medium spiny neurons (MSNs) of the striatum. In this study, we have examined the effect of haloperidol on the state of phosphorylation of the ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit. We found that haloperidol increases the phosphorylation of rpS6 at the dual site Ser235/236, which is involved in the regulation of mRNA translation. This effect was exerted in the MSNs of the indirect pathway, which express specifically dopamine D2 receptors (D2Rs) and adenosine A2 receptors (A2ARs). The effect of haloperidol was decreased by blockade of A2ARs or by genetic attenuation of the Gαolf protein, which couples A2ARs to activation of adenylyl cyclase. Moreover, stimulation of cAMP-dependent protein kinase A (PKA) increased Ser235/236 phosphorylation in cultured striatal neurons. The ability of haloperidol to promote rpS6 phosphorylation was abolished in knock-in mice deficient for PKA activation of the protein phosphatase-1 inhibitor, dopamine- and cAMP-regulated phosphoprotein of 32 kDa. In contrast, pharmacological or genetic inactivation of p70 rpS6 kinase 1, or extracellular signal-regulated kinases did not affect haloperidol-induced rpS6 phosphorylation. These results identify PKA as a major rpS6 kinase in neuronal cells and suggest that regulation of protein synthesis through rpS6 may be a potential target of antipsychotic drugs. PMID:21814187
Eukaryotic organisms in Proterozoic oceans
Knoll, A.H; Javaux, E.J; Hewitt, D; Cohen, P
2006-01-01
The geological record of protists begins well before the Ediacaran and Cambrian diversification of animals, but the antiquity of that history, its reliability as a chronicle of evolution and the causal inferences that can be drawn from it remain subjects of debate. Well-preserved protists are known from a relatively small number of Proterozoic formations, but taphonomic considerations suggest that they capture at least broad aspects of early eukaryotic evolution. A modest diversity of problematic, possibly stem group protists occurs in ca 1800–1300 Myr old rocks. 1300–720 Myr fossils document the divergence of major eukaryotic clades, but only with the Ediacaran–Cambrian radiation of animals did diversity increase within most clades with fossilizable members. While taxonomic placement of many Proterozoic eukaryotes may be arguable, the presence of characters used for that placement is not. Focus on character evolution permits inferences about the innovations in cell biology and development that underpin the taxonomic and morphological diversification of eukaryotic organisms. PMID:16754612
Hong, Mina; Kim, HyungRyong; Kim, Inki
2014-07-18
Although first identified for their roles in protein synthesis, certain ribosomal proteins exert pleiotropic physiological functions in the cell. Ribosomal protein L19 is overexpressed in breast cancer cells by amplification and copy number variation. In this study, we examined the novel pro-apoptotic role of ribosomal protein L19 in the breast cancer cell line MCF7. Overexpression of RPL19 sensitized MCF7 cells to endoplasmic reticulum stress-induced cell death. RPL19 overexpression itself was not cytotoxic; however, cell death induction was enhanced when RPL19 overexpressing cells were incubated with endoplasmic reticulum stress-inducing agents, and this sensitizing effect was specific to MCF7 cells. Examination of the cell signaling pathways that mediate the unfolded protein response (UPR) revealed that overexpression of RPL19 induced pre-activation of the UPR, including phosphorylation of pERK-like ER kinase (PERK), phosphorylation of eukaryotic translation initiation factor 2 alpha (eIF2α), and activation of p38 MAPK-associated stress signaling. Our findings suggest that upregulation of RPL19 induces ER stress, resulting in increased sensitivity to ER stress and enhanced cell death in MCF7 breast cancer cells. Copyright © 2014 Elsevier Inc. All rights reserved.
