Sample records for evolutionarily conserved transcriptional

  1. The evolutionarily conserved transcription factor PRDM12 controls sensory neuron development and pain perception.


    Nagy, Vanja; Cole, Tiffany; Van Campenhout, Claude; Khoung, Thang M; Leung, Calvin; Vermeiren, Simon; Novatchkova, Maria; Wenzel, Daniel; Cikes, Domagoj; Polyansky, Anton A; Kozieradzki, Ivona; Meixner, Arabella; Bellefroid, Eric J; Neely, G Gregory; Penninger, Josef M


    PR homology domain-containing member 12 (PRDM12) belongs to a family of conserved transcription factors implicated in cell fate decisions. Here we show that PRDM12 is a key regulator of sensory neuronal specification in Xenopus. Modeling of human PRDM12 mutations that cause hereditary sensory and autonomic neuropathy (HSAN) revealed remarkable conservation of the mutated residues in evolution. Expression of wild-type human PRDM12 in Xenopus induced the expression of sensory neuronal markers, which was reduced using various human PRDM12 mutants. In Drosophila, we identified Hamlet as the functional PRDM12 homolog that controls nociceptive behavior in sensory neurons. Furthermore, expression analysis of human patient fibroblasts with PRDM12 mutations uncovered possible downstream target genes. Knockdown of several of these target genes including thyrotropin-releasing hormone degrading enzyme (TRHDE) in Drosophila sensory neurons resulted in altered cellular morphology and impaired nociception. These data show that PRDM12 and its functional fly homolog Hamlet are evolutionary conserved master regulators of sensory neuronal specification and play a critical role in pain perception. Our data also uncover novel pathways in multiple species that regulate evolutionary conserved nociception.

  2. Evolutionarily-conserved role of the NF-kappaB transcription factor in neural plasticity and memory.


    Romano, Arturo; Freudenthal, Ramiro; Merlo, Emiliano; Routtenberg, Aryeh


    NF-kappaB is an evolutionarily conserved family of transcription factors (TFs) critically involved in basic cellular mechanisms of the immune response, inflammation, development and apoptosis. In spite of the fact that it is expressed in the central nervous system, particularly in areas involved in memory processing, and is activated by signals such as glutamate and Ca2+, its role in neural plasticity and memory has only recently become apparent. A surprising feature of this molecule is its presence within the synapse. An increasing number of reports have called attention to the role of this TF in processes that require long-term regulation of the synaptic function underlying memory and neural plasticity. Here we review the evidence regarding a dual role for NF-kappaB, as both a signalling molecule after its activation at the synapse and a transcriptional regulator upon reaching the nucleus. The specific role of this signal, as well as the general transcriptional mechanism, in the process of memory formation is discussed. Converging lines of evidence summarized here point to a pivotal role for the NF-kappaB transcription factor as a direct signalling mechanism in the regulation of gene expression involved in long-term memory.

  3. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

    PubMed Central


    Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

  4. Redundant ERF-VII Transcription Factors Bind to an Evolutionarily Conserved cis-Motif to Regulate Hypoxia-Responsive Gene Expression in Arabidopsis

    PubMed Central

    Gasch, Philipp; Fundinger, Moritz; Müller, Jana T.; Lee, Travis; Mustroph, Angelika


    The response of Arabidopsis thaliana to low-oxygen stress (hypoxia), such as during shoot submergence or root waterlogging, includes increasing the levels of ∼50 hypoxia-responsive gene transcripts, many of which encode enzymes associated with anaerobic metabolism. Upregulation of over half of these mRNAs involves stabilization of five group VII ethylene response factor (ERF-VII) transcription factors, which are routinely degraded via the N-end rule pathway of proteolysis in an oxygen- and nitric oxide-dependent manner. Despite their importance, neither the quantitative contribution of individual ERF-VIIs nor the cis-regulatory elements they govern are well understood. Here, using single- and double-null mutants, the constitutively synthesized ERF-VIIs RELATED TO APETALA2.2 (RAP2.2) and RAP2.12 are shown to act redundantly as principle activators of hypoxia-responsive genes; constitutively expressed RAP2.3 contributes to this redundancy, whereas the hypoxia-induced HYPOXIA RESPONSIVE ERF1 (HRE1) and HRE2 play minor roles. An evolutionarily conserved 12-bp cis-regulatory motif that binds to and is sufficient for activation by RAP2.2 and RAP2.12 is identified through a comparative phylogenetic motif search, promoter dissection, yeast one-hybrid assays, and chromatin immunopurification. This motif, designated the hypoxia-responsive promoter element, is enriched in promoters of hypoxia-responsive genes in multiple species. PMID:26668304

  5. Evolutionarily conserved regulation of TOR signalling.


    Takahara, Terunao; Maeda, Tatsuya


    The target of rapamycin (TOR) is an evolutionarily conserved protein kinase that regulates cell growth in response to various environmental as well as intracellular cues through the formation of 2 distinct TOR complexes (TORC), TORC1 and TORC2. Dysregulation of TORC1 and TORC2 activity is closely associated with various diseases, including diabetes, cancer and neurodegenerative disorders. Over the past few years, new regulatory mechanisms of TORC1 and TORC2 activity have been elucidated. Furthermore, recent advances in the study of TOR inhibitors have revealed previously unrecognized cellular functions of TORC1. In this review, we briefly summarize the current understanding of the evolutionarily conserved TOR signalling from upstream regulators to downstream events.

  6. An evolutionarily conserved Myostatin proximal promoter/enhancer confers basal levels of transcription and spatial specificity in vivo.


    Grade, Carla Vermeulen Carvalho; Salerno, Mônica Senna; Schubert, Frank R; Dietrich, Susanne; Alvares, Lúcia Elvira


    Myostatin (Mstn) is a negative regulator of skeletal muscle mass, and Mstn mutations are responsible for the double muscling phenotype observed in many animal species. Moreover, Mstn is a positive regulator of adult muscle stem cell (satellite cell) quiescence, and hence, Mstn is being targeted in therapeutic approaches to muscle diseases. In order to better understand the mechanisms underlying Mstn regulation, we searched for the gene's proximal enhancer and promoter elements, using an evolutionary approach. We identified a 260-bp-long, evolutionary conserved region upstream of tetrapod Mstn and teleost mstn b genes. This region contains binding sites for TATA binding protein, Meis1, NF-Y, and for CREB family members, suggesting the involvement of cAMP in Myostatin regulation. The conserved fragment was able to drive reporter gene expression in C2C12 cells in vitro and in chicken somites in vivo; both normally express Mstn. In contrast, the reporter construct remained silent in the avian neural tube that normally does not express Mstn. This suggests that the identified element serves as a minimal promoter, harboring some spatial specificity. Finally, using bioinformatic approaches, we identified additional genes in the human genome associated with sequences similar to the Mstn proximal promoter/enhancer. Among them are genes important for myogenesis. This suggests that Mstn and these genes may form a synexpression group, regulated by a common signaling pathway.

  7. The transcription factor HNF1α induces expression of angiotensin-converting enzyme 2 (ACE2) in pancreatic islets from evolutionarily conserved promoter motifs.


    Pedersen, Kim Brint; Chhabra, Kavaljit H; Nguyen, Van K; Xia, Huijing; Lazartigues, Eric


    Pancreatic angiotensin-converting enzyme 2 (ACE2) has previously been shown to be critical for maintaining glycemia and β-cell function. Efforts to maintain or increase ACE2 expression in pancreatic β-cells might therefore have therapeutic potential for treating diabetes. In our study, we investigated the transcriptional role of hepatocyte nuclear factor 1α (HNF1α) and hepatocyte nuclear factor 1β (HNF1β) in induction of ACE2 expression in insulin-secreting cells. A deficient allele of HNF1α or HNF1β causes maturity-onset diabetes of the young (MODY) types 3 and 5, respectively, in humans. We found that ACE2 is primarily transcribed from the proximal part of the ACE2 promoter in the pancreas. In the proximal part of the human ACE2 promoter, we further identified three functional HNF1 binding sites, as they have binding affinity for HNF1α and HNF1β and are required for induction of promoter activity by HNF1β in insulinoma cells. These three sites are well-conserved among mammalian species. Both HNF1α and HNF1β induce expression of ACE2 mRNA and lead to elevated levels of ACE2 protein and ACE2 enzymatic activity in insulinoma cells. Furthermore, HNF1α dose-dependently increases ACE2 expression in primary pancreatic islet cells. We conclude that HNF1α can induce the expression of ACE2 in pancreatic islet cells via evolutionarily conserved HNF1 binding sites in the ACE2 promoter. Potential therapeutics aimed at counteracting functional HNF1α depletion in diabetes and MODY3 will thus have ACE2 induction in pancreatic islets as a likely beneficial effect.

  8. Evolutionarily conserved sequences on human chromosome 21

    SciTech Connect

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila


    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  9. An evolutionarily conserved pathway controls proteasome homeostasis

    PubMed Central

    Rousseau, Adrien; Bertolotti, Anne


    The proteasome is essential for the selective degradation of most cellular proteins but how cells maintain adequate amounts of proteasome is unclear. Here we found an evolutionarily conserved signalling pathway controlling proteasome homeostasis. Central to this pathway is TORC1 whose inhibition induced all known yeast 19S regulatory particle assembly-chaperones (RACs) as well as proteasome subunits. Downstream of TORC1 inhibition, the yeast mitogen-activated protein kinase, Mpk1, ensured that the supply of RACs and proteasome subunits increased under challenging conditions to maintain proteasomal degradation and cell viability. This adaptive pathway was evolutionarily conserved, with mTOR and Erk5 controlling the levels of the four mammalian RACs and proteasome abundance. Thus, the central growth and stress controllers, TORC1 and Mpk1/Erk5, endow cells with a rapid and vital adaptive response to adjust proteasome abundance to the rising needs. Enhancing this pathway may be a useful therapeutic approach for diseases resulting from impaired proteasomal degradation. PMID:27462806

  10. An evolutionarily conserved pathway controls proteasome homeostasis.


    Rousseau, Adrien; Bertolotti, Anne


    The proteasome is essential for the selective degradation of most cellular proteins, but how cells maintain adequate amounts of proteasome is unclear. Here we show that there is an evolutionarily conserved signalling pathway controlling proteasome homeostasis. Central to this pathway is TORC1, the inhibition of which induced all known yeast 19S regulatory particle assembly-chaperones (RACs), as well as proteasome subunits. Downstream of TORC1 inhibition, the yeast mitogen-activated protein kinase, Mpk1, acts to increase the supply of RACs and proteasome subunits under challenging conditions in order to maintain proteasomal degradation and cell viability. This adaptive pathway was evolutionarily conserved, with mTOR and ERK5 controlling the levels of the four mammalian RACs and proteasome abundance. Thus, the central growth and stress controllers, TORC1 and Mpk1/ERK5, endow cells with a rapid and vital adaptive response to adjust proteasome abundance in response to the rising needs of cells. Enhancing this pathway may be a useful therapeutic approach for diseases resulting from impaired proteasomal degradation.

  11. Evolutionarily conserved genes preferentially accumulate introns

    PubMed Central

    Carmel, Liran; Rogozin, Igor B.; Wolf, Yuri I.; Koonin, Eugene V.


    Introns that interrupt eukaryotic protein-coding sequences are generally thought to be nonfunctional. However, for reasons still poorly understood, positions of many introns are highly conserved in evolution. Previous reconstructions of intron gain and loss events during eukaryotic evolution used a variety of simplified evolutionary models that yielded contradicting conclusions and are not suited to reveal some of the key underlying processes. We combine a comprehensive probabilistic model and an extended data set, including 391 conserved genes from 19 eukaryotes, to uncover previously unnoticed aspects of intron evolution—in particular, to assign intron gain and loss rates to individual genes. The rates of intron gain and loss in a gene show moderate positive correlation. A gene’s intron gain rate shows a highly significant negative correlation with the coding-sequence evolution rate; intron loss rate also significantly, but positively, correlates with the sequence evolution rate. Correlations of the opposite signs, albeit less significant ones, are observed between intron gain and loss rates and gene expression level. It is proposed that intron evolution includes a neutral component, which is manifest in the positive correlation between the gain and loss rates and a selection-driven component as reflected in the links between intron gain and loss and sequence evolution. The increased intron gain and decreased intron loss in evolutionarily conserved genes indicate that intron insertion often might be adaptive, whereas some of the intron losses might be deleterious. This apparent functional importance of introns is likely to be due, at least in part, to their multiple effects on gene expression. PMID:17495009

  12. Evolutionarily conserved regulation of hypocretin neuron specification by Lhx9.


    Liu, Justin; Merkle, Florian T; Gandhi, Avni V; Gagnon, James A; Woods, Ian G; Chiu, Cindy N; Shimogori, Tomomi; Schier, Alexander F; Prober, David A


    Loss of neurons that express the neuropeptide hypocretin (Hcrt) has been implicated in narcolepsy, a debilitating disorder characterized by excessive daytime sleepiness and cataplexy. Cell replacement therapy, using Hcrt-expressing neurons generated in vitro, is a potentially useful therapeutic approach, but factors sufficient to specify Hcrt neurons are unknown. Using zebrafish as a high-throughput system to screen for factors that can specify Hcrt neurons in vivo, we identified the LIM homeobox transcription factor Lhx9 as necessary and sufficient to specify Hcrt neurons. We found that Lhx9 can directly induce hcrt expression and we identified two potential Lhx9 binding sites in the zebrafish hcrt promoter. Akin to its function in zebrafish, we found that Lhx9 is sufficient to specify Hcrt-expressing neurons in the developing mouse hypothalamus. Our results elucidate an evolutionarily conserved role for Lhx9 in Hcrt neuron specification that improves our understanding of Hcrt neuron development.

  13. The Evolutionarily Conserved C-terminal Domains in the Mammalian Retinoblastoma Tumor Suppressor Family Serve as Dual Regulators of Protein Stability and Transcriptional Potency*

    PubMed Central

    Sengupta, Satyaki; Lingnurkar, Raj; Carey, Timothy S.; Pomaville, Monica; Kar, Parimal; Feig, Michael; Wilson, Catherine A.; Knott, Jason G.; Arnosti, David N.; Henry, R. William


    The retinoblastoma (RB) tumor suppressor and related family of proteins play critical roles in development through their regulation of genes involved in cell fate. Multiple regulatory pathways impact RB function, including the ubiquitin-proteasome system with deregulated RB destruction frequently associated with pathogenesis. With the current study we explored the mechanisms connecting proteasome-mediated turnover of the RB family to the regulation of repressor activity. We find that steady state levels of all RB family members, RB, p107, and p130, were diminished during embryonic stem cell differentiation concomitant with their target gene acquisition. Proteasome-dependent turnover of the RB family is mediated by distinct and autonomously acting instability elements (IE) located in their C-terminal regulatory domains in a process that is sensitive to cyclin-dependent kinase (CDK4) perturbation. The IE regions include motifs that contribute to E2F-DP transcription factor interaction, and consistently, p107 and p130 repressor potency was reduced by IE deletion. The juxtaposition of degron sequences and E2F interaction motifs appears to be a conserved feature across the RB family, suggesting the potential for repressor ubiquitination and specific target gene regulation. These findings establish a mechanistic link between regulation of RB family repressor potency and the ubiquitin-proteasome system. PMID:25903125

  14. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.


    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  15. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved

    PubMed Central

    Meng, Hao; Agbagwa, Ikechukwu O.; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli


    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history. PMID:26760298

  16. Aligning science and policy to achieve evolutionarily enlightened conservation.


    Cook, Carly N; Sgrò, Carla M


    There is increasing recognition among conservation scientists that long-term conservation outcomes could be improved through better integration of evolutionary theory into management practices. Despite concerns that the importance of key concepts emerging from evolutionary theory (i.e., evolutionary principles and processes) are not being recognized by managers, there has been little effort to determine the level of integration of evolutionary theory into conservation policy and practice. We assessed conservation policy at 3 scales (international, national, and provincial) on 3 continents to quantify the degree to which key evolutionary concepts, such as genetic diversity and gene flow, are being incorporated into conservation practice. We also evaluated the availability of clear guidance within the applied evolutionary biology literature as to how managers can change their management practices to achieve better conservation outcomes. Despite widespread recognition of the importance of maintaining genetic diversity, conservation policies provide little guidance about how this can be achieved in practice and other relevant evolutionary concepts, such as inbreeding depression, are mentioned rarely. In some cases the poor integration of evolutionary concepts into management reflects a lack of decision-support tools in the literature. Where these tools are available, such as risk-assessment frameworks, they are not being adopted by conservation policy makers, suggesting that the availability of a strong evidence base is not the only barrier to evolutionarily enlightened management. We believe there is a clear need for more engagement by evolutionary biologists with policy makers to develop practical guidelines that will help managers make changes to conservation practice. There is also an urgent need for more research to better understand the barriers to and opportunities for incorporating evolutionary theory into conservation practice.

  17. Exploitation of evolutionarily conserved amoeba and mammalian processes by Legionella.


    Al-Quadan, Tasneem; Price, Christopher T; Abu Kwaik, Yousef


    Legionella pneumophila proliferates within various protists and metazoan cells, where a cadre of ∼300 effectors is injected into the host cell by the defect in organelle trafficking/intracellular multiplication (Dot/Icm) type IVB translocation system. Interkingdom horizontal gene transfer of genes of protists and their subsequent convergent evolution to become translocated effectors has probably enabled L. pneumophila to adapt to the intracellular life within various protists and metazoan cells through exploitation of evolutionarily eukaryotic processes, such as endoplasmic reticulum-to-Golgi vesicle traffic, phosphoinositol metabolism, AMPylation, deAMPylation, prenylation, polyubiquitination, proteasomal degradation and cytosolic amino- and oligo-peptidases. This is highlighted by the ankyrin B (AnkB) F-box effector that exploits multiple conserved eukaryotic machineries to generate high levels of free amino acids as sources of carbon and energy essential for intracellular proliferation in protists and metazoan cells and for manifestation of pulmonary disease in mammals.

  18. Localization of an evolutionarily conserved protein proton pyrophosphatase in evolutionarily distant plants oryza sativa and physcomitrella patens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proton Pyrophosphatase (H+-PPase) is a highly evolutionarily conserved protein that is prevalent in the plant kingdom. One of the salient features of H+-PPase expression pattern, at least in vascular plants like Arabidopsis, is its conspicuous localization in both actively dividing cells and the phl...

  19. Evolutionarily Conserved, Multitasking TRP Channels: Lessons from Worms and Flies

    PubMed Central

    Venkatachalam, Kartik; Luo, Junjie; Montell, Craig


    The Transient Receptor Potential (TRP) channel family is comprised of a large group of cation-permeable channels, which display an extraordinary diversity of roles in sensory signaling. TRPs allow animals to detect chemicals, mechanical force, light, and changes in temperature. Consequently, these channels control a plethora of animal behaviors. Moreover, their functions are not limited to the classical senses, as they are cellular sensors, which are critical for ionic homeostasis and metabolism. Two genetically tractable invertebrate model organisms, Caenorhabditis elegans and Drosophila melanogaster, have led the way in revealing a wide array of sensory roles and behaviors that depend on TRP channels. Two overriding themes have emerged from these studies. First, TRPs are multitasking proteins, and second, many functions and modes of activation of these channels are evolutionarily conserved, including some that were formerly thought to be unique to invertebrates, such as phototransduction. Thus, worms and flies offer the potential to decipher roles for mammalian TRPs, which would otherwise not be suspected. PMID:24961975

  20. Comparison of splice sites reveals that long noncoding RNAs are evolutionarily well conserved

    PubMed Central

    Nitsche, Anne; Rose, Dominic; Fasold, Mario; Reiche, Kristin; Stadler, Peter F.


    Large-scale RNA sequencing has revealed a large number of long mRNA-like transcripts (lncRNAs) that do not code for proteins. The evolutionary history of these lncRNAs has been notoriously hard to study systematically due to their low level of sequence conservation that precludes comprehensive homology-based surveys and makes them nearly impossible to align. An increasing number of special cases, however, has been shown to be at least as old as the vertebrate lineage. Here we use the conservation of splice sites to trace the evolution of lncRNAs. We show that >85% of the human GENCODE lncRNAs were already present at the divergence of placental mammals and many hundreds of these RNAs date back even further. Nevertheless, we observe a fast turnover of intron/exon structures. We conclude that lncRNA genes are evolutionary ancient components of vertebrate genomes that show an unexpected and unprecedented evolutionary plasticity. We offer a public web service ( that allows to retrieve sets of orthologous splice sites and to produce overview maps of evolutionarily conserved splice sites for visualization and further analysis. An electronic supplement containing the ncRNA data sets used in this study is available at PMID:25802408

  1. Evolutionarily conserved substrate substructures for automated annotation of enzyme superfamilies.


    Chiang, Ranyee A; Sali, Andrej; Babbitt, Patricia C


    The evolution of enzymes affects how well a species can adapt to new environmental conditions. During enzyme evolution, certain aspects of molecular function are conserved while other aspects can vary. Aspects of function that are more difficult to change or that need to be reused in multiple contexts are often conserved, while those that vary may indicate functions that are more easily changed or that are no longer required. In analogy to the study of conservation patterns in enzyme sequences and structures, we have examined the patterns of conservation and variation in enzyme function by analyzing graph isomorphisms among enzyme substrates of a large number of enzyme superfamilies. This systematic analysis of substrate substructures establishes the conservation patterns that typify individual superfamilies. Specifically, we determined the chemical substructures that are conserved among all known substrates of a superfamily and the substructures that are reacting in these substrates and then examined the relationship between the two. Across the 42 superfamilies that were analyzed, substantial variation was found in how much of the conserved substructure is reacting, suggesting that superfamilies may not be easily grouped into discrete and separable categories. Instead, our results suggest that many superfamilies may need to be treated individually for analyses of evolution, function prediction, and guiding enzyme engineering strategies. Annotating superfamilies with these conserved and reacting substructure patterns provides information that is orthogonal to information provided by studies of conservation in superfamily sequences and structures, thereby improving the precision with which we can predict the functions of enzymes of unknown function and direct studies in enzyme engineering. Because the method is automated, it is suitable for large-scale characterization and comparison of fundamental functional capabilities of both characterized and uncharacterized

  2. Of flies, mice, and men: evolutionarily conserved tissue damage responses and aging.


    Neves, Joana; Demaria, Marco; Campisi, Judith; Jasper, Heinrich


    Studies in flies, mice, and human models have provided a conceptual framework for how paracrine interactions between damaged cells and the surrounding tissue control tissue repair. These studies have amassed evidence for an evolutionarily conserved secretory program that regulates tissue homeostasis. This program coordinates cell survival and proliferation during tissue regeneration and repair in young animals. By virtue of chronic engagement, however, it also contributes to the age-related decline of tissue homeostasis leading to degeneration, metabolic dysfunction, and cancer. Here, we review recent studies that shed light on the nature and regulation of this evolutionarily conserved secretory program.

  3. Evening Expression of Arabidopsis GIGANTEA Is Controlled by Combinatorial Interactions among Evolutionarily Conserved Regulatory Motifs[C][W][OPEN

    PubMed Central

    Nordström, Karl; Cremer, Frédéric; Tóth, Réka; Hartke, Martin; Simon, Samson; Klasen, Jonas R.; Bürstel, Ingmar; Coupland, George


    Diurnal patterns of gene transcription are often conferred by complex interactions between circadian clock control and acute responses to environmental cues. Arabidopsis thaliana GIGANTEA (GI) contributes to photoperiodic flowering, circadian clock control, and photoreceptor signaling, and its transcription is regulated by the circadian clock and light. We used phylogenetic shadowing to identify three evolutionarily constrained regions (conserved regulatory modules [CRMs]) within the GI promoter and show that CRM2 is sufficient to confer a similar transcriptional pattern as the full-length promoter. Dissection of CRM2 showed that one subfragment (CRM2-A) contributes light inducibility, while another (CRM2-B) exhibits a diurnal response. Mutational analysis showed that three ABA RESPONSE ELEMENT LIKE (ABREL) motifs in CRM2-A and three EVENING ELEMENTs (EEs) in CRM2-B are essential in combination to confer a high amplitude diurnal pattern of expression. Genome-wide analysis identified characteristic spacing patterns of EEs and 71 A. thaliana promoters containing three EEs. Among these promoters, that of FLAVIN BINDING KELCH REPEAT F-BOX1 was analyzed in detail and shown to harbor a CRM functionally related to GI CRM2. Thus, combinatorial interactions among EEs and ABRELs confer diurnal patterns of transcription via an evolutionarily conserved module present in GI and other evening-expressed genes. PMID:25361953

  4. Oncogenic effects of evolutionarily conserved noncoding RNA ECONEXIN on gliomagenesis.


    Deguchi, S; Katsushima, K; Hatanaka, A; Shinjo, K; Ohka, F; Wakabayashi, T; Zong, H; Natsume, A; Kondo, Y


    Accumulating studies have demonstrated the importance of long noncoding RNAs (lncRNAs) during oncogenic transformation. However, because most lncRNAs are currently uncharacterized, the identification of novel oncogenic lncRNAs is difficult. Given that intergenic lncRNA have substantially less sequence conservation patterns than protein-coding genes across species, evolutionary conserved intergenic lncRNAs are likely to be functional. The current study identified a novel intergenic lncRNA, LINC00461 (ECONEXIN) using a combined approach consisting of searching lncRNAs by evolutionary conservation and validating their expression in a glioma mouse model. ECONEXIN was the most highly conserved intergenic lncRNA containing 83.0% homology with the mouse ortholog (C130071C03Rik) for a region over 2500 bp in length within its exon 3. Expressions of ECONEXIN and C130071C03Rik were significantly upregulated in both human and mouse glioma tissues. Moreover, the expression of C130071C03Rik was upregulated even in precancerous conditions and markedly increased during glioma progression. Functional analysis of ECONEXIN in glioma cell lines, U87 and U251, showed it was dominantly located in the cytoplasm and interacted with miR-411-5p via two binding sites within ECONEXIN. Inhibition of ECONEXIN upregulated miR-411-5p together with the downregulation of its target, Topoisomerase 2 alpha (TOP2A), in glioma cell lines, resulting in decreased cell proliferation. Our data demonstrated that ECONEXIN is a potential oncogene that regulates TOP2A by sponging miR-411-5p in glioma. In addition, our investigative approaches to identify conserved lncRNA and their molecular characterization by validation in mouse tumor models may be useful to functionally annotate novel lncRNAs, especially cancer-associated lncRNAs.Oncogene advance online publication, 3 April 2017; doi:10.1038/onc.2017.88.

  5. Evolutionarily conserved linkage between enzyme fold, flexibility, and catalysis

    SciTech Connect

    Ramanathan, Arvind; Agarwal, Pratul K


    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme substrate interactions, thereby impacting

  6. Evolutionarily conserved linkage between enzyme fold, flexibility, and catalysis.


    Ramanathan, Arvind; Agarwal, Pratul K


    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 Å away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme-substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme-substrate interactions, thereby impacting

  7. Prediction of evolutionarily conserved interologs in Mus musculus

    PubMed Central

    Yellaboina, Sailu; Dudekula, Dawood B; Ko, Minoru SH


    Background Identification of protein-protein interactions is an important first step to understand living systems. High-throughput experimental approaches have accumulated large amount of information on protein-protein interactions in human and other model organisms. Such interaction information has been successfully transferred to other species, in which the experimental data are limited. However, the annotation transfer method could yield false positive interologs due to the lack of conservation of interactions when applied to phylogenetically distant organisms. Results To address this issue, we used phylogenetic profile method to filter false positives in interologs based on the notion that evolutionary conserved interactions show similar patterns of occurrence along the genomes. The approach was applied to Mus musculus, in which the experimentally identified interactions are limited. We first inferred the protein-protein interactions in Mus musculus by using two approaches: i) identifying mouse orthologs of interacting proteins (interologs) based on the experimental protein-protein interaction data from other organisms; and ii) analyzing frequency of mouse ortholog co-occurrence in predicted operons of bacteria. We then filtered possible false-positives in the predicted interactions using the phylogenetic profiles. We found that this filtering method significantly increased the frequency of interacting protein-pairs coexpressed in the same cells/tissues in gene expression omnibus (GEO) database as well as the frequency of interacting protein-pairs shared the similar Gene Ontology (GO) terms for biological processes and cellular localizations. The data supports the notion that phylogenetic profile helps to reduce the number of false positives in interologs. Conclusion We have developed protein-protein interaction database in mouse, which contains 41109 interologs. We have also developed a web interface to facilitate the use of database . PMID:18842131

  8. Blue reflectance in tarantulas is evolutionarily conserved despite nanostructural diversity

    PubMed Central

    Hsiung, Bor-Kai; Deheyn, Dimitri D.; Shawkey, Matthew D.; Blackledge, Todd A.


    Slight shifts in arrangement within biological photonic nanostructures can produce large color differences, and sexual selection often leads to high color diversity in clades with structural colors. We use phylogenetic reconstruction, electron microscopy, spectrophotometry, and optical modeling to show an opposing pattern of nanostructural diversification accompanied by unusual conservation of blue color in tarantulas (Araneae: Theraphosidae). In contrast to other clades, blue coloration in phylogenetically distant tarantulas peaks within a narrow 20-nm region around 450 nm. Both quasi-ordered and multilayer nanostructures found in different tarantulas produce this blue color. Thus, even within monophyletic lineages, tarantulas have evolved strikingly similar blue coloration through divergent mechanisms. The poor color perception and lack of conspicuous display during courtship of tarantulas argue that these colors are not sexually selected. Therefore, our data contrast with sexual selection that typically produces a diverse array of colors with a single structural mechanism by showing that natural selection on structural color in tarantulas resulted in convergence on similar color through diverse structural mechanisms. PMID:26702433

  9. Blue reflectance in tarantulas is evolutionarily conserved despite nanostructural diversity.


    Hsiung, Bor-Kai; Deheyn, Dimitri D; Shawkey, Matthew D; Blackledge, Todd A


    Slight shifts in arrangement within biological photonic nanostructures can produce large color differences, and sexual selection often leads to high color diversity in clades with structural colors. We use phylogenetic reconstruction, electron microscopy, spectrophotometry, and optical modeling to show an opposing pattern of nanostructural diversification accompanied by unusual conservation of blue color in tarantulas (Araneae: Theraphosidae). In contrast to other clades, blue coloration in phylogenetically distant tarantulas peaks within a narrow 20-nm region around 450 nm. Both quasi-ordered and multilayer nanostructures found in different tarantulas produce this blue color. Thus, even within monophyletic lineages, tarantulas have evolved strikingly similar blue coloration through divergent mechanisms. The poor color perception and lack of conspicuous display during courtship of tarantulas argue that these colors are not sexually selected. Therefore, our data contrast with sexual selection that typically produces a diverse array of colors with a single structural mechanism by showing that natural selection on structural color in tarantulas resulted in convergence on similar color through diverse structural mechanisms.

  10. An evolutionarily conserved gene, FUWA, plays a role in determining panicle architecture, grain shape and grain weight in rice.


    Chen, Jun; Gao, He; Zheng, Xiao-Ming; Jin, Mingna; Weng, Jian-Feng; Ma, Jin; Ren, Yulong; Zhou, Kunneng; Wang, Qi; Wang, Jie; Wang, Jiu-Lin; Zhang, Xin; Cheng, Zhijun; Wu, Chuanyin; Wang, Haiyang; Wan, Jian-Min


    Plant breeding relies on creation of novel allelic combinations for desired traits. Identification and utilization of beneficial alleles, rare alleles and evolutionarily conserved genes in the germplasm (referred to as 'hidden' genes) provide an effective approach to achieve this goal. Here we show that a chemically induced null mutation in an evolutionarily conserved gene, FUWA, alters multiple important agronomic traits in rice, including panicle architecture, grain shape and grain weight. FUWA encodes an NHL domain-containing protein, with preferential expression in the root meristem, shoot apical meristem and inflorescences, where it restricts excessive cell division. Sequence analysis revealed that FUWA has undergone a bottleneck effect, and become fixed in landraces and modern cultivars during domestication and breeding. We further confirm a highly conserved role of FUWA homologs in determining panicle architecture and grain development in rice, maize and sorghum through genetic transformation. Strikingly, knockdown of the FUWA transcription level by RNA interference results in an erect panicle and increased grain size in both indica and japonica genetic backgrounds. This study illustrates an approach to create new germplasm with improved agronomic traits for crop breeding by tapping into evolutionary conserved genes.

  11. lolal Is an Evolutionarily New Epigenetic Regulator of dpp Transcription during Dorsal–Ventral Axis Formation

    PubMed Central

    Quijano, Janine C.; Wisotzkey, Robert G.; Tran, Nancy Lan; Huang, Yunxian; Stinchfield, Michael J.; Haerry, Theodor E.; Shimmi, Osamu; Newfeld, Stuart J.


    Secreted ligands in the Dpp/BMP family drive dorsal–ventral (D/V) axis formation in all Bilaterian species. However, maternal factors regulating Dpp/BMP transcription in this process are largely unknown. We identified the BTB domain protein longitudinals lacking-like (lolal) as a modifier of decapentaplegic (dpp) mutations. We show that Lolal is evolutionarily related to the Trithorax group of chromatin regulators and that lolal interacts genetically with the epigenetic factor Trithorax-like during Dpp D/V signaling. Maternally driven LolalHA is found in oocytes and translocates to zygotic nuclei prior to the point at which dpp transcription begins. lolal maternal and zygotic mutant embryos display significant reductions in dpp, pMad, and zerknullt expression, but they are never absent. The data suggest that lolal is required to maintain dpp transcription during D/V patterning. Phylogenetic data revealed that lolal is an evolutionarily new gene present only in insects and crustaceans. We conclude that Lolal is the first maternal protein identified with a role in dpp D/V transcriptional maintenance, that Lolal and the epigenetic protein Trithorax-like are essential for Dpp D/V signaling and that the architecture of the Dpp D/V pathway evolved in the arthropod lineage after the separation from vertebrates via the incorporation of new genes such as lolal. PMID:27401231

  12. A novel evolutionarily conserved domain of cell-adhesion GPCRs mediates autoproteolysis

    PubMed Central

    Araç, Demet; Boucard, Antony A; Bolliger, Marc F; Nguyen, Jenna; Soltis, S Michael; Südhof, Thomas C; Brunger, Axel T


    The G protein-coupled receptor (GPCR) Proteolysis Site (GPS) of cell-adhesion GPCRs and polycystic kidney disease (PKD) proteins constitutes a highly conserved autoproteolysis sequence, but its catalytic mechanism remains unknown. Here, we show that unexpectedly the ∼40-residue GPS motif represents an integral part of a much larger ∼320-residue domain that we termed GPCR-Autoproteolysis INducing (GAIN) domain. Crystal structures of GAIN domains from two distantly related cell-adhesion GPCRs revealed a conserved novel fold in which the GPS motif forms five β-strands that are tightly integrated into the overall GAIN domain. The GAIN domain is evolutionarily conserved from tetrahymena to mammals, is the only extracellular domain shared by all human cell-adhesion GPCRs and PKD proteins, and is the locus of multiple human disease mutations. Functionally, the GAIN domain is both necessary and sufficient for autoproteolysis, suggesting an autoproteolytic mechanism whereby the overall GAIN domain fine-tunes the chemical environment in the GPS to catalyse peptide bond hydrolysis. Thus, the GAIN domain embodies a unique, evolutionarily ancient and widespread autoproteolytic fold whose function is likely relevant for GPCR signalling and for multiple human diseases. PMID:22333914

  13. Moonlighting glycolytic protein glyceraldehyde-3-phosphate dehydrogenase (GAPDH): an evolutionarily conserved plasminogen receptor on mammalian cells.


    Chauhan, Anoop Singh; Kumar, Manoj; Chaudhary, Surbhi; Patidar, Anil; Dhiman, Asmita; Sheokand, Navdeep; Malhotra, Himanshu; Raje, Chaaya Iyengar; Raje, Manoj


    Prokaryotic pathogens establish infection in mammals by capturing the proteolytic enzyme plasminogen (Plg) onto their surface to digest host extracellular matrix (ECM). One of the bacterial surface Plg receptors is the multifunctional glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH). In a defensive response, the host mounts an inflammatory response, which involves infiltration of leukocytes to sites of inflammation. This requires macrophage exit from the blood and migration across basement membranes, a phenomenon dependent on proteolytic remodeling of the ECM utilizing Plg. The ability of Plg to facilitate inflammatory cell recruitment critically depends on receptors on the surface of phagocyte cells. Utilizing a combination of biochemical, cellular, knockdown, and in vivo approaches, we demonstrated that upon inflammation, macrophages recruit GAPDH onto their surface to carry out the same task of capturing Plg to digest ECM to aid rapid phagocyte migration and combat the invading pathogens. We propose that GAPDH is an ancient, evolutionarily conserved receptor that plays a key role in the Plg-dependent regulation of macrophage recruitment in the inflammatory response to microbial aggression, thus pitting prokaryotic GAPDH against mammalian GAPDH, with both involved in a conserved role of Plg activation on the surface of their respective cells, to conflicting ends.-Chauhan, A. S., Kumar, M., Chaudhary, S., Patidar, A., Dhiman, A., Sheokand, N., Malhotra, H., Raje, C. I., Raje, M. Moonlighting glycolytic protein glyceraldehyde-3-phosphate dehydrogenase (GAPDH): an evolutionarily conserved plasminogen receptor on mammalian cells.

  14. The viral transactivator HBx protein exhibits a high potential for regulation via phosphorylation through an evolutionarily conserved mechanism

    PubMed Central


    Background Hepatitis B virus (HBV) encodes an oncogenic factor, HBx, which is a multifunctional protein that can induce dysfunctional regulation of signaling pathways, transcription, and cell cycle progression, among other processes, through interactions with target host factors. The subcellular localization of HBx is both cytoplasmic and nuclear. This dynamic distribution of HBx could be essential to the multiple roles of the protein at different stages during HBV infection. Transactivational functions of HBx may be exerted both in the nucleus, via interaction with host DNA-binding proteins, and in the cytoplasm, via signaling pathways. Although there have been many studies describing different pathways altered by HBx, and its innumerable binding partners, the molecular mechanism that regulates its different roles has been difficult to elucidate. Methods In the current study, we took a bioinformatics approach to investigate whether the viral protein HBx might be regulated via phosphorylation by an evolutionarily conserved mechanism. Results We found that the phylogenetically conserved residues Ser25 and Ser41 (both within the negative regulatory domain), and Thr81 (in the transactivation domain) are predicted to be phosphorylated. By molecular 3D modeling of HBx, we further show these residues are all predicted to be exposed on the surface of the protein, making them easily accesible to these types of modifications. Furthermore, we have also identified Yin Yang sites that might have the potential to be phosphorylated and O-β-GlcNAc interplay at the same residues. Conclusions Thus, we propose that the different roles of HBx displayed in different subcellular locations might be regulated by an evolutionarily conserved mechanism of posttranslational modification, via phosphorylation. PMID:23079056

  15. An evolutionarily conserved NPC subcomplex, which redistributes in part to kinetochores in mammalian cells

    PubMed Central

    Belgareh, Naïma; Rabut, Gwénaël; Baï, Siau Wei; van Overbeek, Megan; Beaudouin, Joël; Daigle, Nathalie; Zatsepina, Olga V.; Pasteau, Fabien; Labas, Valérie; Fromont-Racine, Micheline; Ellenberg, Jan; Doye, Valérie


    The nuclear pore complexes (NPCs) are evolutionarily conserved assemblies that allow traffic between the cytoplasm and the nucleus. In this study, we have identified and characterized a novel human nuclear pore protein, hNup133, through its homology with the Saccharomyces cerevisiae nucleoporin scNup133. Two-hybrid screens and immunoprecipitation experiments revealed a direct and evolutionarily conserved interaction between Nup133 and Nup84/Nup107 and indicated that hNup133 and hNup107 are part of a NPC subcomplex that contains two other nucleoporins (the previously characterized hNup96 and a novel nucleoporin designated as hNup120) homologous to constituents of the scNup84 subcomplex. We further demonstrate that hNup133 and hNup107 are localized on both sides of the NPC to which they are stably associated at interphase, remain associated as part of a NPC subcomplex during mitosis, and are targeted at early stages to the reforming nuclear envelope. Throughout mitosis, a fraction of hNup133 and hNup107 localizes to the kinetochores, thus revealing an unexpected connection between structural NPCs constituents and kinetochores. Photobleaching experiments further showed that the mitotic cytoplasm contains kinetochore-binding competent hNup133 molecules and that in contrast to its stable association with the NPCs the interaction of this nucleoporin with kinetochores is dynamic. PMID:11564755

  16. Moonlighting activity of presenilin in plants is independent of γ-secretase and evolutionarily conserved

    PubMed Central

    Khandelwal, Abha; Chandu, Dilip; Roe, Catherine M.; Kopan, Raphael; Quatrano, Ralph S.


    Presenilins (PS) provide the catalytic activity for γ-secretase, which cleaves physiologically relevant substrates including Notch, ErbB4, and APP. Recent genetic studies indicated that the contribution of PS1 to mouse development includes γ-secretase-independent functions that cannot be easily explained by any of the demonstrated or hypothesized functions of this protein. To begin a nonbiased analysis of PS1 activity unencumbered by the dominant effect stemming from loss of Notch function, we characterized PS functions in the early land plant Physcomitrella patens, which lacks Notch, ErbB4, and APP. Removal of P. patens PS resulted in phenotypic abnormalities. Further assays performed to delineate the defective pathways in PS-deficient P. patens implicated improper function of the cytoskeletal network. Importantly, this characterization of a nonmetazoan PS uncovered a previously undescribed, evolutionarily conserved function (human PS1 can rescue the growth and light responses) that is γ-secretase-independent (mutants with substitutions of the catalytic aspartyl residues retain the activity). Introduction of PpPS into PS-deficient mouse embryonic fibroblasts rescues normal growth rates, demonstrating that at least some metazoan functions of PS are evolutionarily conserved. PMID:17684101

  17. An evolutionarily conserved Rit GTPase–p38 MAPK signaling pathway mediates oxidative stress resistance

    PubMed Central

    Cai, Weikang; Rudolph, Jennifer L.; Harrison, Susan M. W.; Jin, Ling; Frantz, Aubrey L.; Harrison, Douglas A.; Andres, Douglas A.


    Ras-related small GTP-binding proteins control a wide range of cellular processes by regulating a variety of effector pathways, including prominent roles in the control of mitogen-activated protein kinase (MAPK) cascades. Although the regulatory role(s) for many Ras family GTPases are well established, the physiological function for the Rit/Rin subfamily has been lacking. Here, using both knockout mice and Drosophila models, we demonstrate an evolutionarily conserved role for Rit subfamily GTPases (mammalian Rit and Rin, and the Drosophila RIC homologue) in governing survival in response to oxidative stress. Primary embryonic fibroblasts derived from Rit knockout mice display increased apoptosis and selective disruption of MAPK signaling following reactive oxygen species (ROS) exposure but not in response to endoplasmic reticulum stress or DNA damage. These deficits include a reduction in ROS-mediated stimulation of a p38-MK2-HSP27 signaling cascade that controls Akt activation, directing Bad phosphorylation to promote cell survival. Furthermore, D-RIC null flies display increased susceptibility to environmental stresses and reduced stress-dependent p38 signaling, extending the Rit-p38 survival pathway to Drosophila. Together, our studies establish the Rit GTPases as critical regulators of an evolutionarily conserved, p38 MAPK–dependent signaling cascade that functions as an important survival mechanism for cells in response to oxidative stress. PMID:21737674

  18. Automatic annotation of experimentally derived, evolutionarily conserved post-translational modifications onto multiple genomes.


    Sridhara, Viswanadham; Marchler-Bauer, Aron; Bryant, Stephen H; Geer, Lewis Y


    New generation sequencing technologies have resulted in significant increases in the number of complete genomes. Functional characterization of these genomes, such as by high-throughput proteomics, is an important but challenging task due to the difficulty of scaling up existing experimental techniques. By use of comparative genomics techniques, experimental results can be transferred from one genome to another, while at the same time minimizing errors by requiring discovery in multiple genomes. In this study, protein phosphorylation, an essential component of many cellular processes, is studied using data from large-scale proteomics analyses of the phosphoproteome. Phosphorylation sites from Homo sapiens, Mus musculus and Drosophila melanogaster phosphopeptide data sets were mapped onto conserved domains in NCBI's manually curated portion of Conserved Domain Database (CDD). In this subset, 25 phosphorylation sites are found to be evolutionarily conserved between the three species studied. Transfer of phosphorylation annotation of these conserved sites onto sequences sharing the same conserved domains yield 3253 phosphosite annotations for proteins from coelomata, the taxonomic division that spans H. sapiens, M. musculus and D. melanogaster. The method scales automatically, so as the amount of experimental phosphoproteomics data increases, more conserved phosphorylation sites may be revealed.

  19. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges

    PubMed Central

    Lovci, Michael T; Ghanem, Dana; Marr, Henry; Arnold, Justin; Gee, Sherry; Parra, Marilyn; Liang, Tiffany Y; Stark, Thomas J; Gehman, Lauren T; Hoon, Shawn; Massirer, Katlin B; Pratt, Gabriel A; Black, Douglas L; Gray, Joe W; Conboy, John G; Yeo, Gene W


    Alternative splicing (AS) enables programmed diversity of gene expression across tissues and development. We show here that binding in distal intronic regions (>500 nucleotides (nt) from any exon) by Rbfox splicing factors important in development is extensive and is an active mode of splicing regulation. Similarly to exon-proximal sites, distal sites contain evolutionarily conserved GCATG sequences and are associated with AS activation and repression upon modulation of Rbfox abundance in human and mouse experimental systems. As a proof of principle, we validated the activity of two specific Rbfox enhancers in KIF21A and ENAH distal introns and showed that a conserved long-range RNA-RNA base-pairing interaction (an RNA bridge) is necessary for Rbfox-mediated exon inclusion in the ENAH gene. Thus we demonstrate a previously unknown RNA-mediated mechanism for AS control by distally bound RNA-binding proteins. PMID:24213538

  20. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges.


    Lovci, Michael T; Ghanem, Dana; Marr, Henry; Arnold, Justin; Gee, Sherry; Parra, Marilyn; Liang, Tiffany Y; Stark, Thomas J; Gehman, Lauren T; Hoon, Shawn; Massirer, Katlin B; Pratt, Gabriel A; Black, Douglas L; Gray, Joe W; Conboy, John G; Yeo, Gene W


    Alternative splicing (AS) enables programmed diversity of gene expression across tissues and development. We show here that binding in distal intronic regions (>500 nucleotides (nt) from any exon) by Rbfox splicing factors important in development is extensive and is an active mode of splicing regulation. Similarly to exon-proximal sites, distal sites contain evolutionarily conserved GCATG sequences and are associated with AS activation and repression upon modulation of Rbfox abundance in human and mouse experimental systems. As a proof of principle, we validated the activity of two specific Rbfox enhancers in KIF21A and ENAH distal introns and showed that a conserved long-range RNA-RNA base-pairing interaction (an RNA bridge) is necessary for Rbfox-mediated exon inclusion in the ENAH gene. Thus we demonstrate a previously unknown RNA-mediated mechanism for AS control by distally bound RNA-binding proteins.

  1. Evolutionarily conserved CLE peptide signaling in plant development, symbiosis, and parasitism.


    Miyawaki, Kaori; Tabata, Ryo; Sawa, Shinichiro


    Small polypeptides are widely used as signaling molecules in cell-to-cell communication in animals and plants. The CLAVATA3/EMBRYO SURROUNDING REGION-RELATED (CLE) gene family is composed of numerous genes that contain conserved CLE domains in various plant species and plant-parasitic nematodes. Here, we review recent progress in our understanding of CLE signaling during stem cell maintenance in Arabidopsis and grasses. We also summarize the roles of CLE signaling in the legume-Rhizobium symbiosis and infection by plant-parasitic nematodes. CLE signaling is important for diverse aspects of cell-to-cell signaling and long-distance communication, which are critical for survival, and the basic components of the CLE signaling pathway are evolutionarily conserved in both plants and animals.

  2. Nuclear autophagy: An evolutionarily conserved mechanism of nuclear degradation in the cytoplasm.


    Luo, Majing; Zhao, Xueya; Song, Ying; Cheng, Hanhua; Zhou, Rongjia


    Macroautophagy/autophagy is a catabolic process that is essential for cellular homeostasis. Studies on autophagic degradation of cytoplasmic components have generated interest in nuclear autophagy. Although its mechanisms and roles have remained elusive, tremendous progress has been made toward understanding nuclear autophagy. Nuclear autophagy is evolutionarily conserved in eukaryotes that may target various nuclear components through a series of processes, including nuclear sensing, nuclear export, autophagic substrate encapsulation and autophagic degradation in the cytoplasm. However, the molecular processes and regulatory mechanisms involved in nuclear autophagy remain largely unknown. Numerous studies have highlighted the importance of nuclear autophagy in physiological and pathological processes such as cancer. This review focuses on current advances in nuclear autophagy and provides a summary of its research history and landmark discoveries to offer new perspectives.

  3. Development and Organization of the Evolutionarily Conserved Three-Layered Olfactory Cortex

    PubMed Central


    Abstract The olfactory cortex is part of the mammalian cerebral cortex together with the neocortex and the hippocampus. It receives direct input from the olfactory bulbs and participates in odor discrimination, association, and learning (Bekkers and Suzuki, 2013). It is thought to be an evolutionarily conserved paleocortex, which shares common characteristics with the three-layered general cortex of reptiles (Aboitiz et al., 2002). The olfactory cortex has been studied as a “simple model” to address sensory processing, though little is known about its precise cell origin, diversity, and identity. While the development and the cellular diversity of the six-layered neocortex are increasingly understood, the olfactory cortex remains poorly documented in these aspects. Here is a review of current knowledge of the development and organization of the olfactory cortex, keeping the analogy with those of the neocortex. The comparison of olfactory cortex and neocortex will allow the opening of evolutionary perspectives on cortical development. PMID:28144624

  4. EAG2 potassium channel with evolutionarily conserved function as a brain tumor target

    PubMed Central

    Huang, Xi; He, Ye; Dubuc, Adrian M.; Hashizume, Rintaro; Zhang, Wei; Reimand, Jüri; Yang, Huanghe; Wang, Tongfei A.; Stehbens, Samantha J.; Younger, Susan; Barshow, Suzanne; Zhu, Sijun; Cooper, Michael K.; Peacock, John; Ramaswamy, Vijay; Garzia, Livia; Wu, Xiaochong; Remke, Marc; Forester, Craig M.; Kim, Charles C.; Weiss, William A.; James, C. David; Shuman, Marc A.; Bader, Gary D.; Mueller, Sabine; Taylor, Michael D.; Jan, Yuh Nung; Jan, Lily Yeh


    Over 20% of the drugs for treating human diseases target ion channels, however, no cancer drug approved by the U.S. Food and Drug Administration (FDA) is intended to target an ion channel. Here, we demonstrate the evolutionarily conserved function of EAG2 potassium channel in promoting brain tumor growth and metastasis, delineate downstream pathways and uncover a mechanism for different potassium channels to functionally corporate and regulate mitotic cell volume and tumor progression. We show that EAG2 potassium channel is enriched at the trailing edge of migrating MB cells to regulate local cell volume dynamics, thereby facilitating cell motility. We identify the FDA-approved antipsychotic drug thioridazine as an EAG2 channel blocker that reduces xenografted MB growth and metastasis, and present a case report of repurposing thioridazine for treating a human patient. Our findings thus illustrate the potential of targeting ion channels in cancer treatment. PMID:26258683

  5. Evolutionarily conserved coupling of adaptive and excitable networks mediates eukaryotic chemotaxis

    NASA Astrophysics Data System (ADS)

    Tang, Ming; Wang, Mingjie; Shi, Changji; Iglesias, Pablo A.; Devreotes, Peter N.; Huang, Chuan-Hsiang


    Numerous models explain how cells sense and migrate towards shallow chemoattractant gradients. Studies show that an excitable signal transduction network acts as a pacemaker that controls the cytoskeleton to drive motility. Here we show that this network is required to link stimuli to actin polymerization and chemotactic motility and we distinguish the various models of chemotaxis. First, signalling activity is suppressed towards the low side in a gradient or following removal of uniform chemoattractant. Second, signalling activities display a rapid shut off and a slower adaptation during which responsiveness to subsequent test stimuli decline. Simulations of various models indicate that these properties require coupled adaptive and excitable networks. Adaptation involves a G-protein-independent inhibitor, as stimulation of cells lacking G-protein function suppresses basal activities. The salient features of the coupled networks were observed for different chemoattractants in Dictyostelium and in human neutrophils, suggesting an evolutionarily conserved mechanism for eukaryotic chemotaxis.

  6. Phylogenetic Footprinting Reveals Evolutionarily Conserved Regions of the Gonadotropin-Releasing Hormone Gene that Enhance Cell-Specific Expression

    PubMed Central



    Reproductive function is controlled by the hypothalamic neuropeptide, GnRH, which serves as the central regulator of the hypothalamic-pituitary-gonadal axis. GnRH expression is limited to a small population of neurons in the hypothalamus. Targeting this minute population of neurons (as few as 800 in the mouse) requires regulatory elements upstream of the GnRH gene that remain to be fully characterized. Previously, we have identified an evolutionarily conserved promoter region (−173 to −1) and an enhancer (−1863 to −1571) in the rat gene that targets a subset of the GnRH neurons in vivo. In the present study, we used phylogenetic sequence comparison between human and rodents and analysis of the transcription factor clusters within conserved regions in an attempt to identify additional upstream regulatory elements. This approach led to the characterization of a new upstream enhancer that regulates expression of GnRH in a cell-specific manner. Within this upstream enhancer are nine binding sites for Octamer-binding transcription factor 1 (OCT1), known to be an important transcriptional regulator of GnRH gene expression. In addition, we have identified nuclear factor I (NF1) binding to multiple elements in the GnRH-regulatory regions, each in close proximity to OCT1. We show that OCT1 and NF1 physically and functionally interact. Moreover, the OCT1 and NF1 binding sites in the regulatory regions appear to be essential for appropriate GnRH gene expression. These findings indicate a role for this upstream enhancer and novel OCT1/NF1 complexes in neuron-restricted expression of the GnRH gene. PMID:15319450

  7. Evolutionarily distinct bacteriophage endolysins featuring conserved peptidoglycan cleavage sites protect mice from MRSA infection

    PubMed Central

    Schmelcher, Mathias; Shen, Yang; Nelson, Daniel C.; Eugster, Marcel R.; Eichenseher, Fritz; Hanke, Daniela C.; Loessner, Martin J.; Dong, Shengli; Pritchard, David G.; Lee, Jean C.; Becker, Stephen C.; Foster-Frey, Juli; Donovan, David M.


