Sample records for event-specific pcr method

  1. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  2. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    PubMed

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  3. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  4. Simplex and duplex event-specific analytical methods for functional biotech maize.

    PubMed

    Lee, Seong-Hun; Kim, Su-Jeong; Yi, Bu-Young

    2009-08-26

    Analytical methods are very important in the control of genetically modified organism (GMO) labeling systems or living modified organism (LMO) management for biotech crops. Event-specific primers and probes were developed for qualitative and quantitative analysis for biotech maize event 3272 and LY 038 on the basis of the 3' flanking regions, respectively. The qualitative primers confirmed the specificity by a single PCR product and sensitivity to 0.05% as a limit of detection (LOD). Simplex and duplex quantitative methods were also developed using TaqMan real-time PCR. One synthetic plasmid was constructed from two taxon-specific DNA sequences of maize and two event-specific 3' flanking DNA sequences of event 3272 and LY 038 as reference molecules. In-house validation of the quantitative methods was performed using six levels of mixing samples, from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-30%. Limits of quantitation (LOQs) of the quantitative methods were all 0.1% for simplex real-time PCRs of event 3272 and LY 038 and 0.5% for duplex real-time PCR of LY 038. This study reports that event-specific analytical methods were applicable for qualitative and quantitative analysis for biotech maize event 3272 and LY 038.

  5. Simultaneous Detection of Genetically Modified Organisms in a Mixture by Multiplex PCR-Chip Capillary Electrophoresis.

    PubMed

    Patwardhan, Supriya; Dasari, Srikanth; Bhagavatula, Krishna; Mueller, Steffen; Deepak, Saligrama Adavigowda; Ghosh, Sudip; Basak, Sanjay

    2015-01-01

    An efficient PCR-based method to trace genetically modified food and feed products is in demand due to regulatory requirements and contaminant issues in India. However, post-PCR detection with conventional methods has limited sensitivity in amplicon separation that is crucial in multiplexing. The study aimed to develop a sensitive post-PCR detection method by using PCR-chip capillary electrophoresis (PCR-CCE) to detect and identify specific genetically modified organisms in their genomic DNA mixture by targeting event-specific nucleotide sequences. Using the PCR-CCE approach, novel multiplex methods were developed to detect MON531 cotton, EH 92-527-1 potato, Bt176 maize, GT73 canola, or GA21 maize simultaneously when their genomic DNAs in mixtures were amplified using their primer mixture. The repeatability RSD (RSDr) of the peak migration time was 0.06 and 3.88% for the MON531 and Bt176, respectively. The RSD (RSDR) of the Cry1Ac peak ranged from 0.12 to 0.40% in multiplex methods. The method was sensitive in resolving amplicon of size difference up to 4 bp. The PCR-CCE method is suitable to detect multiple genetically modified events in a composite DNA sample by tagging their event specific sequences.

  6. Comparison of three DNA extraction methods for the detection and quantification of GMO in Ecuadorian manufactured food.

    PubMed

    Pacheco Coello, Ricardo; Pestana Justo, Jorge; Factos Mendoza, Andrés; Santos Ordoñez, Efrén

    2017-12-20

    In Ecuador, food products need to be labeled if exceeded 0.9% of transgenic content in whole products. For the detection of genetically modified organisms (GMOs), three DNA extraction methods were tested in 35 food products commercialized in Ecuador. Samples with positive amplification of endogenous genes were screened for the presence of the Cauliflower mosaic virus 35S-promoter (P35S) and the nopaline synthase-terminator (Tnos). TaqMan™ probes were used for determination of transgenic content of the GTS 40-3-2 and MON810 events through quantitative PCR (qPCR). Twenty-six processed food samples were positive for the P35S alone and eight samples for the Tnos and P35S. Absolute qPCR results indicated that eleven samples were positive for GTS 40-3-2 specific event and two for MON810 specific event. A total of nine samples for events GTS 40-3-2 and MON810 exceeded the umbral allowed of transgenic content in the whole food product with the specific events. Different food products may require different DNA extraction protocols for GMO detection through PCR. Among the three methods tested, the DNeasy mericon food kit DNA extraction method obtained higher proportion of amplified endogenous genes through PCR. Finally, event-specific GMOs were detected in food products in Ecuador.

  7. Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

    PubMed

    Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

    2011-12-28

    For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

  8. Development and Evaluation of Event-Specific Quantitative PCR Method for Genetically Modified Soybean MON87701.

    PubMed

    Tsukahara, Keita; Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Nishimaki-Mogami, Tomoko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event, MON87701. First, a standard plasmid for MON87701 quantification was constructed. The conversion factor (C f ) required to calculate the amount of genetically modified organism (GMO) was experimentally determined for a real-time PCR instrument. The determined C f for the real-time PCR instrument was 1.24. For the evaluation of the developed method, a blind test was carried out in an inter-laboratory trial. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr), respectively. The determined biases and the RSDr values were less than 30 and 13%, respectively, at all evaluated concentrations. The limit of quantitation of the method was 0.5%, and the developed method would thus be applicable for practical analyses for the detection and quantification of MON87701.

  9. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    PubMed

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  10. Development and application of absolute quantitative detection by duplex chamber-based digital PCR of genetically modified maize events without pretreatment steps.

    PubMed

    Zhu, Pengyu; Fu, Wei; Wang, Chenguang; Du, Zhixin; Huang, Kunlun; Zhu, Shuifang; Xu, Wentao

    2016-04-15

    The possibility of the absolute quantitation of GMO events by digital PCR was recently reported. However, most absolute quantitation methods based on the digital PCR required pretreatment steps. Meanwhile, singleplex detection could not meet the demand of the absolute quantitation of GMO events that is based on the ratio of foreign fragments and reference genes. Thus, to promote the absolute quantitative detection of different GMO events by digital PCR, we developed a quantitative detection method based on duplex digital PCR without pretreatment. Moreover, we tested 7 GMO events in our study to evaluate the fitness of our method. The optimized combination of foreign and reference primers, limit of quantitation (LOQ), limit of detection (LOD) and specificity were validated. The results showed that the LOQ of our method for different GMO events was 0.5%, while the LOD is 0.1%. Additionally, we found that duplex digital PCR could achieve the detection results with lower RSD compared with singleplex digital PCR. In summary, the duplex digital PCR detection system is a simple and stable way to achieve the absolute quantitation of different GMO events. Moreover, the LOQ and LOD indicated that this method is suitable for the daily detection and quantitation of GMO events. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay.

    PubMed

    Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-02-18

    In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.

  12. [Development and validation of event-specific quantitative PCR method for genetically modified maize LY038].

    PubMed

    Mano, Junichi; Masubuchi, Tomoko; Hatano, Shuko; Futo, Satoshi; Koiwa, Tomohiro; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Takabatake, Reona; Kitta, Kazumi

    2013-01-01

    In this article, we report a novel real-time PCR-based analytical method for quantitation of the GM maize event LY038. We designed LY038-specific and maize endogenous reference DNA-specific PCR amplifications. After confirming the specificity and linearity of the LY038-specific PCR amplification, we determined the conversion factor required to calculate the weight-based content of GM organism (GMO) in a multilaboratory evaluation. Finally, in order to validate the developed method, an interlaboratory collaborative trial according to the internationally harmonized guidelines was performed with blind DNA samples containing LY038 at the mixing levels of 0, 0.5, 1.0, 5.0 and 10.0%. The precision of the method was evaluated as the RSD of reproducibility (RSDR), and the values obtained were all less than 25%. The limit of quantitation of the method was judged to be 0.5% based on the definition of ISO 24276 guideline. The results from the collaborative trial suggested that the developed quantitative method would be suitable for practical testing of LY038 maize.

  13. Development and evaluation of event-specific quantitative PCR method for genetically modified soybean A2704-12.

    PubMed

    Takabatake, Reona; Akiyama, Hiroshi; Sakata, Kozue; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Teshima, Reiko; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) soybean event; A2704-12. During the plant transformation, DNA fragments derived from pUC19 plasmid were integrated in A2704-12, and the region was found to be A2704-12 specific. The pUC19-derived DNA sequences were used as primers for the specific detection of A2704-12. We first tried to construct a standard plasmid for A2704-12 quantification using pUC19. However, non-specific signals appeared with both qualitative and quantitative PCR analyses using the specific primers with pUC19 as a template, and we then constructed a plasmid using pBR322. The conversion factor (C(f)), which is required to calculate the amount of the genetically modified organism (GMO), was experimentally determined with two real-time PCR instruments, the Applied Biosystems 7900HT and the Applied Biosystems 7500. The determined C(f) values were both 0.98. The quantitative method was evaluated by means of blind tests in multi-laboratory trials using the two real-time PCR instruments. The limit of quantitation for the method was estimated to be 0.1%. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSD(R)), and the determined bias and RSD(R) values for the method were each less than 20%. These results suggest that the developed method would be suitable for practical analyses for the detection and quantification of A2704-12.

  14. Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

    PubMed

    Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

    2005-05-18

    To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

  15. Comprehensive GMO detection using real-time PCR array: single-laboratory validation.

    PubMed

    Mano, Junichi; Harada, Mioko; Takabatake, Reona; Furui, Satoshi; Kitta, Kazumi; Nakamura, Kosuke; Akiyama, Hiroshi; Teshima, Reiko; Noritake, Hiromichi; Hatano, Shuko; Futo, Satoshi; Minegishi, Yasutaka; Iizuka, Tayoshi

    2012-01-01

    We have developed a real-time PCR array method to comprehensively detect genetically modified (GM) organisms. In the method, genomic DNA extracted from an agricultural product is analyzed using various qualitative real-time PCR assays on a 96-well PCR plate, targeting for individual GM events, recombinant DNA (r-DNA) segments, taxon-specific DNAs, and donor organisms of the respective r-DNAs. In this article, we report the single-laboratory validation of both DNA extraction methods and component PCR assays constituting the real-time PCR array. We selected some DNA extraction methods for specified plant matrixes, i.e., maize flour, soybean flour, and ground canola seeds, then evaluated the DNA quantity, DNA fragmentation, and PCR inhibition of the resultant DNA extracts. For the component PCR assays, we evaluated the specificity and LOD. All DNA extraction methods and component PCR assays satisfied the criteria set on the basis of previous reports.

  16. Development and validation of an event-specific quantitative PCR method for genetically modified maize MIR162.

    PubMed

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2014-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize event, MIR162. We first prepared a standard plasmid for MIR162 quantification. The conversion factor (Cf) required to calculate the genetically modified organism (GMO) amount was empirically determined for two real-time PCR instruments, the Applied Biosystems 7900HT (ABI7900) and the Applied Biosystems 7500 (ABI7500) for which the determined Cf values were 0.697 and 0.635, respectively. To validate the developed method, a blind test was carried out in an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDr). The determined biases were less than 25% and the RSDr values were less than 20% at all evaluated concentrations. These results suggested that the limit of quantitation of the method was 0.5%, and that the developed method would thus be suitable for practical analyses for the detection and quantification of MIR162.

  17. Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

    PubMed

    Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

    2010-02-01

    To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

  18. Detection and identification of genetically modified EE-1 brinjal (Solanum melongena) by single, multiplex and SYBR® real-time PCR.

    PubMed

    Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R

    2013-01-01

    Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.

  19. Fingerprinting and quantification of GMOs in the agro-food sector.

    PubMed

    Taverniers, I; Van Bockstaele, E; De Loose, M

    2003-01-01

    Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

  20. An event-specific method for the detection and quantification of ML01, a genetically modified Saccharomyces cerevisiae wine strain, using quantitative PCR.

    PubMed

    Vaudano, Enrico; Costantini, Antonella; Garcia-Moruno, Emilia

    2016-10-03

    The availability of genetically modified (GM) yeasts for winemaking and, in particular, transgenic strains based on the integration of genetic constructs deriving from other organisms into the genome of Saccharomyces cerevisiae, has been a reality for several years. Despite this, their use is only authorized in a few countries and limited to two strains: ML01, able to convert malic acid into lactic acid during alcoholic fermentation, and ECMo01 suitable for reducing the risk of carbamate production. In this work we propose a quali-quantitative culture-independent method for the detection of GM yeast ML01 in commercial preparations of ADY (Active Dry Yeast) consisting of efficient extraction of DNA and qPCR (quantitative PCR) analysis based on event-specific assay targeting MLC (malolactic cassette), and a taxon-specific S. cerevisiae assay detecting the MRP2 gene. The ADY DNA extraction methodology has been shown to provide good purity DNA suitable for subsequent qPCR. The MLC and MRP2 qPCR assay showed characteristics of specificity, dynamic range, limit of quantification (LOQ) limit of detection (LOD), precision and trueness, which were fully compliant with international reference guidelines. The method has been shown to reliably detect 0.005% (mass/mass) of GM ML01 S. cerevisiae in commercial preparations of ADY. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-08-15

    Identification of transgenic sequences in an unknown genetically modified (GM) papaya (Carica papaya L.) by whole genome sequence analysis was demonstrated. Whole genome sequence data were generated for a GM-positive fresh papaya fruit commodity detected in monitoring using real-time polymerase chain reaction (PCR). The sequences obtained were mapped against an open database for papaya genome sequence. Transgenic construct- and event-specific sequences were identified as a GM papaya developed to resist infection from a Papaya ringspot virus. Based on the transgenic sequences, a specific real-time PCR detection method for GM papaya applicable to various food commodities was developed. Whole genome sequence analysis enabled identifying unknown transgenic construct- and event-specific sequences in GM papaya and development of a reliable method for detecting them in papaya food commodities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. A new PCR-CGE (size and color) method for simultaneous detection of genetically modified maize events.

    PubMed

    Nadal, Anna; Coll, Anna; La Paz, Jose-Luis; Esteve, Teresa; Pla, Maria

    2006-10-01

    We present a novel multiplex PCR assay for simultaneous detection of multiple transgenic events in maize. Initially, five PCR primers pairs specific to events Bt11, GA21, MON810, and NK603, and Zea mays L. (alcohol dehydrogenase) were included. The event specificity was based on amplification of transgene/plant genome flanking regions, i.e., the same targets as for validated real-time PCR assays. These short and similarly sized amplicons were selected to achieve high and similar amplification efficiency for all targets; however, its unambiguous identification was a technical challenge. We achieved a clear distinction by a novel CGE approach that combined the identification by size and color (CGE-SC). In one single step, all five targets were amplified and specifically labeled with three different fluorescent dyes. The assay was specific and displayed an LOD of 0.1% of each genetically modified organism (GMO). Therefore, it was adequate to fulfill legal thresholds established, e.g., in the European Union. Our CGE-SC based strategy in combination with an adequate labeling design has the potential to simultaneously detect higher numbers of targets. As an example, we present the detection of up to eight targets in a single run. Multiplex PCR-CGE-SC only requires a conventional sequencer device and enables automation and high throughput. In addition, it proved to be transferable to a different laboratory. The number of authorized GMO events is rapidly growing; and the acreage of genetically modified (GM) varieties cultivated and commercialized worldwide is rapidly increasing. In this context, our multiplex PCR-CGE-SC can be suitable for screening GM contents in food.

  3. Evaluation of real-time PCR detection methods for detecting rice products contaminated by rice genetically modified with a CpTI-KDEL-T-nos transgenic construct.

    PubMed

    Nakamura, Kosuke; Akiyama, Hiroshi; Kawano, Noriaki; Kobayashi, Tomoko; Yoshimatsu, Kayo; Mano, Junichi; Kitta, Kazumi; Ohmori, Kiyomi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko

    2013-12-01

    Genetically modified (GM) rice (Oryza sativa) lines, such as insecticidal Kefeng and Kemingdao, have been developed and found unauthorised in processed rice products in many countries. Therefore, qualitative detection methods for the GM rice are required for the GM food regulation. A transgenic construct for expressing cowpea (Vigna unguiculata) trypsin inhibitor (CpTI) was detected in some imported processed rice products contaminated with Kemingdao. The 3' terminal sequence of the identified transgenic construct for expression of CpTI included an endoplasmic reticulum retention signal coding sequence (KDEL) and nopaline synthase terminator (T-nos). The sequence was identical to that in a report on Kefeng. A novel construct-specific real-time polymerase chain reaction (PCR) detection method for detecting the junction region sequence between the CpTI-KDEL and T-nos was developed. The imported processed rice products were evaluated for the contamination of the GM rice using the developed construct-specific real-time PCR methods, and detection frequency was compared with five event-specific detection methods. The construct-specific detection methods detected the GM rice at higher frequency than the event-specific detection methods. Therefore, we propose that the construct-specific detection method is a beneficial tool for screening the contamination of GM rice lines, such as Kefeng, in processed rice products for the GM food regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Event-specific qualitative and quantitative detection of five genetically modified rice events using a single standard reference molecule.

    PubMed

    Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Shin, Min-Ki; Moon, Gui-Im; Hong, Jin-Hwan; Kim, Hae-Yeong

    2017-07-01

    One novel standard reference plasmid, namely pUC-RICE5, was constructed as a positive control and calibrator for event-specific qualitative and quantitative detection of genetically modified (GM) rice (Bt63, Kemingdao1, Kefeng6, Kefeng8, and LLRice62). pUC-RICE5 contained fragments of a rice-specific endogenous reference gene (sucrose phosphate synthase) as well as the five GM rice events. An existing qualitative PCR assay approach was modified using pUC-RICE5 to create a quantitative method with limits of detection correlating to approximately 1-10 copies of rice haploid genomes. In this quantitative PCR assay, the square regression coefficients ranged from 0.993 to 1.000. The standard deviation and relative standard deviation values for repeatability ranged from 0.02 to 0.22 and 0.10% to 0.67%, respectively. The Ministry of Food and Drug Safety (Korea) validated the method and the results suggest it could be used routinely to identify five GM rice events. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment

    PubMed Central

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-01-01

    Digital PCR has developed rapidly since it was first reported in the 1990s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products. PMID:26239916

  6. A highly sensitive and specific method for the screening detection of genetically modified organisms based on digital PCR without pretreatment.

    PubMed

    Fu, Wei; Zhu, Pengyu; Wang, Chenguang; Huang, Kunlun; Du, Zhixin; Tian, Wenying; Wang, Qin; Wang, Huiyu; Xu, Wentao; Zhu, Shuifang

    2015-08-04

    Digital PCR has developed rapidly since it was first reported in the 1990 s. It was recently reported that an improved method facilitated the detection of genetically modified organisms (GMOs). However, to use this improved method, the samples must be pretreated, which could introduce inaccuracy into the results. In our study, we explored a pretreatment-free digital PCR detection method for the screening for GMOs. We chose the CaMV35s promoter and the NOS terminator as the templates in our assay. To determine the specificity of our method, 9 events of GMOs were collected, including MON810, MON863, TC1507, MIR604, MIR162, GA21, T25, NK603 and Bt176. Moreover, the sensitivity, intra-laboratory and inter-laboratory reproducibility of our detection method were assessed. The results showed that the limit of detection of our method was 0.1%, which was lower than the labeling threshold level of the EU. The specificity and stability among the 9 events were consistent, respectively. The intra-laboratory and inter-laboratory reproducibility were both good. Finally, the perfect fitness for the detection of eight double-blind samples indicated the good practicability of our method. In conclusion, the method in our study would allow more sensitive, specific and stable screening detection of the GMO content of international trading products.

  7. Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

    PubMed

    Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2013-05-01

    In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

  8. Optimization and Verification of Droplet Digital PCR Even-Specific Methods for the Quantification of GM Maize DAS1507 and NK603.

    PubMed

    Grelewska-Nowotko, Katarzyna; Żurawska-Zajfert, Magdalena; Żmijewska, Ewelina; Sowa, Sławomir

    2018-05-01

    In recent years, digital polymerase chain reaction (dPCR), a new molecular biology technique, has been gaining in popularity. Among many other applications, this technique can also be used for the detection and quantification of genetically modified organisms (GMOs) in food and feed. It might replace the currently widely used real-time PCR method (qPCR), by overcoming problems related to the PCR inhibition and the requirement of certified reference materials to be used as a calibrant. In theory, validated qPCR methods can be easily transferred to the dPCR platform. However, optimization of the PCR conditions might be necessary. In this study, we report the transfer of two validated qPCR methods for quantification of maize DAS1507 and NK603 events to the droplet dPCR (ddPCR) platform. After some optimization, both methods have been verified according to the guidance of the European Network of GMO Laboratories (ENGL) on analytical method verification (ENGL working group on "Method Verification." (2011) Verification of Analytical Methods for GMO Testing When Implementing Interlaboratory Validated Methods). Digital PCR methods performed equally or better than the qPCR methods. Optimized ddPCR methods confirm their suitability for GMO determination in food and feed.

  9. Detection and quantification of genetically modified organisms using very short, locked nucleic acid TaqMan probes.

    PubMed

    Salvi, Sergio; D'Orso, Fabio; Morelli, Giorgio

    2008-06-25

    Many countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms (GMOs). Real-time quantitative polymerase chain reaction (PCR) based upon the TaqMan probe chemistry has become the method mostly used to support these regulations; moreover, event-specific PCR is the preferred method in GMO detection because of its high specificity based on the flanking sequence of the exogenous integrant. The aim of this study was to evaluate the use of very short (eight-nucleotide long), locked nucleic acid (LNA) TaqMan probes in 5'-nuclease PCR assays for the detection and quantification of GMOs. Classic TaqMan and LNA TaqMan probes were compared for the analysis of the maize MON810 transgene. The performance of the two types of probes was tested on the maize endogenous reference gene hmga, the CaMV 35S promoter, and the hsp70/cryIA(b) construct as well as for the event-specific 5'-integration junction of MON810, using plasmids as standard reference molecules. The results of our study demonstrate that the LNA 5'-nuclease PCR assays represent a valid and reliable analytical system for the detection and quantification of transgenes. Application of very short LNA TaqMan probes to GMO quantification can simplify the design of 5'-nuclease assays.

  10. Highly specific detection of genetic modification events using an enzyme-linked probe hybridization chip.

    PubMed

    Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L

    2015-08-10

    The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.

  11. Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

    PubMed

    Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

    2017-06-01

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  12. Next-generation sequencing is a robust strategy for the high-throughput detection of zygosity in transgenic maize.

    PubMed

    Fritsch, Leonie; Fischer, Rainer; Wambach, Christoph; Dudek, Max; Schillberg, Stefan; Schröper, Florian

    2015-08-01

    Simple and reliable, high-throughput techniques to detect the zygosity of transgenic events in plants are valuable for biotechnology and plant breeding companies seeking robust genotyping data for the assessment of new lines and the monitoring of breeding programs. We show that next-generation sequencing (NGS) applied to short PCR products spanning the transgene integration site provides accurate zygosity data that are more robust and reliable than those generated by PCR-based methods. The NGS reads covered the 5' border of the transgenic events (incorporating part of the transgene and the flanking genomic DNA), or the genomic sequences flanking the unfilled transgene integration site at the wild-type locus. We compared the NGS method to competitive real-time PCR with transgene-specific and wild-type-specific primer/probe pairs, one pair matching the 5' genomic flanking sequence and 5' part of the transgene and the other matching the unfilled transgene integration site. Although both NGS and real-time PCR provided useful zygosity data, the NGS technique was favorable because it needed fewer optimization steps. It also provided statistically more-reliable evidence for the presence of each allele because each product was often covered by more than 100 reads. The NGS method is also more suitable for the genotyping of large panels of plants because up to 80 million reads can be produced in one sequencing run. Our novel method is therefore ideal for the rapid and accurate genotyping of large numbers of samples.

  13. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  14. Molecular toolbox for the identification of unknown genetically modified organisms.

    PubMed

    Ruttink, Tom; Demeyer, Rolinde; Van Gulck, Elke; Van Droogenbroeck, Bart; Querci, Maddalena; Taverniers, Isabel; De Loose, Marc

    2010-03-01

    Competent laboratories monitor genetically modified organisms (GMOs) and products derived thereof in the food and feed chain in the framework of labeling and traceability legislation. In addition, screening is performed to detect the unauthorized presence of GMOs including asynchronously authorized GMOs or GMOs that are not officially registered for commercialization (unknown GMOs). Currently, unauthorized or unknown events are detected by screening blind samples for commonly used transgenic elements, such as p35S or t-nos. If (1) positive detection of such screening elements shows the presence of transgenic material and (2) all known GMOs are tested by event-specific methods but are not detected, then the presence of an unknown GMO is inferred. However, such evidence is indirect because it is based on negative observations and inconclusive because the procedure does not identify the causative event per se. In addition, detection of unknown events is hampered in products that also contain known authorized events. Here, we outline alternative approaches for analytical detection and GMO identification and develop new methods to complement the existing routine screening procedure. We developed a fluorescent anchor-polymerase chain reaction (PCR) method for the identification of the sequences flanking the p35S and t-nos screening elements. Thus, anchor-PCR fingerprinting allows the detection of unique discriminative signals per event. In addition, we established a collection of in silico calculated fingerprints of known events to support interpretation of experimentally generated anchor-PCR GM fingerprints of blind samples. Here, we first describe the molecular characterization of a novel GMO, which expresses recombinant human intrinsic factor in Arabidopsis thaliana. Next, we purposefully treated the novel GMO as a blind sample to simulate how the new methods lead to the molecular identification of a novel unknown event without prior knowledge of its transgene sequence. The results demonstrate that the new methods complement routine screening procedures by providing direct conclusive evidence and may also be useful to resolve masking of unknown events by known events.

  15. Development and validation of duplex, triplex, and pentaplex real-time PCR screening assays for the detection of genetically modified organisms in food and feed.

    PubMed

    Huber, Ingrid; Block, Annette; Sebah, Daniela; Debode, Frédéric; Morisset, Dany; Grohmann, Lutz; Berben, Gilbert; Stebih, Dejan; Milavec, Mojca; Zel, Jana; Busch, Ulrich

    2013-10-30

    Worldwide, qualitative methods based on PCR are most commonly used as screening tools for genetically modified material in food and feed. However, the increasing number and diversity of genetically modified organisms (GMO) require effective methods for simultaneously detecting several genetic elements marking the presence of transgenic events. Herein we describe the development and validation of a pentaplex, as well as complementary triplex and duplex real-time PCR assays, for the detection of the most common screening elements found in commercialized GMOs: P-35S, T-nos, ctp2-cp4-epsps, bar, and pat. The use of these screening assays allows the coverage of many GMO events globally approved for commercialization. Each multiplex real-time PCR assay shows high specificity and sensitivity with an absolute limit of detection below 20 copies for the targeted sequences. We demonstrate by intra- and interlaboratory tests that the assays are robust as well as cost- and time-effective for GMO screening if applied in routine GMO analysis.

  16. Interlaboratory transfer of a PCR multiplex method for simultaneous detection of four genetically modified maize lines: Bt11, MON810, T25, and GA21.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Zhang, David; Esteve, Teresa; Pla, Maria; Prat, Salomé

    2005-05-04

    The number of cultured hectares and commercialized genetically modified organisms (GMOs) has increased exponentially in the past 9 years. Governments in many countries have established a policy of labeling all food and feed containing or produced by GMOs. Consequently, versatile, laboratory-transferable GMO detection methods are in increasing demand. Here, we describe a qualitative PCR-based multiplex method for simultaneous detection and identification of four genetically modified maize lines: Bt11, MON810, T25, and GA21. The described system is based on the use of five primers directed to specific sequences in these insertion events. Primers were used in a single optimized multiplex PCR reaction, and sequences of the amplified fragments are reported. The assay allows amplification of the MON810 event from the 35S promoter to the hsp intron yielding a 468 bp amplicon. Amplification of the Bt11 and T25 events from the 35S promoter to the PAT gene yielded two different amplicons of 280 and 177 bp, respectively, whereas amplification of the 5' flanking region of the GA21 gave rise to an amplicon of 72 bp. These fragments are clearly distinguishable in agarose gels and have been reproduced successfully in a different laboratory. Hence, the proposed method comprises a rapid, simple, reliable, and sensitive (down to 0.05%) PCR-based assay, suitable for detection of these four GM maize lines in a single reaction.

  17. Single-Step qPCR and dPCR Detection of Diverse CRISPR-Cas9 Gene Editing Events In Vivo.

    PubMed

    Falabella, Micol; Sun, Linqing; Barr, Justin; Pena, Andressa Z; Kershaw, Erin E; Gingras, Sebastien; Goncharova, Elena A; Kaufman, Brett A

    2017-10-05

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR-associated protein 9 (Cas9)-based technology is currently the most flexible means to create targeted mutations by recombination or indel mutations by nonhomologous end joining. During mouse transgenesis, recombinant and indel alleles are often pursued simultaneously. Multiple alleles can be formed in each animal to create significant genetic complexity that complicates the CRISPR-Cas9 approach and analysis. Currently, there are no rapid methods to measure the extent of on-site editing with broad mutation sensitivity. In this study, we demonstrate the allelic diversity arising from targeted CRISPR editing in founder mice. Using this DNA sample collection, we validated specific quantitative and digital PCR methods (qPCR and dPCR, respectively) for measuring the frequency of on-target editing in founder mice. We found that locked nucleic acid (LNA) probes combined with an internal reference probe (Drop-Off Assay) provide accurate measurements of editing rates. The Drop-Off LNA Assay also detected on-target CRISPR-Cas9 gene editing in blastocysts with a sensitivity comparable to PCR-clone sequencing. Lastly, we demonstrate that the allele-specific LNA probes used in qPCR competitor assays can accurately detect recombinant mutations in founder mice. In summary, we show that LNA-based qPCR and dPCR assays provide a rapid method for quantifying the extent of on-target genome editing in vivo , testing RNA guides, and detecting recombinant mutations. Copyright © 2017 Falabella et al.

  18. PCR technology for screening and quantification of genetically modified organisms (GMOs).

    PubMed

    Holst-Jensen, Arne; Rønning, Sissel B; Løvseth, Astrid; Berdal, Knut G

    2003-04-01

    Although PCR technology has obvious limitations, the potentially high degree of sensitivity and specificity explains why it has been the first choice of most analytical laboratories interested in detection of genetically modified (GM) organisms (GMOs) and derived materials. Because the products that laboratories receive for analysis are often processed and refined, the quality and quantity of target analyte (e.g. protein or DNA) frequently challenges the sensitivity of any detection method. Among the currently available methods, PCR methods are generally accepted as the most sensitive and reliable methods for detection of GM-derived material in routine applications. The choice of target sequence motif is the single most important factor controlling the specificity of the PCR method. The target sequence is normally a part of the modified gene construct, for example a promoter, a terminator, a gene, or a junction between two of these elements. However, the elements may originate from wildtype organisms, they may be present in more than one GMO, and their copy number may also vary from one GMO to another. They may even be combined in a similar way in more than one GMO. Thus, the choice of method should fit the purpose. Recent developments include event-specific methods, particularly useful for identification and quantification of GM content. Thresholds for labelling are now in place in many countries including those in the European Union. The success of the labelling schemes is dependent upon the efficiency with which GM-derived material can be detected. We will present an overview of currently available PCR methods for screening and quantification of GM-derived DNA, and discuss their applicability and limitations. In addition, we will discuss some of the major challenges related to determination of the limits of detection (LOD) and quantification (LOQ), and to validation of methods.

  19. A case study to determine the geographical origin of unknown GM papaya in routine food sample analysis, followed by identification of papaya events 16-0-1 and 18-2-4.

    PubMed

    Prins, Theo W; Scholtens, Ingrid M J; Bak, Arno W; van Dijk, Jeroen P; Voorhuijzen, Marleen M; Laurensse, Emile J; Kok, Esther J

    2016-12-15

    During routine monitoring for GMOs in food in the Netherlands, papaya-containing food supplements were found positive for the genetically modified (GM) elements P-35S and T-nos. The goal of this study was to identify the unknown and EU unauthorised GM papaya event(s). A screening strategy was applied using additional GM screening elements including a newly developed PRSV coat protein PCR. The detected PRSV coat protein PCR product was sequenced and the nucleotide sequence showed identity to PRSV YK strains indigenous to China and Taiwan. The GM events 16-0-1 and 18-2-4 could be identified by amplifying and sequencing events-specific sequences. Further analyses showed that both papaya event 16-0-1 and event 18-2-4 were transformed with the same construct. For use in routine analysis, derived TaqMan qPCR methods for events 16-0-1 and 18-2-4 were developed. Event 16-0-1 was detected in all samples tested whereas event 18-2-4 was detected in one sample. This study presents a strategy for combining information from different sources (literature, patent databases) and novel sequence data to identify unknown GM papaya events. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    PubMed

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  1. Performance of Traditional and Molecular Methods for Detecting Biological Agents in Drinking Water

    USGS Publications Warehouse

    Francy, Donna S.; Bushon, Rebecca N.; Brady, Amie M.G.; Bertke, Erin E.; Kephart, Christopher M.; Likirdopulos, Christina A.; Mailot, Brian E.; Schaefer, Frank W.; Lindquist, H.D. Alan

    2009-01-01

    To reduce the impact from a possible bioterrorist attack on drinking-water supplies, analytical methods are needed to rapidly detect the presence of biological agents in water. To this end, 13 drinking-water samples were collected at 9 water-treatment plants in Ohio to assess the performance of a molecular method in comparison to traditional analytical methods that take longer to perform. Two 100-liter samples were collected at each site during each sampling event; one was seeded in the laboratory with six biological agents - Bacillus anthracis (B. anthracis), Burkholderia cepacia (as a surrogate for Bu. pseudomallei), Francisella tularensis (F. tularensis), Salmonella Typhi (S. Typhi), Vibrio cholerae (V. cholerae), and Cryptospordium parvum (C. parvum). The seeded and unseeded samples were processed by ultrafiltration and analyzed by use of quantiative polymerase chain reaction (qPCR), a molecular method, and culture methods for bacterial agents or the immunomagnetic separation/fluorescent antibody (IMS/FA) method for C. parvum as traditional methods. Six replicate seeded samples were also processed and analyzed. For traditional methods, recoveries were highly variable between samples and even between some replicate samples, ranging from below detection to greater than 100 percent. Recoveries were significantly related to water pH, specific conductance, and dissolved organic carbon (DOC) for all bacteria combined by culture methods, but none of the water-quality characteristics tested were related to recoveries of C. parvum by IMS/FA. Recoveries were not determined by qPCR because of problems in quantifying organisms by qPCR in the composite seed. Instead, qPCR results were reported as detected, not detected (no qPCR signal), or +/- detected (Cycle Threshold or 'Ct' values were greater than 40). Several sample results by qPCR were omitted from the dataset because of possible problems with qPCR reagents, primers, and probes. For the remaining 14 qPCR results (including some replicate samples), F. tularensis and V. cholerae were detected in all samples after ultrafiltration, B. anthracis was detected in 13 and +/- detected in 1 sample, and C. parvum was detected in 9 and +/- detected in 4 samples. Bu. cepacia was detected in nine samples, +/- detected in two samples, and not detected in three samples (for two out of three samples not detected, a different strain was used). The qPCR assay for V. cholerae provided two false positive - but late - signals in one unseeded sample. Numbers found by qPCR after ultrafiltration were significantly or nearly significantly related to those found by traditional methods for B. anthracis, F. tularensis, and V. cholerae but not for Bu. cepacia and C. parvum. A qPCR assay for S. Typhi was not available. The qPCR method can be used to rapidly detect B. anthracis, F. tularensis, and V. cholerae with some certainty in drinking-water samples, but additional work would be needed to optimize and test qPCR for Bu. cepacia and C. parvum and establish relations to traditional methods. The specificity for the V. cholerae assay needs to be further investigated. Evidence is provided that ultrafiltration and qPCR are promising methods to rapidly detect biological agents in the Nation's drinking-water supplies and thus reduce the impact and consequences from intentional bioterrorist events. To our knowledge, this is the first study to compare the use of traditional and qPCR methods to detect biological agents in large-volume drinking-water samples.

  2. Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

    PubMed

    Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

    2009-08-26

    Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

  3. Selection of Suitable DNA Extraction Methods for Genetically Modified Maize 3272, and Development and Evaluation of an Event-Specific Quantitative PCR Method for 3272.

    PubMed

    Takabatake, Reona; Masubuchi, Tomoko; Futo, Satoshi; Minegishi, Yasutaka; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Kitta, Kazumi

    2016-01-01

    A novel real-time PCR-based analytical method was developed for the event-specific quantification of a genetically modified (GM) maize, 3272. We first attempted to obtain genome DNA from this maize using a DNeasy Plant Maxi kit and a DNeasy Plant Mini kit, which have been widely utilized in our previous studies, but DNA extraction yields from 3272 were markedly lower than those from non-GM maize seeds. However, lowering of DNA extraction yields was not observed with GM quicker or Genomic-tip 20/G. We chose GM quicker for evaluation of the quantitative method. We prepared a standard plasmid for 3272 quantification. The conversion factor (Cf), which is required to calculate the amount of a genetically modified organism (GMO), was experimentally determined for two real-time PCR instruments, the Applied Biosystems 7900HT (the ABI 7900) and the Applied Biosystems 7500 (the ABI7500). The determined Cf values were 0.60 and 0.59 for the ABI 7900 and the ABI 7500, respectively. To evaluate the developed method, a blind test was conducted as part of an interlaboratory study. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSDr). The determined values were similar to those in our previous validation studies. The limit of quantitation for the method was estimated to be 0.5% or less, and we concluded that the developed method would be suitable and practical for detection and quantification of 3272.

  4. Endpoint visual detection of three genetically modified rice events by loop-mediated isothermal amplification.

    PubMed

    Chen, Xiaoyun; Wang, Xiaofu; Jin, Nuo; Zhou, Yu; Huang, Sainan; Miao, Qingmei; Zhu, Qing; Xu, Junfeng

    2012-11-07

    Genetically modified (GM) rice KMD1, TT51-1, and KF6 are three of the most well known transgenic Bt rice lines in China. A rapid and sensitive molecular assay for risk assessment of GM rice is needed. Polymerase chain reaction (PCR), currently the most common method for detecting genetically modified organisms, requires temperature cycling and relatively complex procedures. Here we developed a visual and rapid loop-mediated isothermal amplification (LAMP) method to amplify three GM rice event-specific junction sequences. Target DNA was amplified and visualized by two indicators (SYBR green or hydroxy naphthol blue [HNB]) within 60 min at an isothermal temperature of 63 °C. Different kinds of plants were selected to ensure the specificity of detection and the results of the non-target samples were negative, indicating that the primer sets for the three GM rice varieties had good levels of specificity. The sensitivity of LAMP, with detection limits at low concentration levels (0.01%−0.005% GM), was 10- to 100-fold greater than that of conventional PCR. Additionally, the LAMP assay coupled with an indicator (SYBR green or HNB) facilitated analysis. These findings revealed that the rapid detection method was suitable as a simple field-based test to determine the status of GM crops.

  5. Finding the joker among the maize endogenous reference genes for genetically modified organism (GMO) detection.

    PubMed

    Paternò, Annalisa; Marchesi, Ugo; Gatto, Francesco; Verginelli, Daniela; Quarchioni, Cinzia; Fusco, Cristiana; Zepparoni, Alessia; Amaddeo, Demetrio; Ciabatti, Ilaria

    2009-12-09

    The comparison of five real-time polymerase chain reaction (PCR) methods targeted at maize ( Zea mays ) endogenous sequences is reported. PCR targets were the alcohol dehydrogenase (adh) gene for three methods and high-mobility group (hmg) gene for the other two. The five real-time PCR methods have been checked under repeatability conditions at several dilution levels on both pooled DNA template from several genetically modified (GM) maize certified reference materials (CRMs) and single CRM DNA extracts. Slopes and R(2) coefficients of all of the curves obtained from the adopted regression model were compared within the same method and among all of the five methods, and the limit of detection and limit of quantitation were analyzed for each PCR system. Furthermore, method equivalency was evaluated on the basis of the ability to estimate the target haploid genome copy number at each concentration level. Results indicated that, among the five methods tested, one of the hmg-targeted PCR systems can be considered equivalent to the others but shows the best regression parameters and a higher repeteability along the dilution range. Thereby, it is proposed as a valid module to be coupled to different event-specific real-time PCR for maize genetically modified organism (GMO) quantitation. The resulting practicability improvement on the analytical control of GMOs is discussed.

  6. Development of a Real-Time Reverse Transcription-PCR Assay for Global Differentiation of Yellow Fever Virus Vaccine-Related Adverse Events from Natural Infections.

    PubMed

    Hughes, Holly R; Russell, Brandy J; Mossel, Eric C; Kayiwa, John; Lutwama, Julius; Lambert, Amy J

    2018-06-01

    Yellow fever (YF) is a reemerging public health threat, with frequent outbreaks prompting large vaccination campaigns in regions of endemicity in Africa and South America. Specific detection of vaccine-related adverse events is resource-intensive, time-consuming, and difficult to achieve during an outbreak. To address this, we have developed a highly transferable rapid yellow fever virus (YFV) vaccine-specific real-time reverse transcription-PCR (RT-PCR) assay that distinguishes vaccine from wild-type lineages. The assay utilizes a specific hydrolysis probe that includes locked nucleic acids to enhance specific discrimination of the YFV17D vaccine strain genome. Promisingly, sensitivity and specificity analyses reveal this assay to be highly specific to vaccine strain(s) when tested on clinical samples and YFV cell culture isolates of global origin. Taken together, our data suggest the utility of this assay for use in laboratories of varied capacity for the identification and differentiation of vaccine-related adverse events from wild-type infections of both African and South American origin. Copyright © 2018 American Society for Microbiology.

  7. Molecular Approaches for High Throughput Detection and Quantification of Genetically Modified Crops: A Review

    PubMed Central

    Salisu, Ibrahim B.; Shahid, Ahmad A.; Yaqoob, Amina; Ali, Qurban; Bajwa, Kamran S.; Rao, Abdul Q.; Husnain, Tayyab

    2017-01-01

    As long as the genetically modified crops are gaining attention globally, their proper approval and commercialization need accurate and reliable diagnostic methods for the transgenic content. These diagnostic techniques are mainly divided into two major groups, i.e., identification of transgenic (1) DNA and (2) proteins from GMOs and their products. Conventional methods such as PCR (polymerase chain reaction) and enzyme-linked immunosorbent assay (ELISA) were routinely employed for DNA and protein based quantification respectively. Although, these Techniques (PCR and ELISA) are considered as significantly convenient and productive, but there is need for more advance technologies that allow for high throughput detection and the quantification of GM event as the production of more complex GMO is increasing day by day. Therefore, recent approaches like microarray, capillary gel electrophoresis, digital PCR and next generation sequencing are more promising due to their accuracy and precise detection of transgenic contents. The present article is a brief comparative study of all such detection techniques on the basis of their advent, feasibility, accuracy, and cost effectiveness. However, these emerging technologies have a lot to do with detection of a specific event, contamination of different events and determination of fusion as well as stacked gene protein are the critical issues to be addressed in future. PMID:29085378

  8. A high-throughput multiplex method adapted for GMO detection.

    PubMed

    Chaouachi, Maher; Chupeau, Gaëlle; Berard, Aurélie; McKhann, Heather; Romaniuk, Marcel; Giancola, Sandra; Laval, Valérie; Bertheau, Yves; Brunel, Dominique

    2008-12-24

    A high-throughput multiplex assay for the detection of genetically modified organisms (GMO) was developed on the basis of the existing SNPlex method designed for SNP genotyping. This SNPlex assay allows the simultaneous detection of up to 48 short DNA sequences (approximately 70 bp; "signature sequences") from taxa endogenous reference genes, from GMO constructions, screening targets, construct-specific, and event-specific targets, and finally from donor organisms. This assay avoids certain shortcomings of multiplex PCR-based methods already in widespread use for GMO detection. The assay demonstrated high specificity and sensitivity. The results suggest that this assay is reliable, flexible, and cost- and time-effective for high-throughput GMO detection.

  9. Operational Evaluation of the Rapid Viability PCR Method for ...

    EPA Pesticide Factsheets

    Journal Article This research work has a significant impact on the use of the RV-PCR method to analyze post-decontamination environmental samples during an anthrax event. The method has shown 98% agreement with the traditional culture based method. With such a success, this method, upon validation, will significantly increase the laboratory throughput/capacity to analyze a large number of anthrax event samples in a relatively short time.

  10. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    PubMed

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Rapid-viability PCR method for detection of live, virulent Bacillus anthracis in environmental samples.

    PubMed

    Létant, Sonia E; Murphy, Gloria A; Alfaro, Teneile M; Avila, Julie R; Kane, Staci R; Raber, Ellen; Bunt, Thomas M; Shah, Sanjiv R

    2011-09-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples.

  12. Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences.

    PubMed

    Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne

    2009-02-02

    The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

  13. Quantitative detection method for Roundup Ready soybean in food using duplex real-time PCR MGB chemistry.

    PubMed

    Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson

    2010-07-01

    Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.

  14. Detection by real-time PCR and pyrosequencing of the cry1Ab and cry1Ac genes introduced in genetically modified (GM) constructs.

    PubMed

    Debode, Frederic; Janssen, Eric; Bragard, Claude; Berben, Gilbert

    2017-08-01

    The presence of genetically modified organisms (GMOs) in food and feed is mainly detected by the use of targets focusing on promoters and terminators. As some genes are frequently used in genetically modified (GM) construction, they also constitute excellent screening elements and their use is increasing. In this paper we propose a new target for the detection of cry1Ab and cry1Ac genes by real-time polymerase chain reaction (PCR) and pyrosequencing. The specificity, sensitivity and robustness of the real-time PCR method were tested following the recommendations of international guidelines and the method met the expected performance criteria. This paper also shows how the robustness testing was assessed. This new cry1Ab/Ac method can provide a positive signal with a larger number of GM events than do the other existing methods using double dye-probes. The method permits the analysis of results with less ambiguity than the SYBRGreen method recommended by the European Reference Laboratory (EURL) GM Food and Feed (GMFF). A pyrosequencing method was also developed to gain additional information thanks to the sequence of the amplicon. This method of sequencing-by-synthesis can determine the sequence between the primers used for PCR. Pyrosequencing showed that the sequences internal to the primers present differences following the GM events considered and three different sequences were observed. The sensitivity of the pyrosequencing was tested on reference flours with a low percentage GM content and different copy numbers. Improvements in the pyrosequencing protocol provided correct sequences with 50 copies of the target. Below this copy number, the quality of the sequence was more random.

  15. Development and application of a multi-targeting reference plasmid as calibrator for analysis of five genetically modified soybean events.

    PubMed

    Pi, Liqun; Li, Xiang; Cao, Yiwei; Wang, Canhua; Pan, Liangwen; Yang, Litao

    2015-04-01

    Reference materials are important in accurate analysis of genetically modified organism (GMO) contents in food/feeds, and development of novel reference plasmid is a new trend in the research of GMO reference materials. Herein, we constructed a novel multi-targeting plasmid, pSOY, which contained seven event-specific sequences of five GM soybeans (MON89788-5', A2704-12-3', A5547-127-3', DP356043-5', DP305423-3', A2704-12-5', and A5547-127-5') and sequence of soybean endogenous reference gene Lectin. We evaluated the specificity, limit of detection and quantification, and applicability of pSOY in both qualitative and quantitative PCR analyses. The limit of detection (LOD) was as low as 20 copies in qualitative PCR, and the limit of quantification (LOQ) in quantitative PCR was 10 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and Lectin assays were higher than 90%, and the squared regression coefficients (R(2)) were more than 0.999. The quantification bias varied from 0.21% to 19.29%, and the relative standard deviations were from 1.08% to 9.84% in simulated samples analysis. All the results demonstrated that the developed multi-targeting plasmid, pSOY, was a credible substitute of matrix reference materials, and could be used as a reliable reference calibrator in the identification and quantification of multiple GM soybean events.

  16. Effect of endogenous reference genes on digital PCR assessment of genetically engineered canola events.

    PubMed

    Demeke, Tigst; Eng, Monika

    2018-05-01

    Droplet digital PCR (ddPCR) has been used for absolute quantification of genetically engineered (GE) events. Absolute quantification of GE events by duplex ddPCR requires the use of appropriate primers and probes for target and reference gene sequences in order to accurately determine the amount of GE materials. Single copy reference genes are generally preferred for absolute quantification of GE events by ddPCR. Study has not been conducted on a comparison of reference genes for absolute quantification of GE canola events by ddPCR. The suitability of four endogenous reference sequences ( HMG-I/Y , FatA(A), CruA and Ccf) for absolute quantification of GE canola events by ddPCR was investigated. The effect of DNA extraction methods and DNA quality on the assessment of reference gene copy numbers was also investigated. ddPCR results were affected by the use of single vs. two copy reference genes. The single copy, FatA(A), reference gene was found to be stable and suitable for absolute quantification of GE canola events by ddPCR. For the copy numbers measured, the HMG-I/Y reference gene was less consistent than FatA(A) reference gene. The expected ddPCR values were underestimated when CruA and Ccf (two copy endogenous Cruciferin sequences) were used because of high number of copies. It is important to make an adjustment if two copy reference genes are used for ddPCR in order to obtain accurate results. On the other hand, real-time quantitative PCR results were not affected by the use of single vs. two copy reference genes.

  17. JRC GMO-Matrix: a web application to support Genetically Modified Organisms detection strategies.

    PubMed

    Angers-Loustau, Alexandre; Petrillo, Mauro; Bonfini, Laura; Gatto, Francesco; Rosa, Sabrina; Patak, Alexandre; Kreysa, Joachim

    2014-12-30

    The polymerase chain reaction (PCR) is the current state of the art technique for DNA-based detection of Genetically Modified Organisms (GMOs). A typical control strategy starts by analyzing a sample for the presence of target sequences (GM-elements) known to be present in many GMOs. Positive findings from this "screening" are then confirmed with GM (event) specific test methods. A reliable knowledge of which GMOs are detected by combinations of GM-detection methods is thus crucial to minimize the verification efforts. In this article, we describe a novel platform that links the information of two unique databases built and maintained by the European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) at the Joint Research Centre (JRC) of the European Commission, one containing the sequence information of known GM-events and the other validated PCR-based detection and identification methods. The new platform compiles in silico determinations of the detection of a wide range of GMOs by the available detection methods using existing scripts that simulate PCR amplification and, when present, probe binding. The correctness of the information has been verified by comparing the in silico conclusions to experimental results for a subset of forty-nine GM events and six methods. The JRC GMO-Matrix is unique for its reliance on DNA sequence data and its flexibility in integrating novel GMOs and new detection methods. Users can mine the database using a set of web interfaces that thus provide a valuable support to GMO control laboratories in planning and evaluating their GMO screening strategies. The platform is accessible at http://gmo-crl.jrc.ec.europa.eu/jrcgmomatrix/ .

  18. [Optimized application of nested PCR method for detection of malaria].

    PubMed

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  19. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    PubMed

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for the final evaluation. After the second evaluation, the final amplification curves and melting curves have been achieved.

  20. Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.

    PubMed

    Winn-Deen

    1998-12-01

    Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.

  1. Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

    PubMed Central

    Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

    2011-01-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples. PMID:21764960

  2. Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

    PubMed

    Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

    2013-08-01

    Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

  3. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    PubMed

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  4. High-throughput microfluidic single-cell digital polymerase chain reaction.

    PubMed

    White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

    2013-08-06

    Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

  5. One Novel Multiple-Target Plasmid Reference Molecule Targeting Eight Genetically Modified Canola Events for Genetically Modified Canola Detection.

    PubMed

    Li, Zhuqing; Li, Xiang; Wang, Canhua; Song, Guiwen; Pi, Liqun; Zheng, Lan; Zhang, Dabing; Yang, Litao

    2017-09-27

    Multiple-target plasmid DNA reference materials have been generated and utilized as good substitutes of matrix-based reference materials in the analysis of genetically modified organisms (GMOs). Herein, we report the construction of one multiple-target plasmid reference molecule, pCAN, which harbors eight GM canola event-specific sequences (RF1, RF2, MS1, MS8, Topas 19/2, Oxy235, RT73, and T45) and a partial sequence of the canola endogenous reference gene PEP. The applicability of this plasmid reference material in qualitative and quantitative PCR assays of the eight GM canola events was evaluated, including the analysis of specificity, limit of detection (LOD), limit of quantification (LOQ), and performance of pCAN in the analysis of various canola samples, etc. The LODs are 15 copies for RF2, MS1, and RT73 assays using pCAN as the calibrator and 10 genome copies for the other events. The LOQ in each event-specific real-time PCR assay is 20 copies. In quantitative real-time PCR analysis, the PCR efficiencies of all event-specific and PEP assays are between 91% and 97%, and the squared regression coefficients (R 2 ) are all higher than 0.99. The quantification bias values varied from 0.47% to 20.68% with relative standard deviation (RSD) from 1.06% to 24.61% in the quantification of simulated samples. Furthermore, 10 practical canola samples sampled from imported shipments in the port of Shanghai, China, were analyzed employing pCAN as the calibrator, and the results were comparable with those assays using commercial certified materials as the calibrator. Concluding from these results, we believe that this newly developed pCAN plasmid is one good candidate for being a plasmid DNA reference material in the detection and quantification of the eight GM canola events in routine analysis.

  6. Quantitative microbial faecal source tracking with sampling guided by hydrological catchment dynamics.

    PubMed

    Reischer, G H; Haider, J M; Sommer, R; Stadler, H; Keiblinger, K M; Hornek, R; Zerobin, W; Mach, R L; Farnleitner, A H

    2008-10-01

    The impairment of water quality by faecal pollution is a global public health concern. Microbial source tracking methods help to identify faecal sources but the few recent quantitative microbial source tracking applications disregarded catchment hydrology and pollution dynamics. This quantitative microbial source tracking study, conducted in a large karstic spring catchment potentially influenced by humans and ruminant animals, was based on a tiered sampling approach: a 31-month water quality monitoring (Monitoring) covering seasonal hydrological dynamics and an investigation of flood events (Events) as periods of the strongest pollution. The detection of a ruminant-specific and a human-specific faecal Bacteroidetes marker by quantitative real-time PCR was complemented by standard microbiological and on-line hydrological parameters. Both quantitative microbial source tracking markers were detected in spring water during Monitoring and Events, with preponderance of the ruminant-specific marker. Applying multiparametric analysis of all data allowed linking the ruminant-specific marker to general faecal pollution indicators, especially during Events. Up to 80% of the variation of faecal indicator levels during Events could be explained by ruminant-specific marker levels proving the dominance of ruminant faecal sources in the catchment. Furthermore, soil was ruled out as a source of quantitative microbial source tracking markers. This study demonstrates the applicability of quantitative microbial source tracking methods and highlights the prerequisite of considering hydrological catchment dynamics in source tracking study design.

  7. Applicability of the quantification of genetically modified organisms to foods processed from maize and soy.

    PubMed

    Yoshimura, Tomoaki; Kuribara, Hideo; Matsuoka, Takeshi; Kodama, Takashi; Iida, Mayu; Watanabe, Takahiro; Akiyama, Hiroshi; Maitani, Tamio; Furui, Satoshi; Hino, Akihiro

    2005-03-23

    The applicability of quantifying genetically modified (GM) maize and soy to processed foods was investigated using heat treatment processing models. The detection methods were based on real-time quantitative polymerase chain reaction (PCR) analysis. Ground seeds of insect resistant GM maize (MON810) and glyphosate tolerant Roundup Ready (RR) soy were dissolved in water and were heat treated by autoclaving for various time intervals. The calculated copy numbers of the recombinant and taxon specific deoxyribonucleic acid (DNA) sequences in the extracted DNA solution were found to decrease with time. This decrease was influenced by the PCR-amplified size. The conversion factor (Cf), which is the ratio of the recombinant DNA sequence to the taxon specific DNA sequence and is used as a constant number for calculating GM% at each event, tended to be stable when the sizes of PCR products of two DNA sequences were nearly equal. The results suggested that the size of the PCR product plays a key role in the quantification of GM organisms in processed foods. It is believed that the Cf of the endosperm (3n) is influenced by whether the GM originated from a paternal or maternal source. The embryos and endosperms were separated from the F1 generation seeds of five GM maize events, and their Cf values were measured. Both paternal and maternal GM events were identified. In these, the endosperm Cf was lower than that of the embryo, and the embryo Cf was lower than that of the endosperm. These results demonstrate the difficulties encountered in the determination of GM% in maize grains (F2 generation) and in processed foods from maize and soy.

  8. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    PubMed

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  9. Single molecule quantitation and sequencing of rare translocations using microfluidic nested digital PCR.

    PubMed

    Shuga, Joe; Zeng, Yong; Novak, Richard; Lan, Qing; Tang, Xiaojiang; Rothman, Nathaniel; Vermeulen, Roel; Li, Laiyu; Hubbard, Alan; Zhang, Luoping; Mathies, Richard A; Smith, Martyn T

    2013-09-01

    Cancers are heterogeneous and genetically unstable. New methods are needed that provide the sensitivity and specificity to query single cells at the genetic loci that drive cancer progression, thereby enabling researchers to study the progression of individual tumors. Here, we report the development and application of a bead-based hemi-nested microfluidic droplet digital PCR (dPCR) technology to achieve 'quantitative' measurement and single-molecule sequencing of somatically acquired carcinogenic translocations at extremely low levels (<10(-6)) in healthy subjects. We use this technique in our healthy study population to determine the overall concentration of the t(14;18) translocation, which is strongly associated with follicular lymphoma. The nested dPCR approach improves the detection limit to 1×10(-7) or lower while maintaining the analysis efficiency and specificity. Further, the bead-based dPCR enabled us to isolate and quantify the relative amounts of the various clonal forms of t(14;18) translocation in these subjects, and the single-molecule sensitivity and resolution of dPCR led to the discovery of new clonal forms of t(14;18) that were otherwise masked by the conventional quantitative PCR measurements. In this manner, we created a quantitative map for this carcinogenic mutation in this healthy population and identified the positions on chromosomes 14 and 18 where the vast majority of these t(14;18) events occur.

  10. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  11. Interlaboratory validation of quantitative duplex real-time PCR method for screening analysis of genetically modified maize.

    PubMed

    Takabatake, Reona; Koiwa, Tomohiro; Kasahara, Masaki; Takashima, Kaori; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Oguchi, Taichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2011-01-01

    To reduce the cost and time required to routinely perform the genetically modified organism (GMO) test, we developed a duplex quantitative real-time PCR method for a screening analysis simultaneously targeting an event-specific segment for GA21 and Cauliflower Mosaic Virus 35S promoter (P35S) segment [Oguchi et al., J. Food Hyg. Soc. Japan, 50, 117-125 (2009)]. To confirm the validity of the method, an interlaboratory collaborative study was conducted. In the collaborative study, conversion factors (Cfs), which are required to calculate the GMO amount (%), were first determined for two real-time PCR instruments, the ABI PRISM 7900HT and the ABI PRISM 7500. A blind test was then conducted. The limit of quantitation for both GA21 and P35S was estimated to be 0.5% or less. The trueness and precision were evaluated as the bias and reproducibility of the relative standard deviation (RSD(R)). The determined bias and RSD(R) were each less than 25%. We believe the developed method would be useful for the practical screening analysis of GM maize.

  12. Semiautomated TaqMan PCR screening of GMO labelled samples for (unauthorised) GMOs.

    PubMed

    Scholtens, Ingrid M J; Molenaar, Bonnie; van Hoof, Richard A; Zaaijer, Stephanie; Prins, Theo W; Kok, Esther J

    2017-06-01

    In most countries, systems are in place to analyse food products for the potential presence of genetically modified organisms (GMOs), to enforce labelling requirements and to screen for the potential presence of unauthorised GMOs. With the growing number of GMOs on the world market, a larger diversity of methods is required for informative analyses. In this paper, the specificity of an extended screening set consisting of 32 screening methods to identify different crop species (endogenous genes) and GMO elements was verified against 59 different GMO reference materials. In addition, a cost- and time-efficient strategy for DNA isolation, screening and identification is presented. A module for semiautomated analysis of the screening results and planning of subsequent event-specific tests for identification has been developed. The Excel-based module contains information on the experimentally verified specificity of the element methods and of the EU authorisation status of the GMO events. If a detected GMO element cannot be explained by any of the events as identified in the same sample, this may indicate the presence of an unknown unauthorised GMO that may not yet have been assessed for its safety for humans, animals or the environment.

  13. Droplet Digital PCR-Based Chimerism Analysis for Primary Immunodeficiency Diseases.

    PubMed

    Okano, Tsubasa; Tsujita, Yuki; Kanegane, Hirokazu; Mitsui-Sekinaka, Kanako; Tanita, Kay; Miyamoto, Satoshi; Yeh, Tzu-Wen; Yamashita, Motoi; Terada, Naomi; Ogura, Yumi; Takagi, Masatoshi; Imai, Kohsuke; Nonoyama, Shigeaki; Morio, Tomohiro

    2018-04-01

    In the current study, we aimed to accurately evaluate donor/recipient or male/female chimerism in samples from patients who underwent hematopoietic stem cell transplantation (HSCT). We designed the droplet digital polymerase chain reaction (ddPCR) for SRY and RPP30 to detect the male/female chimerism. We also developed mutation-specific ddPCR for four primary immunodeficiency diseases. The accuracy of the male/female chimerism analysis using ddPCR was confirmed by comparing the results with those of conventional methods (fluorescence in situ hybridization and short tandem repeat-PCR) and evaluating dilution assays. In particular, we found that this method was useful for analyzing small samples. Thus, this method could be used with patient samples, especially to sorted leukocyte subpopulations, during the early post-transplant period. Four mutation-specific ddPCR accurately detected post-transplant chimerism. ddPCR-based male/female chimerism analysis and mutation-specific ddPCR were useful for all HSCT, and these simple methods contribute to following the post-transplant chimerism, especially in disease-specific small leukocyte fractions.