Complete kinetic mechanism for recycling of the bacterial ribosome
Borg, Anneli; Pavlov, Michael
2016-01-01
How EF-G and RRF act together to split a post-termination ribosomal complex into its subunits has remained obscure. Here, using stopped-flow experiments with Rayleigh light scattering detection and quench-flow experiments with radio-detection of GTP hydrolysis, we have clarified the kinetic mechanism of ribosome recycling and obtained precise estimates of its kinetic parameters. Ribosome splitting requires that EF-G binds to an already RRF-containing ribosome. EF-G binding to RRF-free ribosomes induces futile rounds of GTP hydrolysis and inhibits ribosome splitting, implying that while RRF is purely an activator of recycling, EF-G acts as both activator and competitive inhibitor of RRF in recycling of the post-termination ribosome. The ribosome splitting rate and the number of GTPs consumed per splitting event depend strongly on the free concentrations of EF-G and RRF. The maximal recycling rate, here estimated as 25 sec−1, is approached at very high concentrations of EF-G and RRF with RRF in high excess over EF-G. The present in vitro results, suggesting an in vivo ribosome recycling rate of ∼5 sec−1, are discussed in the perspective of rapidly growing bacterial cells. PMID:26527791
A novel subfamily of monomeric inorganic pyrophosphatases in photosynthetic eukaryotes
Gómez-García, María R.; Losada, Manuel; Serrano, Aurelio
2005-01-01
Two sPPases (soluble inorganic pyrophosphatases, EC 3.6.1.1) have been isolated from the microalga Chlamydomonas reinhardtii. Both are monomeric proteins of organellar localization, the chloroplastic sPPase I [Cr (Ch. reinhardtii)-sPPase I, 30 kDa] is a major isoform and slightly larger protein than the mitochondrial sPPase II (Cr-sPPase II, 24 kDa). They are members of sPPase family I and are encoded by two different cDNAs, as demonstrated by peptide mass fingerprint analysis. Molecular phylogenetic analyses indicated that Cr-sPPase I is closely related to other eukaryotic sPPases, whereas Cr-sPPase II resembles its prokaryotic counterparts. Chloroplastic sPPase I may have replaced a cyanobacterial ancestor very early during plastid evolution. Cr-sPPase II orthologues are found in members of the green photosynthetic lineage, but not in animals or fungi. These two sPPases from photosynthetic eukaryotes are novel monomeric family I sPPases with different molecular phylogenies and cellular localizations. PMID:16313235
The relative ages of eukaryotes and akaryotes.
Penny, David; Collins, Lesley J; Daly, Toni K; Cox, Simon J
2014-12-01
The Last Eukaryote Common Ancestor (LECA) appears to have the genetics required for meiosis, mitosis, nucleus and nuclear substructures, an exon/intron gene structure, spliceosomes, many centres of DNA replication, etc. (and including mitochondria). Most of these features are not generally explained by models for the origin of the Eukaryotic cell based on the fusion of an Archeon and a Bacterium. We find that the term 'prokaryote' is ambiguous and the non-phylogenetic term akaryote should be used in its place because we do not yet know the direction of evolution between eukaryotes and akaryotes. We use the term 'protoeukaryote' for the hypothetical stem group ancestral eukaryote that took up a bacterium as an endosymbiont that formed the mitochondrion. It is easier to make detailed models with a eukaryote to an akaryote transition, rather than vice versa. So we really are at a phylogenetic impasse in not being confident about the direction of change between eukaryotes and akaryotes.
Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).
Yonath, Ada
2010-06-14
High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics.
Steps Toward Understanding Mitochondrial Fe/S Cluster Biogenesis.
Melber, Andrew; Winge, Dennis R
2018-01-01
Iron-sulfur clusters (Fe/S clusters) are essential cofactors required throughout the clades of biology for performing a myriad of unique functions including nitrogen fixation, ribosome assembly, DNA repair, mitochondrial respiration, and metabolite catabolism. Although Fe/S clusters can be synthesized in vitro and transferred to a client protein without enzymatic assistance, biology has evolved intricate mechanisms to assemble and transfer Fe/S clusters within the cellular environment. In eukaryotes, the foundation of all cellular clusters starts within the mitochondria. The focus of this review is to detail the mitochondrial Fe/S biogenesis (ISC) pathway along with the Fe/S cluster transfer steps necessary to mature Fe/S proteins. New advances in our understanding of the mitochondrial Fe/S biogenesis machinery will be highlighted. Additionally, we will address various experimental approaches that have been successful in the identification and characterization of components of the ISC pathway. © 2018 Elsevier Inc. All rights reserved.