    Objectives In the light of increasing drug resistance in Staphylococcus aureus, bacteriophage endolysins [peptidoglycan hydrolases (PGHs)] have been suggested as promising antimicrobial agents. The aim of this study was to determine the antimicrobial activity of nine enzymes representing unique homology groups within a diverse class of staphylococcal PGHs. Methods PGHs were recombinantly expressed, purified and tested for staphylolytic activity in multiple in vitro assays (zymogram, turbidity reduction assay and plate lysis) and against a comprehensive set of strains (S. aureus and CoNS). PGH cut sites in the staphylococcal peptidoglycan were determined by biochemical assays (Park–Johnson and Ghuysen procedures) and MS analysis. The enzymes were tested for their ability to eradicate static S. aureus biofilms and compared for their efficacy against systemic MRSA infection in a mouse model. Results Despite similar modular architectures and unexpectedly conserved cleavage sites in the peptidoglycan (conferred by evolutionarily divergent catalytic domains), the enzymes displayed varying degrees of in vitro lytic activity against numerous staphylococcal strains, including cell surface mutants and drug-resistant strains, and proved effective against static biofilms. In a mouse model of systemic MRSA infection, six PGHs provided 100% protection from death, with animals being free of clinical signs at the end of the experiment. Conclusions Our results corroborate the high potential of PGHs for treatment of S. aureus infections and reveal unique antimicrobial and biochemical properties of the different enzymes, suggesting a high diversity of potential applications despite highly conserved peptidoglycan target sites. PMID:25630640

  8. Evolutionarily Ancient Association of the FoxJ1 Transcription Factor with the Motile Ciliogenic Program

    PubMed Central

    Ho, Hao Kee; Babu, Deepak; Eitel, Michael; Narasimhan, Vijayashankaranarayanan; Tiku, Varnesh; Westbrook, Jody; Schierwater, Bernd; Roy, Sudipto


    It is generally believed that the last eukaryotic common ancestor (LECA) was a unicellular organism with motile cilia. In the vertebrates, the winged-helix transcription factor FoxJ1 functions as the master regulator of motile cilia biogenesis. Despite the antiquity of cilia, their highly conserved structure, and their mechanism of motility, the evolution of the transcriptional program controlling ciliogenesis has remained incompletely understood. In particular, it is presently not known how the generation of motile cilia is programmed outside of the vertebrates, and whether and to what extent the FoxJ1-dependent regulation is conserved. We have performed a survey of numerous eukaryotic genomes and discovered that genes homologous to foxJ1 are restricted only to organisms belonging to the unikont lineage. Using a mis-expression assay, we then obtained evidence of a conserved ability of FoxJ1 proteins from a number of diverse phyletic groups to activate the expression of a host of motile ciliary genes in zebrafish embryos. Conversely, we found that inactivation of a foxJ1 gene in Schmidtea mediterranea, a platyhelminth (flatworm) that utilizes motile cilia for locomotion, led to a profound disruption in the differentiation of motile cilia. Together, all of these findings provide the first evolutionary perspective into the transcriptional control of motile ciliogenesis and allow us to propose a conserved FoxJ1-regulated mechanism for motile cilia biogenesis back to the origin of the metazoans. PMID:23144623

  9. Evolutionarily divergent spliceosomal snRNAs and a conserved non-coding RNA processing motif in Giardia lamblia.


    Hudson, Andrew J; Moore, Ashley N; Elniski, David; Joseph, Joella; Yee, Janet; Russell, Anthony G


    Non-coding RNAs (ncRNAs) have diverse essential biological functions in all organisms, and in eukaryotes, two such classes of ncRNAs are the small nucleolar (sno) and small nuclear (sn) RNAs. In this study, we have identified and characterized a collection of sno and snRNAs in Giardia lamblia, by exploiting our discovery of a conserved 12 nt RNA processing sequence motif found in the 3' end regions of a large number of G. lamblia ncRNA genes. RNA end mapping and other experiments indicate the motif serves to mediate ncRNA 3' end formation from mono- and di-cistronic RNA precursor transcripts. Remarkably, we find the motif is also utilized in the processing pathway of all four previously identified trans-spliced G. lamblia introns, revealing a common RNA processing pathway for ncRNAs and trans-spliced introns in this organism. Motif sequence conservation then allowed for the bioinformatic and experimental identification of additional G. lamblia ncRNAs, including new U1 and U6 spliceosomal snRNA candidates. The U6 snRNA candidate was then used as a tool to identity novel U2 and U4 snRNAs, based on predicted phylogenetically conserved snRNA-snRNA base-pairing interactions, from a set of previously identified G. lamblia ncRNAs without assigned function. The Giardia snRNAs retain the core features of spliceosomal snRNAs but are sufficiently evolutionarily divergent to explain the difficulties in their identification. Most intriguingly, all of these snRNAs show structural features diagnostic of U2-dependent/major and U12-dependent/minor spliceosomal snRNAs.

  10. Human growth is associated with distinct patterns of gene expression in evolutionarily conserved networks

    PubMed Central


    Background A co-ordinated tissue-independent gene expression profile associated with growth is present in rodent models and this is hypothesised to extend to all mammals. Growth in humans has similarities to other mammals but the return to active long bone growth in the pubertal growth spurt is a distinctly human growth event. The aim of this study was to describe gene expression and biological pathways associated with stages of growth in children and to assess tissue-independent expression patterns in relation to human growth. Results We conducted gene expression analysis on a library of datasets from normal children with age annotation, collated from the NCBI Gene Expression Omnibus (GEO) and EBI Arrayexpress databases. A primary data set was generated using cells of lymphoid origin from normal children; the expression of 688 genes (ANOVA false discovery rate modified p-value, q < 0.1) was associated with age, and subsets of these genes formed clusters that correlated with the phases of growth – infancy, childhood, puberty and final height. Network analysis on these clusters identified evolutionarily conserved growth pathways (NOTCH, VEGF, TGFB, WNT and glucocorticoid receptor – Hyper-geometric test, q < 0.05). The greatest degree of network ‘connectivity’ and hence functional significance was present in infancy (Wilcoxon test, p < 0.05), which then decreased through to adulthood. These observations were confirmed in a separate validation data set from lymphoid tissue. Similar biological pathways were observed to be associated with development-related gene expression in other tissues (conjunctival epithelia, temporal lobe brain tissue and bone marrow) suggesting the existence of a tissue-independent genetic program for human growth and maturation. Conclusions Similar evolutionarily conserved pathways have been associated with gene expression and child growth in multiple tissues. These expression profiles associate with the developmental phases

  11. The evolutionarily conserved EBR module of RALT/MIG6 mediates suppression of the EGFR catalytic activity.


    Anastasi, S; Baietti, M F; Frosi, Y; Alemà, S; Segatto, O


    Physiological signalling by the epidermal growth factor receptor (EGFR) controls developmental processes and tissue homeostasis, whereas aberrant EGFR activity drives oncogenic cell transformation. Under normal conditions, the EGFR must therefore generate outputs of defined strength and duration. To this aim, cells balance EGFR activity via different modalities of negative signalling. Increasing attention is being drawn on transcriptionally controlled feedback inhibitors of EGFR, namely RALT/MIG6, LRIG1, SOCS4 and SOCS5. Genetic studies in mice have revealed the essential role of Ralt/Mig6 in regulating Egfr-driven skin morphogenesis and tumour formation, yet the mechanisms through which RALT abrogates EGFR activity are still undefined. We report that RALT suppresses EGFR function by inhibiting its catalytic activity. The evolutionarily conserved ErbB-binding region (EBR) is necessary and sufficient to carry out RALT-dependent suppression of EGFR kinase activity in vitro and in intact cells. The mechanism involves binding of the EBR to the 953RYLVIQ958 sequence, which is located in the alphaI helix of the EGFR kinase and has been shown to participate in allosteric control of EGFR catalytic activity. Our results uncover a novel mechanism of temporal regulation of EGFR activity in vertebrate organisms.

  12. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins.


    Michishita, Eriko; Park, Jean Y; Burneskis, Jenna M; Barrett, J Carl; Horikawa, Izumi


    Sir2 is a NAD+-dependent protein deacetylase that extends lifespan in yeast and worms. This study examines seven human proteins homologous to Sir2 (SIRT1 through SIRT7) for cellular localization, expression profiles, protein deacetylation activity, and effects on human cell lifespan. We found that: 1) three nuclear SIRT proteins (SIRT1, SIRT6, and SIRT7) show different subnuclear localizations: SIRT6 and SIRT7 are associated with heterochromatic regions and nucleoli, respectively, where yeast Sir2 functions; 2) SIRT3, SIRT4, and SIRT5 are localized in mitochondria, an organelle that links aging and energy metabolism; 3) cellular p53 is a major in vivo substrate of SIRT1 deacetylase, but not the other six SIRT proteins; 4) SIRT1, but not the other two nuclear SIRT proteins, shows an in vitro deacetylase activity on histone H4 and p53 peptides; and 5) overexpression of any one of the seven SIRT proteins does not extend cellular replicative lifespan in normal human fibroblasts or prostate epithelial cells. This study supports the notion that multiple human SIRT proteins have evolutionarily conserved and nonconserved functions at different cellular locations and reveals that the lifespan of normal human cells, in contrast to that of lower eukaryotes, cannot be manipulated by increased expression of a single SIRT protein.

  13. Trichohyalin-like proteins have evolutionarily conserved roles in the morphogenesis of skin appendages.


    Mlitz, Veronika; Strasser, Bettina; Jaeger, Karin; Hermann, Marcela; Ghannadan, Minoo; Buchberger, Maria; Alibardi, Lorenzo; Tschachler, Erwin; Eckhart, Leopold


    S100 fused-type proteins (SFTPs) such as filaggrin, trichohyalin, and cornulin are differentially expressed in cornifying keratinocytes of the epidermis and various skin appendages. To determine evolutionarily conserved, and thus presumably important, features of SFTPs, we characterized nonmammalian SFTPs and compared their amino acid sequences and expression patterns with those of mammalian SFTPs. We identified an ortholog of cornulin and a previously unknown SFTP, termed scaffoldin, in reptiles and birds, whereas filaggrin was confined to mammals. In contrast to mammalian SFTPs, both cornulin and scaffoldin of the chicken are expressed in the embryonic periderm. However, scaffoldin resembles mammalian trichohyalin with regard to its expression in the filiform papillae of the tongue and in the epithelium underneath the forming tips of the claws. Furthermore, scaffoldin is expressed in the epithelial sheath around growing feathers, reminiscent of trichohyalin expression in the inner root sheath of hair. The results of this study show that SFTP-positive epithelia function as scaffolds for the growth of diverse skin appendages such as claws, nails, hair, and feathers, indicating a common evolutionary origin.

  14. Evolutionarily conserved mechanisms for the selection and maintenance of behavioural activity

    PubMed Central

    Fiore, Vincenzo G.; Dolan, Raymond J.; Strausfeld, Nicholas J.; Hirth, Frank


    Survival and reproduction entail the selection of adaptive behavioural repertoires. This selection manifests as phylogenetically acquired activities that depend on evolved nervous system circuitries. Lorenz and Tinbergen already postulated that heritable behaviours and their reliable performance are specified by genetically determined programs. Here we compare the functional anatomy of the insect central complex and vertebrate basal ganglia to illustrate their role in mediating selection and maintenance of adaptive behaviours. Comparative analyses reveal that central complex and basal ganglia circuitries share comparable lineage relationships within clusters of functionally integrated neurons. These clusters are specified by genetic mechanisms that link birth time and order to their neuronal identities and functions. Their subsequent connections and associated functions are characterized by similar mechanisms that implement dimensionality reduction and transition through attractor states, whereby spatially organized parallel-projecting loops integrate and convey sensorimotor representations that select and maintain behavioural activity. In both taxa, these neural systems are modulated by dopamine signalling that also mediates memory-like processes. The multiplicity of similarities between central complex and basal ganglia suggests evolutionarily conserved computational mechanisms for action selection. We speculate that these may have originated from ancestral ground pattern circuitries present in the brain of the last common ancestor of insects and vertebrates. PMID:26554043

  15. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    PubMed Central

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, Radovan; Vorlíčková, Michaela; Trantírek, Lukáš


    There are two basic mechanisms that are associated with the maintenance of the telomere length, which endows cancer cells with unlimited proliferative potential. One mechanism, referred to as alternative lengthening of telomeres (ALT), accounts for approximately 10–15% of all human cancers. Tumours engaged in the ALT pathway are characterised by the presence of the single stranded 5′-C-rich telomeric overhang (C-overhang). This recently identified hallmark of ALT cancers distinguishes them from healthy tissues and renders the C-overhang as a clear target for anticancer therapy. We analysed structures of the 5′-C-rich and 3′-G-rich telomeric overhangs from human and Caenorhabditis elegans, the recently established multicellular in vivo model of ALT tumours. We show that the telomeric DNA from C. elegans and humans forms fundamentally different secondary structures. The unique structural characteristics of C. elegans telomeric DNA that are distinct not only from those of humans but also from those of other multicellular eukaryotes allowed us to identify evolutionarily conserved properties of telomeric DNA. Differences in structural organisation of the telomeric DNA between the C. elegans and human impose limitations on the use of the C. elegans as an ALT tumour model. PMID:25855805

  16. An evolutionarily conserved mode of modulation of Shaw-like K+ channels

    PubMed Central

    Cotella, Diego; Hernandez-Enriquez, Berenice; Duan, Zhibing; Wu, Xilong; Gazula, Valeswara-Rao; Brown, Maile R.; Kaczmarek, Leonard K.; Sesti, Federico


    Voltage-gated K+ channels of the Shaw family (also known as the KCNC or Kv3 family) play pivotal roles in mammalian brains, and genetic or pharmacological disruption of their activities in mice results in a spectrum of behavioral defects. We have used the model system of Caenorhabditis elegans to elucidate conserved molecular mechanisms that regulate these channels. We have now found that the C. elegans Shaw channel KHT-1, and its mammalian homologue, murine Kv3.1b, are both modulated by acid phosphatases. Thus, the C. elegans phosphatase ACP-2 is stably associated with KHT-1, while its mammalian homolog, prostatic acid phosphatase (PAP; also known as ACPP-201) stably associates with murine Kv3.1b K+ channels in vitro and in vivo. In biochemical experiments both phosphatases were able to reverse phosphorylation of their associated channel. The effect of phosphorylation on both channels is to produce a decrease in current amplitude and electrophysiological analyses demonstrated that dephosphorylation reversed the effects of phosphorylation on the magnitude of the macroscopic currents. ACP-2 and KHT-1 were colocalized in the nervous system of C. elegans and, in the mouse nervous system, PAP and Kv3.1b were colocalized in subsets of neurons, including in the brain stem and the ventricular zone. Taken together, this body of evidence suggests that acid phosphatases are general regulatory partners of Shaw-like K+ channels.—Cotella, D., Hernandez-Enriquez, B., Duan, Z., Wu, X., Gazula, V.-R., Brown, M. R., Kaczmarek, L. K., and Sesti, F. An evolutionarily conserved mode of modulation of Shaw-like K+ channels. PMID:23233530

  17. Evolutionarily-conserved prefrontal-amygdalar dysfunction in early-life anxiety

    PubMed Central

    Birn, Rasmus M.; Shackman, Alexander J.; Oler, Jonathan A.; Williams, Lisa E.; McFarlin, Daniel R.; Rogers, Gregory M.; Shelton, Steven E.; Alexander, Andrew L.; Pine, Daniel S.; Slattery, Marcia J.; Davidson, Richard J.; Fox, Andrew S.; Kalin, Ned H.


    Some individuals are endowed with a biology that renders them more reactive to novelty and potential threat. When extreme, this anxious temperament (AT) confers elevated risk for the development of anxiety, depression, and substance abuse. These disorders are highly prevalent, debilitating, and can be challenging to treat. The high-risk AT phenotype is expressed similarly in children and young monkeys and mechanistic work demonstrates that the central nucleus (Ce) of the amygdala is an important substrate. While it is widely believed that the flow of information across the structural network connecting the Ce to other brain regions underlies primates' capacity for flexibly regulating anxiety, the functional architecture of this network has remained poorly understood. Here we used functional magnetic resonance imaging (fMRI) in anesthetized young monkeys and quietly resting children with anxiety disorders to identify an evolutionarily-conserved pattern of functional connectivity relevant to early-life anxiety. Across primate species and levels of awareness, reduced functional connectivity between the dorsolateral prefrontal cortex (dlPFC), a region thought to play a central role in the control of cognition and emotion, and the Ce was associated with increased anxiety assessed outside the scanner. Importantly, high-resolution 18-fluorodeoxyglucose positron emission tomography (FDG-PET) imaging provided evidence that elevated Ce metabolism statistically mediates the association between prefrontal-amygdalar connectivity and elevated anxiety. These results provide new clues about the brain network underlying extreme early-life anxiety and set the stage for mechanistic work aimed at developing improved interventions for pediatric anxiety. PMID:24863147

  18. An Evolutionarily Conserved PLC-PKD-TFEB Pathway for Host Defense.


    Najibi, Mehran; Labed, Sid Ahmed; Visvikis, Orane; Irazoqui, Javier Elbio


    The mechanisms that tightly control the transcription of host defense genes have not been fully elucidated. We previously identified TFEB as a transcription factor important for host defense, but the mechanisms that regulate TFEB during infection remained unknown. Here, we used C. elegans to discover a pathway that activates TFEB during infection. Gene dkf-1, which encodes a homolog of protein kinase D (PKD), was required for TFEB activation in nematodes infected with Staphylococcus aureus. Conversely, pharmacological activation of PKD was sufficient to activate TFEB. Furthermore, phospholipase C (PLC) gene plc-1 was also required for TFEB activation, downstream of Gαq homolog egl-30 and upstream of dkf-1. Using reverse and chemical genetics, we discovered a similar PLC-PKD-TFEB axis in Salmonella-infected mouse macrophages. In addition, PKCα was required in macrophages. These observations reveal a previously unknown host defense signaling pathway, which has been conserved across one billion years of evolution.

  19. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling.


    Lucas-Reina, Eva; Romero-Campero, Francisco J; Romero, José M; Valverde, Federico


    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs.

  20. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling1[OPEN

    PubMed Central


    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. PMID:25897001

  1. Dissecting the gene network of dietary restriction to identify evolutionarily conserved pathways and new functional genes.


    Wuttke, Daniel; Connor, Richard; Vora, Chintan; Craig, Thomas; Li, Yang; Wood, Shona; Vasieva, Olga; Shmookler Reis, Robert; Tang, Fusheng; de Magalhães, João Pedro


    Dietary restriction (DR), limiting nutrient intake from diet without causing malnutrition, delays the aging process and extends lifespan in multiple organisms. The conserved life-extending effect of DR suggests the involvement of fundamental mechanisms, although these remain a subject of debate. To help decipher the life-extending mechanisms of DR, we first compiled a list of genes that if genetically altered disrupt or prevent the life-extending effects of DR. We called these DR-essential genes and identified more than 100 in model organisms such as yeast, worms, flies, and mice. In order for other researchers to benefit from this first curated list of genes essential for DR, we established an online database called GenDR ( To dissect the interactions of DR-essential genes and discover the underlying lifespan-extending mechanisms, we then used a variety of network and systems biology approaches to analyze the gene network of DR. We show that DR-essential genes are more conserved at the molecular level and have more molecular interactions than expected by chance. Furthermore, we employed a guilt-by-association method to predict novel DR-essential genes. In budding yeast, we predicted nine genes related to vacuolar functions; we show experimentally that mutations deleting eight of those genes prevent the life-extending effects of DR. Three of these mutants (OPT2, FRE6, and RCR2) had extended lifespan under ad libitum, indicating that the lack of further longevity under DR is not caused by a general compromise of fitness. These results demonstrate how network analyses of DR using GenDR can be used to make phenotypically relevant predictions. Moreover, gene-regulatory circuits reveal that the DR-induced transcriptional signature in yeast involves nutrient-sensing, stress responses and meiotic transcription factors. Finally, comparing the influence of gene expression changes during DR on the interactomes of multiple organisms led

  2. Evolutionarily conserved serum microRNAs predict radiation-induced fatality in nonhuman primates.


    Fendler, Wojciech; Malachowska, Beata; Meghani, Khyati; Konstantinopoulos, Panagiotis A; Guha, Chandan; Singh, Vijay K; Chowdhury, Dipanjan


    Effective planning for the medical response to a radiological or nuclear accident is complex. Because of limited resources for medical countermeasures, the key would be to accurately triage and identify victims most likely to benefit from treatment. We used a mouse model system to provide evidence that serum microRNAs (miRNAs) may effectively predict the impact of radiation on the long-term viability of animals. We had previously used nonhuman primates (NHPs) to demonstrate that this concept is conserved and serum miRNA signatures have the potential to serve as prediction biomarkers for radiation-induced fatality in a human population. We identified a signature of seven miRNAs that are altered by irradiation in both mice and NHPs. Genomic analysis of these conserved miRNAs revealed that there is a combination of seven transcription factors that are predicted to regulate these miRNAs in human, mice, and NHPs. Moreover, a combination of three miRNAs (miR-133b, miR-215, and miR-375) can identify, with nearly complete accuracy, NHPs exposed to radiation versus unexposed NHPs. Consistent with historical data, female macaques appeared to be more sensitive to radiation, but the difference was not significant. Sex-based stratification allowed us to identify an interaction between gender and miR-16-2 expression, which affected the outcome of radiation exposure. Moreover, we developed a classifier based on two miRNAs (miR-30a and miR-126) that can reproducibly predict radiation-induced mortality. Together, we have obtained a five-miRNA composite signature that can identify irradiated macaques and predict their probability of survival.

  3. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.


    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L


    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  4. The Evolutionarily Conserved LIM Homeodomain Protein LIM-4/LHX6 Specifies the Terminal Identity of a Cholinergic and Peptidergic C. elegans Sensory/Inter/Motor Neuron-Type.


    Kim, Jinmahn; Yeon, Jihye; Choi, Seong-Kyoon; Huh, Yang Hoon; Fang, Zi; Park, Seo Jin; Kim, Myoung Ok; Ryoo, Zae Young; Kang, Kyeongjin; Kweon, Hee-Seok; Jeon, Won Bae; Li, Chris; Kim, Kyuhyung


    The expression of specific transcription factors determines the differentiated features of postmitotic neurons. However, the mechanism by which specific molecules determine neuronal cell fate and the extent to which the functions of transcription factors are conserved in evolution are not fully understood. In C. elegans, the cholinergic and peptidergic SMB sensory/inter/motor neurons innervate muscle quadrants in the head and control the amplitude of sinusoidal movement. Here we show that the LIM homeobox protein LIM-4 determines neuronal characteristics of the SMB neurons. In lim-4 mutant animals, expression of terminal differentiation genes, such as the cholinergic gene battery and the flp-12 neuropeptide gene, is completely abolished and thus the function of the SMB neurons is compromised. LIM-4 activity promotes SMB identity by directly regulating the expression of the SMB marker genes via a distinct cis-regulatory motif. Two human LIM-4 orthologs, LHX6 and LHX8, functionally substitute for LIM-4 in C. elegans. Furthermore, C. elegans LIM-4 or human LHX6 can induce cholinergic and peptidergic characteristics in the human neuronal cell lines. Our results indicate that the evolutionarily conserved LIM-4/LHX6 homeodomain proteins function in generation of precise neuronal subtypes.

  5. The Evolutionarily Conserved LIM Homeodomain Protein LIM-4/LHX6 Specifies the Terminal Identity of a Cholinergic and Peptidergic C. elegans Sensory/Inter/Motor Neuron-Type

    PubMed Central

    Choi, Seong-Kyoon; Huh, Yang Hoon; Fang, Zi; Park, Seo Jin; Kim, Myoung Ok; Ryoo, Zae Young; Kang, Kyeongjin; Kweon, Hee-Seok; Jeon, Won Bae; Li, Chris; Kim, Kyuhyung


    The expression of specific transcription factors determines the differentiated features of postmitotic neurons. However, the mechanism by which specific molecules determine neuronal cell fate and the extent to which the functions of transcription factors are conserved in evolution are not fully understood. In C. elegans, the cholinergic and peptidergic SMB sensory/inter/motor neurons innervate muscle quadrants in the head and control the amplitude of sinusoidal movement. Here we show that the LIM homeobox protein LIM-4 determines neuronal characteristics of the SMB neurons. In lim-4 mutant animals, expression of terminal differentiation genes, such as the cholinergic gene battery and the flp-12 neuropeptide gene, is completely abolished and thus the function of the SMB neurons is compromised. LIM-4 activity promotes SMB identity by directly regulating the expression of the SMB marker genes via a distinct cis-regulatory motif. Two human LIM-4 orthologs, LHX6 and LHX8, functionally substitute for LIM-4 in C. elegans. Furthermore, C. elegans LIM-4 or human LHX6 can induce cholinergic and peptidergic characteristics in the human neuronal cell lines. Our results indicate that the evolutionarily conserved LIM-4/LHX6 homeodomain proteins function in generation of precise neuronal subtypes. PMID:26305787

  6. Conserved pattern of antisense overlapping transcription in the homologous human ERCC-1 and yeast RAD10 DNA repair gene regions.

    PubMed Central

    van Duin, M; van Den Tol, J; Hoeijmakers, J H; Bootsma, D; Rupp, I P; Reynolds, P; Prakash, L; Prakash, S


    We report that the genes for the homologous Saccharomyces cerevisiae RAD10 and human ERCC-1 DNA excision repair proteins harbor overlapping antisense transcription units in their 3' regions. Since naturally occurring antisense transcription is rare in S. cerevisiae and humans (this is the first example in human cells), our findings indicate that antisense transcription in the ERCC-1-RAD10 gene regions represents an evolutionarily conserved feature. Images PMID:2471070

  7. Evolutionarily conserved recognition and innate immunity to fungal pathogens by the scavenger receptors SCARF1 and CD36

    PubMed Central

    Mylonakis, Eleftherios; Tampakakis, Emmanouil; Colvin, Richard A.; Seung, Edward; Puckett, Lindsay; Tai, Melissa F.; Stewart, Cameron R.; Pukkila-Worley, Read; Hickman, Suzanne E.; Moore, Kathryn J.; Calderwood, Stephen B.; Hacohen, Nir; Luster, Andrew D.; El Khoury, Joseph


    Receptors involved in innate immunity to fungal pathogens have not been fully elucidated. We show that the Caenorhabditis elegans receptors CED-1 and C03F11.3, and their mammalian orthologues, the scavenger receptors SCARF1 and CD36, mediate host defense against two prototypic fungal pathogens, Cryptococcus neoformans and Candida albicans. CED-1 and C03F11.1 mediated antimicrobial peptide production and were necessary for nematode survival after C. neoformans infection. SCARF1 and CD36 mediated cytokine production and were required for macrophage binding to C. neoformans, and control of the infection in mice. Binding of these pathogens to SCARF1 and CD36 was β-glucan dependent. Thus, CED-1/SCARF1 and C03F11.3/CD36 are β-glucan binding receptors and define an evolutionarily conserved pathway for the innate sensing of fungal pathogens. PMID:19237602

  8. Evolutionarily Conserved Binding of Translationally Controlled Tumor Protein to Eukaryotic Elongation Factor 1B*

    PubMed Central

    Wu, Huiwen; Gong, Weibin; Yao, Xingzhe; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang


    Translationally controlled tumor protein (TCTP) is an abundant protein that is highly conserved in eukaryotes. However, its primary function is still not clear. Human TCTP interacts with the metazoan-specific eukaryotic elongation factor 1Bδ (eEF1Bδ) and inhibits its guanine nucleotide exchange factor (GEF) activity, but the structural mechanism remains unknown. The interaction between TCTP and eEF1Bδ was investigated by NMR titration, structure determination, paramagnetic relaxation enhancement, site-directed mutagenesis, isothermal titration calorimetry, and HADDOCK docking. We first demonstrated that the catalytic GEF domain of eEF1Bδ is not responsible for binding to TCTP but rather a previously unnoticed central acidic region (CAR) domain in eEF1Bδ. The mutagenesis data and the structural model of the TCTP-eEF1Bδ CAR domain complex revealed the key binding residues. These residues are highly conserved in eukaryotic TCTPs and in eEF1B GEFs, including the eukaryotically conserved eEF1Bα, implying the interaction may be conserved in all eukaryotes. Interactions were confirmed between TCTP and the eEF1Bα CAR domain for human, fission yeast, and unicellular photosynthetic microalgal proteins, suggesting that involvement in protein translation through the conserved interaction with eEF1B represents a primary function of TCTP. PMID:25635048

  9. Genome-wide identification of evolutionarily conserved alternative splicing events in flowering plants.


    Chamala, Srikar; Feng, Guanqiao; Chavarro, Carolina; Barbazuk, W Brad


    Alternative splicing (AS) plays important roles in many plant functions, but its conservation across the plant kingdom is not known. We describe a methodology to identify AS events and identify conserved AS events across large phylogenetic distances using RNA-Seq datasets. We applied this methodology to transcriptome data from nine angiosperms including Amborella, the single sister species to all other extant flowering plants. AS events within 40-70% of the expressed multi-exonic genes per species were found, 27,120 of which are conserved among two or more of the taxa studied. While many events are species specific, many others are shared across long evolutionary distances suggesting they have functional significance. Conservation of AS event data provides an estimate of the number of ancestral AS events present at each node of the tree representing the nine species studied. Furthermore, the presence or absence of AS isoforms between species with different whole genome duplication (WGD) histories provides the opportunity to examine the impact of WDG on AS potential. Examining AS in gene families identifies those with high rates of AS, and conservation can distinguish ancient events vs. recent or species specific adaptations. The MADS-box and SR protein families are found to represent families with low and high occurrences of AS, respectively, yet their AS events were likely present in the MRCA of angiosperms.

  10. The evolutionarily conserved Krueppel-associated box domain defines a subfamily of eukaryotic multifingered proteins

    SciTech Connect

    Bellefroid, E.J.; Poncelet, D.A.; Lecocq, P.J.; Revelant, O.; Martial, J.A. )


    The authors have previously shown that the human genome includes hundreds of genes coding for putative factors related to the Krueppel zinc-finger protein, which regulates Drosophila segmentation. They report herein that about one-third of these genes code for proteins that share a very conserved region of about 75 amino acids in their N-terminal nonfinger portion. Homologous regions are found in a number of previously described finger proteins, including mouse Zfp-1 and Xenopus Xfin. They named this region the Krueppel-associated box (KRAB). This domain has the potential to form two amphipathic {alpha}-helices. Southern blot analysis of zoo blots suggests that the Krueppel-associated box is highly conserved during evolution. Northern blot analysis shows that these genes are expressed in most adult tissues and are down-regulated during in vitro terminal differentiation of human myeloid cells.

  11. The evolutionarily dynamic IFN-inducible GTPase proteins play conserved immune functions in vertebrates and cephalochordates.


    Li, Guang; Zhang, Juyong; Sun, Yi; Wang, Hua; Wang, Yiquan


    Interferon (IFN)-inducible GTPases currently include four families of proteins: myxovirus resistant proteins (Mxs), guanylate-binding proteins (GBPs), immunity-related GTPase proteins (IRGs), and very large inducible GTPase proteins (VLIGs). They are all under conserved regulation by IFNs in humans and mice and play a critical role in preventing microbial infections. However, differences between vertebrates are poorly characterized, and their evolutionary origins have not been studied in detail. In this study, we performed comparative genomic analysis of the four families in 18 representative animals that yielded several unexpected results. Firstly, we found that Mx, GBP, and IRG protein families arose before the divergence of chordate subphyla, but VLIG emerged solely in vertebrates. Secondly, IRG, GBP, and VLIG families have experienced a high rate of gene gain and loss during the evolution, with the GBP family being lost entirely in two pufferfish and VLIG family lost in primates and carnivores. Thirdly, the regulation of these genes by IFNs is highly conserved throughout vertebrates although the VLIG protein sequences in fish have lost the first 870 amino acid residues. Finally, amphioxus IFN-inducible GTPase genes are all highly expressed in immune-related organs such as gill, liver, and intestine and are upregulated after challenge with PolyI:C and pathogens, although no IFNs or their receptors were detected in the current amphioxus genome database. These results suggest that IFN-inducible GTPase genes play conserved immune functions both in vertebrates and in cephalochordates.

  12. Evolutionarily conserved regions of the human c-myc protein can be uncoupled from transforming activity

    SciTech Connect

    Sarid, J.; Halazonetis, T.D.; Murphy, W.; Leder, P.


    The myc family of oncogenes contains coding sequences that have been preserved in different species for over 400 million years. This conservation (which implies functional selection) is broadly represented throughout the C-terminal portion of the human c-myc protein but is largely restricted to three cluster of amino acid sequences in the N-terminal region. The authors have examined the role that the latter three regions of the c-myc protein might play in the transforming function of the c-myc gene. Several mutations, deletions and frameshifts, were introduced into the c-myc gene, and these mutant genes were tested for their ability to collaborate with the EJ-ras oncogene to transform rat embryo fibroblasts. Complete elimination of the first two N-terminal conserved segments abolished transforming activity. In contrast, genes altered in a portion of the second or the entire third conserved segment retained their transforming activity. Thus, the latter two segments are not required for the transformation process, suggesting that they serve another function related only to the normal expression of the c-myc gene.

  13. Evolutionarily conserved morphogenetic movements at the vertebrate head-trunk interface coordinate the transport and assembly of hypopharyngeal structures.


    Lours-Calet, Corinne; Alvares, Lucia E; El-Hanfy, Amira S; Gandesha, Saniel; Walters, Esther H; Sobreira, Débora Rodrigues; Wotton, Karl R; Jorge, Erika C; Lawson, Jennifer A; Kelsey Lewis, A; Tada, Masazumi; Sharpe, Colin; Kardon, Gabrielle; Dietrich, Susanne


    The vertebrate head-trunk interface (occipital region) has been heavily remodelled during evolution, and its development is still poorly understood. In extant jawed vertebrates, this region provides muscle precursors for the throat and tongue (hypopharyngeal/hypobranchial/hypoglossal muscle precursors, HMP) that take a stereotype path rostrally along the pharynx and are thought to reach their target sites via active migration. Yet, this projection pattern emerged in jawless vertebrates before the evolution of migratory muscle precursors. This suggests that a so far elusive, more basic transport mechanism must have existed and may still be traceable today. Here we show for the first time that all occipital tissues participate in well-conserved cell movements. These cell movements are spearheaded by the occipital lateral mesoderm and ectoderm that split into two streams. The rostrally directed stream projects along the floor of the pharynx and reaches as far rostrally as the floor of the mandibular arch and outflow tract of the heart. Notably, this stream leads and engulfs the later emerging HMP, neural crest cells and hypoglossal nerve. When we (i) attempted to redirect hypobranchial/hypoglossal muscle precursors towards various attractants, (ii) placed non-migratory muscle precursors into the occipital environment or (iii) molecularly or (iv) genetically rendered muscle precursors non-migratory, they still followed the trajectory set by the occipital lateral mesoderm and ectoderm. Thus, we have discovered evolutionarily conserved morphogenetic movements, driven by the occipital lateral mesoderm and ectoderm, that ensure cell transport and organ assembly at the head-trunk interface.

  14. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences

    PubMed Central

    Ivanov, Ivaylo P.; Firth, Andrew E.; Michel, Audrey M.; Atkins, John F.; Baranov, Pavel V.


    In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5′ cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized—both for increased coding capacity and potentially also for novel regulatory mechanisms—remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5′ untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data. PMID:21266472

  15. Evolutionarily conserved differences in pallial and thalamic short-term synaptic plasticity in striatum

    PubMed Central

    Ericsson, Jesper; Stephenson-Jones, Marcus; Kardamakis, Andreas; Robertson, Brita; Silberberg, Gilad; Grillner, Sten


    The striatum of the basal ganglia is conserved throughout the vertebrate phylum. Tracing studies in lamprey have shown that its afferent inputs are organized in a manner similar to that of mammals. The main inputs arise from the thalamus (Th) and lateral pallium (LPal; the homologue of cortex) that represents the two principal excitatory glutamatergic inputs in mammals. The aim here was to characterize the pharmacology and synaptic dynamics of afferent fibres from the LPal and Th onto identified striatal neurons to understand the processing taking place in the lamprey striatum. We used whole-cell current-clamp recordings in acute slices of striatum with preserved fibres from the Th and LPal, as well as tract tracing and immunohistochemistry. We show that the Th and LPal produce monosynaptic excitatory glutamatergic input through NMDA and AMPA receptors. The synaptic input from the LPal displayed short-term facilitation, unlike the Th input that instead displayed strong short-term synaptic depression. There was also an activity-dependent recruitment of intrastriatal oligosynaptic inhibition from both inputs. These results indicate that the two principal inputs undergo different activity-dependent short-term synaptic plasticity in the lamprey striatum. The difference observed between Th and LPal (cortical) input is also observed in mammals, suggesting a conserved trait throughout vertebrate evolution. PMID:23148315

  16. Evolutionarily conserved roles of the dicer helicase domain in regulating RNA interference processing.


    Kidwell, Mary Anne; Chan, Jessica M; Doudna, Jennifer A


    The enzyme Dicer generates 21-25 nucleotide RNAs that target specific mRNAs for silencing during RNA interference and related pathways. Although their active sites and RNA binding regions are functionally conserved, the helicase domains have distinct activities in the context of different Dicer enzymes. To examine the evolutionary origins of Dicer helicase functions, we investigated two related Dicer enzymes from the thermophilic fungus Sporotrichum thermophile. RNA cleavage assays showed that S. thermophile Dicer-1 (StDicer-1) can process hairpin precursor microRNAs, whereas StDicer-2 can only cleave linear double-stranded RNAs. Furthermore, only StDicer-2 possesses robust ATP hydrolytic activity in the presence of double-stranded RNA. Deletion of the StDicer-2 helicase domain increases both StDicer-2 cleavage activity and affinity for hairpin RNA. Notably, both StDicer-1 and StDicer-2 could complement the distantly related yeast Schizosaccharomyces pombe lacking its endogenous Dicer gene but only in their full-length forms, underscoring the importance of the helicase domain. These results suggest an in vivo regulatory function for the helicase domain that may be conserved from fungi to humans.

  17. Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes

    PubMed Central

    Dekel, Amir; Pitts, Ronald J.; Yakir, Esther; Bohbot, Jonathan D.


    Olfaction is a key insect adaptation to a wide range of habitats. In the last thirty years, the detection of octenol by blood-feeding insects has been primarily understood in the context of animal host-seeking. The recent discovery of a conserved octenol receptor gene in the strictly nectar-feeding elephant mosquito Toxorhynchites amboinensis (TaOr8) suggests a different biological role. Here, we show that TaOR8 is a functional ortholog of its counterparts in blood-feeding mosquitoes displaying selectivity towards the (R)-enantiomer of octenol and susceptibility to the insect repellent DEET. These findings suggest that while the function of OR8 has been maintained throughout mosquito evolution, the context in which this receptor is operating has diverged in blood and nectar-feeding mosquitoes. PMID:27849027

  18. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins

    PubMed Central

    Paredez, Alexander R.; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C.; Wang, Chung-Ju Rachel; Cande, W. Z.


    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host. PMID:21444821

  19. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins.


    Paredez, Alexander R; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C; Wang, Chung-Ju Rachel; Cande, W Z


    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host.

  20. Antioxidant properties of UCP1 are evolutionarily conserved in mammals and buffer mitochondrial reactive oxygen species.


    Oelkrug, Rebecca; Goetze, Nadja; Meyer, Carola W; Jastroch, Martin


    Mitochondrial uncoupling reduces reactive oxygen species (ROS) production and appears to be important for cellular signaling/protection, making it a focus for the treatment of metabolic and age-related diseases. Whereas the physiological role of uncoupling protein 1 (UCP1) of brown adipose tissue is established for thermogenesis, the function of UCP1 in the reduction of ROS in cold-exposed animals is currently under debate. Here, we investigated the role of UCP1 in mitochondrial ROS handling in the Lesser hedgehog tenrec (Echinops telfairi), a unique protoendothermic Malagasy mammal with recently identified brown adipose tissue (BAT). We show that the reduction of ROS by UCP1 activity also occurs in BAT mitochondria of the tenrec, suggesting that the antioxidative role of UCP1 is an ancient mammalian trait. Our analysis shows that the quantity of UCP1 displays strong control over mitochondrial hydrogen peroxide release, whereas other factors, such as mild cold, nonshivering thermogenesis, oxidative capacity, and mitochondrial respiration, do not correlate. Furthermore, hydrogen peroxide release from recoupled BAT mitochondria was positively associated with mitochondrial membrane potential. These findings led to a model of UCP1 controlling mitochondrial ROS release and, presumably, being controlled by high membrane potential, as proposed in the canonical model of "mild uncoupling". Our study further promotes a conserved role for UCP1 in the prevention of oxidative stress, which was presumably established during evolution before UCP1 was physiologically integrated into nonshivering thermogenesis.

  1. Computational Analysis of an Evolutionarily Conserved VertebrateMuscle Alternative Splicing Program

    SciTech Connect

    Das, Debopriya; Clark, Tyson A.; Schweitzer, Anthony; Marr,Henry; Yamamoto, Miki L.; Parra, Marilyn K.; Arribere, Josh; Minovitsky,Simon; Dubchak, Inna; Blume, John E.; Conboy, John G.


    A novel exon microarray format that probes gene expression with single exon resolution was employed to elucidate critical features of a vertebrate muscle alternative splicing program. A dataset of 56 microarray-defined, muscle-enriched exons and their flanking introns were examined computationally in order to investigate coordination of the muscle splicing program. Candidate intron regulatory motifs were required to meet several stringent criteria: significant over-representation near muscle-enriched exons, correlation with muscle expression, and phylogenetic conservation among genomes of several vertebrate orders. Three classes of regulatory motifs were identified in the proximal downstream intron, within 200nt of the target exons: UGCAUG, a specific binding site for Fox-1 related splicing factors; ACUAAC, a novel branchpoint-like element; and UG-/UGC-rich elements characteristic of binding sites for CELF splicing factors. UGCAUG was remarkably enriched, being present in nearly one-half of all cases. These studies suggest that Fox and CELF splicing factors play a major role in enforcing the muscle-specific alternative splicing program, facilitating expression of a set of unique isoforms of cytoskeletal proteins that are critical to muscle cell differentiation. Supplementary materials: There are four supplementary tables and one supplementary figure. The tables provide additional detailed information concerning the muscle-enriched datasets, and about over-represented oligonucleotide sequences in the flanking introns. The supplementary figure shows RT-PCR data confirming the muscle-enriched expression of exons predicted from the microarray analysis.

  2. Molecular genetic aetiology of general cognitive function is enriched in evolutionarily conserved regions

    PubMed Central

    Hill, W D; Davies, G; Harris, S E; Hagenaars, S P; Davies, Gail; Deary, Ian J; Debette, Stephanie; Verbaas, Carla I; Bressler, Jan; Schuur, Maaike; Smith, Albert V; Bis, Joshua C; Bennett, David A; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosley Jr, Thomas H; Liewald, D C; Penke, L; Gale, C R; Deary, I J


    Differences in general cognitive function have been shown to be partly heritable and to show genetic correlations with several psychiatric and physical disease states. However, to date, few single-nucleotide polymorphisms (SNPs) have demonstrated genome-wide significance, hampering efforts aimed at determining which genetic variants are most important for cognitive function and which regions drive the genetic associations between cognitive function and disease states. Here, we combine multiple large genome-wide association study (GWAS) data sets, from the CHARGE cognitive consortium (n=53 949) and UK Biobank (n=36 035), to partition the genome into 52 functional annotations and an additional 10 annotations describing tissue-specific histone marks. Using stratified linkage disequilibrium score regression we show that, in two measures of cognitive function, SNPs associated with cognitive function cluster in regions of the genome that are under evolutionary negative selective pressure. These conserved regions contained ~2.6% of the SNPs from each GWAS but accounted for ~40% of the SNP-based heritability. The results suggest that the search for causal variants associated with cognitive function, and those variants that exert a pleiotropic effect between cognitive function and health, will be facilitated by examining these enriched regions. PMID:27959336

  3. Redox proteins in mammalian cell death: an evolutionarily conserved function in mitochondria and prokaryotes.


    Punj, Vasu; Chakrabarty, A M


    Mammalian cell mitochondria are believed to have prokaryotic ancestry. Mitochondria are not only the powerhouse of energy generation within the eukaryotic cell but they also play a major role in inducing apoptotic cell death through release of redox proteins such as cytochrome c and the apoptosis-inducing factor (AIF), a flavoprotein with NADH oxidase activity. Recent evidence indicates that some present day prokaryotes release redox proteins that induce apoptosis in mammalian cells through stabilization of the tumour suppressor protein p53. p53 interacts with mitochondria either directly or through activation of the genes for pro-apoptotic proteins such as Bax or NOXA or genes that encode redox enzymes responsible for the production of reactive oxygen species (ROS). The analogy between the ancient ancestors of present day bacteria, the mitochondria, and the present day bacteria with regard to their ability to release redox proteins for triggering mammalian cell death is an interesting example of functional conservation during the hundreds of millions of years of evolution. It is possible that the ancestors of the present day prokaryotes released redox proteins to kill the ancestors of the eukaryotes. During evolution of the mitochondria from prokaryotes as obligate endosymbionts, the mitochondria maintained the same functions to programme their own host cell death.

  4. The presence of disulfide bonds reveals an evolutionarily conserved mechanism involved in mitochondrial protein translocase assembly

    PubMed Central

    Wrobel, Lidia; Sokol, Anna M.; Chojnacka, Magdalena; Chacinska, Agnieszka


    Disulfide bond formation is crucial for the biogenesis and structure of many proteins that are localized in the intermembrane space of mitochondria. The importance of disulfide bond formation within mitochondrial proteins was extended beyond soluble intermembrane space proteins. Tim22, a membrane protein and core component of the mitochondrial translocase TIM22, forms an intramolecular disulfide bond in yeast. Tim22 belongs to the Tim17/Tim22/Tim23 family of protein translocases. Here, we present evidence of the high evolutionary conservation of disulfide bond formation in Tim17 and Tim22 among fungi and metazoa. Topological models are proposed that include the location of disulfide bonds relative to the predicted transmembrane regions. Yeast and human Tim22 variants that are not oxidized do not properly integrate into the membrane complex. Moreover, the lack of Tim17 oxidation disrupts the TIM23 translocase complex. This underlines the importance of disulfide bond formation for mature translocase assembly through membrane stabilization of weak transmembrane domains. PMID:27265872

  5. The evolutionarily conserved RNA binding protein SMOOTH is essential for maintaining normal muscle function.


    Draper, Isabelle; Tabaka, Meg E; Jackson, F Rob; Salomon, Robert N; Kopin, Alan S


    The Drosophila smooth gene encodes an RNA binding protein that has been well conserved through evolution. To investigate the pleiotropic functions mediated by the smooth gene, we have selected and characterized two sm mutants, which are viable as adults yet display robust phenotypes (including a significant decrease in lifespan). Utilizing these mutants, we have made the novel observation that disruption of the smooth/CG9218 locus leads to age-dependent muscle degeneration, and motor dysfunction. Histological characterization of adult sm mutants revealed marked abnormalities in the major thoracic tubular muscle: the tergal depressor of the trochanter (TDT). Corresponding defects include extensive loss/disruption of striations and nuclei. These pathological changes are recapitulated in flies that express a smooth RNA interference construct (sm RNAi) in the mesoderm. In contrast, targeting sm RNAi constructs to motor neurons does not alter muscle morphology. In addition to examining the TDT phenotype, we explored whether other muscular abnormalities were evident. Utilizing physiological assays developed in the laboratory, we have found that the thoracic muscle defect is preceded by dysmotility of the gastrointestinal tract. SMOOTH thus joins a growing list of hnRNPs that have previously been linked to muscle physiology/pathophysiology. Our findings in Drosophila set the stage for investigating the role of the corresponding mammalian homolog, hnRNP L, in muscle function.

  6. Analysis of evolutionarily conserved innate immune components in coral links immunity and symbiosis.


    Kvennefors, E Charlotte E; Leggat, William; Kerr, Caroline C; Ainsworth, Tracy D; Hoegh-Guldberg, Ove; Barnes, Andrew C


    Reef-building corals are representatives of one of the earliest diverging metazoan lineages and are experiencing increases in bleaching events (breakdown of the coral-Symbiodinium symbiosis) and disease outbreaks. The present study investigates the roles of two pattern recognition proteins, the mannose binding lectin Millectin and a complement factor C3-like protein (C3-Am), in the coral Acropora millepora. The results indicate that the innate immune functions of these molecules are conserved and arose early in evolution. C3-Am is expressed in response to injury, and may function as an opsonin. In contrast, Millectin expression is up-regulated in response to lipopolysaccharide and peptidoglycan. These observations, coupled with localization of Millectin in nematocysts in epidermal tissue, and reported binding of pathogens, are consistent with a key role for the lectin in innate immunity. Furthermore, Millectin was consistently detected binding to the symbiont Symbiodinium in vivo, indicating that the Millectin function of recognition and binding of non-self-entities may have been co-opted from an ancient innate immune system into a role in symbiosis.

  7. Circadian regulation of olfaction and an evolutionarily conserved, nontranscriptional marker in Caenorhabditis elegans.


    Olmedo, Maria; O'Neill, John S; Edgar, Rachel S; Valekunja, Utham K; Reddy, Akhilesh B; Merrow, Martha


    Circadian clocks provide a temporal structure to processes from gene expression to behavior in organisms from all phyla. Most clocks are synchronized to the environment by alternations of light and dark. However, many organisms experience only muted daily environmental cycles due to their lightless spatial niches (e.g., caves or soil). This has led to speculation that they may dispense with the daily clock. However, recent reports contradict this notion, showing various behavioral and molecular rhythms in Caenorhabditis elegans and in blind cave fish. Based on the ecology of nematodes, we applied low-amplitude temperature cycles to synchronize populations of animals through development. This entrainment regime reveals rhythms on multiple levels: in olfactory cued behavior, in RNA and protein abundance, and in the oxidation state of a broadly conserved peroxiredoxin protein. Our work links the nematode clock with that of other clock model systems; it also emphasizes the importance of daily rhythms in sensory functions that are likely to impact on organism fitness and population structure.

  8. Evolutionarily conserved mechanisms of male germline development in flowering plants and animals.


    Pereira, Patrícia A; Navarro-Costa, Paulo; Martinho, Rui Gonçalo; Becker, Jörg D


    Sexual reproduction is the main reproductive strategy of the overwhelming majority of eukaryotes. This suggests that the last eukaryotic common ancestor was able to reproduce sexually. Sexual reproduction reflects the ability to perform meiosis, and ultimately generating gametes, which are cells that carry recombined half sets of the parental genome and are able to fertilize. These functions have been allocated to a highly specialized cell lineage: the germline. Given its significant evolutionary conservation, it is to be expected that the germline programme shares common molecular bases across extremely divergent eukaryotic species. In the present review, we aim to identify the unifying principles of male germline establishment and development by comparing two very disparate kingdoms: plants and animals. We argue that male meiosis defines two temporally regulated gene expression programmes: the first is required for meiotic commitment, and the second is required for the acquisition of fertilizing ability. Small RNA pathways are a further key communality, ultimately ensuring the epigenetic stability of the information conveyed by the male germline.

  9. Comparative biology of the pentraxin protein family: evolutionarily conserved component of innate immune system.


    Armstrong, Peter B


    The immune system is based on the actions of the collection of specialized immune defense cells and their secreted proteins and peptides that defend the host against infection by parasites. Parasites are organisms that live part or all of their lives in close physical association with the host and extract nutrients from the host and, by releasing toxins and virulence factors, cause disease with the potential for injury and premature death of that host. Parasites of the metazoa can be viruses, eubacteria, fungi, protozoans, and other metazoans. The immune system operates to kill or eliminate parasites and eliminate or detoxify their toxins and virulence factors. Although some of the elements of immune systems are specific to a particular phylum of metazoans, others show extensive evolutionary conservation, being present in several or all major phyla of the metazoa. The pentraxins display this latter character in their roles in immune defense. Pentraxins have been documented in vertebrates, nonvertebrate chordates, arthropods, and mollusks and may be present in other taxa of metazoans. Presumably the pentraxins appeared early in the evolution of metazoa, prior to their evolutionary divergence in the Precambrian epoch into many phyla present today, and have been preserved for the 542 million years since that explosive evolutionary radiation. The fidelity with which these phyla have preserved the pentraxins suggests that the functions of these proteins are important for survival of the members of these diverse taxa of animals.

  10. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay


    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  11. Osmotically induced synthesis of the compatible solute hydroxyectoine is mediated by an evolutionarily conserved ectoine hydroxylase.


    Bursy, Jan; Pierik, Antonio J; Pica, Nathalie; Bremer, Erhard


    By using natural abundance (13)C NMR spectroscopy, we investigated the types of compatible solutes synthesized in a variety of Bacilli under high salinity growth conditions. Glutamate, proline, and ectoine were the dominant compatible solutes synthesized by the various Bacillus species. The majority of the inspected Bacilli produced the tetrahydropyrimidine ectoine in response to high salinity stress, and a subset of these also synthesized a hydroxylation derivative of ectoine, 5-hydroxyectoine. In Salibacillus salexigens, a representative of the ectoine- and 5-hydroxyectoine-producing species, ectoine production was linearly correlated with the salinity of the growth medium and dependent on an ectABC biosynthetic operon. The formation of 5-hydroxyectoine was primarily a stationary growth phase phenomenon. The enzyme responsible for ectoine hydroxylation (EctD) was purified from S. salexigens to apparent homogeneity. The EctD protein was shown in vitro to directly hydroxylate ectoine in a reaction dependent on iron(II), molecular oxygen, and 2-oxoglutarate. We identified the structural gene (ectD) for the ectoine hydroxylase in S. salexigens. Northern blot analysis showed that the transcript levels of the ectABC and ectD genes increased as a function of salinity. Many EctD-related proteins can be found in data base searches in various Bacteria. Each of these bacterial species also contains an ectABC ectoine biosynthetic gene cluster, suggesting that 5-hydroxyectoine biosynthesis strictly depends on the prior synthesis of ectoine. Our data base searches and the biochemical characterization of the EctD protein from S. salexigens suggest that the EctD-related ectoine hydroxylases are members of a new subfamily within the non-heme-containing, iron(II)- and 2-oxoglutarate-dependent dioxygenase superfamily (EC 1.14.11).

  12. Drosophila KCNQ Channel Displays Evolutionarily Conserved Electrophysiology and Pharmacology with Mammalian KCNQ Channels

    PubMed Central

    Cavaliere, Sonia; Hodge, James J. L.


    Of the five human KCNQ (Kv7) channels, KCNQ1 with auxiliary subunit KCNE1 mediates the native cardiac IKs current with mutations causing short and long QT cardiac arrhythmias. KCNQ4 mutations cause deafness. KCNQ2/3 channels form the native M-current controlling excitability of most neurons, with mutations causing benign neonatal febrile convulsions. Drosophila contains a single KCNQ (dKCNQ) that appears to serve alone the functions of all the duplicated mammalian neuronal and cardiac KCNQ channels sharing roughly 50–60% amino acid identity therefore offering a route to investigate these channels. Current information about the functional properties of dKCNQ is lacking therefore we have investigated these properties here. Using whole cell patch clamp electrophysiology we compare the biophysical and pharmacological properties of dKCNQ with the mammalian neuronal and cardiac KCNQ channels expressed in HEK cells. We show that Drosophila KCNQ (dKCNQ) is a slowly activating and slowly-deactivating K+ current open at sub-threshold potentials that has similar properties to neuronal KCNQ2/3 with some features of the cardiac KCNQ1/KCNE1 accompanied by conserved sensitivity to a number of clinically relevant KCNQ blockers (chromanol 293B, XE991, linopirdine) and opener (zinc pyrithione). We also investigate the molecular basis of the differential selectivity of KCNQ channels to the opener retigabine and show a single amino acid substitution (M217W) can confer sensitivity to dKCNQ. We show dKCNQ has similar electrophysiological and pharmacological properties as the mammalian KCNQ channels, allowing future study of physiological and pathological roles of KCNQ in Drosophila and whole organism screening for new modulators of KCNQ channelopathies. PMID:21915266

  13. The Diversification of Evolutionarily Conserved MAPK Cascades Correlates with the Evolution of Fungal Species and Development of Lifestyles

    PubMed Central

    Xu, Chuan; Liu, Ran; Zhang, Qiangqiang; Chen, Xiaoxuan; Qian, Ying


    The fungal kingdom displays an extraordinary diversity of lifestyles, developmental processes, and ecological niches. The MAPK (mitogen-activated protein kinase) cascade consists of interlinked MAPKKK, MAPKK, and MAPK, and collectively such cascades play pivotal roles in cellular regulation in fungi. However, the mechanism by which evolutionarily conserved MAPK cascades regulate diverse output responses in fungi remains unknown. Here we identified the full complement of MAPK cascade components from 231 fungal species encompassing 9 fungal phyla. Using the largest data set to date, we found that MAPK family members could have two ancestors, while MAPKK and MAPKKK family members could have only one ancestor. The current MAPK, MAPKK, and MAPKKK subfamilies resulted from duplications and subsequent subfunctionalization during the emergence of the fungal kingdom. However, the gene structure diversification and gene expansion and loss have resulted in significant diversity in fungal MAPK cascades, correlating with the evolution of fungal species and lifestyles. In particular, a distinct evolutionary trajectory of MAPK cascades was identified in single-celled fungi in the Saccharomycetes. All MAPK, MAPKK, and MAPKKK subfamilies expanded in the Saccharomycetes; genes encoding MAPK cascade components have a similar exon–intron structure in this class that differs from those in other fungi. PMID:26957028

  14. A novel, evolutionarily conserved gene family with putative sequence-specific single-stranded DNA-binding activity.


    Castro, Patricia; Liang, Hong; Liang, Jan C; Nagarajan, Lalitha


    Complete and partial deletions of chromosome 5q are recurrent cytogenetic anomalies associated with aggressive myeloid malignancies. Earlier, we identified an approximately 1.5-Mb region of loss at 5q13.3 between the loci D5S672 and D5S620 in primary leukemic blasts. A leukemic cell line, ML3, is diploid for all of chromosome 5, except for an inversion-coupled translocation within the D5S672-D5S620 interval. Here, we report the development of a bacterial artificial chromosome (BAC) contig to define the breakpoint and the identification of a novel gene SSBP2, the target of disruption in ML3 cells. A preliminary evaluation of SSBP2 as a tumor suppressor gene in primary leukemic blasts and cell lines suggests that the remaining allele does not undergo intragenic mutations. SSBP2 is one of three members of a closely related, evolutionarily conserved, and ubiquitously expressed gene family. SSBP3 is the human ortholog of a chicken gene, CSDP, that encodes a sequence-specific single-stranded DNA-binding protein. SSBP3 localizes to chromosome 1p31.3, and the third member, SSBP4, maps to chromosome 19p13.1. Chromosomal localization and the putative single-stranded DNA-binding activity suggest that all three members of this family are capable of potential tumor suppressor activity by gene dosage or other epigenetic mechanisms.