  14. Evaluation of a combined triple method to detect causative HPV in oral and oropharyngeal squamous cell carcinomas: p16 Immunohistochemistry, Consensus PCR HPV-DNA, and In Situ Hybridization

    PubMed Central

    2012-01-01

    Background Recent emerging evidences identify Human Papillomavirus (HPV) related Head and Neck squamous cell carcinomas (HN-SCCs) as a separate subgroup among Head and Neck Cancers with different epidemiology, histopathological characteristics, therapeutic response to chemo-radiation treatment and clinical outcome. However, there is not a worldwide consensus on the methods to be used in clinical practice. The endpoint of this study was to demonstrate the reliability of a triple method which combines evaluation of: 1. p16 protein expression by immunohistochemistry (p16-IHC); 2. HPV-DNA genotyping by consensus HPV-DNA PCR methods (Consensus PCR); and 3 viral integration into the host by in situ hybridization method (ISH). This triple method has been applied to HN-SCC originated from oral cavity (OSCC) and oropharynx (OPSCC), the two anatomical sites in which high risk (HR) HPVs have been clearly implicated as etiologic factors. Methylation-Specific PCR (MSP) was performed to study inactivation of p16-CDKN2a locus by epigenetic events. Reliability of multiple methods was measured by Kappa statistics. Results All the HN-SCCs confirmed HPV positive by PCR and/or ISH were also p16 positive by IHC, with the latter showing a very high level of sensitivity as single test (100% in both OSCC and OPSCC) but lower specificity level (74% in OSCC and 93% in OPSCC). Concordance analysis between ISH and Consensus PCR showed a faint agreement in OPSCC (κ = 0.38) and a moderate agreement in OSCC (κ = 0.44). Furthermore, the addition of double positive score (ISHpositive and Consensus PCR positive) increased significantly the specificity of HR-HPV detection on formalin-fixed paraffin embedded (FFPE) samples (100% in OSCC and 78.5% in OPSCC), but reduced the sensitivity (33% in OSCC and 60% in OPSCC). The significant reduction of sensitivity by the double method was compensated by a very high sensitivity of p16-IHC detection in the triple approach. Conclusions Although HR-HPVs detection is of utmost importance in clinical settings for the Head and Neck Cancer patients, there is no consensus on which to consider the 'golden standard' among the numerous detection methods available either as single test or combinations. Until recently, quantitative E6 RNA PCR has been considered the 'golden standard' since it was demonstrated to have very high accuracy level and very high statistical significance associated with prognostic parameters. In contrast, quantitative E6 DNA PCR has proven to have very high level of accuracy but lesser prognostic association with clinical outcome than the HPV E6 oncoprotein RNA PCR. However, although it is theoretically possible to perform quantitative PCR detection methods also on FFPE samples, they reach the maximum of accuracy on fresh frozen tissue. Furthermore, worldwide diagnostic laboratories have not all the same ability to analyze simultaneously both FFPE and fresh tissues with these quantitative molecular detection methods. Therefore, in the current clinical practice a p16-IHC test is considered as sufficient for HPV diagnostic in accordance with the recently published Head and Neck Cancer international guidelines. Although p16-IHC may serve as a good prognostic indicator, our study clearly demonstrated that it is not satisfactory when used exclusively as the only HPV detecting method. Adding ISH, although known as less sensitive than PCR-based detection methods, has the advantage to preserve the morphological context of HPV-DNA signals in FFPE samples and, thus increase the overall specificity of p16/Consensus PCR combination tests. PMID:22376902

  15. Molecular cloning of IGλ rearrangements using long-distance inverse PCR (LDI-PCR).

    PubMed

    Shimanuki, Masaya; Sonoki, Takashi; Hosoi, Hiroki; Watanuki, Jyuri; Murata, Shogo; Kawakami, Keiki; Matsuoka, Hiroshi; Hanaoka, Nobuyoshi; Nakakuma, Hideki

    2013-01-01

    Malignant cells of mature B-cell origin show tumor-specific clonal immunoglobulin gene (IG) rearrangements, including V(D)J recombinations, nucleotide mutations, or translocations. Rapid molecular cloning of the breakpoint sequence by long-distance inverse PCR (LDI-PCR) has so far been applied to rearrangements targeted to IGH joining, IGH switch, and IGκ regions. We tended to apply LDI-PCR method for cloning of IGλ rearrangements. To identify which IGλ isotype segment was rearranged, we performed Southern blot analysis using isotype-specific probes. We set inverse primers on the telomeric side of each joining region and amplified rearranged bands detected by Southern blot analysis as corresponding PCR products. All germline IGλ segments were successfully amplified as expected PCR products. We determined breakpoint sequences of five chromosome translocations involving IGλ locus: three novel t(8;22)(q24;q11), one known t(3;22)(q27;q11), and one partially known t(11;22)(q13;q11). Two of the three t(8;22)(q24;q11) were involved in Jλ with a recombination signal sequence and one of three in the first exon of IGLL5, which lies upstream of Jλ1. Three 8q24 breakpoints were widespread at 132, 260 and 366 kb downstream of MYC locus. The t(3;22)(q27;q11) showed a juxtaposition of Jλ2 and the first intron of BCL6, as previously reported. In t(11;22)(q13;q11), 3'UTR of cyclin D1 fused to the constant region of λ7 with nucleotide mutations. We also amplified four Vλ/Jλ recombination sequences. Our method is a useful tool for molecular analysis of genetic events in IGλ. © 2012 John Wiley & Sons A/S.

  16. Sourcing faecal pollution: a combination of library-dependent and library-independent methods to identify human faecal pollution in non-sewered catchments.

    PubMed

    Ahmed, W; Stewart, J; Gardner, T; Powell, D; Brooks, P; Sullivan, D; Tindale, N

    2007-08-01

    Library-dependent (LD) (biochemical fingerprinting of Escherichia coli and enterococci) and library-independent (LI) (PCR detection of human-specific biomarkers) methods were used to detect human faecal pollution in three non-sewered catchments. In all, 550 E. coli isolates and 700 enterococci isolates were biochemically fingerprinted from 18 water samples and compared with metabolic fingerprint libraries of 4508 E. coli and 4833 enterococci isolates. E. coli fingerprints identified human unique biochemical phenotypes (BPTs) in nine out of 18 water samples; similarly, enterococci fingerprints identified human faecal pollution in 10 water samples. Seven samples were tested by PCR for the detection of biomarkers. Human-specific HF134 Bacteroides and enterococci surface protein (esp) biomarkers were detected in five samples. Four samples were also positive for HF183 Bacteroides biomarker. The combination of biomarkers detected human faecal pollution in six out of seven water samples. Of the seven samples analysed for both the indicators/markers, at least one indicator/marker was detected in every sample. Four of the seven PCR-positive samples were also positive for one of the human-specific E. coli or enterococci BPTs. The results indicated human faecal pollution in the studied sub-catchments after storm events. LD and LI methods used in this study complimented each other and provided additional information regarding the polluting sources when one method failed to detect human faecal pollution. Therefore, it is recommended that a combination of methods should be used to identify the source(s) of faecal pollution where possible.

  17. Comparison of allele-specific PCR, created restriction-site PCR, and PCR with primer-introduced restriction analysis methods used for screening complex vertebral malformation carriers in Holstein cattle

    PubMed Central

    Altınel, Ahmet

    2017-01-01

    Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256

  18. NAIMA as a solution for future GMO diagnostics challenges.

    PubMed

    Dobnik, David; Morisset, Dany; Gruden, Kristina

    2010-03-01

    In the field of genetically modified organism (GMO) diagnostics, real-time PCR has been the method of choice for target detection and quantification in most laboratories. Despite its numerous advantages, however, the lack of a true multiplexing option may render real-time PCR less practical in the face of future GMO detection challenges such as the multiplicity and increasing complexity of new transgenic events, as well as the repeated occurrence of unauthorized GMOs on the market. In this context, we recently reported the development of a novel multiplex quantitative DNA-based target amplification method, named NASBA implemented microarray analysis (NAIMA), which is suitable for sensitive, specific and quantitative detection of GMOs on a microarray. In this article, the performance of NAIMA is compared with that of real-time PCR, the focus being their performances in view of the upcoming challenge to detect/quantify an increasing number of possible GMOs at a sustainable cost and affordable staff effort. Finally, we present our conclusions concerning the applicability of NAIMA for future use in GMO diagnostics.

  19. Use of species-specific PCR for the identification of 10 sea cucumber species

    NASA Astrophysics Data System (ADS)

    Wen, Jing; Zeng, Ling

    2014-11-01

    We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.

  20. Molecular Quantification of Zooplankton Gut Content: The Case For qPCR

    NASA Astrophysics Data System (ADS)

    Frischer, M. E.; Walters, T. L.; Gibson, D. M.; Nejstgaard, J. C.; Troedsson, C.

    2016-02-01

    The ability to obtain information about feeding selectivity and rates in situ for zooplankton is vital for understanding the mechanisms structuring marine ecosystems. However, directly estimating feeding selection and rates of zooplankton, without bias, associated with culturing conditions has been notoriously difficult. A potential approach for addressing this problem is to target prey-specific DNA as a marker for prey ingestion and selection. In this study we report the development of a differential length amplification quantitative PCR (dla-qPCR) assay targeting the 18S rRNA gene to validate the use of a DNA-based approach to quantify consumption of specific plankton prey by the pelagic tunicate (doliolid) Dolioletta gegenbauri. Compared to copepods and other marine animals, the digestion of prey genomic DNA inside the gut of doliolids is low. This method minimizes potential underestimations, and therefore allows prey DNA to be used as an effective indicator of prey consumption. We also present an initial application of a qPCR-assay to estimate consumption of specific prey species on the southeastern continental shelf of the U.S., where doliolids stochastically bloom in response to upwelling events. Estimated feeding rates, based on qPCR, were in the same range as those estimated from clearance rates in laboratory feeding studies. In the field, consumption of specific prey, including the centric diatom Thalassiosira spp. was detected in the gut of wild caught D. gegenbauri at the levels consistent with their abundance in the water column at the time of collection. Thus, both experimental and field investigations support the hypothesis that a qPCR approach will be useful for the quantitative investigation of the in situ diet of D. gegenbauri without introduced bias' associated with cultivation.

  1. Event-specific plasmid standards and real-time PCR methods for transgenic Bt11, Bt176, and GA21 maize and transgenic GT73 canola.

    PubMed

    Taverniers, Isabel; Windels, Pieter; Vaïtilingom, Marc; Milcamps, Anne; Van Bockstaele, Erik; Van den Eede, Guy; De Loose, Marc

    2005-04-20

    Since the 18th of April 2004, two new regulations, EC/1829/2003 on genetically modified food and feed products and EC/1830/2003 on traceability and labeling of GMOs, are in force in the EU. This new, comprehensive regulatory framework emphasizes the need of an adequate tracing system. Unique identifiers, such as the transgene genome junction region or a specific rearrangement within the transgene DNA, should form the basis of such a tracing system. In this study, we describe the development of event-specific tracing systems for transgenic maize lines Bt11, Bt176, and GA21 and for canola event GT73. Molecular characterization of the transgene loci enabled us to clone an event-specific sequence into a plasmid vector, to be used as a marker, and to develop line-specific primers. Primer specificity was tested through qualitative PCRs and dissociation curve analysis in SYBR Green I real-time PCRs. The primers were then combined with event-specific TaqMan probes in quantitative real-time PCRs. Calibration curves were set up both with genomic DNA samples and the newly synthesized plasmid DNA markers. It is shown that cloned plasmid GMO target sequences are perfectly suitable as unique identifiers and quantitative calibrators. Together with an event-specific primer pair and a highly specific TaqMan probe, the plasmid markers form crucial components of a unique and straighforward tracing system for Bt11, Bt176, and GA21 maize and GT73 canola events.

  2. Development of strain-specific PCR primers for quantitative detection of Bacillus mesentericus strain TO-A in human feces.

    PubMed

    Sato, Naoki; Seo, Genichiro; Benno, Yoshimi

    2014-01-01

    Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.

  3. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    PubMed

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  4. Rapid ABO genotyping by high-speed droplet allele-specific PCR using crude samples.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Takeichi, Naoya; Furukawa, Satomi; Sugano, Mitsutoshi; Uehara, Takeshi; Okumura, Nobuo; Honda, Takayuki

    2018-01-01

    ABO genotyping has common tools for personal identification of forensic and transplantation field. We developed a new method based on a droplet allele-specific PCR (droplet-AS-PCR) that enabled rapid PCR amplification. We attempted rapid ABO genotyping using crude DNA isolated from dried blood and buccal cells. We designed allele-specific primers for three SNPs (at nucleotides 261, 526, and 803) in exons 6 and 7 of the ABO gene. We pretreated dried blood and buccal cells with proteinase K, and obtained crude DNAs without DNA purification. Droplet-AS-PCR allowed specific amplification of the SNPs at the three loci using crude DNA, with results similar to those for DNA extracted from fresh peripheral blood. The sensitivity of the methods was 5%-10%. The genotyping of extracted DNA and crude DNA were completed within 8 and 9 minutes, respectively. The genotypes determined by the droplet-AS-PCR method were always consistent with those obtained by direct sequencing. The droplet-AS-PCR method enabled rapid and specific amplification of three SNPs of the ABO gene from crude DNA treated with proteinase K. ABO genotyping by the droplet-AS-PCR has the potential to be applied to various fields including a forensic medicine and transplantation medical care. © 2017 Wiley Periodicals, Inc.

  5. Real-time PCR assay is superior to other methods for the detection of mycoplasma contamination in the cell lines of the National Cell Bank of Iran.

    PubMed

    Molla Kazemiha, Vahid; Bonakdar, Shahin; Amanzadeh, Amir; Azari, Shahram; Memarnejadian, Arash; Shahbazi, Shirin; Shokrgozar, Mohammad Ali; Mahdian, Reza

    2016-08-01

    Mycoplasmas are the most important contaminants of cell cultures throughout the world. They are considered as a major problem in biological studies and biopharmaceutical economic issues. In this study, our aim was to find the best standard technique as a rapid method with high sensitivity, specificity and accuracy for the detection of mycoplasma contamination in the cell lines of the National Cell Bank of Iran. Thirty cell lines suspected to mycoplasma contamination were evaluated by five different techniques including microbial culture, indirect DNA DAPI staining, enzymatic mycoalert(®) assay, conventional PCR and real-time PCR. Five mycoplasma-contaminated cell lines were assigned as positive controls and five mycoplasma-free cell lines as negative controls. The enzymatic method was performed using the mycoalert(®) mycoplasma detection kit. Real-time PCR technique was conducted by PromoKine diagnostic kits. In the conventional PCR method, mycoplasma genus-specific primers were designed to analyze the sequences based on a fixed and common region on 16S ribosomal RNA with PCR product size of 425 bp. Mycoplasma contamination was observed in 60, 56.66, 53.33, 46.66 and 33.33 % of 30 different cell cultures by real-time PCR, PCR, enzymatic mycoalert(®), indirect DNA DAPI staining and microbial culture methods, respectively. The analysis of the results of the different methods showed that the real-time PCR assay was superior the other methods with the sensitivity, specificity, accuracy, predictive value of positive and negative results of 100 %. These values were 94.44, 100, 96.77, 100 and 92.85 % for the conventional PCR method, respectively. Therefore, this study showed that real-time PCR and PCR assays based on the common sequences in the 16S ribosomal RNA are reliable methods with high sensitivity, specificity and accuracy for detection of mycoplasma contamination in cell cultures and other biological products.

  6. Evaluation of serological and molecular tests used to identify Toxoplasma gondii infection in pregnant women attended in a public health service in São Paulo state, Brazil.

    PubMed

    Murata, Fernando Henrique Antunes; Ferreira, Marina Neves; Pereira-Chioccola, Vera Lucia; Spegiorin, Lígia Cosentino Junqueira Franco; Meira-Strejevitch, Cristina da Silva; Gava, Ricardo; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos; Brandão de Mattos, Cinara Cássia

    2017-09-01

    Toxoplasmosis during pregnancy can have severe consequences. The use of sensitive and specific serological and molecular methods is extremely important for the correct diagnosis of the disease. We compared the ELISA and ELFA serological methods, conventional PCR (cPCR), Nested PCR and quantitative PCR (qPCR) in the diagnosis of Toxoplasma gondii infection in pregnant women without clinical suspicion of toxoplasmosis (G1=94) and with clinical suspicion of toxoplasmosis (G2=53). The results were compared using the Kappa index, and the sensitivity, specificity, positive predictive value and negative predictive value were calculated. The results of the serological methods showed concordance between the ELISA and ELFA methods even though ELFA identified more positive cases than ELISA. Molecular methods were discrepant with cPCR using B22/23 primers having greater sensitivity and lower specificity compared to the other molecular methods. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Application of immuno-PCR assay for the detection of serum IgE specific to Bermuda allergen.

    PubMed

    Rahmatpour, Samine; Khan, Amjad Hayat; Nasiri Kalmarzi, Rasoul; Rajabibazl, Masoumeh; Tavoosidana, Gholamreza; Motevaseli, Elahe; Zarghami, Nosratollah; Sadroddiny, Esmaeil

    2017-04-01

    In vivo and in vitro tests are the two major ways of identifying the triggering allergens in sensitized individuals with allergic symptoms. Both methods are equally significant in terms of sensitivity and specificity. However, in certain circumstances, in vitro methods are highly preferred because they circumvent the use of sensitizing drugs in patients. In current study, we described a highly sensitive immuno-PCR (iPCR) assay for serum IgE specific to Bermuda allergens. Using oligonucleotide-labelled antibody, we used iPCR for the sensitive detection of serum IgE. The nucleotide sequence was amplified using conventional PCR and the bands were visualized on 2.5% agarose gel. Results demonstrated a 100-fold enhancement in sensitivity of iPCR over commercially available enzyme-linked immunosorbent assay (ELISA) kit. Our iPCR method was highly sensitive for Bermuda-specific serum IgE and could be beneficial in allergy clinics. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. [The establishment of a novel method of nano-immunomagnetic separation and Real-time PCR for detecting Vibrio cholerae from seafood].

    PubMed

    Cheng, Jinxia; Zeng, Jing; Liu, Li; Wei, Haiyan; Zhao, Xiaojuan; Zhang, Ximeng; Zhang, Lei; Zhang, Haiyu

    2014-02-01

    A novel method of Nano-Immunomagnetic Separation (Nano-IMS) plus Real-time PCR was established for detecting Vibrio cholerae. The Nano-Immunomagnetic Beads were created by using the monoclonal antibody of Vibrio cholerae, which was named Nano-IMB-Vc. Nano-IMB-Vc has specific adsorption of Vibrio cholerae, combined with Real-time PCR technology, a method for rapid detection of Vibrio cholerae was established. The capture specificity of Nano-IMB-Vc was tested by using 15 bacteria strains. The specificity of Real-time PCR method was tested by using 102 targets and 101 non-targets bacteria strains. The sensitivity of Nano-IMS plus Real-time PCR were tested in pure culture and in artificial samples and compared with NMKL No.156. The capture ratio of Nano-IMB-Vc was reached 70.2% at the level of 10(3) CFU/ml. In pure culture, the sensitivity of Nano-IMS plus Real-time PCR was reached at 5.4×10(2) CFU/ml. The specific of Real-time PCR method was tested by using 102 targets and 101 non-targets bacteria. The results showed that 102 strains of Vibrio cholerae test results were all positive, and the rest of the 101 strains of non-target bacteria test results were negative. No cross-reaction was founded. Add 1 CFU vibrio cholerae per 25 g sample, it could be detect with Nano-IMS plus Real-time PCR method after 8 hours enrichment. The Nano-IMS plus Real-time PCR method of Vibrio cholerae established in this study has good specificity and sensitivity, which could be applied to the rapid detection of Vibrio cholerae.

  9. Identification of Erwinia species isolated from apples and pears by differential PCR.

    PubMed

    Gehring, I; Geider, K

    2012-04-01

    Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Detection of clinically relevant copy number alterations in oral cancer progression using multiplexed droplet digital PCR.

    PubMed

    Hughesman, Curtis B; Lu, X J David; Liu, Kelly Y P; Zhu, Yuqi; Towle, Rebecca M; Haynes, Charles; Poh, Catherine F

    2017-09-19

    Copy number alterations (CNAs), a common genomic event during carcinogenesis, are known to affect a large fraction of the genome. Common recurrent gains or losses of specific chromosomal regions occur at frequencies that they may be considered distinctive features of tumoral cells. Here we introduce a novel multiplexed droplet digital PCR (ddPCR) assay capable of detecting recurrent CNAs that drive tumorigenesis of oral squamous cell carcinoma. Applied to DNA extracted from oral cell lines and clinical samples of various disease stages, we found good agreement between CNAs detected by our ddPCR assay with those previously reported using comparative genomic hybridization or single nucleotide polymorphism arrays. Furthermore, we demonstrate that the ability to target specific locations of the genome permits detection of clinically relevant oncogenic events such as small, submicroscopic homozygous deletions. Additional capabilities of the multiplexed ddPCR assay include the ability to infer ploidy level, quantify the change in copy number of target loci with high-level gains, and simultaneously assess the status and viral load for high-risk human papillomavirus types 16 and 18. This novel multiplexed ddPCR assay therefore may have clinical value in differentiating between benign oral lesions from those that are at risk of progressing to oral cancer.

  11. Formal Specification and Validation of a Hybrid Connectivity Restoration Algorithm for Wireless Sensor and Actor Networks †

    PubMed Central

    Imran, Muhammad; Zafar, Nazir Ahmad

    2012-01-01

    Maintaining inter-actor connectivity is extremely crucial in mission-critical applications of Wireless Sensor and Actor Networks (WSANs), as actors have to quickly plan optimal coordinated responses to detected events. Failure of a critical actor partitions the inter-actor network into disjoint segments besides leaving a coverage hole, and thus hinders the network operation. This paper presents a Partitioning detection and Connectivity Restoration (PCR) algorithm to tolerate critical actor failure. As part of pre-failure planning, PCR determines critical/non-critical actors based on localized information and designates each critical node with an appropriate backup (preferably non-critical). The pre-designated backup detects the failure of its primary actor and initiates a post-failure recovery process that may involve coordinated multi-actor relocation. To prove the correctness, we construct a formal specification of PCR using Z notation. We model WSAN topology as a dynamic graph and transform PCR to corresponding formal specification using Z notation. Formal specification is analyzed and validated using the Z Eves tool. Moreover, we simulate the specification to quantitatively analyze the efficiency of PCR. Simulation results confirm the effectiveness of PCR and the results shown that it outperforms contemporary schemes found in the literature.

  12. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  13. A multiplex PCR method for detection of Aspergillus spp. and Mycobacterium tuberculosis in BAL specimens.

    PubMed

    Amini, F; Kachuei, R; Noorbakhsh, F; Imani Fooladi, A A

    2015-06-01

    The aim of this study was the detection of Aspergillus species and Mycobacterium tuberculosis together in bronchoalveolar lavage (BAL) using of multiplex PCR. In this study, from September 2012 until June 2013, 100 bronchoalveolar lavage (BAL) specimens were collected from patients suspected of tuberculosis (TB). After the direct and culture test, multiplex PCR were utilized in order to diagnose Aspergillus species and M. tuberculosis. Phenol-chloroform manual method was used in order to extract DNA from these microorganisms. Aspergillus specific primers, M. tuberculosis designed primers and beta actin primers were used for multiplex PCR. In this study, by multiplex PCR method, Aspergillus species were identified in 12 samples (12%), positive samples in direct and culture test were respectively 11% and 10%. Sensitivity and specificity of this method in comparison to direct test were respectively 100% and 98.8%, also sensitivity and specificity of this method in comparison to culture test were respectively 100% and 97.7%. In this assay, M. tuberculosis was identified in 8 samples (8%). Mycobacterium-positive samples in molecular method, direct and culture test were respectively 6%, 5% and 7%. Sensitivity and specificity of PCR method in comparison to direct test were 80% and 97.8% also sensitivity and specificity of this method in comparison to culture test was 71.4% and 98.9%. In the present study, multiplex PCR method had higher sensitivity than direct and culture test in order to identify and detect Aspergillus, also this method had lower sensitivity for identification of M. tuberculosis, suggesting that the method of DNA extraction was not suitable. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Quantification of sequence exchange events between PMS2 and PMS2CL provides a basis for improved mutation scanning of Lynch syndrome patients.

    PubMed

    van der Klift, Heleen M; Tops, Carli M J; Bik, Elsa C; Boogaard, Merel W; Borgstein, Anne-Marijke; Hansson, Kerstin B M; Ausems, Margreet G E M; Gomez Garcia, Encarna; Green, Andrew; Hes, Frederik J; Izatt, Louise; van Hest, Liselotte P; Alonso, Angel M; Vriends, Annette H J T; Wagner, Anja; van Zelst-Stams, Wendy A G; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Wijnen, Juul T

    2010-05-01

    Heterozygous mutations in PMS2 are involved in Lynch syndrome, whereas biallelic mutations are found in Constitutional mismatch repair-deficiency syndrome patients. Mutation detection is complicated by the occurrence of sequence exchange events between the duplicated regions of PMS2 and PMS2CL. We investigated the frequency of such events with a nonspecific polymerase chain reaction (PCR) strategy, co-amplifying both PMS2 and PMS2CL sequences. This allowed us to score ratios between gene and pseudogene-specific nucleotides at 29 PSV sites from exon 11 to the end of the gene. We found sequence transfer at all investigated PSVs from intron 12 to the 3' end of the gene in 4 to 52% of DNA samples. Overall, sequence exchange between PMS2 and PMS2CL was observed in 69% (83/120) of individuals. We demonstrate that mutation scanning with PMS2-specific PCR primers and MLPA probes, designed on PSVs, in the 3' duplicated region is unreliable, and present an RNA-based mutation detection strategy to improve reliability. Using this strategy, we found 19 different putative pathogenic PMS2 mutations. Four of these (21%) are lying in the region with frequent sequence transfer and are missed or called incorrectly as homozygous with several PSV-based mutation detection methods. (c) 2010 Wiley-Liss, Inc.

  15. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    PubMed

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an effective alternative to lengthy conventional diagnostic procedures requiring both cytogenetic analysis followed by targeted quantitative reverse transcription (qRT-PCR) methods, thus allowing timely patient management.

  16. Rapid and sensitive detection of Yersinia pestis using amplification of plague diagnostic bacteriophages monitored by real-time PCR.

    PubMed

    Sergueev, Kirill V; He, Yunxiu; Borschel, Richard H; Nikolich, Mikeljon P; Filippov, Andrey A

    2010-06-28

    Yersinia pestis, the agent of plague, has caused many millions of human deaths and still poses a serious threat to global public health. Timely and reliable detection of such a dangerous pathogen is of critical importance. Lysis by specific bacteriophages remains an essential method of Y. pestis detection and plague diagnostics. The objective of this work was to develop an alternative to conventional phage lysis tests--a rapid and highly sensitive method of indirect detection of live Y. pestis cells based on quantitative real-time PCR (qPCR) monitoring of amplification of reporter Y. pestis-specific bacteriophages. Plague diagnostic phages phiA1122 and L-413C were shown to be highly effective diagnostic tools for the detection and identification of Y. pestis by using qPCR with primers specific for phage DNA. The template DNA extraction step that usually precedes qPCR was omitted. phiA1122-specific qPCR enabled the detection of an initial bacterial concentration of 10(3) CFU/ml (equivalent to as few as one Y. pestis cell per 1-microl sample) in four hours. L-413C-mediated detection of Y. pestis was less sensitive (up to 100 bacteria per sample) but more specific, and thus we propose parallel qPCR for the two phages as a rapid and reliable method of Y. pestis identification. Importantly, phiA1122 propagated in simulated clinical blood specimens containing EDTA and its titer rise was detected by both a standard plating test and qPCR. Thus, we developed a novel assay for detection and identification of Y. pestis using amplification of specific phages monitored by qPCR. The method is simple, rapid, highly sensitive, and specific and allows the detection of only live bacteria.

  17. Rapid screening of toxigenic vibrio cholerae O1 strains from south Iran by PCR-ELISA.

    PubMed

    Mousavi, Seyed Latif; Nazarian, Shahram; Amani, Jafar; Rahgerdi, Ahmad Karimi

    2008-01-01

    The ability to sensitively detect Vibrio cholera with PCR-ELISA method represents a considerable advancement over alternative more time-consuming methods for detection of this pathogen. The aim of this research is to evaluate the suitability of a PCR-enzyme-linked immunosorbent assay for sensitive and rapid detection of V. cholera O1. The 398-bp sequence of a gene that codes for the cholera toxin B subunit was amplified by PCR. The digoxigenin-labeled amplified products were coated on microplates and detected by ELISA. The PCR product was also hybridized with biotin labelled probe and detected by ELISA using streptavidin. The specificity of the PCR was determined using 10 bacterial strains and 50 samples from south Iran. The detection limit was 0.5 pg of the genomic DNA and five bacterial cells. Adaptation of PCR into PCR-ELISA assay format facilitates specific and sensitive detection and diagnosis of human cholera disease. We conclude that this PCR-ELISA is a diagnostic method that specifically detects toxin genes in V. cholera O1 strains. It is more rapid and less cumbersome than other diagnostic methods for detection of toxicity in these strains.

  18. Use of PCR-Based Methods for Rapid Differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis

    PubMed Central

    Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco

    1999-01-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059

  19. Use of PCR-based methods for rapid differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis.

    PubMed

    Torriani, S; Zapparoli, G; Dellaglio, F

    1999-10-01

    Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.

  20. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.

  1. A new double digestion ligation mediated suppression PCR method for simultaneous bacteria DNA-typing and confirmation of species: an Acinetobacter sp. model.

    PubMed

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal "band-based" results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3' recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5' rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided.

  2. A New Double Digestion Ligation Mediated Suppression PCR Method for Simultaneous Bacteria DNA-Typing and Confirmation of Species: An Acinetobacter sp. Model

    PubMed Central

    Stojowska, Karolina; Krawczyk, Beata

    2014-01-01

    We have designed a new ddLMS PCR (double digestion Ligation Mediated Suppression PCR) method based on restriction site polymorphism upstream from the specific target sequence for the simultaneous identification and differentiation of bacterial strains. The ddLMS PCR combines a simple PCR used for species or genus identification and the LM PCR strategy for strain differentiation. The bacterial identification is confirmed in the form of the PCR product(s), while the length of the PCR product makes it possible to differentiate between bacterial strains. If there is a single copy of the target sequence within genomic DNA, one specific PCR product is created (simplex ddLMS PCR), whereas for multiple copies of the gene the fingerprinting patterns can be obtained (multiplex ddLMS PCR). The described ddLMS PCR method is designed for rapid and specific strain differentiation in medical and microbiological studies. In comparison to other LM PCR it has substantial advantages: enables specific species' DNA-typing without the need for pure bacterial culture selection, is not sensitive to contamination with other cells or genomic DNA, and gives univocal “band-based” results, which are easy to interpret. The utility of ddLMS PCR was shown for Acinetobacter calcoaceticus-baumannii (Acb) complex, the genetically closely related and phenotypically similar species and also important nosocomial pathogens, for which currently, there are no recommended methods for screening, typing and identification. In this article two models are proposed: 3′ recA-ddLMS PCR-MaeII/RsaI for Acb complex interspecific typing and 5′ rrn-ddLMS PCR-HindIII/ApaI for Acinetobacter baumannii intraspecific typing. ddLMS PCR allows not only for DNA-typing but also for confirmation of species in one reaction. Also, practical guidelines for designing a diagnostic test based on ddLMS PCR for genotyping different species of bacteria are provided. PMID:25522278

  3. Practicable group testing method to evaluate weight/weight GMO content in maize grains.

    PubMed

    Mano, Junichi; Yanaka, Yuka; Ikezu, Yoko; Onishi, Mari; Futo, Satoshi; Minegishi, Yasutaka; Ninomiya, Kenji; Yotsuyanagi, Yuichi; Spiegelhalter, Frank; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Naito, Shigehiro; Koiwa, Tomohiro; Takabatake, Reona; Furui, Satoshi; Kitta, Kazumi

    2011-07-13

    Because of the increasing use of maize hybrids with genetically modified (GM) stacked events, the established and commonly used bulk sample methods for PCR quantification of GM maize in non-GM maize are prone to overestimate the GM organism (GMO) content, compared to the actual weight/weight percentage of GM maize in the grain sample. As an alternative method, we designed and assessed a group testing strategy in which the GMO content is statistically evaluated based on qualitative analyses of multiple small pools, consisting of 20 maize kernels each. This approach enables the GMO content evaluation on a weight/weight basis, irrespective of the presence of stacked-event kernels. To enhance the method's user-friendliness in routine application, we devised an easy-to-use PCR-based qualitative analytical method comprising a sample preparation step in which 20 maize kernels are ground in a lysis buffer and a subsequent PCR assay in which the lysate is directly used as a DNA template. This method was validated in a multilaboratory collaborative trial.

  4. Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

    PubMed

    Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

    1994-02-01

    We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

  5. Development and application of a multiplex PCR assay for detection of the Clostridium perfringens enterotoxin-encoding genes cpe and becAB.

    PubMed

    Yonogi, Shinya; Kanki, Masashi; Ohnishi, Takahiro; Shiono, Masami; Iida, Tetsuya; Kumeda, Yuko

    2016-08-01

    Clostridium perfringens causes food-borne gastroenteritis following the consumption of contaminated food by producing C. perfringens enterotoxin (CPE) in the intestines. Recently, we reported a novel enterotoxin, binary enterotoxin of C. perfringens (BEC) in C. perfringens isolates, which caused two disease outbreaks in Japan. Consequently, in the event of food poisoning outbreaks caused by C. perfringens, it is now necessary to screen for both the cpe and becAB genes by diagnostic PCR. Here, we present a simple multiplex PCR method for simultaneous detection of cpe, becAB and a C. perfringens control locus, phospholipase C (plc). Applying this method, we investigated the prevalence of cpe- or becAB-carrying C. perfringens strains in human stool and bovine rectum swab samples. Using a total of 169 isolates, we found that the percentage of becAB-carrying strains was very small (0.59%), one-tenth that of cpe-carrying strains. The simple method presented in this study with high specificity and sensitivity to C. perfringens will be a useful tool to survey the global prevalence of becAB-carrying C. perfringens strains. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Comparison of methods for in-house screening of HLA-B*57:01 to prevent abacavir hypersensitivity in HIV-1 care.

    PubMed

    De Spiegelaere, Ward; Philippé, Jan; Vervisch, Karen; Verhofstede, Chris; Malatinkova, Eva; Kiselinova, Maja; Trypsteen, Wim; Bonczkowski, Pawel; Vogelaers, Dirk; Callens, Steven; Ruelle, Jean; Kabeya, Kabamba; De Wit, Stephane; Van Acker, Petra; Van Sandt, Vicky; Emonds, Marie-Paule; Coucke, Paul; Sermijn, Erica; Vandekerckhove, Linos

    2015-01-01

    Abacavir is a nucleoside reverse transcriptase inhibitor used as part of combination antiretroviral therapy in HIV-1-infected patients. Because this drug can cause a hypersensitivity reaction that is correlated with the presence of the HLA-B*57:01 allotype, screening for the presence of HLA-B*57:01 is recommended before abacavir initiation. Different genetic assays have been developed for HLA-B*57:01 screening, each with specific sensitivity, turnaround time and assay costs. Here, a new real-time PCR (qPCR) based analysis is described and compared to sequence specific primer PCR with capillary electrophoresis (SSP PCR CE) on 149 patient-derived samples, using sequence specific oligonucleotide hybridization combined with high resolution SSP PCR as gold standard. In addition to these PCR based methods, a complementary approach was developed using flow cytometry with an HLA-B17 specific monoclonal antibody as a pre-screening assay to diminish the number of samples for genetic testing. All three assays had a maximum sensitivity of >99. However, differences in specificity were recorded, i.e. 84.3%, 97.2% and >99% for flow cytometry, qPCR and SSP PCR CE respectively. Our data indicate that the most specific and sensitive of the compared methods is the SSP PCR CE. Flow cytometry pre-screening can substantially decrease the number of genetic tests for HLA-B*57:01 typing in a clinical setting.

  7. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning

    PubMed Central

    Meghdadi, Hossein; Khosravi, Azar D.; Ghadiri, Ata A.; Sina, Amir H.; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39–31.27% for rpoB-PCR, 36.44–60.83% for IS6110- PCR, 75.29–92.93% for nested-rpoB PCR, and 87.98–99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15–100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results. PMID:26191059

  8. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    PubMed

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15-100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results.

  9. A multiplex PCR method for the simultaneous detection of three viruses associated with canine viral enteric infections.

    PubMed

    Deng, Xiaoyu; Zhang, Jiali; Su, Jiazi; Liu, Hao; Cong, Yanlong; Zhang, Lei; Zhang, Kemeng; Shi, Ning; Lu, Rongguang; Yan, Xijun

    2018-04-19

    The aim of this study was to establish a multiplex PCR (mPCR) method that can simultaneously detect canine parvovirus (CPV-2), canine coronavirus (CCoV) and canine adenovirus (CAV), thereby eliminating the need to detect these pathogens individually. Based on conserved regions in the genomes of these three viruses, the VP2 gene of CPV-2, the endoribonuclease nsp15 gene of CCoV, and the 52K gene of CAV were selected for primer design. The specificity of the mPCR results showed no amplification of canine distemper virus (CDV), canine parainfluenza virus (CPIV), or pseudorabies virus (PRV), indicating that the method had good specificity. A sensitivity test showed that the detection limit of the mPCR method was 1 × 10 4 viral copies. A total of 63 rectal swabs from dogs with diarrheal symptoms were evaluated using mPCR and routine PCR. The ratio of positive samples to total samples for CPV-2, CCoV, and CAV was 55.6% (35/63) for mPCR and 55.6% (35/63) for routine PCR. Thirty-five positive samples were detected by both methods, for a coincidence ratio of 100%. This mPCR method can simultaneously detect CCoV (CCoV-II), CAV (CAV-1, CAV-2) and CPV-2 (CPV-2a, CPV-2b, CPV-2c), which are associated with viral enteritis, thereby providing an efficient, inexpensive, specific, and accurate new tool for clinical diagnosis and laboratory epidemiological investigations.

  10. Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing

    PubMed Central

    Espy, M. J.; Uhl, J. R.; Sloan, L. M.; Buckwalter, S. P.; Jones, M. F.; Vetter, E. A.; Yao, J. D. C.; Wengenack, N. L.; Rosenblatt, J. E.; Cockerill, F. R.; Smith, T. F.

    2006-01-01

    Real-time PCR has revolutionized the way clinical microbiology laboratories diagnose many human microbial infections. This testing method combines PCR chemistry with fluorescent probe detection of amplified product in the same reaction vessel. In general, both PCR and amplified product detection are completed in an hour or less, which is considerably faster than conventional PCR detection methods. Real-time PCR assays provide sensitivity and specificity equivalent to that of conventional PCR combined with Southern blot analysis, and since amplification and detection steps are performed in the same closed vessel, the risk of releasing amplified nucleic acids into the environment is negligible. The combination of excellent sensitivity and specificity, low contamination risk, and speed has made real-time PCR technology an appealing alternative to culture- or immunoassay-based testing methods for diagnosing many infectious diseases. This review focuses on the application of real-time PCR in the clinical microbiology laboratory. PMID:16418529

  11. Development of a real-time PCR method for the differential detection and quantification of four solanaceae in GMO analysis: potato (Solanum tuberosum), tomato (Solanum lycopersicum), eggplant (Solanum melongena), and pepper (Capsicum annuum).

    PubMed

    Chaouachi, Maher; El Malki, Redouane; Berard, Aurélie; Romaniuk, Marcel; Laval, Valérie; Brunel, Dominique; Bertheau, Yves

    2008-03-26

    The labeling of products containing genetically modified organisms (GMO) is linked to their quantification since a threshold for the presence of fortuitous GMOs in food has been established. This threshold is calculated from a combination of two absolute quantification values: one for the specific GMO target and the second for an endogenous reference gene specific to the taxon. Thus, the development of reliable methods to quantify GMOs using endogenous reference genes in complex matrixes such as food and feed is needed. Plant identification can be difficult in the case of closely related taxa, which moreover are subject to introgression events. Based on the homology of beta-fructosidase sequences obtained from public databases, two couples of consensus primers were designed for the detection, quantification, and differentiation of four Solanaceae: potato (Solanum tuberosum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), and eggplant (Solanum melongena). Sequence variability was studied first using lines and cultivars (intraspecies sequence variability), then using taxa involved in gene introgressions, and finally, using taxonomically close taxa (interspecies sequence variability). This study allowed us to design four highly specific TaqMan-MGB probes. A duplex real time PCR assay was developed for simultaneous quantification of tomato and potato. For eggplant and pepper, only simplex real time PCR tests were developed. The results demonstrated the high specificity and sensitivity of the assays. We therefore conclude that beta-fructosidase can be used as an endogenous reference gene for GMO analysis.

  12. Epigenetic events underlie the pathogenesis of sinonasal papillomas.

    PubMed

    Stephen, Josena K; Vaught, Lori E; Chen, Kang M; Sethi, Seema; Shah, Veena; Benninger, Michael S; Gardner, Glendon M; Schweitzer, Vanessa G; Khan, Mumtaz; Worsham, Maria J

    2007-10-01

    Benign inverted papillomas have been reported as monoclonal but lacking common genetic alterations identified in squamous cell carcinoma of the head and neck. Epigenetic changes alter the heritable state of gene expression and chromatin organization without change in DNA sequence. We investigated whether epigenetic events of aberrant promoter hypermethylation in genes known to be involved in squamous head and neck cancer underlie the pathogenesis of sinonasal papillomas. Ten formalin-fixed paraffin DNA samples from three inverted papilloma cases, two exophytic (everted) papilloma cases, and two cases with inverted and exophytic components were studied. DNA was obtained from microdissected areas of normal and papilloma areas and examined using a panel of 41 gene probes, designed to interrogate 35 unique genes for aberrant methylation status (22 genes) using the methylation-specific multiplex-ligation-specific polymerase assay. Methylation-specific PCR was employed to confirm aberrant methylation detected by the methylation-specific multiplex-ligation-specific polymerase assay. All seven cases indicated at least one epigenetic event of aberrant promoter hypermethylation. The CDKN2B gene was a consistent target of aberrant methylation in six of seven cases. Methylation-specific PCR confirmed hypermethylation of CDKN2B. Recurrent biopsies from two inverted papilloma cases had common epigenetic events. Promoter hypermethylation of CDKN2B was a consistent epigenetic event. Common epigenetic alterations in recurrent biopsies underscore a monoclonal origin for these lesions. Epigenetic events contribute to the underlying pathogenesis of benign inverted and exophytic papillomas. As a consistent target of aberrant promoter hypermethylation, CDKN2B may serve as an important epigenetic biomarker for gene reactivation studies.

  13. GMDD: a database of GMO detection methods.

    PubMed

    Dong, Wei; Yang, Litao; Shen, Kailin; Kim, Banghyun; Kleter, Gijs A; Marvin, Hans J P; Guo, Rong; Liang, Wanqi; Zhang, Dabing

    2008-06-04

    Since more than one hundred events of genetically modified organisms (GMOs) have been developed and approved for commercialization in global area, the GMO analysis methods are essential for the enforcement of GMO labelling regulations. Protein and nucleic acid-based detection techniques have been developed and utilized for GMOs identification and quantification. However, the information for harmonization and standardization of GMO analysis methods at global level is needed. GMO Detection method Database (GMDD) has collected almost all the previous developed and reported GMOs detection methods, which have been grouped by different strategies (screen-, gene-, construct-, and event-specific), and also provide a user-friendly search service of the detection methods by GMO event name, exogenous gene, or protein information, etc. In this database, users can obtain the sequences of exogenous integration, which will facilitate PCR primers and probes design. Also the information on endogenous genes, certified reference materials, reference molecules, and the validation status of developed methods is included in this database. Furthermore, registered users can also submit new detection methods and sequences to this database, and the newly submitted information will be released soon after being checked. GMDD contains comprehensive information of GMO detection methods. The database will make the GMOs analysis much easier.

  14. Species-specific diagnostic assays for Bonamia ostreae and B. exitiosa in European flat oyster Ostrea edulis: conventional, real-time and multiplex PCR.

    PubMed

    Ramilo, Andrea; Navas, J Ignacio; Villalba, Antonio; Abollo, Elvira

    2013-05-27

    Bonamia ostreae and B. exitiosa have caused mass mortalities of various oyster species around the world and co-occur in some European areas. The World Organisation for Animal Health (OIE) has included infections with both species in the list of notifiable diseases. However, official methods for species-specific diagnosis of either parasite have certain limitations. In this study, new species-specific conventional PCR (cPCR) and real-time PCR techniques were developed to diagnose each parasite species. Moreover, a multiplex PCR method was designed to detect both parasites in a single assay. The analytical sensitivity and specificity of each new method were evaluated. These new procedures were compared with 2 OIE-recommended methods, viz. standard histology and PCR-RFLP. The new procedures showed higher sensitivity than the OIE recommended ones for the diagnosis of both species. The sensitivity of tests with the new primers was higher using oyster gills and gonad tissue, rather than gills alone. The lack of a 'gold standard' prevented accurate estimation of sensitivity and specificity of the new methods. The implementation of statistical tools (maximum likelihood method) for the comparison of the diagnostic tests showed the possibility of false positives with the new procedures, although the absence of a gold standard precluded certainty. Nevertheless, all procedures showed negative results when used for the analysis of oysters from a Bonamia-free area.

  15. Evaluation of the reliability of maize reference assays for GMO quantification.

    PubMed

    Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

    2010-03-01

    A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

  16. Overcoming the errors of in-house PCR used in the clinical laboratory for the diagnosis of extrapulmonary tuberculosis.

    PubMed

    Kunakorn, M; Raksakai, K; Pracharktam, R; Sattaudom, C

    1999-03-01

    Our experiences from 1993 to 1997 in the development and use of IS6110 base PCR for the diagnosis of extrapulmonary tuberculosis in a routine clinical setting revealed that error-correcting processes can improve existing diagnostic methodology. The reamplification method initially used had a sensitivity of 90.91% and a specificity of 93.75%. The concern was focused on the false positive results of this method caused by product-carryover contamination. This method was changed to single round PCR with carryover prevention by uracil DNA glycosylase (UDG), resulting in a 100% specificity but only 63% sensitivity. Dot blot hybridization was added after the single round PCR, increasing the sensitivity to 87.50%. However, false positivity resulted from the nonspecific dot blot hybridization signal, reducing the specificity to 89.47%. The hybridization of PCR was changed to a Southern blot with a new oligonucleotide probe giving the sensitivity of 85.71% and raising the specificity to 99.52%. We conclude that the PCR protocol for routine clinical use should include UDG for carryover prevention and hybridization with specific probes to optimize diagnostic sensitivity and specificity in extrapulmonary tuberculosis testing.

  17. Real-time PCR detection of Plasmodium directly from whole blood and filter paper samples

    PubMed Central

    2011-01-01

    Background Real-time PCR is a sensitive and specific method for the analysis of Plasmodium DNA. However, prior purification of genomic DNA from blood is necessary since PCR inhibitors and quenching of fluorophores from blood prevent efficient amplification and detection of PCR products. Methods Reagents designed to specifically overcome PCR inhibition and quenching of fluorescence were evaluated for real-time PCR amplification of Plasmodium DNA directly from blood. Whole blood from clinical samples and dried blood spots collected in the field in Colombia were tested. Results Amplification and fluorescence detection by real-time PCR were optimal with 40× SYBR® Green dye and 5% blood volume in the PCR reaction. Plasmodium DNA was detected directly from both whole blood and dried blood spots from clinical samples. The sensitivity and specificity ranged from 93-100% compared with PCR performed on purified Plasmodium DNA. Conclusions The methodology described facilitates high-throughput testing of blood samples collected in the field by fluorescence-based real-time PCR. This method can be applied to a broad range of clinical studies with the advantages of immediate sample testing, lower experimental costs and time-savings. PMID:21851640

  18. Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples.

    PubMed

    Kasturi, Kuppuswamy N; Drgon, Tomas

    2017-07-15

    The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA , group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non- Salmonella organisms. The invA - and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella -differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the V itek i mmuno d iagnostic a ssay s ystem (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples.

  19. Real-Time PCR Method for Detection of Salmonella spp. in Environmental Samples

    PubMed Central

    Drgon, Tomas

    2017-01-01

    ABSTRACT The methods currently used for detecting Salmonella in environmental samples require 2 days to produce results and have limited sensitivity. Here, we describe the development and validation of a real-time PCR Salmonella screening method that produces results in 18 to 24 h. Primers and probes specific to the gene invA, group D, and Salmonella enterica serovar Enteritidis organisms were designed and evaluated for inclusivity and exclusivity using a panel of 329 Salmonella isolates representing 126 serovars and 22 non-Salmonella organisms. The invA- and group D-specific sets identified all the isolates accurately. The PCR method had 100% inclusivity and detected 1 to 2 copies of Salmonella DNA per reaction. Primers specific for Salmonella-differentiating fragment 1 (Sdf-1) in conjunction with the group D set had 100% inclusivity for 32 S. Enteritidis isolates and 100% exclusivity for the 297 non-Enteritidis Salmonella isolates. Single-laboratory validation performed on 1,741 environmental samples demonstrated that the PCR method detected 55% more positives than the Vitek immunodiagnostic assay system (VIDAS) method. The PCR results correlated well with the culture results, and the method did not report any false-negative results. The receiver operating characteristic (ROC) analysis documented excellent agreement between the results from the culture and PCR methods (area under the curve, 0.90; 95% confidence interval of 0.76 to 1.0) confirming the validity of the PCR method. IMPORTANCE This validated PCR method detects 55% more positives for Salmonella in half the time required for the reference method, VIDAS. The validated PCR method will help to strengthen public health efforts through rapid screening of Salmonella spp. in environmental samples. PMID:28500041

  20. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms

    PubMed Central

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178

  1. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms.

    PubMed

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.

  2. The combination of quantitative PCR and western blot detecting CP4-EPSPS component in Roundup Ready soy plant tissues and commercial soy-related foodstuffs.

    PubMed

    Xiao, Xiao; Wu, Honghong; Zhou, Xinghu; Xu, Sheng; He, Jian; Shen, Wenbiao; Zhou, Guanghong; Huang, Ming

    2012-06-01

    With the widespread use of Roundup Ready soy (event 40-3-2) (RRS), the comprehensive detection of genetically modified component in foodstuffs is of significant interest, but few protein-based approaches have been found useful in processed foods. In this report, the combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different RRS plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing both meat and plant protein concentrates. The validity of the 2 methods was confirmed first. We also showed that the CP4-EPSPS protein existed in different RRS plant tissues. In certain cases, the results from the western blot and the qPCR were not consistent. To be specific, at least 2 degraded fragments of CP4-EPSPS protein (35.5 and 24.6 kDa) were observed. For dried bean curd crust and deep-fried bean curd, a degraded protein fragment with the size of 24.6 kDa appeared, while cp4-epsps gene could not be traced by qPCR. In contrast, we found a signal of cp4-epsps DNA in 3 foodstuffs, including soy-containing ham cutlet product, meat ball, and sausage by qPCR, while CP4-EPSPS protein could not be detected by western blot in such samples. Our study therefore concluded that the combination of DNA- and protein-based methods would compensate each other, thus resulting in a more comprehensive detection from nucleic acid and protein levels. The combination of quantitative PCR (qPCR) and western blot was used to detect cp4-epsps gene and its protein product in different Roundup Ready soy (event 40-3-2) plant tissues and commercial soy-containing foodstuffs. The foods included those of plant origin produced by different processing procedures and also some products containing a combination of both meat and plant protein concentrates. This study indicated that the combination of DNA- and protein-based methods would supplement each other for genetically modified detection from nucleic acid and protein levels. Accordingly, qPCR and western blot could be used in CP4-EPSPS detection in a wide variety of soy-related foodstuffs. © 2012 Institute of Food Technologists®

  3. Methods for detection of GMOs in food and feed.

    PubMed

    Marmiroli, Nelson; Maestri, Elena; Gullì, Mariolina; Malcevschi, Alessio; Peano, Clelia; Bordoni, Roberta; De Bellis, Gianluca

    2008-10-01

    This paper reviews aspects relevant to detection and quantification of genetically modified (GM) material within the feed/food chain. The GM crop regulatory framework at the international level is evaluated with reference to traceability and labelling. Current analytical methods for the detection, identification, and quantification of transgenic DNA in food and feed are reviewed. These methods include quantitative real-time PCR, multiplex PCR, and multiplex real-time PCR. Particular attention is paid to methods able to identify multiple GM events in a single reaction and to the development of microdevices and microsensors, though they have not been fully validated for application.

  4. Detection of genetically modified organisms in foreign-made processed foods containing corn and potato.

    PubMed

    Monma, Kimio; Araki, Rie; Sagi, Naoki; Satoh, Masaki; Ichikawa, Hisatsugu; Satoh, Kazue; Tobe, Takashi; Kamata, Kunihiro; Hino, Akihiro; Saito, Kazuo

    2005-06-01

    Investigations of the validity of labeling regarding genetically modified (GM) products were conducted using polymerase chain reaction (PCR) methods for foreign-made processed foods made from corn and potato purchased in the Tokyo area and in the USA. Several kinds of GM crops were detected in 12 of 32 samples of processed corn samples. More than two GM events for which safety reviews have been completed in Japan were simultaneously detected in 10 samples. GM events MON810 and Bt11 were most frequently detected in the samples by qualitative PCR methods. MON810 was detected in 11 of the 12 samples, and Bt11 was detected in 6 of the 12 samples. In addition, Roundup Ready soy was detected in one of the 12 samples. On the other hand, CBH351, for which the safety assessment was withdrawn in Japan, was not detected in any of the 12 samples. A trial quantitative analysis was performed on six of the GM maize qualitatively positive samples. The estimated amounts of GM maize in these samples ranged from 0.2 to 2.8%, except for one sample, which contained 24.1%. For this sample, the total amount found by event-specific quantitative analysis was 23.8%. Additionally, Roundup Ready soy was detected in one sample of 21 potato-processed foods, although GM potatoes were not detected in any sample.

  5. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ

    USDA-ARS?s Scientific Manuscript database

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...

  6. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

    PubMed

    Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

    2017-01-01

    Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

  7. Monitoring of Bt11 and Bt176 genetically modified maize in food sold commercially in Brazil from 2005 to 2007.

    PubMed

    Dinon, Andréia Z; Bosco, Kenia T; Arisi, Ana Carolina M

    2010-07-01

    The first genetically modified (GM) maize lines were approved for trading in Brazil after December 2007 and they were T25, MON810, Bt11, NK603 and GA21. The polymerase chain reaction (PCR) method was employed to monitor the presence of Bt11 and nested PCR was used to detect the presence of Bt176 in 81 maize-derived products (maize flour, corn meal, maize flour flakes and polenta) that were sold in Brazilian market from 2005 to 2007, before the release of GM maize in Brazil. The PCR detection limit for Bt11 was 10 g kg(-1) and for nested PCR of Bt176 it was 1 g kg(-1). All Brazilian samples analyzed showed no positive signal for these GM maize events. Bt11 and Bt176 GM maize lines were not detected by specific PCR in 81 maize-derived food samples sold in Brazil from 2005 to 2007, before the commercial release of GM maize in Brazil. These Brazilian food industries were in compliance with the rules stipulated by the current legislation with respect to consumer requirements about GMO labeling.

  8. Discrimination of probiotic Lactobacillus strains for poultry by repetitive sequenced-based PCR fingerprinting.

    PubMed

    Lee, Chin Mei; Sieo, Chin Chin; Cheah, Yoke-Kqueen; Abdullah, Norhani; Ho, Yin Wan

    2012-02-01

    Four repetitive element sequence-based polymerase chain reaction (rep-PCR) methods, namely repetitive extragenic palindromic PCR (REP-PCR), enterobacterial repetitive intergenic consensus PCR (ERIC-PCR), polytrinucleotide (GTG)₅ -PCR and BOX-PCR, were evaluated for the molecular differentiation of 12 probiotic Lactobacillus strains previously isolated from the gastrointestinal tract of chickens and used as a multistrain probiotic. This study represents the first analysis of the comparative efficacy of these four rep-PCR methods and their combination (composite rep-PCR) in the molecular typing of Lactobacillus strains based on a discriminatory index (D). Species-specific and strain-specific profiles were observed from rep-PCR. From the numerical analysis of composite rep-PCR, BOX-PCR, (GTG)₅ -PCR, REP-PCR and ERIC-PCR, D values of 0.9118, 0.9044, 0.8897, 0.8750 and 0.8529 respectively were obtained. Composite rep-PCR analysis was the most discriminative method, with eight Lactobacillus strains, namely L. brevis ATCC 14869(T) , L. reuteri C 10, L. reuteri ATCC 23272(T) , L. gallinarum ATCC 33199(T) , L. salivarius ATCC 11741(T) , L. salivarius I 24, L. panis JCM 11053(T) and L. panis C 17, being differentiated at the strain level. Composite rep-PCR analysis is potentially a useful fingerprinting method to discriminate probiotic Lactobacillus strains isolated from the gastrointestinal tract of chickens. Copyright © 2011 Society of Chemical Industry.

  9. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    PubMed

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  10. Comparison of PCR-based methods for the simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in clinical samples.

    PubMed

    de Filippis, Ivano; de Andrade, Claudia Ferreira; Caldeira, Nathalia; de Azevedo, Aline Carvalho; de Almeida, Antonio Eugenio

    2016-01-01

    Several in-house PCR-based assays have been described for the detection of bacterial meningitis caused by Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae from clinical samples. PCR-based methods targeting different bacterial genes are frequently used by different laboratories worldwide, but no standard method has ever been established. The aim of our study was to compare different in-house and a commercial PCR-based tests for the detection of bacterial pathogens causing meningitis and invasive disease in humans. A total of 110 isolates and 134 clinical samples (99 cerebrospinal fluid and 35 blood samples) collected from suspected cases of invasive disease were analyzed. Specific sets of primers frequently used for PCR-diagnosis of the three pathogens were used and compared with the results achieved using the multiplex approach described here. Several different gene targets were used for each microorganism, namely ctrA, crgA and nspA for N. meningitidis, ply for S. pneumoniae, P6 and bexA for H. influenzae. All used methods were fast, specific and sensitive, while some of the targets used for the in-house PCR assay detected lower concentrations of genomic DNA than the commercial method. An additional PCR reaction is described for the differentiation of capsulated and non-capsulated H. influenzae strains, the while commercial method only detects capsulated strains. The in-house PCR methods here compared showed to be rapid, sensitive, highly specific, and cheaper than commercial methods. The in-house PCR methods could be easily adopted by public laboratories of developing countries for diagnostic purposes. The best results were achieved using primers targeting the genes nspA, ply, and P6 which were able to detect the lowest DNA concentrations for each specific target. Copyright © 2016 Elsevier Editora Ltda. All rights reserved.

  11. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  12. [Sensitivity and specificity of nested PCR pyrosequencing in hepatitis B virus drug resistance gene testing].

    PubMed

    Sun, Shumei; Zhou, Hao; Zhou, Bin; Hu, Ziyou; Hou, Jinlin; Sun, Jian

    2012-05-01

    To evaluate the sensitivity and specificity of nested PCR combined with pyrosequencing in the detection of HBV drug-resistance gene. RtM204I (ATT) mutant and rtM204 (ATG) nonmutant plasmids mixed at different ratios were detected for mutations using nested-PCR combined with pyrosequencing, and the results were compared with those by conventional PCR pyrosequencing to analyze the linearity and consistency of the two methods. Clinical specimens with different viral loads were examined for drug-resistant mutations using nested PCR pyrosequencing and nested PCR combined with dideoxy sequencing (Sanger) for comparison of the detection sensitivity and specificity. The fitting curves demonstrated good linearity of both conventional PCR pyrosequencing and nested PCR pyrosequencing (R(2)>0.99, P<0.05). Nested PCR showed a better consistency with the predicted value than conventional PCR, and was superior to conventional PCR for detection of samples containing 90% mutant plasmid. In the detection of clinical specimens, Sanger sequencing had a significantly lower sensitivity than nested PCR pyrosequencing (92% vs 100%, P<0.01). The detection sensitivity of Sanger sequencing varied with the viral loads, especially in samples with low viral copies (HBV DNA ≤3log10 copies/ml), where the sensitivity was 78%, significantly lower than that of pyrosequencing (100%, P<0.01). Neither of the two methods yielded positive results for the negative control samples, suggesting their good specificity. Compared with nested PCR and Sanger sequencing method, nested PCR pyrosequencing has a higher sensitivity especially in clinical specimens with low viral copies, which can be important for early detection of HBV mutant strains and hence more effective clinical management.

  13. Assessing pathological complete response to neoadjuvant chemoradiotherapy in locally advanced rectal cancer: a systematic review.

    PubMed

    Ryan, J E; Warrier, S K; Lynch, A C; Heriot, A G

    2015-10-01

    Pathological complete response to neoadjuvant chemoradiotherapy is found in 20% of patients with rectal cancer undergoing long-course chemoradiotherapy. Some authors have suggested that these patients do not need to undergo surgery and can be managed with careful follow-up, with surgery only used in the event of clinical failure. Widespread adoption of this regimen is limited by the accuracy of methods to confirm a pathological complete response (pCR). A systematic search of PubMed, Medline and Cochrane databases was conducted to identify clinical, histological and radiological features in those patients with rectal cancer who achieved a pCR following chemoradiotherapy. Searches were conducted with the following keywords and MeSH search terms: 'rectal neoplasm', 'response', 'neoadjuvant', 'preoperative chemoradiation' and 'tumour response'. After review of title and abstracts, 89 articles addressing the assessment of pCR were identified. Histology and clinical assessment are the most effective methods of assessment of pCR, with histology considered the gold standard. Clinical assessment is limited to low rectal tumours and is open to significant inter-rater variability, while histological examination requires a surgical specimen. Diffusion-weighted MRI and (18) F-fluorodeoxyglucose positron emission tomography/CT demonstrate the greatest potential for the assessment of pCR, but both modalities have limited accuracy. Determination of a pCR is crucial if a nonoperative approach is to be undertaken proactively. Various methods are available, but currently they lack sufficient sensitivity and specificity to define management. This is likely to be an area of further research in the future. Colorectal Disease © 2015 The Association of Coloproctology of Great Britain and Ireland.

  14. Alternative splicing and trans-splicing events revealed by analysis of the Bombyx mori transcriptome

    PubMed Central

    Shao, Wei; Zhao, Qiong-Yi; Wang, Xiu-Ye; Xu, Xin-Yan; Tang, Qing; Li, Muwang; Li, Xuan; Xu, Yong-Zhen

    2012-01-01

    Alternative splicing and trans-splicing events have not been systematically studied in the silkworm Bombyx mori. Here, the silkworm transcriptome was analyzed by RNA-seq. We identified 320 novel genes, modified 1140 gene models, and found thousands of alternative splicing and 58 trans-splicing events. Studies of three SR proteins show that both their alternative splicing patterns and mRNA products are conserved from insect to human, and one isoform of Srsf6 with a retained intron is expressed sex-specifically in silkworm gonads. Trans-splicing of mod(mdg4) in silkworm was experimentally confirmed. We identified integrations from a common 5′-gene with 46 newly identified alternative 3′-exons that are located on both DNA strands over a 500-kb region. Other trans-splicing events in B. mori were predicted by bioinformatic analysis, in which 12 events were confirmed by RT-PCR, six events were further validated by chimeric SNPs, and two events were confirmed by allele-specific RT-PCR in F1 hybrids from distinct silkworm lines of JS and L10, indicating that trans-splicing is more widespread in insects than previously thought. Analysis of the B. mori transcriptome by RNA-seq provides valuable information of regulatory alternative splicing events. The conservation of splicing events across species and newly identified trans-splicing events suggest that B. mori is a good model for future studies. PMID:22627775

  15. Enumeration of viable and non-viable larvated Ascaris eggs with quantitative PCR

    EPA Science Inventory

    Aims: The goal of the study was to further develop an incubation-qPCR method for quantifying viable Ascaris eggs. The specific objectives were to characterize the detection limit and number of template copies per egg, determine the specificity of the method, and test the method w...