Germot, Agnès; Philippe, Hervé; Le Guyader, Hervé
1996-01-01
Molecular phylogenetic analyses, based mainly on ribosomal RNA, show that three amitochondriate protist lineages, diplomonads, microsporidia, and trichomonads, emerge consistently at the base of the eukaryotic tree before groups having mitochondria. This suggests that these groups could have diverged before the mitochondrial endosymbiosis. Nevertheless, since all these organisms live in anaerobic environments, the absence of mitochondria might be due to secondary loss, as demonstrated for the later emerging eukaryote Entamoeba histolytica. We have now isolated from Trichomonas vaginalis a gene encoding a chaperone protein (HSP70) that in other lineages is addressed to the mitochondrial compartment. The phylogenetic reconstruction unambiguously located this HSP70 within a large set of mitochondrial sequences, itself a sister-group of α-purple bacteria. In addition, the T. vaginalis protein exhibits the GDAWV sequence signature, so far exclusively found in mitochondrial HSP70 and in proteobacterial dnaK. Thus mitochondrial endosymbiosis could have occurred earlier than previously assumed. The trichomonad double membrane-bounded organelles, the hydrogenosomes, could have evolved from mitochondria. PMID:8962101
Dey, Sandip; Biswas, Chiranjit; Sengupta, Jayati
2018-06-21
The ribosome-associated GTPase HflX acts as an antiassociation factor upon binding to the 50S ribosomal subunit during heat stress in Escherichia coli Although HflX is recognized as a guanosine triphosphatase, several studies have shown that the N-terminal domain 1 of HflX is capable of hydrolyzing adenosine triphosphate (ATP), but the functional role of its adenosine triphosphatase (ATPase) activity remains unknown. We demonstrate that E. coli HflX possesses ATP-dependent RNA helicase activity and is capable of unwinding large subunit ribosomal RNA. A cryo-electron microscopy structure of the 50S-HflX complex in the presence of nonhydrolyzable analogues of ATP and guanosine triphosphate hints at a mode of action for the RNA helicase and suggests the linker helical domain may have a determinant role in RNA unwinding. Heat stress results in inactivation of the ribosome, and we show that HflX can restore heat-damaged ribosomes and improve cell survival. © 2018 Dey et al.
Nuclear export of the small ribosomal subunit requires the Ran–GTPase cycle and certain nucleoporins
Moy, Terence I.; Silver, Pamela A.
1999-01-01
After their assembly in the nucleolus, ribosomal subunits are exported from the nucleus to the cytoplasm. After export, the 20S rRNA in the small ribosomal subunit is cleaved to yield 18S rRNA and the small 5′ ITS1 fragment. The 5′ ITS1 RNA is normally degraded by the cytoplasmic Xrn1 exonuclease, but in strains lacking XRN1, the 5′ ITS1 fragment accumulates in the cytoplasm. Using the cytoplasmic localization of the 5′ ITS1 fragment as an indicator for the export of the small ribosomal subunit, we have identified genes that are required for ribosome export. Ribosome export is dependent on the Ran–GTPase as mutations in Ran or its regulators caused 5′ ITS1 to accumulate in the nucleoplasm. Mutations in the genes encoding the nucleoporin Nup82 and in the NES exporter Xpo1/Crm1 also caused the nucleoplasmic accumulation of 5′ ITS1. Mutants in a subset of nucleoporins and in the nuclear transport factors Srp1, Kap95, Pse1, Cse1, and Mtr10 accumulate the 5′ ITS1 in the nucleolus and affect ribosome assembly. In contrast, we did not detect nuclear accumulation of 5′ ITS1 in 28 yeast strains that have mutations in other genes affecting nuclear trafficking. PMID:10465789
DEL CAMPO, MARK; RECINOS, CLAUDIA; YANEZ, GISCARD; POMERANTZ, STEVEN C.; GUYMON, REBECCA; CRAIN, PAMELA F.; MCCLOSKEY, JAMES A.; OFENGAND, JAMES
2005-01-01