  15. Evolutionarily Conserved Dual Lysine Motif Determines the Non-Chaperone Function of Secreted Hsp90alpha in Tumor Progression

    PubMed Central

    Sahu, Divya; Hou, Yingping; Tsen, Fred; Tong, Chang; O’Brien, Kathryn; Situ, Alan J.; Schmidt, Thomas; Chen, Mei; Ying, Qilong; Ulmer, Tobias S.; Woodley, David T.; Li, Wei


    Both intracellular and extracellular heat shock protein-90 (Hsp90) family proteins (α and β) have been shown to support tumor progression. The tumor-promoting activity of the intracellular Hsp90 proteins is attributed to their N-terminal ATPase-driven chaperone function. What determines the extracellular function of secreted Hsp90 was unclear. Here we show that knocking out Hsp90α nullifies tumor cell abilities to migrate, invade and metastasize without affecting cell survival and growth. Knocking out Hsp90β leads to cell death. Extracellular supplementation with recombinant Hsp90α, but not Hsp90β, protein recovers the tumorigenicity of Hsp90α-knockout cells. Sequential mutagenesis identifies two evolutionarily conserved lysine residues, lys-270 and lys-277, in Hsp90α subfamily that determine the extracellular Hsp90α function. Hsp90β subfamily lacks the dual lysine motif and does not show the same extracellular function. Substitutions of gly-262 and thr-269 in Hsp90β with lysines convert Hsp90β to act as Hsp90α outside the cells. Monoclonal antibody, 1G6-D7, against the dual lysine region of secreted Hsp90α blocks de novo tumor formation and significantly inhibits expansion of already formed tumors. This study suggests an alternative therapeutic approach to selectively target the extracellular Hsp90α to the conventional approach targeting the ATPase of intracellular Hsp90α and Hsp90β in cancer. PMID:27721406

  16. Evolutionarily conserved morphogenetic movements at the vertebrate head–trunk interface coordinate the transport and assembly of hypopharyngeal structures

    PubMed Central

    Lours-Calet, Corinne; Alvares, Lucia E.; El-Hanfy, Amira S.; Gandesha, Saniel; Walters, Esther H.; Sobreira, Débora Rodrigues; Wotton, Karl R.; Jorge, Erika C.; Lawson, Jennifer A.; Kelsey Lewis, A.; Tada, Masazumi; Sharpe, Colin; Kardon, Gabrielle; Dietrich, Susanne


    The vertebrate head–trunk interface (occipital region) has been heavily remodelled during evolution, and its development is still poorly understood. In extant jawed vertebrates, this region provides muscle precursors for the throat and tongue (hypopharyngeal/hypobranchial/hypoglossal muscle precursors, HMP) that take a stereotype path rostrally along the pharynx and are thought to reach their target sites via active migration. Yet, this projection pattern emerged in jawless vertebrates before the evolution of migratory muscle precursors. This suggests that a so far elusive, more basic transport mechanism must have existed and may still be traceable today. Here we show for the first time that all occipital tissues participate in well-conserved cell movements. These cell movements are spearheaded by the occipital lateral mesoderm and ectoderm that split into two streams. The rostrally directed stream projects along the floor of the pharynx and reaches as far rostrally as the floor of the mandibular arch and outflow tract of the heart. Notably, this stream leads and engulfs the later emerging HMP, neural crest cells and hypoglossal nerve. When we (i) attempted to redirect hypobranchial/hypoglossal muscle precursors towards various attractants, (ii) placed non-migratory muscle precursors into the occipital environment or (iii) molecularly or (iv) genetically rendered muscle precursors non-migratory, they still followed the trajectory set by the occipital lateral mesoderm and ectoderm. Thus, we have discovered evolutionarily conserved morphogenetic movements, driven by the occipital lateral mesoderm and ectoderm, that ensure cell transport and organ assembly at the head–trunk interface. PMID:24662046

  17. Members of the evolutionarily conserved PMT family of protein O-mannosyltransferases form distinct protein complexes among themselves.


    Girrbach, Verena; Strahl, Sabine


    Protein O-mannosyltransferases (PMTs) initiate the assembly of O-mannosyl glycans, an essential protein modification. Since PMTs are evolutionarily conserved in fungi but are absent in green plants, the PMT family is a putative target for new antifungal drugs, particularly in fighting the threat of phytopathogenic fungi. The PMT family is phylogenetically classified into PMT1, PMT2, and PMT4 subfamilies, which differ in protein substrate specificity. In the model organism Saccharomyces cerevisiae as well as in many other fungi the PMT family is highly redundant, and only the simultaneous deletion of PMT1/PMT2 and PMT4 subfamily members is lethal. In this study we analyzed the molecular organization of PMT family members in S. cerevisiae. We show that members of the PMT1 subfamily (Pmt1p and Pmt5p) interact in pairs with members of the PMT2 subfamily (Pmt2p and Pmt3p) and that Pmt1p-Pmt2p and Pmt5p-Pmt3p complexes represent the predominant forms. Under certain physiological conditions, however, Pmt1p interacts also with Pmt3p, and Pmt5p with Pmt2p, suggesting a compensatory cooperation that guarantees the maintenance of O-mannosylation. Unlike the PMT1/PMT2 subfamily members, the single member of the PMT4 subfamily (Pmt4p) acts as a homomeric complex. Using mutational analyses we demonstrate that the same conserved protein domains underlie both heteromeric and homomeric interactions, and we identify an invariant arginine residue of transmembrane domain two as essential for the formation and/or stability of PMT complexes in general. Our data suggest that protein-protein interactions between the PMT family members offer a point of attack to shut down overall protein O-mannosylation in fungi.

  18. Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.


    Miyata, Haruhiko; Castaneda, Julio M; Fujihara, Yoshitaka; Yu, Zhifeng; Archambeault, Denise R; Isotani, Ayako; Kiyozumi, Daiji; Kriseman, Maya L; Mashiko, Daisuke; Matsumura, Takafumi; Matzuk, Ryan M; Mori, Masashi; Noda, Taichi; Oji, Asami; Okabe, Masaru; Prunskaite-Hyyrylainen, Renata; Ramirez-Solis, Ramiro; Satouh, Yuhkoh; Zhang, Qian; Ikawa, Masahito; Matzuk, Martin M


    Gene-expression analysis studies from Schultz et al. estimate that more than 2,300 genes in the mouse genome are expressed predominantly in the male germ line. As of their 2003 publication [Schultz N, Hamra FK, Garbers DL (2003) Proc Natl Acad Sci USA 100(21):12201-12206], the functions of the majority of these testis-enriched genes during spermatogenesis and fertilization were largely unknown. Since the study by Schultz et al., functional analysis of hundreds of reproductive-tract-enriched genes have been performed, but there remain many testis-enriched genes for which their relevance to reproduction remain unexplored or unreported. Historically, a gene knockout is the "gold standard" to determine whether a gene's function is essential in vivo. Although knockout mice without apparent phenotypes are rarely published, these knockout mouse lines and their phenotypic information need to be shared to prevent redundant experiments. Herein, we used bioinformatic and experimental approaches to uncover mouse testis-enriched genes that are evolutionarily conserved in humans. We then used gene-disruption approaches, including Knockout Mouse Project resources (targeting vectors and mice) and CRISPR/Cas9, to mutate and quickly analyze the fertility of these mutant mice. We discovered that 54 mutant mouse lines were fertile. Thus, despite evolutionary conservation of these genes in vertebrates and in some cases in all eukaryotes, our results indicate that these genes are not individually essential for male mouse fertility. Our phenotypic data are highly relevant in this fiscally tight funding period and postgenomic age when large numbers of genomes are being analyzed for disease association, and will prevent unnecessary expenditures and duplications of effort by others.

  19. Widespread Shortening of 3' Untranslated Regions and Increased Exon Inclusion Are Evolutionarily Conserved Features of Innate Immune Responses to Infection.


    Pai, Athma A; Baharian, Golshid; Pagé Sabourin, Ariane; Brinkworth, Jessica F; Nédélec, Yohann; Foley, Joseph W; Grenier, Jean-Christophe; Siddle, Katherine J; Dumaine, Anne; Yotova, Vania; Johnson, Zachary P; Lanford, Robert E; Burge, Christopher B; Barreiro, Luis B


    The contribution of pre-mRNA processing mechanisms to the regulation of immune responses remains poorly studied despite emerging examples of their role as regulators of immune defenses. We sought to investigate the role of mRNA processing in the cellular responses of human macrophages to live bacterial infections. Here, we used mRNA sequencing to quantify gene expression and isoform abundances in primary macrophages from 60 individuals, before and after infection with Listeria monocytogenes and Salmonella typhimurium. In response to both bacteria we identified thousands of genes that significantly change isoform usage in response to infection, characterized by an overall increase in isoform diversity after infection. In response to both bacteria, we found global shifts towards (i) the inclusion of cassette exons and (ii) shorter 3' UTRs, with near-universal shifts towards usage of more upstream polyadenylation sites. Using complementary data collected in non-human primates, we show that these features are evolutionarily conserved among primates. Following infection, we identify candidate RNA processing factors whose expression is associated with individual-specific variation in isoform abundance. Finally, by profiling microRNA levels, we show that 3' UTRs with reduced abundance after infection are significantly enriched for target sites for particular miRNAs. These results suggest that the pervasive usage of shorter 3' UTRs is a mechanism for particular genes to evade repression by immune-activated miRNAs. Collectively, our results suggest that dynamic changes in RNA processing may play key roles in the regulation of innate immune responses.

  20. FLRF, a novel evolutionarily conserved RING finger gene, is differentially expressed in mouse fetal and adult hematopoietic stem cells and progenitors.


    Abdullah, J M; Li, X; Nachtman, R G; Jurecic, R


    Through differential screening of mouse hematopoietic stem cell (HSC) and progenitor subtracted cDNA libraries we have identified a HSC-specific transcript that represents a novel RING finger gene, named FLRF (fetal liver ring finger). FLRF represent a novel evolutionarily highly conserved RING finger gene, present in Drosophila, zebrafish, Xenopus, mouse, and humans. Full-length cDNA clones for mouse and human gene encode an identical protein of 317 amino acids with a C3HC4 RING finger domain at the amino terminus. During embryonic hematopoiesis FLRF is abundantly transcribed in mouse fetal liver HSC (Sca-1+c-kit+AA4.1+Lin- cells), but is not expressed in progenitors (AA4.1-). In adult mice FLRF is not transcribed in a highly enriched population of bone marrow HSC (Rh-123lowSca-1+c-kit+Lin- cells). Its expression is upregulated in a more heterogeneous population of bone marrow HSC (Lin-Sca-1+ cells), downregulated as they differentiate into progenitors (Lin-Sca-1- cells), and upregulated as progenitors differentiate into mature lymphoid and myeloid cell types. The human FLRF gene that spans a region of at least 12 kb and consists of eight exons was localized to chromosome 12q13, a region with frequent chromosome aberrations associated with multiple cases of acute myeloid leukemia and non-Hodgkin's lymphoma. The analysis of the genomic sequence upstream of the first exon in the mouse and human FLRF gene has revealed that both putative promoters contain multiple putative binding sites for several hematopoietic (GATA-1, GATA-2, GATA-3, Ikaros, SCL/Tal-1, AML1, MZF-1, and Lmo2) and other transcription factors, suggesting that mouse and human FLRF expression could be regulated in a developmental and cell-specific manner during hematopoiesis. Evolutionary conservation and differential expression in fetal and adult HSC and progenitors suggest that the FLRF gene could play an important role in HSC/progenitor cell lineage commitment and differentiation and could be

  1. RNA editing of the Drosophila para Na(+) channel transcript. Evolutionary conservation and developmental regulation.

    PubMed Central

    Hanrahan, C J; Palladino, M J; Ganetzky, B; Reenan, R A


    Post-transcriptional editing of pre-mRNAs through the action of dsRNA adenosine deaminases results in the modification of particular adenosine (A) residues to inosine (I), which can alter the coding potential of the modified transcripts. We describe here three sites in the para transcript, which encodes the major voltage-activated Na(+) channel polypeptide in Drosophila, where RNA editing occurs. The occurrence of RNA editing at the three sites was found to be developmentally regulated. Editing at two of these sites was also conserved across species between the D. melanogaster and D. virilis. In each case, a highly conserved region was found in the intron downstream of the editing site and this region was shown to be complementary to the region of the exonic editing site. Thus, editing at these sites would appear to involve a mechanism whereby the edited exon forms a base-paired secondary structure with the distant conserved noncoding sequences located in adjacent downstream introns, similar to the mechanism shown for A-to-I RNA editing of mammalian glutamate receptor subunits (GluRs). For the third site, neither RNA editing nor the predicted RNA secondary structures were evolutionarily conserved. Transcripts from transgenic Drosophila expressing a minimal editing site construct for this site were shown to faithfully undergo RNA editing. These results demonstrate that Na(+) channel diversity in Drosophila is increased by RNA editing via a mechanism analogous to that described for transcripts encoding mammalian GluRs. PMID:10880477

  2. TRANSCRIPTION. Structures of the RNA polymerase-σ54 reveal new and conserved regulatory strategies.


    Yang, Yun; Darbari, Vidya C; Zhang, Nan; Lu, Duo; Glyde, Robert; Wang, Yi-Ping; Winkelman, Jared T; Gourse, Richard L; Murakami, Katsuhiko S; Buck, Martin; Zhang, Xiaodong


    Transcription by RNA polymerase (RNAP) in bacteria requires specific promoter recognition by σ factors. The major variant σ factor (σ(54)) initially forms a transcriptionally silent complex requiring specialized adenosine triphosphate-dependent activators for initiation. Our crystal structure of the 450-kilodalton RNAP-σ(54) holoenzyme at 3.8 angstroms reveals molecular details of σ(54) and its interactions with RNAP. The structure explains how σ(54) targets different regions in RNAP to exert its inhibitory function. Although σ(54) and the major σ factor, σ(70), have similar functional domains and contact similar regions of RNAP, unanticipated differences are observed in their domain arrangement and interactions with RNAP, explaining their distinct properties. Furthermore, we observe evolutionarily conserved regulatory hotspots in RNAPs that can be targeted by a diverse range of mechanisms to fine tune transcription.

  3. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki


    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  4. Relaxed selection against accidental binding of transcription factors with conserved chromatin contexts.


    Babbitt, G A


    The spurious (or nonfunctional) binding of transcription factors (TF) to the wrong locations on DNA presents a formidable challenge to genomes given the relatively low ceiling for sequence complexity within the short lengths of most binding motifs. The high potential for the occurrence of random motifs and subsequent nonfunctional binding of many transcription factors should theoretically lead to natural selection against the occurrence of spurious motif throughout the genome. However, because of the active role that chromatin can influence over eukaryotic gene regulation, it may also be expected that many supposed spurious binding sites could escape purifying selection if (A) they simply occur in regions of high nucleosome occupancy or (B) their surrounding chromatin was dynamically involved in their identity and function. We compared nucleosome occupancy and the presence/absence of functionally conserved chromatin context to the strength of selection against spurious binding of various TF binding motifs in Saccharomyces yeast. While we find no direct relationship with nucleosome occupancy, we find strong evidence that transcription factors spatially associated with evolutionarily conserved chromatin states are under relaxed selection against accidental binding. Transcription factors (with/without) a conserved chromatin context were found to occur on average, (87.7%/49.3%) of their expected frequencies. Functional binding motifs with conserved chromatin contexts were also significantly shorter in length and more often clustered. These results indicate a role of chromatin context dependency in relaxing selection against spurious binding in nearly half of all TF binding motifs throughout the yeast genome.

  5. A single transcription factor regulates evolutionarily diverse but functionally linked metabolic pathways in response to nutrient availability.


    Schmid, Amy K; Reiss, David J; Pan, Min; Koide, Tie; Baliga, Nitin S


    During evolution, enzyme-coding genes are acquired and/or replaced through lateral gene transfer and compiled into metabolic pathways. Gene regulatory networks evolve to fine tune biochemical fluxes through such metabolic pathways, enabling organisms to acclimate to nutrient fluctuations in a competitive environment. Here, we demonstrate that a single TrmB family transcription factor in Halobacterium salinarum NRC-1 globally coordinates functionally linked enzymes of diverse phylogeny in response to changes in carbon source availability. Specifically, during nutritional limitation, TrmB binds a cis-regulatory element to activate or repress 113 promoters of genes encoding enzymes in diverse metabolic pathways. By this mechanism, TrmB coordinates the expression of glycolysis, TCA cycle, and amino-acid biosynthesis pathways with the biosynthesis of their cognate cofactors (e.g. purine and thiamine). Notably, the TrmB-regulated metabolic network includes enzyme-coding genes that are uniquely archaeal as well as those that are conserved across all three domains of life. Simultaneous analysis of metabolic and gene regulatory network architectures suggests an ongoing process of co-evolution in which TrmB integrates the expression of metabolic enzyme-coding genes of diverse origins.

  6. Identification of evolutionarily conserved Momordica charantia microRNAs using computational approach and its utility in phylogeny analysis.


    Thirugnanasambantham, Krishnaraj; Saravanan, Subramanian; Karikalan, Kulandaivelu; Bharanidharan, Rajaraman; Lalitha, Perumal; Ilango, S; HairulIslam, Villianur Ibrahim


    Momordica charantia (bitter gourd, bitter melon) is a monoecious Cucurbitaceae with anti-oxidant, anti-microbial, anti-viral and anti-diabetic potential. Molecular studies on this economically valuable plant are very essential to understand its phylogeny and evolution. MicroRNAs (miRNAs) are conserved, small, non-coding RNA with ability to regulate gene expression by bind the 3' UTR region of target mRNA and are evolved at different rates in different plant species. In this study we have utilized homology based computational approach and identified 27 mature miRNAs for the first time from this bio-medically important plant. The phylogenetic tree developed from binary data derived from the data on presence/absence of the identified miRNAs were noticed to be uncertain and biased. Most of the identified miRNAs were highly conserved among the plant species and sequence based phylogeny analysis of miRNAs resolved the above difficulties in phylogeny approach using miRNA. Predicted gene targets of the identified miRNAs revealed their importance in regulation of plant developmental process. Reported miRNAs held sequence conservation in mature miRNAs and the detailed phylogeny analysis of pre-miRNA sequences revealed genus specific segregation of clusters.

  7. Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans.


    Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A


    Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

  8. An evolutionarily conserved mechanism for cAMP elicited axonal regeneration involves direct activation of the dual leucine zipper kinase DLK

    PubMed Central

    Hao, Yan; Frey, Erin; Yoon, Choya; Wong, Hetty; Nestorovski, Douglas; Holzman, Lawrence B; Giger, Roman J; DiAntonio, Aaron; Collins, Catherine


    A broadly known method to stimulate the growth potential of axons is to elevate intracellular levels of cAMP, however the cellular pathway(s) that mediate this are not known. Here we identify the Dual Leucine-zipper Kinase (DLK, Wnd in Drosophila) as a critical target and effector of cAMP in injured axons. DLK/Wnd is thought to function as an injury ‘sensor’, as it becomes activated after axonal damage. Our findings in both Drosophila and mammalian neurons indicate that the cAMP effector kinase PKA is a conserved and direct upstream activator of Wnd/DLK. PKA is required for the induction of Wnd signaling in injured axons, and DLK is essential for the regenerative effects of cAMP in mammalian DRG neurons. These findings link two important mediators of responses to axonal injury, DLK/Wnd and cAMP/PKA, into a unified and evolutionarily conserved molecular pathway for stimulating the regenerative potential of injured axons. DOI: PMID:27268300

  9. Krüppel-like Factor 11 Regulates the Expression of Metabolic Genes via an Evolutionarily Conserved Protein Interaction Domain Functionally Disrupted in Maturity Onset Diabetes of the Young*

    PubMed Central

    Lomberk, Gwen; Grzenda, Adrienne; Mathison, Angela; Escande, Carlos; Zhang, Jin-San; Calvo, Ezequiel; Miller, Laurence J.; Iovanna, Juan; Chini, Eduardo N.; Fernandez-Zapico, Martin E.; Urrutia, Raul


    The function of Krüppel-like factor 11 (KLF11) in the regulation of metabolic pathways is conserved from flies to human. Alterations in KLF11 function result in maturity onset diabetes of the young 7 (MODY7) and neonatal diabetes; however, the mechanisms underlying the role of this protein in metabolic disorders remain unclear. Here, we investigated how the A347S genetic variant, present in MODY7 patients, modulates KLF11 transcriptional activity. A347S affects a previously identified transcriptional regulatory domain 3 (TRD3) for which co-regulators remain unknown. Structure-oriented sequence analyses described here predicted that the KLF11 TRD3 represents an evolutionarily conserved protein domain. Combined yeast two-hybrid and protein array experiments demonstrated that the TRD3 binds WD40, WWI, WWII, and SH3 domain-containing proteins. Using one of these proteins as a model, guanine nucleotide-binding protein β2 (Gβ2), we investigated the functional consequences of KLF11 coupling to a TRD3 binding partner. Combined immunoprecipitation and biomolecular fluorescence complementation assays confirmed that activation of three different metabolic G protein-coupled receptors (β-adrenergic, secretin, and cholecystokinin) induces translocation of Gβ2 to the nucleus where it directly binds KLF11 in a manner that is disrupted by the MODY7 A347S variant. Using genome-wide expression profiles, we identified metabolic gene networks impacted upon TRD3 disruption. Furthermore, A347S disrupted KLF11-mediated increases in basal insulin levels and promoter activity and blunted glucose-stimulated insulin secretion. Thus, this study characterizes a novel protein/protein interaction domain disrupted in a KLF gene variant that associates to MODY7, contributing to our understanding of gene regulation events in complex metabolic diseases. PMID:23589285

  10. Krüppel-like factor 11 regulates the expression of metabolic genes via an evolutionarily conserved protein interaction domain functionally disrupted in maturity onset diabetes of the young.


    Lomberk, Gwen; Grzenda, Adrienne; Mathison, Angela; Escande, Carlos; Zhang, Jin-San; Calvo, Ezequiel; Miller, Laurence J; Iovanna, Juan; Chini, Eduardo N; Fernandez-Zapico, Martin E; Urrutia, Raul


    The function of Krüppel-like factor 11 (KLF11) in the regulation of metabolic pathways is conserved from flies to human. Alterations in KLF11 function result in maturity onset diabetes of the young 7 (MODY7) and neonatal diabetes; however, the mechanisms underlying the role of this protein in metabolic disorders remain unclear. Here, we investigated how the A347S genetic variant, present in MODY7 patients, modulates KLF11 transcriptional activity. A347S affects a previously identified transcriptional regulatory domain 3 (TRD3) for which co-regulators remain unknown. Structure-oriented sequence analyses described here predicted that the KLF11 TRD3 represents an evolutionarily conserved protein domain. Combined yeast two-hybrid and protein array experiments demonstrated that the TRD3 binds WD40, WWI, WWII, and SH3 domain-containing proteins. Using one of these proteins as a model, guanine nucleotide-binding protein β2 (Gβ2), we investigated the functional consequences of KLF11 coupling to a TRD3 binding partner. Combined immunoprecipitation and biomolecular fluorescence complementation assays confirmed that activation of three different metabolic G protein-coupled receptors (β-adrenergic, secretin, and cholecystokinin) induces translocation of Gβ2 to the nucleus where it directly binds KLF11 in a manner that is disrupted by the MODY7 A347S variant. Using genome-wide expression profiles, we identified metabolic gene networks impacted upon TRD3 disruption. Furthermore, A347S disrupted KLF11-mediated increases in basal insulin levels and promoter activity and blunted glucose-stimulated insulin secretion. Thus, this study characterizes a novel protein/protein interaction domain disrupted in a KLF gene variant that associates to MODY7, contributing to our understanding of gene regulation events in complex metabolic diseases.

  11. The functions of the multiproduct and rapidly evolving dec-1 eggshell gene are conserved between evolutionarily distant species of Drosophila.

    PubMed Central

    Badciong, J C; Otto, J M; Waring, G L


    The Drosophila dec-1 gene encodes multiple proteins that are required for female fertility and proper eggshell morphogenesis. Genetic and immunolocalization data suggest that the different DEC-1 proteins are functionally distinct. To identify regions within the proteins with potential biological significance, we cloned and sequenced the D. yakuba and D. virilis dec-1 homologs. Interspecies comparisons of the predicted translation products revealed rapidly evolving sequences punctuated by blocks of conserved amino acids. Despite extensive amino acid variability, the proteins produced by the different dec-1 homologs were functionally interchangeable. The introduction of transgenes containing either the D. yakuba or the D. virilis dec-1 open reading frames into a D. melanogaster DEC-1 protein null mutant was sufficient to restore female fertility and wild-type eggshell morphology. Normal expression and extracellular processing of the DEC-1 proteins was correlated with the phenotypic rescue. The nature of the conserved features highlighted by the evolutionary comparison and the molecular resemblance of some of these features to those found in other extracellular proteins suggests functional correlates for some of the multiple DEC-1 derivatives. PMID:11729155

  12. The role of evolutionarily conserved germ-line DH sequence in B-1 cell development and natural antibody production.


    Vale, Andre M; Nobrega, Alberto; Schroeder, Harry W


    Because of N addition and variation in the site of VDJ joining, the third complementarity-determining region of the heavy chain (CDR-H3) is the most diverse component of the initial immunoglobulin antigen-binding site repertoire. A large component of the peritoneal cavity B-1 cell component is the product of fetal and perinatal B cell production. The CDR-H3 repertoire is thus depleted of N addition, which increases dependency on germ-line sequence. Cross-species comparisons have shown that DH gene sequence demonstrates conservation of amino acid preferences by reading frame. Preference for reading frame 1, which is enriched for tyrosine and glycine, is created both by rearrangement patterns and by pre-BCR and BCR selection. In previous studies, we have assessed the role of conserved DH sequence by examining peritoneal cavity B-1 cell numbers and antibody production in BALB/c mice with altered DH loci. Here, we review our finding that changes in the constraints normally imposed by germ-line-encoded amino acids within the CDR-H3 repertoire profoundly affect B-1 cell development, especially B-1a cells, and thus natural antibody immunity. Our studies suggest that both natural and somatic selection operate to create a restricted B-1 cell CDR-H3 repertoire.

  13. Roundabout controls axon crossing of the CNS midline and defines a novel subfamily of evolutionarily conserved guidance receptors.


    Kidd, T; Brose, K; Mitchell, K J; Fetter, R D; Tessier-Lavigne, M; Goodman, C S; Tear, G


    The robo gene in Drosophila was identified in a large-scale mutant screen for genes that control the decision by axons to cross the CNS midline. In robo mutants, too many axons cross and recross the midline. Here we show that robo encodes an axon guidance receptor that defines a novel subfamily of immunoglobulin superfamily proteins that is highly conserved from fruit flies to mammals. For those axons that never cross the midline, Robo is expressed on their growth cones from the outset; for the majority of axons that do cross the midline, Robo is expressed at high levels on their growth cones only after they cross the midline. Transgenic rescue experiments reveal that Robo can function in a cell-autonomous fashion. Robo appears to function as the gatekeeper controlling midline crossing.

  14. The M1 family of vertebrate aminopeptidases: role of evolutionarily conserved tyrosines in the enzymatic mechanism of aminopeptidase B.


    Cadel, Sandrine; Darmon, Cécile; Pernier, Julien; Hervé, Guy; Foulon, Thierry


    Aminopeptidase B (Ap-B), a member of the M1 family of Zn(2+)-aminopeptidases, removes basic residues at the NH2-terminus of peptides and is involved in the in vivo proteolytic processing of miniglucagon and cholecystokinin-8. M1 enzymes hydrolyze numerous different peptides and are implicated in many physiological functions. As these enzymes have similar catalytic mechanisms, their respective substrate specificity and/or catalytic efficiency must be based on subtle structural differences at or near the catalytic site. This leads to the hypothesis that each primary structure contains a consensus structural template, strictly necessary for aminopeptidase activity, and a specific amino acid environment localized in or outside the catalytic pocket that finely tunes the substrate specificity and catalytic efficiency of each enzyme. A multiple sequence alignment of M1 peptidases from vertebrates allowed to identify conserved tyrosine amino acids, which are members of this catalytic backbone. In the present work, site-directed mutagenesis and 3D molecular modeling of Ap-B were used to specify the role of four fully (Y281, Y229, Y414, and Y441) and one partially (Y409) conserved residues. Tyrosine to phenylalanine mutations allowed confirming the influence of the hydroxyl groups on the enzyme activity. These groups are implicated in the reaction mechanism (Y414), in substrate specificity and/or catalytic efficiency (Y409), in stabilization of essential amino acids of the active site (Y229, Y409) and potentially in the maintenance of its structural integrity (Y281, Y441). The importance of hydrogen bonds is verified by the Y229H substitution, which preserves the enzyme activity. These data provide new insights into the catalytic mechanism of Ap-B in the M1 family of aminopeptidases.

  15. Regulation of carotenoid and bacteriochlorophyll biosynthesis genes and identification of an evolutionarily conserved gene required for bacteriochlorophyll accumulation.


    Armstrong, G A; Cook, D N; Ma, D; Alberti, M; Burke, D H; Hearst, J E


    The temporal expression of ten clustered genes required for carotenoid (crt) and bacteriochlorophyll (bch) biosynthesis was examined during the transition from aerobic respiration to anaerobiosis requisite for the development of the photosynthetic membrane in the bacterium Rhodobacter capsulatus. Accumulation of crtA, crtC, crtD, crtE, crtF, crtK, bchC and bchD mRNAs increased transiently and coordinately, up to 12-fold following removal of oxygen from the growth medium, paralleling increases in mRNAs encoding pigment-binding polypeptides of the photosynthetic apparatus. The crtB and crtI genes, in contrast, were expressed similarly in the presence or absence of oxygen. The regulation patterns of promoters for the crtA and crtI genes and the bchCXYZ operon were characterized using lacZ transcriptional fusion and qualitatively reflected the corresponding mRNA accumulation patterns. We also report that the bchI gene product, encoded by a DNA sequence previously considered to be a portion of crtA, shares 49% sequence identity with the nuclear-encoded Arabidopsis thaliana Cs chloroplast protein required for normal pigmentation in plants.

  16. Blue-light dependent reactive oxygen species formation by Arabidopsis cryptochrome may define a novel evolutionarily conserved signaling mechanism.


    Consentino, Laurent; Lambert, Stefan; Martino, Carlos; Jourdan, Nathalie; Bouchet, Pierre-Etienne; Witczak, Jacques; Castello, Pablo; El-Esawi, Mohamed; Corbineau, Francoise; d'Harlingue, Alain; Ahmad, Margaret


    Cryptochromes are widespread blue-light absorbing flavoproteins with important signaling roles. In plants they mediate de-etiolation, developmental and stress responses resulting from interaction with downstream signaling partners such as transcription factors and components of the proteasome. Recently, it has been shown that Arabidopsis cry1 activation by blue light also results in direct enzymatic conversion of molecular oxygen (O2 ) to reactive oxygen species (ROS) and hydrogen peroxide (H2 O2 ) in vitro. Here we explored whether direct enzymatic synthesis of ROS by Arabidopsis cry1 can play a physiological role in vivo. ROS formation resulting from cry1 expression was measured by fluorescence assay in insect cell cultures and in Arabidopsis protoplasts from cryptochrome mutant seedlings. Cell death was determined by colorimetric assay. We found that ROS formation results from cry1 activation and induces cell death in insect cell cultures. In plant protoplasts, cryptochrome activation results in rapid increase in ROS formation and cell death. We conclude that ROS formation by cryptochromes may indeed be of physiological relevance and could represent a novel paradigm for cryptochrome signaling.

  17. Evolutionarily conserved sequences of striated muscle myosin heavy chain isoforms. Epitope mapping by cDNA expression.


    Miller, J B; Teal, S B; Stockdale, F E


    A cDNA expression strategy was used to localize amino acid sequences which were specific for fast, as opposed to slow, isoforms of the chicken skeletal muscle myosin heavy chain (MHC) and which were conserved in vertebrate evolution. Five monoclonal antibodies (mAbs), termed F18, F27, F30, F47, and F59, were prepared that reacted with all of the known chicken fast MHC isoforms but did not react with any of the known chicken slow nor with smooth muscle MHC isoforms. The epitopes recognized by mAbs F18, F30, F47, and F59 were on the globular head fragment of the MHC, whereas the epitope recognized by mAb F27 was on the helical tail or rod fragment. Reactivity of all five mAbs also was confined to fast MHCs in the rat, with the exception of mAb F59, which also reacted with the beta-cardiac MHC, the single slow MHC isoform common to both the rat heart and skeletal muscle. None of the five epitopes was expressed on amphioxus, nematode, or Dictyostelium MHC. The F27 and F59 epitopes were found on shark, electric ray, goldfish, newt, frog, turtle, chicken, quail, rabbit, and rat MHCs. The epitopes recognized by these mAbs were conserved, therefore, to varying degrees through vertebrate evolution and differed in sequence from homologous regions of a number of invertebrate MHCs and myosin-like proteins. The sequence of those epitopes on the head were mapped using a two-part cDNA expression strategy. First, Bal31 exonuclease digestion was used to rapidly generate fragments of a chicken embryonic fast MHC cDNA that were progressively deleted from the 3' end. These cDNA fragments were expressed as beta-galactosidase/MHC fusion proteins using the pUR290 vector; the fusion proteins were tested by immunoblotting for reactivity with the mAbs; and the approximate locations of the epitopes were determined from the sizes of the cDNA fragments that encoded a particular epitope. The epitopes were then precisely mapped by expression of overlapping cDNA fragments of known sequence that

  18. Control of plant stem cell function by conserved interacting transcriptional regulators

    PubMed Central

    Zhou, Yun; Liu, Xing; Engstrom, Eric M.; Nimchuk, Zachary L.; Pruneda-Paz, Jose L.; Tarr, Paul T.; Yan, An; Kay, Steve A.; Meyerowitz, Elliot M.


    SUMMARY Plant stem cells in the shoot apical meristem (SAM) and root apical meristem (RAM) provide for postembryonic development of above-ground tissues and roots, respectively, while secondary vascular stem cells sustain vascular development1–4. WUSCHEL (WUS), a homeodomain transcription factor expressed in the rib meristem of the SAM, is a key regulatory factor controlling stem cell populations in the Arabidopsis SAM5–6 and is thought to establish the shoot stem cell niche via a feedback circuit with the CLAVATA3 (CLV3) peptide signaling pathway7. WUSCHEL-RELATED HOMEOBOX5 (WOX5), specifically expressed in root quiescent center (QC), defines QC identity and functions interchangeably with WUS in control of shoot and root stem cell niches8. WOX4, expressed in Arabidopsis procambial cells, defines the vascular stem cell niche9–11. WUS/WOX family proteins are evolutionarily and functionally conserved throughout the plant kingdom12 and emerge as key actors in the specification and maintenance of stem cells within all meristems13. However, the nature of the genetic regime in stem cell niches that centers on WOX gene function has been elusive, and molecular links underlying conserved WUS/WOX function in stem cell niches remain unknown. Here we demonstrate that the Arabidopsis HAIRY MERISTEM (HAM)family transcription regulators act as conserved interacting co-factors with WUS/WOX proteins. HAM and WUS share common targets in vivo and their physical interaction is important in driving downstream transcriptional programs and in promoting shoot stem cell proliferation. Differences in the overlapping expression patterns of WOX and HAM family members underlie the formation of diverse stem cell niche locations, and the HAM family is essential for all of these stem cell niches. These findings establish a new framework for the control of stem cell production during plant development. PMID:25363783

  19. An essential and evolutionarily conserved role of protein arginine methyltransferase 1 for adult intestinal stem cells during postembryonic development.


    Matsuda, Hiroki; Shi, Yun-Bo


    Organ-specific adult stem cells are critical for the homeostasis of adult organs and organ repair and regeneration. Unfortunately, it has been difficult to investigate the origins of these stem cells and the mechanisms of their development, especially in mammals. Intestinal remodeling during frog metamorphosis offers a unique opportunity for such studies. During the transition from an herbivorous tadpole to a carnivorous frog, the intestine is completely remodeled as the larval epithelial cells undergo apoptotic degeneration and are replaced by adult epithelial cells developed de novo. The entire metamorphic process is under the control of thyroid hormone, making it possible to control the development of the adult intestinal stem cells. Here, we show that the thyroid hormone receptor-coactivator protein arginine methyltransferase 1 (PRMT1) is upregulated in a small number of larval epithelial cells and that these cells dedifferentiate to become the adult stem cells. More importantly, transgenic overexpression of PRMT1 leads to increased adult stem cells in the intestine, and conversely, knocking down the expression of endogenous PRMT1 reduces the adult stem cell population. In addition, PRMT1 expression pattern during zebrafish and mouse development suggests that PRMT1 may play an evolutionally conserved role in the development of adult intestinal stem cells throughout vertebrates. These findings are not only important for the understanding of organ-specific adult stem cell development but also have important implications in regenerative medicine of the digestive tract.

  20. An Evolutionarily Conserved Switch in Response to GABA Affects Development and Behavior of the Locomotor Circuit of Caenorhabditis elegans

    PubMed Central

    Han, Bingjie; Bellemer, Andrew; Koelle, Michael R.


    The neurotransmitter gamma-aminobutyric acid (GABA) is depolarizing in the developing vertebrate brain, but in older animals switches to hyperpolarizing and becomes the major inhibitory neurotransmitter in adults. We discovered a similar developmental switch in GABA response in Caenorhabditis elegans and have genetically analyzed its mechanism and function in a well-defined circuit. Worm GABA neurons innervate body wall muscles to control locomotion. Activation of GABAA receptors with their agonist muscimol in newly hatched first larval (L1) stage animals excites muscle contraction and thus is depolarizing. At the mid-L1 stage, as the GABAergic neurons rewire onto their mature muscle targets, muscimol shifts to relaxing muscles and thus has switched to hyperpolarizing. This muscimol response switch depends on chloride transporters in the muscles analogous to those that control GABA response in mammalian neurons: the chloride accumulator sodium-potassium-chloride-cotransporter-1 (NKCC-1) is required for the early depolarizing muscimol response, while the two chloride extruders potassium-chloride-cotransporter-2 (KCC-2) and anion-bicarbonate-transporter-1 (ABTS-1) are required for the later hyperpolarizing response. Using mutations that disrupt GABA signaling, we found that neural circuit development still proceeds to completion but with an ∼6-hr delay. Using optogenetic activation of GABAergic neurons, we found that endogenous GABAA signaling in early L1 animals, although presumably depolarizing, does not cause an excitatory response. Thus a developmental depolarizing-to-hyperpolarizing shift is an ancient conserved feature of GABA signaling, but existing theories for why this shift occurs appear inadequate to explain its function upon rigorous genetic analysis of a well-defined neural circuit. PMID:25644702

  1. Sequence of cDNAs for mammalian H2A.Z, an evolutionarily diverged but highly conserved basal histone H2A isoprotein species.

    PubMed Central

    Hatch, C L; Bonner, W M


    The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin. PMID:3344202

  2. Fragile X mental retardation protein has a unique, evolutionarily conserved neuronal function not shared with FXR1P or FXR2P.


    Coffee, R Lane; Tessier, Charles R; Woodruff, Elvin A; Broadie, Kendal


    Fragile X syndrome (FXS), resulting solely from the loss of function of the human fragile X mental retardation 1 (hFMR1) gene, is the most common heritable cause of mental retardation and autism disorders, with syndromic defects also in non-neuronal tissues. In addition, the human genome encodes two closely related hFMR1 paralogs: hFXR1 and hFXR2. The Drosophila genome, by contrast, encodes a single dFMR1 gene with close sequence homology to all three human genes. Drosophila that lack the dFMR1 gene (dfmr1 null mutants) recapitulate FXS-associated molecular, cellular and behavioral phenotypes, suggesting that FMR1 function has been conserved, albeit with specific functions possibly sub-served by the expanded human gene family. To test evolutionary conservation, we used tissue-targeted transgenic expression of all three human genes in the Drosophila disease model to investigate function at (1) molecular, (2) neuronal and (3) non-neuronal levels. In neurons, dfmr1 null mutants exhibit elevated protein levels that alter the central brain and neuromuscular junction (NMJ) synaptic architecture, including an increase in synapse area, branching and bouton numbers. Importantly, hFMR1 can, comparably to dFMR1, fully rescue both the molecular and cellular defects in neurons, whereas hFXR1 and hFXR2 provide absolutely no rescue. For non-neuronal requirements, we assayed male fecundity and testes function. dfmr1 null mutants are effectively sterile owing to disruption of the 9+2 microtubule organization in the sperm tail. Importantly, all three human genes fully and equally rescue mutant fecundity and spermatogenesis defects. These results indicate that FMR1 gene function is evolutionarily conserved in neural mechanisms and cannot be compensated by either FXR1 or FXR2, but that all three proteins can substitute for each other in non-neuronal requirements. We conclude that FMR1 has a neural-specific function that is distinct from its paralogs, and that the unique FMR1 function

  3. Widespread Shortening of 3’ Untranslated Regions and Increased Exon Inclusion Are Evolutionarily Conserved Features of Innate Immune Responses to Infection

    PubMed Central

    Pagé Sabourin, Ariane; Nédélec, Yohann; Dumaine, Anne; Yotova, Vania; Johnson, Zachary P.; Lanford, Robert E.; Burge, Christopher B.


    The contribution of pre-mRNA processing mechanisms to the regulation of immune responses remains poorly studied despite emerging examples of their role as regulators of immune defenses. We sought to investigate the role of mRNA processing in the cellular responses of human macrophages to live bacterial infections. Here, we used mRNA sequencing to quantify gene expression and isoform abundances in primary macrophages from 60 individuals, before and after infection with Listeria monocytogenes and Salmonella typhimurium. In response to both bacteria we identified thousands of genes that significantly change isoform usage in response to infection, characterized by an overall increase in isoform diversity after infection. In response to both bacteria, we found global shifts towards (i) the inclusion of cassette exons and (ii) shorter 3’ UTRs, with near-universal shifts towards usage of more upstream polyadenylation sites. Using complementary data collected in non-human primates, we show that these features are evolutionarily conserved among primates. Following infection, we identify candidate RNA processing factors whose expression is associated with individual-specific variation in isoform abundance. Finally, by profiling microRNA levels, we show that 3’ UTRs with reduced abundance after infection are significantly enriched for target sites for particular miRNAs. These results suggest that the pervasive usage of shorter 3’ UTRs is a mechanism for particular genes to evade repression by immune-activated miRNAs. Collectively, our results suggest that dynamic changes in RNA processing may play key roles in the regulation of innate immune responses. PMID:27690314

  4. IAPs contain an evolutionarily conserved ubiquitin-binding domain that regulates NF-kappaB as well as cell survival and oncogenesis.


    Gyrd-Hansen, Mads; Darding, Maurice; Miasari, Maria; Santoro, Massimo M; Zender, Lars; Xue, Wen; Tenev, Tencho; da Fonseca, Paula C A; Zvelebil, Marketa; Bujnicki, Janusz M; Lowe, Scott; Silke, John; Meier, Pascal


    The covalent attachment of ubiquitin to target proteins influences various cellular processes, including DNA repair, NF-kappaB signalling and cell survival. The most common mode of regulation by ubiquitin-conjugation involves specialized ubiquitin-binding proteins that bind to ubiquitylated proteins and link them to downstream biochemical processes. Unravelling how the ubiquitin-message is recognized is essential because aberrant ubiquitin-mediated signalling contributes to tumour formation. Recent evidence indicates that inhibitor of apoptosis (IAP) proteins are frequently overexpressed in cancer and their expression level is implicated in contributing to tumorigenesis, chemoresistance, disease progression and poor patient-survival. Here, we have identified an evolutionarily conserved ubiquitin-associated (UBA) domain in IAPs, which enables them to bind to Lys 63-linked polyubiquitin. We found that the UBA domain is essential for the oncogenic potential of cIAP1, to maintain endothelial cell survival and to protect cells from TNF-alpha-induced apoptosis. Moreover, the UBA domain is required for XIAP and cIAP2-MALT1 to activate NF-kappaB. Our data suggest that the UBA domain of cIAP2-MALT1 stimulates NF-kappaB signalling by binding to polyubiquitylated NEMO. Significantly, 98% of all cIAP2-MALT1 fusion proteins retain the UBA domain, suggesting that ubiquitin-binding contributes to the oncogenic potential of cIAP2-MALT1 in MALT lymphoma. Our data identify IAPs as ubiquitin-binding proteins that contribute to ubiquitin-mediated cell survival, NF-kappaB signalling and oncogenesis.

  5. BMP, Wnt and FGF signals are integrated through evolutionarily conserved enhancers to achieve robust expression of Pax3 and Zic genes at the zebrafish neural plate border.


    Garnett, Aaron T; Square, Tyler A; Medeiros, Daniel M


    Neural crest cells generate a range of cells and tissues in the vertebrate head and trunk, including peripheral neurons, pigment cells, and cartilage. Neural crest cells arise from the edges of the nascent central nervous system, a domain called the neural plate border (NPB). NPB induction is known to involve the BMP, Wnt and FGF signaling pathways. However, little is known about how these signals are integrated to achieve temporally and spatially specific expression of genes in NPB cells. Furthermore, the timing and relative importance of these signals in NPB formation appears to differ between vertebrate species. Here, we use heat-shock overexpression and chemical inhibitors to determine whether, and when, BMP, Wnt and FGF signaling are needed for expression of the NPB specifiers pax3a and zic3 in zebrafish. We then identify four evolutionarily conserved enhancers from the pax3a and zic3 loci and test their response to BMP, Wnt and FGF perturbations. We find that all three signaling pathways are required during gastrulation for the proper expression of pax3a and zic3 in the zebrafish NPB. We also find that, although the expression patterns driven by the pax3a and zic3 enhancers largely overlap, they respond to different combinations of BMP, Wnt and FGF signals. Finally, we show that the combination of the two pax3a enhancers is less susceptible to signaling perturbations than either enhancer alone. Taken together, our results reveal how BMPs, FGFs and Wnts act cooperatively and redundantly through partially redundant enhancers to achieve robust, specific gene expression in the zebrafish NPB.

  6. Gonadal apoptosis during sex reversal of the rice field eel: implications for an evolutionarily conserved role of the molecular chaperone heat shock protein 10.


    He, Yan; Shang, Xuan; Sun, Junhua; Zhang, Lei; Zhao, Wei; Tian, Yihao; Cheng, Hanhua; Zhou, Rongjia


    Role of apoptosis in gonadal transformation of the rice field eel remains unknown. Here we report characterization of apoptotic pattern of testis, ovary, and ovotestis of the rice field eel, a vertebrate with natural sex reversal characteristic. DNA laddering assay showed typical ladder with step around 200 bp in the gonads, especially in testis. Terminal transferase dUTP nick end labeling on gonads indicated obvious apoptotic signals in the seminiferous tubules. Western blot analysis revealed that pro-apoptotic genes, Caspase 9 and p53, were upregulated and anti-apoptotic factor Bcl2 was downregulated in testis compared with both ovary and ovotestis. These data indicated that sex reversal process is accompanied by gonadal apoptosis with the highest proportion of cell death in the testis. Furthermore, we identified the Hsp10 by differentially screening of testis, ovary, and ovotestis using microarray technique, which is evolutionarily conserved and differentially expressed during gonadal transformation. Downregulation of Hsp10 is consistent with high apoptosis during the gonadal transformation. Flow cytometry assay confirmed that Hsp10 inhibits the apoptosis in male gonadal cells. Moreover, upregulation and mis-localization at sub-cellular level of the HSP10 together with its partner HSP60 is associated with tumorigenesis in human testis. These results suggest that downregulation of Hsp10 would be one of the main causes of apoptosis in testis, overexpression of Hsp10 suppresses apoptosis, and potentially results in testis tumorigenesis, which provide clues for understanding the mechanisms of germ cell apoptosis. Development of Hsp10 as a diagnostic marker or even treatment target will be promising in testis cancer diagnosis and therapy.

  7. A Conserved Transcriptional Signature of Delayed Aging and Reduced Disease Vulnerability Is Partially Mediated by SIRT3

    PubMed Central

    Newton, Michael A.; da Silva, Cristina; Vann, James A.; Pugh, Thomas D.; Someya, Shinichi; Prolla, Tomas A.; Weindruch, Richard


    Aging is the most significant risk factor for a range of diseases, including many cancers, neurodegeneration, cardiovascular disease, and diabetes. Caloric restriction (CR) without malnutrition delays aging in diverse species, and therefore offers unique insights into age-related disease vulnerability. Previous studies suggest that there are shared mechanisms of disease resistance associated with delayed aging, however quantitative support is lacking. We therefore sought to identify a common response to CR in diverse tissues and species and determine whether this signature would reflect health status independent of aging. We analyzed gene expression datasets from eight tissues of mice subjected to CR and identified a common transcriptional signature that includes functional categories of mitochondrial energy metabolism, inflammation and ribosomal structure. This signature is detected in flies, rats, and rhesus monkeys on CR, indicating aspects of CR that are evolutionarily conserved. Detection of the signature in mouse genetic models of slowed aging indicates that it is not unique to CR but rather a common aspect of extended longevity. Mice lacking the NAD-dependent deacetylase SIRT3 fail to induce mitochondrial and anti-inflammatory elements of the signature in response to CR, suggesting a potential mechanism involving SIRT3. The inverse of this transcriptional signature is detected with consumption of a high fat diet, obesity and metabolic disease, and is reversed in response to interventions that decrease disease risk. We propose that this evolutionarily conserved, tissue-independent, transcriptional signature of delayed aging and reduced disease vulnerability is a promising target for developing therapies for age-related diseases. PMID:25830335

  8. Conserved hemopoietic transcription factor Cg-SCL delineates hematopoiesis of Pacific oyster Crassostrea gigas.


    Song, Xiaorui; Wang, Hao; Chen, Hao; Sun, Mingzhe; Liang, Zhongxiu; Wang, Lingling; Song, Linsheng


    Hemocytes are the effective immunocytes in bivalves, which have been reported to be derived from stem-like cells in gill epithelium of oyster. In the present work, a conserved haematopoietic transcription factor Tal-1/Scl (Stem Cell Leukemia) was identified in Pacific oyster (Cg-SCL), and it was evolutionarily close to the orthologs in deuterostomes. Cg-SCL was highly distributed in the hemocytes as well as gill and mantle. The hemocyte specific genes Integrin, EcSOD and haematopoietic transcription factors GATA3, C-Myb, c-kit, were down-regulated when Cg-SCL was interfered by dsRNA. During the larval developmental stages, the mRNA transcripts of Cg-SCL gradually increased after fertilization and peaked at early trochophore larvae stage (10 hpf, hours post fertilization), then sharply decreased in late trochophore larvae stage (15 hpf) before resuming in umbo larvae (120 hpf). Whole-mount immunofluorescence assay further revealed that the immunoreactivity of Cg-SCL appeared in blastula larvae with two approximate symmetric spots, and this expression pattern lasted in gastrula larvae. By trochophore, the immunoreactivity formed a ring around the dorsal region and then separated into two remarkable spots at the dorsal side in D-veliger larvae. After bacterial challenge, the mRNA expression levels of Cg-SCL were significantly up-regulated in the D-veliger and umbo larvae, indicating the available hematopoietic regulation in oyster larvae. These results demonstrated that Cg-SCL could be used as haematopoietic specific marker to trace potential developmental events of hematopoiesis during ontogenesis of oyster, which occurred early in blastula stage and maintained until D-veliger larvae.

  9. Coexpression of Escherichia coli obgE, Encoding the Evolutionarily Conserved Obg GTPase, with Ribosomal Proteins L21 and L27

    PubMed Central

    Maouche, Rim; Burgos, Hector L.; My, Laetitia; Viala, Julie P.