  16. [A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

    PubMed

    Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

    2013-10-18

    To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

  17. Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

    PubMed

    Jia, Xianbo; Lin, Xinjian; Chen, Jichen

    2017-11-02

    Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

  18. Development of a general method for detection and quantification of the P35S promoter based on assessment of existing methods

    PubMed Central

    Wu, Yuhua; Wang, Yulei; Li, Jun; Li, Wei; Zhang, Li; Li, Yunjing; Li, Xiaofei; Li, Jun; Zhu, Li; Wu, Gang

    2014-01-01

    The Cauliflower mosaic virus (CaMV) 35S promoter (P35S) is a commonly used target for detection of genetically modified organisms (GMOs). There are currently 24 reported detection methods, targeting different regions of the P35S promoter. Initial assessment revealed that due to the absence of primer binding sites in the P35S sequence, 19 of the 24 reported methods failed to detect P35S in MON88913 cotton, and the other two methods could only be applied to certain GMOs. The rest three reported methods were not suitable for measurement of P35S in some testing events, because SNPs in binding sites of the primer/probe would result in abnormal amplification plots and poor linear regression parameters. In this study, we discovered a conserved region in the P35S sequence through sequencing of P35S promoters from multiple transgenic events, and developed new qualitative and quantitative detection systems targeting this conserved region. The qualitative PCR could detect the P35S promoter in 23 unique GMO events with high specificity and sensitivity. The quantitative method was suitable for measurement of P35S promoter, exhibiting good agreement between the amount of template and Ct values for each testing event. This study provides a general P35S screening method, with greater coverage than existing methods. PMID:25483893

  19. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    PubMed

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  20. Multiple Hotspot Mutations Scanning by Single Droplet Digital PCR.

    PubMed

    Decraene, Charles; Silveira, Amanda B; Bidard, François-Clément; Vallée, Audrey; Michel, Marc; Melaabi, Samia; Vincent-Salomon, Anne; Saliou, Adrien; Houy, Alexandre; Milder, Maud; Lantz, Olivier; Ychou, Marc; Denis, Marc G; Pierga, Jean-Yves; Stern, Marc-Henri; Proudhon, Charlotte

    2018-02-01

    Progress in the liquid biopsy field, combined with the development of droplet digital PCR (ddPCR), has enabled noninvasive monitoring of mutations with high detection accuracy. However, current assays detect a restricted number of mutations per reaction. ddPCR is a recognized method for detecting alterations previously characterized in tumor tissues, but its use as a discovery tool when the mutation is unknown a priori remains limited. We established 2 ddPCR assays detecting all genomic alterations within KRAS exon 2 and EGFR exon 19 mutation hotspots, which are of clinical importance in colorectal and lung cancer, with use of a unique pair of TaqMan ® oligoprobes. The KRAS assay scanned for the 7 most common mutations in codons 12/13 but also all other mutations found in that region. The EGFR assay screened for all in-frame deletions of exon 19, which are frequent EGFR-activating events. The KRAS and EGFR assays were highly specific and both reached a limit of detection of <0.1% in mutant allele frequency. We further validated their performance on multiple plasma and formalin-fixed and paraffin-embedded tumor samples harboring a panel of different KRAS or EGFR mutations. This method presents the advantage of detecting a higher number of mutations with single-reaction ddPCRs while consuming a minimum of patient sample. This is particularly useful in the context of liquid biopsy because the amount of circulating tumor DNA is often low. This method should be useful as a discovery tool when the tumor tissue is unavailable or to monitor disease during therapy. © 2017 American Association for Clinical Chemistry.

  1. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    PubMed Central

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  2. Statistical framework for detection of genetically modified organisms based on Next Generation Sequencing.

    PubMed

    Willems, Sander; Fraiture, Marie-Alice; Deforce, Dieter; De Keersmaecker, Sigrid C J; De Loose, Marc; Ruttink, Tom; Herman, Philippe; Van Nieuwerburgh, Filip; Roosens, Nancy

    2016-02-01

    Because the number and diversity of genetically modified (GM) crops has significantly increased, their analysis based on real-time PCR (qPCR) methods is becoming increasingly complex and laborious. While several pioneers already investigated Next Generation Sequencing (NGS) as an alternative to qPCR, its practical use has not been assessed for routine analysis. In this study a statistical framework was developed to predict the number of NGS reads needed to detect transgene sequences, to prove their integration into the host genome and to identify the specific transgene event in a sample with known composition. This framework was validated by applying it to experimental data from food matrices composed of pure GM rice, processed GM rice (noodles) or a 10% GM/non-GM rice mixture, revealing some influential factors. Finally, feasibility of NGS for routine analysis of GM crops was investigated by applying the framework to samples commonly encountered in routine analysis of GM crops. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Simple, Sensitive and Accurate Multiplex Detection of Clinically Important Melanoma DNA Mutations in Circulating Tumour DNA with SERS Nanotags

    PubMed Central

    Wee, Eugene J.H.; Wang, Yuling; Tsao, Simon Chang-Hao; Trau, Matt

    2016-01-01

    Sensitive and accurate identification of specific DNA mutations can influence clinical decisions. However accurate diagnosis from limiting samples such as circulating tumour DNA (ctDNA) is challenging. Current approaches based on fluorescence such as quantitative PCR (qPCR) and more recently, droplet digital PCR (ddPCR) have limitations in multiplex detection, sensitivity and the need for expensive specialized equipment. Herein we describe an assay capitalizing on the multiplexing and sensitivity benefits of surface-enhanced Raman spectroscopy (SERS) with the simplicity of standard PCR to address the limitations of current approaches. This proof-of-concept method could reproducibly detect as few as 0.1% (10 copies, CV < 9%) of target sequences thus demonstrating the high sensitivity of the method. The method was then applied to specifically detect three important melanoma mutations in multiplex. Finally, the PCR/SERS assay was used to genotype cell lines and ctDNA from serum samples where results subsequently validated with ddPCR. With ddPCR-like sensitivity and accuracy yet at the convenience of standard PCR, we believe this multiplex PCR/SERS method could find wide applications in both diagnostics and research. PMID:27446486

  4. Simple, Sensitive and Accurate Multiplex Detection of Clinically Important Melanoma DNA Mutations in Circulating Tumour DNA with SERS Nanotags.

    PubMed

    Wee, Eugene J H; Wang, Yuling; Tsao, Simon Chang-Hao; Trau, Matt

    2016-01-01

    Sensitive and accurate identification of specific DNA mutations can influence clinical decisions. However accurate diagnosis from limiting samples such as circulating tumour DNA (ctDNA) is challenging. Current approaches based on fluorescence such as quantitative PCR (qPCR) and more recently, droplet digital PCR (ddPCR) have limitations in multiplex detection, sensitivity and the need for expensive specialized equipment. Herein we describe an assay capitalizing on the multiplexing and sensitivity benefits of surface-enhanced Raman spectroscopy (SERS) with the simplicity of standard PCR to address the limitations of current approaches. This proof-of-concept method could reproducibly detect as few as 0.1% (10 copies, CV < 9%) of target sequences thus demonstrating the high sensitivity of the method. The method was then applied to specifically detect three important melanoma mutations in multiplex. Finally, the PCR/SERS assay was used to genotype cell lines and ctDNA from serum samples where results subsequently validated with ddPCR. With ddPCR-like sensitivity and accuracy yet at the convenience of standard PCR, we believe this multiplex PCR/SERS method could find wide applications in both diagnostics and research.

  5. Rapid PCR-mediated synthesis of competitor molecules for accurate quantification of beta(2) GABA(A) receptor subunit mRNA.

    PubMed

    Vela, J; Vitorica, J; Ruano, D

    2001-12-01

    We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.

  6. Development of a multiplex PCR assay for rapid and simultaneous detection of four genera of fish pathogenic bacteria.

    PubMed

    Zhang, D F; Zhang, Q Q; Li, A H

    2014-11-01

    Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This mPCR assay provides a rapid, specific and sensitive tool for the detection or identification of common fish pathogenic bacteria in aquaculture practice. © 2014 The Society for Applied Microbiology.

  7. Use of taxon-specific competitive-priming PCR to study host specificity, hybridization, and intergroup gene flow in intersterility groups of Heterobasidion annosum

    Treesearch

    M. Garbelotto; A. Ratcliff; T.D. Bruns; F.W. Cobb; W.J. Otrosina

    1996-01-01

    Two intersterility groups (ISGs) of the forest pathogen Heterobasidion annosum are found in California: S and P.We devised a polymerase chain reaction (PCR) method called taxon- specific competitive-priming (TSCP) PCR to differentiate the two ISGs.Using TSCP-PCR, we typed 537 live isolates and dry basidiocarps from 204 trees and 114 stumps from 60 sites in eight...

  8. Design and Assessment of a Real Time Reverse Transcription-PCR Method to Genotype Single-Stranded RNA Male-Specific Coliphages (Family Leviviridae).

    EPA Science Inventory

    A real-time, reverse transcription-PCR (RT-qPCR) assay was developed to differentiate the four genogroups of male-specific ssRNA coliphages (FRNA) (family Leviviridae). As FRNA display a trend of source-specificity (human sewage or animal waste) at the genogroup level, this assa...

  9. FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

    PubMed

    Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

    2007-01-01

    We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

  10. Comparison of Three Different Hepatitis C Virus Genotyping Methods: 5'NCR PCR-RFLP, Core Type-Specific PCR, and NS5b Sequencing in a Tertiary Care Hospital in South India.

    PubMed

    Daniel, Hubert D-J; David, Joel; Raghuraman, Sukanya; Gnanamony, Manu; Chandy, George M; Sridharan, Gopalan; Abraham, Priya

    2017-05-01

    Based on genetic heterogeneity, hepatitis C virus (HCV) is classified into seven major genotypes and 64 subtypes. In spite of the sequence heterogeneity, all genotypes share an identical complement of colinear genes within the large open reading frame. The genetic interrelationships between these genes are consistent among genotypes. Due to this property, complete sequencing of the HCV genome is not required. HCV genotypes along with subtypes are critical for planning antiviral therapy. Certain genotypes are also associated with higher progression to liver cirrhosis. In this study, 100 blood samples were collected from individuals who came for routine HCV genotype identification. These samples were used for the comparison of two different genotyping methods (5'NCR PCR-RFLP and HCV core type-specific PCR) with NS5b sequencing. Of the 100 samples genotyped using 5'NCR PCR-RFLP and HCV core type-specific PCR, 90% (κ = 0.913, P < 0.00) and 96% (κ = 0.794, P < 0.00) correlated with NS5b sequencing, respectively. Sixty percent and 75% of discordant samples by 5'NCR PCR-RFLP and HCV core type-specific PCR, respectively, belonged to genotype 6. All the HCV genotype 1 subtypes were classified accurately by both the methods. This study shows that the 5'NCR-based PCR-RFLP and the HCV core type-specific PCR-based assays correctly identified HCV genotypes except genotype 6 from this region. Direct sequencing of the HCV core region was able to identify all the genotype 6 from this region and serves as an alternative to NS5b sequencing. © 2016 Wiley Periodicals, Inc.

  11. A simplified and accurate detection of the genetically modified wheat MON71800 with one calibrator plasmid.

    PubMed

    Kim, Jae-Hwan; Park, Saet-Byul; Roh, Hyo-Jeong; Park, Sunghoon; Shin, Min-Ki; Moon, Gui Im; Hong, Jin-Hwan; Kim, Hae-Yeong

    2015-06-01

    With the increasing number of genetically modified (GM) events, unauthorized GMO releases into the food market have increased dramatically, and many countries have developed detection tools for them. This study described the qualitative and quantitative detection methods of unauthorized the GM wheat MON71800 with a reference plasmid (pGEM-M71800). The wheat acetyl-CoA carboxylase (acc) gene was used as the endogenous gene. The plasmid pGEM-M71800, which contains both the acc gene and the event-specific target MON71800, was constructed as a positive control for the qualitative and quantitative analyses. The limit of detection in the qualitative PCR assay was approximately 10 copies. In the quantitative PCR assay, the standard deviation and relative standard deviation repeatability values ranged from 0.06 to 0.25 and from 0.23% to 1.12%, respectively. This study supplies a powerful and very simple but accurate detection strategy for unauthorized GM wheat MON71800 that utilizes a single calibrator plasmid. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Development of a loop-mediated isothermal amplification (LAMP) assay for rapid and specific detection of common genetically modified organisms (GMOs).

    PubMed

    Feng, Jiawang; Tang, Shiming; Liu, Lideng; Kuang, Xiaoshan; Wang, Xiaoyu; Hu, Songnan; You, Shuzhu

    2015-03-01

    Here, we developed a loop-mediated isothermal amplification (LAMP) assay for 11 common transgenic target DNA in GMOs. Six sets of LAMP primer candidates for each target were designed and their specificity, sensitivity, and reproductivity were evaluated. With the optimized LAMP primers, this LAMP assay was simply run within 45-60 min to detect all these targets in GMOs tested. The sensitivity, specificity, and reproductivity of the LAMP assay were further analyzed in comparison with those of Real-Time PCR. In consistent with real-time PCR, detection of 0.5% GMOs in equivalent background DNA was possible using this LAMP assay for all targets. In comparison with real-time PCR, the LAMP assay showed the same results with simple instruments. Hence, the LAMP assay developed can provide a rapid and simple approach for routine screening as well as specific events detection of many GMOs.

  13. GMDD: a database of GMO detection methods

    PubMed Central

    Dong, Wei; Yang, Litao; Shen, Kailin; Kim, Banghyun; Kleter, Gijs A; Marvin, Hans JP; Guo, Rong; Liang, Wanqi; Zhang, Dabing

    2008-01-01

    Background Since more than one hundred events of genetically modified organisms (GMOs) have been developed and approved for commercialization in global area, the GMO analysis methods are essential for the enforcement of GMO labelling regulations. Protein and nucleic acid-based detection techniques have been developed and utilized for GMOs identification and quantification. However, the information for harmonization and standardization of GMO analysis methods at global level is needed. Results GMO Detection method Database (GMDD) has collected almost all the previous developed and reported GMOs detection methods, which have been grouped by different strategies (screen-, gene-, construct-, and event-specific), and also provide a user-friendly search service of the detection methods by GMO event name, exogenous gene, or protein information, etc. In this database, users can obtain the sequences of exogenous integration, which will facilitate PCR primers and probes design. Also the information on endogenous genes, certified reference materials, reference molecules, and the validation status of developed methods is included in this database. Furthermore, registered users can also submit new detection methods and sequences to this database, and the newly submitted information will be released soon after being checked. Conclusion GMDD contains comprehensive information of GMO detection methods. The database will make the GMOs analysis much easier. PMID:18522755

  14. Rapid and sensitive detection of Zika virus by reverse transcription loop-mediated isothermal amplification.

    PubMed

    Wang, Xuan; Yin, Fenggui; Bi, Yuhai; Cheng, Gong; Li, Jing; Hou, Lidan; Li, Yunlong; Yang, Baozhi; Liu, Wenjun; Yang, Limin

    2016-12-01

    Zika virus (ZIKV) is an arbovirus that recently emerged and has expanded worldwide, causing a global threat and raising international concerns. Current molecular diagnostics, e.g., real-time PCR and reverse transcription PCR (RT-PCR), are time consuming, expensive, and can only be deployed in a laboratory instead of for field diagnostics. This study aimed to develop a one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) platform showing sensitivity, specificity, and more convenience than previous methods, being easily distributed and implemented. Specific primers were designed and screened to target the entire ZIKV genome. The analytical sensitivity and specificity of the assay were evaluated and compared with traditional PCR and quantitative real-time PCR. Three different simulated clinical sample quick preparation protocols were evaluated to establish a rapid and straightforward treatment procedure for clinical specimens in open field detection. The RT-LAMP assay for detection of ZIKV demonstrated superior specificity and sensitivity compared to traditional PCR at the optimum reaction temperature. For the ZIKV RNA standard, the limit of detection was 20 copies/test. For the simulated ZIKV clinical samples, the limit of detection was 0.02 pfu/test, which was one order of magnitude higher than RT-PCR and similar to real-time PCR. The detection limit of simulated ZIKV specimens prepared using a protease quick processing method was consistent with that of samples prepared using commercial nucleic acid extraction kits, indicating that our ZIKV detection method could be used in point-of-care testing. The RT-LAMP assay had excellent sensitivity and specificity for detecting ZIKV and can be deployed together with a rapid specimen processing method, offering the possibility for ZIKV diagnosis outside of the laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Highly specific and efficient primers for in-house multiplex PCR detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum

    PubMed Central

    2014-01-01

    Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675

  16. Use of SCW4 gene primers in PCR methods for the identification of six medically important Aspergillus species.

    PubMed

    Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia

    2016-10-01

    Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.

  17. A broad range assay for rapid detection and etiologic characterization of bacterial meningitis: performance testing in samples from sub-Sahara.

    PubMed

    Won, Helen; Yang, Samuel; Gaydos, Charlotte; Hardick, Justin; Ramachandran, Padmini; Hsieh, Yu-Hsiang; Kecojevic, Alexander; Njanpop-Lafourcade, Berthe-Marie; Mueller, Judith E; Tameklo, Tsidi Agbeko; Badziklou, Kossi; Gessner, Bradford D; Rothman, Richard E

    2012-09-01

    This study aimed to conduct a pilot evaluation of broad-based multiprobe polymerase chain reaction (PCR) in clinical cerebrospinal fluid (CSF) samples compared to local conventional PCR/culture methods used for bacterial meningitis surveillance. A previously described PCR consisting of initial broad-based detection of Eubacteriales by a universal probe, followed by Gram typing, and pathogen-specific probes was designed targeting variable regions of the 16S rRNA gene. The diagnostic performance of the 16S rRNA assay in "127 CSF samples was evaluated in samples from patients from Togo, Africa, by comparison to conventional PCR/culture methods. Our probes detected Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. Uniprobe sensitivity and specificity versus conventional PCR were 100% and 54.6%, respectively. Sensitivity and specificity of uniprobe versus culture methods were 96.5% and 52.5%, respectively. Gram-typing probes correctly typed 98.8% (82/83) and pathogen-specific probes identified 96.4% (80/83) of the positives. This broad-based PCR algorithm successfully detected and provided species level information for multiple bacterial meningitis agents in clinical samples. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. A broad range assay for rapid detection and etiologic characterization of bacterial meningitis: performance testing in samples from sub-Sahara☆, ☆☆,★

    PubMed Central

    Won, Helen; Yang, Samuel; Gaydos, Charlotte; Hardick, Justin; Ramachandran, Padmini; Hsieh, Yu-Hsiang; Kecojevic, Alexander; Njanpop-Lafourcade, Berthe-Marie; Mueller, Judith E.; Tameklo, Tsidi Agbeko; Badziklou, Kossi; Gessner, Bradford D.; Rothman, Richard E.

    2012-01-01

    This study aimed to conduct a pilot evaluation of broad-based multiprobe polymerase chain reaction (PCR) in clinical cerebrospinal fluid (CSF) samples compared to local conventional PCR/culture methods used for bacterial meningitis surveillance. A previously described PCR consisting of initial broad-based detection of Eubacteriales by a universal probe, followed by Gram typing, and pathogen-specific probes was designed targeting variable regions of the 16S rRNA gene. The diagnostic performance of the 16S rRNA assay in “”127 CSF samples was evaluated in samples from patients from Togo, Africa, by comparison to conventional PCR/culture methods. Our probes detected Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. Uniprobe sensitivity and specificity versus conventional PCR were 100% and 54.6%, respectively. Sensitivity and specificity of uniprobe versus culture methods were 96.5% and 52.5%, respectively. Gram-typing probes correctly typed 98.8% (82/83) and pathogen-specific probes identified 96.4% (80/83) of the positives. This broad-based PCR algorithm successfully detected and provided species level information for multiple bacterial meningitis agents in clinical samples. PMID:22809694

  19. Genotype-specific signal generation based on digestion of 3-way DNA junctions: application to KRAS variation detection.

    PubMed

    Amicarelli, Giulia; Adlerstein, Daniel; Shehi, Erlet; Wang, Fengfei; Makrigiorgos, G Mike

    2006-10-01

    Genotyping methods that reveal single-nucleotide differences are useful for a wide range of applications. We used digestion of 3-way DNA junctions in a novel technology, OneCutEventAmplificatioN (OCEAN) that allows sequence-specific signal generation and amplification. We combined OCEAN with peptide-nucleic-acid (PNA)-based variant enrichment to detect and simultaneously genotype v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) codon 12 sequence variants in human tissue specimens. We analyzed KRAS codon 12 sequence variants in 106 lung cancer surgical specimens. We conducted a PNA-PCR reaction that suppresses wild-type KRAS amplification and genotyped the product with a set of OCEAN reactions carried out in fluorescence microplate format. The isothermal OCEAN assay enabled a 3-way DNA junction to form between the specific target nucleic acid, a fluorescently labeled "amplifier", and an "anchor". The amplifier-anchor contact contains the recognition site for a restriction enzyme. Digestion produces a cleaved amplifier and generation of a fluorescent signal. The cleaved amplifier dissociates from the 3-way DNA junction, allowing a new amplifier to bind and propagate the reaction. The system detected and genotyped KRAS sequence variants down to approximately 0.3% variant-to-wild-type alleles. PNA-PCR/OCEAN had a concordance rate with PNA-PCR/sequencing of 93% to 98%, depending on the exact implementation. Concordance rate with restriction endonuclease-mediated selective-PCR/sequencing was 89%. OCEAN is a practical and low-cost novel technology for sequence-specific signal generation. Reliable analysis of KRAS sequence alterations in human specimens circumvents the requirement for sequencing. Application is expected in genotyping KRAS codon 12 sequence variants in surgical specimens or in bodily fluids, as well as single-base variations and sequence alterations in other genes.

  20. A multiplex PCR for detection of six viruses in ducks.

    PubMed

    Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong

    2017-10-01

    In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.

  1. A multiplex PCR method for the identification of commercially important salmon and trout species (Oncorhynchus and Salmo) in North America.

    PubMed

    Rasmussen Hellberg, Rosalee S; Morrissey, Michael T; Hanner, Robert H

    2010-09-01

    The purpose of this study was to develop a species-specific multiplex polymerase chain reaction (PCR) method that allows for the detection of salmon species substitution on the commercial market. Species-specific primers and TaqMan® probes were developed based on a comprehensive collection of mitochondrial 5' cytochrome c oxidase subunit I (COI) deoxyribonucleic acid (DNA) "barcode" sequences. Primers and probes were combined into multiplex assays and tested for specificity against 112 reference samples representing 25 species. Sensitivity and linearity tests were conducted using 10-fold serial dilutions of target DNA (single-species samples) and DNA admixtures containing the target species at levels of 10%, 1.0%, and 0.1% mixed with a secondary species. The specificity tests showed positive signals for the target DNA in both real-time and conventional PCR systems. Nonspecific amplification in both systems was minimal; however, false positives were detected at low levels (1.2% to 8.3%) in conventional PCR. Detection levels were similar for admixtures and single-species samples based on a 30 PCR cycle cut-off, with limits of 0.25 to 2.5 ng (1% to 10%) in conventional PCR and 0.05 to 5.0 ng (0.1% to 10%) in real-time PCR. A small-scale test with food samples showed promising results, with species identification possible even in heavily processed food items. Overall, this study presents a rapid, specific, and sensitive method for salmon species identification that can be applied to mixed-species and heavily processed samples in either conventional or real-time PCR formats. This study provides a newly developed method for salmon and trout species identification that will assist both industry and regulatory agencies in the detection and prevention of species substitution. This multiplex PCR method allows for rapid, high-throughput species identification even in heavily processed and mixed-species samples. An inter-laboratory study is currently being carried out to assess the ability of this method to identify species in a variety of commercial salmon and trout products.

  2. Rapid and Specific Method for Evaluating Streptomyces Competitive Dynamics in Complex Soil Communities

    USDA-ARS?s Scientific Manuscript database

    Quantifying target microbial populations in complex communities remains a barrier to studying species interactions in soil environments. Quantitative real-time PCR (qPCR) offers a rapid and specific means to assess populations of target microorganisms. SYBR Green and TaqMan-based qPCR assays were de...

  3. Evaluation of a Commercial Multiplex PCR for Rapid Detection of Multi Drug Resistant Gram Negative Infections

    PubMed Central

    Chavada, Ruchir; Maley, Michael

    2015-01-01

    Introduction: Community and healthcare associated infections caused by multi-drug resistant gram negative organisms (MDR GN) represent a worldwide threat. Nucleic Acid Detection tests are becoming more common for their detection; however they can be expensive requiring specialised equipment and local expertise. This study was done to evaluate the utility of a commercial multiplex tandem (MT) PCR for detection of MDR GN. Methods: The study was done on stored laboratory MDR GN isolates from sterile and non-sterile specimens (n=126, out of stored 567 organisms). Laboratory validation of the MT PCR was done to evaluate sensitivity, specificity and agreement with the current phenotypic methods used in the laboratory. Amplicon sequencing was also done on selected isolates for assessing performance characteristics. Workflow and cost implications of the MT PCR were evaluated. Results: The sensitivity and specificity of the MT PCR were calculated to be 95% and 96.7% respectively. Agreement with the phenotypic methods was 80%. Major lack of agreement was seen in detection of AmpC beta lactamase in enterobacteriaceae and carbapenemase in non-fermenters. Agreement of the MT PCR with another multiplex PCR was found to be 87%. Amplicon sequencing confirmed the genotype detected by MT PCR in 94.2 % of cases tested. Time to result was faster for the MT PCR but cost per test was higher. Conclusion: This study shows that with carefully chosen targets for detection of resistance genes in MDR GN, rapid and efficient identification is possible. MT PCR was sensitive and specific and likely more accurate than phenotypic methods. PMID:26464612

  4. Comparison of diagnostic techniques for the detection of Cryptosporidium oocysts in animal samples

    PubMed Central

    Mirhashemi, Marzieh Ezzaty; Zintl, Annetta; Grant, Tim; Lucy, Frances E.; Mulcahy, Grace; De Waal, Theo

    2015-01-01

    While a large number of laboratory methods for the detection of Cryptosporidium oocysts in faecal samples are now available, their efficacy for identifying asymptomatic cases of cryptosporidiosis is poorly understood. This study was carried out to determine a reliable screening test for epidemiological studies in livestock. In addition, three molecular tests were compared to identify Cryptosporidium species responsible for the infection in cattle, sheep and horses. A variety of diagnostic tests including microscopic (Kinyoun's staining), immunological (Direct Fluorescence Antibody tests or DFAT), enzyme-linked immunosorbent assay (ELISA), and molecular methods (nested PCR) were compared to assess their ability to detect Cryptosporidium in cattle, horse and sheep faecal samples. The results indicate that the sensitivity and specificity of each test is highly dependent on the input samples; while Kinyoun's and DFAT proved to be reliable screening tools for cattle samples, DFAT and PCR analysis (targeted at the 18S rRNA gene fragment) were more sensitive for screening sheep and horse samples. Finally different PCR primer sets targeted at the same region resulted in the preferential amplification of certain Cryptosporidium species when multiple species were present in the sample. Therefore, for identification of Cryptosporidium spp. in the event of asymptomatic cryptosporidiosis, the combination of different 18S rRNA nested PCR primer sets is recommended for further epidemiological applications and also tracking the sources of infection. PMID:25662435

  5. Diagnosis of Caprine Arthritis Encephalitis Virus infection in dairy goats by ELISA, PCR and Viral Culture.

    PubMed

    Panneum, S; Rukkwamsuk, T

    2017-03-01

    For preventive and control strategies of Caprine Arthritis Encephalitis Virus (CAEV) infection in dairy goats, performance of the available diagnostic tests was described as one of the most important and necessary aspects. The study aimed at evaluating the diagnostic test performance, including PCR, ELISA and viral culture, for CAEV infection in dairy goats in Thailand. Blood samples of 29 dairy goats from five low- to medium-prevalence herds and one very low-prevalence herd were collected for PCR and ELISA methods. The performance of these two diagnostic methods was evaluated by comparing with cytopathic effects (CPE) in the co-cultivation of CAEV and primary synovial cells. Results indicated that sensitivity, specificity were, respectively, 69.6%, 100%, for PCR; and 95.7%, 83.3% for ELISA. The PCR assay tended to have lower sensitivity and higher specificity than ELISA. When multiple tests were applied, parallel testing provided sensitivity and specificity of 98.7% and 83.3%, while series testing showed sensitivity and specificity of 66.6% and 100% respectively. These results indicated that combination of ELISA and PCR provided some advantages and possibly offered optimal methods to detect CAEV-infected goats. Kappa value of the agreement between PCR and ELISA test was 0.34, indicating fair agreement. Regarding the possibility of antigenic variation between CAEV strains used in both PCR and ELISA assays, the actual circulating CAEV strain should be reviewed in order to develop and enhance the diagnostic tests using the CAE viral antigens derived from specific local strains of Thailand.

  6. Validation of PCR methods for quantitation of genetically modified plants in food.

    PubMed

    Hübner, P; Waiblinger, H U; Pietsch, K; Brodmann, P

    2001-01-01

    For enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients, quantitative detection methods such as quantitative competitive (QC-PCR) and real-time PCR are applied by official food control laboratories. The experiences of 3 European food control laboratories in validating such methods were compared to describe realistic performance characteristics of quantitative PCR detection methods. The limit of quantitation (LOQ) of GMO-specific, real-time PCR was experimentally determined to reach 30-50 target molecules, which is close to theoretical prediction. Starting PCR with 200 ng genomic plant DNA, the LOQ depends primarily on the genome size of the target plant and ranges from 0.02% for rice to 0.7% for wheat. The precision of quantitative PCR detection methods, expressed as relative standard deviation (RSD), varied from 10 to 30%. Using Bt176 corn containing test samples and applying Bt176 specific QC-PCR, mean values deviated from true values by -7to 18%, with an average of 2+/-10%. Ruggedness of real-time PCR detection methods was assessed in an interlaboratory study analyzing commercial, homogeneous food samples. Roundup Ready soybean DNA contents were determined in the range of 0.3 to 36%, relative to soybean DNA, with RSDs of about 25%. Taking the precision of quantitative PCR detection methods into account, suitable sample plans and sample sizes for GMO analysis are suggested. Because quantitative GMO detection methods measure GMO contents of samples in relation to reference material (calibrants), high priority must be given to international agreements and standardization on certified reference materials.

  7. [Detection of KRAS mutation in colorectal cancer patients' cfDNA with droplet digital PCR].

    PubMed

    Luo, Yuwen; Li, Yao

    2018-03-25

    This study aims to develop a new method for the detection of KRAS mutations related to colorectal cancer in cfDNA, and to evaluate the sensitivity and accuracy of the detection. We designed a method of cfDNA based KRAS detection by droplets digital PCR (ddPCR). The theoretical performance of the method is evaluated by reference standard and compared to the ARMS PCR method. Two methods, ddPCR and qPCR, were successfully established to detect KRAS wild type and 7 mutants. Both methods were validated using plasmid standards and actual samples. The results were evaluated by false positive rate, linearity, and limit of detection. Finally, 52 plasma cfDNA samples from patients and 20 samples from healthy people were tested, the clinical sensitivity is 97.64%, clinical specificity is 81.43%. ddPCR method shows higher performance than qPCR. The LOD of ddPCR method reached single digits of cfDNA copies, it can detect as low as 0.01% to 0.04% mutation abundance.

  8. International Study to Evaluate PCR Methods for Detection of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients

    PubMed Central

    Schijman, Alejandro G.; Bisio, Margarita; Orellana, Liliana; Sued, Mariela; Duffy, Tomás; Mejia Jaramillo, Ana M.; Cura, Carolina; Auter, Frederic; Veron, Vincent; Qvarnstrom, Yvonne; Deborggraeve, Stijn; Hijar, Gisely; Zulantay, Inés; Lucero, Raúl Horacio; Velazquez, Elsa; Tellez, Tatiana; Sanchez Leon, Zunilda; Galvão, Lucia; Nolder, Debbie; Monje Rumi, María; Levi, José E.; Ramirez, Juan D.; Zorrilla, Pilar; Flores, María; Jercic, Maria I.; Crisante, Gladys; Añez, Néstor; De Castro, Ana M.; Gonzalez, Clara I.; Acosta Viana, Karla; Yachelini, Pedro; Torrico, Faustino; Robello, Carlos; Diosque, Patricio; Triana Chavez, Omar; Aznar, Christine; Russomando, Graciela; Büscher, Philippe; Assal, Azzedine; Guhl, Felipe; Sosa Estani, Sergio; DaSilva, Alexandre; Britto, Constança; Luquetti, Alejandro; Ladzins, Janis

    2011-01-01

    Background A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. Methodology/Findings An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU) I, IV and VI (set A), human blood spiked with parasite cells (set B) and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C). Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA), 13 satellite DNA (Sat-DNA) and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05–0.5 parasites/mL whereas specific kDNA tests detected 5.10−3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood). The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3–94.4%, specificity of 85–95%, accuracy of 86.8–89.5% and kappa index of 0.7–0.8 compared to consensus PCR reports of the 16 good performing tests and 63–69%, 100%, 71.4–76.2% and 0.4–0.5, respectively compared to serodiagnosis. Method LbD2 used solvent extraction followed by Sybr-Green based Real time PCR targeted to Sat-DNA; method LbD3 used solvent DNA extraction followed by conventional PCR targeted to Sat-DNA. The third method (LbF1) used glass fiber column based DNA extraction followed by TaqMan Real Time PCR targeted to Sat-DNA (cruzi 1/cruzi 2 and cruzi 3 TaqMan probe) and the fourth method (LbQ) used solvent DNA extraction followed by conventional hot-start PCR targeted to kDNA (primer pairs 121/122). These four methods were further evaluated at the coordinating laboratory in a subset of human blood samples, confirming the performance obtained by the participating laboratories. Conclusion/Significance This study represents a first crucial step towards international validation of PCR procedures for detection of T. cruzi in human blood samples. PMID:21264349

  9. Sensitive and specific detection of potentially allergenic almond (Prunus dulcis) in complex food matrices by Taqman(®) real-time polymerase chain reaction in comparison to commercially available protein-based enzyme-linked immunosorbent assay.

    PubMed

    Röder, Martin; Vieths, Stefan; Holzhauser, Thomas

    2011-01-24

    Currently, causative immunotherapies are lacking in food allergy. The only option to prevent allergic reactions in susceptible individuals is to strictly avoid the offending food. Thus, reliable labelling of allergenic constituents is of major importance, but can only be achieved if appropriate specific and sensitive detection techniques for foods with allergenic potential are available. Almond is an allergenic food that requires mandatory labelling on prepackaged foods and belongs to the genus Prunus. Species of this genus are phylogenetically closely related. We observed commercially available almond specific ELISA being highly cross-reactive with other foods of the Prunoideae family, resulting in a false-positive detection of up to 500,000 mg kg(-1) almond. Previously published PCR methods were reported to be cross-reactive with false positive results >1200 mg kg(-1). We describe the development of a novel almond specific real-time PCR, based on mutated mismatch primers and sequence specific Taqman(®) probe detection, in comparison with two quantitative commercially available ELISA. PCR sensitivity was investigated with chocolate, chocolate coating and cookies spiked between 5 and 100,000 mg kg(-1) almond. In all matrices almond was reproducibly detected by real-time PCR at the lowest spike level of 5 mg kg(-1). Further, between 100 and 100,000 mg kg(-1) spiked almond, the method featured good correlation between quantified copy numbers and the amount of spiked almond. Within this range a similar relation between detectable signal and amount of almond was observed for both PCR and ELISA. In contrast to ELISA the Taqman(®) real-time PCR method was highly specific in 59 food items with negligible cross-reactivity for a very limited number of Prunoideae foods. The real-time PCR analysis of 24 retail samples was in concordance with ELISA results: 21% (n=5) contained undeclared almond. This is the first completely disclosed real-time PCR method for a specific and potentially quantitative almond detection. This PCR method detects almond at a level where severe allergic reactions should not be expected for the majority of the almond allergic individuals. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Evaluation of the PCR method for identification of Bifidobacterium species.

    PubMed

    Youn, S Y; Seo, J M; Ji, G E

    2008-01-01

    Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

  11. TaqMan based real time PCR assay targeting EML4-ALK fusion transcripts in NSCLC.

    PubMed

    Robesova, Blanka; Bajerova, Monika; Liskova, Kvetoslava; Skrickova, Jana; Tomiskova, Marcela; Pospisilova, Sarka; Mayer, Jiri; Dvorakova, Dana

    2014-07-01

    Lung cancer with the ALK rearrangement constitutes only a small fraction of patients with non-small cell lung cancer (NSCLC). However, in the era of molecular-targeted therapy, efficient patient selection is crucial for successful treatment. In this context, an effective method for EML4-ALK detection is necessary. We developed a new highly sensitive variant specific TaqMan based real time PCR assay applicable to RNA from formalin-fixed paraffin-embedded tissue (FFPE). This assay was used to analyze the EML4-ALK gene in 96 non-selected NSCLC specimens and compared with two other methods (end-point PCR and break-apart FISH). EML4-ALK was detected in 33/96 (34%) specimens using variant specific real time PCR, whereas in only 23/96 (24%) using end-point PCR. All real time PCR positive samples were confirmed with direct sequencing. A total of 46 specimens were subsequently analyzed by all three detection methods. Using variant specific real time PCR we identified EML4-ALK transcript in 17/46 (37%) specimens, using end-point PCR in 13/46 (28%) specimens and positive ALK rearrangement by FISH was detected in 8/46 (17.4%) specimens. Moreover, using variant specific real time PCR, 5 specimens showed more than one EML4-ALK variant simultaneously (in 2 cases the variants 1+3a+3b, in 2 specimens the variants 1+3a and in 1 specimen the variant 1+3b). In one case of 96 EML4-ALK fusion gene and EGFR mutation were detected. All simultaneous genetic variants were confirmed using end-point PCR and direct sequencing. Our variant specific real time PCR assay is highly sensitive, fast, financially acceptable, applicable to FFPE and seems to be a valuable tool for the rapid prescreening of NSCLC patients in clinical practice, so, that most patients able to benefit from targeted therapy could be identified. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.

    PubMed

    Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R

    2001-04-01

    A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.

  13. An immunomagnetic separation-real-time PCR system for the detection of Alicyclobacillus acidoterrestris in fruit products.

    PubMed

    Wang, Zhouli; Cai, Rui; Yuan, Yahong; Niu, Chen; Hu, Zhongqiu; Yue, Tianli

    2014-04-03

    Alicyclobacillus acidoterrestris is the most important spoilage species within the Alicyclobacillus genus and has become a major issue in the pasteurized fruit juice industry. The aim of this study was to develop a method combining immunomagnetic separation (IMS) with real-time PCR system (IMS-PCR) for rapid and specific detection of A. acidoterrestris in fruit products. A real-time PCR with the TaqMan system was designed to target the 16S rDNA genes with specific primer and probe set. The specificity of the assay was confirmed using 9 A. acidoterrestris strains and 21 non-A. acidoterrestris strains. The results indicated that no combination of the designed primers and probe was found in any Alicyclobacillus genus except A. acidoterrestris. The detection limit of the established IMS-PCR was less than 10CFU/mL and the testing process was accomplished in 2-3h. For the three types of samples (sterile water, apple juice and kiwi juice), the correlation coefficient of standard curves was greater than 0.991, and the calculated PCR efficiencies were from 108% to 109%. As compared with the standard culture method performed concurrently on the same set of samples, the sensitivity, specificity and accuracy of IMS-PCR for 196 naturally contaminated fruit products were 90.0%, 98.3% and 97.5%, respectively. The results exhibited that the proposed IMS-PCR method was effective for the rapid detection of A. acidoterrestris in fruit products. Copyright © 2014. Published by Elsevier B.V.

  14. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    PubMed

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  15. [Comparative analysis between diatom nitric acid digestion method and plankton 16S rDNA PCR method].

    PubMed

    Han, Jun-ge; Wang, Cheng-bao; Li, Xing-biao; Fan, Yan-yan; Feng, Xiang-ping

    2013-10-01

    To compare and explore the application value of diatom nitric acid digestion method and plankton 16S rDNA PCR method for drowning identification. Forty drowning cases from 2010 to 2011 were collected from Department of Forensic Medicine of Wenzhou Medical University. Samples including lung, kidney, liver and field water from each case were tested with diatom nitric acid digestion method and plankton 16S rDNA PCR method, respectively. The Diatom nitric acid digestion method and plankton 16S rDNA PCR method required 20 g and 2 g of each organ, and 15 mL and 1.5 mL of field water, respectively. The inspection time and detection rate were compared between the two methods. Diatom nitric acid digestion method mainly detected two species of diatoms, Centriae and Pennatae, while plankton 16S rDNA PCR method amplified a length of 162 bp band. The average inspection time of each case of the Diatom nitric acid digestion method was (95.30 +/- 2.78) min less than (325.33 +/- 14.18) min of plankton 16S rDNA PCR method (P < 0.05). The detection rates of two methods for field water and lung were both 100%. For liver and kidney, the detection rate of plankton 16S rDNA PCR method was both 80%, higher than 40% and 30% of diatom nitric acid digestion method (P < 0.05), respectively. The laboratory testing method needs to be appropriately selected according to the specific circumstances in the forensic appraisal of drowning. Compared with diatom nitric acid digestion method, plankton 16S rDNA PCR method has practice values with such advantages as less quantity of samples, huge information and high specificity.

  16. Evaluation of a sensitive reverse transcription PCR-enzymelinked immunosorbent assay for detection of hepatitis A virus in oysters (Saccostrea glomerata) on the east coast of the Gulf of Thailand.

    PubMed

    Intamaso, Uraiwan; Ketkhunthod, Sitthisak

    2014-05-01

    Hepatitis A virus (HAV) contamination in food can lead to major health problems. We developed a combination reverse transcription (RT) PCR method plus enzyme-linked immunosorbent assay (ELISA) to detect HAV in fresh oysters harvested along the east coast of the Gulf of Thailand. Viral nucleic acid was extracted via the glycine-arginine-polyethylene glycol method followed by RT-PCR amplification with specifically designed primers against HAV and an ELISA to detect the digoxigenin-labeled RT-PCR products. The ELISA in concert with the RT-PCR protocol further increased the detection sensitivity by 100-fold for the HAV genome and 10-fold in artificially contaminated oysters. The overall sensitivity of the RT-PCR in combination with the ELISA was 31.88 pg and 16 PFU/g, respectively. The ELISA increases the specificity of the RT-PCR assay for detecting naturally occurring HAV in oysters. This combined RT-PCR-ELISA approach is a practical and sensitive method for HAV detection and can be utilized in routine screening for HAV in shellfish.

  17. Digital detection of multiple minority mutants in stool DNA for noninvasive colorectal cancer diagnosis.

    PubMed

    Deng, Lili; Qi, Zongtai; Zou, Binjie; Wu, Haiping; Huang, Huan; Kajiyama, Tomoharu; Kambara, Hideki; Zhou, Guohua

    2012-07-03

    Somatic mutations in stool DNA are quite specific to colorectal cancer (CRC), but a method being able to detect the extraordinarily low amounts of mutants is challengeable in sensitivity. We proposed a hydrogel bead-array to digitally count CRC-specific mutants in stool at a low cost. At first, multiplex amplification of targets containing multiple mutation loci of interest is carried out by a target enriched multiplex PCR (Tem-PCR), yielding the templates qualified for emulsion PCR (emPCR). Then, after immobilizing the beads from emPCR on a glass surface, the incorporation of Cy3-dUTP into the mutant-specific probes, which are specifically hybridized with the amplified beads from emPCR, is used to color the beads coated with mutants. As all amplified beads are hybridized with the Cy5-labeled universal probe, a mutation rate is readily obtained by digitally counting the beads with different colors (yellow and red). A high specificity of the method is achieved by removing the mismatched probes in a bead-array with electrophoresis. The approach has been used to simultaneously detect 8 mutation loci within the APC, TP53, and KRAS genes in stools from eight CRC patients, and 50% of CRC patients were positively diagnosed; therefore, our method can be a potential tool for the noninvasive diagnosis of CRC.

  18. Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

    PubMed

    Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

    2018-01-01

    Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  19. New, Improved Version of the mCOP-PCR Screening System for Detection of Spinal Muscular Atrophy Gene (SMN1) Deletion.

    PubMed

    Shinohara, Masakazu; Ar Rochmah, Mawaddah; Nakanishi, Kenta; Harahap, Nur Imma Fatimah; Niba, Emma Tabe Eko; Saito, Toshio; Saito, Kayoko; Takeuchi, Atsuko; Bouike, Yoshihiro; Nishio, Hisahide

    2017-09-07

    Spinal muscular atrophy (SMA) is a frequent autosomal recessive disorder, characterized by lower motor neuron loss in the spinal cord. More than 95% of SMA patients show homozygous survival motor neuron 1 (SMN1) deletion. We previously developed a screening system for SMN1 deletion based on a modified competitive oligonucleotide priming-PCR (mCOP-PCR) technique. However, non-specific amplification products were observed with mCOP-PCR, which might lead to erroneous interpretation of the screening results. To establish an improved version of the mCOP-PCR screening system without non-specific amplification. DNA samples were assayed using a new version of the mCOP-PCR screening system. DNA samples had already been genotyped by PCR-restriction fragment length polymorphism (PCR-RFLP), showing the presence or absence of SMN1 exon 7. The new mCOP-PCR method contained a targeted pre-amplification step of the region, including an SMN1-specific nucleotide, prior to the mCOP-PCR step. mCOP-PCR products were electrophoresed on agarose gels. No non-specific amplification products were detected in electrophoresis gels with the new mCOP-PCR screening system. An additional targeted pre-amplification step eliminated non-specific amplification from mCOP-PCR screening.

  20. Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.

    PubMed

    Kageyama, A; Benno, Y

    2001-01-01

    PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.

  1. Development and comparison of a real-time PCR assay for detection of Dichelobacter nodosus with culturing and conventional PCR: harmonisation between three laboratories

    PubMed Central

    2012-01-01

    Background Ovine footrot is a contagious disease with worldwide occurrence in sheep. The main causative agent is the fastidious bacterium Dichelobacter nodosus. In Scandinavia, footrot was first diagnosed in Sweden in 2004 and later also in Norway and Denmark. Clinical examination of sheep feet is fundamental to diagnosis of footrot, but D. nodosus should also be detected to confirm the diagnosis. PCR-based detection using conventional PCR has been used at our institutes, but the method was laborious and there was a need for a faster, easier-to-interpret method. The aim of this study was to develop a TaqMan-based real-time PCR assay for detection of D. nodosus and to compare its performance with culturing and conventional PCR. Methods A D. nodosus-specific TaqMan based real-time PCR assay targeting the 16S rRNA gene was designed. The inclusivity and exclusivity (specificity) of the assay was tested using 55 bacterial and two fungal strains. To evaluate the sensitivity and harmonisation of results between different laboratories, aliquots of a single DNA preparation were analysed at three Scandinavian laboratories. The developed real-time PCR assay was compared to culturing by analysing 126 samples, and to a conventional PCR method by analysing 224 samples. A selection of PCR-products was cloned and sequenced in order to verify that they had been identified correctly. Results The developed assay had a detection limit of 3.9 fg of D. nodosus genomic DNA. This result was obtained at all three laboratories and corresponds to approximately three copies of the D. nodosus genome per reaction. The assay showed 100% inclusivity and 100% exclusivity for the strains tested. The real-time PCR assay found 54.8% more positive samples than by culturing and 8% more than conventional PCR. Conclusions The developed real-time PCR assay has good specificity and sensitivity for detection of D. nodosus, and the results are easy to interpret. The method is less time-consuming than either culturing or conventional PCR. PMID:22293440

  2. Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification

    PubMed Central

    Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.

    2016-01-01

    Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522

  3. Allele-specific methylated multiplex real-time quantitative PCR (ASMM RTQ-PCR), a powerful method for diagnosing loss of imprinting of the 11p15 region in Russell Silver and Beckwith Wiedemann syndromes.

    PubMed

    Azzi, Salah; Steunou, Virginie; Rousseau, Alexandra; Rossignol, Sylvie; Thibaud, Nathalie; Danton, Fabienne; Le Jule, Marilyne; Gicquel, Christine; Le Bouc, Yves; Netchine, Irène

    2011-02-01

    Many human syndromes involve a loss of imprinting (LOI) due to a loss (LOM) or a gain of DNA methylation (GOM). Most LOI occur as mosaics and can therefore be difficult to detect with conventional methods. The human imprinted 11p15 region is crucial for the control of fetal growth, and LOI at this locus is associated with two clinical disorders with opposite phenotypes: Beckwith-Wiedemann syndrome (BWS), characterized by fetal overgrowth and a high risk of tumors, and Russell-Silver syndrome (RSS), characterized by intrauterine and postnatal growth restriction. Until recently, we have been using Southern blotting for the diagnosis of RSS and BWS. We describe here a powerful quantitative technique, allele-specific methylated multiplex real-time quantitative PCR (ASMM RTQ-PCR), for the diagnosis of these two complex disorders. We first checked the specificity of the probes and primers used for ASMM RTQ-PCR. We then carried out statistical validation for this method, on both retrospective and prospective populations of patients. This analysis demonstrated that ASMM RTQ-PCR is more sensitive than Southern blotting for detecting low degree of LOI. Moreover, ASMM RTQ-PCR is a very rapid, reliable, simple, safe, and cost effective method. © 2011 Wiley-Liss, Inc.

  4. [A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

    PubMed

    Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

    2015-04-01

    To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

  5. Amplification of Mycoplasma haemofelis DNA by a PCR for point-of-care use.

    PubMed

    Hawley, Jennifer; Yaaran, Tal; Maurice, Sarah; Lappin, Michael R

    2018-01-01

    We compared a qualitative in-clinic (IC)-PCR for the detection of Mycoplasma haemofelis DNA with the results of a commercial qualitative laboratory-based, conventional (c)PCR. In order to determine the specificity of both tests, Bartonella spp. samples were included. Forty-three previously tested blood samples with known PCR results for hemoplasmas and Bartonella spp. were selected. The samples were split between 2 laboratories. At the first laboratory, DNA was purified and run on 2 cPCR assays for the detection of hemoplasmas and Bartonella spp. At the second laboratory, DNA was purified using 2 purification protocols and both run in the IC-PCR assay. The cPCR results confirmed that 18 samples were positive for M. haemofelis, 5 for ' Candidatus M. haemominutum', 8 for Bartonella henselae, 2 for Bartonella clarridgeiae, and 10 were negative for both genera. No mixed infections were observed. The IC-PCR assay for the detection of M. haemofelis had a sensitivity of 94.4% and specificity of 96%, when using the same DNA purification method as the first laboratory. Using the second purification method, the sensitivity of the IC-PCR assay was 77.8% and specificity was 96%. Bartonella species were not detected by the IC-PCR M. haemofelis assay. The IC-PCR assay decreased the amount of time to final result compared to a cPCR assay.

  6. Molecular differentiation of Russian wild ginseng using mitochondrial nad7 intron 3 region.

    PubMed

    Li, Guisheng; Cui, Yan; Wang, Hongtao; Kwon, Woo-Saeng; Yang, Deok-Chun

    2017-07-01

    Cultivated ginseng is often introduced as a substitute and adulterant of Russian wild ginseng due to its lower cost or misidentification caused by similarity in appearance with wild ginseng. The aim of this study is to develop a simple and reliable method to differentiate Russian wild ginseng from cultivated ginseng. The mitochondrial NADH dehydrogenase subunit 7 ( nad 7) intron 3 regions of Russian wild ginseng and Chinese cultivated ginseng were analyzed. Based on the multiple sequence alignment result, a specific primer for Russian wild ginseng was designed by introducing additional mismatch and allele-specific polymerase chain reaction (PCR) was performed for identification of wild ginseng. Real-time allele-specific PCR with endpoint analysis was used for validation of the developed Russian wild ginseng single nucleotide polymorphism (SNP) marker. An SNP site specific to Russian wild ginseng was exploited by multiple alignments of mitochondrial nad 7 intron 3 regions of different ginseng samples. With the SNP-based specific primer, Russian wild ginseng was successfully discriminated from Chinese and Korean cultivated ginseng samples by allele-specific PCR. The reliability and specificity of the SNP marker was validated by checking 20 individuals of Russian wild ginseng samples with real-time allele-specific PCR assay. An effective DNA method for molecular discrimination of Russian wild ginseng from Chinese and Korean cultivated ginseng was developed. The established real-time allele-specific PCR was simple and reliable, and the present method should be a crucial complement of chemical analysis for authentication of Russian wild ginseng.

  7. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    PubMed

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  8. VIRUS ISOLATION AND MOLECULAR DETECTION OF BLUETONGUE AND EPIZOOTIC HEMORRHAGIC DISEASE VIRUSES FROM NATURALLY INFECTED WHITE-TAILED DEER (ODOCOILEUS VIRGINIANUS).

    PubMed

    Kienzle, Clara; Poulson, Rebecca L; Ruder, Mark G; Stallknecht, David E

    2017-10-01

    Hemorrhagic disease in North America is caused by multiple serotypes of epizootic hemorrhagic disease virus (EHDV) and bluetongue virus (BTV). Diagnostic tests for detection of EHDV and BTV include virus isolation (VI), reverse transcriptase (RT)-PCR, and real-time RT-PCR (rRT-PCR). Our objective was to compare the diagnostic capabilities of three rRT-PCR protocols for detection of EHDV and BTV from naturally infected white-tailed deer (Odocoileus virginianus). We compared the effectiveness of these assays to traditional viral detection methods (e.g., VI) for historic and current clinical cases. Because of the variable nature of tissue collection and storage before diagnostic testing, an evaluation of viral persistence on multiple freeze-thaw events was also conducted. Two of the rRT-PCR assays provided for reliable detection of EHDV and BTV from 100% of clinically affected and VI-confirmed infected animals. Additionally, no significant change in viral titer was observed on multiple freeze-thaw events.

  9. A PCR primer bank for quantitative gene expression analysis.

    PubMed

    Wang, Xiaowei; Seed, Brian

    2003-12-15

    Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

  10. [Molecular authentication of Jinyinhua formula granule by using allele-specific PCR].

    PubMed

    Jiang, Chao; Tu, Li-Chan; Yuan, Yuan; Huang, Lu-Qi; Gao, Wei; Jin, Yan

    2017-07-01

    Traditional authentication method is hard to identify herb's authenticity of traditional Chinese medicine(TCM) formula granules because they have lost all their morphological characteristics. In this study, a new allele-specific PCR method was established for identifying the authentication of Jinyinhua formula granule (made from Lonicerae Japonicae Flos) based on an SNP site in trnL-trnF fragment. Genomic DNA was successfully extracted from Lonicerae Japonicae Flos and its formula granules by using an improved spin column method and then PCR was performed with the designed primer. Approximately 110 bp specific bands was obtained only in the authentic Lonicerae Japonicae Flos and its formula granules, while no bands were found in fake mixed products. In addition, the PCR product sequence was proved from Lonicerae Japonicae Flos trnL-trnF sequence by using BLAST method. Therefore, DNA molecular authentication method could make up the limitations of character identification method and microscopic identification, and quickly identify herb's authenticity of TCM formula granules, with enormous potential for market supervision and quality control. Copyright© by the Chinese Pharmaceutical Association.

  11. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  12. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms

    PubMed Central

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-01-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called ‘rain’. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based ‘experience matrix’ that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event. PMID:27077048

  13. Optimization of digital droplet polymerase chain reaction for quantification of genetically modified organisms.

    PubMed

    Gerdes, Lars; Iwobi, Azuka; Busch, Ulrich; Pecoraro, Sven

    2016-03-01

    Digital PCR in droplets (ddPCR) is an emerging method for more and more applications in DNA (and RNA) analysis. Special requirements when establishing ddPCR for analysis of genetically modified organisms (GMO) in a laboratory include the choice between validated official qPCR methods and the optimization of these assays for a ddPCR format. Differentiation between droplets with positive reaction and negative droplets, that is setting of an appropriate threshold, can be crucial for a correct measurement. This holds true in particular when independent transgene and plant-specific reference gene copy numbers have to be combined to determine the content of GM material in a sample. Droplets which show fluorescent units ranging between those of explicit positive and negative droplets are called 'rain'. Signals of such droplets can hinder analysis and the correct setting of a threshold. In this manuscript, a computer-based algorithm has been carefully designed to evaluate assay performance and facilitate objective criteria for assay optimization. Optimized assays in return minimize the impact of rain on ddPCR analysis. We developed an Excel based 'experience matrix' that reflects the assay parameters of GMO ddPCR tests performed in our laboratory. Parameters considered include singleplex/duplex ddPCR, assay volume, thermal cycler, probe manufacturer, oligonucleotide concentration, annealing/elongation temperature, and a droplet separation evaluation. We additionally propose an objective droplet separation value which is based on both absolute fluorescence signal distance of positive and negative droplet populations and the variation within these droplet populations. The proposed performance classification in the experience matrix can be used for a rating of different assays for the same GMO target, thus enabling employment of the best suited assay parameters. Main optimization parameters include annealing/extension temperature and oligonucleotide concentrations. The droplet separation value allows for easy and reproducible assay performance evaluation. The combination of separation value with the experience matrix simplifies the choice of adequate assay parameters for a given GMO event.

  14. Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

    PubMed Central

    2011-01-01

    Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer cell lines. Conclusions Deep transcriptional sequencing and analysis with targeted and spliced alignment methods can effectively identify TIC events across the genome in individual tissues. Prostate and reference samples exhibit a wide range of TIC events, involving more genes than estimated previously using ESTs. Tissue specificity of TIC events is correlated with expression patterns of the upstream gene. Some TIC events, such as MSMB-NCOA4, may play functional roles in cancer. PMID:21261984

  15. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    PubMed

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  16. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    PubMed

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  17. Inter-laboratory analysis of selected genetically modified plant reference materials with digital PCR.

    PubMed

    Dobnik, David; Demšar, Tina; Huber, Ingrid; Gerdes, Lars; Broeders, Sylvia; Roosens, Nancy; Debode, Frederic; Berben, Gilbert; Žel, Jana

    2018-01-01

    Digital PCR (dPCR), as a new technology in the field of genetically modified (GM) organism (GMO) testing, enables determination of absolute target copy numbers. The purpose of our study was to test the transferability of methods designed for quantitative PCR (qPCR) to dPCR and to carry out an inter-laboratory comparison of the performance of two different dPCR platforms when determining the absolute GM copy numbers and GM copy number ratio in reference materials certified for GM content in mass fraction. Overall results in terms of measured GM% were within acceptable variation limits for both tested dPCR systems. However, the determined absolute copy numbers for individual genes or events showed higher variability between laboratories in one third of the cases, most possibly due to variability in the technical work, droplet size variability, and analysis of the raw data. GMO quantification with dPCR and qPCR was comparable. As methods originally designed for qPCR performed well in dPCR systems, already validated qPCR assays can most generally be used for dPCR technology with the purpose of GMO detection. Graphical abstract The output of three different PCR-based platforms was assessed in an inter-laboratory comparison.

  18. Comparison of two PCR-based methods and automated DNA sequencing for prop-1 genotyping in Ames dwarf mice.

    PubMed

    Gerstner, Arpad; DeFord, James H; Papaconstantinou, John

    2003-07-25

    Ames dwarfism is caused by a homozygous single nucleotide mutation in the pituitary specific prop-1 gene, resulting in combined pituitary hormone deficiency, reduced growth and extended lifespan. Thus, these mice serve as an important model system for endocrinological, aging and longevity studies. Because the phenotype of wild type and heterozygous mice is undistinguishable, it is imperative for successful breeding to accurately genotype these animals. Here we report a novel, yet simple, approach for prop-1 genotyping using PCR-based allele-specific amplification (PCR-ASA). We also compare this method to other potential genotyping techniques, i.e. PCR-based restriction fragment length polymorphism analysis (PCR-RFLP) and fluorescence automated DNA sequencing. We demonstrate that the single-step PCR-ASA has several advantages over the classical PCR-RFLP because the procedure is simple, less expensive and rapid. To further increase the specificity and sensitivity of the PCR-ASA, we introduced a single-base mismatch at the 3' penultimate position of the mutant primer. Our results also reveal that the fluorescence automated DNA sequencing has limitations for detecting a single nucleotide polymorphism in the prop-1 gene, particularly in heterozygotes.

  19. Development and validation of a real-time PCR assay for the detection of Toxoplasma gondii DNA in animal and meat samples.

    PubMed

    Marino, Anna Maria Fausta; Percipalle, Maurizio; Giunta, Renato Paolo; Salvaggio, Antonio; Caracappa, Giulia; Alfonzetti, Tiziana; Aparo, Alessandra; Reale, Stefano

    2017-03-01

    We report a rapid and reliable method for the detection of Toxoplasma gondii in meat and animal tissues based on real-time polymerase chain reaction (PCR). Samples were collected from cattle, small ruminants, horses, and pigs raised or imported into Sicily, Italy. All DNA preparations were assayed by real-time PCR tests targeted to a 98-bp long fragment in the AF 529-bp repeat element and to the B1 gene using specific primers. Diagnostic sensitivity (100%), diagnostic specificity (100%), limit of detection (0.01 pg), efficiency (92-109%), and precision (mean coefficient of variation = 0.60%), repeatability (100%), reproducibility (100%), and robustness were evaluated using 240 DNA extracted samples (120 positives and 120 negative as per the OIE nested PCR method) from different matrices. Positive results were confirmed by the repetition of both real-time and nested PCR assays. Our study demonstrates the viability of a reliable, rapid, and specific real-time PCR on a large scale to monitor contamination with Toxoplasma cysts in meat and animal specimens. This validated method can be used for postmortem detection in domestic and wild animals and for food safety purposes.

  20. Effects of DNA extraction and purification methods on real-time quantitative PCR analysis of Roundup Ready soybean.

    PubMed

    Demeke, Tigst; Ratnayaka, Indira; Phan, Anh

    2009-01-01

    The quality of DNA affects the accuracy and repeatability of quantitative PCR results. Different DNA extraction and purification methods were compared for quantification of Roundup Ready (RR) soybean (event 40-3-2) by real-time PCR. DNA was extracted using cetylmethylammonium bromide (CTAB), DNeasy Plant Mini Kit, and Wizard Magnetic DNA purification system for food. CTAB-extracted DNA was also purified using the Zymo (DNA Clean & Concentrator 25 kit), Qtip 100 (Qiagen Genomic-Tip 100/G), and QIAEX II Gel Extraction Kit. The CTAB extraction method provided the largest amount of DNA, and the Zymo purification kit resulted in the highest percentage of DNA recovery. The Abs260/280 and Abs260/230 ratios were less than the expected values for some of the DNA extraction and purification methods used, indicating the presence of substances that could inhibit PCR reactions. Real-time quantitative PCR results were affected by the DNA extraction and purification methods used. Further purification or dilution of the CTAB DNA was required for successful quantification of RR soybean. Less variability of quantitative PCR results was observed among experiments and replications for DNA extracted and/or purified by CTAB, CTAB+Zymo, CTAB+Qtip 100, and DNeasy methods. Correct and repeatable results for real-time PCR quantification of RR soybean were achieved using CTAB DNA purified with Zymo and Qtip 100 methods.