The number and position of the pseudouridines of Haloarcula marismortui and Deinococcus radiodurans large subunit RNA have been determined by a combination of total nucleoside analysis by HPLC-mass spectrometry and pseudouridine sequencing by the reverse transcriptase method and by LC/MS/MS. Three pseudouridines were found in H. marismortui, located at positions 1956, 1958, and 2621 corresponding to Escherichia coli positions 1915, 1917, and 2586, respectively. The three pseudouridines are all in locations found in other organisms. Previous reports of a larger number of pseudouridines in this organism were incorrect. Three pseudouridines and one 3-methyl pseudouridine (m3Ψ) were found in D. radiodurans 23S RNA at positions 1894, 1898 (m3Ψ), 1900, and 2584, the m3Ψ site being determined by a novel application of mass spectrometry. These positions correspond to E. coli positions 1911, 1915, 1917, and 2605, which are also pseudouridines in E. coli (1915 is m3Ψ). The pseudouridines in the helix 69 loop, residues 1911, 1915, and 1917, are in positions highly conserved among all phyla. Pseudouridine 2584 in D. radiodurans is conserved in eubacteria and a chloroplast but is not found in archaea or eukaryotes, whereas pseudouridine 2621 in H. marismortui is more conserved in eukaryotes and is not found in eubacteria. All the pseudoridines are near, but not exactly at, nucleotides directly involved in various aspects of ribosome function. In addition, two D. radiodurans Ψ synthases responsible for the four Ψ were identified. PMID:15659360
Ribosome hijacking: a role for small protein B during trans-translation
Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice
2009-01-01
Tight recognition of codon–anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the ‘tmRNA–SmpB' system (transfer messenger RNA–small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon–anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon–anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for ΔsmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon. PMID:19132006
Ribosome hijacking: a role for small protein B during trans-translation.
Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice
2009-02-01
Tight recognition of codon-anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the 'tmRNA-SmpB' system (transfer messenger RNA-small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon-anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon-anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for DeltasmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon.
Rqc2p and 60S ribosomal subunits mediate mRNA-independent elongation of nascent chains
Shen, Peter S.; Park, Joseph; Qin, Yidan; Li, Xueming; Parsawar, Krishna; Larson, Matthew H.; Cox, James; Cheng, Yifan; Lambowitz, Alan M.; Weissman, Jonathan S.; Brandman, Onn; Frost, Adam
2015-01-01
In Eukarya, stalled translation induces 40S dissociation and recruitment of the Ribosome Quality control Complex (RQC) to the 60S subunit, which mediates nascent chain degradation. Here, we report cryoEM structures revealing that the RQC components Rqc2p (YPL009C/Tae2) and Ltn1p (YMR247C/Rkr1) bind to the 60S at sites exposed after 40S dissociation, placing the Ltn1p RING domain near the exit channel and Rqc2p over the P-site tRNA. We further demonstrate that Rqc2p recruits alanine and threonine charged tRNA to the A-site and directs elongation of nascent chains independently of mRNA or 40S subunits. Our work uncovers an unexpected mechanism of protein synthesis in which a protein—not an mRNA—determines tRNA recruitment and the tagging of nascent chains with Carboxy-terminal Ala and Thr extensions (“CAT tails”). PMID:25554787
Modular Assembly of the Bacterial Large Ribosomal Subunit
Davis, Joseph H.; Tan, Yong Zi; Carragher, Bridget; Potter, Clinton S.; Lyumkis, Dmitry; Williamson, James R.
2016-01-01
SUMMARY The ribosome is a complex macromolecular machine and serves as an ideal system for understanding biological macromolecular assembly. Direct observation of ribosome assembly in vivo is difficult, as few intermediates have been isolated and thoroughly characterized. Herein, we deploy a genetic system to starve cells of an essential ribosomal protein, which results in the accumulation of assembly intermediates that are competent for maturation. Quantitative mass spectrometry and single-particle cryo-electron microscopy reveal 13 distinct intermediates, which were each resolved to ~4–5Å resolution and could be placed in an assembly pathway. We find that ribosome biogenesis is a parallel process, that blocks of structured rRNA and proteins assemble cooperatively, and that the entire process is dynamic and can be ‘re-routed’ through different pathways as needed. This work reveals the complex landscape of ribosome assembly in vivo and provides the requisite tools to characterize additional assembly pathways for ribosomes and other macromolecular machines. PMID:27912064
Precambrian Skeletonized Microbial Eukaryotes
NASA Astrophysics Data System (ADS)
Lipps, Jere H.