    ABSTRACT Multiple essential small GTPases are involved in the assembly of the ribosome or in the control of its activity. Among them, ObgE (CgtA) has been shown recently to act as a ribosome antiassociation factor that binds to ppGpp, a regulator whose best-known target is RNA polymerase. The present study was aimed at elucidating the expression of obgE in Escherichia coli. We show that obgE is cotranscribed with ribosomal protein genes rplU and rpmA and with a gene of unknown function, yhbE. We show here that about 75% of the transcripts terminate before obgE, because there is a transcriptional terminator between rpmA and yhbE. As expected for ribosomal protein operons, expression was highest during exponential growth, decreased during entry into stationary phase, and became almost undetectable thereafter. Expression of the operon was derepressed in mutants lacking ppGpp or DksA. However, regulation by these factors appears to occur post-transcription initiation, since no effects of ppGpp and DksA on rplU promoter activity were observed in vitro. IMPORTANCE The conserved and essential ObgE GTPase binds to the ribosome and affects its assembly. ObgE has also been reported to impact chromosome segregation, cell division, resistance to DNA damage, and, perhaps most interestingly, persister formation and antibiotic tolerance. However, it is unclear whether these effects are related to its role in ribosome formation. Despite its importance, no studies on ObgE expression have been reported. We demonstrate here that obgE is expressed from an operon encoding two ribosomal proteins, that the operon's expression varies with the growth phase, and that it is dependent on the transcription regulators ppGpp and DksA. Our results thus demonstrate that obgE expression is coupled to ribosomal gene expression. PMID:27137500

  10. The Mediator complex of Caenorhabditis elegans: insights into the developmental and physiological roles of a conserved transcriptional coregulator

    PubMed Central

    Grants, Jennifer M.; Goh, Grace Y. S.; Taubert, Stefan


    The Mediator multiprotein complex (‘Mediator’) is an important transcriptional coregulator that is evolutionarily conserved throughout eukaryotes. Although some Mediator subunits are essential for the transcription of all protein-coding genes, others influence the expression of only subsets of genes and participate selectively in cellular signaling pathways. Here, we review the current knowledge of Mediator subunit function in the nematode Caenorhabditis elegans, a metazoan in which established and emerging genetic technologies facilitate the study of developmental and physiological regulation in vivo. In this nematode, unbiased genetic screens have revealed critical roles for Mediator components in core developmental pathways such as epidermal growth factor (EGF) and Wnt/β-catenin signaling. More recently, important roles for C. elegans Mediator subunits have emerged in the regulation of lipid metabolism and of systemic stress responses, engaging conserved transcription factors such as nuclear hormone receptors (NHRs). We emphasize instances where similar functions for individual Mediator subunits exist in mammals, highlighting parallels between Mediator subunit action in nematode development and in human cancer biology. We also discuss a parallel between the association of the Mediator subunit MED12 with several human disorders and the role of its C. elegans ortholog mdt-12 as a regulatory hub that interacts with numerous signaling pathways. PMID:25634893

  11. Evolutionarily conserved Ets family members display distinct DNA binding specificities [published erratum appears in J Exp Med 1993 Sep 1;178(3):1133

    PubMed Central


    Members of the Ets family of proto-oncogenes encode sequence-specific transcription factors that bind to a purine-rich motif centered around a conserved GGA trinucleotide. Ets binding sites have been identified in the transcriptional regulatory regions of multiple T cell genes including the T cell receptor alpha and beta (TCR-alpha and -beta) enhancers and the IL-2 enhancer, as well as in the enhancers of several T cell-trophic viruses including Maloney sarcoma virus, human leukemia virus type 1, and human immunodeficiency virus-2. T cells express multiple members of the Ets gene family including Ets-1, Ets-2, GABP alpha, Elf-1, and Fli-1. The different patterns of expression and protein-protein interactions of these different Ets family members undoubtedly contribute to their ability to specifically regulate distinct sets of T cell genes. However, previous studies have suggested that different Ets family members might also display distinct DNA binding specificities. In this report, we have examined the DNA binding characteristics of two Ets family members, Ets-1 and Elf-1, that are highly expressed in T cells. The results demonstrate that the minimal DNA binding domain of these proteins consists of adjacent basic and putative alpha-helical regions that are conserved in all of the known Ets family members. Both regions are required for DNA binding activity. In vitro binding studies demonstrated that Ets-1 and Elf-1 display distinct DNA binding specificities, and, thereby interact preferentially with different naturally occurring Ets binding sites. A comparison of known Ets binding sites identified three nucleotides at the 3' end of these sequences that control the differential binding of the Ets-1 and Elf-1 proteins. These results are consistent with a model in which different Ets family members regulate the expression of different T cell genes by binding preferentially to purine-rich sequences that share a GGA core motif, but contain distinct flanking sequences

  12. Transcriptional divergence and conservation of human and mouse erythropoiesis.


    Pishesha, Novalia; Thiru, Prathapan; Shi, Jiahai; Eng, Jennifer C; Sankaran, Vijay G; Lodish, Harvey F


    Mouse models have been used extensively for decades and have been instrumental in improving our understanding of mammalian erythropoiesis. Nonetheless, there are several examples of variation between human and mouse erythropoiesis. We performed a comparative global gene expression study using data from morphologically identical stage-matched sorted populations of human and mouse erythroid precursors from early to late erythroblasts. Induction and repression of major transcriptional regulators of erythropoiesis, as well as major erythroid-important proteins, are largely conserved between the species. In contrast, at a global level we identified a significant extent of divergence between the species, both at comparable stages and in the transitions between stages, especially for the 500 most highly expressed genes during development. This suggests that the response of multiple developmentally regulated genes to key erythroid transcriptional regulators represents an important modification that has occurred in the course of erythroid evolution. In developing a systematic framework to understand and study conservation and divergence between human and mouse erythropoiesis, we show how mouse models can fail to mimic specific human diseases and provide predictions for translating findings from mouse models to potential therapies for human disease.

  13. Prediction of synergistic transcription factors by function conservation

    PubMed Central

    Hu, Zihua; Hu, Boyu; Collins, James F


    Background Previous methods employed for the identification of synergistic transcription factors (TFs) are based on either TF enrichment from co-regulated genes or phylogenetic footprinting. Despite the success of these methods, both have limitations. Results We propose a new strategy to identify synergistic TFs by function conservation. Rather than aligning the regulatory sequences from orthologous genes and then identifying conserved TF binding sites (TFBSs) in the alignment, we developed computational approaches to implement the novel strategy. These methods include combinatorial TFBS enrichment utilizing distance constraints followed by enrichment of overlapping orthologous genes from human and mouse, whose regulatory sequences contain the enriched TFBS combinations. Subsequently, integration of function conservation from both TFBS and overlapping orthologous genes was achieved by correlation analyses. These techniques have been used for genome-wide promoter analyses, which have led to the identification of 51 homotypic TF combinations; the validity of these approaches has been exemplified by both known TF-TF interactions and function coherence analyses. We further provide computational evidence that our novel methods were able to identify synergistic TFs to a much greater extent than phylogenetic footprinting. Conclusion Function conservation based on the concordance of combinatorial TFBS enrichment along with enrichment of overlapping orthologous genes has been proven to be a successful means for the identification of synergistic TFs. This approach avoids the limitations of phylogenetic footprinting as it does not depend upon sequence alignment. It utilizes existing gene annotation data, such as those available in GO, thus providing an alternative method for functional TF discovery and annotation. PMID:18053230

  14. Evolutionarily Conserved Function of RRP36 in Early Cleavages of the Pre-rRNA and Production of the 40S Ribosomal Subunit ▿ †

    PubMed Central

    Gérus, Marie; Bonnart, Chrystelle; Caizergues-Ferrer, Michèle; Henry, Yves; Henras, Anthony K.


    Ribosome biogenesis in eukaryotes is a major cellular activity mobilizing the products of over 200 transcriptionally coregulated genes referred to as the rRNA and ribosome biosynthesis regulon. We investigated the function of an essential, uncharacterized gene of this regulon, renamed RRP36. We show that the Rrp36p protein is nucleolar and interacts with 90S and pre-40S preribosomal particles. Its depletion affects early cleavages of the 35S pre-rRNA and results in a rapid decrease in mature 18S rRNA levels. Rrp36p is a novel component of the 90S preribosome, the assembly of which has been suggested to result from the stepwise incorporation of several modules, including the tUTP/UTP-A, PWP2/UTP-B, and UTP-C subcomplexes. We show that Rrp36p depletion does not impair the incorporation of these subcomplexes and the U3 small nucleolar RNP into preribosomes. In contrast, depletion of components of the UTP-A or UTP-B modules, but not Rrp5p, prevents Rrp36p recruitment and reduces its accumulation levels. In parallel, we studied the human orthologue of Rrp36p in HeLa cells, and we show that the function of this protein in early cleavages of the pre-rRNA has been conserved through evolution in eukaryotes. PMID:20038530

  15. Insights from the cold transcriptome of Physcomitrella patens: global specialization pattern of conserved transcriptional regulators and identification of orphan genes involved in cold acclimation

    PubMed Central

    Beike, Anna K; Lang, Daniel; Zimmer, Andreas D; Wüst, Florian; Trautmann, Danika; Wiedemann, Gertrud; Beyer, Peter; Decker, Eva L; Reski, Ralf


    The whole-genome transcriptomic cold stress response of the moss Physcomitrella patens was analyzed and correlated with phenotypic and metabolic changes. Based on time-series microarray experiments and quantitative real-time polymerase chain reaction, we characterized the transcriptomic changes related to early stress signaling and the initiation of cold acclimation. Transcription-associated protein (TAP)-encoding genes of P. patens and Arabidopsis thaliana were classified using generalized linear models. Physiological responses were monitored with pulse-amplitude-modulated fluorometry, high-performance liquid chromatography and targeted high-performance mass spectrometry. The transcript levels of 3220 genes were significantly affected by cold. Comparative classification revealed a global specialization of TAP families, a transcript accumulation of transcriptional regulators of the stimulus/stress response and a transcript decline of developmental regulators. Although transcripts of the intermediate to later response are from evolutionarily conserved genes, the early response is dominated by species-specific genes. These orphan genes may encode as yet unknown acclimation processes. PMID:25209349

  16. Loneliness, eudaimonia, and the human conserved transcriptional response to adversity

    PubMed Central

    Cole, Steven W.; Levine, Morgan E.; Arevalo, Jesusa M. G.; Ma, Jeffrey; Weir, David R.; Crimmins, Eileen M.


    Background Chronic social adversity activates a conserved transcriptional response to adversity (CTRA) marked by increased expression of pro-inflammatory genes and decreased expression of antiviral- and antibody-related genes. Recent findings suggest that some psychological resilience factors may help buffer CTRA activation, but the relative impact of resilience and adversity factors remains poorly understood. Here we examined the relative strength of CTRA association for the two best-established psychological correlates of CTRA gene expression – the risk factor of perceived social isolation (loneliness) and the resilience factor of eudaimonic well-being (purpose and meaning in life). Methods Peripheral blood samples and validated measures of loneliness and eudaimonic well-being were analyzed in 108 community-dwelling older adults participating in the longitudinal US Health and Retirement Study (56% female, mean age 73). Mixed effect linear model analyses quantified the strength of association between CTRA gene expression and measures of loneliness and eudaimonic well-being in separate and joint analyses. Results As in previous studies, separate analyses found CTRA gene expression to be up-regulated in association with loneliness and down-regulated in association with eudaimonic well-being. In joint analyses, effects of loneliness were completely abrogated whereas eudaimonic well-being continued to associate with CTRA down-regulation. Similar eudaimonia-dominant effects were observed for positive and negative affect, optimism and pessimism, and anxiety symptoms. All results were independent of demographic and behavioral health risk factors. Conclusions Eudaimonic well-being may have the potential to compensate for the adverse impact of loneliness on CTRA gene expression. Findings suggest a novel approach to targeting the health risks associated with social isolation by promoting purpose and meaning in life. PMID:26246388

  17. Characterization of Drosophila GDNF Receptor-Like and Evidence for Its Evolutionarily Conserved Interaction with Neural Cell Adhesion Molecule (NCAM)/FasII

    PubMed Central

    Kallijärvi, Jukka; Stratoulias, Vassilis; Virtanen, Kristel; Hietakangas, Ville; Heino, Tapio I.; Saarma, Mart


    Background Glial cell line-derived neurotrophic factor (GDNF) family ligands are secreted growth factors distantly related to the TGF-β superfamily. In mammals, they bind to the GDNF family receptor α (Gfrα) and signal through the Ret receptor tyrosine kinase. In order to gain insight into the evolution of the Ret-Gfr-Gdnf signaling system, we have cloned and characterized the first invertebrate Gfr-like cDNA (DmGfrl) from Drosophila melanogaster and generated a DmGfrl mutant allele. Results We found that DmGfrl encodes a large GPI-anchored membrane protein with four GFR-like domains. In line with the fact that insects lack GDNF ligands, DmGfrl mediated neither Drosophila Ret phosphorylation nor mammalian RET phosphorylation. In situ hybridization analysis revealed that DmGfrl is expressed in the central and peripheral nervous systems throughout Drosophila development, but, surprisingly, DmGfrl and DmRet expression patterns were largely non-overlapping. We generated a DmGfrl null allele by genomic FLP deletion and found that both DmGfrl null females and males are viable but display fertility defects. The female fertility defect manifested as dorsal appendage malformation, small size and reduced viability of eggs laid by mutant females. In male flies DmGfrl interacted genetically with the Drosophila Ncam (neural cell adhesion molecule) homolog FasII to regulate fertility. Conclusion Our results suggest that Ret and Gfrl did not function as an in cis receptor-coreceptor pair before the emergence of GDNF family ligands, and that the Ncam-Gfr interaction predated the in cis Ret-Gfr interaction in evolution. The fertility defects that we describe in DmGfrl null flies suggest that GDNF receptor-like has an evolutionarily ancient role in regulating male fertility and a previously unrecognized role in regulating oogenesis. Significance These results shed light on the evolutionary aspects of the structure, expression and function of Ret-Gfrα and Ncam-Gfrα signaling

  18. Drosophila melanogaster Hox Transcription Factors Access the RNA Polymerase II Machinery through Direct Homeodomain Binding to a Conserved Motif of Mediator Subunit Med19

    PubMed Central

    Boube, Muriel; Hudry, Bruno; Immarigeon, Clément; Carrier, Yannick; Bernat-Fabre, Sandra; Merabet, Samir; Graba, Yacine; Bourbon, Henri-Marc; Cribbs, David L.


    Hox genes in species across the metazoa encode transcription factors (TFs) containing highly-conserved homeodomains that bind target DNA sequences to regulate batteries of developmental target genes. DNA-bound Hox proteins, together with other TF partners, induce an appropriate transcriptional response by RNA Polymerase II (PolII) and its associated general transcription factors. How the evolutionarily conserved Hox TFs interface with this general machinery to generate finely regulated transcriptional responses remains obscure. One major component of the PolII machinery, the Mediator (MED) transcription complex, is composed of roughly 30 protein subunits organized in modules that bridge the PolII enzyme to DNA-bound TFs. Here, we investigate the physical and functional interplay between Drosophila melanogaster Hox developmental TFs and MED complex proteins. We find that the Med19 subunit directly binds Hox homeodomains, in vitro and in vivo. Loss-of-function Med19 mutations act as dose-sensitive genetic modifiers that synergistically modulate Hox-directed developmental outcomes. Using clonal analysis, we identify a role for Med19 in Hox-dependent target gene activation. We identify a conserved, animal-specific motif that is required for Med19 homeodomain binding, and for activation of a specific Ultrabithorax target. These results provide the first direct molecular link between Hox homeodomain proteins and the general PolII machinery. They support a role for Med19 as a PolII holoenzyme-embedded “co-factor” that acts together with Hox proteins through their homeodomains in regulated developmental transcription. PMID:24786462

  19. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.


    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  20. Conservation of AtTZF1, AtTZF2, and AtTZF3 homolog gene regulation by salt stress in evolutionarily distant plant species

    PubMed Central

    D’Orso, Fabio; De Leonardis, Anna M.; Salvi, Sergio; Gadaleta, Agata; Ruberti, Ida; Cattivelli, Luigi; Morelli, Giorgio; Mastrangelo, Anna M.


    Arginine-rich tandem zinc-finger proteins (RR-TZF) participate in a wide range of plant developmental processes and adaptive responses to abiotic stress, such as cold, salt, and drought. This study investigates the conservation of the genes AtTZF1-5 at the level of their sequences and expression across plant species. The genomic sequences of the two RR-TZF genes TdTZF1-A and TdTZF1-B were isolated in durum wheat and assigned to chromosomes 3A and 3B, respectively. Sequence comparisons revealed that they encode proteins that are highly homologous to AtTZF1, AtTZF2, and AtTZF3. The expression profiles of these RR-TZF durum wheat and Arabidopsis proteins support a common function in the regulation of seed germination and responses to abiotic stress. In particular, analysis of plants with attenuated and overexpressed AtTZF3 indicate that AtTZF3 is a negative regulator of seed germination under conditions of salt stress. Finally, comparative sequence analyses establish that the RR-TZF genes are encoded by lower plants, including the bryophyte Physcomitrella patens and the alga Chlamydomonas reinhardtii. The regulation of the Physcomitrella AtTZF1-2-3-like genes by salt stress strongly suggests that a subgroup of the RR-TZF proteins has a function that has been conserved throughout evolution. PMID:26136754

  1. Identification of proliferation-induced genes in Arabidopsis thaliana. Characterization of a new member of the highly evolutionarily conserved histone H2A.F/Z variant subfamily.

    PubMed Central

    Callard, D; Mazzolini, L


    The changes in gene expression associated with the reinitiation of cell division and subsequent progression through the cell cycle in Arabidopsis thaliana cell-suspension cultures were investigated. Partial synchronization of cells was achieved by a technique combining phosphate starvation and a transient treatment with the DNA replication inhibitor aphidicolin. Six cDNAs corresponding to genes highly induced in proliferating cells and showing cell-cycle-regulated expression were obtained by the mRNA differential display technique. Full-length cDNA clones (cH2BAt and cH2AvAt) corresponding to two of the display products were subsequently isolated. The cH2BAt clone codes for a novel histone H2B protein, whereas the cH2AvAt cDNA corresponds to a gene encoding a new member of the highly conserved histone H2A.F/Z subfamily of chromosomal proteins. Further studies indicated that H2AvAt mRNA expression is tightly correlated with cell proliferation in cell-suspension cultures, and that closely related analogs of the encoded protein exist in Arabidopsis. The implications of the conservation of histone H2A.F/Z variants in plants are discussed. PMID:9414552

  2. Evolutionarily conserved organization of the dopaminergic system in lamprey: SNc/VTA afferent and efferent connectivity and D2 receptor expression.


    Pérez-Fernández, Juan; Stephenson-Jones, Marcus; Suryanarayana, Shreyas M; Robertson, Brita; Grillner, Sten


    The dopaminergic system influences motor behavior, signals reward and novelty, and is an essential component of the basal ganglia in all vertebrates including the lamprey, one of the phylogenetically oldest vertebrates. The intrinsic organization and function of the lamprey basal ganglia is highly conserved. For instance, the direct and indirect pathways are modulated through dopamine D1 and D2 receptors in lamprey and in mammals. The nucleus of the tuberculum posterior, a homologue of the substantia nigra pars compacta (SNc)/ventral tegmental area (VTA) is present in lamprey, but only scarce data exist about its connectivity. Likewise, the D2 receptor is expressed in the striatum, but little is known about its localization in other brain areas. We used in situ hybridization and tracer injections, both in combination with tyrosine hydroxylase immunohistochemistry, to characterize the SNc/VTA efferent and afferent connectivity, and to relate its projection pattern with D2 receptor expression in particular. We show that most features of the dopaminergic system are highly conserved. As in mammals, the direct pallial (cortex in mammals) input and the basal ganglia connectivity with the SNc/VTA are present as part of the evaluation system, as well as input from the tectum as the evolutionary basis for salience/novelty detection. Moreover, the SNc/VTA receives sensory information from the olfactory bulbs, optic tectum, octavolateral area, and dorsal column nucleus, and it innervates, apart from the nigrostriatal pathway, several motor-related areas. This suggests that the dopaminergic system also contributes to the control of different motor centers at the brainstem level.

  3. Chicken T-cell receptor beta-chain diversity: an evolutionarily conserved D beta-encoded glycine turn within the hypervariable CDR3 domain.

    PubMed Central

    McCormack, W T; Tjoelker, L W; Stella, G; Postema, C E; Thompson, C B


    Unlike mammals, chickens generate an immunoglobulin (Ig) repertoire by a developmentally regulated process of intrachromosomal gene conversion, which results in nucleotide substitutions throughout the variable regions of the Ig heavy- and light-chain genes. In contrast to chicken Ig genes, we show in this report that diversity of the rearranged chicken T-cell receptor (TCR) beta-chain gene is generated by junctional heterogeneity, as observed in rearranged mammalian TCR genes. This junctional diversity increases during chicken development as a result of an increasing base-pair addition at the V beta-D beta and D beta-J beta joints (where V, D, and J are the variable, diversity, and joining gene segments). Despite the junctional hypervariability, however, almost all functional V beta-D beta-J beta junctions appear to encode a glycine-containing beta-turn. Such a turn may serve to position the amino acid side chains of a hypervariable TCR beta-chain loop with respect to the antigen-binding groove of the major histocompatibility complex molecule. Consistent with this hypothesis, the germ-line D beta nucleotide sequences of chickens, mice, rabbits, and humans have been highly conserved and encode a glycine in all three reading frames. Images PMID:1652759

  4. Two-ligand priming mechanism for potentiated phosphoinositide synthesis is an evolutionarily conserved feature of Sec14-like phosphatidylinositol and phosphatidylcholine exchange proteins

    PubMed Central

    Huang, Jin; Ghosh, Ratna; Tripathi, Ashutosh; Lönnfors, Max; Somerharju, Pentti; Bankaitis, Vytas A.


    Lipid signaling, particularly phosphoinositide signaling, plays a key role in regulating the extreme polarized membrane growth that drives root hair development in plants. The Arabidopsis AtSFH1 gene encodes a two-domain protein with an amino-terminal Sec14-like phosphatidylinositol transfer protein (PITP) domain linked to a carboxy-terminal nodulin domain. AtSfh1 is critical for promoting the spatially highly organized phosphatidylinositol-4,5-bisphosphate signaling program required for establishment and maintenance of polarized root hair growth. Here we demonstrate that, like the yeast Sec14, the AtSfh1 PITP domain requires both its phosphatidylinositol (PtdIns)- and phosphatidylcholine (PtdCho)-binding properties to stimulate PtdIns-4-phosphate [PtdIns(4)P] synthesis. Moreover, we show that both phospholipid-binding activities are essential for AtSfh1 activity in supporting polarized root hair growth. Finally, we report genetic and biochemical evidence that the two-ligand mechanism for potentiation of PtdIns 4-OH kinase activity is a broadly conserved feature of plant Sec14-nodulin proteins, and that this strategy appeared only late in plant evolution. Taken together, the data indicate that the PtdIns/PtdCho-exchange mechanism for stimulated PtdIns(4)P synthesis either arose independently during evolution in yeast and in higher plants, or a suitable genetic module was introduced to higher plants from a fungal source and subsequently exploited by them. PMID:27193303

  5. Conservation of Male Sterility 2 function during spore and pollen wall development supports an evolutionarily early recruitment of a core component in the sporopollenin biosynthetic pathway.


    Wallace, Simon; Chater, Caspar C; Kamisugi, Yasuko; Cuming, Andrew C; Wellman, Charles H; Beerling, David J; Fleming, Andrew J


    The early evolution of plants required the acquisition of a number of key adaptations to overcome physiological difficulties associated with survival on land. One of these was a tough sporopollenin wall that enclosed reproductive propagules and provided protection from desiccation and UV-B radiation. All land plants possess such walled spores (or their derived homologue, pollen). We took a reverse genetics approach, consisting of knock-out and complementation experiments to test the functional conservation of the sporopollenin-associated gene MALE STERILTY 2 (which is essential for pollen wall development in Arabidopsis thaliana) in the bryophyte Physcomitrella patens. Knock-outs of a putative moss homologue of the A. thaliana MS2 gene, which is highly expressed in the moss sporophyte, led to spores with highly defective walls comparable to that observed in the A. thaliana ms2 mutant, and extremely compromised germination. Conversely, the moss MS2 gene could not rescue the A. thaliana ms2 phenotype. The results presented here suggest that a core component of the biochemical and developmental pathway required for angiosperm pollen wall development was recruited early in land plant evolution but the continued increase in pollen wall complexity observed in angiosperms has been accompanied by divergence in MS2 gene function.

  6. Expression of human Cfdp1 gene in Drosophila reveals new insights into the function of the evolutionarily conserved BCNT protein family

    PubMed Central

    Messina, Giovanni; Atterrato, Maria Teresa; Fanti, Laura; Giordano, Ennio; Dimitri, Patrizio


    The Bucentaur (BCNT) protein family is widely distributed in eukaryotes and is characterized by a highly conserved C-terminal domain. This family was identified two decades ago in ruminants, but its role(s) remained largely unknown. Investigating cellular functions and mechanism of action of BCNT proteins is challenging, because they have been implicated in human craniofacial development. Recently, we found that YETI, the D. melanogaster BCNT, is a chromatin factor that participates to H2A.V deposition. Here we report the effects of in vivo expression of CFDP1, the human BCNT protein, in Drosophila melanogaster. We show that CFDP1, similarly to YETI, binds to chromatin and its expression results in a wide range of abnormalities highly reminiscent of those observed in Yeti null mutants. This indicates that CFDP1 expressed in flies behaves in a dominant negative fashion disrupting the YETI function. Moreover, GST pull-down provides evidence indicating that 1) both YETI and CFDP1 undergo homodimerization and 2) YETI and CFDP1 physically interact each other by forming inactive heterodimers that would trigger the observed dominant-negative effect. Overall, our findings highlight unanticipated evidences suggesting that homodimerization mediated by the BCNT domain is integral to the chromatin functions of BCNT proteins. PMID:27151176

  7. Strigolactone biosynthesis is evolutionarily conserved, regulated by phosphate starvation and contributes to resistance against phytopathogenic fungi in a moss, Physcomitrella patens.


    Decker, Eva L; Alder, Adrian; Hunn, Stefan; Ferguson, Jenny; Lehtonen, Mikko T; Scheler, Bjoern; Kerres, Klaus L; Wiedemann, Gertrud; Safavi-Rizi, Vajiheh; Nordzieke, Steffen; Balakrishna, Aparna; Baz, Lina; Avalos, Javier; Valkonen, Jari P T; Reski, Ralf; Al-Babili, Salim


    In seed plants, strigolactones (SLs) regulate architecture and induce mycorrhizal symbiosis in response to environmental cues. SLs are formed by combined activity of the carotenoid cleavage dioxygenases (CCDs) 7 and 8 from 9-cis-β-carotene, leading to carlactone that is converted by cytochromes P450 (clade 711; MAX1 in Arabidopsis) into various SLs. As Physcomitrella patens possesses CCD7 and CCD8 homologs but lacks MAX1, we investigated if PpCCD7 together with PpCCD8 form carlactone and how deletion of these enzymes influences growth and interactions with the environment. We investigated the enzymatic activity of PpCCD7 and PpCCD8 in vitro, identified the formed products by high performance liquid chromatography (HPLC) and LC-MS, and generated and analysed ΔCCD7 and ΔCCD8 mutants. We defined enzymatic activity of PpCCD7 as a stereospecific 9-cis-CCD and PpCCD8 as a carlactone synthase. ΔCCD7 and ΔCCD8 lines showed enhanced caulonema growth, which was revertible by adding the SL analogue GR24 or carlactone. Wild-type (WT) exudates induced seed germination in Orobanche ramosa. This activity was increased upon phosphate starvation and abolished in exudates of both mutants. Furthermore, both mutants showed increased susceptibility to phytopathogenic fungi. Our study reveals the deep evolutionary conservation of SL biosynthesis, SL function, and its regulation by biotic and abiotic cues.

  8. An evolutionarily conserved interaction of tumor suppressor protein Pdcd4 with the poly(A)-binding protein contributes to translation suppression by Pdcd4.


    Fehler, Olesja; Singh, Priyanka; Haas, Astrid; Ulrich, Diana; Müller, Jan P; Ohnheiser, Johanna; Klempnauer, Karl-Heinz


    The tumor suppressor protein programmed cell death 4 (Pdcd4) has been implicated in the translational regulation of specific mRNAs, however, the identities of the natural Pdcd4 target mRNAs and the mechanisms by which Pdcd4 affects their translation are not well understood. Pdcd4 binds to the eukaryotic translation initiation factor eIF4A and inhibits its helicase activity, which has suggested that Pdcd4 suppresses translation initiation of mRNAs containing structured 5'-untranslated regions. Recent work has revealed a second inhibitory mechanism, which is eIF4A-independent and involves direct RNA-binding of Pdcd4 to the target mRNAs. We have now identified the poly(A)-binding protein (PABP) as a novel direct interaction partner of Pdcd4. The ability to interact with PABP is shared between human and Drosophila Pdcd4, indicating that it has been highly conserved during evolution. Mutants of Pdcd4 that have lost the ability to interact with PABP fail to stably associate with ribosomal complexes in sucrose density gradients and to suppress translation, as exemplified by c-myb mRNA. Overall, our work identifies PABP as a novel functionally relevant Pdcd4 interaction partner that contributes to the regulation of translation by Pdcd4.

  9. Evolutionarily conserved regulatory mechanisms of abscisic acid signaling in land plants: characterization of ABSCISIC ACID INSENSITIVE1-like type 2C protein phosphatase in the liverwort Marchantia polymorpha.


    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke


    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the beta -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts.

  10. Profiling of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolutionarily conserved network of aspartic and cysteine peptidases

    PubMed Central

    Sojka, Daniel; Franta, Zdeněk; Horn, Martin; Hajdušek, Ondřej; Caffrey, Conor R; Mareš, Michael; Kopáček, Petr


    Background Ticks are vectors for a variety of viral, bacterial and parasitic diseases in human and domestic animals. To survive and reproduce ticks feed on host blood, yet our understanding of the intestinal proteolytic machinery used to derive absorbable nutrients from the blood meal is poor. Intestinal digestive processes are limiting factors for pathogen transmission since the tick gut presents the primary site of infection. Moreover, digestive enzymes may find practical application as anti-tick vaccine targets. Results Using the hard tick, Ixodes ricinus, we performed a functional activity scan of the peptidase complement in gut tissue extracts that demonstrated the presence of five types of peptidases of the cysteine and aspartic classes. We followed up with genetic screens of gut-derived cDNA to identify and clone genes encoding the cysteine peptidases cathepsins B, L and C, an asparaginyl endopeptidase (legumain), and the aspartic peptidase, cathepsin D. By RT-PCR, expression of asparaginyl endopeptidase and cathepsins B and D was restricted to gut tissue and to those developmental stages feeding on blood. Conclusion Overall, our results demonstrate the presence of a network of cysteine and aspartic peptidases that conceivably operates to digest host blood proteins in a concerted manner. Significantly, the peptidase components of this digestive network are orthologous to those described in other parasites, including nematodes and flatworms. Accordingly, the present data and those available for other tick species support the notion of an evolutionary conservation of a cysteine/aspartic peptidase system for digestion that includes ticks, but differs from that of insects relying on serine peptidases. PMID:18348719

  11. C13C4.5/Spinster, an evolutionarily conserved protein that regulates fertility in C. elegans through a lysosome-mediated lipid metabolism process.


    Han, Mei; Chang, Hao; Zhang, Peng; Chen, Tao; Zhao, Yanhua; Zhang, Yongdeng; Liu, Pingsheng; Xu, Tao; Xu, Pingyong


    Lipid droplets, which are conserved across almost all species, are cytoplasmic organelles used to store neutral lipids. Identification of lipid droplet regulators will be conducive to resolving obesity and other fat-associated diseases. In this paper, we selected 11 candidates that might be associated with lipid metabolism in Caenorhabditis elegans. Using a BODIPY 493/503-based flow cytometry screen, 6 negative and 3 positive regulators of fat content were identified. We selected one negative regulator of lipid content, C13C4.5, for future study. C13C4.5 was mainly expressed in the worm intestine. We found that this gene was important for maintaining the metabolism of lipid droplets. Biochemical results revealed that 50% of triacylglycerol (TAG) was lost in C13C4.5 knockout worms. Stimulated Raman scattering (SRS) signals in C13C4.5 mutants showed only 49.6% of the fat content in the proximal intestinal region and 86.3% in the distal intestinal region compared with wild type animals. The mean values of lipid droplet size and intensity in C13C4.5 knockout animals were found to be significantly decreased compared with those in wild type worms. The LMP-1-labeled membrane structures in worm intestines were also enlarged in C13C4.5 mutant animals. Finally, fertility defects were found in C13C4.5(ok2087) mutants. Taken together, these results indicate that C13C4.5 may regulate the fertility of C. elegans by changing the size and fat content of lipid droplets by interfering with lysosomal morphology and function.

  12. The Human Arp2/3 Complex Is Composed of Evolutionarily Conserved Subunits and Is Localized to Cellular Regions of Dynamic Actin Filament Assembly

    PubMed Central

    Welch, Matthew D.; DePace, Angela H.; Verma, Suzie; Iwamatsu, Akihiro; Mitchison, Timothy J.


    The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells. The human complex consists of seven subunits which include the actin related proteins Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc (Arp complex). We have determined the predicted amino acid sequence of all seven subunits. Each has homologues in diverse eukaryotes, implying that the structure and function of the complex has been conserved through evolution. Human Arp2 and Arp3 are very similar to family members from other species. p41-Arc is a new member of the Sop2 family of WD (tryptophan and aspartate) repeat–containing proteins and may be posttranslationally modified, suggesting that it may be involved in regulating the activity and/or localization of the complex. p34-Arc, p21-Arc, p20-Arc, and p16-Arc define novel protein families. We sought to evaluate the function of the Arp2/3 complex in cells by determining its intracellular distribution. Arp3, p34-Arc, and p21-Arc were localized to the lamellipodia of stationary and locomoting fibroblasts, as well to Listeria monocytogenes assembled actin tails. They were not detected in cellular bundles of actin filaments. Taken together with the ability of the Arp2/3 complex to induce actin polymerization, these observations suggest that the complex promotes actin assembly in lamellipodia and may participate in lamellipodial protrusion. PMID:9230079

  13. The human Arp2/3 complex is composed of evolutionarily conserved subunits and is localized to cellular regions of dynamic actin filament assembly.


    Welch, M D; DePace, A H; Verma, S; Iwamatsu, A; Mitchison, T J


    The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells. The human complex consists of seven subunits which include the actin related proteins Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc (p omplex). We have determined the predicted amino acid sequence of all seven subunits. Each has homologues in diverse eukaryotes, implying that the structure and function of the complex has been conserved through evolution. Human Arp2 and Arp3 are very similar to family members from other species. p41-Arc is a new member of the Sop2 family of WD (tryptophan and aspartate) repeat-containing proteins and may be posttranslationally modified, suggesting that it may be involved in regulating the activity and/or localization of the complex. p34-Arc, p21-Arc, p20-Arc, and p16-Arc define novel protein families. We sought to evaluate the function of the Arp2/3 complex in cells by determining its intracellular distribution. Arp3, p34-Arc, and p21-Arc were localized to the lamellipodia of stationary and locomoting fibroblasts, as well to Listeria monocytogenes assembled actin tails. They were not detected in cellular bundles of actin filaments. Taken together with the ability of the Arp2/3 complex to induce actin polymerization, these observations suggest that the complex promotes actin assembly in lamellipodia and may participate in lamellipodial protrusion.

  14. Conservation of Transcription Start Sites within Genes across a Bacterial Genus

    SciTech Connect

    Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.; Romine, Margaret F.; Arkin, Adam P.


    Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved. Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.

  15. Evolutionarily conserved IMPACT impairs various stress responses that require GCN1 for activating the eIF2 kinase GCN2

    SciTech Connect

    Cambiaghi, Tavane D.; Pereira, Catia M.; Shanmugam, Renuka; Bolech, Michael; Wek, Ronald C.; Sattlegger, Evelyn; Castilho, Beatriz A.


    Highlights: •GCN1 is required for mammalian and yeast GCN2 function in a variety of conditions. •Mammalian IMPACT competes with GCN2 for GCN1 binding. •IMPACT and its yeast counterpart YIH1 downregulate GCN1-dependent GCN2 activation. -- Abstract: In response to a range of environmental stresses, phosphorylation of the alpha subunit of the translation initiation factor 2 (eIF2α) represses general protein synthesis coincident with increased translation of specific mRNAs, such as those encoding the transcription activators GCN4 and ATF4. The eIF2α kinase GCN2 is activated by amino acid starvation by a mechanism involving GCN2 binding to an activator protein GCN1, along with association with uncharged tRNA that accumulates during nutrient deprivation. We previously showed that mammalian IMPACT and its yeast ortholog YIH1 bind to GCN1, thereby preventing GCN1 association with GCN2 and stimulation of this eIF2α kinase during amino acid depletion. GCN2 activity is also enhanced by other stresses, including proteasome inhibition, UV irradiation and lack of glucose. Here, we provide evidence that IMPACT affects directly and specifically the activation of GCN2 under these stress conditions in mammalian cells. We show that activation of mammalian GCN2 requires its interaction with GCN1 and that IMPACT promotes the dissolution of the GCN2–GCN1 complex. To a similar extent as the overexpression of YIH1, overexpression of IMPACT in yeast cells inhibited growth under all stress conditions that require GCN2 and GCN1 for cell survival, including exposure to acetic acid, high levels of NaCl, H{sub 2}O{sub 2} or benomyl. This study extends our understanding of the roles played by GCN1 in GCN2 activation induced by a variety of stress arrangements and suggests that IMPACT and YIH1 use similar mechanisms for regulating this eIF2α kinase.

  16. Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated

    PubMed Central


    Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS") but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) not to be biological transcription factor binding sites ("empirical TFBS"). We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation. PMID:20875111

  17. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes.


    Fujiwara, Nana; Cave, John W


    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord.

  18. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes

    PubMed Central

    Fujiwara, Nana; Cave, John W.


    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord. PMID:27489533

  19. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    DOE Data Explorer

    Loots, Gabriela G. [LLNL; Ovcharenko, I. [LLNL

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. This database of evolutionary conserved regions (ECRs) in vertebrate genomes features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a comprehensive collection of promoters in all vertebrate genomes generated using multiple sources of gene annotation. The database also contains a collection of annotated transcription factor binding sites (TFBSs) in evolutionary conserved and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and fugu genomes. (taken from paper in Journal: Bioinformatics, November 7, 2006, pp. 122-124

  20. Analysis of gene order conservation in eukaryotes identifies transcriptionally and functionally linked genes.


    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore


    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control.

  1. Analysis of Gene Order Conservation in Eukaryotes Identifies Transcriptionally and Functionally Linked Genes

    PubMed Central

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore


    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control. PMID:20498846

  2. Implementation of meiosis prophase I programme requires a conserved retinoid-independent stabilizer of meiotic transcripts

    PubMed Central

    Abby, Emilie; Tourpin, Sophie; Ribeiro, Jonathan; Daniel, Katrin; Messiaen, Sébastien; Moison, Delphine; Guerquin, Justine; Gaillard, Jean-Charles; Armengaud, Jean; Langa, Francina; Toth, Attila; Martini, Emmanuelle; Livera, Gabriel


    Sexual reproduction is crucially dependent on meiosis, a conserved, specialized cell division programme that is essential for the production of haploid gametes. Here we demonstrate that fertility and the implementation of the meiotic programme require a previously uncharacterized meiosis-specific protein, MEIOC. Meioc invalidation in mice induces early and pleiotropic meiotic defects in males and females. MEIOC prevents meiotic transcript degradation and interacts with an RNA helicase that binds numerous meiotic mRNAs. Our results indicate that proper engagement into meiosis necessitates the specific stabilization of meiotic transcripts, a previously little-appreciated feature in mammals. Remarkably, the upregulation of MEIOC at the onset of meiosis does not require retinoic acid and STRA8 signalling. Thus, we propose that the complete induction of the meiotic programme requires both retinoic acid-dependent and -independent mechanisms. The latter process involving post-transcriptional regulation likely represents an ancestral mechanism, given that MEIOC homologues are conserved throughout multicellular animals. PMID:26742488

  3. Assignment of human myocyte-specific enhancer binding factor 2C (hMEF2C) to human chromosome 5q14 and evidence that MEF2C is evolutionarily conserved

    SciTech Connect

    Krainc, D.; Lipton, S.A.; Haas, M.; Ward, D.C.


    Human myocyte-specific enhancer binding factor 2C (hMEF2C) belongs to the MEF2 subfamily of the MADS (MCM1, AGAMOUS, DEF A, serum response factor) family of transcription factors. Members of the MADS family share a conserved domain - the MADS domain - that is necessary for DNA binding. Highly conserved versions of the MADS domain and of an adjacent domain that is known as the MEF2 domain are found in members of the MEF2 subfamily. Both of these domains are necessary for binding to the MEF2 regulatory element. This regulatory element is known to be functionally important in a variety of muscle-specific genes and possibly in the brain creatine kinase gene. The MEF2C gene product activates transcription by binding to the MEF2 element. hMEF2C is expressed at high levels in postmitotic neurons in the brain, where it is most abundant in the cerebral cortex, and is also expressed in differentiated myotubes. Several lines of evidence suggest the existence of a rat homologue of MEF2C, and a mouse homologue has been cloned. The mouse gene was mapped to mouse chromosome 13 in a region that is syntenic to human 5q13-q15. 12 refs., 1 fig.

  4. A conserved heptamer motif for ribosomal RNA transcription termination in animal mitochondria.

    PubMed Central

    Valverde, J R; Marco, R; Garesse, R


    A search of sequence data bases for a tridecamer transcription termination signal, previously described in human mtDNA as being responsible for the accumulation of mitochondrial ribosomal RNAs (rRNAs) in excess over the rest of mitochondrial genes, has revealed that this termination signal occurs in equivalent positions in a wide variety of organisms from protozoa to mammals. Due to the compact organization of the mtDNA, the tridecamer motif usually appears as part of the 3' adjacent gene sequence. Because in phylogenetically widely separated organisms the mitochondrial genome has experienced many rearrangements, it is interesting that its occurrence near the 3' end of the large rRNA is independent of the adjacent gene. The tridecamer sequence has diverged in phylogenetically widely separated organisms. Nevertheless, a well-conserved heptamer--TGGCAGA, the mitochondrial rRNA termination box--can be defined. Although extending the experimental evidence of its role as a transcription termination signal in humans will be of great interest, its evolutionary conservation strongly suggests that mitochondrial rRNA transcription termination could be a widely conserved mechanism in animals. Furthermore, the conservation of a homologous tridecamer motif in one of the last 3' secondary loops of nonmitochondrial 23S-like rRNAs suggests that the role of the sequence has changed during mitochondrial evolution. PMID:7515499

  5. Nuclear pore proteins regulate chromatin structure and transcriptional memory by a conserved mechanism.


    Light, William H; Brickner, Jason H


    Previous experience alters the rate of transcriptional induction of many genes in yeast and this phenomenon persists through several cell division cycles. This phenomenon is called epigenetic transcriptional memory. For the yeast gene INO1, transcriptional memory requires a physical interaction with the nuclear pore complex (NPC) and changes in the chromatin structure of the promoter. These changes lead to binding of a preinitiation form of RNA Polymerase II (RNAPII) to the INO1 promoter, bypassing the need to recruit RNAPII to the promoter during reactivation. In our recent study, we found that in human cells, hundreds of interferon-γ responsive genes exhibit a mechanistically similar form of transcriptional memory. Transcriptional memory requires a homologous nuclear pore protein in yeast and humans, which interacts with the promoters of genes that exhibit transcriptional memory and promotes both alteration of chromatin structure and binding of RNAPII. Whereas the interaction of yeast genes with nuclear pore proteins occurs at the NPC, the interaction of human genes with nuclear pore proteins occurs in the nucleoplasm. Thus, the interaction of nuclear pore proteins with genes plays an important and conserved role in affecting long-term epigenetic changes in transcriptional regulation.

  6. Sense-antisense gene pairs: sequence, transcription, and structure are not conserved between human and mouse

    PubMed Central

    Wood, Emily J.; Chin-Inmanu, Kwanrutai; Jia, Hui; Lipovich, Leonard


    Previous efforts to characterize conservation between the human and mouse genomes focused largely on sequence comparisons. These studies are inherently limited because they don't account for gene structure differences, which may exist despite genomic sequence conservation. Recent high-throughput transcriptome studies have revealed widespread and extensive overlaps between genes, and transcripts, encoded on both strands of the genomic sequence. This overlapping gene organization, which produces sense-antisense (SAS) gene pairs, is capable of effecting regulatory cascades through established mechanisms. We present an evolutionary conservation assessment of SAS pairs, on three levels: genomic, transcriptomic, and structural. From a genome-wide dataset of human SAS pairs, we first identified orthologous loci in the mouse genome, then assessed their transcription in the mouse, and finally compared the genomic structures of SAS pairs expressed in both species. We found that approximately half of human SAS loci have single orthologous locations in the mouse genome; however, only half of those orthologous locations have SAS transcriptional activity in the mouse. This suggests that high human-mouse gene conservation overlooks widespread distinctions in SAS pair incidence and expression. We compared gene structures at orthologous SAS loci, finding frequent differences in gene structure between human and orthologous mouse SAS pair members. Our categorization of human SAS pairs with respect to mouse conservation of expression as well as structure points to limitations of mouse models. Gene structure differences, including at SAS loci, may account for some of the phenotypic distinctions between primates and rodents. Genes in non-conserved SAS pairs may contribute to evolutionary lineage-specific regulatory outcomes. PMID:24133500

  7. Fox transcription factors: from development to disease.


    Golson, Maria L; Kaestner, Klaus H


    Forkhead box (Fox) transcription factors are evolutionarily conserved in organisms ranging from yeast to humans. They regulate diverse biological processes both during development and throughout adult life. Mutations in many Fox genes are associated with human disease and, as such, various animal models have been generated to study the function of these transcription factors in mechanistic detail. In many cases, the absence of even a single Fox transcription factor is lethal. In this Primer, we provide an overview of the Fox family, highlighting several key Fox transcription factor families that are important for mammalian development.

  8. The transcription factor Spn1 regulates gene expression via a highly conserved novel structural motif.


    Pujari, Venugopal; Radebaugh, Catherine A; Chodaparambil, Jayanth V; Muthurajan, Uma M; Almeida, Adam R; Fischbeck, Julie A; Luger, Karolin; Stargell, Laurie A


    Spn1/Iws1 plays essential roles in the regulation of gene expression by RNA polymerase II (RNAPII), and it is highly conserved in organisms ranging from yeast to humans. Spn1 physically and/or genetically interacts with RNAPII, TBP (TATA-binding protein), TFIIS (transcription factor IIS), and a number of chromatin remodeling factors (Swi/Snf and Spt6). The central domain of Spn1 (residues 141-305 out of 410) is necessary and sufficient for performing the essential functions of SPN1 in yeast cells. Here, we report the high-resolution (1.85 Å) crystal structure of the conserved central domain of Saccharomyces cerevisiae Spn1. The central domain is composed of eight α-helices in a right-handed superhelical arrangement and exhibits structural similarity to domain I of TFIIS. A unique structural feature of Spn1 is a highly conserved loop, which defines one side of a pronounced cavity. The loop and the other residues forming the cavity are highly conserved at the amino acid level among all Spn1 family members, suggesting that this is a signature motif for Spn1 orthologs. The locations and the molecular characterization of temperature-sensitive mutations in Spn1 indicate that the cavity is a key attribute of Spn1 that is critical for its regulatory functions during RNAPII-mediated transcriptional activity.

  9. The conserved protein Seb1 drives transcription termination by binding RNA polymerase II and nascent RNA.


    Wittmann, Sina; Renner, Max; Watts, Beth R; Adams, Oliver; Huseyin, Miles; Baejen, Carlo; El Omari, Kamel; Kilchert, Cornelia; Heo, Dong-Hyuk; Kecman, Tea; Cramer, Patrick; Grimes, Jonathan M; Vasiljeva, Lidia


    Termination of RNA polymerase II (Pol II) transcription is an important step in the transcription cycle, which involves the dislodgement of polymerase from DNA, leading to release of a functional transcript. Recent studies have identified the key players required for this process and showed that a common feature of these proteins is a conserved domain that interacts with the phosphorylated C-terminus of Pol II (CTD-interacting domain, CID). However, the mechanism by which transcription termination is achieved is not understood. Using genome-wide methods, here we show that the fission yeast CID-protein Seb1 is essential for termination of protein-coding and non-coding genes through interaction with S2-phosphorylated Pol II and nascent RNA. Furthermore, we present the crystal structures of the Seb1 CTD- and RNA-binding modules. Unexpectedly, the latter reveals an intertwined two-domain arrangement of a canonical RRM and second domain. These results provide important insights into the mechanism underlying eukaryotic transcription termination.

  10. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast.


    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon


    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeast Schizosaccharomyces pombe Genome-wide studies of the Crz1 and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2 and tunicamycin treatment, as well as a ∆pmr1 genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of the Saccharomyces cerevisiae ortholog Crz1 These genes were functionally enriched for Crz1-conserved processes such as cell-wall biosynthesis. Overexpression of prz1(+)increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of theO-mannosyltransferase encoding gene omh1(+) Loss of omh1(+)abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss of prz1(+)resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the ∆prz1 strain was abrogated by the loss of gsf2(+) or cbf12(+) This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes between Crz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network.

  11. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast

    PubMed Central

    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon


    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeast Schizosaccharomyces pombe. Genome-wide studies of the Crz1 and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2 and tunicamycin treatment, as well as a ∆pmr1 genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of the Saccharomyces cerevisiae ortholog Crz1. These genes were functionally enriched for Crz1-conserved processes such as cell-wall biosynthesis. Overexpression of prz1+ increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of the O-mannosyltransferase encoding gene omh1+. Loss of omh1+ abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss of prz1+ resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the ∆prz1 strain was abrogated by the loss of gsf2+ or cbf12+. This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes between Crz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network. PMID:26896331

  12. Dinoflagellate tandem array gene transcripts are highly conserved and not polycistronic

    PubMed Central

    Beauchemin, Mathieu; Roy, Sougata; Daoust, Philippe; Dagenais-Bellefeuille, Steve; Bertomeu, Thierry; Letourneau, Louis; Lang, B. Franz; Morse, David


    Dinoflagellates are an important component of the marine biota, but a large genome with high–copy number (up to 5,000) tandem gene arrays has made genomic sequencing problematic. More importantly, little is known about the expression and conservation of these unusual gene arrays. We assembled de novo a gene catalog of 74,655 contigs for the dinoflagellate Lingulodinium polyedrum from RNA-Seq (Illumina) reads. The catalog contains 93% of a Lingulodinium EST dataset deposited in GenBank and 94% of the enzymes in 16 primary metabolic KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, indicating it is a good representation of the transcriptome. Analysis of the catalog shows a marked underrepresentation of DNA-binding proteins and DNA-binding domains compared with other algae. Despite this, we found no evidence to support the proposal of polycistronic transcription, including a marked underrepresentation of sequences corresponding to the intergenic spacers of two tandem array genes. We also have used RNA-Seq to assess the degree of sequence conservation in tandem array genes and found their transcripts to be highly conserved. Interestingly, some of the sequences in the catalog have only bacterial homologs and are potential candidates for horizontal gene transfer. These presumably were transferred as single-copy genes, and because they are now all GC-rich, any derived from AT-rich contexts must have experienced extensive mutation. Our study not only has provided the most complete dinoflagellate gene catalog known to date, it has also exploited RNA-Seq to address fundamental issues in basic transcription mechanisms and sequence conservation in these algae. PMID:23019363

  13. Inference of transcriptional networks in Arabidopsis through conserved noncoding sequence analysis.


    Van de Velde, Jan; Heyndrickx, Ken S; Vandepoele, Klaas


    Transcriptional regulation plays an important role in establishing gene expression profiles during development or in response to (a)biotic stimuli. Transcription factor binding sites (TFBSs) are the functional elements that determine transcriptional activity, and the identification of individual TFBS in genome sequences is a major goal to inferring regulatory networks. We have developed a phylogenetic footprinting approach for the identification of conserved noncoding sequences (CNSs) across 12 dicot plants. Whereas both alignment and non-alignment-based techniques were applied to identify functional motifs in a multispecies context, our method accounts for incomplete motif conservation as well as high sequence divergence between related species. We identified 69,361 footprints associated with 17,895 genes. Through the integration of known TFBS obtained from the literature and experimental studies, we used the CNSs to compile a gene regulatory network in Arabidopsis thaliana containing 40,758 interactions, of which two-thirds act through binding events located in DNase I hypersensitive sites. This network shows significant enrichment toward in vivo targets of known regulators, and its overall quality was confirmed using five different biological validation metrics. Finally, through the integration of detailed expression and function information, we demonstrate how static CNSs can be converted into condition-dependent regulatory networks, offering opportunities for regulatory gene annotation.

  14. Microbial community transcriptional networks are conserved in three domains at ocean basin scales.


    Aylward, Frank O; Eppley, John M; Smith, Jason M; Chavez, Francisco P; Scholin, Christopher A; DeLong, Edward F


    Planktonic microbial communities in the ocean are typically dominated by several cosmopolitan clades of Bacteria, Archaea, and Eukarya characterized by their ribosomal RNA gene phylogenies and genomic features. Although the environments these communities inhabit range from coastal to open ocean waters, how the biological dynamics vary between such disparate habitats is not well known. To gain insight into the differential activities of microbial populations inhabiting different oceanic provinces we compared the daily metatranscriptome profiles of related microbial populations inhabiting surface waters of both a coastal California upwelling region (CC) as well as the oligotrophic North Pacific Subtropical Gyre (NPSG). Transcriptional networks revealed that the dominant photoautotrophic microbes in each environment (Ostreococcus in CC, Prochlorococcus in NPSG) were central determinants of overall community transcriptome dynamics. Furthermore, heterotrophic bacterial clades common to both ecosystems (SAR11, SAR116, SAR86, SAR406, and Roseobacter) displayed conserved, genome-wide inter- and intrataxon transcriptional patterns and diel cycles. Populations of SAR11 and SAR86 clades in particular exhibited tightly coordinated transcriptional patterns in both coastal and pelagic ecosystems, suggesting that specific biological interactions between these groups are widespread in nature. Our results identify common diurnally oscillating behaviors among diverse planktonic microbial species regardless of habitat, suggesting that highly conserved temporally phased biotic interactions are ubiquitous among planktonic microbial communities worldwide.

  15. Microbial community transcriptional networks are conserved in three domains at ocean basin scales

    NASA Astrophysics Data System (ADS)

    Aylward, Frank O.; Eppley, John M.; Smith, Jason M.; Chavez, Francisco P.; Scholin, Christopher A.; DeLong, Edward F.


    Planktonic microbial communities in the ocean are typically dominated by several cosmopolitan clades of Bacteria, Archaea, and Eukarya characterized by their ribosomal RNA gene phylogenies and genomic features. Although the environments these communities inhabit range from coastal to open ocean waters, how the biological dynamics vary between such disparate habitats is not well known. To gain insight into the differential activities of microbial populations inhabiting different oceanic provinces we compared the daily metatranscriptome profiles of related microbial populations inhabiting surface waters of both a coastal California upwelling region (CC) as well as the oligotrophic North Pacific Subtropical Gyre (NPSG). Transcriptional networks revealed that the dominant photoautotrophic microbes in each environment (Ostreococcus in CC, Prochlorococcus in NPSG) were central determinants of overall community transcriptome dynamics. Furthermore, heterotrophic bacterial clades common to both ecosystems (SAR11, SAR116, SAR86, SAR406, and Roseobacter) displayed conserved, genome-wide inter- and intrataxon transcriptional patterns and diel cycles. Populations of SAR11 and SAR86 clades in particular exhibited tightly coordinated transcriptional patterns in both coastal and pelagic ecosystems, suggesting that specific biological interactions between these groups are widespread in nature. Our results identify common diurnally oscillating behaviors among diverse planktonic microbial species regardless of habitat, suggesting that highly conserved temporally phased biotic interactions are ubiquitous among planktonic microbial communities worldwide.

  16. A conserved family of nuclear phosphoproteins localized to sites of polymerase II transcription

    PubMed Central


    An antibody was identified previously that recognizes sites of polymerase II transcription on lampbrush chromosomes, puffs on polytene chromosomes, and many small granules in the nucleoplasm of all cells tested. This antibody binds a conserved family of phosphorylated polypeptides in vertebrate and invertebrate cells. We developed a method for purifying these proteins that involves differential solubility in MgCl2. We isolated a Drosophila cDNA encoding one of the proteins using information obtained from microsequencing. In vivo expression studies show that this protein is concentrated on sites of polymerase II transcription and that it is highly phosphorylated. The protein shares a high degree of homology with proteins involved in alternative splicing of pre-mRNA suggesting the possibility that this protein plays a role in pre-mRNA splicing. PMID:1717489

  17. Investigating Conservation of the Cell-Cycle-Regulated Transcriptional Program in the Fungal Pathogen, Cryptococcus neoformans

    PubMed Central

    Sierra, Crystal S.; Haase, Steven B.