  1. Clinical evaluation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Neisseria meningitidis in cerebrospinal fluid.

    PubMed

    Lee, DoKyung; Kim, Eun Jin; Kilgore, Paul E; Kim, Soon Ae; Takahashi, Hideyuki; Ohnishi, Makoto; Anh, Dang Duc; Dong, Bai Qing; Kim, Jung Soo; Tomono, Jun; Miyamoto, Shigehiko; Notomi, Tsugunori; Kim, Dong Wook; Seki, Mitsuko

    2015-01-01

    Neisseria meningitidis (Nm) is a leading causative agent of bacterial meningitis in humans. Traditionally, meningococcal meningitis has been diagnosed by bacterial culture. However, isolation of bacteria from patients' cerebrospinal fluid (CSF) is time consuming and sometimes yields negative results. Recently, polymerase chain reaction (PCR)-based diagnostic methods of detecting Nm have been considered the gold standard because of their superior sensitivity and specificity compared with culture. In this study, we developed a loop-mediated isothermal amplification (LAMP) method and evaluated its ability to detect Nm in cerebrospinal fluid (CSF). We developed a meningococcal LAMP assay (Nm LAMP) that targets the ctrA gene. The primer specificity was validated using 16 strains of N. meningitidis (serogroup A, B, C, D, 29-E, W-135, X, Y, and Z) and 19 non-N. meningitidis species. Within 60 min, the Nm LAMP detected down to ten copies per reaction with sensitivity 1000-fold more than that of conventional PCR. The LAMP assays were evaluated using a set of 1574 randomly selected CSF specimens from children with suspected meningitis collected between 1998 and 2002 in Vietnam, China, and Korea. The LAMP method was shown to be more sensitive than PCR methods for CSF samples (31 CSF samples were positive by LAMP vs. 25 by PCR). The detection rate of the LAMP method was substantially higher than that of the PCR method. In a comparative analysis of the PCR and LAMP assays, the clinical sensitivity, specificity, positive predictive value, and negative predictive value of the LAMP assay were 100%, 99.6%, 80.6%, and 100%, respectively. Compared to PCR, LAMP detected Nm with higher analytical and clinical sensitivity. This sensitive and specific LAMP method offers significant advantages for screening patients on a population basis and for diagnosis in clinical settings.

  2. Comparison of Conventional PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Arcobacter Species

    PubMed Central

    Wang, Xiaoyu; Seo, Dong Joo; Lee, Min Hwa

    2014-01-01

    This study aimed to develop a loop-mediated isothermal amplification (LAMP) method for the rapid detection of Arcobacter species. Specific primers targeting the 23S ribosomal RNA gene were used to detect Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii. The specificity of the LAMP primer set was assessed using DNA samples from a panel of Arcobacter and Campylobacter species, and the sensitivity was determined using serial dilutions of Arcobacter species cultures. LAMP showed a 10- to 1,000-fold-higher sensitivity than multiplex PCR, with a detection limit of 2 to 20 CFU per reaction in vitro. Whereas multiplex PCR showed cross-reactivity with Campylobacter species, the LAMP method developed in this study was more sensitive and reliable than conventional PCR or multiplex PCR for the detection of Arcobacter species. PMID:24478488

  3. Comparative analysis of techniques for detection of quiescent Botrytis cinerea in grapes by quantitative PCR

    USDA-ARS?s Scientific Manuscript database

    Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to quiescent Botrytis cinerea infections of grape berries identified some specific limitations. In this study, four DNA extraction methods, two tissue-grinding methods, two gra...

  4. Restriction-Site-Specific PCR as a Rapid Test To Detect Enterohemorrhagic Escherichia coli O157:H7 Strains in Environmental Samples

    PubMed Central

    Kimura, Richard; Mandrell, Robert E.; Galland, John C.; Hyatt, Doreene; Riley, Lee W.

    2000-01-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is an important food-borne pathogen in industrialized countries. We developed a rapid and simple test for detecting E. coli O157:H7 using a method based on restriction site polymorphisms. Restriction-site-specific PCR (RSS-PCR) involves the amplification of DNA fragments using primers based on specific restriction enzyme recognition sequences, without the use of endonucleases, to generate a set of amplicons that yield “fingerprint” patterns when resolved electrophoretically on an agarose gel. The method was evaluated in a blinded study of E. coli isolates obtained from environmental samples collected at beef cattle feedyards. The 54 isolates were all initially identified by a commonly used polyclonal antibody test as belonging to O157:H7 serotype. They were retested by anti-O157 and anti-H7 monoclonal antibody enzyme-linked immunosorbent assay (ELISA). The RSS-PCR method identified all 28 isolates that were shown to be E. coli O157:H7 by the monoclonal antibody ELISA as belonging to the O157:H7 serotype. Of the remaining 26 ELISA-confirmed non-O157:H7 strains, the method classified 25 strains as non-O157:H7. The specificity of the RSS-PCR results correlated better with the monoclonal antibody ELISA than with the polyclonal antibody latex agglutination tests. The RSS-PCR method may be a useful test to distinguish E. coli O157:H7 from a large number of E. coli isolates from environmental samples. PMID:10831431

  5. Model-based branching point detection in single-cell data by K-branches clustering

    PubMed Central

    Chlis, Nikolaos K.; Wolf, F. Alexander; Theis, Fabian J.

    2017-01-01

    Abstract Motivation The identification of heterogeneities in cell populations by utilizing single-cell technologies such as single-cell RNA-Seq, enables inference of cellular development and lineage trees. Several methods have been proposed for such inference from high-dimensional single-cell data. They typically assign each cell to a branch in a differentiation trajectory. However, they commonly assume specific geometries such as tree-like developmental hierarchies and lack statistically sound methods to decide on the number of branching events. Results We present K-Branches, a solution to the above problem by locally fitting half-lines to single-cell data, introducing a clustering algorithm similar to K-Means. These halflines are proxies for branches in the differentiation trajectory of cells. We propose a modified version of the GAP statistic for model selection, in order to decide on the number of lines that best describe the data locally. In this manner, we identify the location and number of subgroups of cells that are associated with branching events and full differentiation, respectively. We evaluate the performance of our method on single-cell RNA-Seq data describing the differentiation of myeloid progenitors during hematopoiesis, single-cell qPCR data of mouse blastocyst development, single-cell qPCR data of human myeloid monocytic leukemia and artificial data. Availability and implementation An R implementation of K-Branches is freely available at https://github.com/theislab/kbranches. Contact fabian.theis@helmholtz-muenchen.de Supplementary information Supplementary data are available at Bioinformatics online. PMID:28582478

  6. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

    PubMed Central

    Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

  7. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    PubMed

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  8. Characterization and application of a quantitative DNA marker that discriminates sex in Chinook salmon (Oncorhynchus tshawytscha)

    USGS Publications Warehouse

    Clifton, D.R.; Rodriguez, R.J.

    1997-01-01

    A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

  9. Characterization and application of a quantitative DNA marker that discriminates sex in chinook salmon (Oncorhynchus tshawytscha)

    USGS Publications Warehouse

    Clifton, D.R.; Rodriguez, R.J.

    1997-01-01

    A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

  10. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    PubMed

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  11. Comparison of 16S rDNA-based PCR and checkerboard DNA-DNA hybridisation for detection of selected endodontic pathogens.

    PubMed

    Siqueira, José F; Rôças, Isabela N; De Uzeda, Milton; Colombo, Ana P; Santos, Kátia R N

    2002-12-01

    Molecular methods have been used recently to investigate the bacteria encountered in human endodontic infections. The aim of the present study was to compare the ability of a 16S rDNA-based PCR assay and checkerboard DNA-DNA hybridisation in detecting Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Peptostreptococcus micros, Porphyromonas endodontalis, Por. gingivalis and Treponema denticola directly from clinical samples. Specimens were obtained from 50 cases of endodontic infections and the presence of the target species was investigated by whole genomic DNA probes and checkerboard DNA-DNA hybridisation or taxon-specific oligonucleotides with PCR assay. Prevalence of the target species was based on data obtained by each method. The sensitivity and specificity of each molecular method was compared with the data generated by the other method as the reference--a value of 1.0 representing total agreement with the chosen standard. The methods were also compared with regard to the prevalence values for each target species. Regardless of the detection method used, T. denticola, Por. gingivalis, Por. endodontalis and B. forsythus were the most prevalent species. If the checkerboard data for these four species were used as the reference, PCR detection sensitivities ranged from 0.53 to 1.0, and specificities from 0.5 to 0.88, depending on the target bacterial species. When PCR data for the same species were used as the reference, the detection sensitivities for the checkerboard method ranged from 0.17 to 0.73, and specificities from 0.75 to 1.0. Accuracy values ranged from 0.6 to 0.74. On the whole, matching results between the two molecular methods ranged from 60% to 97.5%, depending on the target species. The major discrepancies between the methods comprised a number of PCR-positive but checkerboard-negative results. Significantly higher prevalence figures for Por. endodontalis and T. denticola were observed after PCR assessment. There was no further significant difference between the methods with regard to detection of the other target species.

  12. Detection of Legionella pneumophila by PCR-ELISA method in industrial cooling tower water.

    PubMed

    Soheili, Majid; Nejadmoghaddam, Mohammad Reza; Babashamsi, Mohammad; Ghasemi, Jamileh; Jeddi Tehrani, Mahmood

    2007-11-15

    Water supply and Cooling Tower Water (CTW) are among the most common sources of Legionella pneumophila (LP) contamination. A nonradio active method is described to detect LP in industrial CTW samples. DNA was purified and amplified by nested -PCR with amplimers specific for the 16s rRNA gene of LP. The 5' end biotinylated oligomer probe was immobilized on sterptavidin B coated microtiter plates. The nested-PCR product was labeled with digoxigenin and then hybridized with 5'-biotinylated probes. The amplification products were detected by using proxidase-labled anti dioxygenin antibody in a colorimetric reaction. The assay detected LP present in 1 L of 5 CTW samples examined. All of the samples were Legionella positive in both culture and PCR-ELISA methods. The PCR-ELISA assay appears to exhibit high specificity and is a more rapid technique in comparison with bacterial culture method. Thus could prove suitable for use in the routine examination of industrial CTW contamination.

  13. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    PubMed

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  14. Detection of foodborne pathogens using microarray technology

    USDA-ARS?s Scientific Manuscript database

    Assays based on the polymerase chain reaction (PCR) are now accepted methods for rapidly confirming the presence or absence of specific pathogens in foods and other types of samples. Conventional PCR requires the use of agarose gel electrophoresis to detect the PCR product; whereas, real-time PCR c...

  15. Comparison of strategies for the isolation of PCR-compatible, genomic DNA from a municipal biogas plants.

    PubMed

    Weiss, Agnes; Jérôme, Valérie; Freitag, Ruth

    2007-06-15

    The goal of the project was the extraction of PCR-compatible genomic DNA representative of the entire microbial community from municipal biogas plant samples (mash, bioreactor content, process water, liquid fertilizer). For the initial isolation of representative DNA from the respective lysates, methods were used that employed adsorption, extraction, or precipitation to specifically enrich the DNA. Since no dedicated method for biogas plant samples was available, preference was given to kits/methods suited to samples that resembled either the bioreactor feed, e.g. foodstuffs, or those intended for environmental samples including wastewater. None of the methods succeeded in preparing DNA that was directly PCR-compatible. Instead the DNA was found to still contain considerable amounts of difficult-to-remove enzyme inhibitors (presumably humic acids) that hindered the PCR reaction. Based on the isolation method that gave the highest yield/purity for all sample types, subsequent purification was attempted by agarose gel electrophoresis followed by electroelution, spermine precipitation, or dialysis through nitrocellulose membrane. A combination of phenol/chloroform extraction followed by purification via dialysis constituted the most efficient sample treatment. When such DNA preparations were diluted 1:100 they did no longer inhibit PCR reactions, while they still contained sufficient genomic DNA to allow specific amplification of specific target sequences.

  16. Rapid Diagnosis of Bloodstream Infections with PCR Followed by Mass Spectrometry

    PubMed Central

    Jordana-Lluch, Elena; Carolan, Heather E.; Giménez, Montserrat; Sampath, Rangarajan; Ecker, David J.; Quesada, M. Dolores; Mòdol, Josep M.; Arméstar, Fernando; Blyn, Lawrence B.; Cummins, Lendell L.; Ausina, Vicente; Martró, Elisa

    2013-01-01

    Achieving a rapid microbiological diagnosis is crucial for decreasing morbidity and mortality of patients with a bloodstream infection, as it leads to the administration of an appropriate empiric antimicrobial therapy. Molecular methods may offer a rapid alternative to conventional microbiological diagnosis involving blood culture. In this study, the performance of a new technology that uses broad-spectrum PCR coupled with mass spectrometry (PCR/ESI-MS) was evaluated for the detection of microorganisms directly from whole blood. A total of 247 whole blood samples and paired blood cultures were prospectively obtained from 175 patients with a suspicion of sepsis. Both sample types were analyzed using the PCR/ESI-MS technology, and the results were compared with those obtained by conventional identification methods. The overall agreement between conventional methods and PCR/ESI-MS performed in blood culture aliquots was 94.2% with 96.8% sensitivity and 98.5% specificity for the molecular method. When comparing conventional methods with PCR/ESI-MS performed in whole blood specimens, the overall agreement was 77.1% with 50% sensitivity and 93.8% specificity for the molecular method. Interestingly, the PCR/ESI-MS technology led to the additional identification of 13 pathogens that were not found by conventional methods. Using the PCR/ESI-MS technology the microbiological diagnosis of bloodstream infections could be anticipated in about half of the patients in our setting, including a small but significant proportion of patients newly diagnosed. Thus, this promising technology could be very useful for the rapid diagnosis of sepsis in combination with traditional methods. PMID:23626775

  17. Development of a Highly Sensitive Nested-PCR Procedure Using a Single Closed Tube for Detection of Erwinia amylovora in Asymptomatic Plant Material

    PubMed Central

    Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.

    2000-01-01

    A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384

  18. Specific PCR Identification between Peucedanum praeruptorum and Angelica decursiva and Identification between Them and Adulterant Using DNA Barcode.

    PubMed

    Han, Bang-Xing; Yuan, Yuan; Huang, Lu-Qi; Zhao, Qun; Tan, Ling-Ling; Song, Xiang-Wen; He, Xiao-Mei; Xu, Tao; Liu, Feng; Wang, Jian

    2017-01-01

    The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva , respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required. The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu ( Peucedanum praeruptorum ), Zihuaqianhu ( Angelica decursiva ), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva . The ITS sequences of P. praeruptorum , A. decursiva , and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva , respectively. The amplification conditions were optimized, and specific PCR products were obtained. The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs. The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant.Specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Abbreviations used: TCM: The traditional Chinese medicine, P.: Peucedanum , A.: Angelica , ITS: The internal transcribed spacer, PCR: Polymerase chain reaction, NCBI: National Center for Biotechnology Information, NI: Number of individuals, HN: Haplotype number; GAN: Gen Bank accession numbers, L.: Ligusticum , O.: Ostericum , A.: Angelica , P.: Pimpinella , BI: Bayesian inference, MP: Maximum parsimony, AIC: Akaike Information Criterion, MCMC: Markov Chains Monte Carlo, TBR: Tree bisection-reconnection, LPP: Length of PCR product, PRP: PCR reaction procedure, SNP: Single nucleotide polymorphisms, PP: Posterior probability, BS: Bootstrap.Qun Zhao.

  19. PCR method of detecting pork in foods for verifying allergen labeling and for identifying hidden pork ingredients in processed foods.

    PubMed

    Tanabe, Soichi; Miyauchi, Eiji; Muneshige, Akemi; Mio, Kazuhiro; Sato, Chikara; Sato, Masahiko

    2007-07-01

    A PCR method to detect porcine DNA was developed for verifying the allergen labeling of foods and for identifying hidden pork ingredients in processed foods. The primer pair, F2/R1, was designed to detect the gene encoding porcine cytochrome b for the specific detection of pork with high sensitivity. The amplified DNA fragment (130 bp) was specifically detected from porcine DNA, while no amplification occurred with other species such as cattle, chicken, sheep, and horse. When the developed PCR method was used for investigating commercial food products, porcine DNA was clearly detected in those containing pork in the list of ingredients. In addition, 100 ppb of pork in heated gyoza (pork and vegetable dumpling) could be detected by this method. This method is rapid, specific and sensitive, making it applicable for detecting trace amounts of pork in processed foods.

  20. Competitive allele-specific TaqMan PCR (Cast-PCR) is a sensitive, specific and fast method for BRAF V600 mutation detection in Melanoma patients

    PubMed Central

    Barbano, Raffaela; Pasculli, Barbara; Coco, Michelina; Fontana, Andrea; Copetti, Massimiliano; Rendina, Michelina; Valori, Vanna Maria; Graziano, Paolo; Maiello, Evaristo; Fazio, Vito Michele; Parrella, Paola

    2015-01-01

    BRAF codon 600 mutation testing of melanoma patients is mandatory for the choice of the most appropriate therapy in the clinical setting. Competitive allele specific TaqMan PCR (Cast-PCR) technology allows not only the selective amplification of minor alleles, but it also blocks the amplification of non-mutant allele. We genotyped codon 600 of the BRAF gene in 54 patients’ samples by Cast-PCR and bidirectional direct sequence analysis. All the mutations detected by sequencing were also identified by Cast-PCR. In addition, Cast-PCR assay detected four samples carrying mutations and was able to clearly identify two mutations of uncertain interpretation by Sanger sequencing. The limit of detection of Cast-PCR was evaluated by constructing dilution curves of BRAFV600E and BRAFV600K mutated clinical samples mixed with a not-mutated specimens. Both mutations could be detected until a 1:100 mutated/not mutated ratio. Cloning and sequencing of the clones was used to confirm mutations on representative discrepant cases. Cast PCR performances were not affected by intratumour heterogeneity, and less affected by melanin content. Our results indicate that Cast-PCR is a reliable diagnostic tool for the identification of melanoma patients as eligible to be treated with TKIs and might be implemented in the clinical setting as elective screening method. PMID:26690267

  1. Kinetic characterisation of primer mismatches in allele-specific PCR: a quantitative assessment.

    PubMed

    Waterfall, Christy M; Eisenthal, Robert; Cobb, Benjamin D

    2002-12-20

    A novel method of estimating the kinetic parameters of Taq DNA polymerase during rapid cycle PCR is presented. A model was constructed using a simplified sigmoid function to represent substrate accumulation during PCR in combination with the general equation describing high substrate inhibition for Michaelis-Menten enzymes. The PCR progress curve was viewed as a series of independent reactions where initial rates were accurately measured for each cycle. Kinetic parameters were obtained for allele-specific PCR (AS-PCR) amplification to examine the effect of mismatches on amplification. A high degree of correlation was obtained providing evidence of substrate inhibition as a major cause of the plateau phase that occurs in the later cycles of PCR.

  2. The use of digital PCR to improve the application of quantitative molecular diagnostic methods for tuberculosis.

    PubMed

    Devonshire, Alison S; O'Sullivan, Denise M; Honeyborne, Isobella; Jones, Gerwyn; Karczmarczyk, Maria; Pavšič, Jernej; Gutteridge, Alice; Milavec, Mojca; Mendoza, Pablo; Schimmel, Heinz; Van Heuverswyn, Fran; Gorton, Rebecca; Cirillo, Daniela Maria; Borroni, Emanuele; Harris, Kathryn; Barnard, Marinus; Heydenrych, Anthenette; Ndusilo, Norah; Wallis, Carole L; Pillay, Keshree; Barry, Thomas; Reddington, Kate; Richter, Elvira; Mozioğlu, Erkan; Akyürek, Sema; Yalçınkaya, Burhanettin; Akgoz, Muslum; Žel, Jana; Foy, Carole A; McHugh, Timothy D; Huggett, Jim F

    2016-08-03

    Real-time PCR (qPCR) based methods, such as the Xpert MTB/RIF, are increasingly being used to diagnose tuberculosis (TB). While qualitative methods are adequate for diagnosis, the therapeutic monitoring of TB patients requires quantitative methods currently performed using smear microscopy. The potential use of quantitative molecular measurements for therapeutic monitoring has been investigated but findings have been variable and inconclusive. The lack of an adequate reference method and reference materials is a barrier to understanding the source of such disagreement. Digital PCR (dPCR) offers the potential for an accurate method for quantification of specific DNA sequences in reference materials which can be used to evaluate quantitative molecular methods for TB treatment monitoring. To assess a novel approach for the development of quality assurance materials we used dPCR to quantify specific DNA sequences in a range of prototype reference materials and evaluated accuracy between different laboratories and instruments. The materials were then also used to evaluate the quantitative performance of qPCR and Xpert MTB/RIF in eight clinical testing laboratories. dPCR was found to provide results in good agreement with the other methods tested and to be highly reproducible between laboratories without calibration even when using different instruments. When the reference materials were analysed with qPCR and Xpert MTB/RIF by clinical laboratories, all laboratories were able to correctly rank the reference materials according to concentration, however there was a marked difference in the measured magnitude. TB is a disease where the quantification of the pathogen could lead to better patient management and qPCR methods offer the potential to rapidly perform such analysis. However, our findings suggest that when precisely characterised materials are used to evaluate qPCR methods, the measurement result variation is too high to determine whether molecular quantification of Mycobacterium tuberculosis would provide a clinically useful readout. The methods described in this study provide a means by which the technical performance of quantitative molecular methods can be evaluated independently of clinical variability to improve accuracy of measurement results. These will assist in ultimately increasing the likelihood that such approaches could be used to improve patient management of TB.

  3. A PCR detection method for rapid identification of Melissococcus pluton in honeybee larvae.

    PubMed

    Govan, V A; Brözel, V; Allsopp, M H; Davison, S

    1998-05-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae.

  4. A PCR Detection Method for Rapid Identification of Melissococcus pluton in Honeybee Larvae

    PubMed Central

    Govan, V. A.; Brözel, V.; Allsopp, M. H.; Davison, S.

    1998-01-01

    Melissococcus pluton is the causative agent of European foulbrood, a disease of honeybee larvae. This bacterium is particularly difficult to isolate because of its stringent growth requirements and competition from other bacteria. PCR was used selectively to amplify specific rRNA gene sequences of M. pluton from pure culture, from crude cell lysates, and directly from infected bee larvae. The PCR primers were designed from M. pluton 16S rRNA sequence data. The PCR products were visualized by agarose gel electrophoresis and confirmed as originating from M. pluton by sequencing in both directions. Detection was highly specific, and the probes did not hybridize with DNA from other bacterial species tested. This method enabled the rapid and specific detection and identification of M. pluton from pure cultures and infected bee larvae. PMID:9572987

  5. Identification of TCT, a novel knockdown resistance allele mutation and analysis of resistance detection methods in the voltage-gated Na⁺ channel of Culex pipiens pallens from Shandong Province, China.

    PubMed

    Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing

    2013-02-01

    The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.

  6. Sensitive and specific miRNA detection method using SplintR Ligase

    PubMed Central

    Jin, Jingmin; Vaud, Sophie; Zhelkovsky, Alexander M.; Posfai, Janos; McReynolds, Larry A.

    2016-01-01

    We describe a simple, specific and sensitive microRNA (miRNA) detection method that utilizes Chlorella virus DNA ligase (SplintR® Ligase). This two-step method involves ligation of adjacent DNA oligonucleotides hybridized to a miRNA followed by real-time quantitative PCR (qPCR). SplintR Ligase is 100X faster than either T4 DNA Ligase or T4 RNA Ligase 2 for RNA splinted DNA ligation. Only a 4–6 bp overlap between a DNA probe and miRNA was required for efficient ligation by SplintR Ligase. This property allows more flexibility in designing miRNA-specific ligation probes than methods that use reverse transcriptase for cDNA synthesis of miRNA. The qPCR SplintR ligation assay is sensitive; it can detect a few thousand molecules of miR-122. For miR-122 detection the SplintR qPCR assay, using a FAM labeled double quenched DNA probe, was at least 40× more sensitive than the TaqMan assay. The SplintR method, when coupled with NextGen sequencing, allowed multiplex detection of miRNAs from brain, kidney, testis and liver. The SplintR qPCR assay is specific; individual let-7 miRNAs that differ by one nucleotide are detected. The rapid kinetics and ability to ligate DNA probes hybridized to RNA with short complementary sequences makes SplintR Ligase a useful enzyme for miRNA detection. PMID:27154271

  7. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples.

    PubMed

    Stark, D; Al-Qassab, S E; Barratt, J L N; Stanley, K; Roberts, T; Marriott, D; Harkness, J; Ellis, J T

    2011-01-01

    The aim of this study was to describe the first development and evaluation of a multiplex tandem PCR (MT-PCR) assay for the detection and identification of 4 common pathogenic protozoan parasites, Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis, from human clinical samples. A total of 472 fecal samples submitted to the Department of Microbiology at St. Vincent's Hospital were included in the study. The MT-PCR assay was compared to four real-time PCR (RT-PCR) assays and microscopy by a traditional modified iron hematoxylin stain. The MT-PCR detected 28 G. intestinalis, 26 D. fragilis, 11 E. histolytica, and 9 Cryptosporidium sp. isolates. Detection and identification of the fecal protozoa by MT-PCR demonstrated 100% correlation with the RT-PCR results, and compared to RT-PCR, MT-PCR exhibited 100% sensitivity and specificity, while traditional microscopy of stained fixed fecal smears exhibited sensitivities and specificities of 56% and 100% for Cryptosporidium spp., 38% and 99% for D. fragilis, 47% and 97% for E. histolytica, and 50% and 100% for G. intestinalis. No cross-reactivity was detected in 100 stool samples containing various other bacterial, viral, and protozoan species. The MT-PCR assay was able to provide rapid, sensitive, and specific simultaneous detection and identification of the four most important diarrhea-causing protozoan parasites that infect humans. This study also highlights the lack of sensitivity demonstrated by microscopy, and thus, molecular methods such as MT-PCR must be considered the diagnostic methods of choice for enteric protozoan parasites.

  8. Evaluation of the IS6110 PCR assay for the rapid diagnosis of tuberculous meningitis

    PubMed Central

    Deshpande, Poonam S; Kashyap, Rajpal S; Ramteke, Sonali S; Nagdev, Khushboo J; Purohit, Hemant J; Taori, Girdhar M; Daginawala, Hatim F

    2007-01-01

    Background Tuberculous meningitis (TBM) is one of the common clinical manifestations of extra-pulmonary tuberculosis. It is difficult to diagnose due to a lack of rapid, sensitive, and specific tests. Newer methods, which are easy and reliable, are required to diagnose TBM at an early stage. Thus our aim was to evaluate the polymerase chain reaction (PCR) technique, using primers directed against the IS6110 gene, for the detection of Mycobacterium tuberculosis in the CSF, for the diagnosis of TBM patients. Methods An in-house IS6110 PCR method using a specific pair of primers designed to amplify the insertion sequence, IS6110, in the M. tuberculosis genome was used to analyze CSF. A total of 80 CSF samples from different groups of patients were studied (confirmed TBM n = 35, clinically suspected TBM n = 16, non-TBM infectious meningitis n = 12, non infectious neurological diseases n = 17). Results PCR gave a sensitivity of 91.4% and specificity of 75.9% for the diagnosis of TBM in patients with TBM confirmed by culture. In 16 clinically diagnosed, but unconfirmed, TBM cases PCR was positive in 10 (62.5%) cases. There were seven (24.1%) PCR-positive cases among the 29 patients with non-TBM and non-infectious neurological disease. Conclusion We conclude that the performance of an in-house IS6110 PCR assay is valuable in the rapid diagnosis of tuberculous meningitis. PMID:17976247

  9. New multiplex PCR methods for rapid screening of genetically modified organisms in foods

    PubMed Central

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products. PMID:26257724

  10. New multiplex PCR methods for rapid screening of genetically modified organisms in foods.

    PubMed

    Datukishvili, Nelly; Kutateladze, Tamara; Gabriadze, Inga; Bitskinashvili, Kakha; Vishnepolsky, Boris

    2015-01-01

    We present novel multiplex PCR methods for rapid and reliable screening of genetically modified organisms (GMOs). New designed PCR primers targeting four frequently used GMO specific sequences permitted identification of new DNA markers, in particular 141 bp fragment of cauliflower mosaic virus (CaMV) 35S promoter, 224 bp fragment of Agrobacterium tumefaciens nopaline synthase (NOS) terminator, 256 bp fragment of 5-enolppyruvylshikimate-phosphate synthase (epsps) gene and 258 bp fragment of Cry1Ab delta-endotoxin (cry1Ab) gene for GMO screening. The certified reference materials containing Roundup Ready soybean (RRS) and maize MON 810 were applied for the development and optimization of uniplex and multiplex PCR systems. Evaluation of amplification products by agarose gel electrophoresis using negative and positive controls confirmed high specificity and sensitivity at 0.1% GMO for both RRS and MON 810. The fourplex PCR was developed and optimized that allows simultaneous detection of three common transgenic elements, such as: CaMV 35S promoter, NOS terminator, epsps gene together with soybean-specific lectin gene. The triplex PCR developed enables simultaneous identification of transgenic elements, such as: 35S promoter and cry1Ab gene together with maize zein gene. The analysis of different processed foods demonstrated that multiplex PCR methods developed in this study are useful for accurate and fast screening of GM food products.

  11. Development of a novel hexa-plex PCR method for identification and serotyping of Salmonella species.

    PubMed

    Li, Ruichao; Wang, Yang; Shen, Jianzhong; Wu, Congming

    2014-01-01

    Salmonella is one of the most important foodborne pathogens, which causes a huge economic burden worldwide. To detect Salmonella rapidly is very meaningful in preventing salmonellosis and decreasing economic losses. Currently, isolation of Salmonella is confirmed by biochemical and serobased serotyping methods, which are time consuming, labor intensive, and complicated. To solve this problem, a hexa-plex polymerase chain reaction (PCR) method was developed using comparative genomics analysis and multiplex PCR technology to detect Salmonella and Salmonella Typhimurium, Salmonella Enteritidis, Salmonella Agona, Salmonella Choleraesuis, and Salmonella Pullorum simultaneously. The accuracy of this method was tested by a collection of 142 Salmonella. Furthermore, the strategy described in this article to mine serovar-specific fragments for Salmonella could be used to find specific fragments for other Salmonella serotypes and bacteria. The combination of this strategy and multiplex PCR is promising in the rapid identification of foodborne pathogens.

  12. Rapid Identification and Quantification of Aureococcus anophagefferens by qPCR Method (Taqman) in the Qinhuangdao Coastal Area: A Region for Recurrent Brown Tide Breakout in China.

    PubMed

    Wang, Li-Ping; Lei, Kun

    2016-12-01

    Since 2009, Aureococcus anophagefferens has caused brown tide to occur recurrently in Qinhuangdao coastal area, China. Because the algal cells of A. anophagefferens are so tiny (~3 µm) that it is very hard to identify exactly under a microscope for natural water samples, it is very urgent to develop a method for efficient and continuous monitoring. Here specific primers and Taqman probe are designed to develop a real-time quantitative PCR (qPCR) method for identification and quantification continually. The algal community and cell abundance of A. anophagefferens in the study area (E 119°20'-119°50' and N 39°30'-39°50') from April to October in 2013 are detected by pyrosequencing, and are used to validate the specification and precision of qPCR method for natural samples. Both pyrosequencing and qPCR shows that the targeted cells are present only in May, June and July, and the cell abundance are July > June > May. Although there are various algal species including dinoflagellata, diatom, Cryptomonadales, Chrysophyceae and Chlorophyta living in the natural seawater simultaneously, no disturbance happens to qPCR method. This qPCR method could detect as few as 10 targeted cells, indicating it is able to detect the algal cells at pre-bloom levels. Therefore, qPCR with Taqman probe provides a powerful and sensitive method to monitor the brown tide continually in Qinhuangdao coastal area, China. The results provide a necessary technology support for forecasting the brown tide initiation, in China.

  13. Direct PCR - A rapid method for multiplexed detection of different serotypes of Salmonella in enriched pork meat samples.

    PubMed

    Chin, Wai Hoe; Sun, Yi; Høgberg, Jonas; Quyen, Than Linh; Engelsmann, Pia; Wolff, Anders; Bang, Dang Duong

    2017-04-01

    Salmonellosis, an infectious disease caused by Salmonella spp., is one of the most common foodborne diseases. Isolation and identification of Salmonella by conventional bacterial culture method is time consuming. In response to the demand for rapid on line or at site detection of pathogens, in this study, we developed a multiplex Direct PCR method for rapid detection of different Salmonella serotypes directly from pork meat samples without any DNA purification steps. An inhibitor-resistant Phusion Pfu DNA polymerase was used to overcome PCR inhibition. Four pairs of primers including a pair of newly designed primers targeting Salmonella spp. at subtype level were incorporated in the multiplex Direct PCR. To maximize the efficiency of the Direct PCR, the ratio between sample and dilution buffer was optimized. The sensitivity and specificity of the multiplex Direct PCR were tested using naturally contaminated pork meat samples for detecting and subtyping of Salmonella spp. Conventional bacterial culture methods were used as reference to evaluate the performance of the multiplex Direct PCR. Relative accuracy, sensitivity and specificity of 98.8%; 97.6% and 100%, respectively, were achieved by the method. Application of the multiplex Direct PCR to detect Salmonella in pork meat at slaughter reduces the time of detection from 5 to 6 days by conventional bacterial culture and serotyping methods to 14 h (including 12 h enrichment time). Furthermore, the method poses a possibility of miniaturization and integration into a point-of-need Lab-on-a-chip system for rapid online pathogen detection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  15. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  16. Next-Generation Genotyping by Digital PCR to Detect and Quantify the BRAF V600E Mutation in Melanoma Biopsies.

    PubMed

    Lamy, Pierre-Jean; Castan, Florence; Lozano, Nicolas; Montélion, Cécile; Audran, Patricia; Bibeau, Frédéric; Roques, Sylvie; Montels, Frédéric; Laberenne, Anne-Claire

    2015-07-01

    The detection of the BRAF V600E mutation in melanoma samples is used to select patients who should respond to BRAF inhibitors. Different techniques are routinely used to determine BRAF status in clinical samples. However, low tumor cellularity and tumor heterogeneity can affect the sensitivity of somatic mutation detection. Digital PCR (dPCR) is a next-generation genotyping method that clonally amplifies nucleic acids and allows the detection and quantification of rare mutations. Our aim was to evaluate the clinical routine performance of a new dPCR-based test to detect and quantify BRAF mutation load in 47 paraffin-embedded cutaneous melanoma biopsies. We compared the results obtained by dPCR with high-resolution melting curve analysis and pyrosequencing or with one of the allele-specific PCR methods available on the market. dPCR showed the lowest limit of detection. dPCR and allele-specific amplification detected the highest number of mutated samples. For the BRAF mutation load quantification both dPCR and pyrosequencing gave similar results with strong disparities in allele frequencies in the 47 tumor samples under study (from 0.7% to 79% of BRAF V600E mutations/sample). In conclusion, the four methods showed a high degree of concordance. dPCR was the more-sensitive method to reliably and easily detect mutations. Both pyrosequencing and dPCR could quantify the mutation load in heterogeneous tumor samples. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. A rapid single-tube protocol for HAV detection by nested real-time PCR.

    PubMed

    Hu, Yuan; Arsov, Ivica

    2014-09-01

    Infections by food-borne viruses such as hepatitis A virus (HAV) and norovirus are significant public health concerns worldwide. Since food-borne viruses are rarely confirmed through direct isolation from contaminated samples, highly sensitive molecular techniques remain the methods of choice for the detection of viral genetic material. Our group has previously developed a specific nested real-time PCR (NRT-PCR) assay for HAV detection that improved overall sensitivity. Furthermore in this study, we have developed a single-tube NRT-PCR approach for HAV detection in food samples that reduces the likelihood of cross contamination between tubes during sample manipulation. HAV RNA was isolated from HAV-spiked food samples and HAV-infected cell cultures. All reactions following HAV RNA isolation, including conventional reverse transcriptase PCR, nested-PCR, and RT-PCR were performed in a single tube. Our results demonstrated that all the samples tested positive by RT-PCR and nested-PCR were also positive by a single-tube NRT-PCR. The detection limits observed for HAV-infected cell cultures and HAV-spiked green onions were 0.1 and 1 PFU, respectively. This novel method retained the specificity and robustness of the original NRT-PCR method, while greatly reducing sample manipulation, turnaround time, and the risk of carry-over contamination. Single-tube NRT-PCR thus represents a promising new tool that can potentially facilitate the detection of HAV in foods thereby improving food safety and public health.

  18. Microfluidics-based digital quantitative PCR for single-cell small RNA quantification.

    PubMed

    Yu, Tian; Tang, Chong; Zhang, Ying; Zhang, Ruirui; Yan, Wei

    2017-09-01

    Quantitative analyses of small RNAs at the single-cell level have been challenging because of limited sensitivity and specificity of conventional real-time quantitative PCR methods. A digital quantitative PCR (dqPCR) method for miRNA quantification has been developed, but it requires the use of proprietary stem-loop primers and only applies to miRNA quantification. Here, we report a microfluidics-based dqPCR (mdqPCR) method, which takes advantage of the Fluidigm BioMark HD system for both template partition and the subsequent high-throughput dqPCR. Our mdqPCR method demonstrated excellent sensitivity and reproducibility suitable for quantitative analyses of not only miRNAs but also all other small RNA species at the single-cell level. Using this method, we discovered that each sperm has a unique miRNA profile. © The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Trypanosomatidae: Phytomonas detection in plants and phytophagous insects by PCR amplification of a genus-specific sequence of the spliced leader gene.

    PubMed

    Serrano, M G; Nunes, L R; Campaner, M; Buck, G A; Camargo, E P; Teixeira, M M

    1999-03-01

    In this paper we describe a method for the detection of Phytomonas spp. from plants and phytophagous insects using the PCR technique by targeting a genus-specific sequence of the spliced leader (SL) gene. PCR amplification of DNA from 48 plant and insect isolates previously classified as Phytomonas by morphological, biochemical, and molecular criteria resulted in all cases in a 100-bp fragment that hybridized with the Phytomonas-specific spliced leader-derived probe SL3'. Moreover, this Phytomonas-specific PCR could also detect Phytomonas spp. in crude preparations of naturally infected plants and insects. This method shows no reaction with any other trypanosomatid genera or with plant and insect host DNA, revealing it to be able to detect Phytomonas spp. from fruit, latex, or phloem of various host plants as well as from salivary glands and digestive tubes of several species of insect hosts. Results demonstrated that SLPCR is a simple, fast, specific, and sensitive method that can be applied to the diagnosis of Phytomonas among cultured trypanosomatids and directly in plants and putative vector insects. Therefore, the method was shown to be a very specific and sensitive tool for diagnosis of Phytomonas without the need for isolation, culture, and DNA extraction of flagellates, a feature that is very convenient for practical and epidemiological purposes. Copyright 1999 Academic Press.

  20. A new QRT-PCR assay designed for the differentiation between elements provided from Agrobacterium sp. in GMOs plant events and natural Agrobacterium sp. bacteria.

    PubMed

    Nabi, Nesrine; Chaouachi, Maher; Zellama, Mohamed Salem; Ben Hafsa, Ahmed; Mrabet, Besma; Saïd, Khaled; Fathia, Harzallah Skhiri

    2016-04-01

    The question asked in the present work was how to differentiate between contamination of field samples with and GM plants contained sequences provided from this bacterium in order to avoid false positives in the frame of the detection and the quantification of GMO. For this, new set of primers and corresponding TaqMan Minor Groove Binder (MGB) probes were designed to target Agrobacterium sp. using the tumor-morphology-shooty gene (TMS1). Final standard curves were calculated for each pathogen by plotting the threshold cycle value against the bacterial number (log (colony forming units) per milliliter) via linear regression. The method designed was highly specific and sensitive, with a detection limit of 10CFU/ml. No significant cross-reaction was observed. Results from this study showed that TaqMan real-time PCR, is potentially an effective method for the rapid and reliable quantification of Agrobacterium sp. in samples containing GMO or non GMO samples. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. GMOMETHODS: the European Union database of reference methods for GMO analysis.

    PubMed

    Bonfini, Laura; Van den Bulcke, Marc H; Mazzara, Marco; Ben, Enrico; Patak, Alexandre

    2012-01-01

    In order to provide reliable and harmonized information on methods for GMO (genetically modified organism) analysis we have published a database called "GMOMETHODS" that supplies information on PCR assays validated according to the principles and requirements of ISO 5725 and/or the International Union of Pure and Applied Chemistry protocol. In addition, the database contains methods that have been verified by the European Union Reference Laboratory for Genetically Modified Food and Feed in the context of compliance with an European Union legislative act. The web application provides search capabilities to retrieve primers and probes sequence information on the available methods. It further supplies core data required by analytical labs to carry out GM tests and comprises information on the applied reference material and plasmid standards. The GMOMETHODS database currently contains 118 different PCR methods allowing identification of 51 single GM events and 18 taxon-specific genes in a sample. It also provides screening assays for detection of eight different genetic elements commonly used for the development of GMOs. The application is referred to by the Biosafety Clearing House, a global mechanism set up by the Cartagena Protocol on Biosafety to facilitate the exchange of information on Living Modified Organisms. The publication of the GMOMETHODS database can be considered an important step toward worldwide standardization and harmonization in GMO analysis.

  2. Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

    PubMed

    Gonzales, J L; Loza, A; Chacon, E

    2006-03-15

    There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

  3. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori

    PubMed Central

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-01-01

    AIM: To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). METHODS: The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. RESULTS: The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. CONCLUSION: The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori. PMID:27433095

  4. Evaluation of Two PCR-Based Swine-Specific Fecal Source Tracking Assays (Poster)

    EPA Science Inventory

    Several PCR-based methods have been proposed to identify swine fecal pollution in environmental waters. However, the specificity and distribution of these targets have not been adequately assessed. Consequently, the utility of these assays in identifying swine fecal contamination...

  5. Detection of shigella in lettuce by the use of a rapid molecular assay with increased sensitivity

    PubMed Central

    Jiménez, Kenia Barrantes; McCoy², Clyde B.; Achí, Rosario

    2010-01-01

    A Multiplex Polymerase Chain Reaction (PCR) assay to be used as an alternative to the conventional culture method in detecting Shigella and enteroinvasive Escherichia coli (EIEC) virulence genes ipaH and ial in lettuce was developed. Efficacy and rapidity of the molecular method were determined as compared to the conventional culture. Lettuce samples were inoculated with different Shigella flexneri concentrations (from 10 CFU/ml to 107 CFU/ml). DNA was extracted directly from lettuce after inoculation (direct-PCR) and after an enrichment step (enrichment PCR). Multiplex PCR detection limit was 104CFU/ml, diagnostic sensitivity and specificity were 100% accurate. An internal amplification control (IAC) of 100 bp was used in order to avoid false negative results. This method produced results in 1 to 2 days while the conventional culture method required 5 to 6 days. Also, the culture method detection limit was 106 CFU/ml, diagnostic sensitivity was 53% and diagnostic specificity was 100%. In this study a Multiplex PCR method for detection of virulence genes in Shigella and EIEC was shown to be effective in terms of diagnostic sensitivity, detection limit and amount of time as compared to Shigella conventional culture. PMID:24031579

  6. Evaluation by latent class analysis of a magnetic capture based DNA extraction followed by real-time qPCR as a new diagnostic method for detection of Echinococcus multilocularis in definitive hosts.

    PubMed

    Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke

    2016-10-30

    A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Detection of bacterial pathogens in Mongolia meningitis surveillance with a new real-time PCR assay to detect Haemophilus influenzae.

    PubMed

    Wang, Xin; Mair, Raydel; Hatcher, Cynthia; Theodore, M Jordan; Edmond, Karen; Wu, Henry M; Harcourt, Brian H; Carvalho, Maria da Gloria S; Pimenta, Fabiana; Nymadawa, Pagbajab; Altantsetseg, Dorjpurev; Kirsch, Mariah; Satola, Sarah W; Cohn, Amanda; Messonnier, Nancy E; Mayer, Leonard W

    2011-04-01

    Since the implementation of Haemophilus influenzae (Hi) serotype b vaccine, other serotypes and non-typeable strains have taken on greater importance as a cause of Hi diseases. A rapid and accurate method is needed to detect all Hi regardless of the encapsulation status. We developed 2 real-time PCR (rt-PCR) assays to detect specific regions of the protein D gene (hpd). Both hpd assays are very specific and sensitive for detection of Hi. Of the 63 non-Hi isolates representing 21 bacterial species, none was detected by the hpd #1 assay, and only one of 2 H. aphrophilus isolates was detected by the hpd #3 assay. The hpd #1 and #3 assays detected 97% (229/237) and 99% (234/237) of Hi isolates, respectively, and were superior for detection of both typeable and non-typeable Hi isolates, as compared to previously developed rt-PCR targeting ompP2 or bexA. The diagnostic sensitivity and specificity of these rt-PCR assays were assessed on cerebrospinal fluid specimens collected as part of meningitis surveillance in Ulaanbaatar, Mongolia. The etiology (Neisseria meningitidis, Hi, and Streptococcus pneumoniae) of 111 suspected meningitis cases was determined by conventional methods (culture and latex agglutination), previously developed rt-PCR assays, and the new hpd assays. The rt-PCR assays were more sensitive for detection of meningitis pathogens than other classical methods and improved detection from 50% (56/111) to 75% (83/111). The hpd #3 assay identified a non-b Hi that was missed by the bexA assay and other methods. A sensitive rt-PCR assay to detect both typeable and non-typeable Hi is a useful tool for improving Hi disease surveillance especially after Hib vaccine introduction. Published by Elsevier GmbH.

  8. Role of PCR method using IS6110 primer in detecting Mycobacterium tuberculosis among the clinically diagnosed childhood tuberculosis patients at an urban hospital in Dhaka, Bangladesh.

    PubMed

    Kabir, Senjuti; Uddin, Mohammad Khaja Mafij; Chisti, Mohammod Jobayer; Fannana, Tilka; Haque, Mohammad Enamul; Uddin, Muhammad Reaj; Banu, Sayera; Ahmed, Tahmeed

    2018-03-01

    Better methods are needed for the accurate detection of child tuberculosis (TB). This study compared different laboratory tests and evaluated IS6110 PCR for the detection of Mycobacterium tuberculosis (MTB) among clinically diagnosed child TB patients. A total of 102 paediatric patients (<15 years old) with clinically diagnosed TB were enrolled in this study. The patients were admitted to the icddr,b hospital in Dhaka between 2003 and 2005. Sputum/gastric lavage samples were collected for smear microscopy, culture (solid/Lowenstein-Jensen medium and liquid/MGIT), and IS6110 PCR testing. The sensitivity, specificity, and positive and negative predictive values (PPV, NPV) of smear microscopy and PCR were compared to the two culture methods. Three patients were positive on smear microscopy (2.9%). MTB was detected by conventional culture in 15.7% (16/102), liquid culture in 14% (14/100), and IS6110 PCR in 61.8% (63/102). PCR detected an additional 45 patients who were undetected with the three other tests. Compared to conventional and liquid culture, respectively, smear microscopy showed sensitivity of 18.8% and 21.4%, specificity of 100% individually, PPV of 100% individually, and NPV of 86.9% and 88.7%, whereas PCR had sensitivity of 87.5% and 92.9%, specificity of 43% individually, PPV of 22.2% and 21%, and NPV of 94.9% and 97.4%. PCR can be useful compared to smear microscopy and culture methods and is applicable as a rapid screening test for child TB. A larger scale study is required to determine its diagnostic efficacy in improving the detection of child TB in the presence and absence of severe malnutrition. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  9. Specific PCR primers directed to identify cryI and cryIII genes within a Bacillus thuringiensis strain collection.

    PubMed Central

    Cerón, J; Ortíz, A; Quintero, R; Güereca, L; Bravo, A

    1995-01-01

    In this paper we describe a PCR strategy that can be used to rapidly identify Bacillus thuringiensis strains that harbor any of the known cryI or cryIII genes. Four general PCR primers which amplify DNA fragments from the known cryI or cryIII genes were selected from conserved regions. Once a strain was identified as an organism that contains a particular type of cry gene, it could be easily characterized by performing additional PCR with specific cryI and cryIII primers selected from variable regions. The method described in this paper can be used to identify the 10 different cryI genes and the five different cryIII genes. One feature of this screening method is that each cry gene is expected to produce a PCR product having a precise molecular weight. The genes which produce PCR products having different sizes probably represent strains that harbor a potentially novel cry gene. Finally, we present evidence that novel crystal genes can be identified by the method described in this paper. PMID:8526493

  10. A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40).

    PubMed

    Li, Xiang; Wang, Xiuxiu; Yang, Jielin; Liu, Yueming; He, Yuping; Pan, Liangwen

    2014-05-16

    To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5'-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products.

  11. A novel quadruplex real-time PCR method for simultaneous detection of Cry2Ae and two genetically modified cotton events (GHB119 and T304-40)

    PubMed Central

    2014-01-01

    Background To date, over 150 genetically modified (GM) crops are widely cultivated. To comply with regulations developed for genetically modified organisms (GMOs), including labeling policies, many detection methods for GMO identification and quantification have been developed. Results To detect the entrance and exit of unauthorized GM crop events in China, we developed a novel quadruplex real-time PCR method for simultaneous detection and quantification of GM cotton events GHB119 and T304-40 in cotton-derived products (based on the 5′-flanking sequence) and the insect-resistance gene Cry2Ae. The limit of detection was 10 copies for GHB119 and Cry2Ae and 25 copies for T304-40. The limit of quantification was 25 copies for GHB119 and Cry2Ae and 50 copies for T304-40. Moreover, low bias and acceptable standard deviation and relative standard deviation values were obtained in quantification analysis of six blind samples containing different GHB119 and T304-40 ingredients. Conclusions The developed quadruplex quantitative method could be used for quantitative detection of two GM cotton events (GHB119 and T304-40) and Cry2Ae gene ingredient in cotton derived products. PMID:24884946

  12. Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

    PubMed Central

    Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

    2015-01-01

    Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

  13. The Expression and Significance of Feces Cyclooxygensae-2 mRNA in Colorectal Cancer and Colorectal Adenomas

    PubMed Central

    Li, Xiaofeng; Kong, Lixia; Liao, Suhuan; Lu, Jing; Ma, Lin; Long, Xiaohua

    2017-01-01

    Background/Aim: This study aims to explore the expression and significance of feces cyclooxygensae-2 (COX-2) mRNA in colorectal cancer and colorectal adenomas. Materials and Methods: The expression of feces COX-2 mRNA in colorectal cancer (n = 28), colorectal adenomas (n = 54), and normal control group (n = 11) were examined by reverse transcriptase polymerase chain reaction (RT-PCR). The positive rate of fecal occult blood test (FOBT) were detected in colorectal cancer (n = 30), colorectal adenomas (n = 56), and normal control group (n = 11); the sensitivity of the two methods was also compared. Results: The positive rate of feces COX-2 mRNA in colorectal cancer was 82.1% (25/28), which was significantly higher than colorectal adenomas 59.3% (32/54), and normal tissues 18.2% (2/11), the difference being significant between the three groups (χ2= 13.842, P = 0.001). The positive rate of FOBT in colorectal cancer was 73.3% (10/30), which was significantly higher than colorectal adenomas 10.7% (6/56) and normal tissues 9.1% (1/11), the difference being significant between these three groups (χ2= 7.525, P = 0.023). There was no significant association between feces COX-2 expression and various clinical pathological features of colorectal cancer and colorectal adenomas (P > 0.05). The sensitivity of the RT-PCR method is higher than FOBT, however, the specificity of FOBT is slightly higher than RT-PCR. Conclusions: High expression of feces COX-2 mRNA in colorectal adenomas and colorectal cancer is a common event; it is an early event in the development of colorectal adenomas to colorectal cancer. Feces COX-2 mRNA has a high sensitivity for detect colorectal cancer; combination with FOBT will be the best alternative. Feces COX-2 can be potentially used in the early diagnosis and screening of colorectal cancer. PMID:28139497

  14. Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR

    PubMed Central

    Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo

    2005-01-01

    A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001

  15. PCR-based methods for the detection of L1014 kdr mutation in Anopheles culicifacies sensu lato

    PubMed Central

    Singh, Om P; Bali, Prerna; Hemingway, Janet; Subbarao, Sarala K; Dash, Aditya P; Adak, Tridibes

    2009-01-01

    Background Anopheles culicifacies s.l., a major malaria vector in India, has developed widespread resistance to DDT and is becoming resistant to pyrethroids–the only insecticide class recommended for the impregnation of bed nets. Knock-down resistance due to a point mutation in the voltage gated sodium channel at L1014 residue (kdr) is a common mechanism of resistance to DDT and pyrethroids. The selection of this resistance may pose a serious threat to the success of the pyrethroid-impregnated bed net programme. This study reports the presence of kdr mutation (L1014F) in a field population of An. culicifacies s.l. and three new PCR-based methods for kdr genotyping. Methods The IIS4-IIS5 linker to IIS6 segments of the para type voltage gated sodium channel gene of DDT and pyrethroid resistant An. culicifacies s.l. population from the Surat district of India was sequenced. This revealed the presence of an A-to-T substitution at position 1014 leading to a leucine-phenylalanine mutation (L1014F) in a few individuals. Three molecular methods viz. Allele Specific PCR (AS-PCR), an Amplification Refractory Mutation System (ARMS) and Primer Introduced Restriction Analysis-PCR (PIRA-PCR) were developed and tested for kdr genotyping. The specificity of the three assays was validated following DNA sequencing of the samples genotyped. Results The genotyping of this An. culicifacies s.l. population by the three PCR based assays provided consistent result and were in agreement with DNA sequencing result. A low frequency of the kdr allele mostly in heterozygous condition was observed in the resistant population. Frequencies of the different genotypes were in Hardy-Weinberg equilibrium. Conclusion The Leu-Phe mutation, which generates the kdr phenotype in many insects, was detected in a pyrethroid and DDT resistant An. culicifacies s.l. population. Three PCR-based methods were developed for kdr genotyping. All the three assays were specific. The ARMS method was refractory to non-specific amplification in non-stringent amplification conditions. The PIRA-PCR assay is able to detect both the codons for the phenylalanine mutation at kdr locus, i.e., TTT and TTC, in a single assay, although the latter codon was not found in the population genotyped. PMID:19594947

  16. Species-Specific Detection and Identification of Fusarium Species Complex, the Causal Agent of Sugarcane Pokkah Boeng in China

    PubMed Central

    Que, Youxiong; Wang, Jihua; Comstock, Jack C.; Wei, Jinjin; McCord, Per H.; Chen, Baoshan; Chen, Rukai; Zhang, Muqing

    2014-01-01

    Background Pokkah boeng disease caused by the Fusarium species complex results in significant yield losses in sugarcane. Thus, the rapid and accurate detection and identification of the pathogen is urgently required to manage and prevent the spreading of sugarcane pokkah boeng. Methods A total of 101 isolates were recovered from the pokkah boeng samples collected from five major sugarcane production areas in China throughout 2012 and 2013. The causal pathogen was identified by morphological observation, pathogenicity test, and phylogenetic analysis based on the fungus-conserved rDNA-ITS. Species-specific TaqMan real-time PCR and conventional PCR methods were developed for rapid and accurate detection of the causal agent of sugarcane pokkah boeng. The specificity and sensitivity of PCR assay were also evaluated on a total of 84 isolates of Fusarium from China and several isolates from other fungal pathogens of Sporisorium scitamineum and Phoma sp. and sugarcane endophyte of Acremonium sp. Result Two Fusarium species (F. verticillioides and F. proliferatum) that caused sugarcane pokahh boeng were identified by morphological observation, pathogenicity test, and phylogenetic analysis. Species-specific TaqMan PCR and conventional PCR were designed and optimized to target their rDNA-ITS regions. The sensitivity of the TaqMan PCR was approximately 10 pg of fungal DNA input, which was 1,000-fold over conventional PCR, and successfully detected pokkah boeng in the field-grown sugarcane. Conclusions/Significance This study was the first to identify two species, F. verticillioides and F. proliferatum, that were causal pathogens of sugarcane pokkah boeng in China. It also described the development of a species-specific PCR assay to detect and confirm these pathogens in sugarcane plants from mainland China. This method will be very useful for a broad range of research endeavors as well as the regulatory response and management of sugarcane pokkah boeng. PMID:25141192

  17. Statistical tools for transgene copy number estimation based on real-time PCR.

    PubMed

    Yuan, Joshua S; Burris, Jason; Stewart, Nathan R; Mentewab, Ayalew; Stewart, C Neal

    2007-11-01

    As compared with traditional transgene copy number detection technologies such as Southern blot analysis, real-time PCR provides a fast, inexpensive and high-throughput alternative. However, the real-time PCR based transgene copy number estimation tends to be ambiguous and subjective stemming from the lack of proper statistical analysis and data quality control to render a reliable estimation of copy number with a prediction value. Despite the recent progresses in statistical analysis of real-time PCR, few publications have integrated these advancements in real-time PCR based transgene copy number determination. Three experimental designs and four data quality control integrated statistical models are presented. For the first method, external calibration curves are established for the transgene based on serially-diluted templates. The Ct number from a control transgenic event and putative transgenic event are compared to derive the transgene copy number or zygosity estimation. Simple linear regression and two group T-test procedures were combined to model the data from this design. For the second experimental design, standard curves were generated for both an internal reference gene and the transgene, and the copy number of transgene was compared with that of internal reference gene. Multiple regression models and ANOVA models can be employed to analyze the data and perform quality control for this approach. In the third experimental design, transgene copy number is compared with reference gene without a standard curve, but rather, is based directly on fluorescence data. Two different multiple regression models were proposed to analyze the data based on two different approaches of amplification efficiency integration. Our results highlight the importance of proper statistical treatment and quality control integration in real-time PCR-based transgene copy number determination. These statistical methods allow the real-time PCR-based transgene copy number estimation to be more reliable and precise with a proper statistical estimation. Proper confidence intervals are necessary for unambiguous prediction of trangene copy number. The four different statistical methods are compared for their advantages and disadvantages. Moreover, the statistical methods can also be applied for other real-time PCR-based quantification assays including transfection efficiency analysis and pathogen quantification.

  18. Real-time PCR using SYBR Green for the detection of Shigella spp. in food and stool samples.

    PubMed

    Mokhtari, W; Nsaibia, S; Gharbi, A; Aouni, M

    2013-02-01

    Shigella spp are exquisitely fastidious Gram negative organisms that frequently get missed in the detection by traditional culture methods. For this reason, this work has adapted a classical PCR for detection of Shigella in food and stool specimens to real-time PCR using the SYBR Green format. This method follows a melting curve analysis to be more rapid and provide both qualitative and quantitative data about the targeted pathogen. A total of 117 stool samples with diarrhea and 102 food samples were analyzed in Public Health Regional Laboratory of Nabeul by traditional culture methods and real-time PCR. To validate the real-time PCR assay, an experiment was conducted with both spiked and naturally contaminated stool samples. All Shigella strains tested were ipaH positive and all non-Shigella strains yielded no amplification products. The melting temperature (T(m) = 81.5 ± 0.5 °C) was consistently specific for the amplicon. Correlation coefficients of standard curves constructed using the quantification cycle (C(q)) versus copy numbers of Shigella showed good linearity (R² = 0.995; slope = 2.952) and the minimum level of detection was 1.5 × 10³ CFU/g feces. All food samples analyzed were negative for Shigella by standard culture methods, whereas ipaH was detected in 8.8% culture negative food products. Moreover, the ipaH specific PCR system increased the detection rate over that by culture alone from 1.7% to 11.1% among patients with diarrhea. The data presented here shows that the SYBR Green I was suitable for use in the real-time PCR assay, which provided a specific, sensitive and efficient method for the detection and quantification of Shigella spp in food and stool samples. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.

    PubMed

    Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús

    2018-01-01

    The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. COMPARISON OF A GENUS-SPECIFIC CONVENTIONAL PCR AND A SPECIES-SPECIFIC NESTED-PCR FOR MALARIA DIAGNOSIS USING FTA COLLECTED SAMPLES FROM KINGDOM OF SAUDI ARABIA.

    PubMed

    Al-Harthi, Saeed A

    2015-12-01

    Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.

  1. Development of a specific immunomagnetic capture-PCR for rapid detection of viable Mycoplasma agalactiae in sheep milk samples.

    PubMed

    Sanna, G; Lecca, V; Foddai, A; Tola, S

    2014-12-01

    To develop an immunomagnetic capture (IMC) to detect viable Mycoplasma agalactiae in routine ovine milk samples. Polyclonal antibodies against two M. agalactiae membrane surface proteins (P80 and P55) were covalently conjugated to magnetic beads (MBs) to form MB-Ab80 and MB-Ab55. Mycoplasma agalactiae cells were captured by a specific antigen-antibody reaction and magnetic separation. Immunomagnetic capture (IMC) was used to isolate and concentrate M. agalactiae in serial decimal dilutions and in artificially contaminated milk to facilitate subsequent detection by PCR. A 375-bp fragment of M. agalactiae was amplified using a pair of M. agalactiae-specific primers in PCR. The limit of detection of IMC-PCR method ranged from 10 to 10(2)  CCU ml(-1) when mycoplasmas were resuspended in PBS and from 10(2) to 10(3)  CCU ml(-1) when mycoplasmas were resuspended in uncontaminated ovine milk. This study also describes the application of IMC-PCR method to test for M. agalactiae in 516 milk samples collected from sheep with suspected contagious agalactia. Its performance was evaluated relative to culture. This report has demonstrated for the first time, the effective use of rapid and reliable IMC combined with PCR assay for the detection of viable M. agalactiae. The method IMC-PCR provides an alternative to conventional microbiological detection, method and it could be applied to quick detection of M. agalactiae in routine sheep milk samples. © 2014 The Authors published by John Wiley & Sons Ltd on behalf of Society for Applied Microbiology.