2017-04-01
Skeletal heterotrophic eukaryotes are mostly absent from the Precambrian, although algal eukaryotes appear about 2.2 billion years ago. Tintinnids, radiolaria and foraminifera have molecular origins well back into the Precambrian yet no representatives of these groups are known with certainty in that time. These data infer times of the last common ancestors, not the appearance of true representatives of these groups which may well have diversified or not been preserved since those splits. Previous reports of these groups in the Precambrian are misinterpretations of other objects in the fossil record. Reported tintinnids at 1600 mya from China are metamorphic shards or mineral artifacts, the many specimens from 635-715 mya in Mongolia may be eukaryotes but they are not tintinnids, and the putative tintinnids at 580 mya in the Doushantou formation of China are diagenetic alterations of well-known acritarchs. The oldest supposed foraminiferan is Titanotheca from 550 to 565 mya rocks in South America and Africa is based on the occurrence of rutile in the tests and in a few modern agglutinated foraminifera, as well as the agglutinated tests. Neither of these nor the morphology are characteristic of foraminifera; hence these fossils remain as indeterminate microfossils. Platysolenites, an agglutinated tube identical to the modern foraminiferan Bathysiphon, occurs in the latest Neoproterozoic in Russia, Canada, and the USA (California). Some of the larger fossils occurring in typical Ediacaran (late Neoproterozoic) assemblages may be xenophyophorids (very large foraminifera), but the comparison is disputed and flawed. Radiolaria, on occasion, have been reported in the Precambrian, but the earliest known clearly identifiable ones are in the Cambrian. The only certain Precambrian heterotrophic skeletal eukaryotes (thecamoebians) occur in fresh-water rocks at about 750 mya. Skeletonized radiolaria and foraminifera appear sparsely in the Cambrian and radiate in the Ordovician
The others: our biased perspective of eukaryotic genomes
del Campo, Javier; Sieracki, Michael E.; Molestina, Robert; Keeling, Patrick; Massana, Ramon; Ruiz-Trillo, Iñaki
2015-01-01
Understanding the origin and evolution of the eukaryotic cell and the full diversity of eukaryotes is relevant to many biological disciplines. However, our current understanding of eukaryotic genomes is extremely biased, leading to a skewed view of eukaryotic biology. We argue that a phylogeny-driven initiative to cover the full eukaryotic diversity is needed to overcome this bias. We encourage the community: (i) to sequence a representative of the neglected groups available at public culture collections, (ii) to increase our culturing efforts, and (iii) to embrace single cell genomics to access organisms refractory to propagation in culture. We hope that the community will welcome this proposal, explore the approaches suggested, and join efforts to sequence the full diversity of eukaryotes. PMID:24726347
Fluctuations between multiple EF-G-induced chimeric tRNA states during translocation on the ribosome
NASA Astrophysics Data System (ADS)
Adio, Sarah; Senyushkina, Tamara; Peske, Frank; Fischer, Niels; Wintermeyer, Wolfgang; Rodnina, Marina V.
2015-06-01
The coupled translocation of transfer RNA and messenger RNA through the ribosome entails large-scale structural rearrangements, including step-wise movements of the tRNAs. Recent structural work has visualized intermediates of translocation induced by elongation factor G (EF-G) with tRNAs trapped in chimeric states with respect to 30S and 50S ribosomal subunits. The functional role of the chimeric states is not known. Here we follow the formation of translocation intermediates by single-molecule fluorescence resonance energy transfer. Using EF-G mutants, a non-hydrolysable GTP analogue, and fusidic acid, we interfere with either translocation or EF-G release from the ribosome and identify several rapidly interconverting chimeric tRNA states on the reaction pathway. EF-G engagement prevents backward transitions early in translocation and increases the fraction of ribosomes that rapidly fluctuate between hybrid, chimeric and posttranslocation states. Thus, the engagement of EF-G alters the energetics of translocation towards a flat energy landscape, thereby promoting forward tRNA movement.