    The pathogenic yeast Cryptococcus neoformans causes fungal meningitis in immune-compromised patients. Cell proliferation in the budding yeast form is required for C. neoformans to infect human hosts, and virulence factors such as capsule formation and melanin production are affected by cell-cycle perturbation. Thus, understanding cell-cycle regulation is critical for a full understanding of virulence factors for disease. Our group and others have demonstrated that a large fraction of genes in Saccharomyces cerevisiae is expressed periodically during the cell cycle, and that proper regulation of this transcriptional program is important for proper cell division. Despite the evolutionary divergence of the two budding yeasts, we found that a similar percentage of all genes (~20%) is periodically expressed during the cell cycle in both yeasts. However, the temporal ordering of periodic expression has diverged for some orthologous cell-cycle genes, especially those related to bud emergence and bud growth. Genes regulating DNA replication and mitosis exhibited a conserved ordering in both yeasts, suggesting that essential cell-cycle processes are conserved in periodicity and in timing of expression (i.e. duplication before division). In S. cerevisiae cells, we have proposed that an interconnected network of periodic transcription factors (TFs) controls the bulk of the cell-cycle transcriptional program. We found that temporal ordering of orthologous network TFs was not always maintained; however, the TF network topology at cell-cycle commitment appears to be conserved in C. neoformans. During the C. neoformans cell cycle, DNA replication genes, mitosis genes, and 40 genes involved in virulence are periodically expressed. Future work toward understanding the gene regulatory network that controls cell-cycle genes is critical for developing novel antifungals to inhibit pathogen proliferation. PMID:27918582

  18. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    SciTech Connect

    Loots, G; Ovcharenko, I


    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. We have created a database of evolutionary conserved regions (ECRs) in vertebrate genomes entitled ECRbase that is constructed from a collection of pairwise vertebrate genome alignments produced by the ECR Browser database. ECRbase features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a collection of promoters in all vertebrate genomes presented in the database. The database also contains a collection of annotated transcription factor binding sites (TFBS) in all ECRs and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and two pufferfish genomes. It is freely accessible at

  19. The transcription factor Spn1 regulates gene expression via a highly conserved novel structural motif

    PubMed Central

    Pujari, Venugopal; Radebaugh, Catherine A.; Chodaparambil, Jayanth V.; Muthurajan, Uma M.; Almeida, Adam R.; Fischbeck, Julie A.; Luger, Karolin; Stargell, Laurie A.


    Spn1 plays essential roles in the regulation of gene expression by RNA Polymerase II (RNAPII), and it is highly conserved in organisms ranging from yeast to humans. Spn1 physically and/or genetically interacts with RNAPII, TBP, TFIIS and a number of chromatin remodeling factors (Swi/Snf and Spt6). The central domain of Spn1 (residues 141-305 out of 410) is necessary and sufficient for performing the essential functions of SPN1 in yeast cells. Here we report the high-resolution (1.85Å) crystal structure of the conserved central domain of Saccharomyces cerevisiae Spn1. The central domain is comprised of eight alpha-helices in a right handed super helical arrangement, and exhibits structural similarity to domain I of TFIIS. A unique structural feature of Spn1 is a highly conserved loop, which defines one side of a pronounced cavity. The loop and the other residues forming the cavity are highly conserved at the amino acid level among all Spn1 family members, suggesting that this is a signature motif for Spn1 orthologs. The locations and the molecular characterization of temperature-sensitive mutations in Spn1 indicate that the cavity is a key attribute of Spn1 that is critical for its regulatory functions during RNAPII-mediated transcriptional activity. PMID:20875428

  20. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    SciTech Connect

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.; Iyer, VenkyN.; Eisen, Michael B.


    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  1. Sea urchin collagen evolutionarily homologous to vertebrate pro-alpha 2(I) collagen.


    Exposito, J Y; D'Alessio, M; Solursh, M; Ramirez, F


    We isolated several overlapping cDNA clones covering the 4242 nucleotides of a Strongylocentrotus purpuratus transcript that codes for a fibrillar procollagen chain. The sea urchin polypeptide includes a 124-amino acid long amino pre-propeptide, a 1064-amino acid alpha-chain inclusive of 338 uninterrupted Gly-X-Y repeats, and a 226-residue carboxyl-propeptide. The distribution of the highly conserved cysteines within the last domain together with the structural configuration of the amino-propeptide and the organization of the corresponding coding region, strongly suggest that the sea urchin gene is evolutionarily related to the vertebrate pro-alpha 2(I) collagen. This work, therefore, represents the first report of the complete primary structure of an invertebrate fibrillar procollagen chain. It also provides a new insight into the evolution of the amino-propeptide, the most divergent among the major protein domains of fibrillar procollagen chains.

  2. Identification of conserved micro-RNAs and their target transcripts in opium poppy (Papaver somniferum L.).


    Unver, Turgay; Parmaksiz, Iskender; Dündar, Ekrem


    Micro-RNAs (miRNA) are regulatory non-coding class of small RNAs functioning in many organisms. Using computational approaches we have identified 20 conserved opium poppy (Papaver somniferum L.) miRNAs belonging to 16 miRNA families in Expressed Sequence Tags (EST) database. The existence of ESTs suggested that the miRNAs were expressed in P. somniferum. Lengths of mature miRNAs varied from 20 to 23 nucleotides located at the different positions of precursor RNAs. Uracil was found to be a dominant nucleotide in both poppy pre-miRNA sequences (31.28 +/- 7.06% of total nucleotide composition) and in the first position at the 5' end of the mature poppy miRNAs. We have applied quantitative real-time PCR (qRT-PCR) assays to compare and validate expression levels of selected P. somniferum miRNAs and their target transcripts. As a result, some of the predicted miRNAs and their target genes were found to be differentially expressed in P. somniferum leaf and root tissues. A meaningful correlation between three of the four analyzed pairs of miRNAs and their target transcript expression levels was detected. Additionally, using these predicted miRNAs as queries, 41 potential target mRNAs were found in National Center for Biotechnology Information (NCBI) protein-coding nucleotide (mRNA) database of all plant species. Some of the target mRNAs were found to be transcription factors regulating plant development, morphology, and flowering time. Other target mRNAs of identified conserved miRNAs involve in metabolic processes, signal transduction, and stress responses. This study reports the first identification of opium poppy miRNAs.

  3. A prominent and conserved role for YY1 in Xist transcriptional activation

    PubMed Central

    Navarro, Pablo; Neuillet, Damien; Rougeulle, Claire


    Accumulation of the non-coding RNA Xist on one X chromosome in female cells is a hallmark of X-chromosome inactivation in eutherians. Here, we uncovered an essential function for the ubiquitous autosomal transcription factor Yin-Yang 1 (YY1) in the transcriptional activation of Xist in both human and mouse. We show that loss of YY1 prevents Xist up-regulation during the initiation and maintenance of X-inactivation, and that YY1 binds directly the Xist 5′ region to trigger the activity of the Xist promoter. Binding of YY1 to the Xist 5′ region prior to X-chromosome inactivation competes with the Xist repressor REX1 while DNA methylation controls mono-allelic fixation of YY1 to Xist at the onset of X-chromosome inactivation. YY1 is thus the first autosomal activating factor involved in a fundamental and conserved pathway of Xist regulation that ensures the asymmetric transcriptional up-regulation of the master regulator of X-chromosome inactivation. PMID:25209548

  4. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.


    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  5. Conserved transcriptional responses to cyanobacterial stressors are mediated by alternate regulation of paralogous genes in Daphnia.


    Asselman, Jana; Pfrender, Michael E; Lopez, Jacqueline A; De Coninck, Dieter I M; Janssen, Colin R; Shaw, Joseph R; De Schamphelaere, Karel A C


    Despite a significant increase in genomic data, our knowledge of gene functions and their transcriptional responses to environmental stimuli remains limited. Here, we use the model keystone species Daphnia pulex to study environmental responses of genes in the context of their gene family history to better understand the relationship between genome structure and gene function in response to environmental stimuli. Daphnia were exposed to five different treatments, each consisting of a diet supplemented with one of five cyanobacterial species, and a control treatment consisting of a diet of only green algae. Differential gene expression profiles of Daphnia exposed to each of these five cyanobacterial species showed that genes with known functions are more likely to be shared by different expression profiles, whereas genes specific to the lineage of Daphnia are more likely to be unique to a given expression profile. Furthermore, while only a small number of nonlineage-specific genes were conserved across treatment type, there was a high degree of overlap in expression profiles at the functional level. The conservation of functional responses across the different cyanobacterial treatments can be attributed to the treatment-specific expression of different paralogous genes within the same gene family. Comparison with available gene expression data in the literature suggests differences in nutritional composition in diets with cyanobacterial species compared to diets of green algae as a primary driver for cyanobacterial effects on Daphnia. We conclude that conserved functional responses in Daphnia across different cyanobacterial treatments are mediated through alternate regulation of paralogous gene families.

  6. Mechanisms regulating GLUT4 transcription in skeletal muscle cells are highly conserved across vertebrates.


    Marín-Juez, Rubén; Diaz, Mónica; Morata, Jordi; Planas, Josep V


    The glucose transporter 4 (GLUT4) plays a key role in glucose uptake in insulin target tissues. This transporter has been extensively studied in many species in terms of its function, expression and cellular traffic and complex mechanisms are involved in its regulation at many different levels. However, studies investigating the transcription of the GLUT4 gene and its regulation are scarce. In this study, we have identified the GLUT4 gene in a teleost fish, the Fugu (Takifugu rubripes), and have cloned and characterized a functional promoter of this gene for the first time in a non-mammalian vertebrate. In silico analysis of the Fugu GLUT4 promoter identified potential binding sites for transcription factors such as SP1, C/EBP, MEF2, KLF, SREBP-1c and GC-boxes, as well as a CpG island, but failed to identify a TATA box. In vitro analysis revealed three transcription start sites, with the main residing 307 bp upstream of the ATG codon. Deletion analysis determined that the core promoter was located between nucleotides -132/+94. By transfecting a variety of 5´deletion constructs into L6 muscle cells we have determined that Fugu GLUT4 promoter transcription is regulated by insulin, PG-J2, a PPARγ agonist, and electrical pulse stimulation. Furthermore, our results suggest the implication of motifs such as PPARγ/RXR and HIF-1α in the regulation of Fugu GLUT4 promoter activity by PPARγ and contractile activity, respectively. These data suggest that the characteristics and regulation of the GLUT4 promoter have been remarkably conserved during the evolution from fish to mammals, further evidencing the important role of GLUT4 in metabolic regulation in vertebrates.

  7. An ancient transcriptional regulatory module for tip growth has been conserved throughout the vascular plant lineage.


    Cho, Hyung-Taeg


    The root hair development of vascular plants can be divided into two major processes, fate determination and hair morphogenesis, and the latter should be governed by the former so as to express the morphogenetic toolkits in a root hair-specific manner. Vascular plants, depending on taxa, show different fate-determining mechanisms for hair cell/non-hair cell fates, which leads to a question whether the downstream mophogenetic regulatory module is diverged accordingly to the upstream fate determiners or not. Our study demonstrates that the module of a transcription factor and a root hair-specific cis-element (RHE) for root hair-specific expression of morphogenetic toolkit genes is conserved in spite of different fate-determing mechanisms.

  8. A highly conserved novel family of mammalian developmental transcription factors related to Drosophila grainyhead.


    Wilanowski, Tomasz; Tuckfield, Annabel; Cerruti, Loretta; O'Connell, Sinead; Saint, Robert; Parekh, Vishwas; Tao, Jianning; Cunningham, John M; Jane, Stephen M


    The Drosophila transcription factor Grainyhead regulates several key developmental processes. Three mammalian genes, CP2, LBP-1a and LBP-9 have been previously identified as homologues of grainyhead. We now report the cloning of two new mammalian genes (Mammalian grainyhead (MGR) and Brother-of-MGR (BOM)) and one new Drosophila gene (dCP2) that rewrite the phylogeny of this family. We demonstrate that MGR and BOM are more closely related to grh, whereas CP2, LBP-1a and LBP-9 are descendants of the dCP2 gene. MGR shares the greatest sequence homology with grh, is expressed in tissue-restricted patterns more comparable to grh and binds to and transactivates the promoter of the human Engrailed-1 gene, the mammalian homologue of the key grainyhead target gene, engrailed. This sequence and functional conservation indicates that the new mammalian members of this family play important developmental roles.

  9. Sphingolipids, Transcription Factors, and Conserved Toolkit Genes: Developmental Plasticity in the Ant Cardiocondyla obscurior

    PubMed Central

    Schrader, Lukas; Simola, Daniel F.; Heinze, Jürgen; Oettler, Jan


    Developmental plasticity allows for the remarkable morphological specialization of individuals into castes in eusocial species of Hymenoptera. Developmental trajectories that lead to alternative caste fates are typically determined by specific environmental stimuli that induce larvae to express and maintain distinct gene expression patterns. Although most eusocial species express two castes, queens and workers, the ant Cardiocondyla obscurior expresses diphenic females and males; this provides a unique system with four discrete phenotypes to study the genomic basis of developmental plasticity in ants. We sequenced and analyzed the transcriptomes of 28 individual C. obscurior larvae of known developmental trajectory, providing the first in-depth analysis of gene expression in eusocial insect larvae. Clustering and transcription factor binding site analyses revealed that different transcription factors and functionally distinct sets of genes are recruited during larval development to induce the four alternative trajectories. In particular, we found complex patterns of gene regulation pertaining to sphingolipid metabolism, a conserved molecular pathway involved in development, obesity, and aging. PMID:25725431

  10. Dynamic Sumoylation of a Conserved Transcription Corepressor Prevents Persistent Inclusion Formation during Hyperosmotic Stress.


    Oeser, Michelle L; Amen, Triana; Nadel, Cory M; Bradley, Amanda I; Reed, Benjamin J; Jones, Ramon D; Gopalan, Janani; Kaganovich, Daniel; Gardner, Richard G


    Cells are often exposed to physical or chemical stresses that can damage the structures of essential biomolecules. Stress-induced cellular damage can become deleterious if not managed appropriately. Rapid and adaptive responses to stresses are therefore crucial for cell survival. In eukaryotic cells, different stresses trigger post-translational modification of proteins with the small ubiquitin-like modifier SUMO. However, the specific regulatory roles of sumoylation in each stress response are not well understood. Here, we examined the sumoylation events that occur in budding yeast after exposure to hyperosmotic stress. We discovered by proteomic and biochemical analyses that hyperosmotic stress incurs the rapid and transient sumoylation of Cyc8 and Tup1, which together form a conserved transcription corepressor complex that regulates hundreds of genes. Gene expression and cell biological analyses revealed that sumoylation of each protein directs distinct outcomes. In particular, we discovered that Cyc8 sumoylation prevents the persistence of hyperosmotic stress-induced Cyc8-Tup1 inclusions, which involves a glutamine-rich prion domain in Cyc8. We propose that sumoylation protects against persistent inclusion formation during hyperosmotic stress, allowing optimal transcriptional function of the Cyc8-Tup1 complex.

  11. Dynamic Sumoylation of a Conserved Transcription Corepressor Prevents Persistent Inclusion Formation during Hyperosmotic Stress

    PubMed Central

    Oeser, Michelle L.; Amen, Triana; Nadel, Cory M.; Bradley, Amanda I.; Reed, Benjamin J.; Jones, Ramon D.; Gopalan, Janani; Kaganovich, Daniel; Gardner, Richard G.


    Cells are often exposed to physical or chemical stresses that can damage the structures of essential biomolecules. Stress-induced cellular damage can become deleterious if not managed appropriately. Rapid and adaptive responses to stresses are therefore crucial for cell survival. In eukaryotic cells, different stresses trigger post-translational modification of proteins with the small ubiquitin-like modifier SUMO. However, the specific regulatory roles of sumoylation in each stress response are not well understood. Here, we examined the sumoylation events that occur in budding yeast after exposure to hyperosmotic stress. We discovered by proteomic and biochemical analyses that hyperosmotic stress incurs the rapid and transient sumoylation of Cyc8 and Tup1, which together form a conserved transcription corepressor complex that regulates hundreds of genes. Gene expression and cell biological analyses revealed that sumoylation of each protein directs distinct outcomes. In particular, we discovered that Cyc8 sumoylation prevents the persistence of hyperosmotic stress-induced Cyc8-Tup1 inclusions, which involves a glutamine-rich prion domain in Cyc8. We propose that sumoylation protects against persistent inclusion formation during hyperosmotic stress, allowing optimal transcriptional function of the Cyc8-Tup1 complex. PMID:26800527

  12. Functional conservation between members of an ancient duplicated transcription factor family, LSF/Grainyhead.


    Venkatesan, Kavitha; McManus, Heather R; Mello, Craig C; Smith, Temple F; Hansen, Ulla


    The LSF/Grainyhead transcription factor family is involved in many important biological processes, including cell cycle, cell growth and development. In order to investigate the evolutionary conservation of these biological roles, we have characterized two new family members in Caenorhabditis elegans and Xenopus laevis. The C.elegans member, Ce-GRH-1, groups with the Grainyhead subfamily, while the X.laevis member, Xl-LSF, groups with the LSF subfamily. Ce-GRH-1 binds DNA in a sequence-specific manner identical to that of Drosophila melanogaster Grainyhead. In addition, Ce-GRH-1 binds to sequences upstream of the C.elegans gene encoding aromatic L-amino-acid decarboxylase and genes involved in post-embryonic development, mab-5 and dbl-1. All three C.elegans genes are homologs of D.melanogaster Grainyhead-regulated genes. RNA-mediated interference of Ce-grh-1 results in embryonic lethality in worms, accompanied by soft, defective cuticles. These phenotypes are strikingly similar to those observed previously in D.melanogaster grainyhead mutants, suggesting conservation of the developmental role of these family members over the course of evolution. Our phylogenetic analysis of the expanded LSF/GRH family (including other previously unrecognized proteins/ESTs) suggests that the structural and functional dichotomy of this family dates back more than 700 million years, i.e. to the time when the first multicellular organisms are thought to have arisen.

  13. A Conserved Nuclear Cyclophilin Is Required for Both RNA Polymerase II Elongation and Co-transcriptional Splicing in Caenorhabditis elegans

    PubMed Central

    Ahn, Jeong H.; Rechsteiner, Andreas; Strome, Susan; Kelly, William G.


    The elongation phase of transcription by RNA Polymerase II (Pol II) involves numerous events that are tightly coordinated, including RNA processing, histone modification, and chromatin remodeling. RNA splicing factors are associated with elongating Pol II, and the interdependent coupling of splicing and elongation has been documented in several systems. Here we identify a conserved, multi-domain cyclophilin family member, SIG-7, as an essential factor for both normal transcription elongation and co-transcriptional splicing. In embryos depleted for SIG-7, RNA levels for over a thousand zygotically expressed genes are substantially reduced, Pol II becomes significantly reduced at the 3’ end of genes, marks of transcription elongation are reduced, and unspliced mRNAs accumulate. Our findings suggest that SIG-7 plays a central role in both Pol II elongation and co-transcriptional splicing and may provide an important link for their coordination and regulation. PMID:27541139

  14. Thioredoxins in evolutionarily primitive organisms

    NASA Technical Reports Server (NTRS)

    Buchanan, B. B.


    Thioredoxins are low molecular weight redox proteins, alternating between the S-S (oxidized) and SH (reduced) states, that function in a number of biochemical processes, including DNA synthesis, DNA replication, and enzyme regulation. Until recently, reduced ferredoxin was known to serve as the source of reducing power for the reduction of thioredoxins only in oxygenic photosynthetic cells. In all other organisms, the source of hydrogen (electrons) for thioredoxin reduction was considered to be NADPH. It was found that Clostridium pasteurianum, an anaerobic organism normally living in the soil unexposed to light, resembles photosynthetic cells in using ferredoxin for the reduction of thioredoxin. The results reveal the existence of a pathway in which ferredoxin, provides the reducing power for the reduction of thioredoxin via the flavoprotein enzyme, ferredoxinthioredoxin reductase. In related studies, it was found that Chromatium vinosum, an anaerobic photosynthetic purple sulfur bacterium, resembles evolutionarily more advanced micro-organisms in having an NADP-thioredoxin system composed of a single thioredoxin which is reduced by NADPH via NADP-thioredoxin reductase. The adoption of the NADP-thioredoxin system by Chromatium seems appropriate in view of evidence tha the organi sm utilizes ATP-driven reverse electron transport. Finally, results of research directed towards the identification of target enzymes of the ferredoxin/thioredoxin system in a cyanobacterium (Nostoc muscorum), show that thioredoxin-linked photosynthetic enzymes of cyanobateria are similar to those of chloroplasts. It now seems that the ferredoxin/thioredoxin system functions in regulating CO2 assimilation via the reductive pentose phosphate cycle in oxygenic but not anoxygenic photosynthetic cells.

  15. A conserved structural motif reveals the essential transcriptional repression function of Spen proteins and their role in developmental signaling.


    Ariyoshi, Mariko; Schwabe, John W R


    Spen proteins regulate the expression of key transcriptional effectors in diverse signaling pathways. They are large proteins characterized by N-terminal RNA-binding motifs and a highly conserved C-terminal SPOC domain. The specific biological role of the SPOC domain (Spen paralog and ortholog C-terminal domain), and hence, the common function of Spen proteins, has been unclear to date. The Spen protein, SHARP (SMRT/HDAC1-associated repressor protein), was identified as a component of transcriptional repression complexes in both nuclear receptor and Notch/RBP-Jkappa signaling pathways. We have determined the 1.8 A crystal structure of the SPOC domain from SHARP. This structure shows that essentially all of the conserved surface residues map to a positively charged patch. Structure-based mutational analysis indicates that this conserved region is responsible for the interaction between SHARP and the universal transcriptional corepressor SMRT/NCoR (silencing mediator for retinoid and thyroid receptors/nuclear receptor corepressor. We demonstrate that this interaction involves a highly conserved acidic motif at the C terminus of SMRT/NCoR. These findings suggest that the conserved function of the SPOC domain is to mediate interaction with SMRT/NCoR corepressors, and that Spen proteins play an essential role in the repression complex.

  16. The Conserved Foot Domain of RNA Pol II Associates with Proteins Involved in Transcriptional Initiation and/or Early Elongation

    PubMed Central

    García-López, M. Carmen; Pelechano, Vicent; Mirón-García, M. Carmen; Garrido-Godino, Ana I.; García, Alicia; Calvo, Olga; Werner, Michel; Pérez-Ortín, José E.; Navarro, Francisco


    RNA polymerase (pol) II establishes many protein–protein interactions with transcriptional regulators to coordinate different steps of transcription. Although some of these interactions have been well described, little is known about the existence of RNA pol II regions involved in contact with transcriptional regulators. We hypothesize that conserved regions on the surface of RNA pol II contact transcriptional regulators. We identified such an RNA pol II conserved region that includes the majority of the “foot” domain and identified interactions of this region with Mvp1, a protein required for sorting proteins to the vacuole, and Spo14, a phospholipase D. Deletion of MVP1 and SPO14 affects the transcription of their target genes and increases phosphorylation of Ser5 in the carboxy-terminal domain (CTD). Genetic, phenotypic, and functional analyses point to a role for these proteins in transcriptional initiation and/or early elongation, consistent with their genetic interactions with CEG1, a guanylyltransferase subunit of the Saccharomyces cerevisiae capping enzyme. PMID:21954159

  17. Stable Binding of the Conserved Transcription Factor Grainy Head to its Target Genes Throughout Drosophila melanogaster Development.


    Nevil, Markus; Bondra, Eliana R; Schulz, Katharine N; Kaplan, Tommy; Harrison, Melissa M


    It has been suggested that transcription factor binding is temporally dynamic, and that changes in binding determine transcriptional output. Nonetheless, this model is based on relatively few examples in which transcription factor binding has been assayed at multiple developmental stages. The essential transcription factor Grainy head (Grh) is conserved from fungi to humans, and controls epithelial development and barrier formation in numerous tissues. Drosophila melanogaster, which possess a single grainy head (grh) gene, provide an excellent system to study this conserved factor. To determine whether temporally distinct binding events allow Grh to control cell fate specification in different tissue types, we used a combination of ChIP-seq and RNA-seq to elucidate the gene regulatory network controlled by Grh during four stages of embryonic development (spanning stages 5-17) and in larval tissue. Contrary to expectations, we discovered that Grh remains bound to at least 1146 genomic loci over days of development. In contrast to this stable DNA occupancy, the subset of genes whose expression is regulated by Grh varies. Grh transitions from functioning primarily as a transcriptional repressor early in development to functioning predominantly as an activator later. Our data reveal that Grh binds to target genes well before the Grh-dependent transcriptional program commences, suggesting it sets the stage for subsequent recruitment of additional factors that execute stage-specific Grh functions.

  18. Conservation of transcription factor binding specificities across 600 million years of bilateria evolution

    PubMed Central

    Nitta, Kazuhiro R; Jolma, Arttu; Yin, Yimeng; Morgunova, Ekaterina; Kivioja, Teemu; Akhtar, Junaid; Hens, Korneel; Toivonen, Jarkko; Deplancke, Bart; Furlong, Eileen E M; Taipale, Jussi


    Divergent morphology of species has largely been ascribed to genetic differences in the tissue-specific expression of proteins, which could be achieved by divergence in cis-regulatory elements or by altering the binding specificity of transcription factors (TFs). The relative importance of the latter has been difficult to assess, as previous systematic analyses of TF binding specificity have been performed using different methods in different species. To address this, we determined the binding specificities of 242 Drosophila TFs, and compared them to human and mouse data. This analysis revealed that TF binding specificities are highly conserved between Drosophila and mammals, and that for orthologous TFs, the similarity extends even to the level of very subtle dinucleotide binding preferences. The few human TFs with divergent specificities function in cell types not found in fruit flies, suggesting that evolution of TF specificities contributes to emergence of novel types of differentiated cells. DOI: PMID:25779349

  19. Evolutionary and molecular analysis of Dof transcription factors identified a conserved motif for intercellular protein trafficking.


    Chen, Huan; Ahmad, Munawar; Rim, Yeonggil; Lucas, William J; Kim, Jae-Yean


    · Cell-to-cell trafficking of transcription factors (TFs) has been shown to play an important role in the regulation of plant developmental events, but the evolutionary relationship between cell-autonomous and noncell-autonomous (NCA) TFs remains elusive. · AtDof4.1, named INTERCELLULAR TRAFFICKING DOF 1 (ITD1), was chosen as a representative NCA member to explore this evolutionary relationship. Using domain structure-function analyses and swapping studies, we examined the cell-to-cell trafficking of plant-specific Dof TF family members across Arabidopsis and other species. · We identified a conserved intercellular trafficking motif (ITM) that is necessary and sufficient for selective cell-to-cell trafficking and can impart gain-of-function cell-to-cell movement capacity to an otherwise cell-autonomous TF. The functionality of related motifs from Dof members across the plant kingdom extended, surprisingly, to a unicellular alga that lacked plasmodesmata. By contrast, the algal homeodomain related to the NCA KNOX homeodomain was either inefficient or unable to impart such cell-to-cell movement function. · The Dof ITM appears to predate the evolution of selective plasmodesmal trafficking in the plant kingdom, which may well have acted as a molecular template for the evolution of Dof proteins as NCA TFs. However, the ability to efficiently traffic for KNOX homeodomain (HD) proteins may have been acquired during the evolution of early nonvascular plants.

  20. The highly conserved MraZ protein is a transcriptional regulator in Escherichia coli

    SciTech Connect

    Eraso, Jesus M.; Markillie, Lye Meng; Mitchell, Hugh D.; Taylor, Ronald C.; Orr, Galya; Margolin, William


    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and location at the head of the division and cell wall (dcw) gene cluster. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin, and MraW is known to methylate ribosomal RNA, mraZ and mraW null mutants have no detectable growth phenotype in any species tested to date, hampering progress in understanding their physiological role. Here we show that overproduction of Escherichia coli MraZ perturbs cell division and the cell envelope, is more lethal at high levels or in minimal growth medium, and that MraW antagonizes these effects. MraZGFP localizes to the nucleoid, suggesting that it binds DNA. Indeed, purified MraZ directly binds a region upstream from its own promoter containing three direct repeats to regulate its own expression and that of downstream cell division and cell wall genes. MraZ-LacZ fusions are repressed by excess MraZ but not when DNA binding by MraZ is inhibited. RNAseq analysis indicates that MraZ is a global transcriptional regulator with numerous targets in addition to dcw genes. One of these targets, mioC, is directly bound by MraZ in a region with three direct repeats.

  1. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.


    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P


    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  2. Conserved archetypal configuration of the transcriptional control region during the course of BK polyomavirus evolution.


    Yogo, Yoshiaki; Zhong, Shan; Xu, Yawei; Zhu, Mengyun; Chao, Yuegen; Sugimoto, Chie; Ikegaya, Hiroshi; Shibuya, Ayako; Kitamura, Tadaichi


    BK polyomavirus (BKV) is widespread among humans, asymptomatically infecting children and then persisting in renal tissue. The transcriptional control region (TCR) of the BKV genome is variable among clinical isolates. Thus, archetypal TCRs with a common basic configuration generally occur in BKV isolates from the urine of immunocompromised patients, but rearranged TCRs that possibly arise from the archetypal configuration have also been detected in clinical specimens. To examine the hypothesis that archetypal strains represent wild-type strains circulating in the human population (the archetype hypothesis), we analysed 145 complete viral genomes amplified directly from the urine of non-immunocompromised individuals worldwide. These genomes included 82, three, two and 58 sequences classified as belonging to subtypes I, II, III and IV, respectively. Rearranged TCRs with long duplications or deletions were detected from two subtype I and two subtype IV genomes, but not from the other 141 genomes (thus, the TCRs of these genomes were judged to be archetypal). The variations in the archetypal TCRs were nucleotide substitutions and single-nucleotide deletions, most of which were unique to particular subtypes or subgroups. We confirmed that the four complete BKV genomes with rearranged TCRs did not form a unique lineage on a phylogenetic tree. Collectively, the findings demonstrate that the archetypal TCR configuration has been conserved during the evolution of BKV, providing support for the archetype hypothesis. Additionally, we suggest that 'archetype' should be used as a conceptual term that denotes a prototypical structure that can generate various rearranged TCRs during viral growth in vivo and in vitro.

  3. Surprising flexibility in a conserved Hox transcription factor over 550 million years of evolution

    PubMed Central

    Heffer, Alison; Shultz, Jeffrey W.; Pick, Leslie


    Although metazoan body plans are remarkably diverse, the structure and function of many embryonic regulatory genes are conserved because large changes would be detrimental to development. However, the fushi tarazu (ftz) gene has changed dramatically during arthropod evolution from Hox-like to a pair-rule segmentation gene in Drosophila. Changes in both expression and protein sequence contributed to this new function: ftz expression switched from Hox-like to stripes and changes in Ftz cofactor interaction motifs led to loss of homeotic and gain of segmentation potential. Here, we reconstructed ftz changes in a rigorous phylogenetic context. We found that ftz did not simply switch from Hox-like to segmentation function; rather, ftz is remarkably labile, having undergone multiple changes in sequence and expression. The segmentation LXXLL motif was stably acquired in holometabolous insects after the appearance of striped expression in early insect lineages. The homeotic YPWM motif independently degenerated multiple times. These “degen-YPWMs” showed varying degrees of homeotic potential when expressed in Drosophila, suggesting variable loss of Hox function in different arthropods. Finally, the intensity of ftz Hox-like expression decreased to marginal levels in some crustaceans. We propose that decreased expression levels permitted ftz variants to arise and persist in populations without disadvantaging organismal development. This process, in turn, allowed evolutionary transitions in protein function, as weakly expressed “hopeful gene variants” were coopted into alternative developmental pathways. Our findings show that variation of a pleiotropic transcription factor is more extensive than previously imagined, suggesting that evolutionary plasticity may be widespread among regulatory genes. PMID:20921393

  4. A Conserved Transcriptional Regulator Governs Fungal Morphology in Widely Diverged Species

    PubMed Central

    Cain, Christopher W.; Lohse, Matthew B.; Homann, Oliver R.; Sil, Anita; Johnson, Alexander D.


    Fungi exhibit a large variety of morphological forms. Here, we examine the functions of a deeply conserved regulator of morphology in three fungal species: Saccharomyces cerevisiae, Candida albicans, and Histoplasma capsulatum. We show that, despite an estimated 600 million years since those species diverged from a common ancestor, Wor1 in C. albicans, Ryp1 in H. capsulatum, and Mit1 in S. cerevisiae are transcriptional regulators that recognize the same DNA sequence. Previous work established that Wor1 regulates white–opaque switching in C. albicans and that its ortholog Ryp1 regulates the yeast to mycelial transition in H. capsulatum. Here we show that the ortholog Mit1 in S. cerevisiae is also a master regulator of a morphological transition, in this case pseudohyphal growth. Full-genome chromatin immunoprecipitation experiments show that Mit1 binds to the control regions of the previously known regulators of pseudohyphal growth as well as those of many additional genes. Through a comparison of binding sites for Mit1 in S. cerevisiae, Wor1 in C. albicans, and Wor1 ectopically expressed in S. cerevisiae, we conclude that the genes controlled by the orthologous regulators overlap only slightly between these two species despite the fact that the DNA binding specificity of the regulators has remained largely unchanged. We suggest that the ancestral Wor1/Mit1/Ryp1 protein controlled aspects of cell morphology and that movement of genes in and out of the Wor1/Mit1/Ryp1 regulon is responsible, in part, for the differences of morphological forms among these species. PMID:22095082

  5. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes.


    Uhl, Juli D; Zandvakili, Arya; Gebelein, Brian


    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints.

  6. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes

    PubMed Central

    Uhl, Juli D.; Zandvakili, Arya; Gebelein, Brian


    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints. PMID:27058369

  7. The endopeptidase activity and the activation by Cl- of angiotensin-converting enzyme is evolutionarily conserved: purification and properties of an an angiotensin-converting enzyme from the housefly, Musca domestica.

    PubMed Central

    Lamango, N S; Sajid, M; Isaac, R E


    A soluble 67 kDa angiotensin-converting enzyme (ACE) has been purified by lisinopril-Sepharose affinity column chromatography from adult houseflies, Musca domestica. The dipeptidyl carboxypeptidase activity towards benzoyl-Gly-His-Leu was inhibited by captopril (IC50 50 nM) and fosinoprilat (IC50 251 nM), two inhibitors of mammalian ACE, and was activated by Cl- (optimal Cl- concentration 600 mM). Musca ACE removed C-terminal dipeptides from angiotensin I, bradykinin [Leu5]enkephalin and [Met5]enkephalin and also functioned as an endopeptidase by hydrolysing dipeptideamides from [Leu5]enkephalinamide and [Met5]enkephalinamide, and a dipeptideamide and a tripeptideamide from substance P. Musca ACE was also able to cleave a tripeptide from both the N-terminus and C-terminus of luteinizing hormone-releasing hormone, with C-terminal hydrolysis predominating. Maximal N-terminal tripeptidase activity occurred at 150 mM NaCl, whereas the C-terminal tripeptidase activity continued to rise with increasing concentration of Cl- (0-0.5 M). Musca ACE displays properties of both the N- and C-domains of human ACE, indicating a high degree of conservation during evolution of the substrate specificity of ACE and its response to Cl-. PMID:8670080

  8. Comparative Analysis of P450 Signature Motifs EXXR and CXG in the Large and Diverse Kingdom of Fungi: Identification of Evolutionarily Conserved Amino Acid Patterns Characteristic of P450 Family

    PubMed Central

    Syed, Khajamohiddin; Mashele, Samson Sitheni


    Cytochrome P450 monooxygenases (P450s) are heme-thiolate proteins distributed across the biological kingdoms. P450s are catalytically versatile and play key roles in organisms primary and secondary metabolism. Identification of P450s across the biological kingdoms depends largely on the identification of two P450 signature motifs, EXXR and CXG, in the protein sequence. Once a putative protein has been identified as P450, it will be assigned to a family and subfamily based on the criteria that P450s within a family share more than 40% homology and members of subfamilies share more than 55% homology. However, to date, no evidence has been presented that can distinguish members of a P450 family. Here, for the first time we report the identification of EXXR- and CXG-motifs-based amino acid patterns that are characteristic of the P450 family. Analysis of P450 signature motifs in the under-explored fungal P450s from four different phyla, ascomycota, basidiomycota, zygomycota and chytridiomycota, indicated that the EXXR motif is highly variable and the CXG motif is somewhat variable. The amino acids threonine and leucine are preferred as second and third amino acids in the EXXR motif and proline and glycine are preferred as second and third amino acids in the CXG motif in fungal P450s. Analysis of 67 P450 families from biological kingdoms such as plants, animals, bacteria and fungi showed conservation of a set of amino acid patterns characteristic of a particular P450 family in EXXR and CXG motifs. This suggests that during the divergence of P450 families from a common ancestor these amino acids patterns evolve and are retained in each P450 family as a signature of that family. The role of amino acid patterns characteristic of a P450 family in the structural and/or functional aspects of members of the P450 family is a topic for future research. PMID:24743800

  9. Conserved sequence-specific lincRNA-steroid receptor interactions drive transcriptional repression and direct cell fate

    SciTech Connect

    Hudson, William H.; Pickard, Mark R.; de Vera, Ian Mitchelle S.; Kuiper, Emily G.; Mourtada-Maarabouni, Mirna; Conn, Graeme L.; Kojetin, Douglas J.; Williams, Gwyn T.; Ortlund, Eric A.


    The majority of the eukaryotic genome is transcribed, generating a significant number of long intergenic noncoding RNAs (lincRNAs). Although lincRNAs represent the most poorly understood product of transcription, recent work has shown lincRNAs fulfill important cellular functions. In addition to low sequence conservation, poor understanding of structural mechanisms driving lincRNA biology hinders systematic prediction of their function. Here we report the molecular requirements for the recognition of steroid receptors (SRs) by the lincRNA growth arrest-specific 5 (Gas5), which regulates steroid-mediated transcriptional regulation, growth arrest and apoptosis. We identify the functional Gas5-SR interface and generate point mutations that ablate the SR-Gas5 lincRNA interaction, altering Gas5-driven apoptosis in cancer cell lines. Further, we find that the Gas5 SR-recognition sequence is conserved among haplorhines, with its evolutionary origin as a splice acceptor site. This study demonstrates that lincRNAs can recognize protein targets in a conserved, sequence-specific manner in order to affect critical cell functions.

  10. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  11. The basic helix-loop-helix leucine zipper transcription factor Mitf is conserved in Drosophila and functions in eye development.

    PubMed Central

    Hallsson, Jón H; Haflidadóttir, Benedikta S; Stivers, Chad; Odenwald, Ward; Arnheiter, Heinz; Pignoni, Francesca; Steingrímsson, Eiríkur


    The MITF protein is a member of the MYC family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors and is most closely related to the TFE3, TFEC, and TFEB proteins. In the mouse, MITF is required for the development of several different cell types, including the retinal pigment epithelial (RPE) cells of the eye. In Mitf mutant mice, the presumptive RPE cells hyperproliferate, abnormally express the retinal transcriptional regulator Pax6, and form an ectopic neural retina. Here we report the structure of the Mitf gene in Drosophila and demonstrate expression during embryonic development and in the eye-antennal imaginal disc. In vitro, transcriptional regulation by Drosophila Mitf, like its mouse counterpart, is modified by the Eyeless (Drosophila Pax6) transcription factor. In vivo, targeted expression of wild-type or dominant-negative Drosophila Mitf results in developmental abnormalities reminiscent of Mitf function in mouse eye development. Our results suggest that the Mitf gene is the original member of the Mitf-Tfe subfamily of bHLH-Zip proteins and that its developmental function is at least partially conserved between vertebrates and invertebrates. These findings further support the common origin of the vertebrate and invertebrate eyes. PMID:15166150

  12. Amphibian interorder nuclear transfer embryos reveal conserved embryonic gene transcription, but deficient DNA replication or chromosome segregation.


    Narbonne, Patrick; Gurdon, John B


    Early interspecies nuclear transfer (iNT) experiments suggested that a foreign nucleus may become permanently damaged after a few rounds of cell division in the cytoplasm of another species. That is, in some distant species combinations, nucleocytoplasmic hybrid (cybrid) blastula nuclei can no longer support development, even if they are back-transferred into their own kind of egg cytoplasm. We monitored foreign DNA amplification and RNA production by quantitative PCR (qPCR) and RT-qPCR in interorder amphibian hybrids and cybrids formed by the transfer of newt (Pleurodeles waltl) embryonic nuclei into intact and enucleated frog (Xenopus laevis) eggs. We found a dramatic reduction in the expansion of foreign DNA and cell numbers in developing cybrid embryos that correlated with reduced gene transcription. Interestingly, expansion in cell numbers was rescued by the recipient species (Xenopus) maternal genome in iNT hybrids, but it did not improve P. waltl DNA expansion or gene transcription. Also, foreign gene transcripts, normalized to DNA copy numbers, were mostly normal in both iNT hybrids and cybrids. Thus, incomplete foreign DNA replication and/or chromosome segregation during cell division may be the major form of nuclear damage occurring as a result of nuclear replication in a foreign cytoplasmic environment. It also shows that the mechanisms of embryonic gene transcription are highly conserved across amphibians and may not be a major cause of cybrid lethality.

  13. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC


    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  14. Rethinking transcription coupled DNA repair.


    Kamarthapu, Venu; Nudler, Evgeny


    Nucleotide excision repair (NER) is an evolutionarily conserved, multistep process that can detect a wide variety of DNA lesions. Transcription coupled repair (TCR) is a subpathway of NER that repairs the transcribed DNA strand faster than the rest of the genome. RNA polymerase (RNAP) stalled at DNA lesions mediates the recruitment of NER enzymes to the damage site. In this review we focus on a newly identified bacterial TCR pathway in which the NER enzyme UvrD, in conjunction with NusA, plays a major role in initiating the repair process. We discuss the tradeoff between the new and conventional models of TCR, how and when each pathway operates to repair DNA damage, and the necessity of pervasive transcription in maintaining genome integrity.

  15. Identification and Characterization of Elf1, a Conserved Transcription Elongation Factor in Saccharomyces cerevisiae

    PubMed Central

    Prather, Donald; Krogan, Nevan J.; Emili, Andrew; Greenblatt, Jack F.; Winston, Fred


    In order to identify previously unknown transcription elongation factors, a genetic screen was carried out to identify mutations that cause lethality when combined with mutations in the genes encoding the elongation factors TFIIS and Spt6. This screen identified a mutation in YKL160W, hereafter named ELF1 (elongation factor 1). Further analysis identified synthetic lethality between an elf1Δ mutation and mutations in genes encoding several known elongation factors, including Spt4, Spt5, Spt6, and members of the Paf1 complex. Genome-wide synthetic lethality studies confirmed that elf1Δ specifically interacts with mutations in genes affecting transcription elongation. Chromatin immunoprecipitation experiments show that Elf1 is cotranscriptionally recruited over actively transcribed regions and that this association is partially dependent on Spt4 and Spt6. Analysis of elf1Δ mutants suggests a role for this factor in maintaining proper chromatin structure in regions of active transcription. Finally, purification of Elf1 suggests an association with casein kinase II, previously implicated in roles in transcription. Together, these results suggest an important role for Elf1 in the regulation of transcription elongation. PMID:16260625

  16. A Conserved Structural Module Regulates Transcriptional Responses to Diverse Stress Signals in Bacteria

    PubMed Central

    Campbell, Elizabeth A.; Greenwell, Roger; Anthony, Jennifer R.; Wang, Sheng; Lim, Lionel; Das, Kalyan; Sofia, Heidi J.; Donohue, Timothy J.; Darst, Seth A.


    SUMMARY A transcriptional response to singlet oxygen in Rhodobacter sphaeroides is controlled by the group IV σ factor σE and its cognate anti-σ ChrR. Crystal structures of the σE/ChrR complex reveal a modular, two-domain architecture for ChrR. The ChrR N-terminal anti-σ domain (ASD) binds a Zn2+ ion, contacts σE, and is sufficient to inhibit σE-dependent transcription. The ChrR C-terminal domain adopts a cupin fold, can coordinate an additional Zn2+, and is required for the transcriptional response to singlet oxygen. Structure-based sequence analyses predict that the ASD defines a common structural fold among predicted group IV antiσs. These ASDs are fused to diverse C-terminal domains that are likely involved in responding to specific environmental signals that control the activity of their cognate σ factor. PMID:17803943

  17. Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone.


    Melia, Tisha; Hao, Pengying; Yilmaz, Feyza; Waxman, David J


    Long intergenic noncoding RNAs (lincRNAs) are increasingly recognized as key chromatin regulators, yet few studies have characterized lincRNAs in a single tissue under diverse conditions. Here, we analyzed 45 mouse liver RNA sequencing (RNA-Seq) data sets collected under diverse conditions to systematically characterize 4,961 liver lincRNAs, 59% of them novel, with regard to gene structures, species conservation, chromatin accessibility, transcription factor binding, and epigenetic states. To investigate the potential for functionality, we focused on the responses of the liver lincRNAs to growth hormone stimulation, which imparts clinically relevant sex differences to hepatic metabolism and liver disease susceptibility. Sex-biased expression characterized 247 liver lincRNAs, with many being nuclear RNA enriched and regulated by growth hormone. The sex-biased lincRNA genes are enriched for nearby and correspondingly sex-biased accessible chromatin regions, as well as sex-biased binding sites for growth hormone-regulated transcriptional activators (STAT5, hepatocyte nuclear factor 6 [HNF6], FOXA1, and FOXA2) and transcriptional repressors (CUX2 and BCL6). Repression of female-specific lincRNAs in male liver, but not that of male-specific lincRNAs in female liver, was associated with enrichment of H3K27me3-associated inactive states and poised (bivalent) enhancer states. Strikingly, we found that liver-specific lincRNA gene promoters are more highly species conserved and have a significantly higher frequency of proximal binding by liver transcription factors than liver-specific protein-coding gene promoters. Orthologs for many liver lincRNAs were identified in one or more supraprimates, including two rat lincRNAs showing the same growth hormone-regulated, sex-biased expression as their mouse counterparts. This integrative analysis of liver lincRNA chromatin states, transcription factor occupancy, and growth hormone regulation provides novel insights into the

  18. Regulation of Nav1.7: A Conserved SCN9A Natural Antisense Transcript Expressed in Dorsal Root Ganglia.


    Koenig, Jennifer; Werdehausen, Robert; Linley, John E; Habib, Abdella M; Vernon, Jeffrey; Lolignier, Stephane; Eijkelkamp, Niels; Zhao, Jing; Okorokov, Andrei L; Woods, C Geoffrey; Wood, John N; Cox, James J


    The Nav1.7 voltage-gated sodium channel, encoded by SCN9A, is critical for human pain perception yet the transcriptional and post-transcriptional mechanisms that regulate this gene are still incompletely understood. Here, we describe a novel natural antisense transcript (NAT) for SCN9A that is conserved in humans and mice. The NAT has a similar tissue expression pattern to the sense gene and is alternatively spliced within dorsal root ganglia. The human and mouse NATs exist in cis with the sense gene in a tail-to-tail orientation and both share sequences that are complementary to the terminal exon of SCN9A/Scn9a. Overexpression analyses of the human NAT in human embryonic kidney (HEK293A) and human neuroblastoma (SH-SY5Y) cell lines show that it can function to downregulate Nav1.7 mRNA, protein levels and currents. The NAT may play an important role in regulating human pain thresholds and is a potential candidate gene for individuals with chronic pain disorders that map to the SCN9A locus, such as Inherited Primary Erythromelalgia, Paroxysmal Extreme Pain Disorder and Painful Small Fibre Neuropathy, but who do not contain mutations in the sense gene. Our results strongly suggest the SCN9A NAT as a prime candidate for new therapies based upon augmentation of existing antisense RNAs in the treatment of chronic pain conditions in man.

  19. Novel PDE10A transcript diversity in the human striatum: Insights into gene complexity, conservation and regulation.


    MacMullen, Courtney M; Fallahi, Mohammad; Davis, Ronald L


    PDE10A is a cAMP/cGMP phosphodiesterase important in signal transduction within medium spiny neurons of the human striatum. This gene region has been associated with bipolar disorder via case-control and linkage studies. The three most studied human PDE10A isoforms differ in both their N-termini and trafficking within the cell with PDE10A2 found predominantly at the plasma membrane and PDE10A1 and PDE10A19 remaining primarily within the cytosol. RNA-sequencing and 5' RLM-RACE studies of the human putamen and caudate nucleus revealed 16 new exons and 12 novel transcripts of PDE10A, 3 of which are predicted to produce proteins with unique N-termini. The novel first exons of these transcripts are highly conserved in non-human primate species and are rarely found in other mammals. One hundred and eight previously classified intronic SNPs were found within the novel PDE10A exons of which 78% were classified as rare variants. Since most of the rare variants localize to 5' UTR regions, they may influence PDE10A transcription, translation, or mRNA stability. Dysregulation of cAMP signaling has been proposed as a cause of bipolar disorder and PDE10A inhibitors have been investigated as potential therapeutics for schizophrenia. Understanding the mechanisms contributing to PDE10A expression in the human striatum may provide evidence linking this gene to the phenotypes observed in neuropsychiatric disorders.

  20. A Conserved Transcript Pattern in Response to a Specialist and a Generalist HerbivoreW⃞

    PubMed Central

    Reymond, Philippe; Bodenhausen, Natacha; Van Poecke, Remco M.P.; Krishnamurthy, Venkatesh; Dicke, Marcel; Farmer, Edward E.


    Transcript patterns elicited in response to attack reveal, at the molecular level, how plants respond to aggressors. These patterns are fashioned both by inflicted physical damage as well as by biological components displayed or released by the attacker. Different types of attacking organisms might therefore be expected to elicit different transcription programs in the host. Using a large-scale DNA microarray, we characterized gene expression in damaged as well as in distal Arabidopsis thaliana leaves in response to the specialist insect, Pieris rapae. More than 100 insect-responsive genes potentially involved in defense were identified, including genes involved in pathogenesis, indole glucosinolate metabolism, detoxification and cell survival, and signal transduction. Of these 114 genes, 111 were induced in Pieris feeding, and only three were repressed. Expression patterns in distal leaves were markedly similar to those of local leaves. Analysis of wild-type and jasmonate mutant plants, coupled with jasmonate treatment, showed that between 67 and 84% of Pieris-regulated gene expression was controlled, totally or in part, by the jasmonate pathway. This was correlated with increased larval performance on the coronatine insensitive1 glabrous1 (coi1-1 gl1) mutant. Independent mutations in COI1 and GL1 led to a faster larval weight gain, but the gl1 mutation had relatively little effect on the expression of the insect-responsive genes examined. Finally, we compared transcript patterns in Arabidopis in response to larvae of the specialist P. rapae and to a generalist insect, Spodoptera littoralis. Surprisingly, given the complex nature of insect salivary components and reported differences between species, almost identical transcript profiles were observed. This study also provides a robustly characterized gene set for the further investigation of plant–insect interaction. PMID:15494554

  1. A conserved role for Snail as a potentiator of active transcription

    PubMed Central

    Rembold, Martina; Ciglar, Lucia; Yáñez-Cuna, J. Omar; Zinzen, Robert P.; Girardot, Charles; Jain, Ankit; Welte, Michael A.; Stark, Alexander; Leptin, Maria; Furlong, Eileen E.M.


    The transcription factors of the Snail family are key regulators of epithelial–mesenchymal transitions, cell morphogenesis, and tumor metastasis. Since its discovery in Drosophila ∼25 years ago, Snail has been extensively studied for its role as a transcriptional repressor. Here we demonstrate that Drosophila Snail can positively modulate transcriptional activation. By combining information on in vivo occupancy with expression profiling of hand-selected, staged snail mutant embryos, we identified 106 genes that are potentially directly regulated by Snail during mesoderm development. In addition to the expected Snail-repressed genes, almost 50% of Snail targets showed an unanticipated activation. The majority of “Snail-activated” genes have enhancer elements cobound by Twist and are expressed in the mesoderm at the stages of Snail occupancy. Snail can potentiate Twist-mediated enhancer activation in vitro and is essential for enhancer activity in vivo. Using a machine learning approach, we show that differentially enriched motifs are sufficient to predict Snail's regulatory response. In silico mutagenesis revealed a likely causative motif, which we demonstrate is essential for enhancer activation. Taken together, these data indicate that Snail can potentiate enhancer activation by collaborating with different activators, providing a new mechanism by which Snail regulates development. PMID:24402316

  2. A Conserved Structural Module Regulates Transcriptional Responses to Diverse Stress Signals in Eubacteria

    SciTech Connect

    Campbell,E.; Greenwell, R.; Anthony, J.; Wang, S.; Lim, L.; Das, K.; Sofia, H.; Donohue, T.; Darst, S.


    A transcriptional response to singlet oxygen in Rhodobacter sphaeroides is controlled by the group IV {sigma} factor {sigma}{sup E} and its cognate anti-{sigma} ChrR. Crystal structures of the {sigma}{sup E}/ChrR complex reveal a modular, two-domain architecture for ChrR. The ChrR N-terminal anti-{sigma} domain (ASD) binds a Zn{sup 2+} ion, contacts {sigma}{sup E}, and is sufficient to inhibit {sigma}{sup E}-dependent transcription. The ChrR C-terminal domain adopts a cupin fold, can coordinate an additional Zn{sup 2+}, and is required for the transcriptional response to singlet oxygen. Structure-based sequence analyses predict that the ASD defines a common structural fold among predicted group IV anti-{sigma}s. These ASDs are fused to diverse C-terminal domains that are likely involved in responding to specific environmental signals that control the activity of their cognate {sigma} factor.

  3. Minimal promoter systems reveal the importance of conserved residues in the B-finger of human transcription factor IIB.


    Thompson, Nancy E; Glaser, Bryan T; Foley, Katherine M; Burton, Zachary F; Burgess, Richard R


    The "B-finger" of transcription factor IIB (TFIIB) is highly conserved and believed to play a role in the initiation process. We performed alanine substitutions across the B-finger of human TFIIB, made change-of-charge mutations in selected residues, and substituted the B-finger sequence from other organisms. Mutant proteins were examined in two minimal promoter systems (containing only RNA polymerase II, TATA-binding protein, and TFIIB) and in a complex system, using TFIIB-immunodepleted HeLa cell nuclear extract (NE). Mutations in conserved residues located on the sides of the B-finger had the greatest effect on activity in both minimal promoter systems, with mutations in residues Glu-51 and Arg-66 eliminating activity. The double change-of-charge mutant (E51R:R66E) did not show activity in either minimal promoter system. Mutations in the nonconserved residues at the tip of the B-finger did not significantly affect activity. However, all of the mutations in the B-finger showed at least 25% activity in the HeLa cell NE. Chimeric proteins, containing B-finger sequences from species with conserved residues on the side of the B-finger, showed wild-type activity in a minimal promoter system and in the HeLa cell NE. However, chimeric proteins whose sequence showed divergence on the sides of the B-finger had reduced activity. Transcription factor IIF (TFIIF) partially restored activity of the inactive mutants in the minimal promoter system, suggesting that TFIIF in HeLa cell NE helps to rescue the inactive mutations by interacting with either the B-finger or another component of the initiation complex that is influenced by the B-finger.

  4. Conserved themes in target recognition by the PAH1 and PAH2 domains of the Sin3 transcriptional corepressor.


    Sahu, Sarata C; Swanson, Kurt A; Kang, Richard S; Huang, Kai; Brubaker, Kurt; Ratcliff, Kathleen; Radhakrishnan, Ishwar


    The recruitment of chromatin-modifying coregulator complexes by transcription factors to specific sites of the genome constitutes an important step in many eukaryotic transcriptional regulatory pathways. The histone deacetylase-associated Sin3 corepressor complex is recruited by a large and diverse array of transcription factors through direct interactions with the N-terminal PAH domains of Sin3. Here, we describe the solution structures of the mSin3A PAH1 domain in the apo form and when bound to SAP25, a component of the corepressor complex. Unlike the apo-mSin3A PAH2 domain, the apo-PAH1 domain is conformationally pure and is largely, but not completely, folded. Portions of the interacting segments of both mSin3A PAH1 and SAP25 undergo folding upon complex formation. SAP25 binds through an amphipathic helix to a predominantly hydrophobic cleft on the surface of PAH1. Remarkably, the orientation of the helix is reversed compared to that adopted by NRSF, a transcription factor unrelated to SAP25, upon binding to the mSin3B PAH1 domain. The reversal in helical orientations is correlated with a reversal in the underlying PAH1-interaction motifs, echoing a theme previously described for the mSin3A PAH2 domain. The definition of these so-called type I and type II PAH1-interaction motifs has allowed us to predict the precise location of these motifs within previously experimentally characterized PAH1 binders. Finally, we explore the specificity determinants of protein-protein interactions involving the PAH1 and PAH2 domains. These studies reveal that even conservative replacements of PAH2 residues with equivalent PAH1 residues are sufficient to alter the affinity and specificity of these protein-protein interactions dramatically.