  2. Event-specific real-time detection and quantification of genetically modified Roundup Ready soybean.

    PubMed

    Huang, Chia-Chia; Pan, Tzu-Ming

    2005-05-18

    The event-specific real-time detection and quantification of Roundup Ready soybean (RRS) using an ABI PRISM 7700 sequence detection system with light upon extension (LUX) primer was developed in this study. The event-specific primers were designed, targeting the junction of the RRS 5' integration site and the endogenous gene lectin1. Then, a standard reference plasmid was constructed that carried both of the targeted sequences for quantitative analysis. The detection limit of the LUX real-time PCR system was 0.05 ng of 100% RRS genomic DNA, which was equal to 20.5 copies. The range of quantification was from 0.1 to 100%. The sensitivity and range of quantification successfully met the requirement of the labeling rules in the European Union and Taiwan.

  3. Ultra-fast DNA-based multiplex convection PCR method for meat species identification with possible on-site applications.

    PubMed

    Song, Kyung-Young; Hwang, Hyun Jin; Kim, Jeong Hee

    2017-08-15

    The aim of this study was to develop an ultra-fast molecular detection method for meat identification using convection Palm polymerase chain reaction (PCR). The mitochondrial cytochrome b (Cyt b) gene was used as a target gene. Amplicon size was designed to be different for beef, lamb, and pork. When these primer sets were used, each species-specific set specifically detected the target meat species in singleplex and multiplex modes in a 24min PCR run. The detection limit was 1pg of DNA for each meat species. The convection PCR method could detect as low as 1% of meat adulteration. The stability of the assay was confirmed using thermal processed meats. We also showed that direct PCR can be successfully performed with mixed meats and food samples. These results suggest that the developed assay may be useful in the authentication of meats and meat products in laboratory and rapid on-site applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. DETECTION AND QUANTIFICATION OF COW FECAL POLLUTION WITH REAL-TIME PCR

    EPA Science Inventory

    Assessment of health risk and fecal bacteria loads associated with cow fecal pollution requires a reliable host-specific genetic marker and a rapid quantification method. We report the development of quantitative PCR assays for enumeration of two recently described cow-specific g...

  5. Comparison of real-time PCR with disk diffusion, agar screen and E-test methods for detection of methicillin-resistant Staphylococcus aureus.

    PubMed

    Shariati, Laleh; Validi, Majid; Tabatabaiefar, Mohammad Amin; Karimi, Ali; Nafisi, Mohammad Reza

    2010-12-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a nosocomial pathogen. Our main objective was to compare oxacillin disk test, oxacillin E-test, and oxacillin agar screen for detection of methicillin resistance in S. aureus, using real-time PCR for mecA as the "gold standard" comparison assay. 196 S. aureus isolates were identified out of 284 Staphylococcus isolates. These isolates were screened for MRSA with several methods: disk diffusion, agar screen (6.0 μg/ml), oxacillin E-test, and real-time PCR for detection of mecA gene. Of the 196 S. aureus isolates tested, 96 isolates (49%) were mecA-positive and 100 isolates (51%) mecA-negative. All methods tested had a statistically significant agreement with real-time PCR. E-test was 100% sensitive and specific for mecA presence. The sensitivity and specificity of oxacillin agar screen method were 98 and 99%, respectively and sensitivity and specificity of oxacillin disk diffusion method were 95 and 93%, respectively. In the present study, oxacillin E-test is proposed as the best phenotypic method. For economic reasons, the oxacillin agar screen method (6.0 μg/ml), which is suitable for the detection of MRSA, is recommended due to its accuracy and low cost.

  6. Single Laboratory Comparison of Host-Specific PCR Assays for the Detection of Bovine Fecal Pollution

    EPA Science Inventory

    There are numerous PCR-based methods available to detect bovine fecal pollution in ambient waters. Each method targets a different gene and microorganism leading to differences in method performance, making it difficult to determine which approach is most suitable for field appl...

  7. Comparison of a real-time PCR method with a culture method for the detection of Salmonella enterica serotype enteritidis in naturally contaminated environmental samples from integrated poultry houses.

    PubMed

    Lungu, Bwalya; Waltman, W Douglas; Berghaus, Roy D; Hofacre, Charles L

    2012-04-01

    Conventional culture methods have traditionally been considered the "gold standard" for the isolation and identification of foodborne bacterial pathogens. However, culture methods are labor-intensive and time-consuming. A Salmonella enterica serotype Enteritidis-specific real-time PCR assay that recently received interim approval by the National Poultry Improvement Plan for the detection of Salmonella Enteritidis was evaluated against a culture method that had also received interim National Poultry Improvement Plan approval for the analysis of environmental samples from integrated poultry houses. The method was validated with 422 field samples collected by either the boot sock or drag swab method. The samples were cultured by selective enrichment in tetrathionate broth followed by transfer onto a modified semisolid Rappaport-Vassiliadis medium and then plating onto brilliant green with novobiocin and xylose lysine brilliant Tergitol 4 plates. One-milliliter aliquots of the selective enrichment broths from each sample were collected for DNA extraction by the commercial PrepSEQ nucleic acid extraction assay and analysis by the Salmonella Enteritidis-specific real-time PCR assay. The real-time PCR assay detected no significant differences between the boot sock and drag swab samples. In contrast, the culture method detected a significantly higher number of positive samples from boot socks. The diagnostic sensitivity of the real-time PCR assay for the field samples was significantly higher than that of the culture method. The kappa value obtained was 0.46, indicating moderate agreement between the real-time PCR assay and the culture method. In addition, the real-time PCR method had a turnaround time of 2 days compared with 4 to 8 days for the culture method. The higher sensitivity as well as the reduction in time and labor makes this real-time PCR assay an excellent alternative to conventional culture methods for diagnostic purposes, surveillance, and research studies to improve food safety.

  8. QUALITY ASSURANCE FOR PCR

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) held a workshop in January 2003 on the detection of viruses in water using polymerase chain reaction (PCR)-based methods. Speakers were asked to address a series of specific questions, including whether a single standard method coul...

  9. A practical approach to screen for authorised and unauthorised genetically modified plants.

    PubMed

    Waiblinger, Hans-Ulrich; Grohmann, Lutz; Mankertz, Joachim; Engelbert, Dirk; Pietsch, Klaus

    2010-03-01

    In routine analysis, screening methods based on real-time PCR are most commonly used for the detection of genetically modified (GM) plant material in food and feed. In this paper, it is shown that the combination of five DNA target sequences can be used as a universal screening approach for at least 81 GM plant events authorised or unauthorised for placing on the market and described in publicly available databases. Except for maize event LY038, soybean events DP-305423 and BPS-CV127-9 and cotton event 281-24-236 x 3006-210-23, at least one of the five genetic elements has been inserted in these GM plants and is targeted by this screening approach. For the detection of these sequences, fully validated real-time PCR methods have been selected. A screening table is presented that describes the presence or absence of the target sequences for most of the listed GM plants. These data have been verified either theoretically according to available databases or experimentally using available reference materials. The screening table will be updated regularly by a network of German enforcement laboratories.

  10. Novel multiplex qualitative detection using universal primer-multiplex-PCR combined with pyrosequencing.

    PubMed

    Shang, Ying; Xu, Wentao; Wang, Yong; Xu, Yuancong; Huang, Kunlun

    2017-12-15

    This study described a novel multiplex qualitative detection method using pyrosequencing. Based on the principle of the universal primer-multiplex-PCR, only one sequencing primer was employed to realize the detection of the multiple targets. Samples containing three genetically modified (GM) crops in different proportions were used to validate the method. The dNTP dispensing order was designed based on the product sequences. Only 12 rounds (ATCTGATCGACT) of dNTPs addition and, often, as few as three rounds (CAT) under ideal conditions, were required to detect the GM events qualitatively, and sensitivity was as low as 1% of a mixture. However, when considering a mixture, calculating signal values allowed the proportion of each GM to be estimated. Based on these results, we concluded that our novel method not only realized detection but also allowed semi-quantitative detection of individual events. Copyright © 2017. Published by Elsevier Ltd.

  11. Evaluation of Bacillus anthracis and Yersinia pestis sample collection from nonporous surfaces by quantitative real-time PCR.

    PubMed

    Hong-Geller, E; Valdez, Y E; Shou, Y; Yoshida, T M; Marrone, B L; Dunbar, J M

    2010-04-01

    We will validate sample collection methods for recovery of microbial evidence in the event of accidental or intentional release of biological agents into the environment. We evaluated the sample recovery efficiencies of two collection methods - swabs and wipes - for both nonvirulent and virulent strains of Bacillus anthracis and Yersinia pestis from four types of nonporous surfaces: two hydrophilic surfaces, stainless steel and glass, and two hydrophobic surfaces, vinyl and plastic. Sample recovery was quantified using real-time qPCR to assay for intact DNA signatures. We found no consistent difference in collection efficiency between swabs or wipes. Furthermore, collection efficiency was more surface-dependent for virulent strains than nonvirulent strains. For the two nonvirulent strains, collection efficiency was similar between all four surfaces, albeit B. anthracis Sterne exhibited higher levels of recovery compared to Y. pestis A1122. In contrast, recovery of B. anthracis Ames spores and Y. pestis CO92 from the hydrophilic glass or stainless steel surfaces was generally more efficient compared to collection from the hydrophobic vinyl and plastic surfaces. Our results suggest that surface hydrophobicity may play a role in the strength of pathogen adhesion. The surface-dependent collection efficiencies observed with the virulent strains may arise from strain-specific expression of capsular material or other cell surface receptors that alter cell adhesion to specific surfaces. These findings contribute to the validation of standard bioforensics procedures and emphasize the importance of specific strain and surface interactions in pathogen detection.

  12. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  13. A semi-automated magnetic capture probe based DNA extraction and real-time PCR method applied in the Swedish surveillance of Echinococcus multilocularis in red fox (Vulpes vulpes) faecal samples.

    PubMed

    Isaksson, Mats; Hagström, Åsa; Armua-Fernandez, Maria Teresa; Wahlström, Helene; Ågren, Erik Olof; Miller, Andrea; Holmberg, Anders; Lukacs, Morten; Casulli, Adriano; Deplazes, Peter; Juremalm, Mikael

    2014-12-19

    Following the first finding of Echinococcus multilocularis in Sweden in 2011, 2985 red foxes (Vulpes vulpes) were analysed by the segmental sedimentation and counting technique. This is a labour intensive method and requires handling of the whole carcass of the fox, resulting in a costly analysis. In an effort to reduce the cost of labour and sample handling, an alternative method has been developed. The method is sensitive and partially automated for detection of E. multilocularis in faecal samples. The method has been used in the Swedish E. multilocularis monitoring program for 2012-2013 on more than 2000 faecal samples. We describe a new semi-automated magnetic capture probe DNA extraction method and real time hydrolysis probe polymerase chain reaction assay (MC-PCR) for the detection of E. multilocularis DNA in faecal samples from red fox. The diagnostic sensitivity was determined by validating the new method against the sedimentation and counting technique in fox samples collected in Switzerland where E. multilocularis is highly endemic. Of 177 foxes analysed by the sedimentation and counting technique, E. multilocularis was detected in 93 animals. Eighty-two (88%, 95% C.I 79.8-93.9) of these were positive in the MC-PCR. In foxes with more than 100 worms, the MC-PCR was positive in 44 out of 46 (95.7%) cases. The two MC-PCR negative samples originated from foxes with only immature E. multilocularis worms. In foxes with 100 worms or less, (n = 47), 38 (80.9%) were positive in the MC-PCR. The diagnostic specificity of the MC-PCR was evaluated using fox scats collected within the Swedish screening. Of 2158 samples analysed, two were positive. This implies that the specificity is at least 99.9% (C.I. = 99.7-100). The MC-PCR proved to have a high sensitivity and a very high specificity. The test is partially automated but also possible to perform manually if desired. The test is well suited for nationwide E. multilocularis surveillance programs where sampling of fox scats is done to reduce the costs for sampling and where a test with a high sensitivity and a very high specificity is needed.

  14. Xylella fastidiosa: Host Range and Advance in Molecular Identification Techniques

    PubMed Central

    Baldi, Paolo; La Porta, Nicola

    2017-01-01

    In the never ending struggle against plant pathogenic bacteria, a major goal is the early identification and classification of infecting microorganisms. Xylella fastidiosa, a Gram-negative bacterium belonging to the family Xanthmonadaceae, is no exception as this pathogen showed a broad range of vectors and host plants, many of which may carry the pathogen for a long time without showing any symptom. Till the last years, most of the diseases caused by X. fastidiosa have been reported from North and South America, but recently a widespread infection of olive quick decline syndrome caused by this fastidious pathogen appeared in Apulia (south-eastern Italy), and several cases of X. fastidiosa infection have been reported in other European Countries. At least five different subspecies of X. fastidiosa have been reported and classified: fastidiosa, multiplex, pauca, sandyi, and tashke. A sixth subspecies (morus) has been recently proposed. Therefore, it is vital to develop fast and reliable methods that allow the pathogen detection during the very early stages of infection, in order to prevent further spreading of this dangerous bacterium. To this purpose, the classical immunological methods such as ELISA and immunofluorescence are not always sensitive enough. However, PCR-based methods exploiting specific primers for the amplification of target regions of genomic DNA have been developed and are becoming a powerful tool for the detection and identification of many species of bacteria. The aim of this review is to illustrate the application of the most commonly used PCR approaches to X. fastidiosa study, ranging from classical PCR, to several PCR-based detection methods: random amplified polymorphic DNA (RAPD), quantitative real-time PCR (qRT-PCR), nested-PCR (N-PCR), immunocapture PCR (IC-PCR), short sequence repeats (SSRs, also called VNTR), single nucleotide polymorphisms (SNPs) and multilocus sequence typing (MLST). Amplification and sequence analysis of specific targets is also mentioned. The fast progresses achieved during the last years in the DNA-based classification of this pathogen are described and discussed and specific primers designed for the different methods are listed, in order to provide a concise and useful tool to all the researchers working in the field. PMID:28642764

  15. Quantitative Detection of Viable Bifidobacterium bifidum BF-1 Cells in Human Feces by Using Propidium Monoazide and Strain-Specific Primers

    PubMed Central

    Fujimoto, Junji

    2013-01-01

    We developed a PCR-based method to detect and quantify viable Bifidobacterium bifidum BF-1 cells in human feces. This method (PMA-qPCR) uses propidium monoazide (PMA) to distinguish viable from dead cells and quantitative PCR using a BF-1-specific primer set designed from the results of randomly amplified polymorphic DNA analysis. During long-term culture (10 days), the number of viable BF-1 cells detected by counting the number of CFU on modified MRS agar, by measuring the ATP contents converted to CFU, and by using PMA-qPCR decreased from about 1010 to 106 cells/ml; in contrast, the total number of (viable and dead) BF-1 cells detected by counting 4′,6-diamidino-2-phenylindolee (DAPI)-stained cells and by using qPCR without PMA and reverse transcription-qPCR remained constant. The number of viable BF-1 cells in fecal samples detected by using PMA-qPCR was highly and significantly correlated with the number of viable BF-1 cells added to the fecal samples, within the range of 105.3 to 1010.3 cells/g feces (wet weight) (r > 0.99, P < 0.001). After 12 healthy subjects ingested 1010.3 to 1011.0 CFU of BF-1 in a fermented milk product daily for 28 days, 104.5 ± 1.5 (mean ± standard deviation [SD]) BF-1 CFU/g was detected in fecal samples by using strain-specific selective agar; in contrast, 106.2 ± 0.4 viable BF-1 cells/g were detected by using PMA-qPCR, and a total of 107.6 ± 0.7 BF-1 cells/g were detected by using qPCR without PMA. Thus, the number of viable BF-1 cells detected by PMA-qPCR was about 50 times higher (P < 0.01) than that detected by the culture-dependent method. We conclude that strain-specific PMA-qPCR can be used to quickly and accurately evaluate viable BF-1 in feces. PMID:23354719

  16. Use of next generation sequencing data to develop a qPCR method for specific detection of EU-unauthorized genetically modified Bacillus subtilis overproducing riboflavin.

    PubMed

    Barbau-Piednoir, Elodie; De Keersmaecker, Sigrid C J; Delvoye, Maud; Gau, Céline; Philipp, Patrick; Roosens, Nancy H

    2015-11-11

    Recently, the presence of an unauthorized genetically modified (GM) Bacillus subtilis bacterium overproducing vitamin B2 in a feed additive was notified by the Rapid Alert System for Food and Feed (RASFF). This has demonstrated that a contamination by a GM micro-organism (GMM) may occur in feed additives and has confronted for the first time,the enforcement laboratories with this type of RASFF. As no sequence information of this GMM nor any specific detection or identification method was available, Next GenerationSequencing (NGS) was used to generate sequence information. However, NGS data analysis often requires appropriate tools, involving bioinformatics expertise which is not alwayspresent in the average enforcement laboratory. This hampers the use of this technology to rapidly obtain critical sequence information in order to be able to develop a specific qPCRdetection method. Data generated by NGS were exploited using a simple BLAST approach. A TaqMan® qPCR method was developed and tested on isolated bacterial strains and on the feed additive directly. In this study, a very simple strategy based on the common BLAST tools that can be used by any enforcement lab without profound bioinformatics expertise, was successfully used toanalyse the B. subtilis data generated by NGS. The results were used to design and assess a new TaqMan® qPCR method, specifically detecting this GM vitamin B2 overproducing bacterium. The method complies with EU critical performance parameters for specificity, sensitivity, PCR efficiency and repeatability. The VitB2-UGM method also could detect the B. subtilis strain in genomic DNA extracted from the feed additive, without prior culturing step. The proposed method, provides a crucial tool for specifically and rapidly identifying this unauthorized GM bacterium in food and feed additives by enforcement laboratories. Moreover, this work can be seen as a case study to substantiate how the use of NGS data can offer an added value to easily gain access to sequence information needed to develop qPCR methods to detect unknown andunauthorized GMO in food and feed.

  17. Accurate quantitation of circulating cell-free mitochondrial DNA in plasma by droplet digital PCR.

    PubMed

    Ye, Wei; Tang, Xiaojun; Liu, Chu; Wen, Chaowei; Li, Wei; Lyu, Jianxin

    2017-04-01

    To establish a method for accurate quantitation of circulating cell-free mitochondrial DNA (ccf-mtDNA) in plasma by droplet digital PCR (ddPCR), we designed a ddPCR method to determine the copy number of ccf-mtDNA by amplifying mitochondrial ND1 (MT-ND1). To evaluate the sensitivity and specificity of the method, a recombinant pMD18-T plasmid containing MT-ND1 sequences and mtDNA-deleted (ρ 0 ) HeLa cells were used, respectively. Subsequently, different plasma samples were prepared for ddPCR to evaluate the feasibility of detecting plasma ccf-mtDNA. In the results, the ddPCR method showed high sensitivity and specificity. When the DNA was extracted from plasma prior to ddPCR, the ccf-mtDNA copy number was higher than that measured without extraction. This difference was not due to a PCR inhibitor, such as EDTA-Na 2 , an anti-coagulant in plasma, because standard EDTA-Na 2 concentration (5 mM) did not significantly inhibit ddPCR reactions. The difference might be attributable to plasma exosomal mtDNA, which was 4.21 ± 0.38 copies/μL of plasma, accounting for ∼19% of plasma ccf-mtDNA. Therefore, ddPCR can quickly and reliably detect ccf-mtDNA from plasma with a prior DNA extraction step, providing for a more accurate detection of ccf-mtDNA. The direct use of plasma as a template in ddPCR is suitable for the detection of exogenous cell-free nucleic acids within plasma, but not of nucleic acids that have a vesicle-associated form, such as exosomal mtDNA. Graphical Abstract Designs of the present work. *: Module 1, #: Module 2, &: Module 3.

  18. Diagnosis of Bubonic Plague by PCR in Madagascar under Field Conditions

    PubMed Central

    Rahalison, L.; Vololonirina, E.; Ratsitorahina, M.; Chanteau, S.

    2000-01-01

    The diagnostic value of a PCR assay that amplifies a 501-bp fragment of the Yersinia pestis caf1 gene has been determined in a reference laboratory with 218 bubo aspirates collected from patients with clinically suspected plague managed in a regional hospital in Madagascar. The culture of Y. pestis and the detection of the F1 antigen (Ag) by enzyme-linked immunosorbent assay (ELISA) were used as reference diagnostic methods. The sensitivity of PCR was 89% (57 of 64) for the Y. pestis-positive patients, and 80.7% (63 of 78) for the F1 Ag-positive patients. The specificity of PCR for the culture-, F1 Ag-, and antibody-negative patients (n = 105) was 100%. Because in Madagascar most patients with plague are managed and their clinical samples are collected in remote villages, the usefulness of PCR was evaluated for routine diagnostic use in the operational conditions of the control program. The sensitivity of PCR was 50% (25 of 50) relative to the results of culture and 35.2% (19 of 54) relative to the results of the F1 Ag immunocapture ELISA. The specificity of PCR under these conditions was 96%. In conclusion, the PCR method was found to be very specific but not as sensitive as culture or the F1 Ag detection method. The limitation in sensitivity may have been due to suboptimal field conditions and the small volumes of samples used for DNA extraction. This technique is not recommended as a routine diagnostic test for plague in Madagascar. PMID:10618097

  19. Evaluation of Two PCR-based Swine-specific Fecal Source Tracking Assays (Abstract)

    EPA Science Inventory

    Several PCR-based methods have been proposed to identify swine fecal pollution in environmental waters. However, the utility of these assays in identifying swine fecal contamination on a broad geographic scale is largely unknown. In this study, we evaluated the specificity, distr...

  20. Application of the Modular Approach to an In-House Validation Study of Real-Time PCR Methods for the Detection and Serogroup Determination of Verocytotoxigenic Escherichia coli ▿ †

    PubMed Central

    Kagkli, Dafni-Maria; Weber, Thomas P.; Van den Bulcke, Marc; Folloni, Silvia; Tozzoli, Rosangela; Morabito, Stefano; Ermolli, Monica; Gribaldo, Laura; Van den Eede, Guy

    2011-01-01

    European Commission regulation 2073/2005 on the microbiological criteria for food requires that Escherichia coli is monitored as an indicator of hygienic conditions. Since verocytotoxigenic E. coli (VTEC) strains often cause food-borne infections by the consumption of raw food, the Biological Hazards (BIOHAZ) panel of the European Food Safety Authority (EFSA) recommended their monitoring in food as well. In particular, VTEC strains belonging to serogroups such as O26, O103, O111, O145, and O157 are known causative agents of several human outbreaks. Eight real-time PCR methods for the detection of E. coli toxin genes and their variants (stx1, stx2), the intimin gene (eae), and five serogroup-specific genes have been proposed by the European Reference Laboratory for VTEC (EURL-VTEC) as a technical specification to the European Normalization Committee (CEN TC275/WG6). Here we applied a “modular approach” to the in-house validation of these PCR methods. The modular approach subdivides an analytical process into separate parts called “modules,” which are independently validated based on method performance criteria for a limited set of critical parameters. For the VTEC real-time PCR module, the following parameters are being assessed: specificity, dynamic range, PCR efficiency, and limit of detection (LOD). This study describes the modular approach for the validation of PCR methods to be used in food microbiology, using single-target plasmids as positive controls and showing their applicability with food matrices. PMID:21856838

  1. Methods for Characterization of Alternative RNA Splicing.

    PubMed

    Harvey, Samuel E; Cheng, Chonghui

    2016-01-01

    Quantification of alternative splicing to detect the abundance of differentially spliced isoforms of a gene in total RNA can be accomplished via RT-PCR using both quantitative real-time and semi-quantitative PCR methods. These methods require careful PCR primer design to ensure specific detection of particular splice isoforms. We also describe analysis of alternative splicing using a splicing "minigene" in mammalian cell tissue culture to facilitate investigation of the regulation of alternative splicing of a particular exon of interest.

  2. [Application of rapid PCR to authenticate medicinal snakes].

    PubMed

    Chen, Kang; Jiang, Chao; Yuan, Yuan; Huang, Lu-Qi; Li, Man

    2014-10-01

    To obtained an accurate, rapid and efficient method for authenticate medicinal snakes listed in Chinese Pharmacopoeia (Zaocysd humnades, Bungarus multicinctus, Agkistrodon acutus), a rapid PCR method for authenticate snakes and its adulterants was established based on the classic molecular authentication methods. DNA was extracted by alkaline lysis and the specific primers were amplified by two-steps PCR amplification method. The denatured and annealing temperature and cycle numbers were optimized. When 100 x SYBR Green I was added in the PCR product, strong green fluorescence was visualized under 365 nm UV whereas adulterants without. The whole process can complete in 30-45 minutes. The established method provides the technical support for authentication of the snakes on field.

  3. Optimization of Trichomonas vaginalis Diagnosis during Pregnancy at a University Hospital, Argentina.

    PubMed

    Testardini, Pamela; Vaulet, María Lucía Gallo; Entrocassi, Andrea Carolina; Menghi, Claudia; Eliseht, Martha Cora; Gatta, Claudia; Losada, Mirta; Touzón, María Sol; Corominas, Ana; Vay, Carlos; Tatti, Silvio; Famiglietti, Angela; Fermepin, Marcelo Rodriguez; Perazzi, Beatriz

    2016-04-01

    The aim of this study was to evaluate different methods for Trichomonas vaginalis diagnosis during pregnancy in order to prevent maternal and perinatal complications. A total of 386 vaginal exudates from pregnant women were analyzed. T. vaginalis was investigated by 3 types of microscopic examinations direct wet mount with physiologic saline solution, prolonged May-Grunwald Giemsa (MGG) staining, and wet mount with sodium-acetate-formalin (SAF)/methylene blue method. PCR for 18S rRNA gene as well as culture in liquid medium were performed. The sensitivity and specificity of the microscopic examinations were evaluated considering the culture media positivity or the PCR techniques as gold standard. The frequency of T. vaginalis infection was 6.2% by culture and/or PCR, 5.2% by PCR, 4.7% by culture, 3.1% by SAF/methylene blue method and 2.8% by direct wet smear and prolonged MGG staining. The sensitivities were 83.3%, 75.0%, 50.0%, and 45.8% for PCR, culture, SAF/methylene blue method, and direct wet smear-prolonged MGG staining, respectively. The specificity was 100% for all the assessed methods. Microscopic examinations showed low sensitivity, mainly in asymptomatic pregnant patients. It is necessary to improve the detection of T. vaginalis using combined methods providing higher sensitivity, such as culture and PCR, mainly in asymptomatic pregnant patients, in order to prevent maternal and perinatal complications.

  4. Parasite detection in patients with post kala-azar dermal leishmaniasis in India: a comparison between molecular and immunological methods

    PubMed Central

    Salotra, P; Sreenivas, G; Beena, K R; Mukherjee, A; Ramesh, V

    2003-01-01

    Aims: To evaluate the sensitivity and specificity of serological, immunohistochemical, and molecular methods in the diagnosis of post kala-azar dermal leishmaniasis (PKDL). Methods: Twenty five patients with confirmed PKDL and 25 controls were included in the study. G2D10, a monoclonal antibody against Leishmania, was used for the immunohistochemical (IHC) staining of lesion sections to visualise anti-Leishmania donovani antibodies. The diagnostic usefulness of IHC was compared with enzyme linked immunosorbent assay (ELISA) with a recombinant (rk39) antigen, and a species specific polymerase chain reaction (PCR) assay, amplifying a kinetoplast minicircle DNA sequence. Results: IHC detected 22 of 25 PKDL cases, giving a sensitivity of 88%. The diagnostic sensitivity of both the ELISA and PCR tests was higher (96%). All of the 25 controls examined were negative in PCR, indicating 100% specificity of the test, whereas ELISA showed 96% specificity. Conclusions: IHC with G2D10 significantly enhances the sensitivity of detection of PKDL over routine haematoxylin and eosin staining. ELISA with a recombinant antigen is an economical and practical assay. PCR is the most sensitive and specific diagnostic method for PKDL. The tests described would facilitate the recognition of patients with PKDL, enabling timely treatment, which would contribute greatly to the control of kala-azar. PMID:14600129

  5. Rectal swab sampling followed by an enrichment culture-based real-time PCR assay to detect Salmonella enterocolitis in children.

    PubMed

    Lin, L-H; Tsai, C-Y; Hung, M-H; Fang, Y-T; Ling, Q-D

    2011-09-01

    Although routine bacterial culture is the traditional reference standard method for the detection of Salmonella infection in children with diarrhoea, it is a time-consuming procedure that usually only gives results after 3-4 days. Some molecular detection methods can improve the turn-around time to within 24 h, but these methods are not applied directly from stool or rectal swab specimens as routine diagnostic methods for the detection of gastrointestinal pathogens. In this study, we tested the feasibility of a bacterial enrichment culture-based real-time PCR assay method for detecting and screening for diarrhoea in children caused by Salmonella. Our results showed that the minimum real-time PCR assay time required to detect enriched bacterial culture from a swab was 3 h. In all children with suspected Salmonella diarrhoea, the enrichment culture-based real-time PCR achieved 85.4% sensitivity and 98.1% specificity, as compared with the 53.7% sensitivity and 100% specificity of detection with the routine bacterial culture method. We suggest that rectal swab sampling followed by enrichment culture-based real-time PCR is suitable as a rapid method for detecting and screening for Salmonella in paediatric patients. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  6. Synthetic internal control sequences to increase negative call veracity in multiplexed, quantitative PCR assays for Phakopsora pachyrhizi

    USDA-ARS?s Scientific Manuscript database

    Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...

  7. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

    PubMed

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-07-07

    To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori.

  8. Multiplex Droplet Digital PCR Protocols for Quantification of GM Maize Events.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Štebih, Dejan; Morisset, Dany; Holst-Jensen, Arne; Žel, Jana

    2018-01-01

    The standard-curve based simplex quantitative polymerase chain reaction (qPCR) has been the gold standard for DNA target quantification for more than a decade. The large and growing number of individual analyses needed to test for genetically modified organisms (GMOs) is reducing the cost-effectiveness of qPCR. Droplet digital PCR (ddPCR) enables absolute quantification without standard curves, avoids the amplification efficiency bias observed with qPCR, allows more accurate estimations at low target copy numbers and, in combination with multiplexing, significantly improves cost efficiency. Here we describe two protocols for multiplex quantification of GM maize events: (1) nondiscriminating, with multiplex quantification of targets as a group (12 GM maize lines) and (2) discriminating, with multiplex quantification of individual targets (events). The first enables the quantification of twelve European Union authorized GM maize events as a group with only two assays, but does not permit determination of the individual events present. The second protocol enables the quantification of four individual targets (three GM events and one endogene) in a single reaction. Both protocols can be modified for quantification of any other DNA target.

  9. A study of alternative splicing in the pig

    PubMed Central

    2010-01-01

    Background Since at least half of the genes in mammalian genomes are subjected to alternative splicing, alternative pre-mRNA splicing plays an important contribution to the complexity of the mammalian proteome. Expressed sequence tags (ESTs) provide evidence of a great number of possible alternative isoforms. With the EST resource for the domestic pig now containing more than one million porcine ESTs, it is possible to identify alternative splice forms of the individual transcripts in this species from the EST data with some confidence. Results The pig EST data generated by the Sino-Danish Pig Genome project has been assembled with publicly available ESTs and made available in the PigEST database. Using the Distiller package 2,515 EST clusters with candidate alternative isoforms were identified in the EST data with high confidence. In agreement with general observations in human and mouse, we find putative splice variants in about 30% of the contigs with more than 50 ESTs. Based on the criteria that a minimum of two EST sequences confirmed each splice event, a list of 100 genes with the most distinct tissue-specific alternative splice events was generated from the list of candidates. To confirm the tissue specificity of the splice events, 10 genes with functional annotation were randomly selected from which 16 individual splice events were chosen for experimental verification by quantitative PCR (qPCR). Six genes were shown to have tissue specific alternatively spliced transcripts with expression patterns matching those of the EST data. The remaining four genes had tissue-restricted expression of alternative spliced transcripts. Five out of the 16 splice events that were experimentally verified were found to be putative pig specific. Conclusions In accordance with human and rodent studies we estimate that approximately 30% of the porcine genes undergo alternative splicing. We found a good correlation between EST predicted tissue-specificity and experimentally validated splice events in different porcine tissue. This study indicates that a cluster size of around 50 ESTs is optimal for in silico detection of alternative splicing. Although based on a limited number of splice events, the study supports the notion that alternative splicing could have an important impact on species differentiation since 31% of the splice events studied appears to be species specific. PMID:20444244

  10. Detection of Alicyclobacillus spp. in Fruit Juice by Combination of Immunomagnetic Separation and a SYBR Green I Real-Time PCR Assay

    PubMed Central

    Yuan, Yahong; Liu, Bin; Wang, Ling; Yue, Tianli

    2015-01-01

    An approach based on immunomagnetic separation (IMS) and SYBR Green I real-time PCR (real-time PCR) with species-specific primers and melting curve analysis was proposed as a rapid and effective method for detecting Alicyclobacillus spp. in fruit juices. Specific primers targeting the 16S rDNA sequences of Alicyclobacillus spp. were designed and then confirmed by the amplification of DNA extracted from standard strains and isolates. Spiked samples containing known amounts of target bacteria were used to obtain standard curves; the correlation coefficient was greater than 0.986 and the real-time PCR amplification efficiencies were 98.9%- 101.8%. The detection limit of the testing system was 2.8×101 CFU/mL. The coefficient of variation for intra-assay and inter-assay variability were all within the acceptable limit of 5%. Besides, the performance of the IMS-real-time PCR assay was further investigated by detecting naturally contaminated kiwi fruit juice; the sensitivity, specificity and accuracy were 91.7%, 95.9% and 95.3%, respectively. The established IMS-real-time PCR procedure provides a new method for identification and quantitative detection of Alicyclobacillus spp. in fruit juice. PMID:26488469

  11. Establishment and application of cross-priming isothermal amplification coupled with lateral flow dipstick (CPA-LFD) for rapid and specific detection of red-spotted grouper nervous necrosis virus.

    PubMed

    Su, Zi Dan; Shi, Cheng Yin; Huang, Jie; Shen, Gui Ming; Li, Jin; Wang, Sheng Qiang; Fan, Chao

    2015-09-26

    Red-spotted grouper nervous necrosis virus (RGNNV) is an important pathogen that causes diseases in many species of fish in marine aquaculture. The larvae and juveniles are more easily infected by RGNNV and the cumulative mortality is as high as 100 % after being infected with RGNNV. This virus imposes a serious threat to aquaculture of grouper fry. This study aimed to establish a simple, accurate and highly sensitive method for rapid detection of RGNNV on the spot. In this study, the primers specifically targeting RGNNV were designed and cross-priming isothermal amplification (CPA) system was established. The product amplified by CPA was detected through visualization with lateral flow dipstick (LFD). Three important parameters, including the amplification temperature, the concentration of dNTPs and the concentration of Mg(2+) for the CPA system, were optimized. The sensitivity and specificity of this method for RGNNV were tested and compared with those of the conventional RT-PCR and real-time quantitative RT-PCR (qRT-PCR). The optimized conditions for the CPA amplification system were determined as follows: the optimal amplification temperature, the optimized concentration of dNTPs and the concentration for Mg(2+) were 69 °C, 1.2 mmol/L and 5 mmol/L, respectively. The lowest limit of detection (LLOD) of this method for RGNNV was 10(1) copies/μL of RNA sample, which was 10 times lower than that of conventional RT-PCR and comparable to that of RT-qPCR. This method was specific for RGNNV in combination with SJNNV and had no cross-reactions with 8 types of virus and bacterial strains tested. This method was successfully applied to detect RGNNV in fish samples. This study established a CPA-LFD method for detection of RGNNV. This method is simple and rapid with high sensitivity and good specificity and can be widely applied for rapid detection of this virus on the spot.

  12. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  13. Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.

    PubMed

    Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P

    2014-07-05

    The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the WSSV and the PstDV1 in whiteleg shrimp. The use of the TaqMan Universal Master Mix and the relative threshold method of data analysis in our duplex qPCR method provided optimal levels of sensitivity and specificity.

  14. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    PubMed

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  15. Real-time PCR for type-specific identification of herpes simplex in clinical samples: evaluation of type-specific results in the context of CNS diseases.

    PubMed

    Meylan, Sylvain; Robert, Daniel; Estrade, Christine; Grimbuehler, Valérie; Péter, Olivier; Meylan, Pascal R; Sahli, Roland

    2008-02-01

    HSV-1 and HSV-2 cause CNS infections of dissimilar clinico-pathological characteristics with prognostic and therapeutic implications. To validate a type-specific real-time PCR that uses MGB/LNA Taqman probes and to review the virologico-clinical data of 25 eligible patients with non-neonatal CNS infections. This real-time PCR was evaluated against conventional PCR (26 CSF and 20 quality controls), and LightCycler assay (51 mucocutaneous, 8 CSF and 32 quality controls) and culture/immunofluorescence (75 mucocutaneous) to assess typing with independent methods. Taqman real-time PCR detected 240 HSV genomes per ml CSF, a level appropriate for the management of patients, and provided unambiguous typing for the 104 positive (62 HSV-1 and 42 HSV-2) out the 160 independent clinical samples tested. HSV type diagnosed by Taqman real-time PCR predicted final diagnosis (meningitis versus encephalitis/meningoencephalitis, p<0.001) in 24/25 patients at time of presentation, in contrast to clinical evaluation. Our real-time PCR, as a sensitive and specific means for type-specific HSV diagnosis, provided rapid prognostic information for patient management.

  16. Development of a rapid, sensitive and specific diagnostic assay for fish Aquareovirus based on RT-PCR.

    PubMed

    Seng, E K; Fang, Q; Lam, T J; Sin, Y M

    2004-06-15

    A rapid, sensitive and highly specific detection method for Aquareovirus based on reverse-transcription polymerase chain reaction (RT-PCR) was developed. Based on multiple sequence alignment of the cloned sequences of a local isolates, the Threadfin reovirus (TFV) and Guppy reovirus (GPV) with Grass carp reovirus (GCRV), a pair of degenerate primers was selected carefully and synthesized. Using this primer combination, only one specific product, approximately 450 bp in length was obtained when RT-PCR was carried out using the genomic double-stranded RNA (dsRNA) of TFV, GPV and GCRV. Similar results were also obtained when Chum salmon reovirus (CSRV) and Striped bass reovirus (SBRV) dsRNA were used as templates. No products were observed when nucleic acids other than the dsRNA of the aquareoviruses described above were used as RT-PCR templates. This technique could detect not only TFV but also GPV and GCRV in low titer virus-infected cell cultured cells. Furthermore, this method has also been shown to be able to diagnose GPV-infected guppy (Poecilia reticulata) that exhibit clinical symptoms as well as GPV-carrier guppy. Collectively, these results showed that the RT-PCR amplification method using specific degenerate primers described below is very useful for rapid and accurate detection of a variety of aquareovirus strains isolated from different host species and origin.

  17. Simple, multiplexed, PCR-based barcoding of DNA enables sensitive mutation detection in liquid biopsies using sequencing.

    PubMed

    Ståhlberg, Anders; Krzyzanowski, Paul M; Jackson, Jennifer B; Egyud, Matthew; Stein, Lincoln; Godfrey, Tony E

    2016-06-20

    Detection of cell-free DNA in liquid biopsies offers great potential for use in non-invasive prenatal testing and as a cancer biomarker. Fetal and tumor DNA fractions however can be extremely low in these samples and ultra-sensitive methods are required for their detection. Here, we report an extremely simple and fast method for introduction of barcodes into DNA libraries made from 5 ng of DNA. Barcoded adapter primers are designed with an oligonucleotide hairpin structure to protect the molecular barcodes during the first rounds of polymerase chain reaction (PCR) and prevent them from participating in mis-priming events. Our approach enables high-level multiplexing and next-generation sequencing library construction with flexible library content. We show that uniform libraries of 1-, 5-, 13- and 31-plex can be generated. Utilizing the barcodes to generate consensus reads for each original DNA molecule reduces background sequencing noise and allows detection of variant alleles below 0.1% frequency in clonal cell line DNA and in cell-free plasma DNA. Thus, our approach bridges the gap between the highly sensitive but specific capabilities of digital PCR, which only allows a limited number of variants to be analyzed, with the broad target capability of next-generation sequencing which traditionally lacks the sensitivity to detect rare variants. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

    PubMed

    Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

    2014-05-08

    Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

  19. Comparison of four molecular assays for the detection of Tembusu virus.

    PubMed

    Tang, Yi; Yeh, Yin-Ting; Chen, Hao; Yu, Chunmei; Gao, Xuhui; Diao, Youxiang

    2015-10-01

    Tembusu virus (TMUV) belongs to the genus Flavivirus that may cause severe egg drop in ducks. In order to evaluate the most efficient TMUV detection method, the performances of a conventional RT-PCR (C-RT-PCR), a semi-nested PCR (SN-RT-PCR), a reverse-transcriptase real-time quantitative PCR (Q-RT-PCR), and a reverse-transcription loop-mediated isothermal amplification (RT-LAMP) targeting the TMUV virus-specific NS5 gene were examined. In order to compare the sensitivity of these four techniques, two templates were used: (1) plasmid DNA that contained a partial region of the NS5 gene and (2) genomic RNA from TMUV-positive cell culture supernatants. The sensitivities using plasmid DNA detection by C-RT-PCR, SN-RT-PCR, Q-RT-PCR, and RT-LAMP were 2 × 10(4) copies/μL, 20 copies/μL, 2 copies/μL, and 20 copies/μL, respectively. The sensitivities using genomic RNA for the C-RT-PCR, SN-RT-PCR, Q-RT-PCR, and RT-LAMP were 100 pg/tube, 100, 10, and 100 fg/tube, respectively. All evaluated assays were specific for TMUV detection. The TMUV-specific RNA was detected in cloacal swabs from experimentally infected ducks using these four methods with different rates (52-92%), but not in the control (non-inoculated) samples. The sensitivities of RT-PCR, SN-RT-PCR, Q-RT-PCR, and RT-LAMP performed with cloacal swabs collected from suspected TMUV infected ducks within 2 weeks of severe egg-drop were 38/69 (55.1%), 52/69 (75.4%), 57/69 (82.6%), and 55/69 (79.7%), respectively. In conclusion, both RT-LAMP and Q-RT-PCR can provide a rapid diagnosis of TMUV infection, but RT-LAMP is more useful in TMUV field situations or poorly equipped laboratories.

  20. Novel potential diagnostic test for Mycobacterium tuberculosis complex using combined immunomagnetic separation (IMS) and PCR-CTPP.

    PubMed

    Intorasoot, S; Tharinjaroen, C S; Phunpae, P; Butr-Indr, B; Anukool, U; Intachai, K; Orrapin, S; Apiratmateekul, N; Arunothong, S; Suthachai, V; Saengsawang, K; Khamnoi, P; Pata, S; Kasinrerk, W; Tragoolpua, K

    2016-08-01

    To exploit immunomagnetic separation combined with PCR with confronting two-pair primers (IMS-PCR-CTPP) as a rapid method for detection of Mycobacterium tuberculosis complex (MTC) and identification of Mycobacterium bovis from sputum specimens. Monoclonal antibody (mAb) against the mycobacterial antigen, 85B (Ag85B), was coupled with magnetic particles for specific immunomagnetic separation (IMS) of Mycobacterium spp. Immunofluorescence assay indicated the capability of mAb to bind to Ag85B in both the recombinant and the native form. The IMS combined with PCR-CTPP targeting the mycobacterial lep B gene was further implemented using 133 sputum samples with acid-fast bacilli grading from negative to 3+. The results showed the sensitivity and specificity of IMS-PCR-CTPP vs gold standard culture method were 89·9 and 88·6% respectively. The IMS-PCR-CTPP method shortens the time for tuberculosis (TB) diagnosis from months to a day. This method is also suitable for investigation of MTC and epidemiological study of Myco. bovis in sputum specimens. This study is the first report emphasizing the combination of IMS and PCR-CTPP for the detection of MTC and simultaneous identification of Myco. bovis from sputum. It could be used for TB diagnosis in resource-limited countries with high TB burden. © 2016 The Society for Applied Microbiology.

  1. A semi-nested real-time PCR method to detect low chimerism percentage in small quantity of hematopoietic stem cell transplant DNA samples.

    PubMed

    Aloisio, Michelangelo; Bortot, Barbara; Gandin, Ilaria; Severini, Giovanni Maria; Athanasakis, Emmanouil

    2017-02-01

    Chimerism status evaluation of post-allogeneic hematopoietic stem cell transplantation samples is essential to predict post-transplant relapse. The most commonly used technique capable of detecting small increments of chimerism is quantitative real-time PCR. Although this method is already used in several laboratories, previously described protocols often lack sensitivity and the amount of the DNA required for each chimerism analysis is too high. In the present study, we compared a novel semi-nested allele-specific real-time PCR (sNAS-qPCR) protocol with our in-house standard allele-specific real-time PCR (gAS-qPCR) protocol. We selected two genetic markers and analyzed technical parameters (slope, y-intercept, R2, and standard deviation) useful to determine the performances of the two protocols. The sNAS-qPCR protocol showed better sensitivity and precision. Moreover, the sNAS-qPCR protocol requires, as input, only 10 ng of DNA, which is at least 10-fold less than the gAS-qPCR protocols described in the literature. Finally, the proposed sNAS-qPCR protocol could prove very useful for performing chimerism analysis with a small amount of DNA, as in the case of blood cell subsets.

  2. Development of real-time PCR technique for the estimation of population density of Pythium intermedium in forest soils.

    PubMed

    Li, Mingzhu; Senda, Masako; Komatsu, Tsutomu; Suga, Haruhisa; Kageyama, Koji

    2010-10-20

    Pythium intermedium is known to play an important role in the carbon cycling of cool-temperate forest soils. In this study, a fast, precise and effective real-time PCR technique for estimating the population densities of P. intermedium from soils was developed using species-specific primers. Specificity was confirmed both with conventional PCR and real-time PCR. The detection limit (sensitivity) was determined and amplification standard curves were generated using SYBR Green II fluorescent dye. A rapid and accurate assay for quantification of P. intermedium in Takayama forest soils of Japan was developed using a combination of a new DNA extraction method and PCR primers were developed for real-time PCR. And the distribution of P. intermedium in forest soil was investigated with both soil plating method and the developed real-time PCR technique. This new technique will be a useful tool and can be applied to practical use for studying the role of Pythium species in forest and agricultural ecosystems. Copyright © 2009 Elsevier GmbH. All rights reserved.

  3. Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital PCR for vaccine evaluation in challenged monkeys and TB diagnosis.

    PubMed

    Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian

    2018-04-24

    Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.

  4. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  5. Detection of Genetic Markers of Fecal Indicator Bacteria in Lake Michigan and Determination of Their Relationship to Escherichia coli Densities Using Standard Microbiological Methods

    PubMed Central

    Bower, Patricia A.; Scopel, Caitlin O.; Jensen, Erika T.; Depas, Morgan M.; McLellan, Sandra L.

    2005-01-01

    Lake Michigan surface waters impacted by fecal pollution were assessed to determine the occurrence of genetic markers for Bacteroides and Escherichia coli. Initial experiments with sewage treatment plant influent demonstrated that total Bacteroides spp. could be detected by PCR in a 25- to 125-fold-higher dilution series than E. coli and human-specific Bacteroides spp., which were both found in similar dilution ranges. The limit of detection for the human-specific genetic marker ranged from 0.2 CFU/100 ml to 82 CFU/100 ml culturable E. coli for four wastewater treatment plants in urban and rural areas. The spatial and temporal distributions of these markers were assessed following major rain events that introduced urban storm water, agricultural runoff, and sewage overflows into Lake Michigan. Bacteroides spp. were detected in all of these samples by PCR, including those with <1 CFU/100 ml E. coli. Human-specific Bacteroides spp. were detected as far as 2 km into Lake Michigan during sewage overflow events, with variable detection 1 to 9 days postoverflow, whereas the cow-specific Bacteroides spp. were detected in only highly contaminated samples near the river outflow. Lake Michigan beaches were also assessed throughout the summer season for the same markers. Bacteroides spp. were detected in all beach samples, including 28 of the 74 samples that did not exceed 235 CFU/100 ml of E. coli. Human-specific Bacteroides spp. were detected at three of the seven beaches; one of the sites demonstrating positive results was sampled during a reported sewage overflow, but E. coli levels were below 235 CFU/100 ml. This study demonstrates the usefulness of non-culture-based microbial-source tracking approaches and the prevalence of these genetic markers in the Great Lakes, including freshwater coastal beaches. PMID:16332817

  6. Development of allele-specific primer PCR for a swine TLR2 SNP and comparison of the frequency among several pig breeds of Japan and the Czech Republic.

    PubMed

    Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor

    2012-05-01

    In the present study, we have developed an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 2 (TLR2) (C406G), which is related to the prevalence of pneumonia caused by Mycoplasma hyopneumoniae. We also compared the allele frequency among several pig breeds of Japan and the Czech Republic. Allele-specific primers were constructed by introducing 1-base mismatch sequence before the SNP site. The swine TLR2 C406G mutation was successfully determined by the ASP-PCR using genomic DNA samples in Japan as previously genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from pig blood obtained from 110 pigs from 7 different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR were completely matched with the results from the sequencing method. The allele frequency of the swine TLR2 C406G mutation was 27.5% in the Czech Republic and 3.6% in Japan. The C406G mutation was only found in the Landrace breed in Japan, and was almost exclusively found in the Landrace breed in the Czech Republic as well. These results indicated the usefulness of ASP-PCR for detecting a specific SNP for swine TLR2.

  7. The diagnosis of microorganism involved in infective endocarditis (IE) by polymerase chain reaction (PCR) and real-time PCR: A systematic review.

    PubMed

    Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi

    2018-02-01

    Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.

  8. EVALUATION OF RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    EPA Science Inventory

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan (trademark)) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glab...

  9. Characterization of Aspergillus section Nigri species populations in vineyard soil using droplet digital PCR

    USDA-ARS?s Scientific Manuscript database

    Identification of populations of Aspergillus section Nigri species in environmental samples using traditional methods is laborious and impractical for large numbers of samples. We developed species-specific primers and probes for quantitative droplet digital PCR (ddPCR) to improve sample throughput ...

  10. Comparison of the diagnostic performance of microscopic examination with nested polymerase chain reaction for optimum malaria diagnosis in Upper Myanmar.

    PubMed

    Kang, Jung-Mi; Cho, Pyo-Yun; Moe, Mya; Lee, Jinyoung; Jun, Hojong; Lee, Hyeong-Woo; Ahn, Seong Kyu; Kim, Tae Im; Pak, Jhang Ho; Myint, Moe Kyaw; Lin, Khin; Kim, Tong-Soo; Na, Byoung-Kuk

    2017-03-16

    Accurate diagnosis of Plasmodium infection is crucial for prompt malaria treatment and surveillance. Microscopic examination has been widely applied as the gold standard for malaria diagnosis in most part of malaria endemic areas, but its diagnostic value has been questioned, particularly in submicroscopic malaria. In this study, the diagnostic performance of microscopic examination and nested polymerase chain reaction (PCR) was evaluated to establish optimal malaria diagnosis method in Myanmar. A total of 1125 blood samples collected from residents in the villages and towns located in Naung Cho, Pyin Oo Lwin, Tha Beik Kyin townships and Mandalay of Upper Myanmar were screened by microscopic examination and species-specific nested PCR method. Among the 1125 blood samples, 261 samples were confirmed to be infected with malaria by microscopic examination. Evaluation of the 1125 samples by species-specific nested PCR analysis revealed that the agreement between microscopic examination and nested PCR was 87.3% (261/299). Nested PCR successfully detected 38 Plasmodium falciparum or Plasmodium vivax infections, which were missed in microscopic examination. Microscopic examinations also either misdiagnosed the infected Plasmodium species, or did not detect mixed infections with different Plasmodium species in 31 cases. The nested PCR method is more reliable than conventional microscopic examination for the diagnosis of malaria infections, and this is particularly true in cases of mixed infections and submicroscopic infections. Given the observed higher sensitivity and specificity of nested PCR, the molecular method holds enormous promise in malaria diagnosis and species differentiation, and can be applied as an effective monitoring tool for malaria surveillance, control and elimination in Myanmar.

  11. An innovative SNP genotyping method adapting to multiple platforms and throughputs.

    PubMed

    Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

    2017-03-01

    An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

  12. Comparison of DNA-based techniques for differentiation of production strains of ale and lager brewing yeast.

    PubMed

    Kopecká, J; Němec, M; Matoulková, D

    2016-06-01

    Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The Society for Applied Microbiology.

  13. Detection and enumeration of Salmonella enteritidis in homemade ice cream associated with an outbreak: comparison of conventional and real-time PCR methods.

    PubMed

    Seo, K H; Valentin-Bon, I E; Brackett, R E

    2006-03-01

    Salmonellosis caused by Salmonella Enteritidis (SE) is a significant cause of foodborne illnesses in the United States. Consumption of undercooked eggs and egg-containing products has been the primary risk factor for the disease. The importance of the bacterial enumeration technique has been enormously stressed because of the quantitative risk analysis of SE in shell eggs. Traditional enumeration methods mainly depend on slow and tedious most-probable-number (MPN) methods. Therefore, specific, sensitive, and rapid methods for SE quantitation are needed to collect sufficient data for risk assessment and food safety policy development. We previously developed a real-time quantitative PCR assay for the direct detection and enumeration of SE and, in this study, applied it to naturally contaminated ice cream samples with and without enrichment. The detection limit of the real-time PCR assay was determined with artificially inoculated ice cream. When applied to the direct detection and quantification of SE in ice cream, the real-time PCR assay was as sensitive as the conventional plate count method in frequency of detection. However, populations of SE derived from real-time quantitative PCR were approximately 1 log higher than provided by MPN and CFU values obtained by conventional culture methods. The detection and enumeration of SE in naturally contaminated ice cream can be completed in 3 h by this real-time PCR method, whereas the cultural enrichment method requires 5 to 7 days. A commercial immunoassay for the specific detection of SE was also included in the study. The real-time PCR assay proved to be a valuable tool that may be useful to the food industry in monitoring its processes to improve product quality and safety.

  14. Microsatellite instability in prostate cancer by PCR or next-generation sequencing.

    PubMed

    Hempelmann, Jennifer A; Lockwood, Christina M; Konnick, Eric Q; Schweizer, Michael T; Antonarakis, Emmanuel S; Lotan, Tamara L; Montgomery, Bruce; Nelson, Peter S; Klemfuss, Nola; Salipante, Stephen J; Pritchard, Colin C

    2018-04-17

    Microsatellite instability (MSI) is now being used as a sole biomarker to guide immunotherapy treatment for men with advanced prostate cancer. Yet current molecular diagnostic tests for MSI have not been evaluated for use in prostate cancer. We evaluated two next-generation sequencing (NGS) MSI-detection methods, MSIplus (18 markers) and MSI by Large Panel NGS (> 60 markers), and compared the performance of each NGS method to the most widely used 5-marker MSI-PCR detection system. All methods were evaluated by comparison to targeted whole gene sequencing of DNA mismatch-repair genes, and immunohistochemistry for mismatch repair genes, where available. In a set of 91 prostate tumors with known mismatch repair status (29-deficient and 62-intact mismatch-repair) MSIplus had a sensitivity of 96.6% (28/29) and a specificity of 100% (62/62), MSI by Large Panel NGS had a sensitivity of 93.1% (27/29) and a specificity of 98.4% (61/62), and MSI-PCR had a sensitivity of 72.4% (21/29) and a specificity of 100% (62/62). We found that the widely used 5-marker MSI-PCR panel has inferior sensitivity when applied to prostate cancer and that NGS testing with an expanded panel of markers performs well. In addition, NGS methods offer advantages over MSI-PCR, including no requirement for matched non-tumor tissue and an automated analysis pipeline with quantitative interpretation of MSI-status.

  15. Multiplex PCR for rapid diagnosis and differentiation of pox and pox-like diseases in dromedary Camels.

    PubMed

    Khalafalla, Abdelmalik I; Al-Busada, Khalid A; El-Sabagh, Ibrahim M

    2015-07-07

    Pox and pox-like diseases of camels are a group of exanthematous skin conditions that have become increasingly important economically. Three distinct viruses may cause them: camelpox virus (CMLV), camel parapox virus (CPPV) and camelus dromedary papilloma virus (CdPV). These diseases are often difficult to differentiate based on clinical presentation in disease outbreaks. Molecular methods such as PCR targeting species-specific genes have been developed and used to identify these diseases, but not simultaneously in a single tube. Recently, multiplex PCR has gained reputation as a convenient diagnostic method with cost-and timesaving benefits. In the present communication, we describe the development, optimization and validation of a multiplex PCR assay able to detect simultaneously the genome of the three viruses in one single test allowing for rapid and efficient molecular diagnosis. The assay was developed based on the evaluation and combination of published and new primer sets and was validated with viral genomic DNA extracted from known virus strains (n = 14) and DNA extracted from homogenized clinical skin specimens (n = 86). The assay detects correctly the target pathogens by amplification of targeted genes, even in case of co-infection. The method showed high sensitivity, and the specificity was confirmed by PCR-product sequencing. This assay provide rapid, sensitive and specific method for identifying three important viruses in specimens collected from dromedary camels with varying clinical presentations.

  16. [Comparison between conventional methods, ChromAgar Candida® and PCR method for the identification of Candida species in clinical isolates].

    PubMed

    Estrada-Barraza, Deyanira; Dávalos Martínez, Arturo; Flores-Padilla, Luis; Mendoza-De Elias, Roberto; Sánchez-Vargas, Luis Octavio

    2011-01-01

    The increase in the incidence of yeast species causing fungemia in susceptible immunocompromised patients in the last two decades and the low sensitivity of conventional blood culture has led to the need to develop alternative approaches for the early detection and identification of causative species. The aim of this study was to compare the usefulness of molecular testing by the polymerase chain reaction (PCR) and conventional methods to identify clinical isolates of different species, using the ID32C ATB system (bioMérieux, France), chromogenic culture Chromagar Candida® (CHROMagar, France) and morphogenesis in corn meal agar. We studied 79 isolates, in which the most prevalent species using the system ID32C and PCR was C. albicans, followed by C. tropicalis, C. glabrata and C .krusei. PCR patterns obtained for the identification of clinical isolates were stable and consistent in the various independent studies and showed good reproducibility, concluding that PCR with species-specific primers that amplify genes ITS1 and ITS2 for rRNA or topoisomerase II primers is a very specific and sensitive method for the identification of C. glabrata, C. krusei, C. albicans, and with less specificity for C. tropicalis. Copyright © 2010 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  17. Rapid single nucleotide polymorphism based method for hematopoietic chimerism analysis and monitoring using high-speed droplet allele-specific PCR and allele-specific quantitative PCR.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Uehara, Masayuki; Sugano, Mitsutoshi; Okumura, Nobuo; Honda, Takayuki

    2015-05-20

    Chimerism analysis is important for the evaluation of engraftment and predicting relapse following hematopoietic stem cell transplantation (HSCT). We developed a chimerism analysis for single nucleotide polymorphisms (SNPs), including rapid screening of the discriminable donor/recipient alleles using droplet allele-specific PCR (droplet-AS-PCR) pre-HSCT and quantitation of recipient DNA using AS-quantitative PCR (AS-qPCR) following HSCT. SNP genotyping of 20 donor/recipient pairs via droplet-AS-PCR and the evaluation of the informativity of 5 SNP markers for chimerism analysis were performed. Samples from six follow-up patients were analyzed to assess the chimerism via AS-qPCR. These results were compared with that determined by short tandem repeat PCR (STR-PCR). Droplet-AS-PCR could determine genotypes within 8min. The total informativity using all 5 loci was 95% (19/20). AS-qPCR provided the percentage of recipient DNA in all 6 follow-up patients without influence of the stutter peak or the amplification efficacy, which affected the STR-PCR results. The droplet-AS-PCR had an advantage over STR-PCR in terms of rapidity and simplicity for screening before HSCT. Furthermore, AS-qPCR had better accuracy than STR-PCR for quantification of recipient DNA following HSCT. The present chimerism assay compensates for the disadvantages of STR-PCR and is readily performable in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Detection of Echinococcus multilocularis by MC-PCR: evaluation of diagnostic sensitivity and specificity without gold standard

    PubMed Central

    Wahlström, Helene; Comin, Arianna; Isaksson, Mats; Deplazes, Peter

    2016-01-01

    Introduction A semi-automated magnetic capture probe-based DNA extraction and real-time PCR method (MC-PCR), allowing for a more efficient large-scale surveillance of Echinococcus multilocularis occurrence, has been developed. The test sensitivity has previously been evaluated using the sedimentation and counting technique (SCT) as a gold standard. However, as the sensitivity of the SCT is not 1, test characteristics of the MC-PCR was also evaluated using latent class analysis, a methodology not requiring a gold standard. Materials and methods Test results, MC-PCR and SCT, from a previous evaluation of the MC-PCR using 177 foxes shot in the spring (n=108) and autumn 2012 (n=69) in high prevalence areas in Switzerland were used. Latent class analysis was used to estimate the test characteristics of the MC-PCR. Although it is not the primary aim of this study, estimates of the test characteristics of the SCT were also obtained. Results and discussion This study showed that the sensitivity of the MC-PCR was 0.88 [95% posterior credible interval (PCI) 0.80–0.93], which was not significantly different than the SCT, 0.83 (95% PCI 0.76–0.88), which is currently considered as the gold standard. The specificity of both tests was high, 0.98 (95% PCI 0.94–0.99) for the MC-PCR and 0.99 (95% PCI 0.99–1) for the SCT. In a previous study, using fox scats from a low prevalence area, the specificity of the MC-PCR was higher, 0.999% (95% PCI 0.997–1). One reason for the lower estimate of the specificity in this study could be that the MC-PCR detects DNA from infected but non-infectious rodents eaten by foxes. When using MC-PCR in low prevalence areas or areas free from the parasite, a positive result in the MC-PCR should be regarded as a true positive. Conclusion The sensitivity of the MC-PCR (0.88) was comparable to the sensitivity of SCT (0.83). PMID:26968153

  19. PCR in laboratory diagnosis of human Borrelia burgdorferi infections.

    PubMed

    Schmidt, B L

    1997-01-01

    The laboratory diagnosis of Lyme borreliosis, the most prevalent vector-borne disease in the United States and endemic in parts of Europe and Asia, is currently based on serology with known limitations. Direct demonstration of Borrelia burgdorferi by culture may require weeks, while enzyme-linked immunosorbent assays for antigen detection often lack sensitivity. The development of the PCR has offered a new dimension in the diagnosis. Capable of amplifying minute amounts of DNA into billions of copies in just a few hours, PCR facilitates the sensitive and specific detection of DNA or RNA of pathogenic organisms. This review is restricted to applications of PCR methods in the diagnosis of human B. burgdorferi infections. In the first section, methodological aspects, e.g., sample preparation, target selection, primers and PCR methods, and detection and control of inhibition and contamination, are highlighted. In the second part, emphasis is placed on diagnostic aspects, where PCR results in patients with dermatological, neurological, joint, and ocular manifestations of the disease are discussed. Here, special attention is given to monitoring treatment efficacy by PCR tests. Last, specific guidelines on how to interpret PCR results, together with the advantages and limitations of these new techniques, are presented.