Structure modulation of helix 69 from Escherichia coli 23S ribosomal RNA by pseudouridylations
Jiang, Jun; Aduri, Raviprasad; Chow, Christine S.; SantaLucia, John
2014-01-01
Helix 69 (H69) is a 19-nt stem-loop region from the large subunit ribosomal RNA. Three pseudouridine (Ψ) modifications clustered in H69 are conserved across phylogeny and known to affect ribosome function. To explore the effects of Ψ on the conformations of Escherichia coli H69 in solution, nuclear magnetic resonance spectroscopy was used to reveal the structural differences between H69 with (ΨΨΨ) and without (UUU) Ψ modifications. Comparison of the two structures shows that H69 ΨΨΨ has the following unique features: (i) the loop region is closed by a Watson–Crick base pair between Ψ1911 and A1919, which is potentially reinforced by interactions involving Ψ1911N1H and (ii) Ψ modifications at loop residues 1915 and 1917 promote base stacking from Ψ1915 to A1918. In contrast, the H69 UUU loop region, which lacks Ψ modifications, is less organized. Structure modulation by Ψ leads to alteration in conformational behavior of the 5' half of the H69 loop region, observed as broadening of C1914 non-exchangeable base proton resonances in the H69 ΨΨΨ nuclear magnetic resonance spectra, and plays an important biological role in establishing the ribosomal intersubunit bridge B2a and mediating translational fidelity. PMID:24371282
Structure modulation of helix 69 from Escherichia coli 23S ribosomal RNA by pseudouridylations.
Jiang, Jun; Aduri, Raviprasad; Chow, Christine S; SantaLucia, John
2014-04-01
Helix 69 (H69) is a 19-nt stem-loop region from the large subunit ribosomal RNA. Three pseudouridine (Ψ) modifications clustered in H69 are conserved across phylogeny and known to affect ribosome function. To explore the effects of Ψ on the conformations of Escherichia coli H69 in solution, nuclear magnetic resonance spectroscopy was used to reveal the structural differences between H69 with (ΨΨΨ) and without (UUU) Ψ modifications. Comparison of the two structures shows that H69 ΨΨΨ has the following unique features: (i) the loop region is closed by a Watson-Crick base pair between Ψ1911 and A1919, which is potentially reinforced by interactions involving Ψ1911N1H and (ii) Ψ modifications at loop residues 1915 and 1917 promote base stacking from Ψ1915 to A1918. In contrast, the H69 UUU loop region, which lacks Ψ modifications, is less organized. Structure modulation by Ψ leads to alteration in conformational behavior of the 5' half of the H69 loop region, observed as broadening of C1914 non-exchangeable base proton resonances in the H69 ΨΨΨ nuclear magnetic resonance spectra, and plays an important biological role in establishing the ribosomal intersubunit bridge B2a and mediating translational fidelity.
Hurt, Ed; Hannus, Stefan; Schmelzl, Birgit; Lau, Denise; Tollervey, David; Simos, George
1999-01-01
To identify components involved in the nuclear export of ribosomes in yeast, we developed an in vivo assay exploiting a green fluorescent protein (GFP)-tagged version of ribosomal protein L25. After its import into the nucleolus, L25-GFP assembles with 60S ribosomal subunits that are subsequently exported into the cytoplasm. In wild-type cells, GFP-labeled ribosomes are only detected by fluorescence in the cytoplasm. However, thermosensitive rna1-1 (Ran-GAP), prp20-1 (Ran-GEF), and nucleoporin nup49 and nsp1 mutants are impaired in ribosomal export as revealed by nuclear accumulation of L25-GFP. Furthermore, overexpression of dominant-negative RanGTP (Gsp1-G21V) and the tRNA exportin Los1p inhibits ribosomal export. The pattern of subnuclear accumulation of L25-GFP observed in different mutants is not identical, suggesting that transport can be blocked at different steps. Thus, nuclear export of ribosomes requires the nuclear/cytoplasmic Ran-cycle and distinct nucleoporins. This assay can be used to identify soluble transport factors required for nuclear exit of ribosomes. PMID:9971735
The eukaryotic fossil record in deep time
NASA Astrophysics Data System (ADS)
Butterfield, N.