  5. Regulation of tyrosine hydroxylase transcription by hnRNP K and DNA secondary structure

    PubMed Central

    Banerjee, Kasturi; Wang, Meng; Cai, Elizabeth; Fujiwara, Nana; Baker, Harriet; Cave, John W.


    Regulation of tyrosine hydroxylase gene (Th) transcription is critical for specifying and maintaining the dopaminergic neuronal phenotype. Here we define a molecular regulatory mechanism for Th transcription conserved in tetrapod vertebrates. We show that heterogeneous nuclear ribonucleoprotein (hnRNP) K is a transactivator of Th transcription. It binds to previously unreported and evolutionarily conserved G:C-rich regions in the Th proximal promoter. hnRNP K directly binds C-rich single DNA strands within these conserved regions and also associates with double-stranded sequences when proteins, such as CREB, are bound to an adjacent cis-regulatory element. The single DNA strands within the conserved G:C-rich regions adopt either G-quadruplex or i-motif secondary structures. We also show that small molecule-mediated stabilization of these secondary structures represses Th promoter activity. These data suggest that these secondary structures are targets for pharmacological modulation of the dopaminergic phenotype. PMID:25493445

  6. An evolutionary conserved interaction between the Gcm transcription factor and the SF1 nuclear receptor in the female reproductive system.


    Cattenoz, Pierre B; Delaporte, Claude; Bazzi, Wael; Giangrande, Angela


    NR5A1 is essential for the development and for the function of steroid producing glands of the reproductive system. Moreover, its misregulation is associated with endometriosis, which is the first cause of infertility in women. Hr39, the Drosophila ortholog of NR5A1, is expressed and required in the secretory cells of the spermatheca, the female exocrine gland that ensures fertility by secreting substances that attract and capacitate the spermatozoids. We here identify a direct regulator of Hr39 in the spermatheca: the Gcm transcription factor. Furthermore, lack of Gcm prevents the production of the secretory cells and leads to female sterility in Drosophila. Hr39 regulation by Gcm seems conserved in mammals and involves the modification of the DNA methylation profile of mNr5a1. This study identifies a new molecular pathway in female reproductive system development and suggests a role for hGCM in the progression of reproductive tract diseases in humans.

  7. Integrated, multi-cohort analysis identifies conserved transcriptional signatures across multiple respiratory viruses

    PubMed Central

    Andres-Terre, Marta; McGuire, Helen M; Pouliot, Yannick; Bongen, Erika; Sweeney, Timothy E.; Tato, Cristina M; Khatri, Purvesh


    Respiratory viral infections are a significant burden to healthcare worldwide. Many whole genome expression profiles have identified different respiratory viral infection signatures, but these have not translated to clinical practice. Here, we performed two integrated, multi-cohort analyses of publicly available transcriptional data of viral infections. First, we identified a common host signature across different respiratory viral infections that could distinguish (a) individuals with viral infections from healthy controls and from those with bacterial infections, and (b) symptomatic from asymptomatic subjects prior to symptom onset in challenge studies. Second, we identified an influenza-specific host response signature that (a) could distinguish influenza-infected samples from those with bacterial and other respiratory viral infections, (b) was a diagnostic and prognostic marker in influenza-pneumonia patients and influenza challenge studies, and (c) was predictive of response to influenza vaccine. Our results have applications in the diagnosis, prognosis, and identification of drug targets in viral infections. PMID:26682989

  8. Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.

    PubMed Central

    Katsani, K R; Hajibagheri, M A; Verrijzer, C P


    The POZ domain is a conserved protein-protein interaction motif present in a variety of transcription factors involved in development, chromatin remodelling and human cancers. Here, we study the role of the POZ domain of the GAGA transcription factor in promoter recognition. Natural target promoters for GAGA typically contain multiple GAGA-binding elements. Our results show that the POZ domain mediates strong co-operative binding to multiple sites but inhibits binding to single sites. Protein cross-linking and gel filtration chromatography experiments established that the POZ domain is required for GAGA oligomerization into higher order complexes. Thus, GAGA oligomerization increases binding specificity by selecting only promoters with multiple sites. Electron microscopy revealed that GAGA binds to multiple sites as a large oligomer and induces bending of the promoter DNA. Our results indicate a novel mode of DNA binding by GAGA, in which a large GAGA complex binds multiple GAGA elements that are spread out over a region of a few hundred base pairs. We suggest a model in which the promoter DNA is wrapped around a GAGA multimer in a conformation that may exclude normal nucleosome formation. PMID:9927429

  9. Sexually Dimorphic Differentiation of a C. elegans Hub Neuron Is Cell Autonomously Controlled by a Conserved Transcription Factor.


    Serrano-Saiz, Esther; Oren-Suissa, Meital; Bayer, Emily A; Hobert, Oliver


    Functional and anatomical sexual dimorphisms in the brain are either the result of cells that are generated only in one sex or a manifestation of sex-specific differentiation of neurons present in both sexes. The PHC neuron pair of the nematode C. elegans differentiates in a strikingly sex-specific manner. In hermaphrodites the PHC neurons display a canonical pattern of synaptic connectivity similar to that of other sensory neurons, but in males PHC differentiates into a densely connected hub sensory neuron/interneuron, integrating a large number of male-specific synaptic inputs and conveying them to both male-specific and sex-shared circuitry. We show that the differentiation into such a hub neuron involves the sex-specific scaling of several components of the synaptic vesicle machinery, including the vesicular glutamate transporter eat-4/VGLUT, induction of neuropeptide expression, changes in axonal projection morphology, and a switch in neuronal function. We demonstrate that these molecular and anatomical remodeling events are controlled cell autonomously by the phylogenetically conserved Doublesex homolog dmd-3, which is both required and sufficient for sex-specific PHC differentiation. Cellular specificity of dmd-3 action is ensured by its collaboration with non-sex-specific terminal selector-type transcription factors, whereas the sex specificity of dmd-3 action is ensured by the hermaphrodite-specific transcriptional master regulator of hermaphroditic cell identity tra-1, which represses the transcription of dmd-3 in hermaphrodite PHC. Taken together, our studies provide mechanistic insights into how neurons are specified in a sexually dimorphic manner.

  10. Functional cross-kingdom conservation of mammalian and moss (Physcomitrella patens) transcription, translation and secretion machineries.


    Gitzinger, Marc; Parsons, Juliana; Reski, Ralf; Fussenegger, Martin


    Plants and mammals are separated by a huge evolutionary distance. Consequently, biotechnology and genetics have traditionally been divided into 'green' and 'red'. Here, we provide comprehensive evidence that key components of the mammalian transcription, translation and secretion machineries are functional in the model plant Physcomitrella patens. Cross-kingdom compatibility of different expression modalities originally designed for mammalian cells, such as native and synthetic promoters and polyadenylation sites, viral and cellular internal ribosome entry sites, secretion signal peptides and secreted product proteins, and synthetic transactivators and transrepressors, was established. This mammalian expression portfolio enabled constitutive, conditional and autoregulated expression of different product genes in a multicistronic expression format, optionally adjusted by various trigger molecules, such as butyrolactones, macrolide antibiotics and ethanol. Capitalizing on a cross-kingdom-compatible expression platform, we pioneered a prototype biopharmaceutical manufacturing scenario using microencapsulated transgenic P. patens protoplasts cultivated in a Wave Bioreactor. Vascular endothelial growth factor 121 (VEGF(121)) titres matched those typically achieved by standard protonema populations grown in stirred-tank bioreactors. The full compatibility of mammalian expression systems in P. patens further promotes the use of moss as a cost-effective alternative for the manufacture of complex biopharmaceuticals, and as a valuable host system to advance synthetic biology in plants.

  11. The Highly Conserved Escherichia coli Transcription Factor YhaJ Regulates Aromatic Compound Degradation

    PubMed Central

    Palevsky, Noa; Shemer, Benjamin; Connolly, James P. R.; Belkin, Shimshon


    The aromatic compound 2,4-dinitrotoluene (DNT), a common impurity in 2,4,6-trinitrotoluene (TNT) production, has been suggested as a tracer for the presence of TNT-based landmines due to its stability and high volatility. We have previously described an Escherichia coli bioreporter capable of detecting the presence of DNT vapors, harboring a fusion of the yqjF gene promoter to a reporter element. However, the DNT metabolite which is the direct inducer of yqjF, has not yet been identified, nor has the regulatory mechanism of the induction been clarified. We demonstrate here that the YhaJ protein, a member of the LysR type family, acts as a transcriptional regulator of yqjF activation, as well as of a panel of additional E. coli genes. This group of genes share a common sequence motif in their promoters, which is suggested here as a putative YhaJ-box. In addition, we have linked YhaJ to the regulation of quinol-like compound degradation in the cell, and identified yhaK as playing a role in the degradation of DNT. PMID:27713734

  12. High conservation of a 5' element required for RNA editing of a C target in chloroplast psbE transcripts.


    Hayes, Michael L; Hanson, Maureen R


    C-to-U editing modifies 30-40 distinct nucleotides within higher-plant chloroplast transcripts. Many C targets are located at the same position in homologous genes from different plants; these either could have emerged independently or could share a common origin. The 5' sequence GCCGUU, required for editing of C214 in tobacco psbE in vitro, is one of the few identified editing cis-elements. We investigated psbE sequences from many plant species to determine in what lineage(s) editing of psbE C214 emerged and whether the cis-element identified in tobacco is conserved in plants with a C214. The GCCGUU sequence is present at a high frequency in plants that carry a C214 in psbE. However, Sciadopitys verticillata (Pinophyta) edits C214 despite the presence of nucleotide differences compared to the conserved cis-element. The C214 site in psbE genes is represented in members of four branches of spermatophytes but not in gnetophytes, resulting in the parsimonious prediction that editing of psbE C214 was present in the ancestor of spermatophytes. Extracts from chloroplasts from a species that has a difference in the motif and lacks the C target are incapable of editing tobacco psbE C214 substrates, implying that the critical trans-acting protein factors were not retained without a C target. Because noncoding sequences are less constrained than coding regions, we analyzed sequences 5' to two C editing targets located within coding regions to search for possible editing-related conserved elements. Putative editing cis-elements were uncovered in the 5' UTRs near editing sites psbL C2 and ndhD C2.

  13. Yeast general transcription factor GFI: sequence requirements for binding to DNA and evolutionary conservation.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A


    GFI is an abundant DNA binding protein in the yeast S. cerevisiae. The protein binds to specific sequences in both ARS elements and the upstream regions of a large number of genes and is likely to play an important role in yeast cell growth. To get insight into the relative strength of the various GFI-DNA binding sites within the yeast genome, we have determined dissociation rates for several GFI-DNA complexes and found them to vary over a 70-fold range. Strong binding sites for GFI are present in the upstream activating sequences of the gene encoding the 40 kDa subunit II of the QH2:cytochrome c reductase, the gene encoding ribosomal protein S33 and in the intron of the actin gene. The binding site in the ARS1-TRP1 region is of intermediate strength. All strong binding sites conform to the sequence 5' RTCRYYYNNNACG-3'. Modification interference experiments and studies with mutant binding sites indicate that critical bases for GFI recognition are within the two elements of the consensus DNA recognition sequence. Proteins with the DNA binding specificities of GFI and GFII can also be detected in the yeast K. lactis, suggesting evolutionary conservation of at least the respective DNA-binding domains in both yeasts. Images PMID:2187179

  14. Crystal Structures of Two Transcriptional Regulators from Bacillus cereus Define the Conserved Structural Features of a PadR Subfamily

    PubMed Central

    Fibriansah, Guntur; Kovács, Ákos T.; Pool, Trijntje J.; Boonstra, Mirjam; Kuipers, Oscar P.; Thunnissen, Andy-Mark W. H.


    PadR-like transcriptional regulators form a structurally-related family of proteins that control the expression of genes associated with detoxification, virulence and multi-drug resistance in bacteria. Only a few members of this family have been studied by genetic, biochemical and biophysical methods, and their structure/function relationships are still largely undefined. Here, we report the crystal structures of two PadR-like proteins from Bacillus cereus, which we named bcPadR1 and bcPadR2 (products of gene loci BC4206 and BCE3449 in strains ATCC 14579 and ATCC 10987, respectively). BC4206, together with its neighboring gene BC4207, was previously shown to become significantly upregulated in presence of the bacteriocin AS-48. DNA mobility shift assays reveal that bcPadR1 binds to a 250 bp intergenic region containing the putative BC4206–BC4207 promoter sequence, while in-situ expression of bcPadR1 decreases bacteriocin tolerance, together suggesting a role for bcPadR1 as repressor of BC4206–BC4207 transcription. The function of bcPadR2 (48% identical in sequence to bcPadR1) is unknown, but the location of its gene just upstream from genes encoding a putative antibiotic ABC efflux pump, suggests a role in regulating antibiotic resistance. The bcPadR proteins are structurally similar to LmrR, a PadR-like transcription regulator in Lactococcus lactis that controls expression of a multidrug ABC transporter via a mechanism of multidrug binding and induction. Together these proteins define a subfamily of conserved, relatively small PadR proteins characterized by a single C-terminal helix for dimerization. Unlike LmrR, bcPadR1 and bcPadR2 lack a central pore for ligand binding, making it unclear whether the transcriptional regulatory roles of bcPadR1 and bcPadR2 involve direct ligand recognition and induction. PMID:23189126

  15. A belief-based evolutionarily stable strategy.


    Deng, Xinyang; Wang, Zhen; Liu, Qi; Deng, Yong; Mahadevan, Sankaran


    As an equilibrium refinement of the Nash equilibrium, evolutionarily stable strategy (ESS) is a key concept in evolutionary game theory and has attracted growing interest. An ESS can be either a pure strategy or a mixed strategy. Even though the randomness is allowed in mixed strategy, the selection probability of pure strategy in a mixed strategy may fluctuate due to the impact of many factors. The fluctuation can lead to more uncertainty. In this paper, such uncertainty involved in mixed strategy has been further taken into consideration: a belief strategy is proposed in terms of Dempster-Shafer evidence theory. Furthermore, based on the proposed belief strategy, a belief-based ESS has been developed. The belief strategy and belief-based ESS can reduce to the mixed strategy and mixed ESS, which provide more realistic and powerful tools to describe interactions among agents.

  16. Evolutionarily stable sex ratios and mutation load.


    Hough, Josh; Immler, Simone; Barrett, Spencer C H; Otto, Sarah P


    Frequency-dependent selection should drive dioecious populations toward a 1:1 sex ratio, but biased sex ratios are widespread, especially among plants with sex chromosomes. Here, we develop population genetic models to investigate the relationships between evolutionarily stable sex ratios, haploid selection, and deleterious mutation load. We confirm that when haploid selection acts only on the relative fitness of X- and Y-bearing pollen and the sex ratio is controlled by the maternal genotype, seed sex ratios evolve toward 1:1. When we also consider haploid selection acting on deleterious mutations, however, we find that biased sex ratios can be stably maintained, reflecting a balance between the advantages of purging deleterious mutations via haploid selection, and the disadvantages of haploid selection on the sex ratio. Our results provide a plausible evolutionary explanation for biased sex ratios in dioecious plants, given the extensive gene expression that occurs across plant genomes at the haploid stage.

  17. Changing a conserved amino acid in R2R3-MYB transcription repressors results in cytoplasmic accumulation and abolishes their repressive activity in Arabidopsis.


    Zhou, Meiliang; Sun, Zhanmin; Wang, Chenglong; Zhang, Xinquan; Tang, Yixiong; Zhu, Xuemei; Shao, Jirong; Wu, Yanmin


    Sub-group 4 R2R3-type MYB transcription factors, including MYB3, MYB4, MYB7 and MYB32, act as repressors in phenylpropanoid metabolism. These proteins contain the conserved MYB domain and the ethylene-responsive element binding factor-associated amphiphilic repression (EAR) repression domain. Additionally, MYB4, MYB7 and MYB32 possess a putative zinc-finger domain and a conserved GY/FDFLGL motif in their C-termini. The protein 'sensitive to ABA and drought 2' (SAD2) recognizes the nuclear pore complex, which then transports the SAD2-MYB4 complex into the nucleus. Here, we show that the conserved GY/FDFLGL motif contributes to the interaction between MYB factors and SAD2. The Asp → Asn mutation in the GY/FDFLGL motif abolishes the interaction between MYB transcription factors and SAD2, and therefore they cannot be transported into the nucleus and cannot repress their target genes. We found that MYB4(D261N) loses the capacity to repress expression of the cinnamate 4-hydroxylase (C4H) gene and biosynthesis of sinapoyl malate. Our results indicate conservation among MYB transcription factors in terms of their interaction with SAD2. Therefore, the Asp → Asn mutation may be used to engineer transcription factors.

  18. Arabidopsis NAC Transcription Factor JUNGBRUNNEN1 Exerts Conserved Control Over Gibberellin and Brassinosteroid Metabolism and Signaling Genes in Tomato

    PubMed Central

    Shahnejat-Bushehri, Sara; Allu, Annapurna D.; Mehterov, Nikolay; Thirumalaikumar, Venkatesh P.; Alseekh, Saleh; Fernie, Alisdair R.; Mueller-Roeber, Bernd; Balazadeh, Salma


    The Arabidopsis thaliana NAC transcription factor JUNGBRUNNEN1 (AtJUB1) regulates growth by directly repressing GA3ox1 and DWF4, two key genes involved in gibberellin (GA) and brassinosteroid (BR) biosynthesis, respectively, leading to GA and BR deficiency phenotypes. AtJUB1 also reduces the expression of PIF4, a bHLH transcription factor that positively controls cell elongation, while it stimulates the expression of DELLA genes, which are important repressors of growth. Here, we extend our previous findings by demonstrating that AtJUB1 induces similar GA and BR deficiency phenotypes and changes in gene expression when overexpressed in tomato (Solanum lycopersicum). Importantly, and in accordance with the growth phenotypes observed, AtJUB1 inhibits the expression of growth-supporting genes, namely the tomato orthologs of GA3ox1, DWF4 and PIF4, but activates the expression of DELLA orthologs, by directly binding to their promoters. Overexpression of AtJUB1 in tomato delays fruit ripening, which is accompanied by reduced expression of several ripening-related genes, and leads to an increase in the levels of various amino acids (mostly proline, β-alanine, and phenylalanine), γ-aminobutyric acid (GABA), and major organic acids including glutamic acid and aspartic acid. The fact that AtJUB1 exerts an inhibitory effect on the GA/BR biosynthesis and PIF4 genes but acts as a direct activator of DELLA genes in both, Arabidopsis and tomato, strongly supports the model that the molecular constituents of the JUNGBRUNNEN1 growth control module are considerably conserved across species. PMID:28326087

  19. Cytokinin Response Factor 5 has transcriptional activity governed by its C-terminal domain.


    Striberny, Bernd; Melton, Anthony E; Schwacke, Rainer; Krause, Kirsten; Fischer, Karsten; Goertzen, Leslie R; Rashotte, Aaron M


    Cytokinin Response Factors (CRFs) are AP2/ERF transcription factors involved in cytokinin signal transduction. CRF proteins consist of a N-terminal dimerization domain (CRF domain), an AP2 DNA-binding domain, and a clade-specific C-terminal region of unknown function. Using a series of sequential deletions in yeast-2-hybrid assays, we provide evidence that the C-terminal region of Arabidopsis CRF5 can confer transactivation activity. Although comparative analyses identified evolutionarily conserved protein sequence within the C-terminal region, deletion experiments suggest that this transactivation domain has a partially redundant modular structure required for activation of target gene transcription.

  20. Conserved role of Ovo in germline development in mouse and Drosophila

    PubMed Central

    Hayashi, Makoto; Shinozuka, Yuko; Shigenobu, Shuji; Sato, Masanao; Sugimoto, Michihiko; Ito, Seiji; Abe, Kuniya; Kobayashi, Satoru


    Ovo, which encodes a transcription factor with Zn-finger domains, is evolutionarily conserved among animals. In Drosophila, in addition to its zygotic function for egg production, maternal ovo activity is required in primordial germ cells (PGCs) for expression of germline genes such as vasa and nanos. In this study, we found that maternal Ovo accumulates in PGC nuclei during embryogenesis. In these cells, ovo serves a dual function: activation of genes expressed predominantly in PGCs, and conversely suppression of somatic genes. Reduction of ovo activity in PGCs makes them unable to develop normally into germ cells of both sexes. In mice, knockout of the ovo ortholog, Ovol2, which is expressed in PGCs, decreases the number of PGCs during early embryogenesis. These data strongly suggest that ovo acts as part of an evolutionarily conserved mechanism that regulates germline development in animals. PMID:28059165

  1. Human and mouse ZFY genes produce a conserved testis-specific transcript encoding a zinc finger protein with a short acidic domain and modified transactivation potential.


    Decarpentrie, Fanny; Vernet, Nadège; Mahadevaiah, Shantha K; Longepied, Guy; Streichemberger, Eric; Aknin-Seifer, Isabelle; Ojarikre, Obah A; Burgoyne, Paul S; Metzler-Guillemain, Catherine; Mitchell, Michael J


    Mammalian ZFY genes are located on the Y chromosome, and code putative transcription factors with 12-13 zinc fingers preceded by a large acidic (activating) domain. In mice, there are two genes, Zfy1 and Zfy2, which are expressed mainly in the testis. Their transcription increases in germ cells as they enter meiosis, both are silenced by meiotic sex chromosome inactivation (MSCI) during pachytene, and Zfy2 is strongly reactivated later in spermatids. Recently, we have shown that mouse Zfy2, but not Zfy1, is involved in triggering the apoptotic elimination of specific types of sex chromosomally aberrant spermatocytes. In humans, there is a single widely transcribed ZFY gene, and there is no evidence for a specific role in the testis. Here, we characterize ZFY transcription during spermatogenesis in mice and humans. In mice, we define a variety of Zfy transcripts, among which is a Zfy2 transcript that predominates in spermatids, and a Zfy1 transcript, lacking an exon encoding approximately half of the acidic domain, which predominates prior to MSCI. In humans, we have identified a major testis-specific ZFY transcript that encodes a protein with the same short acidic domain. This represents the first evidence that ZFY has a conserved function during human spermatogenesis. We further show that, in contrast to the full acidic domain, the short domain does not activate transcription in yeast, and we hypothesize that this explains the functional difference observed between Zfy1 and Zfy2 during mouse meiosis.

  2. Conserved XPB Core Structure and Motifs for DNA Unwinding:Implications for Pathway Selection of Transcription or ExcisionRepair

    SciTech Connect

    Fan, Li; Arval, Andrew S.; Cooper, Priscilla K.; Iwai, Shigenori; Hanaoka, Fumio; Tainer, John A.


    The human xeroderma pigmentosum group B (XPB) helicase is essential for transcription, nucleotide excision repair, and TFIIH functional assembly. Here, we determined crystal structures of an Archaeoglobus fulgidus XPB homolog (AfXPB) that characterize two RecA-like XPB helicase domains and discover a DNA damage recognition domain (DRD), a unique RED motif, a flexible thumb motif (ThM), and implied conformational changes within a conserved functional core. RED motif mutations dramatically reduce helicase activity, and the DRD and ThM, which flank the RED motif, appear structurally as well as functionally analogous to the MutS mismatch recognition and DNA polymerase thumb domains. Substrate specificity is altered by DNA damage, such that AfXPB unwinds dsDNA with 3' extensions, but not blunt-ended dsDNA, unless it contains a lesion, as shown for CPD or (6-4) photoproducts. Together, these results provide an unexpected mechanism of DNA unwinding with Implications for XPB damage verification in nucleotide excision repair.

  3. An evolutionary conserved interaction between the Gcm transcription factor and the SF1 nuclear receptor in the female reproductive system

    PubMed Central

    Cattenoz, Pierre B.; Delaporte, Claude; Bazzi, Wael; Giangrande, Angela


    NR5A1 is essential for the development and for the function of steroid producing glands of the reproductive system. Moreover, its misregulation is associated with endometriosis, which is the first cause of infertility in women. Hr39, the Drosophila ortholog of NR5A1, is expressed and required in the secretory cells of the spermatheca, the female exocrine gland that ensures fertility by secreting substances that attract and capacitate the spermatozoids. We here identify a direct regulator of Hr39 in the spermatheca: the Gcm transcription factor. Furthermore, lack of Gcm prevents the production of the secretory cells and leads to female sterility in Drosophila. Hr39 regulation by Gcm seems conserved in mammals and involves the modification of the DNA methylation profile of mNr5a1. This study identifies a new molecular pathway in female reproductive system development and suggests a role for hGCM in the progression of reproductive tract diseases in humans. PMID:27886257

  4. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms

    PubMed Central

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun


    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions. PMID:28107438

  5. Inferring Functional Relationships from Conservation of Gene Order.


    Moreno-Hagelsieb, Gabriel


    Predicting functional associations using the Gene Neighbor Method depends on the simple idea that if genes are conserved next to each other in evolutionarily distant prokaryotes they might belong to a polycistronic transcription unit. The procedure presented in this chapter starts with the organization of the genes within genomes into pairs of adjacent genes. Then, the pairs of adjacent genes in a genome of interest are mapped to their corresponding orthologs in other, informative, genomes. The final step is to verify if the mapped orthologs are also pairs of adjacent genes in the informative genomes.

  6. The Evolutionarily Stable Distribution of Fitness Effects

    PubMed Central

    Rice, Daniel P.; Good, Benjamin H.; Desai, Michael M.


    The distribution of fitness effects (DFE) of new mutations is a key parameter in determining the course of evolution. This fact has motivated extensive efforts to measure the DFE or to predict it from first principles. However, just as the DFE determines the course of evolution, the evolutionary process itself constrains the DFE. Here, we analyze a simple model of genome evolution in a constant environment in which natural selection drives the population toward a dynamic steady state where beneficial and deleterious substitutions balance. The distribution of fitness effects at this steady state is stable under further evolution and provides a natural null expectation for the DFE in a population that has evolved in a constant environment for a long time. We calculate how the shape of the evolutionarily stable DFE depends on the underlying population genetic parameters. We show that, in the absence of epistasis, the ratio of beneficial to deleterious mutations of a given fitness effect obeys a simple relationship independent of population genetic details. Finally, we analyze how the stable DFE changes in the presence of a simple form of diminishing-returns epistasis. PMID:25762525

  7. The evolutionarily stable distribution of fitness effects.


    Rice, Daniel P; Good, Benjamin H; Desai, Michael M


    The distribution of fitness effects (DFE) of new mutations is a key parameter in determining the course of evolution. This fact has motivated extensive efforts to measure the DFE or to predict it from first principles. However, just as the DFE determines the course of evolution, the evolutionary process itself constrains the DFE. Here, we analyze a simple model of genome evolution in a constant environment in which natural selection drives the population toward a dynamic steady state where beneficial and deleterious substitutions balance. The distribution of fitness effects at this steady state is stable under further evolution and provides a natural null expectation for the DFE in a population that has evolved in a constant environment for a long time. We calculate how the shape of the evolutionarily stable DFE depends on the underlying population genetic parameters. We show that, in the absence of epistasis, the ratio of beneficial to deleterious mutations of a given fitness effect obeys a simple relationship independent of population genetic details. Finally, we analyze how the stable DFE changes in the presence of a simple form of diminishing-returns epistasis.

  8. Uncovering ancient transcription systems with a novel evolutionary indicator

    PubMed Central

    Adachi, Naruhiko; Senda, Toshiya; Horikoshi, Masami


    TBP and TFIIB are evolutionarily conserved transcription initiation factors in archaea and eukaryotes. Information about their ancestral genes would be expected to provide insight into the origin of the RNA polymerase II-type transcription apparatus. In obtaining such information, the nucleotide sequences of current genes of both archaea and eukaryotes should be included in the analysis. However, the present methods of evolutionary analysis require that a subset of the genes should be excluded as an outer group. To overcome this limitation, we propose an innovative concept for evolutionary analysis that does not require an outer group. This approach utilizes the similarity in intramolecular direct repeats present in TBP and TFIIB as an evolutionary measure revealing the degree of similarity between the present offspring genes and their ancestors. Information on the properties of the ancestors and the order of emergence of TBP and TFIIB was also revealed. These findings imply that, for evolutionarily early transcription systems billions of years ago, interaction of RNA polymerase II with transcription initiation factors and the regulation of its enzymatic activity was required prior to the accurate positioning of the enzyme. Our approach provides a new way to discuss mechanistic and system evolution in a quantitative manner. PMID:27307191

  9. Lipopolysaccharide-induced inhibition of transcription of tlr4 in vitro is reversed by dexamethasone and correlates with presence of conserved NFκB binding sites

    SciTech Connect

    Bonin, Camila P.; Baccarin, Raquel Y.A.; Nostell, Katarina; Nahum, Laila A.; Fossum, Caroline; Camargo, Maristela M. de


    Highlights: ► Chimpanzees, horses and humans have regions of similarity on TLR4 and MD2 promoters. ► Rodents have few regions of similarity on TLR4 promoter when compared to primates. ► Conserved NFkB binding sites were found in the promoters of TLR4 and MD2. ► LPS-induced inhibition of TLR4 transcription is reversed by dexamethasone. ► LPS-induced transcription of MD2 is inhibited by dexamethasone. -- Abstract: Engagement of Toll-like receptor 4 (TLR4) by lipopolysaccharide (LPS) is a master trigger of the deleterious effects of septic shock. Horses and humans are considered the most sensitive species to septic shock, but the mechanisms explaining these phenomena remain elusive. Analysis of tlr4 promoters revealed high similarity among LPS-sensitive species (human, chimpanzee, and horse) and low similarity with LPS-resistant species (mouse and rat). Four conserved nuclear factor kappa B (NFκB) binding sites were found in the tlr4 promoter and two in the md2 promoter sequences that are likely to be targets for dexamethasone regulation. In vitro treatment of equine peripheral blood mononuclear cells (eqPBMC) with LPS decreased transcripts of tlr4 and increased transcription of md2 (myeloid differentiation factor 2) and cd14 (cluster of differentiation 14). Treatment with dexamethasone rescued transcription of tlr4 after LPS inhibition. LPS-induced transcription of md2 was inhibited in the presence of dexamethasone. Dexamethasone alone did not affect transcription of tlr4 and md2.

  10. A Phylogenetically Conserved Group of Nuclear Factor-Y Transcription Factors Interact to Control Nodulation in Legumes.


    Baudin, Maël; Laloum, Tom; Lepage, Agnès; Rípodas, Carolina; Ariel, Federico; Frances, Lisa; Crespi, Martin; Gamas, Pascal; Blanco, Flavio Antonio; Zanetti, Maria Eugenia; de Carvalho-Niebel, Fernanda; Niebel, Andreas


    The endosymbiotic association between legumes and soil bacteria called rhizobia leads to the formation of a new root-derived organ called the nodule in which differentiated bacteria convert atmospheric nitrogen into a form that can be assimilated by the host plant. Successful root infection by rhizobia and nodule organogenesis require the activation of symbiotic genes that are controlled by a set of transcription factors (TFs). We recently identified Medicago truncatula nuclear factor-YA1 (MtNF-YA1) and MtNF-YA2 as two M. truncatula TFs playing a central role during key steps of the Sinorhizobium meliloti-M. truncatula symbiotic interaction. NF-YA TFs interact with NF-YB and NF-YC subunits to regulate target genes containing the CCAAT box consensus sequence. In this study, using a yeast two-hybrid screen approach, we identified the NF-YB and NF-YC subunits able to interact with MtNF-YA1 and MtNF-YA2. In yeast (Saccharomyces cerevisiae) and in planta, we further demonstrated by both coimmunoprecipitation and bimolecular fluorescence complementation that these NF-YA, -B, and -C subunits interact and form a stable NF-Y heterotrimeric complex. Reverse genetic and chromatin immunoprecipitation-PCR approaches revealed the importance of these newly identified NF-YB and NF-YC subunits for rhizobial symbiosis and binding to the promoter of MtERN1 (for Ethylene Responsive factor required for Nodulation), a direct target gene of MtNF-YA1 and MtNF-YA2. Finally, we verified that a similar trimer is formed in planta by the common bean (Phaseolus vulgaris) NF-Y subunits, revealing the existence of evolutionary conserved NF-Y protein complexes to control nodulation in leguminous plants. This sheds light on the process whereby an ancient heterotrimeric TF mainly controlling cell division in animals has acquired specialized functions in plants.

  11. A comparative analysis of distribution and conservation of microsatellites in the transcripts of sequenced Fusarium species and development of genic-SSR markers for polymorphism analysis.


    Mahfooz, Sahil; Srivastava, Arpita; Srivastava, Alok K; Arora, Dilip K


    We used an in silico approach to survey and compare microsatellites in transcript sequences of four sequenced members of genus Fusarium. G + C content of transcripts was found to be positively correlated with the frequency of SSRs. Our analysis revealed that, in all the four transcript sequences studied, the occurrence, relative abundance and density of microsatellites varied and was not influenced by transcript sizes. No correlation between relative abundance and transcript sizes was observed. The relative abundance and density of microsatellites were highest in the transcripts of Fusarium solani when compared with F. graminearum, F. verticillioides and F. oxysporum. The maximum frequency of SSRs among all four sequence sets was of trinucleotide repeats (67.8%), whereas the dinucleotide repeat represents <1%. Among all classes of repeats, 36.5% motifs were found conserved within Fusarium species. In order to study polymorphism within Fusarium isolates, 11 polymorphic genic-SSR markers were developed. Of the 11 markers, 5 were from F. oxysporum and remaining 6 belongs to F. solani. SSR markers from F. oxysporum were found to be more polymorphic (38%) as compared to F. solani (26%). Eleven polymorphic markers obtained in this study clearly demonstrate the utility of newly developed SSR markers in establishing genetic relationships among different isolates of Fusarium.

  12. Genome‐wide analysis reveals conserved transcriptional responses downstream of resting potential change in Xenopus embryos, axolotl regeneration, and human mesenchymal cell differentiation

    PubMed Central

    Pai, Vaibhav P.; Martyniuk, Christopher J.; Echeverri, Karen; Sundelacruz, Sarah; Kaplan, David L.


    Abstract Endogenous bioelectric signaling via changes in cellular resting potential (V mem) is a key regulator of patterning during regeneration and embryogenesis in numerous model systems. Depolarization of V mem has been functionally implicated in dedifferentiation, tumorigenesis, anatomical re‐specification, and appendage regeneration. However, no unbiased analyses have been performed to understand genome‐wide transcriptional responses to V mem change in vivo. Moreover, it is unknown which genes or gene networks represent conserved targets of bioelectrical signaling across different patterning contexts and species. Here, we use microarray analysis to comparatively analyze transcriptional responses to V mem depolarization. We compare the response of the transcriptome during embryogenesis (Xenopus development), regeneration (axolotl regeneration), and stem cell differentiation (human mesenchymal stem cells in culture) to identify common networks across model species that are associated with depolarization. Both subnetwork enrichment and PANTHER analyses identified a number of key genetic modules as targets of V mem change, and also revealed important (well‐conserved) commonalities in bioelectric signal transduction, despite highly diverse experimental contexts and species. Depolarization regulates specific transcriptional networks across all three germ layers (ectoderm, mesoderm, and endoderm) such as cell differentiation and apoptosis, and this information will be used for developing mechanistic models of bioelectric regulation of patterning. Moreover, our analysis reveals that V mem change regulates transcripts related to important disease pathways such as cancer and neurodegeneration, which may represent novel targets for emerging electroceutical therapies. PMID:27499876

  13. Genome-wide analysis reveals conserved transcriptional responses downstream of resting potential change in Xenopus embryos, axolotl regeneration, and human mesenchymal cell differentiation.


    Pai, Vaibhav P; Martyniuk, Christopher J; Echeverri, Karen; Sundelacruz, Sarah; Kaplan, David L; Levin, Michael


    Endogenous bioelectric signaling via changes in cellular resting potential (V mem) is a key regulator of patterning during regeneration and embryogenesis in numerous model systems. Depolarization of V mem has been functionally implicated in dedifferentiation, tumorigenesis, anatomical re-specification, and appendage regeneration. However, no unbiased analyses have been performed to understand genome-wide transcriptional responses to V mem change in vivo. Moreover, it is unknown which genes or gene networks represent conserved targets of bioelectrical signaling across different patterning contexts and species. Here, we use microarray analysis to comparatively analyze transcriptional responses to V mem depolarization. We compare the response of the transcriptome during embryogenesis (Xenopus development), regeneration (axolotl regeneration), and stem cell differentiation (human mesenchymal stem cells in culture) to identify common networks across model species that are associated with depolarization. Both subnetwork enrichment and PANTHER analyses identified a number of key genetic modules as targets of V mem change, and also revealed important (well-conserved) commonalities in bioelectric signal transduction, despite highly diverse experimental contexts and species. Depolarization regulates specific transcriptional networks across all three germ layers (ectoderm, mesoderm, and endoderm) such as cell differentiation and apoptosis, and this information will be used for developing mechanistic models of bioelectric regulation of patterning. Moreover, our analysis reveals that V mem change regulates transcripts related to important disease pathways such as cancer and neurodegeneration, which may represent novel targets for emerging electroceutical therapies.

  14. Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

    NASA Technical Reports Server (NTRS)

    Romano, Laura A.; Wray, Gregory A.


    Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

  15. Transcriptional Control of the TNF Gene

    PubMed Central

    Falvo, James V.; Tsytsykova, Alla V.; Goldfeld, Anne E.


    The cytokine TNF is a critical mediator of immune and inflammatory responses. The TNF gene is an immediate early gene, rapidly transcribed in a variety of cell types following exposure to a broad range of pathogens and signals of inflammation and stress. Regulation of TNF gene expression at the transcriptional level is cell type- and stimulus-specific, involving the recruitment of distinct sets of transcription factors to a compact and modular promoter region. In this review, we describe our current understanding of the mechanisms through which TNF transcription is specifically activated by a variety of extracellular stimuli in multiple cell types, including T cells, B cells, macrophages, mast cells, dendritic cells, and fibroblasts. We discuss the role of nuclear factor of activated T cells and other transcription factors and coactivators in enhanceosome formation, as well as the contradictory evidence for a role for nuclear factor κB as a classical activator of the TNF gene. We describe the impact of evolutionarily conserved cis-regulatory DNA motifs in the TNF locus upon TNF gene transcription, in contrast to the neutral effect of single nucleotide polymorphisms. We also assess the regulatory role of chromatin organization, epigenetic modifications, and long-range chromosomal interactions at the TNF locus. PMID:20173386

  16. Nucleotide sequence conservation of novel and established cis-regulatory sites within the tyrosine hydroxylase gene promoter

    PubMed Central

    Wang, Meng; Banerjee, Kasturi; Baker, Harriet; Cave, John W.


    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in catecholamine biosynthesis and its gene proximal promoter ( < 1 kb upstream from the transcription start site) is essential for regulating transcription in both the developing and adult nervous systems. Several putative regulatory elements within the TH proximal promoter have been reported, but evolutionary conservation of these elements has not been thoroughly investigated. Since many vertebrate species are used to model development, function and disorders of human catecholaminergic neurons, identifying evolutionarily conserved transcription regulatory mechanisms is a high priority. In this study, we align TH proximal promoter nucleotide sequences from several vertebrate species to identify evolutionarily conserved motifs. This analysis identified three elements (a TATA box, cyclic AMP response element (CRE) and a 5′-GGTGG-3′ site) that constitute the core of an ancient vertebrate TH promoter. Focusing on only eutherian mammals, two regions of high conservation within the proximal promoter were identified: a ∼250 bp region adjacent to the transcription start site and a ∼85 bp region located approximately 350 bp further upstream. Within both regions, conservation of previously reported cis-regulatory motifs and human single nucleotide variants was evaluated. Transcription reporter assays in a TH -expressing cell line demonstrated the functionality of highly conserved motifs in the proximal promoter regions and electromobility shift assays showed that brain-region specific complexes assemble on these motifs. These studies also identified a non-canonical CRE binding (CREB) protein recognition element in the proximal promoter. Together, these studies provide a detailed analysis of evolutionary conservation within the TH promoter and identify potential cis-regulatory motifs that underlie a core set of regulatory mechanisms in mammals. PMID:25774193

  17. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    SciTech Connect

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.; Salzberg, Steven L.; Rubin, Gerald M.; Eisen, Michael B.; Celniker, SusanE.


    The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.

  18. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    SciTech Connect

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.; Salzberg, Steven L.; Rubin, Gerald M.; Eisen, Michael B.; Celniker, SusanE.


    Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.

  19. Differential conservation of transcriptional domains of mammalian Prophet of Pit-1 proteins revealed by structural studies of the bovine gene and comparative functional analysis of the protein.


    Showalter, Aaron D; Smith, Timothy P L; Bennett, Gary L; Sloop, Kyle W; Whitsett, Julie A; Rhodes, Simon J


    The Prophet of Pit-1 (PROP1) gene encodes a paired class homeodomain transcription factor that is exclusively expressed in the developing mammalian pituitary gland. PROP1 function is essential for anterior pituitary organogenesis, and heritable mutations in the gene are associated with combined pituitary hormone deficiency in human patients and animals. By cloning the bovine PROP1 gene and by comparative analysis, we demonstrate that the homeodomains and carboxyl termini of mammalian PROP1 proteins are highly conserved while the amino termini are diverged. Whereas the carboxyl termini of the human and bovine PROP1 proteins contain potent transcriptional activation domains, the amino termini and homeodomains have repressive activities. The bovine PROP1 gene has four exons and three introns and maps to a region of chromosome seven carrying a quantitative trait locus affecting ovulation rate. Two alleles of the bovine gene were found that encode distinct protein products with different DNA binding and transcriptional activities. These experiments demonstrate that mammalian PROP1 genes encode proteins with complex regulatory capacities and that modest changes in protein sequence can significantly alter the activity of this pituitary developmental transcription factor.

  20. Evolutionary conservation of zinc finger transcription factor binding sites in promoters of genes co-expressed with WT1 in prostate cancer

    PubMed Central

    Eisermann, Kurtis; Tandon, Sunpreet; Bazarov, Anton; Brett, Adina; Fraizer, Gail; Piontkivska, Helen


    Background Gene expression analyses have led to a better understanding of growth control of prostate cancer cells. We and others have identified the presence of several zinc finger transcription factors in the neoplastic prostate, suggesting a potential role for these genes in the regulation of the prostate cancer transcriptome. One of the transcription factors (TFs) identified in the prostate cancer epithelial cells was the Wilms tumor gene (WT1). To rapidly identify coordinately expressed prostate cancer growth control genes that may be regulated by WT1, we used an in silico approach. Results Evolutionary conserved transcription factor binding sites (TFBS) recognized by WT1, EGR1, SP1, SP2, AP2 and GATA1 were identified in the promoters of 24 differentially expressed prostate cancer genes from eight mammalian species. To test the relationship between sequence conservation and function, chromatin of LNCaP prostate cancer and kidney 293 cells were tested for TF binding using chromatin immunoprecipitation (ChIP). Multiple putative TFBS in gene promoters of placental mammals were found to be shared with those in human gene promoters and some were conserved between genomes that diverged about 170 million years ago (i.e., primates and marsupials), therefore implicating these sites as candidate binding sites. Among those genes coordinately expressed with WT1 was the kallikrein-related peptidase 3 (KLK3) gene commonly known as the prostate specific antigen (PSA) gene. This analysis located several potential WT1 TFBS in the PSA gene promoter and led to the rapid identification of a novel putative binding site confirmed in vivo by ChIP. Conversely for two prostate growth control genes, androgen receptor (AR) and vascular endothelial growth factor (VEGF), known to be transcriptionally regulated by WT1, regulatory sequence conservation was observed and TF binding in vivo was confirmed by ChIP. Conclusion Overall, this targeted approach rapidly identified important candidate

  1. INO80-dependent regression of ecdysone-induced transcriptional responses regulates developmental timing in Drosophila.


    Neuman, Sarah D; Ihry, Robert J; Gruetzmacher, Kelly M; Bashirullah, Arash


    Sequential pulses of the steroid hormone ecdysone regulate the major developmental transitions in Drosophila, and the duration of each developmental stage is determined by the length of time between ecdysone pulses. Ecdysone regulates biological responses by directly initiating target gene transcription. In turn, these transcriptional responses are known to be self-limiting, with mechanisms in place to ensure regression of hormone-dependent transcription. However, the biological significance of these transcriptional repression mechanisms remains unclear. Here we show that the chromatin remodeling protein INO80 facilitates transcriptional repression of ecdysone-regulated genes during prepupal development. In ino80 mutant animals, inefficient repression of transcriptional responses to the late larval ecdysone pulse delays the onset of the subsequent prepupal ecdysone pulse, resulting in a significantly longer prepupal stage. Conversely, increased expression of ino80 is sufficient to shorten the prepupal stage by increasing the rate of transcriptional repression. Furthermore, we demonstrate that enhancing the rate of regression of the mid-prepupal competence factor βFTZ-F1 is sufficient to determine the timing of head eversion and thus the duration of prepupal development. Although ino80 is conserved from yeast to humans, this study represents the first characterization of a bona fide ino80 mutation in any metazoan, raising the possibility that the functions of ino80 in transcriptional repression and developmental timing are evolutionarily conserved.

  2. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L


    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  3. Conservation of the sizes of 53 introns and over 100 intronic sequences for the binding of common transcription factors in the human and mouse genes for type II procollagen (COL2A1).

    PubMed Central

    Ala-Kokko, L; Kvist, A P; Metsäranta, M; Kivirikko, K I; de Crombrugghe, B; Prockop, D J; Vuorio, E


    Over 11,000 bp of previously undefined sequences of the human COL2A1 gene were defined. The results made it possible to compare the intron structures of a highly complex gene from man and mouse. Surprisingly, the sizes of the 53 introns of the two genes were highly conserved with a mean difference of 13%. After alignment of the sequences, 69% of the intron sequences were identical. The introns contained consensus sequences for the binding of over 100 different transcription factors that were conserved in the introns of the two genes. The first intron of the gene contained 80 conserved consensus sequences and the remaining 52 introns of the gene contained 106 conserved sequences for the binding of transcription factors. The 5'-end of intron 2 in both genes had a potential for forming a stem loop in RNA transcripts. Images Figure 4 PMID:8948452

  4. Transcription factors that influence RNA polymerases I and II: To what extent is mechanism of action conserved?


    Zhang, Yinfeng; Najmi, Saman M; Schneider, David A


    In eukaryotic cells, nuclear RNA synthesis is accomplished by at least three unique, multisubunit RNA polymerases. The roles of these enzymes are generally partitioned into the synthesis of the three major classes of RNA: rRNA, mRNA, and tRNA for RNA polymerases I, II, and III respectively. Consistent with their unique cellular roles, each enzyme has a complement of specialized transcription factors and enzymatic properties. However, not all transcription factors have evolved to affect only one eukaryotic RNA polymerase. In fact, many factors have been shown to influence the activities of multiple nuclear RNA polymerases. This review focuses on a subset of these factors, specifically addressing the mechanisms by which these proteins influence RNA polymerases I and II.

  5. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  6. Transcriptional coordination of hepatic autophagy by nutrient-sensing nuclear receptor PPARα and FXR

    PubMed Central


    Nuclear receptors are in general ligand-dependent transcription factors that control a variety of mammalian physiologies including development, differentiation, proliferation, and homeostasis. Recent studies have found that two nutrient-sensing nuclear receptors, peroxisome proliferator-activated receptor α and farnesoid x receptor, responding to fasting or feeding state, respectively are able to regulate autophagy, an evolutionarily conserved catabolic process involved in lysosomal degradation. In this review, we discuss the role of these nutrient-sensing nuclear receptors in an aspect of transcriptional regulation of autophagy, and how these nuclear receptor-driven transcriptional programs integrate lipophagy, a lipid autophagy with fatty acid oxidation to coordinate hepatic lipid metabolism in the fasted state of the liver. PMID:28164071

  7. Cks1-dependent proteasome recruitment and activation of CDC20 transcription in budding yeast.


    Morris, May C; Kaiser, Peter; Rudyak, Stanislav; Baskerville, Chris; Watson, Mark H; Reed, Steven I


    Cks proteins are small evolutionarily conserved proteins that interact genetically and physically with cyclin-dependent kinases. However, in spite of a large body of genetic, biochemical and structural research, no compelling unifying model of their functions has emerged. Here we show, by investigating the essential role of Cks1 in Saccharomyces cerevisiae, that the protein is primarily involved in promoting mitosis by modulating the transcriptional activation of the APC/C protein-ubiquitin ligase activator Cdc20. Cks1 is required for both the periodic dissociation of Cdc28 kinase from the CDC20 promoter and the periodic association of the proteasome with the promoter. We propose that the essential role of Cks1 is to recruit the proteasome to, and/or dissociate the Cdc28 kinase from, the CDC20 promoter, thus facilitating transcription by remodelling transcriptional complexes or chromatin associated with the CDC20 gene.

  8. Transcriptional coordination of hepatic autophagy by nutrient-sensing nuclear receptor PPARα and FXR.


    Lee, Jae Man


    Nuclear receptors are in general ligand-dependent transcription factors that control a variety of mammalian physiologies including development, differentiation, proliferation, and homeostasis. Recent studies have found that two nutrient-sensing nuclear receptors, peroxisome proliferator-activated receptor α and farnesoid x receptor, responding to fasting or feeding state, respectively are able to regulate autophagy, an evolutionarily conserved catabolic process involved in lysosomal degradation. In this review, we discuss the role of these nutrient-sensing nuclear receptors in an aspect of transcriptional regulation of autophagy, and how these nuclear receptor-driven transcriptional programs integrate lipophagy, a lipid autophagy with fatty acid oxidation to coordinate hepatic lipid metabolism in the fasted state of the liver.

  9. Post-transcriptional regulation of cytokine genes in fish: A role for conserved AU-rich elements located in the 3'-untranslated region of their mRNAs.


    Roca, Francisco J; Cayuela, María L; Secombes, Chris J; Meseguer, José; Mulero, Victoriano


    The overproduction of cytokines, such us interleukin-1beta (IL-1beta) and tumor necrosis factor alpha (TNFalpha), contributes to the pathological complications observed in many inflammatory diseases caused by bacterial endotoxins. The synthesis of these cytokines is tightly regulated at both transcriptional and post-transcriptional levels. Post-transcriptional regulation of gene expression depends on specific cis-acting sequences and trans-acting factors. Thus, the presence of adenylate- and uridylate-rich (AU-rich) elements (AREs) has been described in the 3'-untranslated regions (UTRs) of many unstable mammalian mRNAs. Although, it represents the most widespread, phylogenetically conserved and efficient determinant of mRNA stability among those so far characterized in mammalian cells, no studies are available on the functional relevance of this sequence in non-mammalian vertebrates. In this contribution, we study the enzymatic activity of various luciferase reporter constructs, containing or lacking the 3'UTR of IL-1beta and TNFalpha from different fish species, and report the finding that bony fish AREs are able to decrease luciferase activity but are less potent than their mammalian counterparts. Surprisingly, the 3'UTR of the IL-1beta from the cartilaginous fish small spotted catshark had the greatest ability to decrease luciferase activity. Lastly, the functional significance of the above was confirmed by measuring the half-life of IL-1beta and TNFalpha mRNAs in gilthead seabream leukocytes by blocking transcription with actinomycin D. Both cytokine mRNAs were unstable with an estimated half-life of about 45 min in control and activated cells.

  10. Drosophila OVO regulates ovarian tumor transcription by binding unusually near the transcription start site.


    Lü, J; Oliver, B


    Evolutionarily conserved ovo loci encode developmentally regulated, sequence-specific, DNA-binding, C(2)H(2)-zinc-finger proteins required in the germline and epidermal cells of flies and mice. The direct targets of OVO activity are not known. Genetic experiments suggest that ovo acts in the same regulatory network as ovarian tumor (otu), but the relative position of these genes in the pathway is controversial. Three OVO-binding sites exist in a compact regulatory region that controls germline expression of the otu gene. Interestingly, the strongest OVO-binding site is very near the otu transcription start, where basal transcriptional complexes must function. Loss-of-function, gain-of-function and promoter swapping constructs demonstrate that OVO binding near the transcription start site is required for OVO-dependent otu transcription in vivo. These data unambiguously identify otu as a direct OVO target gene and raise the tantalizing possibility that an OVO site, at the location normally occupied by basal components, functions as part of a specialized core promoter.

  11. Nucleotide excision repair (NER) machinery recruitment by the transcription-repair coupling factor involves unmasking of a conserved intramolecular interface

    PubMed Central

    Deaconescu, Alexandra M.; Sevostyanova, Anastasia; Artsimovitch, Irina; Grigorieff, Nikolaus


    Transcription-coupled DNA repair targets DNA lesions that block progression of elongating RNA polymerases. In bacteria, the transcription-repair coupling factor (TRCF; also known as Mfd) SF2 ATPase recognizes RNA polymerase stalled at a site of DNA damage, removes the enzyme from the DNA, and recruits the Uvr(A)BC nucleotide excision repair machinery via UvrA binding. Previous studies of TRCF revealed a molecular architecture incompatible with UvrA binding, leaving its recruitment mechanism unclear. Here, we examine the UvrA recognition determinants of TRCF using X-ray crystallography of a core TRCF–UvrA complex and probe the conformational flexibility of TRCF in the absence and presence of nucleotides using small-angle X-ray scattering. We demonstrate that the C-terminal domain of TRCF is inhibitory for UvrA binding, but not RNA polymerase release, and show that nucleotide binding induces concerted multidomain motions. Our studies suggest that autoinhibition of UvrA binding in TRCF may be relieved only upon engaging the DNA damage. PMID:22331906

  12. A Conserved Network of Transcriptional Activators and Repressors Regulates Anthocyanin Pigmentation in Eudicots[C][W][OPEN

    PubMed Central

    Albert, Nick W.; Davies, Kevin M.; Lewis, David H.; Zhang, Huaibi; Montefiori, Mirco; Brendolise, Cyril; Boase, Murray R.; Ngo, Hanh; Jameson, Paula E.; Schwinn, Kathy E.


    Plants require sophisticated regulatory mechanisms to ensure the degree of anthocyanin pigmentation is appropriate to myriad developmental and environmental signals. Central to this process are the activity of MYB-bHLH-WD repeat (MBW) complexes that regulate the transcription of anthocyanin genes. In this study, the gene regulatory network that regulates anthocyanin synthesis in petunia (Petunia hybrida) has been characterized. Genetic and molecular evidence show that the R2R3-MYB, MYB27, is an anthocyanin repressor that functions as part of the MBW complex and represses transcription through its C-terminal EAR motif. MYB27 targets both the anthocyanin pathway genes and basic-helix-loop-helix (bHLH) ANTHOCYANIN1 (AN1), itself an essential component of the MBW activation complex for pigmentation. Other features of the regulatory network identified include inhibition of AN1 activity by the competitive R3-MYB repressor MYBx and the activation of AN1, MYB27, and MYBx by the MBW activation complex, providing for both reinforcement and feedback regulation. We also demonstrate the intercellular movement of the WDR protein (AN11) and R3-repressor (MYBx), which may facilitate anthocyanin pigment pattern formation. The fundamental features of this regulatory network in the Asterid model of petunia are similar to those in the Rosid model of Arabidopsis thaliana and are thus likely to be widespread in the Eudicots. PMID:24642943

  13. The Function of the MEF2 Family of Transcription Factors in Cardiac Development, Cardiogenomics, and Direct Reprogramming

    PubMed Central

    Desjardins, Cody A.; Naya, Francisco J.