  20. Energy system contribution to 400-metre and 800-metre track running.

    PubMed

    Duffield, Rob; Dawson, Brian; Goodman, Carmel

    2005-03-01

    As a wide range of values has been reported for the relative energetics of 400-m and 800-m track running events, this study aimed to quantify the respective aerobic and anaerobic energy contributions to these events during track running. Sixteen trained 400-m (11 males, 5 females) and 11 trained 800-m (9 males, 2 females) athletes participated in this study. The participants performed (on separate days) a laboratory graded exercsie test and multiple race time-trials. The relative energy system contribution was calculated by multiple methods based upon measures of race VO2, accumulated oxygen deficit (AOD), blood lactate and estimated phosphocreatine degradation (lactate/PCr). The aerobic/anaerobic energy system contribution (AOD method) to the 400-m event was calculated as 41/59% (male) and 45/55% (female). For the 800-m event, an increased aerobic involvement was noted with a 60/40% (male) and 70/30% (female) respective contribution. Significant (P < 0.05) negative correlations were noted between race performance and anaerobic energy system involvement (lactate/PCr) for the male 800-m and female 400-m events (r = - 0.77 and - 0.87 respectively). These track running data compare well with previous estimates of the relative energy system contributions to the 400-m and 800-m events. Additionally, the relative importance and speed of interaction of the respective metabolic pathways has implications to training for these events.

  1. Cytomegalovirus frequency in neonatal intrahepatic cholestasis determined by serology, histology, immunohistochemistry and PCR

    PubMed Central

    Bellomo-Brandao, Maria Angela; Andrade, Paula D; Costa, Sandra CB; Escanhoela, Cecilia AF; Vassallo, Jose; Porta, Gilda; De Tommaso, Adriana MA; Hessel, Gabriel

    2009-01-01

    AIM: To determine cytomegalovirus (CMV) frequency in neonatal intrahepatic cholestasis by serology, histological revision (searching for cytomegalic cells), immunohistochemistry, and polymerase chain reaction (PCR), and to verify the relationships among these methods. METHODS: The study comprised 101 non-consecutive infants submitted for hepatic biopsy between March 1982 and December 2005. Serological results were obtained from the patient’s files and the other methods were performed on paraffin-embedded liver samples from hepatic biopsies. The following statistical measures were calculated: frequency, sensibility, specific positive predictive value, negative predictive value, and accuracy. RESULTS: The frequencies of positive results were as follows: serology, 7/64 (11%); histological revision, 0/84; immunohistochemistry, 1/44 (2%), and PCR, 6/77 (8%). Only one patient had positive immunohistochemical findings and a positive PCR. The following statistical measures were calculated between PCR and serology: sensitivity, 33.3%; specificity, 88.89%; positive predictive value, 28.57%; negative predictive value, 90.91%; and accuracy, 82.35%. CONCLUSION: The frequency of positive CMV varied among the tests. Serology presented the highest positive frequency. When compared to PCR, the sensitivity and positive predictive value of serology were low. PMID:19610143

  2. Diagnosis of invasive fungal infections using real-time PCR assay in paediatric acute leukaemia induction.

    PubMed

    Mandhaniya, Sushil; Iqbal, Sobuhi; Sharawat, Surender Kumar; Xess, Immaculata; Bakhshi, Sameer

    2012-07-01

    Invasive fungal infections (IFI) lead to morbidity and mortality in neutropenic patients and in allogenic stem cell transplantation. Serum-based fungal detection assays have limitation of specificity or sensitivity. Studies on fungal DNA detection using real-time PCR in childhood leukaemia are lacking. The aim of this study was to develop sensitive and specific diagnostic tools for IFI in paediatric acute leukaemia patients using real-time PCR. Of 100 randomised paediatric acute leukaemia patients receiving antifungal prophylaxis with voriconazole/amphotericin B, single peripheral whole blood sample in EDTA was used for Pan-AC real-time PCR assay (detects nine Candida and six Aspergillus species) in patients who failed prophylaxis due to proven, probable, possible or suspected fungal infections. PCR results were retrospectively correlated with clinical profile. Real-time PCR test was positive in 18/29 (62%) patients who failed prophylaxis. The only patient with proven IFI (mucormycosis), real-time PCR assay was negative. Real-time PCR was positive in 2/4 (50%) patients with possible and 16/24 (66.6%) suspected IFI and 5/10 (50%) patients with pneumonia. By applying method A/B, sensitivity and positive predictive value could not be commented due to unproven Aspergillus or Candida infections; specificity and negative predictive values (NPV) were 41% and 100% respectively; by method C (included episodes of possible IFI as true positive), sensitivity, specificity, PPV and NPV were 50%, 36%, 11% and 81% respectively. In those with suspected IFI, 8/24 (33.3%) were PCR negative and unnecessarily received empirical antifungal therapy (EAFT). Real-time PCR is a practical, rapid, non-invasive screening test for excluding IFI in paediatric leukaemia. The high NPV makes real-time PCR a promising tool to use this prior to initiating EAFT in antibiotic-resistant febrile neutropenic patients; this would avoid toxicity, cost and hospitalisation for EAFT (ClinicalTrials.gov identifier:NCT00624143). © 2011 Blackwell Verlag GmbH.

  3. Quantitative detection method of Enterocytozoon hepatopenaei using TaqMan probe real-time PCR.

    PubMed

    Liu, Ya-Mei; Qiu, Liang; Sheng, An-Zhi; Wan, Xiao-Yuan; Cheng, Dong-Yuan; Huang, Jie

    2018-01-01

    A TaqMan probe and a pair of specific primers were selected from the small subunit ribosomal DNA (SSU rDNA) sequence of Enterocytozoon hepatopenaei (EHP); this real-time PCR assay was developed and optimized. It showed a good linearity in detecting standards of EHP SSU rDNA fragments from 4 × 10 2 to 4 × 10 8 copies/reaction using the established method. The detection limit of the qPCR method was as low as 4 × 10 1 copies per reaction, which was higher than the conventional PCR and SYBR Green I-based EHP qPCR reported. Using the qPCR assay, EHP was detected in four batches of slow-growing Penaeus vannamei specimens collected from Tianjin and Zhejiang Province in China was detected using qPCR. The results showed that all the hepatopancreas from the slow-growing P. vannamei specimens were detected as EHP-positive. EHP copies of hepatopancreas in some batches had a negative correlation with the body mass index (BMI) of shrimps; however, not all batches of specimens had this negative correlation between EHP copies of hepatopancreas and BMI. This qPCR technique is sensitive, specific and easy to perform (96 tests in <3 h), which provides technical support for the detection and prevention of EHP. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Analysis of a quantitative PCR assay for CMV infection in liver transplant recipients: an intent to find the optimal cut-off value.

    PubMed

    Martín-Dávila, P; Fortún, J; Gutiérrez, C; Martí-Belda, P; Candelas, A; Honrubia, A; Barcena, R; Martínez, A; Puente, A; de Vicente, E; Moreno, S

    2005-06-01

    Preemptive therapy required highly predictive tests for CMV disease. CMV antigenemia assay (pp65 Ag) has been commonly used for rapid diagnosis of CMV infection. Amplification methods for early detection of CMV DNA are under analysis. To compare two diagnostic methods for CMV infection and disease in this population: quantitative PCR (qPCR) performed in two different samples, plasma and leukocytes (PMNs) and using a commercial diagnostic test (COBAS Amplicor Monitor Test) versus pp65 Ag. Prospective study conducted in liver transplant recipients from February 2000 to February 2001. Analyses were performed on 164 samples collected weekly during early post-transplant period from 33 patients. Agreements higher than 78% were observed between the three assays. Optimal qPCR cut-off values were calculated using ROC curves for two specific antigenemia values. For antigenemia >or=10 positive cells, the optimal cut-off value for qPCR in plasma was 1330 copies/ml, with a sensitivity (S) of 58% and a specificity (E) of 98% and the optimal cut-off value for qPCR-cells was 713 copies/5x10(6) cells (S:91.7% and E:86%). Using a threshold of antigenemia >or=20 positive cells, the optimal cut-off values were 1330 copies/ml for qPCR-plasma (S 87%; E 98%) and 4755 copies/5x10(6) cells for qPCR-cells (S 87.5%; E 98%). Prediction values for the three assays were calculated in patients with CMV disease (9 pts; 27%). Considering the assays in a qualitative way, the most sensitive was CMV PCR in cells (S: 100%, E: 54%, PPV: 40%; NPV: 100%). Using specific cut-off values for disease detection the sensitivity, specificity, PPV and NPV for antigenemia >or=10 positive cells were: 89%; 83%; 67%; 95%, respectively. For qPCR-cells >or=713 copies/5x10(6) cells: 100%; 54%; 33% and 100% and for plasma-qPCR>or=1330 copies/ml: 78%, 77%, 47%, 89% respectively. Optimal cut-off for viral load performed in plasma and cells can be obtained for the breakpoint antigenemia value recommended for initiating preemptive therapy with high specificities and sensitivities. Diagnostic assays like CMV pp65 Ag and quantitative PCR for CMV have similar efficiency and could be recommended as methods of choice for diagnosis and monitoring of active CMV infection after transplantation.

  5. Salmonella spp. contamination in commercial layer hen farms using different types of samples and detection methods.

    PubMed

    Soria, M C; Soria, M A; Bueno, D J; Godano, E I; Gómez, S C; ViaButron, I A; Padin, V M; Rogé, A D

    2017-08-01

    The performance of detection methods (culture methods and polymerase chain reaction assay) and plating media used in the same type of samples were determined as well as the specificity of PCR primers to detected Salmonella spp. contamination in layer hen farms. Also, the association of farm characteristics with Salmonella presence was evaluated. Environmental samples (feces, feed, drinking water, air, boot-swabs) and eggs were taken from 40 layer hen houses. Salmonella spp. was most detected in boot-swabs taken around the houses (30% and 35% by isolation and PCR, respectively) follow by fecal samples (15.2% and 13.6% by isolation and PCR, respectively). Eggs, drinking water, and air samples were negative for Salmonella detection. Salmonella Schwarzengrund and S. Enteritidis were the most isolated serotypes. For plating media, relative specificity was 1, and the relative sensitivity was greater for EF-18 agar than XLDT agar in feed and fecal samples. However, relative sensitivity was greater in XLDT agar than EF-18 agar for boot-swab samples. Agreement was between fair to good depending on the sample, and it was good between isolation and PCR (feces and boot-swabs), without agreement for feed samples. Salmonella spp. PCR was positive for all strains, while S. Typhimurium PCR was negative. Salmonella Enteritidis PCR used was not specific. Based in the multiple logistic regression analyses, categorization by counties was significant for Salmonella spp. presence (P-value = 0.010). This study shows the importance of considering different types of samples, plating media and detection methods during a Salmonella spp. monitoring study. In addition, it is important to incorporate the sampling of floors around the layer hen houses to learn if biosecurity measures should be strengthened to minimize the entry and spread of Salmonella in the houses. Also, the performance of some PCR methods and S. Enteritidis PCR should be improved, and biosecurity measures in hen farms must be reinforced in the region of more concentrated layer hen houses to reduce the probability of Salmonella spp. presence. © 2017 Poultry Science Association Inc.

  6. Nested-PCR and a new ELISA-based NovaLisa test kit for malaria diagnosis in an endemic area of Thailand.

    PubMed

    Thongdee, Pimwan; Chaijaroenkul, Wanna; Kuesap, Jiraporn; Na-Bangchang, Kesara

    2014-08-01

    Microscopy is considered as the gold standard for malaria diagnosis although its wide application is limited by the requirement of highly experienced microscopists. PCR and serological tests provide efficient diagnostic performance and have been applied for malaria diagnosis and research. The aim of this study was to investigate the diagnostic performance of nested PCR and a recently developed an ELISA-based new rapid diagnosis test (RDT), NovaLisa test kit, for diagnosis of malaria infection, using microscopic method as the gold standard. The performance of nested-PCR as a malaria diagnostic tool is excellent with respect to its high accuracy, sensitivity, specificity, and ability to discriminate Plasmodium species. The sensitivity and specificity of nested-PCR compared with the microscopic method for detection of Plasmodium falciparum, Plasmodium vivax, and P. falciparum/P. vivax mixed infection were 71.4 vs 100%, 100 vs 98.7%, and 100 vs 95.0%, respectively. The sensitivity and specificity of the ELISA-based NovaLisa test kit compared with the microscopic method for detection of Plasmodium genus were 89.0 vs 91.6%, respectively. NovaLisa test kit provided comparable diagnostic performance. Its relatively low cost, simplicity, and rapidity enables large scale field application.

  7. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    PubMed

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  8. Nucleic Acid Amplification Based Diagnostic of Lyme (Neuro-)borreliosis – Lost in the Jungle of Methods, Targets, and Assays?

    PubMed Central

    Nolte, Oliver

    2012-01-01

    Laboratory based diagnosis of infectious diseases usually relies on culture of the disease causing micro-organism, followed by identification and susceptibility testing. Since Borrelia burgdorferi sensu lato, the etiologic agent of Lyme disease or Lyme borreliosis, requires very specific culture conditions (e.g. specific liquid media, long term cul-ture) traditional bacteriology is often not done on a routine basis. Instead, confirmation of the clinical diagnosis needs ei-ther indirect techniques (like serology or measurement of cellular activity in the presence of antigens) or direct but culture independent techniques, like microscopy or nucleic acid amplification techniques (NAT), with polymerase chain reaction (PCR) being the most frequently applied NAT method in routine laboratories. NAT uses nucleic acids of the disease causing micro-organism as template for amplification, isolated from various sources of clinical specimens. Although the underlying principle, adoption of the enzymatic process running during DNA duplication prior to prokaryotic cell division, is comparatively easy, a couple of ‘pitfalls’ is associated with the technique itself as well as with interpretation of the results. At present, no commercial, CE-marked and sufficiently validated PCR assay is available. A number of homebrew assays have been published, which are different in terms of target (i.e. the gene targeted by the amplification primers), method (nested PCR, PCR followed by hybridization, real-time PCR) and validation criteria. Inhibitory compounds may lead to false negative results, if no appropriate internal control is included. Carry-over of amplicons, insufficient handling and workflow and/or insufficiently validated targets/primers may result in false positive results. Different targets may yield different analytical sensitivity, depending, among other factors, of the redundancy of a target gene in the genome. Per-formance characteristics (e.g. analytical sensitivity and specificity, clinical sensitivity and specificity, reproducibility, etc.) are, if available, only applicable to a specific assay, running in a specific laboratory. Finally, not only the NAT/PCR method itself, but also the process of DNA isolation from the specimen, is highly diverse and may have fundamental im-pact on the (expected) PCR result. Of concern are distribution effects of DNA, in particular, if only low numbers of bacte-ria/genomes are present in a sample, as it is the case for instance in cerebrospinal fluids. For the ordering physician and for the patient requesting PCR analysis, these ‘pitfalls’ are usually invisible. As a conse-quence, the reported result (i.e. PCR negative or positive for B. burgdorferi) is hard to interpret, especially, if the reported PCR result is contradictory to the clinical diagnosis or other laboratory findings. Moreover, due to the high number of dif-ferent assays in use, two laboratories, testing the same specimen, might come to different PCR results. The current paper wants to summarize the available PCR/NAT assays for the detection of B. burgdorferi DNA in clinical specimens, with special attention to neurologic disorders, and to discuss the difficulties in PCR analysis and result inter-pretation, associated thereof. In view of growing numbers of patients who are diagnosed of having Lyme disease, and ac-knowledging a substantial growth in knowledge regarding other tick- or vector-borne pathogens, which might be able to induce symptoms comparable to Lyme (neuro-)borreliosis, efforts are urgently needed to standardize and harmonize methods for B. burgdorferi nucleic acid amplification. PMID:23230454

  9. EVALUATION OF A RAPID, QUANTITATIVE REAL-TIME PCR METHOD FOR ENUMERATION OF PATHOGENIC CANDIDA CELLS IN WATER

    EPA Science Inventory

    Quantitative Real-Time PCR (QRT-PCR) technology, incorporating fluorigenic 5' nuclease (TaqMan?) chemistry, was developed for the specific detection and quantification of six pathogenic species of Candida (C. albicans, C. tropicalis, C. krusei, C. parapsilosis, C. glabrata and C....

  10. Use of amplicon sequencing to improve sensitivity in PCR-based detection of microbial pathogen in environmental samples.

    PubMed

    Saingam, Prakit; Li, Bo; Yan, Tao

    2018-06-01

    DNA-based molecular detection of microbial pathogens in complex environments is still plagued by sensitivity, specificity and robustness issues. We propose to address these issues by viewing them as inadvertent consequences of requiring specific and adequate amplification (SAA) of target DNA molecules by current PCR methods. Using the invA gene of Salmonella as the model system, we investigated if next generation sequencing (NGS) can be used to directly detect target sequences in false-negative PCR reaction (PCR-NGS) in order to remove the SAA requirement from PCR. False-negative PCR and qPCR reactions were first created using serial dilutions of laboratory-prepared Salmonella genomic DNA and then analyzed directly by NGS. Target invA sequences were detected in all false-negative PCR and qPCR reactions, which lowered the method detection limits near the theoretical minimum of single gene copy detection. The capability of the PCR-NGS approach in correcting false negativity was further tested and confirmed under more environmentally relevant conditions using Salmonella-spiked stream water and sediment samples. Finally, the PCR-NGS approach was applied to ten urban stream water samples and detected invA sequences in eight samples that would be otherwise deemed Salmonella negative. Analysis of the non-target sequences in the false-negative reactions helped to identify primer dime-like short sequences as the main cause of the false negativity. Together, the results demonstrated that the PCR-NGS approach can significantly improve method sensitivity, correct false-negative detections, and enable sequence-based analysis for failure diagnostics in complex environmental samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Accurate measurement of transgene copy number in crop plants using droplet digital PCR

    USDA-ARS?s Scientific Manuscript database

    Technical abstract: Genetic transformation is a powerful means for the improvement of crop plants, but requires labor and resource intensive methods. An efficient method for identifying single copy transgene insertion events from a population of independent transgenic lines is desirable. Currently ...

  12. Accurate measure of transgene copy number in crop plants using droplet digital PCR

    USDA-ARS?s Scientific Manuscript database

    Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy numb...

  13. Detection and quantification of Plectosphaerella cucumerina, a potential biological control agent of potato cyst nematodes, by using conventional PCR, real-time PCR, selective media, and baiting.

    PubMed

    Atkins, S D; Clark, I M; Sosnowska, D; Hirsch, P R; Kerry, B R

    2003-08-01

    Potato cyst nematodes (PCN) are serious pests in commercial potato production, causing yield losses valued at approximately $300 million in the European Community. The nematophagous fungus Plectosphaerella cucumerina has demonstrated its potential as a biological control agent against PCN populations by reducing field populations by up to 60% in trials. The use of biological control agents in the field requires the development of specific techniques to monitor the release, population size, spread or decline, and pathogenicity against its host. A range of methods have therefore been developed to monitor P. cucumerina. A species-specific PCR primer set (PcCF1-PcCR1) was designed that was able to detect the presence of P. cucumerina in soil, root, and nematode samples. PCR was combined with a bait method to identify P. cucumerina from infected nematode eggs, confirming the parasitic ability of the fungus. A selective medium was adapted to isolate the fungus from root and soil samples and was used to quantify the fungus from field sites. A second P. cucumerina-specific primer set (PcRTF1-PcRTR1) and a Taqman probe (PcRTP1) were designed for real-time PCR quantification of the fungus and provided a very sensitive means of detecting the fungus from soil. PCR, bait, and culture methods were combined to investigate the presence and abundance of P. cucumerina from two field sites in the United Kingdom where PCN populations were naturally declining. All methods enabled differences in the activity of P. cucumerina to be detected, and the results demonstrated the importance of using a combination of methods to investigate population size and activity of fungi.

  14. Development of Nested PCR-Based Specific Markers for Detection of Peach Rosette Mosaic Virus in Plant Quarantine.

    PubMed

    Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H

    2016-03-01

    The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.

  15. Production of anti-digoxigenin antibody HRP conjugate for PCR-ELISA DIG detection system.

    PubMed

    Gill, Pooria; Forouzandeh, Mehdi; Rahbarizadeh, Fatemeh; Ramezani, Reihaneh; Rasaee, Mohammad Javad

    2006-01-01

    There are several methods used to visualize the end product of polymerase chain reactions. One of these methods is an ELISA-based detection system (PCR-ELISA) which is very sensitive and can be used to measure the PCR products quantitatively by a colorimetric method. According to this technique, copies of DNA segments from genomic DNA are amplified by PCR with incorporation of digoxigenin-11-dUTP. Samples are analyzed in a microtiter plate format by alkaline denaturation and are hybridized to biotinylated allele-specific capture probes bound to streptavidin coated plates. Use of the produced anti-digoxigenin antibody horseradish peroxidase conjugate and the substrate 2,2'-azino-di-3-ethylbenzthiazolinsulfonate (ABTS) detected the hybridized DNA. One of the key components in this procedure is the anti-digoxigenin antibody HRP conjugate. Described here is the preparation, purification, and characterization of anti-digoxigenin antibody HRP conjugate for use in the PCR-ELISA DIG detection system. Several biochemical protocols and modifications were applied to increase the sensitivity and specificity of this conjugate for an efficient and cost-effective product.

  16. COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

    PubMed

    Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

    2017-06-01

    Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

  17. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus.

    PubMed

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-10-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.

  18. Development of Nested PCR, Multiplex PCR, and Loop-Mediated Isothermal Amplification Assays for Rapid Detection of Cylindrocladium scoparium on Eucalyptus

    PubMed Central

    Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui

    2016-01-01

    Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691

  19. PCR method based on the ogdH gene for the detection of Salmonella spp. from chicken meat samples.

    PubMed

    Jin, Un-Ho; Cho, Sung-Hak; Kim, Min-Gon; Ha, Sang-Do; Kim, Keun-Sung; Lee, Kyu-Ho; Kim, Kwang-Yup; Chung, Duck Hwa; Lee, Young-Choon; Kim, Cheorl-Ho

    2004-09-01

    In a previous paper, the ogdH gene that encodes 2-oxoglutarate dehydrogenase was isolated from Salmonella typhimurium. The catalytic N-terminal region in the enzyme was found to be very specific for the Salmonella species. Therefore, the aim of the present study was to detect S. typhimurium in food sources using primers designed for OGDH-1 and OGDH-2 which were based on the salmonella-specific region of the ogdH gene. A simple polymerase chain reaction (PCR) detection method was developed to detect low numbers of S. typhimurium in a chicken meat microbial consortium. Using the ogdH-specific primers under stringent amplification conditions and for gene probe analysis, fewer than 100 colony-forming units (CFUs) were detectable when pure cultures were employed. When the PCR assay was run on S. typhimurium-contaminated meat contents, only the positive meat samples containing as few as 200 CFUs reacted to the assay. The method employed for sample processing is simple and it was determined to provide a sensitive means of detecting trace amounts of S. typhimurium-specific sequences in the presence of mixed meat microbial populations. When compared with six representative intestinal gram-negative bacterial strains in foods, including Vibrio parahaemolyticus, V. vulnificus, Enterobacter cloacae, E. coli O157:H7, Pseudomonas aeruginosa, and Proteus sp., S. typhimurium had a unique and distinct PCR product (796 bp). In conclusion, the two OGDH primers were found to be rapid and sensitive detectors of Salmonella spp for the PCR method. Copyright 2004 The Microbiological Society of Korea

  20. Field evaluation of the photo-induced electron transfer fluorogenic primers (PET) real-time PCR for the detection of Plasmodium falciparum in Tanzania

    PubMed Central

    2014-01-01

    Background Accurate diagnosis of malaria infections remains challenging, especially in the identification of submicroscopic infections. New molecular diagnostic tools that are inexpensive, sensitive enough to detect low-level infections and suitable in laboratory settings of resource-limited countries are required for malaria control and elimination programmes. Here the diagnostic potential of a recently developed photo-induced electron transfer fluorogenic primer (PET) real-time polymerase chain reaction (PCR) called PET-PCR was investigated. This study aimed to (i) evaluate the use of this assay as a method for the detection of both Plasmodium falciparum and other Plasmodium species infections in a developing country’s diagnostic laboratory; and, (ii) determine the assay’s sensitivity and specificity compared to a nested 18S rRNA PCR. Methods Samples used in this study were obtained from a previous study conducted in the region of Iringa, Tanzania. A total of 303 samples from eight health facilities in Tanzania were utilized for this evaluation. All samples were screened using the multiplex PET-PCR assay designed to detect Plasmodium genus and P. falciparum initially in laboratory in Tanzania and then repeated at a reference laboratory at the CDC in the USA. Microscopy data was available for all the 303 samples. A subset of the samples were tested in a blinded fashion to find the sensitivity and specificity of the PET-PCR compared to the nested 18S rRNA PCR. Results Compared to microscopy, the PET-PCR assay was 59% more sensitive in detecting P. falciparum infections. The observed sensitivity and specificity were 100% (95% confidence interval (CI0.95) = 94-100%) and (CI0.95 = 96-100%), respectively, for the PET-PCR assay when compared to nested 18S rRNA PCR. When compared to 18S rRNA PCR, microscopy had a low sensitivity of 40% (CI0.95 = 23-61%) and specificity of 100% (CI0.95 = 96-100%). The PET-PCR results performed in the field laboratory in Tanzania were in 100% concordance with the results obtained at the reference laboratory in the USA. Conclusion The PET-PCR is a new molecular diagnostic tool with similar performance characteristics as commonly used PCR methods that is less expensive, easy to use, and amiable to large scale-surveillance studies in developing country settings. PMID:24467985

  1. Comparison of diagnostic methods to detect Histoplasma capsulatum in serum and blood samples from AIDS patients

    PubMed Central

    da Silva, Marcos Vinicius; Criado, Paulo Ricardo; Luiz, Olinda do Carmo; Vicentini, Adriana Pardini

    2018-01-01

    Background Although early and rapid detection of histoplasmosis is essential to prevent morbidity and mortality, few diagnostic tools are available in resource-limited areas, especially where it is endemic and HIV/AIDS is also epidemic. Thus, we compared conventional and molecular methods to detect Histoplasma capsulatum in sera and blood from HIV/AIDS patients. Methodology We collected a total of 40 samples from control volunteers and patients suspected of histoplasmosis, some of whom were also infected with other pathogens. Samples were then analyzed by mycological, serological, and molecular methods, and stratified as histoplasmostic with (group I) or without AIDS (group II), uninfected (group III), and infected with HIV and other pathogens only (group IV). All patients were receiving treatment for histoplasmosis and other infections at the time of sample collection. Results Comparison of conventional methods with nested PCR using primers against H. capsulatum 18S rRNA (HC18S), 5.8S rRNA ITS (HC5.8S-ITS), and a 100 kDa protein (HC100) revealed that sensitivity against sera was highest for PCR with HC5.8S-ITS, followed by immunoblotting, double immunodiffusion, PCR with HC18S, and PCR with HC100. Specificity was equally high for double immunodiffusion, immunoblotting and PCR with HC100, followed for PCR with HC18S and HC5.8-ITS. Against blood, sensitivity was highest for PCR with HC5.8S-ITS, followed by PCR with HC18S, Giemsa staining, and PCR with HC100. Specificity was highest for Giemsa staining and PCR with HC100, followed by PCR with HC18S and HC5.8S-ITS. PCR was less efficient in patients with immunodeficiency due to HIV/AIDS and/or related diseases. Conclusion Molecular techniques may detect histoplasmosis even in cases with negative serology and mycology, potentially enabling early diagnosis. PMID:29342162

  2. Highly Sensitive Detection of Low-Abundance White Spot Syndrome Virus by a Pre-Amplification PCR Method.

    PubMed

    Pan, Xiaoming; Zhang, Yanfang; Sha, Xuejiao; Wang, Jing; Li, Jing; Dong, Ping; Liang, Xingguo

    2017-03-28

    White spot syndrome virus (WSSV) is a major threat to the shrimp farming industry and so far there is no effective therapy for it, and thus early diagnostic of WSSV is of great importance. However, at the early stage of infection, the extremely low-abundance of WSSV DNA challenges the detection sensitivity and accuracy of PCR. To effectively detect low-abundance WSSV, here we developed a pre-amplification PCR (pre-amp PCR) method to amplify trace amounts of WSSV DNA from massive background genomic DNA. Combining with normal specific PCR, 10 copies of target WSSV genes were detected from ~10 10 magnitude of backgrounds. In particular, multiple target genes were able to be balanced amplified with similar efficiency due to the usage of the universal primer. The efficiency of the pre-amp PCR was validated by nested-PCR and quantitative PCR, and pre-amp PCR showed higher efficiency than nested-PCR when multiple targets were detected. The developed method is particularly suitable for the super early diagnosis of WSSV, and has potential to be applied in other low-abundance sample detection cases.

  3. [Identification of Env-specific monoclonal antibodies from Chinese HIV-1 infected person by magnetic beads separating B cells and single cell RT-PCR cloning].

    PubMed

    Huang, Xiang-Ying; Yu, Shuang-Qing; Cheng, Zhan; Ye, Jing-Rong; Xu, Ke; Feng, Xia; Zeng, Yi

    2013-04-01

    To establish a simple and practical method for screening of Env-specific monoclonal antibodies from HIV-1 infected individuals. Human B cells were purified by negative sorting from PBMCs and memory B cells were further enriched using anti-CD27 microbeads. Gp120 antigen labbled with biotin was incubated with memory B cells to specifically bind IgG on cells membrane. The memory B cells expressing the Env-specific antibody were harvested by magnetic beads separating, counted and diluted to the level of single cell in each PCR well that loading with catch buffer containing RNase inhibitor to get RNAs. The antibody genes were amplified by single cell RT-PCR and nested PCR, cloned into eukaryotic expression vectors and transfected into 293T cells. The binding activity of recombinant antibodies to Env were tested by ELISA. Three monocolonal Env-specific antibodies were isolated from one HIV-1 infected individual. We can obtain Env-specific antibody by biotin labbled antigen, magnetic beads separating technique coupled with single cell RT-PCR and expression cloning.

  4. Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

    PubMed

    Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

    2018-08-01

    Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p < 0.05) with Fusarium sp. counts (CFU/g). These results suggest that the PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. Angiotensin-converting enzyme insertion/deletion polymorphism genotyping error: the cause and a possible solution to the problem.

    PubMed

    Saracevic, Andrea; Simundic, Ana-Maria; Celap, Ivana; Luzanic, Valentina

    2013-07-01

    Rigat and colleagues were the first ones to develop a rapid PCR-based assay for identifying the angiotensin converting enzyme insertion/deletion (I/D) polymorphism. Due to a big difference between the length of the wild-type and mute alleles the PCR method is prone to mistyping because of preferential amplification of the D allele causing depicting I/D heterozygotes as D/D homozygotes. The aim of this study was to investigate whether this preferential amplification can be repressed by amplifying a longer DNA fragment in a so called Long PCR protocol. We also aimed to compare the results of genotyping using five different PCR protocols and to estimate the mistyping rate. The study included 200 samples which were genotyped using standard method used in our laboratory, a stepdown PCR, PCR protocol with the inclusion of 4 % DMSO, PCR with the use of insertion specific primers and new Long PCR method. The results of this study have shown that accurate ACE I/D polymorphism genotyping can be accomplished with the standard and the Long PCR method. Also, as of our results, accurate ACE I/D polymorphism genotyping can be accomplished regardless of the method used. Therefore, if the standard method is optimized more cautiously, accurate results can be obtained by this simple, inexpensive and rapid PCR protocol.

  6. A PCR method for the detection and differentiation of Lentinus edodes and Trametes versicolor in defined-mixed cultures used for wastewater treatment.

    PubMed

    García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M

    2005-06-01

    A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes.

  7. Detection of influenza virus types A and B and type A subtypes (H1, H3, and H5) by multiplex polymerase chain reaction.

    PubMed

    Boonsuk, Pitirat; Payungporn, Sunchai; Chieochansin, Thaweesak; Samransamruajkit, Rujipat; Amonsin, Alongkorn; Songserm, Thaweesak; Chaisingh, Arunee; Chamnanpood, Pornchai; Chutinimitkul, Salin; Theamboonlers, Apiradee; Poovorawan, Yong

    2008-07-01

    Infections with influenza virus type A and B present serious public health problems on a global scale. However, only influenza A virus has been reported to cause fatal pandemic in many species. To provide suitable clinical management and prevent further virus transmission, efficient and effective clinical diagnosis is essential. Therefore, we developed multiplex PCR assays for detecting influenza types A and B and the subtypes of influenza A virus (H1, H3 and H5). Upon performing multiplex PCR assays with type-specific primer sets, the clearly distinguishable products representing influenza A and B virus were separated by agarose gel electrophoresis. In addition, the subtypes of influenza A virus (H1, H3 and H5), which are most common in humans, can be readily distinguished by PCR with subtype-specific primer sets, yielding PCR products of different sizes depending on which subtype has been amplified. This method was tested on 46 influenza virus positive specimens of avian and mammalian (dog and human) origins collected between 2006 and 2008. The sensitivity of this method, tested against known concentrations of each type and subtype specific plasmid, was established to detect 10(3) copies/microl. The method's specificity was determined by testing against other subtypes of influenza A virus (H2, H4 and H6-H15) and respiratory pathogens commonly found in humans. None of them could be amplified, thus excluding cross reactivity. In conclusion, the multiplex PCR assays developed are advantageous as to rapidity, specificity, and cost effectiveness.

  8. Simultaneous mutation detection of three homoeologous genes in wheat by High Resolution Melting analysis and Mutation Surveyor.

    PubMed

    Dong, Chongmei; Vincent, Kate; Sharp, Peter

    2009-12-04

    TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful tool for reverse genetics, combining traditional chemical mutagenesis with high-throughput PCR-based mutation detection to discover induced mutations that alter protein function. The most popular mutation detection method for TILLING is a mismatch cleavage assay using the endonuclease CelI. For this method, locus-specific PCR is essential. Most wheat genes are present as three similar sequences with high homology in exons and low homology in introns. Locus-specific primers can usually be designed in introns. However, it is sometimes difficult to design locus-specific PCR primers in a conserved region with high homology among the three homoeologous genes, or in a gene lacking introns, or if information on introns is not available. Here we describe a mutation detection method which combines High Resolution Melting (HRM) analysis of mixed PCR amplicons containing three homoeologous gene fragments and sequence analysis using Mutation Surveyor software, aimed at simultaneous detection of mutations in three homoeologous genes. We demonstrate that High Resolution Melting (HRM) analysis can be used in mutation scans in mixed PCR amplicons containing three homoeologous gene fragments. Combining HRM scanning with sequence analysis using Mutation Surveyor is sensitive enough to detect a single nucleotide mutation in the heterozygous state in a mixed PCR amplicon containing three homoeoloci. The method was tested and validated in an EMS (ethylmethane sulfonate)-treated wheat TILLING population, screening mutations in the carboxyl terminal domain of the Starch Synthase II (SSII) gene. Selected identified mutations of interest can be further analysed by cloning to confirm the mutation and determine the genomic origin of the mutation. Polyploidy is common in plants. Conserved regions of a gene often represent functional domains and have high sequence similarity between homoeologous loci. The method described here is a useful alternative to locus-specific based methods for screening mutations in conserved functional domains of homoeologous genes. This method can also be used for SNP (single nucleotide polymorphism) marker development and eco-TILLING in polyploid species.

  9. Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) for large genomic rearrangements (LGRs) detection: A new approach to assess quantitative status of BRCA1 gene in a reference laboratory.

    PubMed

    Minucci, Angelo; De Paolis, Elisa; Concolino, Paola; De Bonis, Maria; Rizza, Roberta; Canu, Giulia; Scaglione, Giovanni Luca; Mignone, Flavio; Scambia, Giovanni; Zuppi, Cecilia; Capoluongo, Ettore

    2017-07-01

    Evaluation of copy number variation (CNV) in BRCA1/2 genes, due to large genomic rearrangements (LGRs), is a mandatory analysis in hereditary breast and ovarian cancers families, if no pathogenic variants are found by sequencing. LGRs cannot be detected by conventional methods and several alternative methods have been developed. Since these approaches are expensive and time consuming, identification of alternative screening methods for LGRs detection is needed in order to reduce and optimize the diagnostic procedure. The aim of this study was to investigate a Competitive PCR-High Resolution Melting Analysis (C-PCR-HRMA) as molecular tool to detect recurrent BRCA1 LGRs. C-PCR-HRMA was performed on exons 3, 14, 18, 19, 20 and 21 of the BRCA1 gene; exons 4, 6 and 7 of the ALB gene were used as reference fragments. This study showed that it is possible to identify recurrent BRCA1 LGRs, by melting peak height ratio between target (BRCA1) and reference (ALB) fragments. Furthermore, we underline that a peculiar amplicon-melting profile is associated to a specific BRCA1 LGR. All C-PCR-HRMA results were confirmed by Multiplex ligation-dependent probe amplification. C-PCR-HRMA has proved to be an innovative, efficient and fast method for BRCA1 LGRs detection. Given the sensitivity, specificity and ease of use, c-PCR-HRMA can be considered an attractive and powerful alternative to other methods for BRCA1 CNVs screening, improving molecular strategies for BRCA testing in the context of Massive Parallel Sequencing. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Detection of epidermal growth factor receptor mutation in lung cancer by droplet digital polymerase chain reaction

    PubMed Central

    Xu, Qing; Zhu, Yazhen; Bai, Yali; Wei, Xiumin; Zheng, Xirun; Mao, Mao; Zheng, Guangjuan

    2015-01-01

    Background Two types of epidermal growth factor receptor (EGFR) mutations in exon 19 and exon 21 (ex19del and L858R) are prevalent in lung cancer patients and sensitive to targeted EGFR inhibition. A resistance mutation in exon 20 (T790M) has been found to accompany drug treatment when patients relapse. These three mutations are valuable companion diagnostic biomarkers for guiding personalized treatment. Quantitative polymerase chain reaction (qPCR)-based methods have been widely used in the clinic by physicians to guide treatment decisions. The aim of this study was to evaluate the technical and clinical sensitivity and specificity of the droplet digital polymerase chain reaction (ddPCR) method in detecting the three EGFR mutations in patients with lung cancer. Methods Genomic DNA from H1975 and PC-9 cells, as well as 92 normal human blood specimens, was used to determine the technical sensitivity and specificity of the ddPCR assays. Genomic DNA of formalin-fixed, paraffin-embedded specimens from 78 Chinese patients with lung adenocarcinoma were assayed using both qPCR and ddPCR. Results The three ddPCR assays had a limit of detection of 0.02% and a wide dynamic range from 1 to 20,000 copies measurement. The L858R and ex19del assays had a 0% background level in the technical and clinical settings. The T790M assay appeared to have a 0.03% technical background. The ddPCR assays were robust for correct determination of EGFR mutation status in patients, and the dynamic range appeared to be better than qPCR methods. The ddPCR assay for T790M could detect patient samples that the qPCR method failed to detect. About 49% of this patient cohort had EGFR mutations (L858R, 15.4%; ex19del, 29.5%; T790M, 6.4%). Two patients with the ex19del mutation also had a naïve T790M mutation. Conclusion These data suggest that the ddPCR method could be useful in the personalized treatment of patients with lung cancer. PMID:26124670

  11. Cloned plasmid DNA fragments as calibrators for controlling GMOs: different real-time duplex quantitative PCR methods.

    PubMed

    Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc

    2004-03-01

    Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.

  12. Identification of Lactobacillus delbrueckii and Streptococcus thermophilus Strains Present in Artisanal Raw Cow Milk Cheese Using Real-time PCR and Classic Plate Count Methods.

    PubMed

    Stachelska, Milena A

    2017-12-04

    The aim of this paper was to detect Lactobacillus delbrueckii and Streptococcus thermophilus using real-time quantitative PCR assay in 7-day ripening cheese produced from unpasteurised milk. Real-time quantitative PCR assays were designed to identify and enumerate the chosen species of lactic acid bacteria (LAB) in ripened cheese. The results of molecular quantification and classic bacterial enumeration showed a high level of similarity proving that DNA extraction was carried out in a proper way and that genomic DNA solutions were free of PCR inhibitors. These methods revealed the presence of L. delbrueckii and S. thermophilus. The real-time PCR enabled quantification with a detection of 101-103 CFU/g of product. qPCR-standard curves were linear over seven log units down to 101 copies per reaction; efficiencies ranged from 77.9% to 93.6%. Cheese samples were analysed with plate count method and qPCR in parallel. Compared with the classic plate count method, the newly developed qPCR method provided faster and species specific identification of two dairy LAB and yielded comparable quantitative results.

  13. Application of tetraplex PCR for detection of Vibrio cholerae, V. parahaemolyticus, V. vulnificus and V. mimicus in cockle.

    PubMed

    Senachai, Pachara; Chomvarin, Chariya; Namwat, Wises; Wongboot, Warawan; Wongwajana, Suwin; Tangkanakul, Waraluk

    2013-03-01

    A tetraplex PCR method was developed for simultaneous detection of Vibrio cholerae, V. parahaemolyticus, V. vulnificus and V. mimicus in cockle samples in comparison with conventional culture method. Specific primers targeting ompW of V. cholerae, tl of V. parahaemolyticus, hsp60 of V. vulnificus and sodB of V. mimicus were employed in the same PCR. Detection limit of the tetraplex PCR assay was 104 cfu/ml (400 cfu/PCR reaction) for pure cultures of all four species of Vibrio. In Vibrio spiked cockle samples, the limit of detection after 6 hours enrichment in alkaline peptone water was 1 cfu/10 g of cockle tissue for three Vibrio spp, except for V. mimicus that was 102 cfu/10 g of cockle tissue. When the tetraplex PCR and culture methods were applied to 100 cockle samples, V. parahaemolyticus, V. vulnificus, V. cholerae and V. mimicus were detected in 100, 98, 80 and 9% of the samples by tetraplex PCR and in 76, 42, 0 and 0% by the culture method, respectively. This developed tetraplex PCR method should be suitable for simultaneous and rapid detection of Vibrio species in food samples and for food safety assessment.

  14. Comparison of viable plate count, turbidity measurement and real-time PCR for quantification of Porphyromonas gingivalis.

    PubMed

    Clais, S; Boulet, G; Van Kerckhoven, M; Lanckacker, E; Delputte, P; Maes, L; Cos, P

    2015-01-01

    The viable plate count (VPC) is considered as the reference method for bacterial enumeration in periodontal microbiology but shows some important limitations for anaerobic bacteria. As anaerobes such as Porphyromonas gingivalis are difficult to culture, VPC becomes time-consuming and less sensitive. Hence, efficient normalization of experimental data to bacterial cell count requires alternative rapid and reliable quantification methods. This study compared the performance of VPC with that of turbidity measurement and real-time PCR (qPCR) in an experimental context using highly concentrated bacterial suspensions. Our TaqMan-based qPCR assay for P. gingivalis 16S rRNA proved to be sensitive and specific. Turbidity measurements offer a fast method to assess P. gingivalis growth, but suffer from high variability and a limited dynamic range. VPC was very time-consuming and less repeatable than qPCR. Our study concludes that qPCR provides the most rapid and precise approach for P. gingivalis quantification. Although our data were gathered in a specific research context, we believe that our conclusions on the inferior performance of VPC and turbidity measurements in comparison to qPCR can be extended to other research and clinical settings and even to other difficult-to-culture micro-organisms. Various clinical and research settings require fast and reliable quantification of bacterial suspensions. The viable plate count method (VPC) is generally seen as 'the gold standard' for bacterial enumeration. However, VPC-based quantification of anaerobes such as Porphyromonas gingivalis is time-consuming due to their stringent growth requirements and shows poor repeatability. Comparison of VPC, turbidity measurement and TaqMan-based qPCR demonstrated that qPCR possesses important advantages regarding speed, accuracy and repeatability. © 2014 The Society for Applied Microbiology.

  15. Evaluation of RIDA®GENE norovirus GI/GII real time RT-PCR using stool specimens collected from children and adults with acute gastroenteritis.

    PubMed

    Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R

    2018-04-10

    Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.

  16. Multiparametric comparison of chromogenic-based culture methods used to assess the microbiological quality of drinking water and the mFC method combined with a molecular confirmation procedure.

    PubMed

    Maheux, Andrée F; Dion-Dupont, Vanessa; Bisson, Marc-Antoine; Bouchard, Sébastien; Jubinville, Éric; Nkuranga, Martine; Rodrigue, Lynda; Bergeron, Michel G; Rodriguez, Manuel J

    2015-03-01

    MI agar and Colilert(®), as well as mFC agar combined with an Escherichia coli-specific molecular assay (mFC + E. coli rtPCR), were compared in terms of their sensitivity, ease of use, time to result and affordability. The three methods yielded a positive E. coli signal for 11.5, 10.8, and 11.5% of the 968 well water samples tested, respectively. One hundred and thirty-six (136) samples gave blue colonies on mFC agar and required confirmation. E. coli-specific rtPCR showed false-positive results in 23.5% (32/136) of cases. In terms of ease of use, Colilert was the simplest method to use while the MI method provided ease of use comparable to all membrane filtration methods. However, the mFC + E. coli rtPCR assay required highly trained employees for confirmation purposes. In terms of affordability, and considering contamination rate of well water samples tested, the Colilert method and the mFC + E. coli rtPCR assay were at least five times more costly than the MI agar method. Overall, compared with the other two methods tested, the MI agar method offers the most advantages to assess drinking water quality.

  17. A SIMPLE AND EFFECTIVE MULTIPLEX PCR TECHNIQUE FOR DETECTING HUMAN PATHOGENIC TAENIA EGGS IN HOUSEFLIES.

    PubMed

    Pornruseetriratn, Siritavee; Maipanich, Wanna; Sa-nguankiat, Surapol; Pubampen, Somchit; Poodeepiyasawat, Akkarin; Thaenkham, Urusa

    2017-01-01

    Taenia solium, T. saginata, and T. asiatica are cestode pathogens causing taeniasis in humans. Houseflies can transfer Taenia eggs to food. However, houseflies are thought to carry only small numbers of Taenia eggs, sometimes fewer than 10. Although several PCR-based methods have been developed to detect Taenia DNA, these require more than 10 eggs for adequate detection. We developed a multiplex PCR method with high specificity for the discrimination among the eggs of the three Taenia species, T. solium, T. saginata, and T. asiatica, using 18S ribosomal DNA (rDNA) as a genetic marker. This technique was found to be highly sensitive, capable of identifying the Taenia species from only one egg. This multiplex PCR technique using 18S rDNA specific primers should be suitable to diagnose Taenia eggs.

  18. Evaluation of chromogenic media and seminested PCR in the identification of Candida species

    PubMed Central

    Daef, Enas; Moharram, Ahmed; Eldin, Salwa Seif; Elsherbiny, Nahla; Mohammed, Mona

    2014-01-01

    Identification of Candida cultured from various clinical specimens to the species level is increasingly necessary for clinical laboratories. Although sn PCR identifies the species within hours but its cost-effectiveness is to be considered. So there is always a need for media which help in the isolation and identification at the species level. The study aimed to evaluate the performance of different chromogenic media and to compare the effectiveness of the traditional phenotypic methods vs. seminested polymerase chain reaction (sn PCR) for identification of Candida species. One hundred and twenty seven Candida strains isolated from various clinical specimens were identified by conventional methods, four different chromogenic media and sn PCR. HiCrome Candida Differential and CHROMagar Candida media showed comparably high sensitivities and specificities in the identification of C. albicans, C. tropicalis, C. glabrata and C. krusei. CHROMagar Candida had an extra advantage of identifying all C. parapsilosis isolates. CHROMagar-Pal’s medium identified C. albicans, C. tropicalis and C. krusei with high sensitivities and specificities, but couldn’t identify C. glabrata or C. parapsilosis. It was the only medium that identified C. dubliniensis with a sensitivity and specificity of 100%. Biggy agar showed the least sensitivities and specificities. The overall concordance of the snPCR compared to the conventional tests including CHROMAgar Candida in the identification of Candida species was 97.5%. The use of CHROMAgar Candida medium is an easy and accurate method for presumptive identification of the most commonly encountered Candida spp. PMID:24948942

  19. Development and Evaluation of a Loop-Mediated Isothermal Amplification (Lamp) Assay for the Detection of Haemonchus contortus in Goat Fecal Samples.

    PubMed

    Yang, X; Qi, M W; Zhang, Z Z; Gao, C; Wang, C Q; Lei, W Q; Tan, L; Zhao, J L; Fang, R; Hu, M

    2017-04-01

    Haemonchus contortus is one of the most significant strongylid nematodes infecting small ruminants, and it causes great economic losses to the livestock industry worldwide. Accurate diagnosis of H. contortus is crucial to control strategies. Traditional microscopic examinations are the most common methods for the diagnosis of H. contortus , but they are time-consuming and inaccurate. Molecular methods based on PCR are more accurate, but need expensive machines usually only used in the laboratory. Loop-mediated isothermal amplification (LAMP) is a rapid, simple, specific, and sensitive method that has been widely used to detect viruses, bacteria, and parasites. In the present study, a LAMP method targeting ribosomal ITS-2 gene for detection of the H. contortus in goat fecal samples has been established. The established LAMP method was H. contortus specific, and the sensitivity of LAMP was the same as that of the H. contortus species-specific PCR, with the lowest DNA level detected as being 1 pg. Examination of the clinical samples indicated that the positive rate of LAMP was higher than that of PCR, but no statistical difference was observed between LAMP and PCR (χ 2 = 17.991, P = 0.053). In conclusion, a LAMP assay with a high specificity and a good sensitivity has been developed to detect H. contortus infection in goats. The established LAMP assay is useful for clinical diagnosis of H. contortus .

  20. Strand-specific, real-time RT-PCR assays for quantification of genomic and positive-sense RNAs of the fish rhabdovirus, Infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Purcell, Maureen K.; Hart, S. Alexandra; Kurath, Gael; Winton, James R.

    2006-01-01

    The fish rhabdovirus, Infectious hematopoietic necrosis virus (IHNV), is an important pathogen of salmonids. Cell culture assays have traditionally been used to quantify levels of IHNV in samples; however, real-time or quantitative RT-PCR assays have been proposed as a rapid alternative. For viruses having a single-stranded, negative-sense RNA genome, standard qRT-PCR assays do not distinguish between the negative-sense genome and positive-sense RNA species including mRNA and anti-genome. Thus, these methods do not determine viral genome copy number. This study reports development of strand-specific, qRT-PCR assays that use tagged primers for enhancing strand specificity during cDNA synthesis and quantitative PCR. Protocols were developed for positive-strand specific (pss-qRT-PCR) and negative-strand specific (nss-qRT-PCR) assays for IHNV glycoprotein (G) gene sequences. Validation with synthetic RNA transcripts demonstrated the assays could discriminate the correct strand with greater than 1000-fold fidelity. The number of genome copies in livers of IHNV-infected fish determined by nss-qRT-PCR was, on average, 8000-fold greater than the number of infectious units as determined by plaque assay. We also compared the number of genome copies with the quantity of positive-sense RNA and determined that the ratio of positive-sense molecules to negative-sense genome copies was, on average, 2.7:1. Potential future applications of these IHNV strand-specific qRT-PCR assays are discussed.

  1. Protocol for chromosome-specific probe construction using PRINS, micromanipulation and DOP-PCR techniques.

    PubMed

    Passamani, Paulo Z; Carvalho, Carlos R; Soares, Fernanda A F

    2018-01-01

    Chromosome-specific probes have been widely used in molecular cytogenetics, being obtained with different methods. In this study, a reproducible protocol for construction of chromosome-specific probes is proposed which associates in situ amplification (PRINS), micromanipulation and degenerate oligonucleotide-primed PCR (DOP-PCR). Human lymphocyte cultures were used to obtain metaphases from male and female individuals. The chromosomes were amplified via PRINS, and subcentromeric fragments of the X chromosome were microdissected using microneedles coupled to a phase contrast microscope. The fragments were amplified by DOP-PCR and labeled with tetramethyl-rhodamine-5-dUTP. The probes were used in fluorescent in situ hybridization (FISH) procedure to highlight these specific regions in the metaphases. The results show one fluorescent red spot in male and two in female X chromosomes and interphase nuclei.

  2. Relation of polymorphism C1236T and C3435T in ABCB1 gene with bone marrow suppression in chemotherapy-treated breast cancer patients

    NASA Astrophysics Data System (ADS)

    Syarifah, S.; Hamdi, T.; Widyawati, T.; Sari, M. I.; Anggraini, D. R.

    2018-03-01

    ABCB1 is agene that encoded P-glycoprotein (P-gp), a transmembrane active efflux pump for a variety of carcinogens and cytostatics.ABCB1 polymorphisms C1236T and C3435T contribute to the variability oftherapeutic outcome and side effects.The present study was conducted to investigatethe relation of C1236T and C3435T polymorphisms in ABCB1 gene with bone marrow suppression in breast cancer patients treated withchemotherapy72 Indonesian womens isolated DNA sampleswere amplified using the PCR method. The analysis process of ABCB1 C1236T and C3435T polymorphism was by using thePCR-RFLP method. The frequencies of ABCB1 C1236T genotype for homozygous CC,heterozygous CT and variant TT was 11(15.28%), 42(58.33%), 19(26.39%), respectively. No associationwas between ABCB1 C1236T and C3435T polymorphisms in both individually and haplotypes with bone marrow suppression event (p > 0.05). There was no specific deviation of allele and genotype frequency from Hardy-Weinberg Equilibrium. There was a linkage between heterozygous CT-heterozygous CT in position 1236 and 3435 within 25 people (35%).

  3. Nested-PCR real time as alternative molecular tool for detection of Borrelia burgdorferi compared to the classical serological diagnosis of the blood.

    PubMed

    Sroka-Oleksiak, Agnieszka; Ufir, Krzysztof; Salamon, Dominika; Bulanda, Malgorzata; Gosiewski, Tomasz

    Lyme disease, caused by Borrelia burgdorferi, is a multisystem disease that often makes difficulties to recognize caused by their genetic heterogenity. Currently, the gold standard for the detection of Lyme disease (LD) is serologic diagnostics based mainly on tests: ELISA and Western blot (WB). These methods, however, are subject to consider- able defect, especially in the initial phase of infection due to the occurrence of so-called serological window period and low specificity. For this reason, they might be replaced by molecular methods, for example polymerase chain reaction (PCR), which should be more sensitivity and specificity. In the present study we attempt to optimize the PCR reaction conditions and enhance existing test sensitivity by applying the equivalent of real time PCR - nested PCR for detection B. burgdorferi DNA in the patient's blood. The study involved 94 blood samples of patients with suspected LD. From each sample, 1.5 ml of blood was used for the isolation of bacterial DNA and PCR real time am- plification and its equivalent, in nested version. The remaining part earmarked for serologi- cal testing. Optimization of the reaction conditions made experimentally, using gradient of the temperature and gradient of the magnesium ions concentration for reaction real time in nested-PCR and PCR version. The results show that the nested-PCR real time, has a much higher sensitivity 45 (47.8%) of positive results for the detection of B. burgdorferi compared to the single- variety, without a preceding pre-amplification 2 (2.1%). Serological methods allowed the detection of infection in 41 (43.6%) samples. These results support of the nested PCR method as a better molecular tool for the detection of B. burgdorferi infection than classical PCR real time reaction. The nested-PCR real time method may be considered as a complement to ELISA and WB mainly in the early stages of infection, when in the blood circulating B. burgdorferi cells. By contrast, the results of serological and molecular tests should always be carried out tak- ing into account the patient's clinical status.

  4. Development and evaluation of IgY ImmunoCapture PCR ELISA for detection of Staphylococcus aureus enterotoxin A devoid of protein A interference.

    PubMed

    Reddy, Prakash; Ramlal, Shylaja; Sripathy, Murali Harishchandra; Batra, Harsh Vardhan

    2014-06-01

    In the present study, a sensitive and specific IgY mediated ImmunoCapture-PCR-ELISA (IC-PCR-ELISA) was developed for the detection of staphylococcal enterotoxin A (SEA) from culture supernatants and suspected contaminated samples. Due to the virtue of avian immunoglobulins (IgY) to have the least affinity towards staphylococcal protein A (SpA) responsible for false positives, we employed anti-SEA IgY for capture of SEA toxin and revealed with SEA specific rabbit antibodies conjugated to a 524bp DNA marker. Biotin-11-dUTP was incorporated during PCR amplification and post PCR analysis was performed by PCR-ELISA. Unlike IgG immunocapture, IgY mediated immunocapture of SEA was free from false positives due to protein A. The developed assay was specific to SEA except for minor cross reactivity with staphylococcal enterotoxin E (SEE). Several raw milk samples were evaluated for the presence of SEA with and without enrichment. Three samples were found to be positive for SEA after enrichment for 8h. Though IC-PCR-ELISA for SEA showed 100% correlation with PCR analysis for sea gene, the assay was unique in terms of sensitivity of detecting ~10pg/ml of SEA toxin from spiked milk samples. Result of IC-PCR-ELISA was further confirmed by conventional methods of isolation and characterization. The presented method can be very useful for rapid analysis of milk samples for SEA contamination and can be further extended for detection of multiple SE's in different wells of same PCR plate using common DNA substrate. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Measuring and mitigating inhibition during real-time, quantitative PCR analysis of viral nucleic acid extracts from large-volume environmental water samples

    USDA-ARS?s Scientific Manuscript database

    Naturally-occurring inhibitory compounds are a major concern during qPCR and RT-qPCR analysis of environmental samples, particularly large volume water samples. Here, a standardized method for measuring and mitigating sample inhibition in environmental water concentrates is described. Specifically, ...

  6. Comparison of quantitative PCR assays for Escherichia coli targeting ribosomal RNA and single copy genes

    EPA Science Inventory

    Aims: Compare specificity and sensitivity of quantitative PCR (qPCR) assays targeting single and multi-copy gene regions of Escherichia coli. Methods and Results: A previously reported assay targeting the uidA gene (uidA405) was used as the basis for comparing the taxono...

  7. Improved Specificity for Detection of Mycobacterium bovis in Fresh Tissues Using IS6110 Real-time PCR

    USDA-ARS?s Scientific Manuscript database

    Background: Culture of M. bovis from diagnostic specimens is the gold standard for bovine tuberculosis diagnostics in the US. Detection of M. bovis by PCR in tissue homogenates may provide a simple, rapid method to complement diagnostic culture. A significant impediment to PCR based assays on tissue...

  8. Effects of rainfall events on the occurrence and detection efficiency of viruses in river water impacted by combined sewer overflows.

    PubMed

    Hata, Akihiko; Katayama, Hiroyuki; Kojima, Keisuke; Sano, Shoichi; Kasuga, Ikuro; Kitajima, Masaaki; Furumai, Hiroaki

    2014-01-15

    Rainfall events can introduce large amount of microbial contaminants including human enteric viruses into surface water by intermittent discharges from combined sewer overflows (CSOs). The present study aimed to investigate the effect of rainfall events on viral loads in surface waters impacted by CSO and the reliability of molecular methods for detection of enteric viruses. The reliability of virus detection in the samples was assessed by using process controls for virus concentration, nucleic acid extraction and reverse transcription (RT)-quantitative PCR (qPCR) steps, which allowed accurate estimation of virus detection efficiencies. Recovery efficiencies of poliovirus in river water samples collected during rainfall events (<10%) were lower than those during dry weather conditions (>10%). The log10-transformed virus concentration efficiency was negatively correlated with suspended solid concentration (r(2)=0.86) that increased significantly during rainfall events. Efficiencies of DNA extraction and qPCR steps determined with adenovirus type 5 and a primer sharing control, respectively, were lower in dry weather. However, no clear relationship was observed between organic water quality parameters and efficiencies of these two steps. Observed concentrations of indigenous enteric adenoviruses, GII-noroviruses, enteroviruses, and Aichi viruses increased during rainfall events even though the virus concentration efficiency was presumed to be lower than in dry weather. The present study highlights the importance of using appropriate process controls to evaluate accurately the concentration of water borne enteric viruses in natural waters impacted by wastewater discharge, stormwater, and CSOs. © 2013.

  9. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    PubMed

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific, sensitive, and economic alternative to the current quantitative methods.

  10. Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

    PubMed

    Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2014-01-01

    The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

  11. Development of an immunomagnetic separation-polymerase chain reaction (IMS-PCR) assay specific for Enterocytozoon bieneusi in water samples.

    PubMed

    Sorel, N; Guillot, E; Thellier, M; Accoceberry, I; Datry, A; Mesnard-Rouiller, L; Miégeville, M

    2003-01-01

    Microsporidia have become widely recognized as important human pathogens. Among Microsporidia, Enterocytozoon bieneusi is responsible for severe gastrointestinal disease. To date, no current therapy has been proven effective. Their mode of transmission and environmental occurrence are poorly documented because of the lack of detection methods that are both species-specific and sensitive. In this study, we developed a sensitive and specific molecular method to detect E. bieneusi spores in water samples. The molecular assay combined immunomagnetic separation (IMS) and polymerase chain reaction (PCR) amplification to detect E. bieneusi spores. A comparison was made of IMS magnetic beads coated with two different monoclonal antibodies, one specific for the Encephalitozoon genus that cross-reacts with E. bieneusi and the other specific only for the E. bieneusi species itself. Immunotech beads coated with the antibody specific for E. bieneusi were found to be the most effective combination. The highly specific IMS-PCR assay developed in this study provides a rapid and sensitive means of screening water samples for the presence of E. bieneusi spores.

  12. Co-amplification at lower denaturation temperature-PCR: methodology and applications.

    PubMed

    Liang, Hui; Chen, Guo-Jie; Yu, Yan; Xiong, Li-Kuan

    2018-03-20

    Co-amplification at lower denaturation temperature-polymerase chain reaction (COLD-PCR) is a novel form of PCR that selectively denatures and amplifies low-abundance mutations from mixtures of wild-type and mutation-containing sequences, enriching the mutation 10 to 100 folds. Due to the slightly altered melting temperature (Tm) of the double-stranded DNA and the formation of the mutation/wild-type heteroduplex DNA, COLD-PCR methods are sensitive, specific, accurate, cost-effective and easy to maneuver, and can enrich mutations of any type and at any position, even unknown mutations within amplicons. COLD-PCR and its improved methods are now applied in cancer, microorganisms, prenatal screening, animals and plants. They are extremely useful for early diagnosis, monitoring the prognosis of disease and the efficiency of the treatment, drug selection, prediction of prognosis, plant breeding and etc. In this review, we introduce the principles, key techniques, derived methods and applications of COLD-PCR.