2011-12-01
Eukaryotic organisms are defining constituents of the Phanerozoic biosphere, but they also extend well back into the Proterozoic record, primarily in the form of microscopic body fossils. Criteria for identifying pre-Ediacaran eukaryotes include large cell size, morphologically complex cell walls and/or the recognition of diagnostically eukaryotic cell division patterns. The oldest unambiguous eukaryote currently on record is an acanthomorphic acritarch (Tappania) from the Palaeoproterozoic Semri Group of central India. Older candidate eukaryotes are difficult to distinguish from giant bacteria, prokaryotic colonies or diagenetic artefacts. In younger Meso- and Neoproterozoic strata, the challenge is to recognize particular grades and clades of eukaryotes, and to document their macro-evolutionary expression. Distinctive unicellular forms include mid-Neoproterozoic testate amoebae and phosphate biomineralizing 'scale-microfossils' comparable to an extant green alga. There is also a significant record of seaweeds, possible fungi and problematica from this interval, documenting multiple independent experiments in eukaryotic multicellularity. Taxonomically resolved forms include a bangiacean red alga and probable vaucheriacean chromalveolate algae from the late Mesoproterozoic, and populations of hydrodictyacean and siphonocladalean green algae of mid Neoproterozoic age. Despite this phylogenetic breadth, however, or arguments from molecular clocks, there is no convincing evidence for pre-Ediacaran metazoans or metaphytes. The conspicuously incomplete nature of the Proterozoic record makes it difficult to resolve larger-scale ecological and evolutionary patterns. Even so, both body fossils and biomarker data point to a pre-Ediacaran biosphere dominated overwhelming by prokaryotes. Contemporaneous eukaryotes appear to be limited to conspicuously shallow water environments, and exhibit fundamentally lower levels of morphological diversity and evolutionary turnover than
Therapeutic Discourse and ACOA Films of the '80s and '90s.
ERIC Educational Resources Information Center
Lynch, Joan Driscoll
2000-01-01
Argues that many family melodramas in films of the '80s and '90s focus their narrative on the negative dynamics of the parental relationship. Identifies underlying generic patterns and ideas found in these films. Explores representations of mothers, fathers, and children; gender representation and codependency; and familial dysfunction. Broadens…
Molecular Detection of Eukaryotes in a Single Human Stool Sample from Senegal
Hamad, Ibrahim; Sokhna, Cheikh; Raoult, Didier; Bittar, Fadi
2012-01-01
Background Microbial eukaryotes represent an important component of the human gut microbiome, with different beneficial or harmful roles; some species are commensal or mutualistic, whereas others are opportunistic or parasitic. The diversity of eukaryotes inhabiting humans remains relatively unexplored because of either the low abundance of these organisms in human gut or because they have received limited attention from a whole-community perspective. Methodology/Principal Finding In this study, a single fecal sample from a healthy African male was studied using both culture-dependent methods and extended molecular methods targeting the 18S rRNA and ITS sequences. Our results revealed that very few fungi, including Candida spp., Galactomyces spp., and Trichosporon asahii, could be isolated using culture-based methods. In contrast, a relatively a high number of eukaryotic species could be identified in this fecal sample when culture-independent methods based on various primer sets were used. A total of 27 species from one sample were found among the 977 analyzed clones. The clone libraries were dominated by fungi (716 clones/977, 73.3%), corresponding to 16 different species. In addition, 187 sequences out of 977 (19.2%) corresponded to 9 different species of plants; 59 sequences (6%) belonged to other micro-eukaryotes in the gut, including Entamoeba hartmanni and Blastocystis sp; and only 15 clones/977 (1.5%) were related to human 18S rRNA sequences. Conclusion Our results revealed a complex eukaryotic community in the volunteer’s gut, with fungi being the most abundant species in the stool sample. Larger investigations are needed to assess the generality of these results and to understand their roles in human health and disease. PMID:22808282