    Proper formation of the mammalian heart requires precise spatiotemporal transcriptional regulation of gene programs in cardiomyocytes. Sophisticated regulatory networks have evolved to not only integrate the activities of distinct transcription factors to control tissue-specific gene programs but also, in many instances, to incorporate multiple members within these transcription factor families to ensure accuracy and specificity in the system. Unsurprisingly, perturbations in this elaborate transcriptional circuitry can lead to severe cardiac abnormalities. Myocyte enhancer factor–2 (MEF2) transcription factor belongs to the evolutionarily conserved cardiac gene regulatory network. Given its central role in muscle gene regulation and its evolutionary conservation, MEF2 is considered one of only a few core cardiac transcription factors. In addition to its firmly established role as a differentiation factor, MEF2 regulates wide variety of, sometimes antagonistic, cellular processes such as cell survival and death. Vertebrate genomes encode multiple MEF2 family members thereby expanding the transcriptional potential of this core transcription factor in the heart. This review highlights the requirement of the MEF2 family and their orthologs in cardiac development in diverse animal model systems. Furthermore, we describe the recently characterized role of MEF2 in direct reprogramming and genome-wide cardiomyocyte gene regulation. A thorough understanding of the regulatory functions of the MEF2 family in cardiac development and cardiogenomics is required in order to develop effective therapeutic strategies to repair the diseased heart. PMID:27630998

  14. Transcription, translation, and immunolocalization of ODVP-6E/ODV-E56 and p74 proteins: two highly conserved ODV-associated envelope proteins of Choristoneura fumiferana Granulovirus.


    Rashidan, Kianoush Khajeh; Nassoury, Nasha; Giannopoulos, Paresa N; Guertin, Claude


    Choristoneura fumiferana granulovirus (ChfuGV) infection results two types of enveloped virions: Occlusion-derived virus (ODV) and budded virus (BV). Structural proteins ODVP-6E/ODV-E56 and p74 are two major conserved ODV-associated proteins that may be involved in the initiation of viral infection cycle in susceptible host insect larvae. This study presents the characterization of ChfuGV odvp-6e/odv-e56 and p74 transcription and translation as well as immunolocalization of these proteins in the occluded ChfuGV virion. Our results revealed that the transcription of odvp-6e/odv-e56 and p74 genes, both, start at 24 hours post infection (h p.i.). Using monospecific polyclonal antibodies made against ODVP-6E/ODV-E56 and p74 we demonstrated that these proteins are both expressed late in infection (24 h p.i.). Immunogold labeling using antisera against ODVP-6E/ODV-E56 and p74 proteins demonstrated that ODVP-6E/ODV-E56 and p74 proteins are both associated with the ODV envelop of ChfuGV.

  15. Regulation of Lactobacillus casei Sorbitol Utilization Genes Requires DNA-Binding Transcriptional Activator GutR and the Conserved Protein GutM▿

    PubMed Central

    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J.


    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTSGut). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIBGat domain) and a mannitol/fructose-specific EIIA-like domain (EIIAMtl domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBCGut negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM. PMID:18676710

  16. Regulation of Lactobacillus casei sorbitol utilization genes requires DNA-binding transcriptional activator GutR and the conserved protein GutM.


    Alcántara, Cristina; Sarmiento-Rubiano, Luz Adriana; Monedero, Vicente; Deutscher, Josef; Pérez-Martínez, Gaspar; Yebra, María J


    Sequence analysis of the five genes (gutRMCBA) downstream from the previously described sorbitol-6-phosphate dehydrogenase-encoding Lactobacillus casei gutF gene revealed that they constitute a sorbitol (glucitol) utilization operon. The gutRM genes encode putative regulators, while the gutCBA genes encode the EIIC, EIIBC, and EIIA proteins of a phosphoenolpyruvate-dependent sorbitol phosphotransferase system (PTS(Gut)). The gut operon is transcribed as a polycistronic gutFRMCBA messenger, the expression of which is induced by sorbitol and repressed by glucose. gutR encodes a transcriptional regulator with two PTS-regulated domains, a galactitol-specific EIIB-like domain (EIIB(Gat) domain) and a mannitol/fructose-specific EIIA-like domain (EIIA(Mtl) domain). Its inactivation abolished gut operon transcription and sorbitol uptake, indicating that it acts as a transcriptional activator. In contrast, cells carrying a gutB mutation expressed the gut operon constitutively, but they failed to transport sorbitol, indicating that EIIBC(Gut) negatively regulates GutR. A footprint analysis showed that GutR binds to a 35-bp sequence upstream from the gut promoter. A sequence comparison with the presumed promoter region of gut operons from various firmicutes revealed a GutR consensus motif that includes an inverted repeat. The regulation mechanism of the L. casei gut operon is therefore likely to be operative in other firmicutes. Finally, gutM codes for a conserved protein of unknown function present in all sequenced gut operons. A gutM mutant, the first constructed in a firmicute, showed drastically reduced gut operon expression and sorbitol uptake, indicating a regulatory role also for GutM.

  17. Regeneration in an evolutionarily primitive brain--the planarian Dugesia japonica model.


    Umesono, Yoshihiko; Tasaki, Junichi; Nishimura, Kaneyasu; Inoue, Takeshi; Agata, Kiyokazu


    A unique aspect of planarians is that they can regenerate a brain from somatic pluripotent stem cells called neoblasts, which have the ability to produce themselves (self-renew) and to give rise to all missing cell types during regeneration. Recent molecular studies have revealed that the planarian brain is composed of many distinct neuronal populations, which are evolutionarily and functionally conserved ones, and acts as an information-processing center to elicit distinct behavioral traits depending on a variety of signals arising from the external environment. How can planarians regenerate such a brain? On the basis of our recent findings, here we review the cellular and molecular mechanisms that regulate the stem cell dynamics involved in the brain regeneration of the planarian Dugesia japonica. Our findings suggest the possible value of in vivo planarian studies for guiding regenerative medicine to treat neurodegenerative diseases via interlinking stem cell biology and regeneration biology.

  18. Deciphering modular and dynamic behaviors of transcriptional networks.


    Zhan, Ming


    The coordinated and dynamic modulation or interaction of genes or proteins acts as an important mechanism used by a cell in functional regulation. Recent studies have shown that many transcriptional networks exhibit a scale-free topology and hierarchical modular architecture. It has also been shown that transcriptional networks or pathways are dynamic and behave only in certain ways and controlled manners in response to disease development, changing cellular conditions, and different environmental factors. Moreover, evolutionarily conserved and divergent transcriptional modules underline fundamental and species-specific molecular mechanisms controlling disease development or cellular phenotypes. Various computational algorithms have been developed to explore transcriptional networks and modules from gene expression data. In silico studies have also been made to mimic the dynamic behavior of regulatory networks, analyzing how disease or cellular phenotypes arise from the connectivity or networks of genes and their products. Here, we review the recent development in computational biology research on deciphering modular and dynamic behaviors of transcriptional networks, highlighting important findings. We also demonstrate how these computational algorithms can be applied in systems biology studies as on disease, stem cells, and drug discovery.

  19. Discovering transcriptional regulatory regions in Drosophila by a nonalignment method for phylogenetic footprinting

    PubMed Central

    Sosinsky, Alona; Honig, Barry; Mann, Richard S.; Califano, Andrea


    The functional annotation of the nonprotein-coding DNA of eukaryotic genomes is a problem of central importance. Phylogenetic footprinting methods, which attempt to identify functional regulatory regions by comparing orthologous genomic sequences of evolutionarily related species, have shown promising results. The main advantage of this class of approaches is that they do not require any knowledge of the regulating transcription factors. Here we describe a method called Enhancer Detection using only Genomic Information (EDGI), which integrates a traditional motif-discovery algorithm with a local permutation-clustering algorithm. Together, they can identify large regulatory elements (e.g., enhancers) as evolutionarily conserved order-independent clusters of short conserved motifs. We show that EDGI can distinguish between established sets of known enhancers and nonenhancers with 88% accuracy, rivaling predictions by methods that rely on the knowledge of the regulating transcription factors and their DNA-binding specificities. We tested EDGI's performance on a set of Drosophila genomes. Our results demonstrate that comparative genomic analysis of multiple closely related species has substantial power to identify key functional elements without additional biological knowledge. PMID:17395715

  20. Autopalmitoylation of TEAD Proteins Regulates Transcriptional Output of Hippo Pathway

    PubMed Central

    Chan, PuiYee; Han, Xiao; Zheng, Baohui; DeRan, Michael; Yu, Jianzhong; Jarugumilli, Gopala K.; Deng, Hua; Pan, Duojia; Luo, Xuelian; Wu, Xu


    TEA domain (TEAD) transcription factors bind to the co-activator YAP/TAZ, and regulate the transcriptional output of Hippo pathway, playing critical roles in organ size control and tumorigenesis. Protein S-palmitoylation attaches fatty acid (palmitate) to cysteine residues, and regulates protein trafficking, membrane localization and signaling activities. Using activity-based chemical probes, we discovered that human TEADs possess intrinsic palmitoylating enzyme-like activities, and undergo autopalmitoylation at evolutionarily conserved cysteine residues under physiological conditions. We determined the crystal structures of lipid-bound TEADs, and found that the lipid chain of palmitate inserts into a conserved deep hydrophobic pocket. Strikingly, palmitoylation is required for TEAD’s binding to YAP/TAZ, but dispensable for the binding to Vgll4 tumor suppressor. In addition, palmitoylation does not alter TEAD’s localization. Moreover, TEAD palmitoylation-deficient mutants impaired TAZ-mediated muscle differentiation in vitro, and Yorkie-mediated tissue overgrowth in Drosophila in vivo. Our study directly linked autopalmitoylation to the transcriptional regulation of Hippo pathway. PMID:26900866

  1. T-box transcription factors in cancer biology.


    Wansleben, Sabina; Peres, Jade; Hare, Shannagh; Goding, Colin R; Prince, Sharon


    The evolutionarily conserved T-box family of transcription factors have critical and well-established roles in embryonic development. More recently, T-box factors have also gained increasing prominence in the field of cancer biology where a wide range of cancers exhibit deregulated expression of T-box factors that possess tumour suppressor and/or tumour promoter functions. Of these the best characterised is TBX2, whose expression is upregulated in cancers including breast, pancreatic, ovarian, liver, endometrial adenocarcinoma, glioblastomas, gastric, uterine cervical and melanoma. Understanding the role and regulation of TBX2, as well as other T-box factors, in contributing directly to tumour progression, and especially in suppression of senescence and control of invasiveness suggests that targeting TBX2 expression or function alone or in combination with currently available chemotherapeutic agents may represent a therapeutic strategy for cancer.

  2. Transcription factors Mix1 and VegT, relocalization of vegt mRNA, and conserved endoderm and dorsal specification in frogs

    PubMed Central

    Sudou, Norihiro; Garcés-Vásconez, Andrés; López-Latorre, María A.; Taira, Masanori


    Protein expression of the transcription factor genes mix1 and vegt characterized the presumptive endoderm in embryos of the frogs Engystomops randi, Epipedobates machalilla, Gastrotheca riobambae, and Eleutherodactylus coqui, as in Xenopus laevis embryos. Protein VegT was detected in the animal hemisphere of the early blastula in all frogs, and only the animal pole was VegT-negative. This finding stimulated a vegt mRNA analysis in X. laevis eggs and embryos. vegt mRNA was detected in the animal region of X. laevis eggs and early embryos, in agreement with the VegT localization observed in the analyzed frogs. Moreover, a dorso-animal relocalization of vegt mRNA occurred in the egg at fertilization. Thus, the comparative analysis indicated that vegt may participate in dorsal development besides its known roles in endoderm development, and germ-layer specification. Zygotic vegt (zvegt) mRNA was detected as a minor isoform besides the major maternal (mvegt) isoform of the X. laevis egg. In addition, α-amanitin–insensitive vegt transcripts were detected around vegetal nuclei of the blastula. Thus, accumulation of vegt mRNA around vegetal nuclei was caused by relocalization rather than new mRNA synthesis. The localization of vegt mRNA around vegetal nuclei may contribute to the identity of vegetal blastomeres. These and previously reportedly localization features of vegt mRNA and protein derive from the master role of vegt in the development of frogs. The comparative analysis indicated that the strategies for endoderm, and dorsal specification, involving vegt and mix1, have been evolutionary conserved in frogs. PMID:27140624

  3. Transcription factors Mix1 and VegT, relocalization of vegt mRNA, and conserved endoderm and dorsal specification in frogs.


    Sudou, Norihiro; Garcés-Vásconez, Andrés; López-Latorre, María A; Taira, Masanori; Del Pino, Eugenia M


    Protein expression of the transcription factor genes mix1 and vegt characterized the presumptive endoderm in embryos of the frogs Engystomops randi, Epipedobates machalilla, Gastrotheca riobambae, and Eleutherodactylus coqui, as in Xenopus laevis embryos. Protein VegT was detected in the animal hemisphere of the early blastula in all frogs, and only the animal pole was VegT-negative. This finding stimulated a vegt mRNA analysis in X. laevis eggs and embryos. vegt mRNA was detected in the animal region of X. laevis eggs and early embryos, in agreement with the VegT localization observed in the analyzed frogs. Moreover, a dorso-animal relocalization of vegt mRNA occurred in the egg at fertilization. Thus, the comparative analysis indicated that vegt may participate in dorsal development besides its known roles in endoderm development, and germ-layer specification. Zygotic vegt (zvegt) mRNA was detected as a minor isoform besides the major maternal (mvegt) isoform of the X. laevis egg. In addition, α-amanitin-insensitive vegt transcripts were detected around vegetal nuclei of the blastula. Thus, accumulation of vegt mRNA around vegetal nuclei was caused by relocalization rather than new mRNA synthesis. The localization of vegt mRNA around vegetal nuclei may contribute to the identity of vegetal blastomeres. These and previously reportedly localization features of vegt mRNA and protein derive from the master role of vegt in the development of frogs. The comparative analysis indicated that the strategies for endoderm, and dorsal specification, involving vegt and mix1, have been evolutionary conserved in frogs.

  4. Cloning of zebrafish nkx6.2 and a comprehensive analysis of the conserved transcriptional response to Hedgehog/Gli signaling in the zebrafish neural tube

    PubMed Central

    Guner, Burcu; Karlstrom, Rolf O.


    Sonic Hedgehog (Shh) signaling helps pattern the vertebrate neural tube, in part by regulating the dorsal/ventral expression of a number of homeodomain containing transcription factors. These Hh responsive genes have been divided into two classes, with Class II genes being activated by Hh signaling and Class I genes being repressed by Hh signaling. While the transcriptional response to varying Hh levels is well defined in chick and mouse, it is only partially described in zebrafish, despite the fact that zebrafish has emerged as a powerful genetic system for the study of neural patterning. To better characterize the Hh response in the zebrafish neural tube, we cloned the zebrafish Class II Hh target genes nkx2.9 and nkx6.2. We then analyzed the expression of a number of Class I and Class II Hh responsive genes in wild type, Hh mutant, and Hh over-expressing zebrafish embryos. We show that expression of Class I and Class II genes is highly conserved in the vertebrate neural tube. Further, ventral-most Class II gene expression was completely lost in all Hh pathway mutants analyzed, indicating high levels of Hh signaling are blocked in all of these mutants. In contrast, more dorsally expressed genes were variably affected in different Hh pathway mutants, indicating mid-levels of Hh signaling are differentially affected. This comprehensive expression study provides an important tool for the characterization of Hh signaling in zebrafish and provides a sensitive assay for determining the degree to which newly identified zebrafish mutants affect Hh signaling. PMID:17307034

  5. Integrated genome analysis suggests that most conserved non-coding sequences are regulatory factor binding sites

    PubMed Central

    Hemberg, Martin; Gray, Jesse M.; Cloonan, Nicole; Kuersten, Scott; Grimmond, Sean; Greenberg, Michael E.; Kreiman, Gabriel


    More than 98% of a typical vertebrate genome does not code for proteins. Although non-coding regions are sprinkled with short (<200 bp) islands of evolutionarily conserved sequences, the function of most of these unannotated conserved islands remains unknown. One possibility is that unannotated conserved islands could encode non-coding RNAs (ncRNAs); alternatively, unannotated conserved islands could serve as promoter-distal regulatory factor binding sites (RFBSs) like enhancers. Here we assess these possibilities by comparing unannotated conserved islands in the human and mouse genomes to transcribed regions and to RFBSs, relying on a detailed case study of one human and one mouse cell type. We define transcribed regions by applying a novel transcript-calling algorithm to RNA-Seq data obtained from total cellular RNA, and we define RFBSs using ChIP-Seq and DNAse-hypersensitivity assays. We find that unannotated conserved islands are four times more likely to coincide with RFBSs than with unannotated ncRNAs. Thousands of conserved RFBSs can be categorized as insulators based on the presence of CTCF or as enhancers based on the presence of p300/CBP and H3K4me1. While many unannotated conserved RFBSs are transcriptionally active to some extent, the transcripts produced tend to be unspliced, non-polyadenylated and expressed at levels 10 to 100-fold lower than annotated coding or ncRNAs. Extending these findings across multiple cell types and tissues, we propose that most conserved non-coding genomic DNA in vertebrate genomes corresponds to promoter-distal regulatory elements. PMID:22684627

  6. Multi-Species Comparative Analysis of the Equine ACE Gene Identifies a Highly Conserved Potential Transcription Factor Binding Site in Intron 16

    PubMed Central

    Hamilton, Natasha A.; Tammen, Imke; Raadsma, Herman W.


    Angiotensin converting enzyme (ACE) is essential for control of blood pressure. The human ACE gene contains an intronic Alu indel (I/D) polymorphism that has been associated with variation in serum enzyme levels, although the functional mechanism has not been identified. The polymorphism has also been associated with cardiovascular disease, type II diabetes, renal disease and elite athleticism. We have characterized the ACE gene in horses of breeds selected for differing physical abilities. The equine gene has a similar structure to that of all known mammalian ACE genes. Nine common single nucleotide polymorphisms (SNPs) discovered in pooled DNA were found to be inherited in nine haplotypes. Three of these SNPs were located in intron 16, homologous to that containing the Alu polymorphism in the human. A highly conserved 18 bp sequence, also within that intron, was identified as being a potential binding site for the transcription factors Oct-1, HFH-1 and HNF-3β, and lies within a larger area of higher than normal homology. This putative regulatory element may contribute to regulation of the documented inter-individual variation in human circulating enzyme levels, for which a functional mechanism is yet to be defined. Two equine SNPs occurred within the conserved area in intron 16, although neither of them disrupted the putative binding site. We propose a possible regulatory mechanism of the ACE gene in mammalian species which was previously unknown. This advance will allow further analysis leading to a better understanding of the mechanisms underpinning the associations seen between the human Alu polymorphism and enzyme levels, cardiovascular disease states and elite athleticism. PMID:23408978

  7. Expanding the Iroquois genes repertoire: a non-transcriptional function in cell cycle progression.


    Barrios, Natalia; Campuzano, Sonsoles


    Drosophila Iroquois (Iro) proteins are components of the TALE homeodomain family of transcriptional regulators. They play key roles in territorial specification and pattern formation. A recent study has disclosed a novel developmental function of the Iro proteins. In the eye and wing imaginal discs, they can regulate the size of the territories that they specify. They do so by cell-autonomously controlling cell cycle progression. Indeed, Iro proteins down-regulate the activity of the CyclinE/Cdk2 complex by a transcription-independent mechanism. This novel function is executed mainly through 2 evolutionarily conserved domains of the Iro proteins: the Cyclin Binding Domain and the IRO-box, which mediate their binding to CyclinE-containing protein complexes. Here we discuss the functional implications of the control of the cell cycle by Iro proteins for development and oncogenesis.

  8. Evolutionarily stable range limits set by interspecific competition.


    Price, Trevor D; Kirkpatrick, Mark


    A combination of abiotic and biotic factors probably restricts the range of many species. Recent evolutionary models and tests of those models have asked how a gradual change in environmental conditions can set the range limit, with a prominent idea being that gene flow disrupts local adaptation. We investigate how biotic factors, explicitly competition for limited resources, result in evolutionarily stable range limits even in the absence of the disruptive effect of gene flow. We model two competing species occupying different segments of the resource spectrum. If one segment of the resource spectrum declines across space, a species that specializes on that segment can be driven to extinction, even though in the absence of competition it would evolve to exploit other abundant resources and so be saved. The result is that a species range limit is set in both evolutionary and ecological time, as the resources associated with its niche decline. Factors promoting this outcome include: (i) inherent gaps in the resource distribution, (ii) relatively high fitness of the species when in its own niche, and low fitness in the alternative niche, even when resource abundances are similar in each niche, (iii) strong interspecific competition, and (iv) asymmetric interspecific competition. We suggest that these features are likely to be common in multispecies communities, thereby setting evolutionarily stable range limits.

  9. The Conserved Chimeric Transcript UPGRADE2 Is Associated with Unreduced Pollen Formation and Is Exclusively Found in Apomictic Boechera Species1[C][W][OPEN

    PubMed Central

    Mau, Martin; Corral, José M.; Vogel, Heiko; Melzer, Michael; Fuchs, Jörg; Kuhlmann, Markus; de Storme, Nico; Geelen, Danny; Sharbel, Timothy F.


    In apomictic Boechera spp., meiotic diplospory leads to the circumvention of meiosis and the suppression of recombination to produce unreduced male and female gametes (i.e. apomeiosis). Here, we have established an early flower developmental staging system and have performed microarray-based comparative gene expression analyses of the pollen mother cell stage in seven diploid sexual and seven diploid apomictic genotypes to identify candidate factors for unreduced pollen formation. We identified a transcript unique to apomictic Boechera spp. called UPGRADE2 (BspUPG2), which is highly up-regulated in their pollen mother cells. BspUPG2 is highly conserved among apomictic Boechera spp. genotypes but has no homolog in sexual Boechera spp. or in any other taxa. BspUPG2 undergoes posttranscriptional processing but lacks a prominent open reading frame. Together with the potential of stably forming microRNA-like secondary structures, we hypothesize that BspUPG2 functions as a long regulatory noncoding messenger RNA-like RNA. BspUPG2 has apparently arisen through a three-step process initiated by ancestral gene duplication of the original BspUPG1 locus, followed by sequential insertions of segmentally duplicated gene fragments, with final exonization of its sequence structure. Its genesis reflects the hybridization history that characterizes the genus Boechera. PMID:24130193

  10. A conserved function of the zinc finger transcription factor Sp8/9 in allometric appendage growth in the milkweed bug Oncopeltus fasciatus.


    Schaeper, Nina D; Prpic, Nikola-Michael; Wimmer, Ernst A


    The genes encoding the closely related zinc finger transcription factors Buttonhead (Btd) and D-Sp1 are expressed in the developing limb primordia of Drosophila melanogaster and are required for normal growth of the legs. The D-Sp1 homolog of the red flour beetle Tribolium castaneum, Sp8 (appropriately termed Sp8/9), is also required for the proper growth of the leg segments. Here we report on the isolation and functional study of the Sp8/9 gene from the milkweed bug Oncopeltus fasciatus. We show that Sp8/9 is expressed in the developing appendages throughout development and that the downregulation of Sp8/9 via RNAi leads to antennae, rostrum, and legs with shortened and fused segments. This supports a conserved role of Sp8/9 in allometric leg segment growth. However, all leg segments including the claws are present and the expression of the leg genes Distal-less, dachshund, and homothorax are proportionally normal, thus providing no evidence for a role of Sp8/9 in appendage specification.

  11. Horizontal alignment of 5′ -> 3′ intergene distance segment tropy with respect to the gene as the conserved basis for DNA transcription

    PubMed Central

    Sarin, Hemant


    Aim: To study the conserved basis for gene expression in comparative cell types at opposite ends of the cell pressuromodulation spectrum, the lymphatic endothelial cell and the blood microvascular capillary endothelial cell. Methods: The mechanism for gene expression is studied in terms of the 5′ -> 3′ direction paired point tropy quotients (prpTQs) and the final 5′ -> 3′ direction episodic sub-episode block sums split-integrated weighted average-averaged gene overexpression tropy quotient (esebssiwaagoTQ). Results: The final 5′ -> 3′ esebssiwaagoTQ classifies an lymphatic endothelial cell overexpressed gene as a supra-pressuromodulated gene (esebssiwaagoTQ ≥ 0.25 < 0.75) every time and classifies a blood microvascular capillary endothelial cell overexpressed gene every time as an infra-pressuromodulated gene (esebssiwaagoTQ < 0.25) (100% sensitivity; 100% specificity). Conclusion: Horizontal alignment of 5′ -> 3′ intergene distance segment tropy wrt the gene is the basis for DNA transcription in the pressuromodulated state. PMID:28344824

  12. Tracheophytes Contain Conserved Orthologs of a Basic Helix-Loop-Helix Transcription Factor That Modulate ROOT HAIR SPECIFIC Genes[OPEN

    PubMed Central

    Cho, Hyun-Min


    ROOT HAIR SPECIFIC (RHS) genes, which contain the root hair-specific cis-element (RHE) in their regulatory regions, function in root hair morphogenesis. Here, we demonstrate that an Arabidopsis thaliana basic helix-loop-helix transcription factor, ROOT HAIR DEFECTVE SIX-LIKE4 (RSL4), directly binds to the RHE in vitro and in vivo, upregulates RHS genes, and stimulates root hair formation in Arabidopsis. Orthologs of RSL4 from a eudicot (poplar [Populus trichocarpa]), a monocot (rice [Oryza sativa]), and a lycophyte (Selaginella moellendorffii) each restored root hair growth in the Arabidopsis rsl4 mutant. In addition, the rice and S. moellendorffii RSL4 orthologs bound to the RHE in in vitro and in vivo assays. The RSL4 orthologous genes contain RHEs in their promoter regions, and RSL4 was able to bind to its own RHEs in vivo and amplify its own expression. This process likely provides a positive feedback loop for sustainable root hair growth. When RSL4 and its orthologs were expressed in cells in non-root-hair positions, they induced ectopic root hair growth, indicating that these genes are sufficient to specify root hair formation. Our results suggest that RSL4 mediates root hair formation by regulating RHS genes and that this mechanism is conserved throughout the tracheophyte (vascular plant) lineage. PMID:28087829

  13. Conserved regulation of the Hansenula polymorpha MOX promoter in Saccharomyces cerevisiae reveals insights in the transcriptional activation by Adr1p.


    Pereira, G G; Hollenberg, C P


    The Hansenula polymorpha MOX gene encodes a peroxisomal enzyme that catalyzes the first step of the highly specialized methanol metabolism. MOX is strongly transcribed in cells growing in methanol and completely repressed in glucose. We show here that the MOX promoter confers a glucose-repressible expression upon a lacZ reporter gene in Saccharomyces cerevisiae, an unrelated yeast species that lacks the methanol metabolism. Repression was mediated by a 200-bp region of the MOX promoter, termed MOX-B, and was counteracted by Adr1p, a transcription factor involved in the derepression of S. cerevisiae genes encoding peroxisomal proteins, the class to which MOX belongs. Binding of Adr1p to MOX-B was demonstrated by gel retardation and DNaseI-footprinting, and Adr1p was shown to interact with a DNA region containing only a half of the putative Adr1p consensus binding site. Our findings suggest that Adr1p is a conserved regulator for genes encoding peroxisomal proteins at least in other yeast species, and that its interaction with the DNA is dependent on the promoter context.

  14. Conserved serine/threonine kinase encoded by CBK1 regulates expression of several hypha-associated transcripts and genes encoding cell wall proteins in Candida albicans.


    McNemar, Mark D; Fonzi, William A


    The opportunistic fungal pathogen, Candida albicans, is reported to have several potential virulence factors. A potentially significant factor is the ability to undergo morphological transition from yeast to hypha. This alteration of form is accompanied by many changes within the cell, including alterations in gene expression and cell wall composition. We have isolated a gene that encodes a highly conserved serine/threonine kinase that appears to be involved in the regulation of proteins associated with the cell wall. We have assigned the designation CBK1 (cell wall biosynthesis kinase 1) to this gene. Mutants lacking CBK1 form large aggregates of round cells under all growth conditions and lack the ability to undergo morphological differentiation. Additionally, these mutants show an altered pattern of expression of several transcripts encoding proteins associated with the cell wall. The results suggest that the kinase encoded by CBK1 plays a general role in the maintenance and alteration of the cell wall of C. albicans in all morphologies.

  15. A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.


    Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B


    Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

  16. Kinetics of transcription initiation directed by multiple cis-regulatory elements on the glnAp2 promoter

    PubMed Central

    Wang, Yaolai; Liu, Feng; Wang, Wei


    Transcription initiation is orchestrated by dynamic molecular interactions, with kinetic steps difficult to detect. Utilizing a hybrid method, we aim to unravel essential kinetic steps of transcriptional regulation on the glnAp2 promoter, whose regulatory region includes two enhancers (sites I and II) and three low-affinity sequences (sites III-V), to which the transcriptional activator NtrC binds. By structure reconstruction, we analyze all possible organization architectures of the transcription apparatus (TA). The main regulatory mode involves two NtrC hexamers: one at enhancer II transiently associates with site V such that the other at enhancer I can rapidly approach and catalyze the σ54-RNA polymerase holoenzyme. We build a kinetic model characterizing essential steps of the TA operation; with the known kinetics of the holoenzyme interacting with DNA, this model enables the kinetics beyond technical detection to be determined by fitting the input-output function of the wild-type promoter. The model further quantitatively reproduces transcriptional activities of various mutated promoters. These results reveal different roles played by two enhancers and interpret why the low-affinity elements conditionally enhance or repress transcription. This work presents an integrated dynamic picture of regulated transcription initiation and suggests an evolutionarily conserved characteristic guaranteeing reliable transcriptional response to regulatory signals. PMID:27899598

  17. A Global Trend towards the Loss of Evolutionarily Unique Species in Mangrove Ecosystems

    PubMed Central

    Mankga, Ledile T.; Davies, T. Jonathan


    The mangrove biome stands out as a distinct forest type at the interface between terrestrial, estuarine, and near-shore marine ecosystems. However, mangrove species are increasingly threatened and experiencing range contraction across the globe that requires urgent conservation action. Here, we assess the spatial distribution of mangrove species richness and evolutionary diversity, and evaluate potential predictors of global declines and risk of extinction. We found that human pressure, measured as the number of different uses associated with mangroves, correlated strongly, but negatively, with extinction probability, whereas species ages were the best predictor of global decline, explaining 15% of variation in extinction risk. Although the majority of mangrove species are categorised by the IUCN as Least Concern, our finding that the more threatened species also tend to be those that are more evolutionarily unique is of concern because their extinction would result in a greater loss of phylogenetic diversity. Finally, we identified biogeographic regions that are relatively species-poor but rich in evolutionary history, and suggest these regions deserve greater conservation priority. Our study provides phylogenetic information that is important for developing a unified management plan for mangrove ecosystems worldwide. PMID:23805263

  18. NAD kinase controls animal NADP biosynthesis and is modulated via evolutionarily divergent calmodulin-dependent mechanisms.


    Love, Nick R; Pollak, Nadine; Dölle, Christian; Niere, Marc; Chen, Yaoyao; Oliveri, Paola; Amaya, Enrique; Patel, Sandip; Ziegler, Mathias


    Nicotinamide adenine dinucleotide phosphate (NADP) is a critical cofactor during metabolism, calcium signaling, and oxidative defense, yet how animals regulate their NADP pools in vivo and how NADP-synthesizing enzymes are regulated have long remained unknown. Here we show that expression of Nadk, an NAD(+) kinase-encoding gene, governs NADP biosynthesis in vivo and is essential for development in Xenopus frog embryos. Unexpectedly, we found that embryonic Nadk expression is dynamic, showing cell type-specific up-regulation during both frog and sea urchin embryogenesis. We analyzed the NAD kinases (NADKs) of a variety of deuterostome animals, finding two conserved internal domains forming a catalytic core but a highly divergent N terminus. One type of N terminus (found in basal species such as the sea urchin) mediates direct catalytic activation of NADK by Ca(2+)/calmodulin (CaM), whereas the other (typical for vertebrates) is phosphorylated by a CaM kinase-dependent mechanism. This work indicates that animal NADKs govern NADP biosynthesis in vivo and are regulated by evolutionarily divergent and conserved CaM-dependent mechanisms.

  19. Clade IVa Basic Helix-Loop-Helix Transcription Factors Form Part of a Conserved Jasmonate Signaling Circuit for the Regulation of Bioactive Plant Terpenoid Biosynthesis.


    Mertens, Jan; Van Moerkercke, Alex; Vanden Bossche, Robin; Pollier, Jacob; Goossens, Alain


    Plants produce many bioactive, specialized metabolites to defend themselves when facing various stress situations. Their biosynthesis is directed by a tightly controlled regulatory circuit that is elicited by phytohormones such as jasmonate (JA). The basic helix-loop-helix (bHLH) transcription factors (TFs) bHLH iridoid synthesis 1 (BIS1) and Triterpene Saponin Activating Regulator (TSAR) 1 and 2, from Catharanthus roseus and Medicago truncatula, respectively, all belong to clade IVa of the bHLH protein family and activate distinct terpenoid pathways, thereby mediating monoterpenoid indole alkaloid (MIA) and triterpene saponin (TS) accumulation, respectively, in these two species. In this study, we report that promoters of the genes encoding the enzymes involved in the specific terpenoid pathway of one of these species can be transactivated by the orthologous bHLH factor from the other species through recognition of the same cis-regulatory elements. Accordingly, ectopic expression of CrBIS1 in M. truncatula hairy roots up-regulated the expression of all genes required for soyasaponin production, resulting in strongly increased levels of soyasaponins in the transformed roots. Likewise, transient expression of MtTSAR1 and MtTSAR2 in C. roseus petals led to up-regulation of the genes involved in the iridoid branch of the MIA pathway. Together, our data illustrate the functional similarity of these JA-inducible TFs and indicate that recruitment of defined cis-regulatory elements constitutes an important aspect of the evolution of conserved regulatory modules for the activation of species-specific terpenoid biosynthesis pathways by common signals such as the JA phytohormones.

  20. Graded Proteasome Dysfunction in Caenorhabditis elegans Activates an Adaptive Response Involving the Conserved SKN-1 and ELT-2 Transcription Factors and the Autophagy-Lysosome Pathway.


    Keith, Scott A; Maddux, Sarah K; Zhong, Yayu; Chinchankar, Meghna N; Ferguson, Annabel A; Ghazi, Arjumand; Fisher, Alfred L


    The maintenance of cellular proteins in a biologically active and structurally stable state is a vital endeavor involving multiple cellular pathways. One such pathway is the ubiquitin-proteasome system that represents a major route for protein degradation, and reductions in this pathway usually have adverse effects on the health of cells and tissues. Here, we demonstrate that loss-of-function mutants of the Caenorhabditis elegans proteasome subunit, RPN-10, exhibit moderate proteasome dysfunction and unexpectedly develop both increased longevity and enhanced resistance to multiple threats to the proteome, including heat, oxidative stress, and the presence of aggregation prone proteins. The rpn-10 mutant animals survive through the activation of compensatory mechanisms regulated by the conserved SKN-1/Nrf2 and ELT-2/GATA transcription factors that mediate the increased expression of genes encoding proteasome subunits as well as those mediating oxidative- and heat-stress responses. Additionally, we find that the rpn-10 mutant also shows enhanced activity of the autophagy-lysosome pathway as evidenced by increased expression of the multiple autophagy genes including atg-16.2, lgg-1, and bec-1, and also by an increase in GFP::LGG-1 puncta. Consistent with a critical role for this pathway, the enhanced resistance of the rpn-10 mutant to aggregation prone proteins depends on autophagy genes atg-13, atg-16.2, and prmt-1. Furthermore, the rpn-10 mutant is particularly sensitive to the inhibition of lysosome activity via either RNAi or chemical means. We also find that the rpn-10 mutant shows a reduction in the numbers of intestinal lysosomes, and that the elt-2 gene also plays a novel and vital role in controlling the production of functional lysosomes by the intestine. Overall, these experiments suggest that moderate proteasome dysfunction could be leveraged to improve protein homeostasis and organismal health and longevity, and that the rpn-10 mutant provides a unique

  1. Graded Proteasome Dysfunction in Caenorhabditis elegans Activates an Adaptive Response Involving the Conserved SKN-1 and ELT-2 Transcription Factors and the Autophagy-Lysosome Pathway

    PubMed Central

    Chinchankar, Meghna N.; Ferguson, Annabel A.; Ghazi, Arjumand; Fisher, Alfred L.


    The maintenance of cellular proteins in a biologically active and structurally stable state is a vital endeavor involving multiple cellular pathways. One such pathway is the ubiquitin-proteasome system that represents a major route for protein degradation, and reductions in this pathway usually have adverse effects on the health of cells and tissues. Here, we demonstrate that loss-of-function mutants of the Caenorhabditis elegans proteasome subunit, RPN-10, exhibit moderate proteasome dysfunction and unexpectedly develop both increased longevity and enhanced resistance to multiple threats to the proteome, including heat, oxidative stress, and the presence of aggregation prone proteins. The rpn-10 mutant animals survive through the activation of compensatory mechanisms regulated by the conserved SKN-1/Nrf2 and ELT-2/GATA transcription factors that mediate the increased expression of genes encoding proteasome subunits as well as those mediating oxidative- and heat-stress responses. Additionally, we find that the rpn-10 mutant also shows enhanced activity of the autophagy-lysosome pathway as evidenced by increased expression of the multiple autophagy genes including atg-16.2, lgg-1, and bec-1, and also by an increase in GFP::LGG-1 puncta. Consistent with a critical role for this pathway, the enhanced resistance of the rpn-10 mutant to aggregation prone proteins depends on autophagy genes atg-13, atg-16.2, and prmt-1. Furthermore, the rpn-10 mutant is particularly sensitive to the inhibition of lysosome activity via either RNAi or chemical means. We also find that the rpn-10 mutant shows a reduction in the numbers of intestinal lysosomes, and that the elt-2 gene also plays a novel and vital role in controlling the production of functional lysosomes by the intestine. Overall, these experiments suggest that moderate proteasome dysfunction could be leveraged to improve protein homeostasis and organismal health and longevity, and that the rpn-10 mutant provides a unique

  2. Angiomotin stabilization by tankyrase inhibitors antagonizes constitutive TEAD-dependent transcription and proliferation of human tumor cells with Hippo pathway core component mutations

    PubMed Central

    Esposito, Davide; Garibsingh, Rachel-Ann A.; Reddy, E. Premkumar; Mungamuri, Sathish Kumar; Aaronson, Stuart A.


    The evolutionarily conserved Hippo inhibitory pathway plays critical roles in tissue homeostasis and organ size control, while mutations affecting certain core components contribute to tumorigenesis. Here we demonstrate that proliferation of Hippo pathway mutant human tumor cells exhibiting high constitutive TEAD transcriptional activity was markedly inhibited by dominant negative TEAD4, which did not inhibit the growth of Hippo wild-type cells with low levels of regulatable TEAD-mediated transcription. The tankyrase inhibitor, XAV939, identified in a screen for inhibitors of TEAD transcriptional activity, phenocopied these effects independently of its other known functions by stabilizing angiomotin and sequestering YAP in the cytosol. We also identified one intrinsically XAV939 resistant Hippo mutant tumor line exhibiting lower and less durable angiomotin stabilization. Thus, angiomotin stabilization provides a new mechanism for targeting tumors with mutations in Hippo pathway core components as well as a biomarker for sensitivity to such therapy. PMID:27144834

  3. An Evolutionarily Conserved Mechanism for Activity-Dependent Visual Circuit Development

    PubMed Central

    Pratt, Kara G.; Hiramoto, Masaki; Cline, Hollis T.


    Neural circuit development is an activity-dependent process. This activity can be spontaneous, such as the retinal waves that course across the mammalian embryonic retina, or it can be sensory-driven, such as the activation of retinal ganglion cells (RGCs) by visual stimuli. Whichever the source, neural activity provides essential instruction to the developing circuit. Indeed, experimentally altering activity has been shown to impact circuit development and function in many different ways and in many different model systems. In this review, we contemplate the idea that retinal waves in amniotes, the animals that develop either in ovo or utero (namely reptiles, birds and mammals) could be an evolutionary adaptation to life on land, and that the anamniotes, animals whose development is entirely external (namely the aquatic amphibians and fish), do not display retinal waves, most likely because they simply don’t need them. We then review what is known about the function of both retinal waves and visual stimuli on their respective downstream targets, and predict that the experience-dependent development of the tadpole visual system is a blueprint of what will be found in future studies of the effects of spontaneous retinal waves on instructing development of retinorecipient targets such as the superior colliculus (SC) and the lateral geniculate nucleus. PMID:27818623

  4. Evidence for an Evolutionarily Conserved Memory Coding Scheme in the Mammalian Hippocampus.


    Thome, Alexander; Marrone, Diano F; Ellmore, Timothy M; Chawla, Monica K; Lipa, Peter; Ramirez-Amaya, Victor; Lisanby, Sarah H; McNaughton, Bruce L; Barnes, Carol A


    Decades of research identify the hippocampal formation as central to memory storage and recall. Events are stored via distributed population codes, the parameters of which (e.g., sparsity and overlap) determine both storage capacity and fidelity. However, it remains unclear whether the parameters governing information storage are similar between species. Because episodic memories are rooted in the space in which they are experienced, the hippocampal response to navigation is often used as a proxy to study memory. Critically, recent studies in rodents that mimic the conditions typical of navigation studies in humans and nonhuman primates (i.e., virtual reality) show that reduced sensory input alters hippocampal representations of space. The goal of this study was to quantify this effect and determine whether there are commonalities in information storage across species. Using functional molecular imaging, we observe that navigation in virtual environments elicits activity in fewer CA1 neurons relative to real-world conditions. Conversely, comparable neuronal activity is observed in hippocampus region CA3 and the dentate gyrus under both conditions. Surprisingly, we also find evidence that the absolute number of neurons used to represent an experience is relatively stable between nonhuman primates and rodents. We propose that this convergence reflects an optimal ensemble size for episodic memories.SIGNIFICANCE STATEMENT One primary factor constraining memory capacity is the sparsity of the engram, the proportion of neurons that encode a single experience. Investigating sparsity in humans is hampered by the lack of single-cell resolution and differences in behavioral protocols. Sparsity can be quantified in freely moving rodents, but extrapolating these data to humans assumes that information storage is comparable across species and is robust to restraint-induced reduction in sensory input. Here, we test these assumptions and show that species differences in brain size build memory capacity without altering the structure of the data being stored. Furthermore, sparsity in most of the hippocampus is resilient to reduced sensory information. This information is vital to integrating animal data with human imaging navigation studies.

  5. Molecular phylogeny and biogeography of the weevil subfamily Platypodinae reveals evolutionarily conserved range patterns.


    Jordal, Bjarte H


    Platypodinae is a peculiar weevil subfamily of species that cultivate fungi in tunnels excavated in dead wood. Their geographical distribution is generally restricted, with genera confined to a single continent or large island, which provides a useful system for biogeographical research. This study establishes the first detailed molecular phylogeny of the group, with the aim of testing hypotheses on classification, diversification, and biogeography. A phylogeny was reconstructed based on 3648 nucleotides from COI, EF-1α, CAD, ArgK, and 28S. Tree topology was well resolved and indicated a strong correlation with geography, more so than predicted by previous morphology-based classifications. Tesserocerini was paraphyletic, with Notoplatypus as the sister group to a clade consisting of three main lineages of Tesserocerini and the recently evolved Platypodini. Austroplatypus formed the sister group to all remaining Platypodini and hence confirmed its separate status from Platypus. The Indo-Australian genera of Platypodini were strikingly paraphyletic, suggesting that the taxonomy of this tribe needs careful revision. Ancestral-area reconstructions in Lagrange and S-DIVA were ambiguous for nodes roughly older than 80 Ma. More recent events were firmly assessed and involved post-Gondwanan long-distance dispersal. The Neotropics was colonized three times, all from the Afrotropical region, with the latest event less than 25 Ma that included the ancestor of all Neotropical Platypodini.

  6. Assembly of an Evolutionarily Conserved Alternative Proteasome Isoform in Human Cells.


    Padmanabhan, Achuth; Vuong, Simone Anh-Thu; Hochstrasser, Mark


    Targeted intracellular protein degradation in eukaryotes is largely mediated by the proteasome. Here, we report the formation of an alternative proteasome isoform in human cells, previously found only in budding yeast, that bears an altered subunit arrangement in the outer ring of the proteasome core particle. These proteasomes result from incorporation of an additional α4 (PSMA7) subunit in the position normally occupied by α3 (PSMA4). Assembly of "α4-α4" proteasomes depends on the relative cellular levels of α4 and α3 and on the proteasome assembly chaperone PAC3. The oncogenic tyrosine kinases ABL and ARG and the tumor suppressor BRCA1 regulate cellular α4 levels and formation of α4-α4 proteasomes. Cells primed to assemble α4-α4 proteasomes exhibit enhanced resistance to toxic metal ions. Taken together, our results establish the existence of an alternative mammalian proteasome isoform and suggest a potential role in enabling cells to adapt to environmental stresses.

  7. FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells

    PubMed Central

    Nalbant, Demet; Youn, Hyewon; Nalbant, S Isil; Sharma, Savitha; Cobos, Everardo; Beale, Elmus G; Du, Yang; Williams, Simon C


    Background Hematopoiesis is a complex developmental process controlled by a large number of factors that regulate stem cell renewal, lineage commitment and differentiation. Secreted proteins, including the hematopoietic growth factors, play critical roles in these processes and have important biological and clinical significance. We have employed representational difference analysis to identify genes that are differentially expressed during experimentally induced myeloid differentiation in the murine EML hematopoietic stem cell line. Results One identified clone encoded a previously unidentified protein of 541 amino acids that contains an amino terminal signal sequence but no other characterized domains. This protein is a member of family of related proteins that has been named family with sequence similarity 20 (FAM20) with three members (FAM20A, FAM20B and FAM20C) in mammals. Evolutionary comparisons revealed the existence of a single FAM20 gene in the simple vertebrate Ciona intestinalis and the invertebrate worm Caenorhabditis elegans and two genes in two insect species, Drosophila melanogaster and Anopheles gambiae. Six FAM20 family members were identified in the genome of the pufferfish, Fugu rubripes and five members in the zebrafish, Danio rerio. The mouse Fam20a protein was ectopically expressed in a mammalian cell line and found to be a bona fide secreted protein and efficient secretion was dependent on the integrity of the signal sequence. Expression analysis revealed that the Fam20a gene was indeed differentially expressed during hematopoietic differentiation and that the other two family members (Fam20b and Fam20c) were also expressed during hematcpoiesis but that their mRNA levels did not vary significantly. Likewise FAM20A was expressed in more limited set of human tissues than the other two family members. Conclusions The FAM20 family represents a new family of secreted proteins with potential functions in regulating differentiation and function of hematopoietic and other tissues. The Fam20a mRNA was only expressed during early stages of hematopoietic development and may play a role in lineage commitment or proliferation. The expansion in gene number in different species suggests that the family has evolved as a result of several gene duplication events that have occurred in both vertebrates and invertebrates. PMID:15676076

  8. Ghrelin O-Acyl Transferase in Zebrafish Is an Evolutionarily Conserved Peptide Upregulated During Calorie Restriction

    PubMed Central

    Hatef, Azadeh; Yufa, Roman


    Abstract Ghrelin is a multifunctional orexigenic hormone with a unique acyl modification enabled by ghrelin O-acyl transferase (GOAT). Ghrelin is well-characterized in nonmammals, and GOAT sequences of several fishes are available in the GenBank. However, endogenous GOAT in non-mammals remains poorly understood. In this research, GOAT sequence comparison, tissue-specific GOAT expression, and its regulation by nutrient status and exogenous ghrelin were studied. It was found that the bioactive core of zebrafish GOAT amino acid sequence share high identity with that of mammals. GOAT mRNA was most abundant in the gut. GOAT-like immunoreactivity (i.r.) was found colocalized with ghrelin in the gastric mucosa. Food deprivation increased, and feeding decreased GOAT and preproghrelin mRNA expression in the brain and gut. GOAT and ghrelin peptides in the gut and brain showed corresponding decrease in food-deprived state. Intraperitoneal injection of acylated fish ghrelin caused a significant decrease in GOAT mRNA expression, suggesting a feedback mechanism regulating its abundance. Together, these results provide the first in-depth characterization of GOAT in a non-mammal. Our results demonstrate that endogenous GOAT expression is responsive to metabolic status and availability of acylated ghrelin, providing further evidences for GOAT in the regulation of feeding in teleosts. PMID:26226634

  9. Evolutionarily distinct bacteriophage endolysins featuring conserved peptidoglycan cleavage sites protect mice from MRSA infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Staphylococcus aureus is a Gram-positive pathogen relevant for both human and animal health. With multi-drug resistant S. aureus strains becoming increasingly prevalent, alternative therapeutics are urgently needed. Bacteriophage endolysins (peptidoglycan hydrolases, PGH) are capable of killing Gra...

  10. Evolutionarily Conserved Pattern of Interactions in a Protein Revealed by Local Thermal Expansion Properties.


    Dellarole, Mariano; Caro, Jose A; Roche, Julien; Fossat, Martin; Barthe, Philippe; García-Moreno E, Bertrand; Royer, Catherine A; Roumestand, Christian


    The way in which the network of intramolecular interactions determines the cooperative folding and conformational dynamics of a protein remains poorly understood. High-pressure NMR spectroscopy is uniquely suited to examine this problem because it combines the site-specific resolution of the NMR experiments with the local character of pressure perturbations. Here we report on the temperature dependence of the site-specific volumetric properties of various forms of staphylococcal nuclease (SNase), including three variants with engineered internal cavities, as measured with high-pressure NMR spectroscopy. The strong temperature dependence of pressure-induced unfolding arises from poorly understood differences in thermal expansion between the folded and unfolded states. A significant inverse correlation was observed between the global thermal expansion of the folded proteins and the number of strong intramolecular hydrogen bonds, as determined by the temperature coefficient of the backbone amide chemical shifts. Comparison of the identity of these strong H-bonds with the co-evolution of pairs of residues in the SNase protein family suggests that the architecture of the interactions detected in the NMR experiments could be linked to a functional aspect of the protein. Moreover, the temperature dependence of the residue-specific volume changes of unfolding yielded residue-specific differences in expansivity and revealed how mutations impact intramolecular interaction patterns. These results show that intramolecular interactions in the folded states of proteins impose constraints against thermal expansion and that, hence, knowledge of site-specific thermal expansivity offers insight into the patterns of strong intramolecular interactions and other local determinants of protein stability, cooperativity, and potentially also of function.

  11. The Drosophila wings apart Gene Anchors a Novel, Evolutionarily Conserved Pathway of Neuromuscular Development

    PubMed Central

    Morriss, Ginny R.; Jaramillo, Carmelita T.; Mikolajczak, Crystal M.; Duong, Sandy; Jaramillo, MaryAnn S.; Cripps, Richard M.


    wings apart (wap) is a recessive, semilethal gene located on the X chromosome in Drosophila melanogaster, which is required for normal wing-vein patterning. We show that the wap mutation also results in loss of the adult jump muscle. We use complementation mapping and gene-specific RNA interference to localize the wap locus to the proximal X chromosome. We identify the annotated gene CG14614 as the gene affected by the wap mutation, since one wap allele contains a non-sense mutation in CG14614, and a genomic fragment containing only CG14614 rescues the jump-muscle phenotypes of two wap mutant alleles. The wap gene lies centromere-proximal to touch-insensitive larva B and centromere-distal to CG14619, which is tentatively assigned as the gene affected in introverted mutants. In mutant wap animals, founder cell precursors for the jump muscle are specified early in development, but are later lost. Through tissue-specific knockdowns, we demonstrate that wap function is required in both the musculature and the nervous system for normal jump-muscle formation. wap/CG14614 is homologous to vertebrate wdr68, DDB1 and CUL4 associated factor 7, which also are expressed in neuromuscular tissues. Thus, our findings provide insight into mechanisms of neuromuscular development in higher animals and facilitate the understanding of neuromuscular diseases that may result from mis-expression of muscle-specific or neuron-specific genes. PMID:24026097

  12. Neprilysins: an evolutionarily conserved family of metalloproteases that play important roles in reproduction in Drosophila.


    Sitnik, Jessica L; Francis, Carmen; Hens, Korneel; Huybrechts, Roger; Wolfner, Mariana F; Callaerts, Patrick


    Members of the M13 class of metalloproteases have been implicated in diseases and in reproductive fitness. Nevertheless, their physiological role remains poorly understood. To obtain a tractable model with which to analyze this protein family's function, we characterized the gene family in Drosophila melanogaster and focused on reproductive phenotypes. The D. melanogaster genome contains 24 M13 class protease homologs, some of which are orthologs of human proteases, including neprilysin. Many are expressed in the reproductive tracts of either sex. Using RNAi we individually targeted the five Nep genes most closely related to vertebrate neprilysin, Nep1-5, to investigate their roles in reproduction. A reduction in Nep1, Nep2, or Nep4 expression in females reduced egg laying. Nep1 and Nep2 are required in the CNS and the spermathecae for wild-type fecundity. Females that are null for Nep2 also show defects as hosts of sperm competition as well as an increased rate of depletion for stored sperm. Furthermore, eggs laid by Nep2 mutant females are fertilized normally, but arrest early in embryonic development. In the male, only Nep1 was required to induce normal patterns of female egg laying. Reduction in the expression of Nep2-5 in the male did not cause any dramatic effects on reproductive fitness, which suggests that these genes are either nonessential for male fertility or perform redundant functions. Our results suggest that, consistent with the functions of neprilysins in mammals, these proteins are also required for reproduction in Drosophila, opening up this model system for further functional analysis of this protein class and their substrates.

  13. Imaging evolutionarily conserved neural networks: preferential activation of the olfactory system by food-related odor.


    Kulkarni, Praveen; Stolberg, Tara; Sullivanjr, J M; Ferris, Craig F


    Rodents routinely forge and rely on hippocampal-dependent spatial memory to guide them to sources of caloric rich food in their environment. Has evolution affected the olfactory system and its connections to the hippocampus and limbic cortex, so rodents have an innate sensitivity to energy rich food and their location? To test this notion, we used functional magnetic resonance imaging in awake rats to observe changes in brain activity in response to four odors: benzaldehyde (almond odor), isoamyl acetate (banana odor), methyl benzoate (rosy odor), and limonene (citrus odor). We chose the almond odor because nuts are high in calories and would be expected to convey greater valance as compared to the other odors. Moreover, the standard food chow is devoid of nuts, so laboratory bred rats would not have any previous exposure to this food. Activation maps derived from computational analysis using a 3D segmented rat MRI atlas were dramatically different between odors. Animals exposed to banana, rosy and citrus odors showed modest activation of the primary olfactory system, hippocampus and limbic cortex. However, animals exposed to almond showed a robust increase in brain activity in the primary olfactory system particularly the main olfactory bulb, anterior olfactory nucleus and tenia tecta. The most significant difference in brain activation between odors was observed in the hippocampus and limbic cortex. These findings show that fMRI can be used to identify neural circuits that have an innate sensitivity to environmental stimuli that may help in an animal's survival.

  14. Saccharomyces cerevisiae SMT4 encodes an evolutionarily conserved protease with a role in chromosome condensation regulation.

    PubMed Central

    Strunnikov, A V; Aravind, L; Koonin, E V


    In a search for regulatory genes affecting the targeting of the condensin complex to chromatin in Saccharomyces cerevisiae, we identified a member of the adenovirus protease family, SMT4. SMT4 overexpression suppresses the temperature-sensitive conditional lethal phenotype of smc2-6, but not smc2-8 or smc4-1. A disruption allele of SMT4 has a prominent chromosome phenotype: impaired targeting of Smc4p-GFP to rDNA chromatin. Site-specific mutagenesis of the predicted protease active site cysteine and histidine residues of Smt4p abolishes the SMT4 function in vivo. The previously uncharacterized SIZ1 (SAP and Miz) gene, which encodes a protein containing a predicted DNA-binding SAP module and a Miz finger, is identified as a bypass suppressor of the growth defect associated with the SMT4 disruption. The SIZ1 gene disruption is synthetically lethal with the SIZ2 deletion. We propose that SMT4, SIZ1, and SIZ2 are involved in a novel pathway of chromosome maintenance. PMID:11333221

  15. Evolutionarily conserved amino acids in TCR V regions and MHC control their interaction

    PubMed Central

    Marrack, Philippa; Scott-Browne, James P.; Dai, Shaodong; Gapin, Laurent; Kappler, John W.