  13. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    PubMed

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  14. The expression and significance of feces cyclooxygensae-2 mRNA in colorectal cancer and colorectal adenomas.

    PubMed

    Li, Xiaofeng; Kong, Lixia; Liao, Suhuan; Lu, Jing; Ma, Lin; Long, Xiaohua

    2017-01-01

    This study aims to explore the expression and significance of feces cyclooxygensae-2 (COX-2) mRNA in colorectal cancer and colorectal adenomas. The expression of feces COX-2 mRNA in colorectal cancer (n = 28), colorectal adenomas (n = 54), and normal control group (n = 11) were examined by reverse transcriptase polymerase chain reaction (RT-PCR). The positive rate of fecal occult blood test (FOBT) were detected in colorectal cancer (n = 30), colorectal adenomas (n = 56), and normal control group (n = 11); the sensitivity of the two methods was also compared. The positive rate of feces COX-2 mRNA in colorectal cancer was 82.1% (25/28), which was significantly higher than colorectal adenomas 59.3% (32/54), and normal tissues 18.2% (2/11), the difference being significant between the three groups (χ2= 13.842,P= 0.001). The positive rate of FOBT in colorectal cancer was 73.3% (10/30), which was significantly higher than colorectal adenomas 10.7% (6/56) and normal tissues 9.1% (1/11), the difference being significant between these three groups (χ2= 7.525,P= 0.023). There was no significant association between feces COX-2 expression and various clinical pathological features of colorectal cancer and colorectal adenomas (P > 0.05). The sensitivity of the RT-PCR method is higher than FOBT, however, the specificity of FOBT is slightly higher than RT-PCR. High expression of feces COX-2 mRNA in colorectal adenomas and colorectal cancer is a common event; it is an early event in the development of colorectal adenomas to colorectal cancer. Feces COX-2 mRNA has a high sensitivity for detect colorectal cancer; combination with FOBT will be the best alternative. Feces COX-2 can be potentially used in the early diagnosis and screening of colorectal cancer.

  15. Quantitative Monitoring of Microbial Species during Bioleaching of a Copper Concentrate.

    PubMed

    Hedrich, Sabrina; Guézennec, Anne-Gwenaëlle; Charron, Mickaël; Schippers, Axel; Joulian, Catherine

    2016-01-01

    Monitoring of the microbial community in bioleaching processes is essential in order to control process parameters and enhance the leaching efficiency. Suitable methods are, however, limited as they are usually not adapted to bioleaching samples and often no taxon-specific assays are available in the literature for these types of consortia. Therefore, our study focused on the development of novel quantitative real-time PCR (qPCR) assays for the quantification of Acidithiobacillus caldus, Leptospirillum ferriphilum, Sulfobacillus thermosulfidooxidans , and Sulfobacillus benefaciens and comparison of the results with data from other common molecular monitoring methods in order to evaluate their accuracy and specificity. Stirred tank bioreactors for the leaching of copper concentrate, housing a consortium of acidophilic, moderately thermophilic bacteria, relevant in several bioleaching operations, served as a model system. The microbial community analysis via qPCR allowed a precise monitoring of the evolution of total biomass as well as abundance of specific species. Data achieved by the standard fingerprinting methods, terminal restriction fragment length polymorphism (T-RFLP) and capillary electrophoresis single strand conformation polymorphism (CE-SSCP) on the same samples followed the same trend as qPCR data. The main added value of qPCR was, however, to provide quantitative data for each species whereas only relative abundance could be deduced from T-RFLP and CE-SSCP profiles. Additional value was obtained by applying two further quantitative methods which do not require nucleic acid extraction, total cell counting after SYBR Green staining and metal sulfide oxidation activity measurements via microcalorimetry. Overall, these complementary methods allow for an efficient quantitative microbial community monitoring in various bioleaching operations.

  16. Quantitative Monitoring of Microbial Species during Bioleaching of a Copper Concentrate

    PubMed Central

    Hedrich, Sabrina; Guézennec, Anne-Gwenaëlle; Charron, Mickaël; Schippers, Axel; Joulian, Catherine

    2016-01-01

    Monitoring of the microbial community in bioleaching processes is essential in order to control process parameters and enhance the leaching efficiency. Suitable methods are, however, limited as they are usually not adapted to bioleaching samples and often no taxon-specific assays are available in the literature for these types of consortia. Therefore, our study focused on the development of novel quantitative real-time PCR (qPCR) assays for the quantification of Acidithiobacillus caldus, Leptospirillum ferriphilum, Sulfobacillus thermosulfidooxidans, and Sulfobacillus benefaciens and comparison of the results with data from other common molecular monitoring methods in order to evaluate their accuracy and specificity. Stirred tank bioreactors for the leaching of copper concentrate, housing a consortium of acidophilic, moderately thermophilic bacteria, relevant in several bioleaching operations, served as a model system. The microbial community analysis via qPCR allowed a precise monitoring of the evolution of total biomass as well as abundance of specific species. Data achieved by the standard fingerprinting methods, terminal restriction fragment length polymorphism (T-RFLP) and capillary electrophoresis single strand conformation polymorphism (CE-SSCP) on the same samples followed the same trend as qPCR data. The main added value of qPCR was, however, to provide quantitative data for each species whereas only relative abundance could be deduced from T-RFLP and CE-SSCP profiles. Additional value was obtained by applying two further quantitative methods which do not require nucleic acid extraction, total cell counting after SYBR Green staining and metal sulfide oxidation activity measurements via microcalorimetry. Overall, these complementary methods allow for an efficient quantitative microbial community monitoring in various bioleaching operations. PMID:28066365

  17. Rapid detection method for fusaric acid-producing species of Fusarium by PCR

    USDA-ARS?s Scientific Manuscript database

    Fusaric acid is a mycotoxin produced by species of the fungus Fusarium and can act synergistically with other Fusarium toxins. In order to develop a specific detection method for fusaric acid-producing fungus, PCR prim¬ers were designed to amplify FUB10, a transcription factor gene in fusaric acid ...

  18. Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

    PubMed

    Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

    2015-07-01

    Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

  19. Simultaneous genotyping of single-nucleotide polymorphisms in alcoholism-related genes using duplex and triplex allele-specific PCR with two-step thermal cycles.

    PubMed

    Shirasu, Naoto; Kuroki, Masahide

    2014-01-01

    We developed a time- and cost-effective multiplex allele-specific polymerase chain reaction (AS-PCR) method based on the two-step PCR thermal cycles for genotyping single-nucleotide polymorphisms in three alcoholism-related genes: alcohol dehydrogenase 1B, aldehyde dehydrogenase 2 and μ-opioid receptor. Applying MightyAmp(®) DNA polymerase with optimized AS-primers and PCR conditions enabled us to achieve effective and selective amplification of the target alleles from alkaline lysates of a human hair root, and simultaneously to determine the genotypes within less than 1.5 h using minimal lab equipment.

  20. Species-specific differentiation of variola, monkeypox, and varicella-zoster viruses by multiplex real-time PCR assay.

    PubMed

    Maksyutov, Rinat A; Gavrilova, Elena V; Shchelkunov, Sergei N

    2016-10-01

    A method of one-stage rapid detection and differentiation of epidemiologically important variola virus (VARV), monkeypox virus (MPXV), and varicella-zoster virus (VZV) utilizing multiplex real-time TaqMan PCR assay was developed. Four hybridization probes with various fluorescent dyes and the corresponding fluorescence quenchers were simultaneously used for the assay. The hybridization probes specific for the VARV sequence contained FAM/BHQ1 as a dye/quencher pair; MPXV-specific, JOE/BHQ1; VZV-specific, TAMRA/BHQ2; and internal control-specific, Cy5/BHQ3. The specificity and sensitivity of the developed method were assessed by analyzing DNA of 32 strains belonging to orthopoxvirus and herpesvirus species. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Design and performance testing of a real-time PCR assay for sensitive and reliable direct quantification of Brettanomyces in wine.

    PubMed

    Tessonnière, H; Vidal, S; Barnavon, L; Alexandre, H; Remize, F

    2009-02-28

    Because the yeast Brettanomyces produces volatile phenols and acetic acid, it is responsible for wine spoilage. The uncontrolled accumulation of these molecules in wine leads to sensorial defects that compromise wine quality. The need for a rapid, specific, sensitive and reliable method to detect this spoilage yeast has increased over the last decade. All these requirements are met by real-time PCR. We here propose improvements of existing methods to enhance the robustness of the assay. Six different protocols to isolate DNA from a wine and three PCR mix compositions were tested, and the best method was selected. Insoluble PVPP addition during DNA extraction by a classical phenol:chloroform protocol succeeded in the relief of PCR inhibitors from wine. We developed an internal control which was efficient to avoid false negative results due to decreases in the efficiency of DNA isolation and/or amplification. The method was evaluated by an intra-laboratory study for its specificity, linearity, repeatability and reproducibility. A standard curve was established from 14 different wines artificially inoculated. The quantification limit was 31 cfu/mL.

  2. Validation and clinical application of a molecular method for the identification of Cryptococcus neoformans/Cryptococcus gattii complex DNA in human clinical specimens.

    PubMed

    Rivera, Vanessa; Gaviria, Marcela; Muñoz-Cadavid, Cesar; Cano, Luz; Naranjo, Tonny

    2015-01-01

    The diagnosis of cryptococcosis is usually performed based on cultures of tissue or body fluids and isolation of the fungus, but this method may require several days. Direct microscopic examination, although rapid, is relatively insensitive. Biochemical and immunodiagnostic rapid tests are also used. However, all of these methods have limitations that may hinder final diagnosis. The increasing incidence of fungal infections has focused attention on tools for rapid and accurate diagnosis using molecular biological techniques. Currently, PCR-based methods, particularly nested, multiplex and real-time PCR, provide both high sensitivity and specificity. In the present study, we evaluated a nested PCR targeting the gene encoding the ITS-1 and ITS-2 regions of rDNA in samples from a cohort of patients diagnosed with cryptococcosis. The results showed that in our hands, this Cryptococcus nested PCR assay has 100% specificity and 100% sensitivity and was able to detect until 2 femtograms of Cryptococcus DNA. Copyright © 2015 Elsevier Editora Ltda. All rights reserved.

  3. Comparative evaluation of two Rickettsia typhi-specific quantitative real-time PCRs for research and diagnostic purposes.

    PubMed

    Papp, Stefanie; Rauch, Jessica; Kuehl, Svenja; Richardt, Ulricke; Keller, Christian; Osterloh, Anke

    2017-02-01

    Rickettsioses are caused by intracellular bacteria of the family of Rickettsiaceae. Rickettsia (R.) typhi is the causative agent of endemic typhus. The disease occurs worldwide and is one of the most prevalent rickettsioses. Rickettsial diseases, however, are generally underdiagnosed which is mainly due to the lack of sensitive and specific methods. In addition, methods for quantitative detection of the bacteria for research purposes are rare. We established two qPCRs for the detection of R. typhi by amplification of the outer membrane protein B (ompB) and parvulin-type PPIase (prsA) genes. Both qPCRs are specific and exclusively recognize R. typhi but no other rickettsiae including the closest relative, R. prowazekii. The prsA-based qPCR revealed to be much more sensitive than the amplification of ompB and provided highly reproducible results in the detection of R. typhi in organs of infected mice. Furthermore, as a nested PCR the prsA qPCR was applicable for the detection of R. typhi in human blood samples. Collectively, the prsA-based qPCR represents a reliable method for the quantitative detection of R. typhi for research purposes and is a promising candidate for differential diagnosis.

  4. Evaluation of Various Campylobacter-Specific Quantitative PCR (qPCR) Assays for Detection and Enumeration of Campylobacteraceae in Irrigation Water and Wastewater via a Miniaturized Most-Probable-Number–qPCR Assay

    PubMed Central

    Banting, Graham S.; Braithwaite, Shannon; Scott, Candis; Kim, Jinyong; Jeon, Byeonghwa; Ashbolt, Nicholas; Ruecker, Norma; Tymensen, Lisa; Charest, Jollin; Pintar, Katarina; Checkley, Sylvia

    2016-01-01

    ABSTRACT Campylobacter spp. are the leading cause of bacterial gastroenteritis worldwide, and water is increasingly seen as a risk factor in transmission. Here we describe a most-probable-number (MPN)–quantitative PCR (qPCR) assay in which water samples are centrifuged and aliquoted into microtiter plates and the bacteria are enumerated by qPCR. We observed that commonly used Campylobacter molecular assays produced vastly different detection rates. In irrigation water samples, detection rates varied depending upon the PCR assay and culture method used, as follows: 0% by the de Boer Lv1-16S qPCR assay, 2.5% by the Van Dyke 16S and Jensen glyA qPCR assays, and 75% by the Linton 16S endpoint PCR when cultured at 37°C. Primer/probe specificity was the major confounder, with Arcobacter spp. routinely yielding false-positive results. The primers and PCR conditions described by Van Dyke et al. (M. I. Van Dyke, V. K. Morton, N. L. McLellan, and P. M. Huck, J Appl Microbiol 109:1053–1066, 2010, http://dx.doi.org/10.1111/j.1365-2672.2010.04730.x) proved to be the most sensitive and specific for Campylobacter detection in water. Campylobacter occurrence in irrigation water was found to be very low (<2 MPN/300 ml) when this Campylobacter-specific qPCR was used, with the most commonly detected species being C. jejuni, C. coli, and C. lari. Campylobacters in raw sewage were present at ∼102/100 ml, with incubation at 42°C required for reducing microbial growth competition from arcobacters. Overall, when Campylobacter prevalence and/or concentration in water is reported using molecular methods, considerable validation is recommended when adapting methods largely developed for clinical applications. Furthermore, combining MPN methods with molecular biology-based detection algorithms allows for the detection and quantification of Campylobacter spp. in environmental samples and is potentially suited to quantitative microbial risk assessment for improved public health disease prevention related to food and water exposures. IMPORTANCE The results of this study demonstrate the importance of assay validation upon data interpretation of environmental monitoring for Campylobacter when using molecular biology-based assays. Previous studies describing Campylobacter prevalence in Canada utilized primers that we have determined to be nonspecific due to their cross-amplification of Arcobacter spp. As such, Campylobacter prevalence may have been vastly overestimated in other studies. Additionally, the development of a quantitative assay described in this study will allow accurate determination of Campylobacter concentrations in environmental water samples, allowing more informed decisions to be made about water usage based on quantitative microbial risk assessment. PMID:27235434

  5. Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

    PubMed

    Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

    2010-04-01

    Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

  6. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    PubMed

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. [Identification of hepatitis B virus YMDD point mutation using peptide nucleic acid clamping PCR].

    PubMed

    Zhang, Yingying; He, Haitang; Yang, Jie; Hou, Jinlin

    2013-06-01

    To establish a peptide nucleic acid clamping PCR assay for detecting hepatitis B virus (HBV) drug resistance mutation. RtM204I (ATT) mutant, rtM204V (GTG) mutant and rtM204 (ATG) wild-type plasmids mixed at different ratios were detected for mutations by PNA clamping PCR assay and direct sequencing, and the sensitivity and specificity of the two methods were compared. Serum samples from 85 patients with chronic HBV infection were detected for drug resistance using the two methods. The sensitivity of PNA-PCR assay was 0.001% in a 10(5)-fold excess of wild-type HBV DNA with a detection limit of 10(1) copies. The sensitivity of direct sequencing was 10% with a detection limit of 10(4) copies. Mutants were detected in 73 of the 85 serum samples (85.9%), including YIDD in 40 samples, YVDD in 23 samples, and YIDD+YVDD in 10 samples. The agreement of PNA-PCR assay with direct sequencing was only 40% (34/85, YIDD in 21 samples, YVDD in 11 samples, and YIDD+YVDD in 2 samples). Neither of the two methods yielded positive results for the negative control samples, suggesting their good specificity. PNA-PCR assay appears to be a more sensitive and rapid assay for detection of HBV genotypic resistance.

  8. Determining the analytical specificity of PCR-based assays for the diagnosis of IA: What is Aspergillus?

    PubMed

    Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen

    2017-06-01

    A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P < .0001) than assays specific for individual Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. [Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].

    PubMed

    Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing

    2012-08-01

    Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.

  10. Single Color Multiplexed ddPCR Copy Number Measurements and Single Nucleotide Variant Genotyping.

    PubMed

    Wood-Bouwens, Christina M; Ji, Hanlee P

    2018-01-01

    Droplet digital PCR (ddPCR) allows for accurate quantification of genetic events such as copy number variation and single nucleotide variants. Probe-based assays represent the current "gold-standard" for detection and quantification of these genetic events. Here, we introduce a cost-effective single color ddPCR assay that allows for single genome resolution quantification of copy number and single nucleotide variation.

  11. Specific detection of common pathogens of acute bacterial meningitis using an internally controlled tetraplex-PCR assay.

    PubMed

    Farahani, Hamidreza; Ghaznavi-Rad, Ehsanollah; Mondanizadeh, Mahdieh; MirabSamiee, Siamak; Khansarinejad, Behzad

    2016-08-01

    Accurate and timely diagnosis of acute bacterial meningitis is critical for antimicrobial treatment of patients. Although PCR-based methods have been widely used for the diagnosis of acute meningitis caused by bacterial pathogens, the main disadvantage of these methods is their high cost. This disadvantage has hampered the widespread use of molecular assays in many developing countries. The application of multiplex assays and "in-house" protocols are two main approaches that can reduce the overall cost of a molecular test. In the present study, an internally controlled tetraplex-PCR was developed and validated for the specific detection of Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae in cerebrospinal fluid (CSF) samples. The analysis of a panel of other human pathogens showed no cross-reactivity in the assay. The analytical sensitivity of the in-house assay was 792.3 copies/ml, when all three bacteria were presentin the specimens. This value was calculated as 444.5, 283.7, 127.8 copies/ml when only S. pneumoniae, N. meningitidis and H. influenzae, respectively, were present. To demonstrate the diagnostic performance of the assay, a total of 150 archival CSF samples were tested and compared with a commercial multiplex real-time PCR kit. A diagnostic sensitivity of 92.8% and a specificity of 95.1% were determined for the present tetraplex-PCR assay. The results indicate that the established method is sensitive, specific and cost-effective, and can be used particularly in situations where the high cost of commercial kits prevents the use of molecular methods for the diagnosis of bacterial meningitis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Detection of the KIT D816V mutation in peripheral blood of systemic mastocytosis: diagnostic implications.

    PubMed

    Jara-Acevedo, Maria; Teodosio, Cristina; Sanchez-Muñoz, Laura; Álvarez-Twose, Ivan; Mayado, Andrea; Caldas, Carolina; Matito, Almudena; Morgado, José M; Muñoz-González, Javier I; Escribano, Luis; Garcia-Montero, Andrés C; Orfao, Alberto

    2015-08-01

    Recent studies have found the KIT D816V mutation in peripheral blood of virtually all adult systemic mastocytosis patients once highly sensitive PCR techniques were used; thus, detection of the KIT D816V mutation in peripheral blood has been proposed to be included in the diagnostic work-up of systemic mastocytosis algorithms. However, the precise frequency of the mutation, the biological significance of peripheral blood-mutated cells and their potential association with involvement of bone marrow hematopoietic cells other than mast cells still remain to be investigated. Here, we determined the frequency of peripheral blood involvement by the KIT D816V mutation, as assessed by two highly sensitive PCR methods, and investigated its relationship with multilineage involvement of bone marrow hematopoiesis. Overall, our results confirmed the presence of the KIT D816V mutation in peripheral blood of most systemic mastocytosis cases (161/190; 85%)--with an increasing frequency from indolent systemic mastocytosis without skin lesions (29/44; 66%) to indolent systemic mastocytosis with skin involvement (124/135; 92%), and more aggressive disease subtypes (11/11; 100%)--as assessed by the allele-specific oligonucleotide-qPCR method, which was more sensitive (P<.0001) than the peptide nucleic acid-mediated PCR approach (84/190; 44%). Although the presence of the KIT mutation in peripheral blood, as assessed by the allele-specific oligonucleotide-qPCR technique, did not accurately predict for multilineage bone marrow involvement of hematopoiesis, the allele-specific oligonucleotide-qPCR allele burden and the peptide nucleic acid-mediated-PCR approach did. These results suggest that both methods provide clinically useful and complementary information through the identification and/or quantification of the KIT D816V mutation in peripheral blood of patients suspected of systemic mastocytosis.

  13. Real-Time PCR-Based Quantitation Method for the Genetically Modified Soybean Line GTS 40-3-2.

    PubMed

    Kitta, Kazumi; Takabatake, Reona; Mano, Junichi

    2016-01-01

    This chapter describes a real-time PCR-based method for quantitation of the relative amount of genetically modified (GM) soybean line GTS 40-3-2 [Roundup Ready(®) soybean (RRS)] contained in a batch. The method targets a taxon-specific soybean gene (lectin gene, Le1) and the specific DNA construct junction region between the Petunia hybrida chloroplast transit peptide sequence and the Agrobacterium 5-enolpyruvylshikimate-3-phosphate synthase gene (epsps) sequence present in GTS 40-3-2. The method employs plasmid pMulSL2 as a reference material in order to quantify the relative amount of GTS 40-3-2 in soybean samples using a conversion factor (Cf) equal to the ratio of the RRS-specific DNA to the taxon-specific DNA in representative genuine GTS 40-3-2 seeds.

  14. Distribution of Diego blood group alleles and identification of four novel mutations on exon 19 of SLC4A1 gene in the Chinese Han population by polymerase chain reaction sequence-based typing.

    PubMed

    Xu, X G; He, J; He, Y M; Tao, S D; Ying, Y L; Zhu, F M; Lv, H J; Yan, L X

    2011-04-01

    The Diego blood group system plays an important role in transfusion medicine. Genotyping of DI1 and DI2 alleles is helpful for the investigation into haemolytic disease of the newborn (HDN) and for the development of rare blood group databases. Here, we set up a polymerase chain reaction sequence-based typing (PCR-SBT) method for genotyping of Diego blood group alleles. Specific primers for exon 19 of the solute carrier family 4, anion exchanger, member1 (SLC4A1) gene were designed, and our PCR-SBT method was established and optimized for Diego genotyping. A total of 1053 samples from the Chinese Han population and the family members of a rare proband with DI1/DI1 genotype were investigated by the PCR-SBT method. An allele-specific primer PCR (PCR-ASP) was used to verify the reliability of the PCR-SBT method. The frequencies of DI1 and DI2 alleles in the Chinese Han population were 0.0247 and 0.9753, respectively. Six new single nucleotide polymorphisms (SNPs) were found in the sequenced regions of the SLC4A1 gene, and four novel SNPs located in the exon 19, in which one SNP could cause an amino acid alteration of Ala858Ser on erythrocyte anion exchanger protein 1. The genotypes for Diego blood group were identical among 41 selected samples with PCR-ASP and PCR-SBT. The PCR-SBT method can be used in Diego genotyping as a substitute of serological technique when the antisera is lacking and was suitable for screening large numbers of donors in rare blood group databases. © 2010 The Author(s). Vox Sanguinis © 2010 International Society of Blood Transfusion.

  15. Application of denaturing gradient gel electrophoresis (DGGE) to the analysis of microbial communities of subgingival plaque.

    PubMed

    Fujimoto, C; Maeda, H; Kokeguchi, S; Takashiba, S; Nishimura, F; Arai, H; Fukui, K; Murayama, Y

    2003-08-01

    Denaturing gradient gel electrophoresis (DGGE) was applied to the microbiologic examination of subgingival plaque. The PCR primers were designed from conserved nucleotide sequences on 16S ribosomal RNA gene (16SrDNA) with GC rich clamp at the 5'-end. Polymerase chain reaction (PCR) was performed using the primers and genomic DNAs of typical periodontal bacteria. The generated 16SrDNA fragments were separated by denaturing gel. Although the sizes of the amplified DNA fragments were almost the same among the species, 16SrDNAs of the periodontal bacteria were distinguished according to their specific sequences. The microflora of clinical plaque samples were profiled by the PCR-DGGE method, and the dominant 16SrDNA bands were cloned and sequenced. Simultaneously, Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis and Prevotella intermedia were detected by an ordinary PCR method. In the deep periodontal pockets, the bacterial community structures were complicated and P. gingivalis was the most dominant species, whereas the DGGE profiles were simple and Streptococcus or Neisseria species were dominant in the shallow pockets. The species-specific PCR method revealed the presence of A. actinomycetemcomitans, P. gingivalis and P. intermedia in the clinical samples. However, corresponding bands were not always observed in the DGGE profiles, indicating a lower sensitivity of the DGGE method. Although the DGGE method may have a lower sensitivity than the ordinary PCR methods, it could visualize the bacterial qualitative compositions and reveal the major species of the plaque. The DGGE analysis and following sequencing may have the potential to be a promising bacterial examination procedure in periodontal diseases.

  16. Loop-mediated isothermal amplification for detection of Staphylococcus aureus in dairy cow suffering from mastitis.

    PubMed

    Tie, Zhang; Chunguang, Wang; Xiaoyuan, Wei; Xinghua, Zhao; Xiuhui, Zhong

    2012-01-01

    To develop a rapid detection method of Staphylococcus aureus using loop-mediated isothermal amplification (LAMP), four specific primers were designed according to six distinct sequences of the nuc gene. In addition, the specificity and sensitivity of LAMP were verified and compared with those of PCR. Results showed that the LAMP reaction was completed within 45 min at 62.5°C, and ladder bands were appeared in LAMP products analyzed by gel electrophoresis. After adding 1x SYBR Green l, the positive reaction tube showed green color and the negative reaction tube remained orange, indicating that the LAMP has high specificity. The minimal detectable concentration of LAMP was 1 × 10² CFU/mL and that of PCR was 1 × 10⁴ CFU/mL, indicating that the LAMP was 100 times more sensitive than the PCR. The LAMP method for detection of Staphylococcus aureus has many advantages, such as simple operation, high sensitivity, high specificity, and rapid analysis. Therefore, this method is more suitable for the rapid on-site detection of Staphylococcus aureus.

  17. Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis.

    PubMed

    van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L

    2018-04-26

    Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.

  18. Field evaluation of the photo-induced electron transfer fluorogenic primers (PET) real-time PCR for the detection of Plasmodium falciparum in Tanzania.

    PubMed

    Talundzic, Eldin; Maganga, Mussa; Masanja, Irene M; Peterson, David S; Udhayakumar, Venkatachalam; Lucchi, Naomi W

    2014-01-27

    Accurate diagnosis of malaria infections remains challenging, especially in the identification of submicroscopic infections. New molecular diagnostic tools that are inexpensive, sensitive enough to detect low-level infections and suitable in laboratory settings of resource-limited countries are required for malaria control and elimination programmes. Here the diagnostic potential of a recently developed photo-induced electron transfer fluorogenic primer (PET) real-time polymerase chain reaction (PCR) called PET-PCR was investigated. This study aimed to (i) evaluate the use of this assay as a method for the detection of both Plasmodium falciparum and other Plasmodium species infections in a developing country's diagnostic laboratory; and, (ii) determine the assay's sensitivity and specificity compared to a nested 18S rRNA PCR. Samples used in this study were obtained from a previous study conducted in the region of Iringa, Tanzania. A total of 303 samples from eight health facilities in Tanzania were utilized for this evaluation. All samples were screened using the multiplex PET-PCR assay designed to detect Plasmodium genus and P. falciparum initially in laboratory in Tanzania and then repeated at a reference laboratory at the CDC in the USA. Microscopy data was available for all the 303 samples. A subset of the samples were tested in a blinded fashion to find the sensitivity and specificity of the PET-PCR compared to the nested 18S rRNA PCR. Compared to microscopy, the PET-PCR assay was 59% more sensitive in detecting P. falciparum infections. The observed sensitivity and specificity were 100% (95% confidence interval (CI0.95) = 94-100%) and (CI0.95 = 96-100%), respectively, for the PET-PCR assay when compared to nested 18S rRNA PCR. When compared to 18S rRNA PCR, microscopy had a low sensitivity of 40% (CI0.95 = 23-61%) and specificity of 100% (CI0.95 = 96-100%). The PET-PCR results performed in the field laboratory in Tanzania were in 100% concordance with the results obtained at the reference laboratory in the USA. The PET-PCR is a new molecular diagnostic tool with similar performance characteristics as commonly used PCR methods that is less expensive, easy to use, and amiable to large scale-surveillance studies in developing country settings.

  19. Microbial source tracking and transfer hydrodynamics in rural catchments.

    NASA Astrophysics Data System (ADS)

    Murphy, Sinead; Bhreathnach, Niamh; O'Flaherty, Vincent; Jordan, Philip; Wuertz, Stefan

    2013-04-01

    In Ireland, bacterial pathogens from continual point source pollution and intermittent pollution from diffuse sources can impact both drinking water supplies and recreational waters. This poses a serious public health threat. Observing and establishing the source of faecal pollution is imperative for the protection of water quality and human health. Traditional culture methods to detect such pollution via faecal indicator bacteria have been widely utilised but do not decipher the source of pollution. To combat this, microbial source tracking, an important emerging molecular tool, is applied to detect host-specific markers in faecally contaminated waters. The aim of this study is to target ruminant and human-specific faecal Bacteroidales and Bacteroides 16S rRNA genes within rural river catchments in Ireland and investigate hydrological transfer dependencies. During storm events and non-storm periods, 1L untreated water samples, taken every 2 hours over a 48-hour time period at the spring (Cregduff) or outlet (Dunleer), and large (5-20L) untreated water samples were collected from two catchment sites. Cregduff is a spring emergence under a grassland karst landscape in Co. Mayo (west coast of Ireland) and Dunleer is a mixed landuse over till soils in Co. Louth (east coast). From a risk assessment point of view, the catchments are very different. Samples were filtered through 0.2µm nitrocellulose filters to concentrate bacterial cells which then underwent chemical extraction of total nucleic acids. Animal and human stool samples were also collected from the catchments to determine assay sensitivity and specificity following nucleic acid extraction. Aquifer response to seasonal events was assessed by monitoring coliforms and E. coli occurrence using the IDEXX Colisure® Quanti Tray®/2000 system in conjunction with chemical and hydrological parameters. Autoanalysers deployed at each catchment monitor multiple water parameters every 10 min such as phosphorus, nitrogen (nitrate), turbidity, conductivity and flow rate. InStat V 3.06 was used to determine correlations between chemical and microbial parameters (P< 0.05 considered significant).There was a positive correlation between E. coli and phosphorus in Cregduff during rain events (p=0.040) & significant correlation for a non-rain periods (<0.001). There was a positive correlation between E. coli and turbidity in Dunleer during rain events (p=0.0008) and in Cregduff during non-rain periods (p=0.0241). The water samples from Dunleer have a higher concentration of phosphorus than in Cregduff. Host specific primers BacCow-UCD, BacHum-UCD, BacUni-UCD and BoBac were then assayed against both faecal and water extracts and quantified using PCR. BacUni-UCD, BacCow-UCD and BoBac detected faecal contamination in three of the four sample sites in Dunleer and BacHum-UCD detected faecal contamination in one of the sites. The concentrations of the BacUni-UCD qPCR assay were higher in the water samples taken from Dunleer outlet than those taken from Cregduff spring. BacCow-UCD and BacHum-UCD qPCR detected low and very low concentrations, respectively, in water from the Dunleer outlet. The concentrations can be seen changing over the hydrograph event. None of the host-specific assays detected pollution in Cregduff. From the results, it can be seen that Dunleer is more subject to contamination than Cregduff.

  20. [Diagnosis of tuberculosis meningitis by detection of adenosine deaminase activity and amplification of nucleotide sequences with PCR].

    PubMed

    Correa, M F; Armas, E; Díaz, D; de Elguezabal, K; De la Rosa, M L; Calles, G; Adjounian, H; Pedroza, R

    2001-01-01

    Tuberculous meningitis (TBM) is the most severe and lethal form of tuberculosis. The rapid bacteriological diagnosis with the conventional techniques is nearly impossible in TBM. There for many patients are treated with anti-TBC drugs without a definitive diagnosis. A more fast and accurate diagnostic method is necessary, in order to initiate the treatment on time to prevent the irreversible neurologic sequel or death. We evaluated the use of two rapid methods: Adenosine deaminase activity (ADA) and polymerase chain reaction (PCR) for IS6110 and mtp40 sequences on cerebrospinal fluid (CSF) from chronic meningitis patients. For ADA activity > 8.0 U/L the sensibility and specificity was 80% and 91%. PCR sensibility was 80% and specificity 97%. ADA activity and PCR on CSF could be specially useful as complementary tools in the early diagnosis of TBM.

  1. Development of a rapid diagnostic method for identification of Staphylococcus aureus and antimicrobial resistance in positive blood culture bottles using a PCR-DNA-chromatography method.

    PubMed

    Ohshiro, Takeya; Miyagi, Chihiro; Tamaki, Yoshikazu; Mizuno, Takuya; Ezaki, Takayuki

    2016-06-01

    Blood culturing and the rapid reporting of results are essential for infectious disease clinics to obtain bacterial information that can affect patient prognosis. When gram-positive coccoid cells are observed in blood culture bottles, it is important to determine whether the strain is Staphylococcus aureus and whether the strain has resistance genes, such as mecA and blaZ, for proper antibiotic selection. Previous work led to the development of a PCR method that is useful for rapid identification of bacterial species and antimicrobial susceptibility. However, that method has not yet been adopted in community hospitals due to the high cost and methodological complexity. We report here the development of a quick PCR and DNA-chromatography test, based on single-tag hybridization chromatography, that permits detection of S. aureus and the mecA and blaZ genes; results can be obtained within 1 h for positive blood culture bottles. We evaluated this method using 42 clinical isolates. Detection of S. aureus and the resistance genes by the PCR-DNA-chromatography method was compared with that obtained via the conventional identification method and actual antimicrobial susceptibility testing. Our method had a sensitivity of 97.0% and a specificity of 100% for the identification of the bacterial species. For the detection of the mecA gene of S. aureus, the sensitivity was 100% and the specificity was 95.2%. For the detection of the blaZ gene of S. aureus, the sensitivity was 100% and the specificity was 88.9%. The speed and simplicity of this PCR-DNA-chromatography method suggest that our method will facilitate rapid diagnoses. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans

    PubMed Central

    Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.

    2000-01-01

    Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130

  3. Comparison of real-time PCR methods for the detection of Naegleria fowleri in surface water and sediment.

    PubMed

    Streby, Ashleigh; Mull, Bonnie J; Levy, Karen; Hill, Vincent R

    2015-05-01

    Naegleria fowleri is a thermophilic free-living ameba found in freshwater environments worldwide. It is the cause of a rare but potentially fatal disease in humans known as primary amebic meningoencephalitis. Established N. fowleri detection methods rely on conventional culture techniques and morphological examination followed by molecular testing. Multiple alternative real-time PCR assays have been published for rapid detection of Naegleria spp. and N. fowleri. Foursuch assays were evaluated for the detection of N. fowleri from surface water and sediment. The assays were compared for thermodynamic stability, analytical sensitivity and specificity, detection limits, humic acid inhibition effects, and performance with seeded environmental matrices. Twenty-one ameba isolates were included in the DNA panel used for analytical sensitivity and specificity analyses. N. fowleri genotypes I and III were used for method performance testing. Two of the real-time PCR assays were determined to yield similar performance data for specificity and sensitivity for detecting N. fowleri in environmental matrices.

  4. Comparison of real-time PCR methods for the detection of Naegleria fowleri in surface water and sediment

    PubMed Central

    Streby, Ashleigh; Mull, Bonnie J.; Levy, Karen

    2015-01-01

    Naegleria fowleri is a thermophilic free-living ameba found in freshwater environments worldwide. It is the cause of a rare but potentially fatal disease in humans known as primary amebic meningoencephalitis. Established N. fowleri detection methods rely on conventional culture techniques and morphological examination followed by molecular testing. Multiple alternative real-time PCR assays have been published for rapid detection of Naegleria spp. and N. fowleri. Four such assays were evaluated for the detection of N. fowleri from surface water and sediment. The assays were compared for thermodynamic stability, analytical sensitivity and specificity, detection limits, humic acid inhibition effects, and performance with seeded environmental matrices. Twenty-one ameba isolates were included in the DNA panel used for analytical sensitivity and specificity analyses. N. fowleri genotypes I and III were used for method performance testing. Two of the real-time PCR assays were determined to yield similar performance data for specificity and sensitivity for detecting N. fowleri in environmental matrices. PMID:25855343

  5. Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

    2005-08-10

    As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM insect resistant cottons quantification. All of these results indicated that our established conventional and TaqMan real-time PCR assays were applicable to detect the three insect resistant cottons qualitatively and quantitatively.

  6. Identification of Pseudallescheria and Scedosporium species by three molecular methods.

    PubMed

    Lu, Qiaoyun; Gerrits van den Ende, A H G; Bakkers, J M J E; Sun, Jiufeng; Lackner, M; Najafzadeh, M J; Melchers, W J G; Li, Ruoyu; de Hoog, G S

    2011-03-01

    The major clinically relevant species in Scedosporium (teleomorph Pseudallescheria) are Pseudallescheria boydii, Scedosporium aurantiacum, Scedosporium apiospermum, and Scedosporium prolificans, while Pseudallescheria minutispora, Petriellopsis desertorum, and Scedosporium dehoogii are exceptional agents of disease. Three molecular methods targeting the partial β-tubulin gene were developed and evaluated to identify six closely related species of the S. apiospermum complex using quantitative real-time PCR (qPCR), PCR-based reverse line blot (PCR-RLB), and loop-mediated isothermal amplification (LAMP). qPCR was not specific enough for the identification of all species but had the highest sensitivity. The PCR-RLB assay was efficient for the identification of five species. LAMP distinguished all six species unambiguously. The analytical sensitivities of qPCR, PCR-RLB, and LAMP combined with MagNAPure, CTAB (cetyltrimethylammonium bromide), and FTA filter (Whatman) extraction were 50, 5 × 10(3), and 5 × 10(2) cells/μl, respectively. When LAMP was combined with a simplified DNA extraction method using an FTA filter, identification to the species level was achieved within 2 h, including DNA extraction. The FTA-LAMP assay is therefore recommended as a cost-effective, simple, and rapid method for the identification of Scedosporium species.

  7. Evaluation of a Rapid Fecal PCR Test for Detection of Mycobacterium avium subsp. paratuberculosis in Dairy Cattle▿

    PubMed Central

    Wells, Scott J.; Collins, Michael T.; Faaberg, Kay S.; Wees, Carrie; Tavornpanich, Saraya; Petrini, Kristine R.; Collins, James E.; Cernicchiaro, Natalia; Whitlock, Robert H.

    2006-01-01

    A high-throughput TaqMan PCR assay for detection of bovine paratuberculosis was evaluated by using fecal samples from 1,808 dairy cattle in seven naturally infected herds and 347 dairy cattle in seven herds considered free of paratuberculosis. Fecal, blood, and milk samples were submitted to laboratories where the PCR-based assay, three different fecal culture procedures for Mycobacterium avium subsp. paratuberculosis (centrifugation, sedimentation, and the BACTEC filter concentration method), two serologic enzyme-linked immunosorbent assays (ELISAs), and one milk ELISA were performed. Results from testing of dairy cattle in herds free of M. avium subsp. paratuberculosis showed that the PCR assay's specificity was 99.7%. Twenty-three percent of the dairy cows that were fecal culture positive by at least one of the three methods were positive by the PCR assay. By Bayesian non-“gold standard” analysis methods, the TaqMan PCR assay had a higher specificity than the serum ELISAs (99.3%; 95% confidence interval [CI] = 98.6 to 99.7%) and a test sensitivity similar to that of the serum ELISAs (29%; 95% CI = 24 to 35%). By classical methods, the estimated relative sensitivity of the fecal PCR assay was 4% for light and moderate fecal shedders (compared to 12 to 13% for the ELISAs) and 76% for heavy fecal shedders (compared to 67% for the milk ELISA). The PCR assay has higher sensitivity for detection of heavy fecal shedders than the evaluated milk ELISA but lower sensitivity than a serum or milk ELISA for detection of light and moderate fecal shedders. This assay can be used as a quick test for detection of cattle with heavy fecal shedding, those cattle with the highest risk of transmitting infection to susceptible cattle. PMID:16928884

  8. Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR.

    PubMed

    D'Costa, Susan; Blouin, Veronique; Broucque, Frederic; Penaud-Budloo, Magalie; François, Achille; Perez, Irene C; Le Bec, Christine; Moullier, Philippe; Snyder, Richard O; Ayuso, Eduard

    2016-01-01

    Clinical trials using recombinant adeno-associated virus (rAAV) vectors have demonstrated efficacy and a good safety profile. Although the field is advancing quickly, vector analytics and harmonization of dosage units are still a limitation for commercialization. AAV reference standard materials (RSMs) can help ensure product safety by controlling the consistency of assays used to characterize rAAV stocks. The most widely utilized unit of vector dosing is based on the encapsidated vector genome. Quantitative polymerase chain reaction (qPCR) is now the most common method to titer vector genomes (vg); however, significant inter- and intralaboratory variations have been documented using this technique. Here, RSMs and rAAV stocks were titered on the basis of an inverted terminal repeats (ITRs) sequence-specific qPCR and we found an artificial increase in vg titers using a widely utilized approach. The PCR error was introduced by using single-cut linearized plasmid as the standard curve. This bias was eliminated using plasmid standards linearized just outside the ITR region on each end to facilitate the melting of the palindromic ITR sequences during PCR. This new "Free-ITR" qPCR delivers vg titers that are consistent with titers obtained with transgene-specific qPCR and could be used to normalize in-house product-specific AAV vector standards and controls to the rAAV RSMs. The free-ITR method, including well-characterized controls, will help to calibrate doses to compare preclinical and clinical data in the field.

  9. Development of real-time PCR method for the detection and the quantification of a new endogenous reference gene in sugar beet "Beta vulgaris L.": GMO application.

    PubMed

    Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled

    2013-01-01

    KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices.

  10. Development of real-time PCR tests for the detection of Tenebrio molitor in food and feed.

    PubMed

    Debode, Frédéric; Marien, Aline; Gérard, Amaury; Francis, Frédéric; Fumière, Olivier; Berben, Gilbert

    2017-08-01

    Insects are rich in proteins and could be an alternative source of proteins to feed animals and humans. Numerous companies have started the production of insects for feed purposes. In Europe, these processed animal proteins are not yet authorised by legislation as many questions still need to be answered concerning this 'novel food'. Authorisations will be possible when methods of authentication of the products are available. In this study we propose real-time PCR methods for the specific detection of the mealworm (Tenebriomolitor), one of the most widely used insects for food and feed production. Two PCR assays are proposed: the first based on the wingless gene and the second based on the cadherin gene. The PCR tests amplify fragments of 87 bp. These qualitative methods were tested according to several performance criteria. The specificity was tested on 34 insect species' DNA, but also on non-insect species including crustacean, mammals, birds and plants. The limit of detection was determined and was below 20 copies for the two PCR tests. The applicability of the tests was demonstrated by the analysis of real-life processed samples containing T. molitor.

  11. Development and application of a universal Hemoplasma screening assay based on the SYBR green PCR principle.

    PubMed

    Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina

    2009-12-01

    Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.

  12. Robust detection of rare species using environmental DNA: The importance of primer specificity

    Treesearch

    Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Stephen F. Jane; Winsor H. Lowe; Andrew R. Whiteley; Michael K. Schwartz

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probebased chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence...

  13. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  14. [Use of nested PCR in detection of the plague pathogen].

    PubMed

    Glukhov, A I; Gordeev, S A; Al'tshuler, M L; Zykova, I E; Severin, S E

    2003-07-01

    Causative agents of plague, i.e. bacterium Yersina pestis (in the subcutaneous tissues of rodents) and their cutaneous parasites need to be isolated to enable plague prevention. A comparatively new method of polymerase chain reaction (PCR) opens up new possibilities of determining Y. pestis just within several hours and without any cultivation. The article contains a description of the PCR-method, which makes it possible to distinguish the culture of Y. pestis from cultures of other microorganism, including speci of Yersina. The method is of the cluster-type, i.e. it is made up of subsequent PC reactions with the substrate for the second reaction being the product of the first one. The cluster nature of the method preconditions a higher sensitivity and specificity versus the ordinary PCR.

  15. Strain-specific reverse transcriptase PCR assay: means to distinguish candidate vaccine from wild-type strains of respiratory syncytial virus.

    PubMed Central

    Zheng, H; Peret, T C; Randolph, V B; Crowley, J C; Anderson, L J

    1996-01-01

    Candidate live-virus vaccines for respiratory syncytial virus are being developed and are beginning to be evaluated in clinical trials. To distinguish candidate vaccine strains from wild-type strains isolated during these trials, we developed PCR assays specific to two sets of candidate vaccine strains. The two sets were a group A strain (3A), its three attenuated, temperature-sensitive variant strains, a group B strain (2B), and its four attenuated, temperature-sensitive variant strains. The PCR assays were evaluated by testing 18 group A wild-type strains, the 3A strains, 9 group B wild-type strains, and the 2B strains. PCR specific to group A wild-type strains amplified only group A wild-type strains, and 3A-specific PCR amplified only 3A strains. PCR specific to group B wild-type strains amplified all group A and group B strains but gave a 688-bp product for group B wild-type strains, a 279-bp product for 2B strains, a 547-bp product for all group A strains, and an additional 688-bp product for some group A strains, including 3A strains. These types of PCR assays can, in conjunction with other methods, be used to efficiently distinguish candidate vaccine strains from other respiratory syncytial virus strains. PMID:8789010

  16. Simultaneous and Rapid Detection of Salmonella typhi, Bacillus anthracis, and Yersinia pestis by Using Multiplex Polymerase Chain Reaction (PCR)

    PubMed Central

    Safari Foroshani, Nargess; Karami, Ali; Pourali, Fatemeh

    2013-01-01

    Background Salmonella typhi, Bacillus anthracis, and Yersinia pestis are some serious human pathogens, which their early diagnosis is of great importance. Salmonella typhi, Bacillus anthracis, and Yersinia pestis cause typhoid fever, anthrax, and plague respectively. These bacteria can be used to make biologic weapons. Objectives In this study, we designed a new and rapid diagnostic method based on Uniplex and Multiplex PCR method. Materials and Methods Uniplex and multiplex Polymerase Chain Reaction (PCR) were conducted on virulent genes of hp and invA of Salmonella typhimurium, Pa and chr of Bacillus anthracis, and pla of Yersinia pestis. A genome from other bacteria was used to study the specificity of the primer and the PCR test. Results Standard strains used in this study showed that primers were specific. As for sensitivity, it was shown that this method can diagnose 1-10 copies of the genome, or 1-10 Colony Forming Units (CFU) for each of the bacteria. All pieces except anthrax were sequenced in PCR to validate the product. DNA fragment resulted from Bacillus anthracis was confirmed by restriction enzyme digestions. Conclusion The designed methods are accurate, rapid, and inexpensive to find and differentiate these bacteria from similar bacteria. They can be applied for rapid diagnosis of these agents in different specimens, and bioterrorism cases. PMID:24719692

  17. Detection of pathogenic organisms in food, water, and body fluids

    NASA Astrophysics Data System (ADS)

    Wallace, William H.; Henley, Michael V.; Sayler, Gary S.

    2002-06-01

    The construction of specific bioluminescent bacteriophage for detection of pathogenic organism can be developed to overcome interferences in complex matrices such as food, water and body fluids. Detection and identification of bacteria often require several days and frequently weeks by standard methods of isolation, growth and biochemical test. Immunoassay detection often requires the expression of the bacterial toxin, which can lead to non-detection of cells that may express the toxin under conditions different from testing protocols. Immunoassays require production of a specific antibody to the agent for detection and interference by contaminants frequently affects results. PCR based detection may be inhibited by substances in complex matrices. Modified methods of the PCR technique, such as magnetic capture-hybridization PCR (MCH-PCR), appear to improve the technique by removing the DNA products away from the inhibitors. However, the techniques required for PCR-based detection are slow and the procedures require skilled personnel working with labile reagents. Our approach is based on transferring bioluminescence (lux) genes into a selected bacteriophage. Bacteriophages are bacterial viruses that are widespread in nature and often are genus and species specific. This specificity eliminates or reduces false positives in a bacteriophage assay. The phage recognizes a specific receptor molecule on the surface of a susceptible bacterium, attaches and then injects the viral nucleic acid into the cell. The injected viral genome is expressed and then replicated, generating numerous exact copies of the viral genetic material including the lux genes, often resulting in an increase in bioluminescence by several hundred fold.

  18. Diagnosis of bacteremia in pediatric oncologic patients by in-house real-time PCR.

    PubMed

    Quiles, Milene Gonçalves; Menezes, Liana Carballo; Bauab, Karen de Castro; Gumpl, Elke Kreuscher; Rocchetti, Talita Trevizani; Palomo, Flavia Silva; Carlesse, Fabianne; Pignatari, Antonio Carlos Campos

    2015-07-23

    Infections are the major cause of morbidity and mortality in children with cancer. Gaining a favorable prognosis for these patients depends on selecting the appropriate therapy, which in turn depends on rapid and accurate microbiological diagnosis. This study employed real-time PCR (qPCR) to identify the main pathogens causing bloodstream infection (BSI) in patients treated at the Pediatric Oncology Institute IOP-GRAACC-UNIFESP-Brazil. Antimicrobial resistance genes were also investigated using this methodology. A total of 248 samples from BACTEC® blood culture bottles and 99 whole-blood samples collected in tubes containing EDTA K2 Gel were isolated from 137 patients. All samples were screened by specific Gram probes for multiplex qPCR. Seventeen sequences were evaluated using gender-specific TaqMan probes and the resistance genes bla SHV, bla TEM, bla CTX, bla KPC, bla IMP, bla SPM, bla VIM, vanA, vanB and mecA were detected using the SYBR Green method. Positive qPCR results were obtained in 112 of the blood culture bottles (112/124), and 90 % agreement was observed between phenotypic and molecular microbial detection methods. For bacterial and fungal identification, the performance test showed: sensitivity 87 %; specificity 91 %; NPV 90 %; PPV 89 % and accuracy of 89 % when compared with the phenotypic method. The mecA gene was detected in 37 samples, extended-spectrum β-lactamases were detected in six samples and metallo-β-lactamase coding genes in four samples, with 60 % concordance between the two methods. The qPCR on whole blood detected eight samples possessing the mecA gene and one sample harboring the vanB gene. The bla KPC, bla VIM, bla IMP and bla SHV genes were not detected in this study. Real-time PCR is a useful tool in the early identification of pathogens and antimicrobial resistance genes from bloodstream infections of pediatric oncologic patients.

  19. Real-time PCR assay for the diagnosis of pleural tuberculosis

    PubMed Central

    Cárdenas Bernal, Ana María; Giraldo-Cadavid, Luis Fernando; Prieto Diago, Enrique; Santander, Sandra Paola

    2017-01-01

    Abstract Introduction: The diagnosis of pleural tuberculosis requires an invasive and time-consuming reference method. Polymerase chain reaction (PCR) is rapid, but validation in pleural tuberculosis is still weak. Objective: To establish the operating characteristics of real-time polymerase chain reaction (RT-PCR) hybridization probes for the diagnosis of pleural tuberculosis. Methods: The validity of the RT-PCR hybridization probes was evaluated compared to a composite reference method by a cross-sectional study at the Hospital Universitario de la Samaritana. 40 adults with lymphocytic pleural effusion were included. Pleural tuberculosis was confirmed (in 9 patients) if the patient had at least one of three tests using the positive reference method: Ziehl-Neelsen or Mycobacterium tuberculosis culture in fluid or pleural tissue, or pleural biopsy with granulomas. Pleural tuberculosis was ruled out (in 31 patients) if all three tests were negative. The operating characteristics of the RT-PCR, using the Mid-P Exact Test, were determined using the OpenEpi 2.3 Software (2009). Results: The RT-PCR hybridization probes showed a sensitivity of 66.7% (95% CI: 33.2%-90.7%) and a specificity of 93.5% (95% CI: 80.3%-98.9%). The PPV was 75.0% (95% CI: 38.8%-95.6%) and a NPV of 90.6% (95% CI: 76.6%-97.6%). Two false positives were found for the test, one with pleural mesothelioma and the other with chronic pleuritis with mesothelial hyperplasia. Conclusions: The RT-PCR hybridization probes had good specificity and acceptable sensitivity, but a negative value cannot rule out pleural tuberculosis. PMID:29021638

  20. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  1. Direct identification of Streptococcus agalactiae and capsular type by real-time PCR in vaginal swabs from pregnant women.

    PubMed

    Morozumi, Miyuki; Chiba, Naoko; Igarashi, Yuko; Mitsuhashi, Naoki; Wajima, Takeaki; Iwata, Satoshi; Ubukata, Kimiko

    2015-01-01

    Most group B streptococcus (GBS) infections in newborns are with capsular type Ia, Ib, or III. To prevent these infections more effectively, we developed a real-time PCR method to simultaneously detect GBS species and identify these 3 capsular types in vaginal swab samples from women at 36-39 weeks of gestation. DNA to be detected included those of the dltS gene (encoding a histidine kinase specific to GBS) and cps genes encoding capsular types. PCR sensitivity was 10 CFU/well for a 33-35 threshold cycle. Results were obtained within 2 h. Direct PCR results were compared with results obtained from cultures. Samples numbering 1226 underwent PCR between September 2008 and August 2012. GBS positivity rates by direct PCR and after routine culture were 15.7% (n = 192) and 12.6% (n = 154), respectively. Sensitivity and specificity of direct PCR relative to culture were 96.1% and 95.9%. Of GBS positive samples identified by PCR, capsular types determined directly by real-time PCR were Ia (n = 24), Ib (n = 32), and III (n = 26). Real-time PCR using our designed cycling probe is a practical, highly sensitive method for identification of GBS in pregnant carriers, allowing use of prophylactic intrapartum antibiotics in time to cover the possibility of unexpected premature birth. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  2. Evaluation of PCR methods for detection of Brucella strains from culture and tissues.

    PubMed

    Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar

    2017-04-01

    The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.

  3. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

    PubMed

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

    2016-04-15

    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Establishment of a multiplex real-time RT-PCR assay for rapid identification of H6 subtype avian influenza viruses.

    PubMed

    Yang, Fan; Wu, Haibo; Liu, Fumin; Lu, Xiangyun; Peng, Xiuming; Wu, Nanping

    2018-06-01

    The H6 subtype avian influenza viruses (AIVs) possess the capacity for zoonotic transmission from avian species to humans. Establishment of a specific, rapid and sensitive method to screen H6 AIVs is necessary. Based on the conserved domain of the matrix and H6 AIV hemagglutinin genes, two TaqMan minor-groove-binder probes and multiplex real-time RT-PCR primers were designed in this study. The multiplex real-time RT-PCR assay developed in this study had high specificity and repeatability and a detection limit of 30 copies per reaction. This rapid diagnostic method will be useful for clinical detection and surveillance of H6 AIVs in China.

  5. Differential Detection of Echinococcus Spp. Copro-DNA by Nested-PCR in Domestic and Wild Definitive Hosts in Moghan Plain, Iran

    PubMed Central

    Mobedi, I; Zare-Bidaki, M; Siavashi, MR; Naddaf, SR; Kia, EB; Mahmoudi, M

    2013-01-01

    Background Despite Echinococcus granulosus, there are merely two old reports of E. multilocularis infection among Iranian canids of Moghan Plain, the only area known endemic for the species. We detected specific DNA markers in fecal samples by PCR (Copro-PCR) for differential diagnosis of Echinococcus species in living canids. Methods Totally 144 fecal samples from domestic dogs, red foxes and a golden jackal were examined for genus-specific Echinococcus coproantigens using ELISA. Forty two positive or ambiguous samples were further examined for Echinococcus species-specific DNA markers by two different set of nested-PCR. Results Twenty five out of 144 (17.4%) animals were contaminated with E. granulosus including 14 (23.7%) domestic dogs, 10 (11.9%) red foxes and one (100%) golden jackal. But none of them harboured E. multilocularis species-specific Copro-DNA. The overall prevalence of E. granulosus and E. multilocularis infections in canids of the area was estimated to be 17.4% and 0.0%, respectively. There was a significant relation between the results of Copro-PCR and CA-ELISA. Conclusion The lack of E. multilocularis infection, compared to previous reports may be due to the differences in used diagnostic methods and/or recently limited territories of wild canids and altered their food resources in this particular area. PMID:23682268

  6. Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

    PubMed

    Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

    2017-10-01

    Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

  7. Most Probable Number Rapid Viability PCR Method to Detect Viable Spores of Bacillus anthracis in Swab Samples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Letant, S E; Kane, S R; Murphy, G A

    2008-05-30

    This note presents a comparison of Most-Probable-Number Rapid Viability (MPN-RV) PCR and traditional culture methods for the quantification of Bacillus anthracis Sterne spores in macrofoam swabs generated by the Centers for Disease Control and Prevention (CDC) for a multi-center validation study aimed at testing environmental swab processing methods for recovery, detection, and quantification of viable B. anthracis spores from surfaces. Results show that spore numbers provided by the MPN RV-PCR method were in statistical agreement with the CDC conventional culture method for all three levels of spores tested (10{sup 4}, 10{sup 2}, and 10 spores) even in the presence ofmore » dirt. In addition to detecting low levels of spores in environmental conditions, the MPN RV-PCR method is specific, and compatible with automated high-throughput sample processing and analysis protocols.« less

  8. Quantitative PCR for Genetic Markers of Human Fecal Pollution

    EPA Science Inventory

    Assessment of health risk and fecal bacteria loads associated with human fecal pollution requires reliable host-specific analytical methods and a rapid quantificationapproach. We report the development of quantitative PCR assays for quantification of two recently described human-...

  9. Steps to achieve quantitative measurements of microRNA using two step droplet digital PCR.

    PubMed

    Stein, Erica V; Duewer, David L; Farkas, Natalia; Romsos, Erica L; Wang, Lili; Cole, Kenneth D

    2017-01-01

    Droplet digital PCR (ddPCR) is being advocated as a reference method to measure rare genomic targets. It has consistently been proven to be more sensitive and direct at discerning copy numbers of DNA than other quantitative methods. However, one of the largest obstacles to measuring microRNA (miRNA) using ddPCR is that reverse transcription efficiency depends upon the target, meaning small RNA nucleotide composition directly effects primer specificity in a manner that prevents traditional quantitation optimization strategies. Additionally, the use of reagents that are optimized for miRNA measurements using quantitative real-time PCR (qRT-PCR) appear to either cause false positive or false negative detection of certain targets when used with traditional ddPCR quantification methods. False readings are often related to using inadequate enzymes, primers and probes. Given that two-step miRNA quantification using ddPCR relies solely on reverse transcription and uses proprietary reagents previously optimized only for qRT-PCR, these barriers are substantial. Therefore, here we outline essential controls, optimization techniques, and an efficacy model to improve the quality of ddPCR miRNA measurements. We have applied two-step principles used for miRNA qRT-PCR measurements and leveraged the use of synthetic miRNA targets to evaluate ddPCR following cDNA synthesis with four different commercial kits. We have identified inefficiencies and limitations as well as proposed ways to circumvent identified obstacles. Lastly, we show that we can apply these criteria to a model system to confidently quantify miRNA copy number. Our measurement technique is a novel way to quantify specific miRNA copy number in a single sample, without using standard curves for individual experiments. Our methodology can be used for validation and control measurements, as well as a diagnostic technique that allows scientists, technicians, clinicians, and regulators to base miRNA measures on a single unit of measurement rather than a ratio of values.

  10. Steps to achieve quantitative measurements of microRNA using two step droplet digital PCR

    PubMed Central

    Duewer, David L.; Farkas, Natalia; Romsos, Erica L.; Wang, Lili; Cole, Kenneth D.

    2017-01-01

    Droplet digital PCR (ddPCR) is being advocated as a reference method to measure rare genomic targets. It has consistently been proven to be more sensitive and direct at discerning copy numbers of DNA than other quantitative methods. However, one of the largest obstacles to measuring microRNA (miRNA) using ddPCR is that reverse transcription efficiency depends upon the target, meaning small RNA nucleotide composition directly effects primer specificity in a manner that prevents traditional quantitation optimization strategies. Additionally, the use of reagents that are optimized for miRNA measurements using quantitative real-time PCR (qRT-PCR) appear to either cause false positive or false negative detection of certain targets when used with traditional ddPCR quantification methods. False readings are often related to using inadequate enzymes, primers and probes. Given that two-step miRNA quantification using ddPCR relies solely on reverse transcription and uses proprietary reagents previously optimized only for qRT-PCR, these barriers are substantial. Therefore, here we outline essential controls, optimization techniques, and an efficacy model to improve the quality of ddPCR miRNA measurements. We have applied two-step principles used for miRNA qRT-PCR measurements and leveraged the use of synthetic miRNA targets to evaluate ddPCR following cDNA synthesis with four different commercial kits. We have identified inefficiencies and limitations as well as proposed ways to circumvent identified obstacles. Lastly, we show that we can apply these criteria to a model system to confidently quantify miRNA copy number. Our measurement technique is a novel way to quantify specific miRNA copy number in a single sample, without using standard curves for individual experiments. Our methodology can be used for validation and control measurements, as well as a diagnostic technique that allows scientists, technicians, clinicians, and regulators to base miRNA measures on a single unit of measurement rather than a ratio of values. PMID:29145448

  11. [Correlation between results of PCR and specific serological tests in diagnosis of Epstein-Barr virus in patients with mononucleosis syndrome].

    PubMed

    Banko, A V; Lazarević, I B; Cupić, M D; Knezević, A M; Stevanović, G D; Krejović-Trivić, S B; Jovanović, T P

    2009-01-01

    Routine laboratory diagnosis of infectious mononucleosis is based on EBV serological testing, but due to problems in interpretation of results, molecular methods, especially PCR, are often necessary. The aim of the present study was to investigate correlation between results of PCR and specific serological tests in diagnosis of Epstein-Barr virus in patients with mononucleosis syndrome. The study comprised 68 patients with mononucleosis syndrome. Their blood samples were tested using ELISA for detection of 4 EBV specific antibodies (anti-VCA IgM and IgG, anti-EA-D IgG and anti-EBNA-1 IgG) and PCR for detection of EBV DNA. According to results of serology 42 patients had acute primary infection, 2 reactivation, 1 chronic active infection, 19 past infection, and 4 have been EBV seronegative. EBV DNA was detected in 17 patients (25%) and all of them were serologically defined as acutely infected. PCR was useful for resolving unclear serology results. Specific serology is the first step in diagnosis of IM, but PCR may serve as a useful additional diagnostic tool for clarifying serological dilemmas, reaching final diagnosis and defining status of the infection.

  12. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  13. Fluorescence acquisition during hybridization phase in quantitative real-time PCR improves specificity and signal-to-noise ratio.

    PubMed

    Mehndiratta, Mohit; Palanichamy, Jayanth Kumar; Ramalingam, Pradeep; Pal, Arnab; Das, Prerna; Sinha, Subrata; Chattopadhyay, Parthaprasad

    2008-12-01

    Quantitative real-time PCR (qPCR) is a standard method used for quantification of specific gene expression. This utilizes either dsDNA binding dyes or probe based chemistry. While dsDNA binding dyes have the advantage of low cost and flexibility, fluorescence due to primer dimers also interferes with the fluorescence of the specific product. Sometimes it is difficult, if not impossible, to standardize conditions and redesign primers in such a way that only specific fluorescence of the products of test and reference genes are acquired. Normally, the fluorescence acquisition in qPCR using dsDNA binding dyes is done during the melting phase of the PCR at a temperature between the melting points of primer dimers and the specific product. We have modified the protocol to acquire fluorescence during the hybridization phase. This significantly increased the signal-to-noise ratio and enabled the use of dsDNA binding dyes for mRNA quantification in situations where it was not possible when measurement was done in the melting phase. We have demonstrated it for three mRNAs, E6, E7, and DNMT1 with beta-actin as the reference gene, and for two miRNAs. This modification broadens the scope of qPCR using dsDNA binding dyes.

  14. Reduced-cost Chlamydia trachomatis-specific multiplex real-time PCR diagnostic assay evaluated for ocular swabs and use by trachoma research programmes.

    PubMed

    Butcher, Robert; Houghton, Jo; Derrick, Tamsyn; Ramadhani, Athumani; Herrera, Beatriz; Last, Anna R; Massae, Patrick A; Burton, Matthew J; Holland, Martin J; Roberts, Chrissy H

    2017-08-01

    Trachoma, caused by the intracellular bacterium Chlamydia trachomatis (Ct), is the leading infectious cause of preventable blindness. Many commercial platforms are available that provide highly sensitive and specific detection of Ct DNA. However, the majority of these commercial platforms are inaccessible for population-level surveys in resource-limited settings typical to trachoma control programmes. We developed two low-cost quantitative PCR (qPCR) tests for Ct using readily available reagents on standard real-time thermocyclers. Each multiplex qPCR test targets one genomic and one plasmid Ct target in addition to an endogenous positive control for Homo sapiens DNA. The quantitative performance of the qPCR assays in clinical samples was determined by comparison to a previously evaluated droplet digital PCR (ddPCR) test. The diagnostic performance of the qPCR assays were evaluated against a commercial assay (artus C. trachomatis Plus RG PCR, Qiagen) using molecular diagnostics quality control standards and clinical samples. We examined the yield of Ct DNA prepared from five different DNA extraction kits and a cold chain-free dry-sample preservation method using swabs spiked with fixed concentrations of human and Ct DNA. The qPCR assay was highly reproducible (Ct plasmid and genomic targets mean total coefficients of variance 41.5% and 48.3%, respectively). The assay detected 8/8 core specimens upon testing of a quality control panel and performed well in comparison to commercially marketed comparator test (sensitivity and specificity>90%). Optimal extraction and sample preservation methods for research applications were identified. We describe a pipeline from collection to diagnosis providing the most efficient sample preservation and extraction with significant per test cost savings over a commercial qPCR diagnostic assay. The assay and its evaluation should allow control programs wishing to conduct independent research within the context of trachoma control, access to an affordable test with defined performance characteristics. Copyright © 2017. Published by Elsevier B.V.

  15. A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Della Vittoria Scarpati, Giuseppina; Falcetta, Francesca; Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it

    2012-07-15

    Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsiesmore » obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.« less

  16. Amplification of Mitochondrial DNA for detection of Plasmodiumvivax in Balochistan.

    PubMed

    Shahwani, Muhammad Naeem; Nisar, Samia; Aleem, Abdul; Panezai, Marina; Afridi, Sarwat; Malik, Shaukat Iqbal

    2017-05-01

    To access a new step using PCR to amplify the targeted mtDNA sequence for detecting specifically Plasmodium vivax and its co-infections, false positive and false negative results with Plasmodium falciparum. In this study we have standardized a new technical approach in which the target mitochondrial DNA sequence (mtDNA) was amplified by using a PCR technique as a tool to detect Plasmodium spp. Species specific primers were designed to hybridize with cytochrome c oxidase gene of P. vivax (cox I) and P. falciparum (cox III). Two hundred blood samples were collected on the basis of clinical symptoms which were initially examined through microscopic analysis after preparing Giemsa stained thick and thin blood smears. Afterwards genomic DNA was extracted from all samples and was then subjected to PCR amplification by using species specific primers and amplified segments were sequenced for confirmation of results. One-hundred and thirty-two blood samples were detected as positive for malaria by PCR, out of which 64 were found to be positive by PCR and 53 by both microscopy and PCR for P.vivax infection. Nine samples were found to be false negative, one P.vivax mono infection was declared as co infection by PCR and 3 samples identified as having P.falciparum gametes were confirmed as P.vivax by PCR amplification. Sensitivity and specificity were found to be 85% and 92% respectively. Results obtained through PCR method were comparatively better and reliable than microscopy.

  17. [Application study of droplet digital PCR to detect maternal cell contamination in prenatal diagnosis].

    PubMed

    Geng, J; Liu, C; Zhou, X C; Ma, J; Du, L; Lu, J; Zhou, W N; Hu, T T; Lyu, L J; Yin, A H

    2017-02-25

    Objective: To develop a new method based on droplet digital PCR (DD-PCR) for detection and quantification of maternal cell contamination in prenatal diagnosis. Methods: Invasive prenatal samples from 40 couples of β(IVS-Ⅱ-654)/β(N) thalassemia gene carriers who accepted prenatal diagnosis in Affiliated Women and Children's Hospital of Guangzhou Medical University from October 2015 to December 2016 were analyzed retrospectively. Specific primers and probes were designed. The concentration gradient were 50%, 25%, 12.5%, 6.25%, 3.125%, 1.562 5%. There were 40 groups of prenatal diagnostic samples. Comparing DD-PCR with quantitative fluorescent-PCR (QF-PCR) based on the short tandem repeats for assement of the sensitivity and accuracy of maternal cell contamination, respectively. Results: DD-PCR could quantify the maternal cell contamination as low as 1.562 5%. The result was proportional to the dilution titers. In the 40 prenatal samples, 6 cases (15%, 6/40) of maternal cell contamination were detected by DD-PCR, while the QF-PCR based on short tandem repeat showed 3 cases (7.5%, 3/40) with maternal cell contamination, DD-PCR was more accurate ( P= 0.002) . Conclusion: DD-PCR is a precise and sensitive method in the detection of maternal cell contamintation. It could be useful in clinical application.

  18. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    PubMed

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species. Nevertheless, to accurately differentiate among the taxonomically related species, PCR-RFLP should be implemented.

  19. Optimization of PMA-PCR Protocol for Viability Detection of Pathogens

    NASA Technical Reports Server (NTRS)

    Mikkelson, Brian J.; Lee, Christine M.; Ponce, Adrian

    2011-01-01

    This presented study demonstrates the need that PMA-PCR can be used to capture the loss of viability of a sample that is much more specific and time-efficient than alternative methods. This protocol is particularly useful in scenarios in which sterilization treatments may inactivate organisms but not degrade their DNA. The use of a PCR-based method of pathogen detection without first inactivating the DNA of nonviable cells will potentially lead to false positives. The loss of culturability, by heat-killing, did not prevent amplified PCR products, which supports the use of PMA to prevent amplification and differentiate between viable and dead cells. PMA was shown to inhibit the amplification of DNA by PCR in vegetative cells that had been heat-killed.

  20. Application of IS1311 locus 2 PCR-REA assay for the specific detection of 'Bison type' Mycobacterium avium subspecies paratuberculosis isolates of Indian origin.

    PubMed

    Singh, Ajay Vir; Chauhan, Devendra Singh; Singh, Abhinendra; Singh, Pravin Kumar; Sohal, Jagdip Singh; Singh, Shoor Vir

    2015-01-01

    Of the three major genotypes of Mycobacterium avium subspecies paratuberculosis (MAP), 'Bison type' is most prevalent genotype in the domestic livestock species of the country, and has also been recovered from patients suffering from Crohn's disease. Recently, a new assay based on IS1311 locus 2 PCR- restriction endonuclease analysis (REA) was designed to distinguish between 'Indian Bison type' and non-Indian genotypes. The present study investigated discriminatory potential of this new assay while screening of a panel of MAP isolates of diverse genotypes and from different geographical regions. A total of 53 mycobacterial isolates (41 MAP and 12 mycobacterium other than MAP), three MAP genomic DNA and 36 MAP positive faecal DNA samples from different livestock species (cattle, buffaloes, goat, sheep and bison) and geographical regions (India, Canada, USA, Spain and Portugal) were included in the study. The extracted DNA samples (n=92) were analyzed for the presence of MAP specific sequences (IS900, ISMav 2 and HspX) using PCR. DNA samples were further subjected to genotype differentiation using IS1311 PCR-REA and IS1311 L2 PCR-REA methods. All the DNA samples (except DNA from non-MAP mycobacterial isolates) were positive for all the three MAP specific sequences based PCRs. IS1311 PCR-REA showed that MAP DNA samples of Indian origin belonged to 'Bison type'. Whereas, of the total 19 non-Indian MAP DNA samples, 2, 15 and 2 were genotyped as 'Bison type', 'Cattle type' and 'Sheep type', respectively. IS1311 L2 PCR-REA method showed different restriction profiles of 'Bison type' genotype as compared to non-Indian DNA samples. IS1311 L2 PCR-REA method successfully discriminated 'Indian Bison type' from other non-Indian genotypes and showed potential to be future epidemiological tool and for genotyping of MAP isolates.

  1. A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

    PubMed Central

    2010-01-01

    A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

  2. Cross-reactions in specific Brachyspira spp. PCR assays caused by "Brachyspira hampsonii" isolates: implications for detection.

    PubMed

    Aller-Morán, Luis M; Martínez-Lobo, F Javier; Rubio, Pedro; Carvajal, Ana

    2016-11-01

    An emerging novel spirochete in swine, provisionally designated "Brachyspira hampsonii," has been detected worldwide. It has been associated with swine dysentery and cannot be differentiated from B. hyodysenteriae, the classical etiologic agent of this disease, using standard phenotypic methods. We evaluated cross-reactions of "B. hampsonii" isolates recovered from avian species in some of the currently available species-specific polymerase chain reaction (PCR) assays for the identification of swine Brachyspira species. Ten avian "B. hampsonii" isolates recovered from wild waterfowl were used. No false-positive results were recorded with a B. pilosicoli-specific PCR based on the amplification of a fragment of the 16S rRNA gene. However, the percentage of false-positive results varied, with a range of 10-80%, in the evaluated B. hyodysenteriae-specific assays based on the amplification of the 23S rRNA, nox, and tlyA genes. Similarly, results of the B. intermedia-specific PCR assays yielded poor specificity, with up to 80% of the "B. hampsonii" isolates tested giving false-positive results. Finally, 2 "B. hampsonii" avian isolates yielded a positive result in a B. innocens- and B. murdochii-specific PCR. This result should be interpreted very cautiously as these 2 isolates could represent a recombinant genotype. © 2016 The Author(s).

  3. Development and validation of real-time PCR screening methods for detection of cry1A.105 and cry2Ab2 genes in genetically modified organisms.

    PubMed

    Dinon, Andréia Z; Prins, Theo W; van Dijk, Jeroen P; Arisi, Ana Carolina M; Scholtens, Ingrid M J; Kok, Esther J

    2011-05-01

    Primers and probes were developed for the element-specific detection of cry1A.105 and cry2Ab2 genes, based on their DNA sequence as present in GM maize MON89034. Cry genes are present in many genetically modified (GM) plants and they are important targets for developing GMO element-specific detection methods. Element-specific methods can be of use to screen for the presence of GMOs in food and feed supply chains. Moreover, a combination of GMO elements may indicate the potential presence of unapproved GMOs (UGMs). Primer-probe combinations were evaluated in terms of specificity, efficiency and limit of detection. Except for specificity, the complete experiment was performed in 9 PCR runs, on 9 different days and by testing 8 DNA concentrations. The results showed a high specificity and efficiency for cry1A.105 and cry2Ab2 detection. The limit of detection was between 0.05 and 0.01 ng DNA per PCR reaction for both assays. These data confirm the applicability of these new primer-probe combinations for element detection that can contribute to the screening for GM and UGM crops in food and feed samples.

  4. Development of a multiplex methylation specific PCR suitable for (early) detection of non-small cell lung cancer

    PubMed Central

    Nawaz, Imran; Qiu, Xiaoming; Wu, Heng; Li, Yang; Fan, Yaguang; Hu, Li-Fu; Zhou, Qinghua; Ernberg, Ingemar

    2014-01-01

    Lung cancer is a worldwide health problem and a leading cause of cancer-related deaths. Silencing of potential tumor suppressor genes (TSGs) by aberrant promoter methylation is an early event in the initiation and development of cancer. Thus, methylated cancer type-specific TSGs in DNA can serve as useful biomarkers for early cancer detection. We have now developed a “Multiplex Methylation Specific PCR” (MMSP) assay for analysis of the methylation status of multiple potential TSGs by a single PCR reaction. This method will be useful for early diagnosis and treatment outcome studies of non-small cell lung cancer (NSCLC). Genome-wide CpG methylation and expression microarrays were performed on lung cancer tissues and matched distant non-cancerous tissues from three NSCLC patients from China. Thirty-eight potential TSGs were selected and analyzed by methylation PCR on bisulfite treated DNA. On the basis of sensitivity and specificity, six marker genes, HOXA9, TBX5, PITX2, CALCA, RASSF1A, and DLEC1, were selected to establish the MMSP assay. This assay was then used to analyze lung cancer tissues and matched distant non-cancerous tissues from 70 patients with NSCLC, as well as 24 patients with benign pulmonary lesion as controls. The sensitivity of the assay was 99% (69/70). HOXA9 and TBX5 were the 2 most sensitive marker genes: 87% (61/70) and 84% (59/70), respectively. RASSF1A and DLEC1 showed the highest specificity at 99% (69/70). Using the criterion of identifying at least any two methylated marker genes, 61/70 cancer samples were positive, corresponding to a sensitivity of 87% and a specificity of 94%. Early stage I or II NSCLC could even be detected with a 100% specificity and 86% sensitivity. In conclusion, MMSP has the potential to be developed into a population-based screening tool and can be useful for early diagnosis of NSCLC. It might also be suitable for monitoring treatment outcome and recurrence. PMID:24937636

  5. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi.

    PubMed

    Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio; Kano, Shigeyuki

    2018-01-01

    A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.

  6. A novel PCR-based system for the detection of four species of human malaria parasites and Plasmodium knowlesi

    PubMed Central

    Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio

    2018-01-01

    A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297

  7. Development of a sensitive detection method for stressed E. coli O157:H7 in source and finished drinking water by culture-qPCR.

    PubMed

    Sen, Keya; L Sinclair, James; Boczek, Laura; Rice, Eugene W

    2011-03-15

    A sensitive and specific method that also demonstrates viability is of interest for detection of E. coli O157:H7 in drinking water. A combination of culture and qPCR was investigated. Two triplex qPCRs, one from a commercial source and another designed for this study were optimized from 5 different assays to be run on a single qPCR plate. The qPCR assays were specific for 33 E. coli O157:H7 strains tested and detected 500 cells spiked in a background of 10(8) nontarget bacterial cells. The qPCR detection was combined with an enrichment process using Presence Absence (P/A) broth to detect chlorine and starvation stressed cells. qPCR analysis performed post-enrichment allowed the detection of 3-4 cells/L as indicated by a sharp increase in fluorescence (lowering of Ct values) from pre-enrichment levels, demonstrating a 5-6 log increase in the number of cells. When six vulnerable untreated surface water samples were examined, only one was positive for viable E. coli O157:H7 cells. These results suggest that the culture-PCR procedure can be used for rapid detection of E. coli O157:H7 in drinking water.

  8. Quantitative phenotyping of X-disease resistance in chokecherry using real-time PCR.

    PubMed

    Huang, Danqiong; Walla, James A; Dai, Wenhao

    2014-03-01

    A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-disease phytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designed based on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIII group (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of both chokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCR using the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phenotypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherries had a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCR assay provides a more objective tool to phenotype phytoplasma disease severity, particularly for early evaluation of host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and has great potential in enhancing plant breeding. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. High-resolution melting analysis for bird sexing: a successful approach to molecular sex identification using different biological samples.

    PubMed

    Morinha, Francisco; Travassos, Paulo; Seixas, Fernanda; Santos, Nuno; Sargo, Roberto; Sousa, Luís; Magalhães, Paula; Cabral, João A; Bastos, Estela

    2013-05-01

    High-resolution melting (HRM) analysis is a very attractive and flexible advanced post-PCR method with high sensitivity/specificity for simple, fast and cost-effective genotyping based on the detection of specific melting profiles of PCR products. Next generation real-time PCR systems, along with improved saturating DNA-binding dyes, enable the direct acquisition of HRM data after quantitative PCR. Melting behaviour is particularly influenced by the length, nucleotide sequence and GC content of the amplicons. This method is expanding rapidly in several research areas such as human genetics, reproductive biology, microbiology and ecology/conservation of wild populations. Here we have developed a successful HRM protocol for avian sex identification based on the amplification of sex-specific CHD1 fragments. The melting curve patterns allowed efficient sexual differentiation of 111 samples analysed (plucked feathers, muscle tissues, blood and oral cavity epithelial cells) of 14 bird species. In addition, we sequenced the amplified regions of the CHD1 gene and demonstrated the usefulness of this strategy for the genotype discrimination of various amplicons (CHD1Z and CHD1W), which have small size differences, ranging from 2 bp to 44 bp. The established methodology clearly revealed the advantages (e.g. closed-tube system, high sensitivity and rapidity) of a simple HRM assay for accurate sex differentiation of the species under study. The requirements, strengths and limitations of the method are addressed to provide a simple guide for its application in the field of molecular sexing of birds. The high sensitivity and resolution relative to previous real-time PCR methods makes HRM analysis an excellent approach for improving advanced molecular methods for bird sexing. © 2013 Blackwell Publishing Ltd.

  10. PCR-Based Method for the Detection of Toxic Mushrooms Causing Food-Poisoning Incidents.

    PubMed

    Nomura, Chie; Masayama, Atsushi; Yamaguchi, Mizuka; Sakuma, Daisuke; Kajimura, Keiji

    2017-01-01

    In this study, species-specific identification of five toxic mushrooms, Chlorophyllum molybdites, Gymnopilus junonius, Hypholoma fasciculare, Pleurocybella porrigens, and Tricholoma ustale, which have been involved in food-poisoning incidents in Japan, was investigated. Specific primer pairs targeting internal transcribed spacer (ITS) regions were designed for PCR detection. The specific amplicons were obtained from fresh, cooked, and simulated gastric fluid (SGF)-treated samples. No amplicons were detected from other mushrooms with similar morphology. Our method using one-step extraction of mushrooms allows rapid detection within 2.5 hr. It could be utilized for rapid identification or screening of toxic mushrooms.

  11. A PCR-Based Method for RNA Probes and Applications in Neuroscience.

    PubMed

    Hua, Ruifang; Yu, Shanshan; Liu, Mugen; Li, Haohong

    2018-01-01

    In situ hybridization (ISH) is a powerful technique that is used to detect the localization of specific nucleic acid sequences for understanding the organization, regulation, and function of genes. However, in most cases, RNA probes are obtained by in vitro transcription from plasmids containing specific promoter elements and mRNA-specific cDNA. Probes originating from plasmid vectors are time-consuming and not suitable for the rapid gene mapping. Here, we introduce a simplified method to prepare digoxigenin (DIG)-labeled non-radioactive RNA probes based on polymerase chain reaction (PCR) amplification and applications in free-floating mouse brain sections. Employing a transgenic reporter line, we investigate the expression of the somatostatin (SST) mRNA in the adult mouse brain. The method can be applied to identify the colocalization of SST mRNA and proteins including corticotrophin-releasing hormone (CRH) and protein kinase C delta type (PKC-δ) using double immunofluorescence, which is useful for understanding the organization of complex brain nuclei. Moreover, the method can also be incorporated with retrograde tracing to visualize the functional connection in the neural circuitry. Briefly, the PCR-based method for non-radioactive RNA probes is a useful tool that can be substantially utilized in neuroscience studies.

  12. Development and validation of a multiplex PCR for detection of Scedosporium spp. in respiratory tract specimens from patients with cystic fibrosis.

    PubMed

    Harun, Azian; Blyth, Christopher C; Gilgado, Felix; Middleton, Peter; Chen, Sharon C-A; Meyer, Wieland

    2011-04-01

    The emergence of Scedosporium infections in diverse groups of individuals, which are often treatment refractory, warrants timely and accurate laboratory diagnosis. Species- or group-specific primers based on internal transcribed spacer (ITS) sequence polymorphisms were designed for Scedosporium aurantiacum, Scedosporium dehoogii, Scedosporium prolificans, Pseudallescheria boydii species complex (former clade 5)/Pseudallescheria apiosperma (formerly classified as S. apiospermum sensu lato) and Pseudallescheria minutispora. Primers for S. aurantiacum, S. prolificans, and P. boydii species complex/P. apiosperma were incorporated into a multiplex PCR assay for the detection and identification of the three major clinically important Scedosporium species and validated using sputum specimens collected from patients seen at a major Australian cystic fibrosis clinic. The multiplex PCR assay showed 100% specificity in identifying the three major clinically relevant Scedosporium species from pure culture. When evaluated using DNA extracts from sputa, sensitivity and specificity of the multiplex PCR assay were 62.1% and 97.2%, respectively. This highly species-specific multiplex PCR assay offers a rapid and simple method of detection of the most clinically important Scedosporium species in respiratory tract specimens.

  13. Optimized Pan-species and Speciation Duplex Real-time PCR Assays for Plasmodium Parasites Detection in Malaria Vectors

    PubMed Central

    Sandeu, Maurice Marcel; Moussiliou, Azizath; Moiroux, Nicolas; Padonou, Gilles G.; Massougbodji, Achille; Corbel, Vincent; Tuikue Ndam, Nicaise

    2012-01-01

    Background An accurate method for detecting malaria parasites in the mosquito’s vector remains an essential component in the vector control. The Enzyme linked immunosorbent assay specific for circumsporozoite protein (ELISA-CSP) is the gold standard method for the detection of malaria parasites in the vector even if it presents some limitations. Here, we optimized multiplex real-time PCR assays to accurately detect minor populations in mixed infection with multiple Plasmodium species in the African malaria vectors Anopheles gambiae and Anopheles funestus. Methods Complementary TaqMan-based real-time PCR assays that detect Plasmodium species using specific primers and probes were first evaluated on artificial mixtures of different targets inserted in plasmid constructs. The assays were further validated in comparison with the ELISA-CSP on 200 field caught Anopheles gambiae and Anopheles funestus mosquitoes collected in two localities in southern Benin. Results The validation of the duplex real-time PCR assays on the plasmid mixtures demonstrated robust specificity and sensitivity for detecting distinct targets. Using a panel of mosquito specimen, the real-time PCR showed a relatively high sensitivity (88.6%) and specificity (98%), compared to ELISA-CSP as the referent standard. The agreement between both methods was “excellent” (κ = 0.8, P<0.05). The relative quantification of Plasmodium DNA between the two Anopheles species analyzed showed no significant difference (P = 0, 2). All infected mosquito samples contained Plasmodium falciparum DNA and mixed infections with P. malariae and/or P. ovale were observed in 18.6% and 13.6% of An. gambiae and An. funestus respectively. Plasmodium vivax was found in none of the mosquito samples analyzed. Conclusion This study presents an optimized method for detecting the four Plasmodium species in the African malaria vectors. The study highlights substantial discordance with traditional ELISA-CSP pointing out the utility of employing an accurate molecular diagnostic tool for detecting malaria parasites in field mosquito populations. PMID:23285168

  14. Microtiter format for simultaneous multianalyte detection and development of a PCR-chemiluminescent enzyme immunoassay for typing human papillomavirus DNAs.

    PubMed

    Roda, Aldo; Mirasoli, Mara; Venturoli, Simona; Cricca, Monica; Bonvicini, Francesca; Baraldini, Mario; Pasini, Patrizia; Zerbini, Marialuisa; Musiani, Monica

    2002-10-01

    To allow multianalyte binding assays, we have developed a novel polystyrene microtiter plate containing 24 main wells, each divided into 7 subwells. We explored its clinical potential by developing a PCR-chemiluminescent immunoassay (PCR-CLEIA) for simultaneous detection and typing of seven high oncogenic risk human papillomavirus (HPV) DNAs in one well. Seven different oligonucleotide probes, each specific for a high-risk HPV genotype, were separately immobilized in the subwells. Subsequently, a digoxigenin-labeled consensus PCR amplification product was added to the main well. The PCR product hybridized to the immobilized probe corresponding to its genotype and was subsequently detected by use of a peroxidase-labeled anti-digoxigenin antibody and chemiluminescence imaging with an ultrasensitive charge-coupled device camera. Results obtained for 50 cytologic samples were compared with those obtained with a conventional colorimetric PCR-ELISA. The method was specific and allowed detection of 50 genome copies of HPV 16, 18, 33, and 58, and 100 genome copies of HPV 31, 35, and 45. Intra- and interassay CVs for the method were 5.6% and 7.9%, respectively. All results obtained for clinical samples were confirmed by the conventional PCR-ELISA. PCR-CLEIA allows rapid, single-tube simultaneous detection and typing of seven high-risk HPV DNAs with small reagent volumes. The principle appears applicable to the development of other single-tube panels of tests.

  15. Quantitative PCR for genetic markers of human fecal pollution

    EPA Science Inventory

    Assessment of health risk and fecal bacteria loads associated with human fecal pollution requires reliable host-specific analytical methods and a rapid quantification approach. We report the development of quantitative PCR assays for enumeration of two recently described hum...

  16. Rapid genetic typing of diarrheagenic Escherichia coli using a two-tube modified molecular beacon based multiplex real-time PCR assay and its clinical application

    PubMed Central

    2014-01-01

    Background Diarrheagenic Escherichia coli (DEC), including Enterotoxigenic E.coli (ETEC), Enteroaggregative E.coli (EAEC), Enteropathogenic E.coli (EPEC), Enterohemolysin E.coli (EHEC) and Enteroinvasive E.coli (EIEC) causes diarrhea or hemolytic uremic syndromes among infants and travelers around the world. A rapid, reliable and repeatable method is urgent for identifying DEC so as to provide the reference for responding to diarrheal disease outbreak and the treatment of the diarrheal patients associated with DEC. Methods In this study, specific primers and modified molecular beacon probes of nine specific virulence genes, whose 5′end were added with homo tail sequence, were designed; and a two-tube modified molecular beacon based multiplex real–time PCR (rtPCR) assay for the identification of five Escherichia coli pathotypes, including ETEC, EAEC, EPEC, EHEC and EIEC was developed and optimized. Totally 102 bacterial strains, including 52 reference bacterial strains and 50 clinical strains were detected to confirm whether the target genes selected were specific. Then detection limits of the assay were tested. Lastly, the assay was applied to the detection of 11860 clinical samples to evaluate the specificity and sensitivity of the developed assay compared with the conventional PCR. Results The target genes were 100% specific as assessed on 102 bacterial strains since no cross-reactions were observed. The detection limits ranged from 88 CFU/mL (EHEC) to 880 CFU/mL (EPEC). Compared with the conventional PCR, the specificity and sensitivity of the multiplex rtPCR was 100% and over 99%, respectively. The coefficient of variation (CV) for each target gene ranged from 0.45% to 1.53%. 171 positive clinical samples were mostly identified as ETEC (n = 111, 64.9%) and EPEC (n = 38, 22.2%), which were the dominating pathotypes of DEC strains. Conclusion The developed multiplex rtPCR assay for the identification of DEC was high sensitive and specific and could be applied to the rapid identification of DEC in clinical and public health laboratories. PMID:25023669

  17. PCR method for detection and identification of Lactobacillus casei/paracasei bacteriophages in dairy products.

    PubMed

    Binetti, Ana G; Capra, M Luján; Alvarez, Miguel A; Reinheimer, Jorge A

    2008-05-31

    Bacteriophage infections of starter lactic acid bacteria (LAB) pose a serious risk to the dairy industry. Nowadays, the expanding use of valuable Lactobacillus strains as probiotic starters determines an increase in the frequency of specific bacteriophage infections in dairy plants. This work describes a simple and rapid Polymerase Chain Reaction (PCR) method that detects and identifies bacteriophages infecting Lactobacillus casei/paracasei, the main bacterial species used as probiotic. Based on a highly conserved region of the NTP-binding genes belonging to the replication module of L. casei phages phiA2 and phiAT3 (the only two whose genomes are completely sequenced), a pair of primers was designed to generate a specific fragment. Furthermore, this PCR detection method proved to be a useful tool for monitoring and identifying L. casei/paracasei phages in industrial samples since specific PCR signals were obtained from phage contaminated milk (detection limit: 10(4) PFU/mL milk) and other commercial samples (fermented milks and cheese whey) that include L. casei/paracasei as probiotic starter (detection limit: 10(6) PFU/mL fermented milk). Since this method can detect the above phages in industrial samples and can be easily incorporated into dairy industry routines, it might be readily used to earmark contaminated milk for use in processes that do not involve susceptible starter organisms, or processes which involve phage-deactivating conditions.

  18. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

    PubMed

    Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

    2000-01-01

    Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

  20. Production of transgenic strawberries by temporary immersion bioreactor system and verification by TAIL-PCR

    PubMed Central

    Hanhineva, Kati J; Kärenlampi, Sirpa O

    2007-01-01

    Background Strawberry (Fragaria × ananassa) is an economically important soft fruit crop with polyploid genome which complicates the breeding of new cultivars. For certain traits, genetic engineering offers a potential alternative to traditional breeding. However, many strawberry varieties are quite recalcitrant for Agrobacterium-mediated transformation, and a method allowing easy handling of large amounts of starting material is needed. Also the genotyping of putative transformants is challenging since the isolation of DNA for Southern analysis is difficult due to the high amount of phenolic compounds and polysaccharides that complicate efficient extraction of digestable DNA. There is thus a need to apply a screening method that is sensitive and unambiguous in identifying the different transformation events. Results Hygromycin-resistant strawberries were developed in temporary immersion bioreactors by Agrobacterium-mediated gene transfer. Putative transformants were screened by TAIL-PCR to verify T-DNA integration and to distinguish between the individual transformation events. Several different types of border sequence arrangements were detected. Conclusion This study demonstrates that temporary immersion bioreactor system suits well for the regeneration of transgenic strawberry plants as a labour-efficient technique. Small amount of DNA required by TAIL-PCR is easily recovered even from a small transformant, which allows rapid verification of T-DNA integration and detection of separate gene transfer events. These techniques combined clearly facilitate the generation of transgenic strawberries but should be applicable to other plants as well. PMID:17309794

  1. Can we rely on the multiplex ligation-dependent probe amplification method (MLPA) for prenatal diagnosis?

    PubMed Central

    Omrani, Mir Davood; Azizi, Faezeh; Rajabibazl, Masoumeh; Safavi Naini, Niloufar; Omrani, Sara; Abbasi, Arezo Mona; Saleh Gargari, Soraya

    2014-01-01

    Background: The major aneuploidies that are diagnosed prenatally involve the autosomal chromosomes 13, 18, and 21, as well as sex chromosomes, X and Y. Because multiplex ligation-dependent probe amplification (MLPA) is rapid and non-invasive, it has replaced traditional culture methods for the screening and diagnosis of common aneuploidies in some countries. Objective: To evaluate the sensitivity and specificity of MLPA in a cross-sectional descriptive study for the detection of chromosomal aneuploidies in comparison to other methods. Materials and Methods: Genomic DNA was extracted from the peripheral blood samples of 10 normal controls and the amniotic fluid of 55 patients. Aneuploidies screening of chromosomes 13, 18, 21, X and Y were carried out using specific MLPA probe mixes (P095-A2). For comparison purposes, samples were also tested by Quantitative Fluorescent-PCR (QF-PCR) and routine chromosomal culture method. Results: Using this specific MLPA technique and data-analyzing software (Genemarker v1.85), one case was diagnosed with 45, X (e.g. Monosomy X or Turner’s Syndrome), and the remaining 54 cases revealed normal karyotypes. These results were concordant with routine chromosomal culture and QF-PCR findings. Conclusion: The experiment demonstrates that MLPA can provide a rapid and accurate clinical method for prenatal identification of common chromosomal aneuploidies with 100% sensitivity and 100% specificity. PMID:24976821

  2. Digital-Direct-RT-PCR: a sensitive and specific method for quantification of CTC in patients with cervical carcinoma.

    PubMed

    Pfitzner, Claudia; Schröder, Isabel; Scheungraber, Cornelia; Dogan, Askin; Runnebaum, Ingo Bernhard; Dürst, Matthias; Häfner, Norman

    2014-02-05

    The detection of circulating tumour cells (CTC) in cancer patients may be useful for therapy monitoring and prediction of relapse. A sensitive assay based on HPV-oncogene transcripts which are highly specific for cervical cancer cells was established. The Digital-Direct-RT-PCR (DD-RT-PCR) combines Ficoll-separation, ThinPrep-fixation and one-step RT-PCR in a low-throughput digital-PCR format enabling the direct analysis and detection of individual CTC without RNA isolation. Experimental samples demonstrated a sensitivity of one HPV-positive cell in 500,000 HPV-negative cells. Spike-in experiments with down to 5 HPV-positive cells per millilitre EDTA-blood resulted in concordant positive results by PCR and immunocytochemistry. Blood samples from 3 of 10 CxCa patients each contained a single HPV-oncogene transcript expressing CTC among 5 to 15*10(5) MNBC. Only 1 of 7 patients with local but 2 of 3 women with systemic disease had CTC. This highly sensitive DD-RT-PCR for the detection of CTC may also be applied to other tumour entities which express tumour-specific transcripts.

  3. Large scale q-PCR reveals maize transcription factors that are regulated under water deficit in a tissue-specific manner

    USDA-ARS?s Scientific Manuscript database

    Water deficit stress is a major component of agricultural drought events and contributes greatly to yield loss in all crops. Genetic modification to improve water deficit tolerance is an obvious strategy to mitigate this problem and an understanding of the mechanism of adaptation to water deficit is...

  4. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    PubMed

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  5. Characterization of Aspergillus flavus strains from Brazilian Brazil nuts and cashew by RAPD and ribosomal DNA analysis.

    PubMed

    Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G

    2008-07-01

    The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.

  6. Advantageous Direct Quantification of Viable Closely Related Probiotics in Petit-Suisse Cheeses under In Vitro Gastrointestinal Conditions by Propidium Monoazide - qPCR

    PubMed Central

    Villarreal, Martha Lissete Morales; Padilha, Marina; Vieira, Antonio Diogo Silva; Franco, Bernadette Dora Gombossy de Melo; Martinez, Rafael Chacon Ruiz; Saad, Susana Marta Isay

    2013-01-01

    Species-specific Quantitative Real Time PCR (qPCR) alone and combined with the use of propidium monoazide (PMA) were used along with the plate count method to evaluate the survival of the probiotic strains Lactobacillus acidophilus La-5 and Bifidobacterium animalis subsp. lactis Bb-12, and the bacteriocinogenic and potentially probiotic strain Lactobacillus sakei subsp. sakei 2a in synbiotic (F1) and probiotic (F2) petit-suisse cheeses exposed throughout shelf-life to in vitro simulated gastrointestinal tract conditions. The three strains studied showed a reduction in their viability after the 6 h assay. Bb-12 displayed the highest survival capacity, above 72.6 and 74.6% of the initial populations, respectively, by plate count and PMA-qPCR, maintaining population levels in the range or above 6 log CFU/g. The prebiotic mix of inulin and FOS did not offer any additional protection for the strains against the simulated gastrointestinal environment. The microorganisms' populations were comparable among the three methods at the initial time of the assay, confirming the presence of mainly viable and culturable cells. However, with the intensification of the stress induced throughout the various stages of the in vitro test, the differences among the methods increased. The qPCR was not a reliable enumeration method for the quantification of intact bacterial populations, mixed with large numbers of injured and dead bacteria, as confirmed by the scanning electron microscopy results. Furthermore, bacteria plate counts were much lower (P<0.05) than with the PMA-qPCR method, suggesting the accumulation of stressed or dead microorganisms unable to form colonies. The use of PMA overcame the qPCR inability to differentiate between dead and alive cells. The combination of PMA and species-specific qPCR in this study allowed a quick and unequivocal way of enumeration of viable closely related species incorporated into probiotic and synbiotic petit-suisse cheeses and under stress conditions. PMID:24358142

  7. Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.

    PubMed

    Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin

    2010-03-01

    Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.

  8. The detectability of the pretreatment EGFR T790M mutations in lung adenocarcinoma using CAST-PCR and digital PCR

    PubMed Central

    Tatematsu, Tsutomu; Suzuki, Ayumi; Oda, Risa; Sakane, Tadashi; Kawano, Osamu; Haneda, Hiroshi; Moriyama, Satoru; Sasaki, Hidefumi; Nakanishi, Ryoichi

    2017-01-01

    Background A gatekeeper T790M mutation is thought to cause resistance to epidermal growth factor receptor tyrosine kinase inhibitor (EGFR-TKI) treatment. The detection of a 2nd mutation is important for planning the next therapy when patients acquire resistance to the first line EGFR-TKI. Methods We used a competitive allele-specific polymerase chain reaction (CAST-PCR) to analyze the incidence and clinical significance of T790M mutations in 153 lung adenocarcinomas with EGFR-activating mutations. To increase the sensitivity and specificity of the detection of T790M mutations, we subjected 20 of the 153 cases to a digital PCR. The genomic DNAs were extracted from frozen, surgically resected tumor tissue specimens. Results The CAST-PCR detected T790M mutations in 45 (29.4%) of the 153 cases. The analytical sensitivity in the detection T790M mutations was 0.13–2.65% (average 0.27%, median 0.20%). In contrast, the digital PCR, detected T790M mutations in 8 (40%) out of 20 cases. Conclusions Our study shows that the pretreatment incidence of T790M mutation was less than that reported in previous studies. In order to clinically use pretreatment EGFR T790M mutation identification method, we should clarify the adequate methods and tissue preserved status. PMID:28932544

  9. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments.

    PubMed

    Ganger, Michael T; Dietz, Geoffrey D; Ewing, Sarah J

    2017-12-01

    qPCR has established itself as the technique of choice for the quantification of gene expression. Procedures for conducting qPCR have received significant attention; however, more rigorous approaches to the statistical analysis of qPCR data are needed. Here we develop a mathematical model, termed the Common Base Method, for analysis of qPCR data based on threshold cycle values (C q ) and efficiencies of reactions (E). The Common Base Method keeps all calculations in the logscale as long as possible by working with log 10 (E) ∙ C q , which we call the efficiency-weighted C q value; subsequent statistical analyses are then applied in the logscale. We show how efficiency-weighted C q values may be analyzed using a simple paired or unpaired experimental design and develop blocking methods to help reduce unexplained variation. The Common Base Method has several advantages. It allows for the incorporation of well-specific efficiencies and multiple reference genes. The method does not necessitate the pairing of samples that must be performed using traditional analysis methods in order to calculate relative expression ratios. Our method is also simple enough to be implemented in any spreadsheet or statistical software without additional scripts or proprietary components.

  10. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    PubMed

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  11. Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus: methicillin-resistant isolates are detected directly in blood cultures by multiplex PCR.

    PubMed

    Pereira, Eliezer M; Schuenck, Ricardo P; Malvar, Karoline L; Iorio, Natalia L P; Matos, Pricilla D M; Olendzki, André N; Oelemann, Walter M R; dos Santos, Kátia R N

    2010-03-31

    In this study, we standardized and evaluated a multiplex-PCR methodology using specific primers to identify Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus haemolyticus and their methicillin-resistance directly from blood cultures. Staphylococci clinical isolates (149) and control strains (16) previously identified by conventional methods were used to establish the multiplex PCR protocol. Subsequently, this methodology was evaluated using a fast and cheap DNA extraction protocol from 25 staphylococci positive blood cultures. A wash step of the pellet with 0.1% bovine serum albumin (BSA) solution was performed to reduce PCR inhibitors. Amplicons of 154bp (mecA gene), 271bp (S. haemolyticus mvaA gene) and 108 and 124bp (S. aureus and S. epidermidis species-specific fragments, respectively) were observed. Reliable results were obtained for 100% of the evaluated strains, suggesting that this new multiplex-PCR combined with an appropriate DNA-extraction method could be useful in the laboratory for fast and accurate identification of three staphylococci species and simultaneously their methicillin resistance directly in blood cultures.

  12. Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.

    PubMed

    Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana

    2010-12-01

    A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp. Copyright © 2010 Elsevier GmbH. All rights reserved.

  13. PCR detection and identification of oral streptococci in saliva samples using gtf genes.

    PubMed

    Hoshino, Tomonori; Kawaguchi, Mamoru; Shimizu, Noriko; Hoshino, Naoko; Ooshima, Takashi; Fujiwara, Taku

    2004-03-01

    Oral streptococci are major constituents of dental plaque, and their prevalence is implicated in various pathologies. Therefore, accurate identification of oral streptococci would be valuable for studies of cariogenic plaque and for diagnostic use in infective endocarditis. Many oral streptococci possess glucosyltransferase enzymes that synthesize glucan, which is an obligate component of dental plaque. We established a rapid and precise method to identify oral streptococci by PCR using the species-specific region from the glucosyltransferase gene. With the species-specific primers, Streptococcus mutans, S. sobrinus, S. salivarius, S. sanguinis, S. oralis, and S. gordonii could be successfully distinguished. Further, we developed a simple method to extract the bacterial DNA from saliva. Using the resultant DNA as a template, the proposed PCR detection was performed. Their distribution was in accord with results of conventional biochemical tests. These findings indicate that the present PCR method is useful for the analysis of oral streptococci and can be successfully used in clinical applications to identify pathogenic bacteria associated with oral infectious disease and/or endocarditis.

  14. Development of multiplex PCR assay for authentication of Cornu Cervi Pantotrichum in traditional Chinese medicine based on cytochrome b and C oxidase subunit 1 genes.

    PubMed

    Gao, Lijun; Xia, Wei; Ai, Jinxia; Li, Mingcheng; Yuan, Guanxin; Niu, Jiamu; Fu, Guilian; Zhang, Lihua

    2016-07-01

    This study describes a method for discriminating the true Cervus antlers from its counterfeits using multiplex PCR. Bioinformatics were carried out to design the specific alleles primers for mitochondrial (mt) cytochrome b (Cyt b) and cytochrome C oxidase subunit 1 (Cox 1) genes. The mt DNA and genomic DNA were extracted from Cervi Cornu Pantotrichum through the modified alkaline and the salt-extracting method in addition to its counterfeits, respectively. Sufficient DNA templates were extracted from all samples used in two methods, and joint fragments of 354 bp and 543 bp that were specifically amplified from both of true Cervus antlers served as a standard control. The data revealed that the multiplex PCR-based assays using two primer sets can be used for forensic and quantitative identification of original Cervus deer products from counterfeit antlers in a single step.

  15. Immunohistochemistry and Polymerase Chain Reaction for Detection Human Papilloma Virus in Warts: A Comparative Study

    PubMed Central

    Lee, Hong Sun; Lee, Ji Hyun; Choo, Ji Yoon; Byun, Hee Jin; Jun, Jin Hyun

    2016-01-01

    Background Immunohistochemistry and polymerase chain reaction (PCR) are the most widely used methods for the detection of viruses. PCR is known to be a more sensitive and specific method than the immunohistochemical method at this time, but PCR has the disadvantages of high cost and skilled work to use widely. With the progress of technology, the immunohistochemical methods used in these days has come to be highly sensitive and actively used in the diagnostic fields. Objective To evaluate and compare the usefulness of immunohistochemistry and PCR for detection human papilloma virus (HPV) in wart lesions. Methods Nine biopsy samples of verruca vulgaris and 10 of condyloma accuminatum were examined. Immunohistochemical staining using monoclonal antibody to HPV L1 capsid protein and PCR were done for the samples. DNA sequencing of the PCR products and HPV genotyping were also done. Results HPV detection rate was 78.9% (88.9% in verruca vulgaris, 70.0% in condyloma accuminatum) on immunohistochemistry and 100.0% for PCR. HPV-6 genotype showed a lower positivity rate on immunohistochemistry (50.0%) as compared to that of the other HPV genotypes. Conclusion Immunohistochemistry for HPV L1 capsid protein showed comparable sensitivity for detection HPV. Considering the high cost and great effort needed for the PCR methods, we can use immunohistochemistry for HPV L1 capsid protein with the advantage of lower cost and simple methods for HPV detection. PMID:27489431

  16. [Analytical performances of real-time PCR by Abbott RealTime CMV with m2000 for the detection of cytomegalovirus in urine].

    PubMed

    De Monte, Anne; Cannavo, Isabelle; Caramella, Anne; Ollier, Laurence; Giordanengo, Valérie

    2016-01-01

    Congenital cytomegalovirus (CMV) infection is the leading cause of sensoneurinal disability due to infectious congenital disease. The diagnosis of congenital CMV infection is based on the search of CMV in the urine within the first two weeks of life. Viral culture of urine is the gold standard. However, the PCR is highly sensitive and faster. It is becoming an alternative choice. The objective of this study is the validation of real-time PCR by Abbott RealTime CMV with m2000 for the detection of cytomegalovirus in urine. Repeatability, reproducibility, detection limit and inter-sample contamination were evaluated. Urine samples from patients (n=141) were collected and analyzed simultaneously in culture and PCR in order to assess the correlation of these two methods. The sensitivity and specificity of PCR were also calculated. The Abbott RealTime CMV PCR in urine is an automated and sensitive method (detection limit 200 UI/mL). Fidelity is very good (standard deviation of repeatability: 0.08 to 0.15 LogUI/mL and reproducibility 0.18 LogUI/mL). We can note a good correlation between culture and Abbott RealTime CMV PCR (kappa 96%). When considering rapid culture as reference, real-time PCR was highly sensitive (100%) and specific (98.2%). The real-time PCR by Abbott RealTime CMV with m2000 is optimal for CMV detection in urine.

  17. A survey of tools for the analysis of quantitative PCR (qPCR) data.

    PubMed

    Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas

    2014-09-01

    Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.

  18. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    PubMed

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  19. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis

    PubMed Central

    2010-01-01

    Background Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. Results The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 105 genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively. In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. Conclusions The PCR provides increased sensitivity and the multiplex format facilitates diagnosis of S. pneumoniae, H. influenzae and N. meningitidis and the assay enable detection after antibiotic treatment has been installed. Quantification increases the specificity of the etiology for pneumonia. PMID:21129171

  20. Multiplex quantitative PCR for detection of lower respiratory tract infection and meningitis caused by Streptococcus pneumoniae, Haemophilus influenzae and Neisseria meningitidis.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Korsgaard, Jens; Blomberg, Jonas; Welinder-Olsson, Christina; Herrmann, Björn

    2010-12-03

    Streptococcus pneumoniae and Haemophilus influenzae cause pneumonia and as Neisseria meningitidis they are important agents of meningitis. Although several PCR methods have been described for these bacteria the specificity is an underestimated problem. Here we present a quantitative multiplex real-time PCR (qmPCR) for detection of S. pneumoniae (9802 gene fragment), H. influenzae (omp P6 gene) and N. meningitidis (ctrA gene). The method was evaluated on bronchoalveolar lavage (BAL) samples from 156 adults with lower respiratory tract infection (LRTI) and 31 controls, and on 87 cerebrospinal fluid (CSF) samples from meningitis patients. The analytical sensitivity was not affected by using a combined mixture of reagents and a combined DNA standard (S. pneumoniae/H. influenzae/N. meningitidis) in single tubes. By blood- and BAL-culture and S. pneumoniae urinary antigen test, S. pneumoniae and H. influenzae were aetiological agents in 21 and 31 of the LTRI patients, respectively. These pathogens were identified by qmPCR in 52 and 72 of the cases, respectively, yielding sensitivities and specificities of 95% and 75% for S. pneumoniae, and 90% and 65% for H. influenzae, respectively. When using a cut-off of 10⁵ genome copies/mL for clinical positivity the sensitivities and specificities were 90% and 80% for S. pneumoniae, and 81% and 85% for H. influenzae, respectively. Of 44 culture negative but qmPCR positive for H. influenzae, 41 were confirmed by fucK PCR as H. influenzae. Of the 103 patients who had taken antibiotics prior to sampling, S. pneumoniae and H. influenzae were identified by culture in 6% and 20% of the cases, respectively, and by the qmPCR in 36% and 53% of the cases, respectively.In 87 CSF samples S. pneumoniae and N. meningitidis were identified by culture and/or 16 S rRNA in 14 and 10 samples and by qmPCR in 14 and 10 samples, respectively, giving a sensitivity of 100% and a specificity of 100% for both bacteria. The PCR provides increased sensitivity and the multiplex format facilitates diagnosis of S. pneumoniae, H. influenzae and N. meningitidis and the assay enable detection after antibiotic treatment has been installed. Quantification increases the specificity of the etiology for pneumonia.

  1. Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

    PubMed

    Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

    2011-01-01

    It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

  2. Halal authenticity of gelatin using species-specific PCR.

    PubMed

    Shabani, Hessam; Mehdizadeh, Mehrangiz; Mousavi, Seyed Mohammad; Dezfouli, Ehsan Ansari; Solgi, Tara; Khodaverdi, Mahdi; Rabiei, Maryam; Rastegar, Hossein; Alebouyeh, Mahmoud

    2015-10-01

    Consumption of food products derived from porcine sources is strictly prohibited in Islam. Gelatin, mostly derived from bovine and porcine sources, has many applications in the food and pharmaceutical industries. To ensure that food products comply with halal regulations, development of valid and reliable analytical methods is very much required. In this study, a species-specific polymerase chain reaction (PCR) assay using conserved regions of mitochondrial DNA (cytochrome b gene) was performed to evaluate the halal authenticity of gelatin. After isolation of DNA from gelatin powders with known origin, conventional PCR using species-specific primers was carried out on the extracted DNA. The amplified expected PCR products of 212 and 271 bp were observed for porcine and bovine gelatin, respectively. The sensitivity of the method was tested on binary gelatin mixtures containing 0.1%, 1%, 10%, and 100% (w/w) of porcine gelatin within bovine gelatin and vice versa. Although most of the DNA is degraded due to the severe processing steps of gelatin production, the minimum level of 0.1% w/w of both porcine and bovine gelatin was detected. Moreover, eight food products labeled as containing bovine gelatin and eight capsule shells were subjected to PCR examination. The results showed that all samples contained bovine gelatin, and the absence of porcine gelatin was verified. This method of species authenticity is very useful to verify whether gelatin and gelatin-containing food products are derived from halal ingredients. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Quantitative real-time PCR approaches for microbial community studies in wastewater treatment systems: applications and considerations.

    PubMed

    Kim, Jaai; Lim, Juntaek; Lee, Changsoo

    2013-12-01

    Quantitative real-time PCR (qPCR) has been widely used in recent environmental microbial ecology studies as a tool for detecting and quantifying microorganisms of interest, which aids in better understandings of the complexity of wastewater microbial communities. Although qPCR can be used to provide more specific and accurate quantification than other molecular techniques, it does have limitations that must be considered when applying it in practice. This article reviews the principle of qPCR quantification and its applications to microbial ecology studies in various wastewater treatment environments. Here we also address several limitations of qPCR-based approaches that can affect the validity of quantification data: template nucleic acid quality, nucleic acid extraction efficiency, specificity of group-specific primers and probes, amplification of nonviable DNA, gene copy number variation, and limited number of sequences in the database. Even with such limitations, qPCR is reportedly among the best methods for quantitatively investigating environmental microbial communities. The application of qPCR is and will continue to be increasingly common in studies of wastewater treatment systems. To obtain reliable analyses, however, the limitations that have often been overlooked must be carefully considered when interpreting the results. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Validation and Application of a PCR Primer Set to Quantify Fungal Communities in the Soil Environment by Real-Time Quantitative PCR

    PubMed Central

    Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel

    2011-01-01

    Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659

  5. Comparative analysis of minimal residual disease detection using four-color flow cytometry, consensus IgH-PCR, and quantitative IgH PCR in CLL after allogeneic and autologous stem cell transplantation.

    PubMed

    Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M

    2004-10-01

    The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.

  6. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  7. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  8. URPD: a specific product primer design tool.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  9. Detection of Echinococcus multilocularis by MC-PCR: evaluation of diagnostic sensitivity and specificity without gold standard.

    PubMed

    Wahlström, Helene; Comin, Arianna; Isaksson, Mats; Deplazes, Peter

    2016-01-01

    A semi-automated magnetic capture probe-based DNA extraction and real-time PCR method (MC-PCR), allowing for a more efficient large-scale surveillance of Echinococcus multilocularis occurrence, has been developed. The test sensitivity has previously been evaluated using the sedimentation and counting technique (SCT) as a gold standard. However, as the sensitivity of the SCT is not 1, test characteristics of the MC-PCR was also evaluated using latent class analysis, a methodology not requiring a gold standard. Test results, MC-PCR and SCT, from a previous evaluation of the MC-PCR using 177 foxes shot in the spring (n=108) and autumn 2012 (n=69) in high prevalence areas in Switzerland were used. Latent class analysis was used to estimate the test characteristics of the MC-PCR. Although it is not the primary aim of this study, estimates of the test characteristics of the SCT were also obtained. This study showed that the sensitivity of the MC-PCR was 0.88 [95% posterior credible interval (PCI) 0.80-0.93], which was not significantly different than the SCT, 0.83 (95% PCI 0.76-0.88), which is currently considered as the gold standard. The specificity of both tests was high, 0.98 (95% PCI 0.94-0.99) for the MC-PCR and 0.99 (95% PCI 0.99-1) for the SCT. In a previous study, using fox scats from a low prevalence area, the specificity of the MC-PCR was higher, 0.999% (95% PCI 0.997-1). One reason for the lower estimate of the specificity in this study could be that the MC-PCR detects DNA from infected but non-infectious rodents eaten by foxes. When using MC-PCR in low prevalence areas or areas free from the parasite, a positive result in the MC-PCR should be regarded as a true positive. The sensitivity of the MC-PCR (0.88) was comparable to the sensitivity of SCT (0.83).

  10. Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene

    PubMed Central

    Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

    2017-01-01

    Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10-4 ng μL-1), being 10 times more sensitive than nested PCR (1.28 × 10-3 ng μL-1), 100 times more sensitive than real-time PCR (1.28 × 10-2 ng μL-1) and 103 times more sensitive than the conventional PCR assay (1.28 × 10-1 ng μL-1). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics. PMID:29051751

  11. Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene.

    PubMed

    Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

    2017-01-01

    Late blight, caused by the oomycete Phytophthora infestans , is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10 -4 ng μL -1 ), being 10 times more sensitive than nested PCR (1.28 × 10 -3 ng μL -1 ), 100 times more sensitive than real-time PCR (1.28 × 10 -2 ng μL -1 ) and 10 3 times more sensitive than the conventional PCR assay (1.28 × 10 -1 ng μL -1 ). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics.

  12. Quantification of measles, mumps and rubella viruses using real-time quantitative TaqMan-based RT-PCR assay.

    PubMed

    Ammour, Y; Faizuloev, E; Borisova, T; Nikonova, A; Dmitriev, G; Lobodanov, S; Zverev, V

    2013-01-01

    In this study, a rapid quantitative method using TaqMan-based real-time reverse transcription-polymerase chain reaction (qPCR-RT) has been developed for estimating the titers of measles, mumps and rubella (MMR) viruses in infected cell culture supernatants. The qPCR-RT assay was demonstrated to be a specific, sensitive, efficient and reproducible method. For MMR viral samples obtained during MMR viral propagations in Vero cells at a different multiplicity of infection, titers determined by the qPCR-RT assay have been compared with estimates of infectious virus obtained by a traditional commonly used method for MMR viruses - 50% cell culture infective dose (CCID(50)) assay, in paired samples. Pearson analysis evidenced a significant correlation between both methods for a certain period after viral inoculation. Furthermore, the established qPCR-RT assay was faster and less-laborious. The developed method could be used as an alternative method or a supplementary tool for the routine titer estimation during MMR vaccine production. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.

    PubMed

    Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S

    2015-11-01

    The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  14. Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis

    PubMed Central

    Chen, Derrick J.; Procop, Gary W.; Vogel, Sherilynn; Yen-Lieberman, Belinda

    2015-01-01

    The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. PMID:26292304

  15. Detection of Genetically Modified Maize in Processed Foods Sold Commercially in Iran by Qualitative PCR

    PubMed Central

    Rabiei, Maryam; Mehdizadeh, Mehrangiz; Rastegar, Hossein; Vahidi, Hossein; Alebouyeh, Mahmoud

    2013-01-01

    Detection of genetically modified organisms (GMOs) in food is an important issue for all the subjects involved in food control and customer’s right. Due to the increasing number of GMOs imported to Iran during the past few years, it has become necessary to screen the products in order to determine the identity of the consumed daily foodstuffs. In this study, following the extraction of genomic DNA from processed foods sold commercially in Iran, qualitative PCR was performed to detect genetically modified maize. The recombinant DNA target sequences were detected with primers highly specific for each investigated transgene such as CaMV35s gene, Bt-11, MON810 and Bt-176 separately. Based on the gel electrophoresis results, Bt- 11 and MON810 events were detected in some maize samples, while, in none of them Bt- 176 modified gene was detected. For the first time, the results demonstrate the presence of genetically modified maize in Iranian food products, reinforcing the need for the development of labeling system and valid quantitative methods in routine analyses. PMID:24250568

  16. Detection of genetically modified maize in processed foods sold commercially in iran by qualitative PCR.

    PubMed

    Rabiei, Maryam; Mehdizadeh, Mehrangiz; Rastegar, Hossein; Vahidi, Hossein; Alebouyeh, Mahmoud

    2013-01-01

    Detection of genetically modified organisms (GMOs) in food is an important issue for all the subjects involved in food control and customer's right. Due to the increasing number of GMOs imported to Iran during the past few years, it has become necessary to screen the products in order to determine the identity of the consumed daily foodstuffs. In this study, following the extraction of genomic DNA from processed foods sold commercially in Iran, qualitative PCR was performed to detect genetically modified maize. The recombinant DNA target sequences were detected with primers highly specific for each investigated transgene such as CaMV35s gene, Bt-11, MON810 and Bt-176 separately. Based on the gel electrophoresis results, Bt- 11 and MON810 events were detected in some maize samples, while, in none of them Bt- 176 modified gene was detected. For the first time, the results demonstrate the presence of genetically modified maize in Iranian food products, reinforcing the need for the development of labeling system and valid quantitative methods in routine analyses.

  17. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    PubMed

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  18. Clinical sensitivity and specificity of the Check-Points Check-Direct ESBL Screen for BD MAX, a real-time PCR for direct ESBL detection from rectal swabs.

    PubMed

    Souverein, Dennis; Euser, Sjoerd M; van der Reijden, Wil A; Herpers, Bjorn L; Kluytmans, Jan; Rossen, John W A; Den Boer, Jeroen W

    2017-09-01

    To determine the diagnostic accuracy of the Check-Direct ESBL Screen for BD MAX (ESBL qPCR) and an ESBL culture method to identify ESBLs directly from rectal swabs. Rectal swabs were obtained from clinical patients by performing cross-sectional (point)prevalence measurements in three regional hospitals. Rectal swabs were analysed by direct culture (ChromID ESBL agar) and with the ESBL qPCR. Suspected ESBL-producing isolates were confirmed with the combination disc method and analysed by WGS. Out of 354 rectal swabs and 351 patients, 21 rectal swabs and 20 patients were positive for ESBL-producing isolates, resulting in a regional ESBL colonization prevalence of 5.7%. One rectal swab was false negative with the ESBL qPCR (blaTEM-12) and not covered by the ESBL qPCR. Eight ESBL qPCR-positive rectal swabs could not be confirmed by culture and were classified as false ESBL qPCR positive. The sensitivity and specificity of the ESBL qPCR were 95.2% (n = 20) and 97.6% (n = 323), respectively. When an optimal cycle threshold cut-off value of 37 was used, the ESBL qPCR displayed a sensitivity and specificity of 95.2% (n = 20) and 98.8% (n = 327), respectively (AUC = 0.975, 95% CI = 0.922-1). This ESBL qPCR offers rapid direct detection of the most prevalent ESBL types (blaCTX-M group and blaSHV group) from rectal swabs. The relatively high false-positive rate renders this test the most suitable as a screening test in high-prevalence regions or in an outbreak setting where a fast result is essential. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Usefulness of multiplex PCR methods and respiratory viruses’ distribution in children below 15 years old according to age, seasons and clinical units in France: A 3 years retrospective study

    PubMed Central

    Collin, Gilles; Ichou, Houria; Charpentier, Charlotte; Bendhafer, Samia; Dumitrescu, Madalina; Allal, Lahcene; Cojocaru, Bogdan; Desfrère, Luc; Descamps, Diane; Mandelbrot, Laurent; Houhou-Fidouh, Nadhira

    2017-01-01

    Background To date, only influenza and RSV testing are recommended for respiratory viruses’ detection in paediatric units. In this study, we described, according to seasons, ages and clinical units, the results obtained in children (<15 years old) by multiplex-PCR (mPCR) tests allowing a quick and wide range detection of all respiratory viruses. These results were also compared with RSV specific detection. Methods All nasopharyngeal mPCR and RSV tests requested by clinicians in our French teaching hospitals group between 2011 and 2014 were retrospectively included. All repeated samples for the same children in the same month were discarded. Results Of the 381 mPCR tests (344 children) performed, 51.4% were positive. Positivity and viral co-infection rates were higher in the 6–36 months old strata (81% and 25%, p<0.0001 and p = 0.04, respectively). Viral distribution showed strong variations across ages. During specific influenza epidemic periods, only 1/39 (2.5%) mPCR tests were positive for influenza and 19/39 (48.7%) for other viruses. During specific RSV epidemic periods, only 8/46 (17.4%) mPCR tests were positive for RSV and 14/46 (30.4%) for other viruses. 477/1529 (31.2%) of RSV immunochromatography-tests were positive. Among the negatives immunochromatography-test also explored by mPCR, 28/62 (31%) were positive for other respiratory viruses. Conclusion This study provides a wide description of respiratory viruses’ distribution among children in hospital settings using mPCR over 3 years. It emphasizes the number of undiagnosed respiratory viruses according to the current diagnosis practice in France and gives a better picture of respiratory viruses identified in hospital settings by mPCR all over the year in France. PMID:28235002

  20. Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.

    PubMed

    Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong

    2014-09-01

    PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.

Top