    Alpha/beta T cell receptors (TCRs) react with major histocompatibility complex proteins (MHC) plus peptides, a poorly understood phenomenon, probably because thymocytes bearing TCRs that manifest MHC-reactivity too well are lost by negative selection. Only TCRs with attenuated ability to react with MHC appear on mature T cells. Also, the interaction sites between TCRs and MHC may be inherently flexible and hence difficult to spot. Contacts between TCRs and MHC in the solved structures of their complexes were reevaluated with these points in mind. The results show that frequently used amino acids in TCR CDR1 and CDR2 regions are often used to bind MHC, in areas around small amino acids on the surfaces of MHC α helices that form a cup, allowing somewhat flexible binding of the TCRs. The TCR amino acids involved are specific to families of V regions and partially different rules govern recognition of MHC1 versus MHCII. PMID:18304006

  16. Monoacylglycerol Lipases Act as Evolutionarily Conserved Regulators of Non-oxidative Ethanol Metabolism*

    PubMed Central

    Heier, Christoph; Taschler, Ulrike; Radulovic, Maja; Aschauer, Philip; Eichmann, Thomas O.; Grond, Susanne; Wolinski, Heimo; Oberer, Monika; Zechner, Rudolf; Kohlwein, Sepp D.; Zimmermann, Robert


    Fatty acid ethyl esters (FAEEs) are non-oxidative metabolites of ethanol that accumulate in human tissues upon ethanol intake. Although FAEEs are considered as toxic metabolites causing cellular dysfunction and tissue damage, the enzymology of FAEE metabolism remains poorly understood. In this study, we used a biochemical screen in Saccharomyces cerevisiae to identify and characterize putative hydrolases involved in FAEE catabolism. We found that Yju3p, the functional orthologue of mammalian monoacylglycerol lipase (MGL), contributes >90% of cellular FAEE hydrolase activity, and its loss leads to the accumulation of FAEE. Heterologous expression of mammalian MGL in yju3Δ mutants restored cellular FAEE hydrolase activity and FAEE catabolism. Moreover, overexpression or pharmacological inhibition of MGL in mouse AML-12 hepatocytes decreased or increased FAEE levels, respectively. FAEEs were transiently incorporated into lipid droplets (LDs) and both Yju3p and MGL co-localized with these organelles. We conclude that the storage of FAEE in inert LDs and their mobilization by LD-resident FAEE hydrolases facilitate a controlled metabolism of these potentially toxic lipid metabolites. PMID:27036938

  17. A highly conserved SOX6 double binding site mediates SOX6 gene downregulation in erythroid cells

    PubMed Central

    Cantu', Claudio; Grande, Vito; Alborelli, Ilaria; Cassinelli, Letizia; Cantu’, Ileana; Colzani, Maria Teresa; Ierardi, Rossella; Ronzoni, Luisa; Cappellini, Maria Domenica; Ferrari, Giuliana; Ottolenghi, Sergio; Ronchi, Antonella


    The Sox6 transcription factor plays critical roles in various cell types, including erythroid cells. Sox6-deficient mice are anemic due to impaired red cell maturation and show inappropriate globin gene expression in definitive erythrocytes. To identify new Sox6 target genes in erythroid cells, we used the known repressive double Sox6 consensus within the εy-globin promoter to perform a bioinformatic genome-wide search for similar, evolutionarily conserved motifs located within genes whose expression changes during erythropoiesis. We found a highly conserved Sox6 consensus within the Sox6 human gene promoter itself. This sequence is bound by Sox6 in vitro and in vivo, and mediates transcriptional repression in transient transfections in human erythroleukemic K562 cells and in primary erythroblasts. The binding of a lentiviral transduced Sox6FLAG protein to the endogenous Sox6 promoter is accompanied, in erythroid cells, by strong downregulation of the endogenous Sox6 transcript and by decreased in vivo chromatin accessibility of this region to the PstI restriction enzyme. These observations suggest that the negative Sox6 autoregulation, mediated by the double Sox6 binding site within its own promoter, may be relevant to control the Sox6 transcriptional downregulation that we observe in human erythroid cultures and in mouse bone marrow cells in late erythroid maturation. PMID:20852263

  18. Specification of jaw identity by the Hand2 transcription factor

    PubMed Central

    Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko


    Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel’s cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940

  19. Cross-Species Network Analysis Uncovers Conserved Nitrogen-Regulated Network Modules in Rice1[OPEN

    PubMed Central

    Obertello, Mariana; Shrivastava, Stuti; Katari, Manpreet S.; Coruzzi, Gloria M.


    In this study, we used a cross-species network approach to uncover nitrogen (N)-regulated network modules conserved across a model and a crop species. By translating gene network knowledge from the data-rich model Arabidopsis (Arabidopsis thaliana) to a crop, rice (Oryza sativa), we identified evolutionarily conserved N-regulatory modules as targets for translational studies to improve N use efficiency in transgenic plants. To uncover such conserved N-regulatory network modules, we first generated an N-regulatory network based solely on rice transcriptome and gene interaction data. Next, we enhanced the network knowledge in the rice N-regulatory network using transcriptome and gene interaction data from Arabidopsis and new data from Arabidopsis and rice plants exposed to the same N treatment conditions. This cross-species network analysis uncovered a set of N-regulated transcription factors (TFs) predicted to target the same genes and network modules in both species. Supernode analysis of the TFs and their targets in these conserved network modules uncovered genes directly related to N use (e.g. N assimilation) and to other shared biological processes indirectly related to N. This cross-species network approach was validated with members of two TF families in the supernode network, BASIC-LEUCINE ZIPPER TRANSCRIPTION FACTOR1-TGA and HYPERSENSITIVITY TO LOW PI-ELICITED PRIMARY ROOT SHORTENING1 (HRS1)/HRS1 Homolog family, which have recently been experimentally validated to mediate the N response in Arabidopsis. PMID:26045464

  20. The lunule of caligid copepods: an evolutionarily novel structure.


    Kaji, Tomonari; Venmathi Maran, B A; Kondoh, Yuusuke; Ohtsuka, Susumu; Boxshall, Geoff A; Tsukagoshi, Akira


    Nearly half of the genera of the family Caligidae possess an evolutionarily novel structure called the "lunule" on the ventral surface of the frontal plate. Lunules are paired cup-like suckers that assist in securing attachment of the copepod parasite to its host. Although present in genera such as Caligus and Pseudocaligus, lunules are absent in other caligid genera such as Lepeophtheirus as well as in more primitive caligiforms such as members of the families Trebiidae and Dissonidae. We compared the morphology and development of the anterior margin of the frontal plates between two caligids, Pseudocaligus fugu and Lepeophtheirus sekii, and a more basal caligiform, Dissonus heronensis (a dissonid), using scanning electron, transmission electron, and laser confocal microscopes. Our observations suggest that the lunules originated as a modification of the marginal membranes of the ancestral frontal plates. We also demonstrated the presence of an anlagen cell population for the lunule and marginal membrane in the developing frontal plate. These primordial cells can be detected as early as the first stage of the chalimus phase. Based on these observations, an evolutionary scenario for the lunule is proposed based on cytological evidence. This case study enhances our understanding of "evolutionary novelty," which is a main focus of contemporary evolutionary developmental biology.

  1. Evolutionarily Stable Strategies for Fecundity and Swimming Speed of Fish.


    Plank, Michael J; Pitchford, Jonathan W; James, Alex


    Many pelagic fish species have a life history that involves producing a large number of small eggs. This is the result of a trade-off between fecundity and larval survival probability. There are also trade-offs involving other traits, such as larval swimming speed. Swimming faster increases the average food encounter rate but also increases the metabolic cost. Here we introduce an evolutionary model comprising fecundity and swimming speed as heritable traits. We show that there can be two evolutionary stable strategies. In environments where there is little noise in the food encounter rate, the stable strategy is a low-fecundity strategy with a swimming speed that minimises the mean time taken to reach reproductive maturity. However, in noisy environments, for example where the prey distribution is patchy or the water is turbulent, strategies that optimise mean outcomes are often outperformed by strategies that increase inter-individual variance. We show that, when larval growth rates are unpredictable, a high-fecundity strategy is evolutionarily stable. In a population following this strategy, the swimming speed is higher than would be anticipated by maximising the mean growth rate.

  2. Retinoic acid expands the evolutionarily reduced dentition of zebrafish

    PubMed Central

    Seritrakul, Pawat; Samarut, Eric; Lama, Tenzing T. S.; Gibert, Yann; Laudet, Vincent; Jackman, William R.


    Zebrafish lost anterior teeth during evolution but retain a posterior pharyngeal dentition that requires retinoic acid (RA) cell-cell signaling for its development. The purposes of this study were to test the sufficiency of RA to induce tooth development and to assess its role in evolution. We found that exposure of embryos to exogenous RA induces a dramatic anterior expansion of the number of pharyngeal teeth that later form and shifts anteriorly the expression patterns of genes normally expressed in the posterior tooth-forming region, such as pitx2 and dlx2b. After RA exposure, we also observed a correlation between cartilage malformations and ectopic tooth induction, as well as abnormal cranial neural crest marker gene expression. Additionally, we observed that the RA-induced zebrafish anterior teeth resemble in pattern and number the dentition of fish species that retain anterior pharyngeal teeth such as medaka but that medaka do not express the aldh1a2 RA-synthesizing enzyme in tooth-forming regions. We conclude that RA is sufficient to induce anterior ectopic tooth development in zebrafish where teeth were lost in evolution, potentially by altering neural crest cell development, and that changes in the location of RA synthesis correlate with evolutionary changes in vertebrate dentitions.—Seritrakul, P., Samarut, E., Lama, T. T. S., Gibert, Y., Laudet, V., Jackman, W. R. Retinoic acid expands the evolutionarily reduced dentition of zebrafish. PMID:22942074

  3. Evolutionarily advanced ant farmers rear polyploid fungal crops.


    Kooij, P W; Aanen, D K; Schiøtt, M; Boomsma, J J


    Innovative evolutionary developments are often related to gene or genome duplications. The crop fungi of attine fungus-growing ants are suspected to have enhanced genetic variation reminiscent of polyploidy, but this has never been quantified with cytological data and genetic markers. We estimated the number of nuclei per fungal cell for 42 symbionts reared by 14 species of Panamanian fungus-growing ants. This showed that domesticated symbionts of higher attine ants are polykaryotic with 7-17 nuclei per cell, whereas nonspecialized crops of lower attines are dikaryotic similar to most free-living basidiomycete fungi. We then investigated how putative higher genetic diversity is distributed across polykaryotic mycelia, using microsatellite loci and evaluating models assuming that all nuclei are either heterogeneously haploid or homogeneously polyploid. Genetic variation in the polykaryotic symbionts of the basal higher attine genera Trachymyrmex and Sericomyrmex was only slightly enhanced, but the evolutionarily derived crop fungi of Atta and Acromyrmex leaf-cutting ants had much higher genetic variation. Our opposite ploidy models indicated that the symbionts of Trachymyrmex and Sericomyrmex are likely to be lowly and facultatively polyploid (just over two haplotypes on average), whereas Atta and Acromyrmex symbionts are highly and obligatorily polyploid (ca. 5-7 haplotypes on average). This stepwise transition appears analogous to ploidy variation in plants and fungi domesticated by humans and in fungi domesticated by termites and plants, where gene or genome duplications were typically associated with selection for higher productivity, but allopolyploid chimerism was incompatible with sexual reproduction.

  4. Uncharacterized conserved motifs outside the HD-Zip domain in HD-Zip subfamily I transcription factors; a potential source of functional diversity

    PubMed Central


    Background Plant HD-Zip transcription factors are modular proteins in which a homeodomain is associated to a leucine zipper. Of the four subfamilies in which they are divided, the tested members from subfamily I bind in vitro the same pseudopalindromic sequence CAAT(A/T)ATTG and among them, several exhibit similar expression patterns. However, most experiments in which HD-Zip I proteins were over or ectopically expressed under the control of the constitutive promoter 35S CaMV resulted in transgenic plants with clearly different phenotypes. Aiming to elucidate the structural mechanisms underlying such observation and taking advantage of the increasing information in databases of sequences from diverse plant species, an in silico analysis was performed. In addition, some of the results were also experimentally supported. Results A phylogenetic tree of 178 HD-Zip I proteins together with the sequence conservation presented outside the HD-Zip domains allowed the distinction of six groups of proteins. A motif-discovery approach enabled the recognition of an activation domain in the carboxy-terminal regions (CTRs) and some putative regulatory mechanisms acting in the amino-terminal regions (NTRs) and CTRs involving sumoylation and phosphorylation. A yeast one-hybrid experiment demonstrated that the activation activity of ATHB1, a member of one of the groups, is located in its CTR. Chimerical constructs were performed combining the HD-Zip domain of one member with the CTR of another and transgenic plants were obtained with these constructs. The phenotype of the chimerical transgenic plants was similar to the observed in transgenic plants bearing the CTR of the donor protein, revealing the importance of this module inside the whole protein. Conclusions The bioinformatical results and the experiments conducted in yeast and transgenic plants strongly suggest that the previously poorly analyzed NTRs and CTRs of HD-Zip I proteins play an important role in their function, hence

  5. Transcription and activation under environmental stress of the complex telomeric repeats of Chironomus thummi.


    Martínez-Guitarte, J L; Díez, J L; Morcillo, G


    In contrast to their traditional role, telomeres seem to behave as transcriptionally active regions. RNAs complementary to the short DNA repeats characteristic of telomerase-maintained telomeres have recently been identified in various mammalian cell lines, representing a new and unexpected element in telomere architecture. Here, we report the existence of transcripts complementary to telomeric sequences characteristic of Chironomus thummi telomeres. As in other Diptera, the non-canonical telomeres of chironomids lack the simple telomerase repeats and have instead more complex repetitive sequences. Northern blots of total RNA hybridized with telomere probes and RT-PCR with telomere-specific tailed primers confirm the existence of small non-coding RNAs of around 200 bp, the size of the DNA repeated telomeric unit. Telomere transcripts are heterogeneous in length, and they appear as a ladder pattern that probably corresponds to multimers of the repeat. Moreover, telomeres are activated under conditions of environmental stress, such as heat shock, appearing highly decondensed and densely labelled with acetylated H4 histone, as well as with RNA polymerase II antibodies, both marks of transcriptional activity. Changes in the expression levels of telomeric RNA were detected after heat shock. These findings provide evidence that transcriptional activity of the repetitive telomere sequences is an evolutionarily conserved feature, not limited to telomerase telomeres. The functional significance of this non-coding RNA as a new additional element in the context of telomere biology remains to be explained.

  6. Pollen-Specific Activation of Arabidopsis Retrogenes Is Associated with Global Transcriptional Reprogramming[W][OPEN

    PubMed Central

    Abdelsamad, Ahmed; Pecinka, Ales


    Duplications allow for gene functional diversification and accelerate genome evolution. Occasionally, the transposon amplification machinery reverse transcribes the mRNA of a gene, integrates it into the genome, and forms an RNA-duplicated copy: the retrogene. Although retrogenes have been found in plants, their biology and evolution are poorly understood. Here, we identified 251 (216 novel) retrogenes in Arabidopsis thaliana, corresponding to 1% of protein-coding genes. Arabidopsis retrogenes are derived from ubiquitously transcribed parents and reside in gene-rich chromosomal regions. Approximately 25% of retrogenes are cotranscribed with their parents and 3% with head-to-head oriented neighbors. This suggests transcription by novel promoters for 72% of Arabidopsis retrogenes. Many retrogenes reach their transcription maximum in pollen, the tissue analogous to animal spermatocytes, where upregulation of retrogenes has been found previously. This implies an evolutionarily conserved mechanism leading to this transcription pattern of RNA-duplicated genes. During transcriptional repression, retrogenes are depleted of permissive chromatin marks without an obvious enrichment for repressive modifications. However, this pattern is common to many other pollen-transcribed genes independent of their evolutionary origin. Hence, retroposition plays a role in plant genome evolution, and the developmental transcription pattern of retrogenes suggests an analogous regulation of RNA-duplicated genes in plants and animals. PMID:25118244

  7. Multiple transcription factor codes activate epidermal wound-response genes in Drosophila.


    Pearson, Joseph C; Juarez, Michelle T; Kim, Myungjin; Drivenes, Øyvind; McGinnis, William


    Wounds in Drosophila and mouse embryos induce similar genetic pathways to repair epidermal barriers. However, the transcription factors that transduce wound signals to repair epidermal barriers are largely unknown. We characterize the transcriptional regulatory enhancers of 4 genes-Ddc, ple, msn, and kkv-that are rapidly activated in epidermal cells surrounding wounds in late Drosophila embryos and early larvae. These epidermal wound enhancers all contain evolutionarily conserved sequences matching binding sites for JUN/FOS and GRH transcription factors, but vary widely in trans- and cis-requirements for these inputs and their binding sites. We propose that the combination of GRH and FOS is part of an ancient wound-response pathway still used in vertebrates and invertebrates, but that other mechanisms have evolved that result in similar transcriptional output. A common, but largely untested assumption of bioinformatic analyses of gene regulatory networks is that transcription units activated in the same spatial and temporal patterns will require the same cis-regulatory codes. Our results indicate that this is an overly simplistic view.

  8. Testing the evolutionary conservation of vocal motoneurons in vertebrates.


    Albersheim-Carter, Jacob; Blubaum, Aleksandar; Ballagh, Irene H; Missaghi, Kianoush; Siuda, Edward R; McMurray, George; Bass, Andrew H; Dubuc, Réjean; Kelley, Darcy B; Schmidt, Marc F; Wilson, Richard J A; Gray, Paul A


    Medullary motoneurons drive vocalization in many vertebrate lineages including fish, amphibians, birds, and mammals. The developmental history of vocal motoneuron populations in each of these lineages remains largely unknown. The highly conserved transcription factor Paired-like Homeobox 2b (Phox2b) is presumed to be expressed in all vertebrate hindbrain branchial motoneurons, including laryngeal motoneurons essential for vocalization in humans. We used immunohistochemistry and in situ hybridization to examine Phox2b protein and mRNA expression in caudal hindbrain and rostral spinal cord motoneuron populations in seven species across five chordate classes. Phox2b was present in motoneurons dedicated to sound production in mice and frogs (bullfrog, African clawed frog), but not those in bird (zebra finch) or bony fish (midshipman, channel catfish). Overall, the pattern of caudal medullary motoneuron Phox2b expression was conserved across vertebrates and similar to expression in sea lamprey. These observations suggest that motoneurons dedicated to sound production in vertebrates are not derived from a single developmentally or evolutionarily conserved progenitor pool.

  9. Scaling factors: transcription factors regulating subcellular domains.


    Mills, Jason C; Taghert, Paul H


    Developing cells acquire mature fates in part by selective (i.e. qualitatively different) expression of a few cell-specific genes. However, all cells share the same basic repertoire of molecular and subcellular building blocks. Therefore, cells must also specialize according to quantitative differences in cell-specific distributions of those common molecular resources. Here we propose the novel hypothesis that evolutionarily-conserved transcription factors called scaling factors (SFs) regulate quantitative differences among mature cell types. SFs: (1) are induced during late stages of cell maturation; (2) are dedicated to specific subcellular domains; and, thus, (3) allow cells to emphasize specific subcellular features. We identify candidate SFs and discuss one in detail: MIST1 (BHLHA15, vertebrates)/DIMM (CG8667, Drosophila); professional secretory cells use this SF to scale up regulated secretion. Because cells use SFs to develop their mature properties and also to adapt them to ever-changing environmental conditions, SF aberrations likely contribute to diseases of adult onset.

  10. Evolutionarily stable defence and signalling of that defence.


    Broom, M; Speed, M P; Ruxton, G D


    We examine the evolution and maintenance of defence and conspicuousness in prey species using a game theoretic model. In contrast to previous works, predators can raise as well as lower their attack probabilities as a consequence of encountering moderately defended prey. Our model predicts four distinct possibilities for evolutionarily stable strategies (ESSs) featuring maximum crypsis. Namely that such a solution can exist with (1) zero toxicity, (2) a non-zero but non-aversive level of toxicity, (3) a high, aversive level of toxicity or (4) that no such maximally cryptic solution exists. Maximally cryptic prey may still invest in toxins, because of the increased chance of surviving an attack (should they be discovered) that comes from having toxins. The toxin load of maximally cryptic prey may be sufficiently strong that the predators will find them aversive, and seek to avoid similar looking prey in future. However, this aversiveness does not always necessarily trigger aposematic signalling, and highly toxic prey can still be maximally cryptic, because the increased initial rate of attack from becoming more conspicuous is not necessarily always compensated for by increased avoidance of aversive prey by predators. In other circumstances, the optimal toxin load may be insufficient to generate aversion but still be non-zero (because it increases survival), and in yet other circumstances, it is optimal to make no investment in toxins at all. The model also predicts ESSs where the prey are highly defended and aversive and where this defence is advertised at a cost of increased conspicuousness to predators. In many circumstances there is an infinite array of these aposematic ESSs, where the precise appearance is unimportant as long as it is highly visible and shared by all members of the population. Yet another class of solutions is possible where there is strong between-individual variation in appearance between conspicuous, poorly defended prey.

  11. TCP Transcription Factors at the Interface between Environmental Challenges and the Plant's Growth Responses.


    Danisman, Selahattin


    Plants are sessile and as such their reactions to environmental challenges differ from those of mobile organisms. Many adaptions involve growth responses and hence, growth regulation is one of the most crucial biological processes for plant survival and fitness. The plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, PCF1 (TCP) transcription factor family is involved in plant development from cradle to grave, i.e., from seed germination throughout vegetative development until the formation of flowers and fruits. TCP transcription factors have an evolutionary conserved role as regulators in a variety of plant species, including orchids, tomatoes, peas, poplar, cotton, rice and the model plant Arabidopsis. Early TCP research focused on the regulatory functions of TCPs in the development of diverse organs via the cell cycle. Later research uncovered that TCP transcription factors are not static developmental regulators but crucial growth regulators that translate diverse endogenous and environmental signals into growth responses best fitted to ensure plant fitness and health. I will recapitulate the research on TCPs in this review focusing on two topics: the discovery of TCPs and the elucidation of their evolutionarily conserved roles across the plant kingdom, and the variety of signals, both endogenous (circadian clock, plant hormones) and environmental (pathogens, light, nutrients), TCPs respond to in the course of their developmental roles.

  12. Sequences of human immunoglobulin switch regions: implications for recombination and transcription.

    PubMed Central

    Mills, F C; Brooker, J S; Camerini-Otero, R D


    We have sequenced the entire human S mu and S gamma 4 immunoglobulin heavy chain class switch regions, and have also completed the sequence of human S epsilon. S mu is composed predominantly of GAGCT and GGGCT pentameric repeats, with these units also being found in S epsilon at a much lower density. S mu-S gamma 4 matches are infrequent, but S gamma 4 contains a cluster of repeated sequences similar to units in mouse gamma switch sites and unrelated to the S mu repeats, suggesting that S mu-S gamma homology is not important in mu-gamma switching. We examined our epsilon and gamma 4 sequences for features that could regulate production of 'sterile' transcripts preceding switch recombination. There is an Evolutionarily Conserved Sequence (ECS) upstream from the human and mouse S epsilon regions that overlaps and extends 5' to the start sites for human and mouse epsilon sterile transcripts. Similarly, an ECS upstream from S gamma 4 is homologous to a mouse sequence that overlaps and extends 5' to the start sites for mouse gamma 2b sterile transcripts. The epsilon and gamma 4 conserved segments contain potential Interferon Stimulable Response Elements (ISRE's) that are identical between human epsilon and gamma 4. PMID:2124350

  13. TCP Transcription Factors at the Interface between Environmental Challenges and the Plant’s Growth Responses

    PubMed Central

    Danisman, Selahattin


    Plants are sessile and as such their reactions to environmental challenges differ from those of mobile organisms. Many adaptions involve growth responses and hence, growth regulation is one of the most crucial biological processes for plant survival and fitness. The plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, PCF1 (TCP) transcription factor family is involved in plant development from cradle to grave, i.e., from seed germination throughout vegetative development until the formation of flowers and fruits. TCP transcription factors have an evolutionary conserved role as regulators in a variety of plant species, including orchids, tomatoes, peas, poplar, cotton, rice and the model plant Arabidopsis. Early TCP research focused on the regulatory functions of TCPs in the development of diverse organs via the cell cycle. Later research uncovered that TCP transcription factors are not static developmental regulators but crucial growth regulators that translate diverse endogenous and environmental signals into growth responses best fitted to ensure plant fitness and health. I will recapitulate the research on TCPs in this review focusing on two topics: the discovery of TCPs and the elucidation of their evolutionarily conserved roles across the plant kingdom, and the variety of signals, both endogenous (circadian clock, plant hormones) and environmental (pathogens, light, nutrients), TCPs respond to in the course of their developmental roles. PMID:28066483

  14. Autopalmitoylation of TEAD proteins regulates transcriptional output of the Hippo pathway.


    Chan, PuiYee; Han, Xiao; Zheng, Baohui; DeRan, Michael; Yu, Jianzhong; Jarugumilli, Gopala K; Deng, Hua; Pan, Duojia; Luo, Xuelian; Wu, Xu


    TEA domain (TEAD) transcription factors bind to the coactivators YAP and TAZ and regulate the transcriptional output of the Hippo pathway, playing critical roles in organ size control and tumorigenesis. Protein S-palmitoylation attaches a fatty acid, palmitate, to cysteine residues and regulates protein trafficking, membrane localization and signaling activities. Using activity-based chemical probes, we discovered that human TEADs possess intrinsic palmitoylating enzyme-like activities and undergo autopalmitoylation at evolutionarily conserved cysteine residues under physiological conditions. We determined the crystal structures of lipid-bound TEADs and found that the lipid chain of palmitate inserts into a conserved deep hydrophobic pocket. Strikingly, palmitoylation did not alter TEAD's localization, but it was required for TEAD's binding to YAP and TAZ and was dispensable for its binding to the Vgll4 tumor suppressor. Moreover, palmitoylation-deficient TEAD mutants impaired TAZ-mediated muscle differentiation in vitro and tissue overgrowth mediated by the Drosophila YAP homolog Yorkie in vivo. Our study directly links autopalmitoylation to the transcriptional regulation of the Hippo pathway.

  15. Transcription factor SGF1 is critical for the neurodevelopment in the silkworm, Bombyx mori.


    Liu, Zhao-Yang; Yu, Qi; Yang, Chun-Hong; Meng, Miao; Ren, Chun-Jiu; Mu, Zhi-Mei; Cui, Wei-Zheng; Liu, Qing-Xin


    FoxA transcription factors play vital roles in regulating the expression of organ-specific genes. BmSGF1, the sole FoxA family member in Bombyx mori, is required for development of the silk gland. However, the function of BmSGF1 in development of the nervous system in the silkworm remains unknown. Here, we show that the amino acids sequence of BmSGF1 is evolutionarily conserved in its middle region from Trichoplax adhaerens to human and diverged from the homologues in most other species in its N-terminal region. BmSGF1 expresses in the nervous system at the embryonic stage. Knockdown of Bmsgf1 by RNA interference (RNAi) results in abnormal development of axons. Therefore, our results demonstrate that BmSGF1 is an indispensable regulator for neurodevelopment.

  16. The sine oculis homeobox (SIX) family of transcription factors as regulators of development and disease

    PubMed Central

    Kumar, J. P.


    The sine oculis homeobox (SIX) protein family is a group of evolutionarily conserved transcription factors that are found in diverse organisms that range from flatworms to humans. These factors are expressed within, and play pivotal developmental roles in, cell populations that give rise to the head, retina, ear, nose, brain, kidney, muscle and gonads. Mutations within the fly and mammalian versions of these genes have adverse consequences on the development of these organs/tissues. Several SIX proteins have been shown to directly influence the cell cycle and are present at elevated levels during tumorigenesis and within several cancers. This review aims to highlight aspects of (1) the evolutionary history of the SIX family; (2) the structural differences and similarities amongst the different SIX proteins; (3) the role that these genes play in retinal development; and (4) the influence that these proteins have on cell proliferation and growth. PMID:18989625

  17. RFX transcription factors are essential for hearing in mice

    PubMed Central

    Elkon, Ran; Milon, Beatrice; Morrison, Laura; Shah, Manan; Vijayakumar, Sarath; Racherla, Manoj; Leitch, Carmen C.; Silipino, Lorna; Hadi, Shadan; Weiss-Gayet, Michèle; Barras, Emmanuèle; Schmid, Christoph D.; Ait-Lounis, Aouatef; Barnes, Ashley; Song, Yang; Eisenman, David J.; Eliyahu, Efrat; Frolenkov, Gregory I.; Strome, Scott E.; Durand, Bénédicte; Zaghloul, Norann A.; Jones, Sherri M.; Reith, Walter; Hertzano, Ronna


    Sensorineural hearing loss is a common and currently irreversible disorder, because mammalian hair cells (HCs) do not regenerate and current stem cell and gene delivery protocols result only in immature HC-like cells. Importantly, although the transcriptional regulators of embryonic HC development have been described, little is known about the postnatal regulators of maturating HCs. Here we apply a cell type-specific functional genomic analysis to the transcriptomes of auditory and vestibular sensory epithelia from early postnatal mice. We identify RFX transcription factors as essential and evolutionarily conserved regulators of the HC-specific transcriptomes, and detect Rfx1,2,3,5 and 7 in the developing HCs. To understand the role of RFX in hearing, we generate Rfx1/3 conditional knockout mice. We show that these mice are deaf secondary to rapid loss of initially well-formed outer HCs. These data identify an essential role for RFX in hearing and survival of the terminally differentiating outer HCs. PMID:26469318

  18. Expression of transcripts for cysteine-rich secretory proteins (CRISPs) in the murine lacrimal gland.


    Haendler, B; Toda, I; Sullivan, D A; Schleuning, W D


    Cysteine-rich secretory proteins (CRISPs) represent a family of evolutionarily conserved proteins which may play a role in the innate immune system and are transcriptionally regulated by androgens in several tissues. Transcripts for all three members of the CRISP family have now been identified in the murine lacrimal gland. RT-PCR using primers able to discriminate between the related CRISP forms allowed the amplification of fragments with the expected length. DNA sequencing revealed a complete identity with the hitherto characterized epididymal CRISP-1, testicular CRISP-2, and salivary gland CRISP-3. An analysis of several mouse strains indicated that all expressed the three CRISP forms, but in differing amounts. RT-PCR analysis of RNA isolated from acinar cells of lacrimal glands revealed that they expressed CRISP-1 and CRISP-2. Semiquantitative and quantitative analyses furthermore showed higher CRISP-1 and CRISP-3 mRNA levels in the lacrimal glands of male BALB/c and NOD mice when compared to females. Testosterone treatment of C3H/HeJ female mice was followed by an upregulation of the steady-state CRISP-1 but not CRISP-2 transcript levels. A comparable stimulation was observed for the mRNAs coding for parotid secretory protein (PSP), a factor previously shown to exhibit sexual dimorphism in the murine lacrimal gland. The expression of CRISP transcripts in the lacrimal gland is consistent with a function in the innate immune system.

  19. Functional interaction between SNPs and microsatellite in the transcriptional regulation of insulin-like growth factor 1.


    Chen, Holly Y; Huang, Wei; Leung, Vincent H K; Fung, Simon L M; Ma, Suk Ling; Jiang, Hongling; Tang, Nelson L S


    A CA-repeat microsatellite in insulin-like growth factor 1 (IGF1) promoter was associated with interindividual variation of circulating IGF1 level. Previously, we reported that such association was due to variation of haplotype unit in a linkage disequilibrium block composed of microsatellite and single-nucleotide polymorphisms (SNPs), suggesting the presence of an interaction between them. In this study, reporter assays were performed to investigate the regulatory effect and interaction of genetic variants on gene expression. We used an in vitro system to compare the transcriptional activities of haplotypes (rs35767:T>C, the CA-repeat microsatellite, rs5742612:T>C, and rs2288377:T>A) in evolutionarily conserved region of IGF1 promoter. In haplotype C-T-T, a longer microsatellite had a lower transcriptional activity (17.6 ± 2.4-fold for 17 repeats and 8.3 ± 1.1-fold for 21 repeats), whereas in haplotype T-C-A, such trend could not be observed, as the microsatellite with 21 repeats had the highest transcriptional activity (17.5 ± 2.3-fold). Because the microsatellite and SNPs affected the transcriptional activity of each other, there may be an interaction between them in the regulation of IGF1 expression. For the first time, we demonstrated that a noncoding microsatellite polymorphism could act as a functional unit and interact with SNPs in the regulation of transcription in human genome.

  20. One-step identification of conserved miRNAs, their targets, potential transcription factors and effector genes of complete secondary metabolism pathways after 454 pyrosequencing of calyx cDNAs from the Labiate Salvia sclarea L.


    Legrand, Sylvain; Valot, Nadine; Nicolé, Florence; Moja, Sandrine; Baudino, Sylvie; Jullien, Frédéric; Magnard, Jean-Louis; Caissard, Jean-Claude; Legendre, Laurent


    The outermost floral whorl, composed of sepals, is generally thought to function in the protection of reproductive tissues. In the plant family Lamiaceae, sepals are fused into a tube that is densely covered by hairs for mechanical defence and contains secondary metabolites for chemical defence against insects and abiotic stresses. Despite the importance of this tissue in plant fitness, virtually no study has addressed the basic aspects of sepal development and functioning. Because of its large size and its impressive metabolic activity (both in terms of quantity and diversity of secondary metabolites), we have used clary sage calyx as a model system to generate the first high throughput sequencing of the transcriptome of an angiosperm calyx. We applied massive parallel 454 pyrosequencing technology to a normalized cDNA extract and unveiled potential candidate genes for all steps of secondary metabolite pathways (phenylpropanoids and terpenoids). It also proved efficient in predicting the expression of large numbers of transcription factors and, with the use of bioinformatics tools, it predicted in the same sequencing run the presence of a novel class of gene transcription regulatory elements, miRNAs, without the need to generate a separate miRNA library. In our clary sage EST library, 18 conserved miRNAs were predicted. Among them, 15 were present in most studied plant species while the others were only shared with limited or discrete plant lineages. A separate data mining of the same clary sage EST library suggested the presence of 19 potential target genes to the 18 predicted conserved miRNAs. These coded for only 6 transcription factors or F-box proteins, 11 metabolism or abiotic stress response related proteins and 2 products with no known predicted function. All in all, this study provides novel genomic information on an angiosperm calyx and an experimental framework to predict in a single step metabolic pathway enzymes and regulator genes including miRNAs.

  1. Fli-1 controls transcription from the MCP-1 gene promoter, which may provide a novel mechanism for chemokine and cytokine activation.


    Lennard Richard, Mara L; Nowling, Tamara K; Brandon, Danielle; Watson, Dennis K; Zhang, Xian K


    Regulation of proinflammatory cytokines and chemokines is a primary role of the innate immune response. MCP-1 is a chemokine that recruits immune cells to sites of inflammation. Expression of MCP-1 is reduced in primary kidney endothelial cells from mice with a heterozygous knockout of the Fli-1 transcription factor. Fli-1 is a member of the Ets family of transcription factors, which are evolutionarily conserved across several organisms including Drosophilla, Xenopus, mouse and human. Ets family members bind DNA through a consensus sequence GGAA/T, or Ets binding site (EBS). Fli-1 binds to EBSs within the endogenous MCP-1 promoter by ChIP assay. In this study, transient transfection assays indicate that the Fli-1 gene actively promotes transcription from the MCP-1 gene promoter in a dose-dependent manner. Mutation of the DNA binding domain of Fli-1 demonstrated that Fli-1 activates transcription of MCP-1 both directly, by binding to the promoter, and indirectly, likely through interactions with other transcription factors. Another Ets transcription factor, Ets-1, was also tested, but failed to promote transcription. While Ets-1 failed to drive transcription independently, a weak synergistic activation of the MCP-1 promoter was observed between Ets-1 and Fli-1. In addition, Fli-1 and the NFκB family member p65 were found to interact synergistically to activate transcription from the MCP-1 promoter, while Sp1 and p50 inhibit this interaction. Deletion studies identified that EBSs in the distal and proximal MCP-1 promoter are critical for Fli-1 activation from the MCP-1 promoter. Together, these results demonstrate that Fli-1 is a novel regulator of the proinflammatory chemokine MCP-1, that interacts with other transcription factors to form a complex transcriptional mechanism for the activation of MCP-1 and mediation of the inflammatory response.

  2. Identification and analysis of alternative splicing events conserved in human and mouse

    PubMed Central

    Yeo, Gene W.; Van Nostrand, Eric; Holste, Dirk; Poggio, Tomaso; Burge, Christopher B.


    Alternative pre-mRNA splicing affects a majority of human genes and plays important roles in development and disease. Alternative splicing (AS) events conserved since the divergence of human and mouse are likely of primary biological importance, but relatively few of such events are known. Here we describe sequence features that distinguish exons subject to evolutionarily conserved AS, which we call alternative conserved exons (ACEs), from other orthologous human/mouse exons and integrate these features into an exon classification algorithm, acescan. Genome-wide analysis of annotated orthologous human–mouse exon pairs identified ≈2,000 predicted ACEs. Alternative splicing was verified in both human and mouse tissues by using an RT-PCR-sequencing protocol for 21 of 30 (70%) predicted ACEs tested, supporting the validity of a majority of acescan predictions. By contrast, AS was observed in mouse tissues for only 2 of 15 (13%) tested exons that had EST or cDNA evidence of AS in human but were not predicted ACEs, and AS was never observed for 11 negative control exons in human or mouse tissues. Predicted ACEs were much more likely to preserve the reading frame and less likely to disrupt protein domains than other AS events and were enriched in genes expressed in the brain and in genes involved in transcriptional regulation, RNA processing, and development. Our results also imply that the vast majority of AS events represented in the human EST database are not conserved in mouse. PMID:15708978

  3. Chromatin environment, transcriptional regulation, and splicing distinguish lincRNAs and mRNAs

    PubMed Central

    Melé, Marta; Mattioli, Kaia; Mallard, William; Shechner, David M.; Gerhardinger, Chiara; Rinn, John L.


    While long intergenic noncoding RNAs (lincRNAs) and mRNAs share similar biogenesis pathways, these transcript classes differ in many regards. LincRNAs are less evolutionarily conserved, less abundant, and more tissue-specific, suggesting that their pre- and post-transcriptional regulation is different from that of mRNAs. Here, we perform an in-depth characterization of the features that contribute to lincRNA regulation in multiple human cell lines. We find that lincRNA promoters are depleted of transcription factor (TF) binding sites, yet enriched for some specific factors such as GATA and FOS relative to mRNA promoters. Surprisingly, we find that H3K9me3—a histone modification typically associated with transcriptional repression—is more enriched at the promoters of active lincRNA loci than at those of active mRNAs. Moreover, H3K9me3-marked lincRNA genes are more tissue-specific. The most discriminant differences between lincRNAs and mRNAs involve splicing. LincRNAs are less efficiently spliced, which cannot be explained by differences in U1 binding or the density of exonic splicing enhancers but may be partially attributed to lower U2AF65 binding and weaker splicing-related motifs. Conversely, the stability of lincRNAs and mRNAs is similar, differing only with regard to the location of stabilizing protein binding sites. Finally, we find that certain transcriptional properties are correlated with higher evolutionary conservation in both DNA and RNA motifs and are enriched in lincRNAs that have been functionally characterized. PMID:27927715

  4. Disruption of an Evolutionarily Novel Synaptic Expression Pattern in Autism

    PubMed Central

    Jiang, Xi; Hu, Haiyang; Guijarro, Patricia; Mitchell, Amanda; Ely, John J.; Sherwood, Chet C.; Hof, Patrick R.; Qiu, Zilong; Pääbo, Svante; Akbarian, Schahram; Khaitovich, Philipp


    Cognitive defects in autism spectrum disorder (ASD) include socialization and communication: key behavioral capacities that separate humans from other species. Here, we analyze gene expression in the prefrontal cortex of 63 autism patients and control individuals, as well as 62 chimpanzees and macaques, from natal to adult age. We show that among all aberrant expression changes seen in ASD brains, a single aberrant expression pattern overrepresented in genes involved synaptic-related pathways is enriched in nucleotide variants linked to autism. Furthermore, only this pattern contains an excess of developmental expression features unique to humans, thus resulting in the disruption of human-specific developmental programs in autism. Several members of the early growth response (EGR) transcription factor family can be implicated in regulation of this aberrant developmental change. Our study draws a connection between the genetic risk architecture of autism and molecular features of cortical development unique to humans. PMID:27685936

  5. A modular system of DNA enhancer elements mediates tissue-specific activation of transcription by high dietary zinc in C. elegans

    PubMed Central

    Roh, Hyun Cheol; Dimitrov, Ivan; Deshmukh, Krupa; Zhao, Guoyan; Warnhoff, Kurt; Cabrera, Daniel; Tsai, Wendy; Kornfeld, Kerry


    Zinc is essential for biological systems, and aberrant zinc metabolism is implicated in a broad range of human diseases. To maintain homeostasis in response to fluctuating levels of dietary zinc, animals regulate gene expression; however, mechanisms that mediate the transcriptional response to fluctuating levels of zinc have not been fully defined. Here, we identified DNA enhancer elements that mediate intestine-specific transcriptional activation in response to high levels of dietary zinc in C. elegans. Using bioinformatics, we characterized an evolutionarily conserved enhancer element present in multiple zinc-inducible genes, the high zinc activation (HZA) element. The HZA was consistently adjacent to a GATA element that mediates expression in intestinal cells. Functional studies using transgenic animals demonstrated that this modular system of DNA enhancers mediates tissue-specific transcriptional activation in response to high levels of dietary zinc. We used this information to search the genome and successfully identified novel zinc-inducible genes. To characterize the mechanism of enhancer function, we demonstrated that the GATA transcription factor ELT-2 and the mediator subunit MDT-15 are necessary for zinc-responsive transcriptional activation. These findings define new mechanisms of zinc homeostasis and tissue-specific regulation of transcription. PMID:25552416

  6. 18 CFR 1b.12 - Transcripts.

    Code of Federal Regulations, 2011 CFR


    ... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any,...

  7. 18 CFR 1b.12 - Transcripts.

    Code of Federal Regulations, 2014 CFR


    ... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any,...

  8. 18 CFR 1b.12 - Transcripts.

    Code of Federal Regulations, 2012 CFR


    ... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any,...

  9. 18 CFR 1b.12 - Transcripts.

    Code of Federal Regulations, 2013 CFR


    ... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any,...

  10. 18 CFR 1b.12 - Transcripts.

    Code of Federal Regulations, 2010 CFR


    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Transcripts. 1b.12 Section 1b.12 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY GENERAL RULES RULES RELATING TO INVESTIGATIONS § 1b.12 Transcripts. Transcripts, if any,...

  11. Functional diversification within the family of B-GATA transcription factors through the leucine-leucine-methionine domain.


    Behringer, Carina; Bastakis, Emmanouil; Ranftl, Quirin L; Mayer, Klaus F X; Schwechheimer, Claus


    The transcription of the Arabidopsis (Arabidopsis thaliana) GATA transcription factors GATA, NITRATE-INDUCIBLE, CARBON METABOLISM-INVOLVED (GNC) and GNC-LIKE (GNL)/CYTOKININ-RESPONSIVE GATA FACTOR1 is controlled by several growth regulatory signals including light and the phytohormones auxin, cytokinin, and gibberellin. To date, GNC and GNL have been attributed functions in the control of germination, greening, flowering time, floral development, senescence, and floral organ abscission. GNC and GNL belong to the 11-member family of B-class GATA transcription factors that are characterized to date solely by their high sequence conservation within the GATA DNA-binding domain. The degree of functional conservation among the various B-class GATA family members is not understood. Here, we identify and examine B-class GATAs from Arabidopsis, tomato (Solanum lycopersicon), Brachypodium (Brachypodium distachyon), and barley (Hordeum vulgare). We find that B-class GATAs from these four species can be subdivided based on their short or long N termini and the presence of the 13-amino acid C-terminal leucine-leucine-methionine (LLM) domain with the conserved motif LLM. Through overexpression analyses and by complementation of a gnc gnl double mutant, we provide evidence that the length of the N terminus may not allow distinguishing between the different B-class GATAs at the functional level. In turn, we find that the presence and absence of the LLM domain in the overexpressors has differential effects on hypocotyl elongation, leaf shape, and petiole length, as well as on gene expression. Thus, our analyses identify the LLM domain as an evolutionarily conserved domain that determines B-class GATA factor identity and provides a further subclassification criterion for this transcription factor family.

  12. Noncoding RNA. piRNA-guided slicing specifies transcripts for Zucchini-dependent, phased piRNA biogenesis.


    Mohn, Fabio; Handler, Dominik; Brennecke, Julius


    In animal gonads, PIWI-clade Argonaute proteins repress transposons sequence-specifically via bound Piwi-interacting RNAs (piRNAs). These are processed from single-stranded precursor RNAs by largely unknown mechanisms. Here we show that primary piRNA biogenesis is a 3'-directed and phased process that, in the Drosophila germ line, is initiated by secondary piRNA-guided transcript cleavage. Phasing results from consecutive endonucleolytic cleavages catalyzed by Zucchini, implying coupled formation of 3' and 5' ends of flanking piRNAs. Unexpectedly, Zucchini also participates in 3' end formation of secondary piRNAs. Its function can, however, be bypassed by downstream piRNA-guided precursor cleavages coupled to exonucleolytic trimming. Our data uncover an evolutionarily conserved piRNA biogenesis mechanism in which Zucchini plays a central role in defining piRNA 5' and 3' ends.

  13. Paired related homeobox protein-like 1 (Prrxl1) controls its own expression by a transcriptional autorepression mechanism.


    Monteiro, César B; Costa, Mariana F; Reguenga, Carlos; Lima, Deolinda; Castro, Diogo S; Monteiro, Filipe A


    The homeodomain factor paired related homeobox protein-like 1 (Prrxl1) is crucial for proper assembly of dorsal root ganglia (DRG)-dorsal spinal cord (SC) pain-sensing circuit. By performing chromatin immunoprecipitation with either embryonic DRG or dorsal SC, we identified two evolutionarily conserved regions (i.e. proximal promoter and intron 4) of Prrxl1 locus that show tissue-specific binding of Prrxl1. Transcriptional assays confirm the identified regions can mediate repression by Prrxl1, while gain-of-function studies in Prrxl1 expressing ND7/23 cells indicate Prrxl1 can down-regulate its own expression. Altogether, our results suggest that Prrxl1 uses distinct regulatory regions to repress its own expression in DRG and dorsal SC.

  14. A nuclear DNA perspective on delineating evolutionarily significant lineages in polyploids: the case of the endangered shortnose sturgeon (Acipenser brevirostrum)

    USGS Publications Warehouse

    King, Timothy L.; Henderson, Anne P.; Kynard, Boyd E.; Kieffer, Micah C.; Peterson, Douglas L.; Aunins, Aaron W.; Brown, Bonnie L.


    The shortnose sturgeon, Acipenser brevirostrum, oft considered a phylogenetic relic, is listed as an “endangered species threatened with extinction” in the US and “Vulnerable” on the IUCN Red List. Effective conservation of A. brevirostrum depends on understanding its diversity and evolutionary processes, yet challenges associated with the polyploid nature of its nuclear genome have heretofore limited population genetic analysis to maternally inherited haploid characters. We developed a suite of polysomic microsatellite DNA markers and characterized a sample of 561 shortnose sturgeon collected from major extant populations along the North American Atlantic coast. The 181 alleles observed at 11 loci were scored as binary loci and the data were subjected to multivariate ordination, Bayesian clustering, hierarchical partitioning of variance, and among-population distance metric tests. The methods uncovered moderately high levels of gene diversity suggesting population structuring across and within three metapopulations (Northeast, Mid-Atlantic, and Southeast) that encompass seven demographically discrete and evolutionarily distinct lineages. The predicted groups are consistent with previously described behavioral patterns, especially dispersal and migration, supporting the interpretation that A. brevirostrum exhibit adaptive differences based on watershed. Combined with results of prior genetic (mitochondrial DNA) and behavioral studies, the current work suggests that dispersal is an important factor in maintaining genetic diversity in A. brevirostrum and that the basic unit for conservation management is arguably the local population.

  15. rVISTA 2.0: evolutionary analysis of transcription factor binding sites.


    Loots, Gabriela G; Ovcharenko, Ivan


    Identifying and characterizing the transcription factor binding site (TFBS) patterns of cis-regulatory elements represents a challenge, but holds promise to reveal the regulatory language the genome uses to dictate transcriptional dynamics. Several studies have demonstrated that regulatory modules are under positive selection and, therefore, are often conserved between related species. Using this evolutionary principle, we have created a comparative tool, rVISTA, for analyzing the regulatory potential of noncoding sequences. Our ability to experimentally identify functional noncoding sequences is extremely limited, therefore, rVISTA attempts to fill this great gap in genomic analysis by offering a powerful approach for eliminating TFBSs least likely to be biologically relevant. The rVISTA tool combines TFBS predictions, sequence comparisons and cluster analysis to identify noncoding DNA regions that are evolutionarily conserved and present in a specific configuration within genomic sequences. Here, we present the newly developed version 2.0 of the rVISTA tool, which can process alignments generated by both the zPicture and blastz alignment programs or use pre-computed pairwise alignments of several vertebrate genomes available from the ECR Browser and GALA database. The rVISTA web server is closely interconnected with the TRANSFAC database, allowing users to either search for matrices present in the TRANSFAC library collection or search for user-defined consensus sequences. The rVISTA tool is publicly available at

  16. Conservation of NLR-triggered immunity across plant lineages.


    Maekawa, Takaki; Kracher, Barbara; Vernaldi, Saskia; Ver Loren van Themaat, Emiel; Schulze-Lefert, Paul


    The nucleotide-binding domain and leucine-rich repeat (NLR) family of plant receptors detects pathogen-derived molecules, designated effectors, inside host cells and mediates innate immune responses to pathogenic invaders. Genetic evidence revealed species-specific coevolution of many NLRs with effectors from host-adapted pathogens, suggesting that the specificity of these NLRs is restricted to the host or closely related plant species. However, we report that an NLR immune receptor (MLA1) from monocotyledonous barley is fully functional in partially immunocompromised dicotyledonous Arabidopsis thaliana against the barley powdery mildew fungus, Blumeria graminis f. sp. hordei. This implies ~200 million years of evolutionary conservation of the underlying immune mechanism. A time-course RNA-seq analysis in transgenic Arabidopsis lines detected sustained expression of a large MLA1-dependent gene cluster. This cluster is greatly enriched in genes known to respond to the fungal cell wall-derived microbe-associated molecular pattern chitin. The MLA1-dependent sustained transcript accumulation could define a conserved function of the nuclear pool of MLA1 detected in barley and Arabidopsis. We also found that MLA1-triggered immunity was fully retained in mutant plants that are simultaneously depleted of ethylene, jasmonic acid, and salicylic acid signaling. This points to the existence of an evolutionarily conserved and phytohormone-independent MLA1-mediated resistance mechanism. This also suggests a conserved mechanism for internalization of B. graminis f. sp. hordei effectors into host cells of flowering plants. Furthermore, the deduced connectivity of the NLR to multiple branches of immune signaling pathways likely confers increased robustness against pathogen effector-mediated interception of host immune signaling and could have contributed to the evolutionary preservation of the immune mechanism.

  17. A conserved role for the 20S proteasome and Nrf2 transcription factor in oxidative stress adaptation in mammals, Caenorhabditis elegans and Drosophila melanogaster

    PubMed Central

    Pickering, Andrew M.; Staab, Trisha A.; Tower, John; Sieburth, Derek; Davies, Kelvin J. A.


    SUMMARY In mammalian cells, hydrogen peroxide (H2O2)-induced adaptation to oxidative stress is strongly dependent on an Nrf2 transcription factor-mediated increase in the 20S proteasome. Here, we report that both Caenorhabditis elegans nematode worms and Drosophila melanogaster fruit flies are also capable of adapting to oxidative stress with H2O2 pre-treatment. As in mammalian cells, this adaptive response in worms and flies involves an increase in proteolytic activity and increased expression of the 20S proteasome, but not of the 26S proteasome. We also found that the increase in 20S proteasome expression in both worms and flies, as in mammalian cells, is important for the adaptive response, and that it is mediated by the SKN-1 and CNC-C orthologs of the mammalian Nrf2 transcription factor, respectively. These studies demonstrate that stress mechanisms operative in cell culture also apply in disparate intact organisms across a wide biological diversity. PMID:23038734

  18. Molecular and biochemical analysis of rainbow trout LCK suggests a conserved mechanism for T-cell signaling in gnathostomes

    USGS Publications Warehouse

    Laing, K.J.; Dutton, S.; Hansen, J.D.


    Two genes were identified in rainbow trout that display high sequence identity to vertebrate Lck. Both of the trout Lck transcripts are associated with lymphoid tissues and were found to be highly expressed in IgM-negative lymphocytes. In vitro analysis of trout lymphocytes indicates that trout Lck mRNA is up-regulated by T-cell mitogens, supporting an evolutionarily conserved function for Lck in the signaling pathways of T-lymphocytes. Here, we describe the generation and characterization of a specific monoclonal antibody raised against the N-terminal domains of recombinant trout Lck that can recognize Lck protein(s) from trout thymocyte lysates that are similar in size (???57 kDa) to mammalian Lck. This antibody also reacted with permeabilized lymphocytes during FACS analysis, indicating its potential usage for cellular analyses of trout lymphocytes, thus representing an important tool for investigations of salmonid T-cell function.

  19. A Conserved Structural Signature of the Homeobox Coding DNA in HOX genes

    PubMed Central

    Fongang, Bernard; Kong, Fanping; Negi, Surendra; Braun, Werner; Kudlicki, Andrzej


    The homeobox encodes a DNA-binding domain found in transcription factors regulating key developmental processes. The most notable examples of homeobox containing genes are the Hox genes, arranged on chromosomes in the same order as their expression domains along the body axis. The mechanisms responsible for the synchronous regulation of Hox genes and the molecular function of their colinearity remain unknown. Here we report the discovery of a conserved structural signature of the 180-base pair DNA fragment comprising the homeobox. We demonstrate that the homeobox DNA has a characteristic 3-base-pair periodicity in the hydroxyl radical cleavage pattern. This periodic pattern is significant in most of the 39 mammalian Hox genes and in other homeobox-containing transcription factors. The signature is present in segmented bilaterian animals as evolutionarily distant as humans and flies. It remains conserved despite the fact that it would be disrupted by synonymous mutations, which raises the possibility of evolutionary selective pressure acting on the structure of the coding DNA. The homeobox coding DNA may therefore have a secondary function, possibly as a regulatory element. The existence of such element may have important consequences for understanding how these genes are regulated. PMID:27739488

  20. A Conserved Structural Signature of the Homeobox Coding DNA in HOX genes.


    Fongang, Bernard; Kong, Fanping; Negi, Surendra; Braun, Werner; Kudlicki, Andrzej


    The homeobox encodes a DNA-binding domain found in transcription factors regulating key developmental processes. The most notable examples of homeobox containing genes are the Hox genes, arranged on chromosomes in the same order as their expression domains along the body axis. The mechanisms responsible for the synchronous regulation of Hox genes and the molecular function of their colinearity remain unknown. Here we report the discovery of a conserved structural signature of the 180-base pair DNA fragment comprising the homeobox. We demonstrate that the homeobox DNA has a characteristic 3-base-pair periodicity in the hydroxyl radical cleavage pattern. This periodic pattern is significant in most of the 39 mammalian Hox genes and in other homeobox-containing transcription factors. The signature is present in segmented bilaterian animals as evolutionarily distant as humans and flies. It remains conserved despite the fact that it would be disrupted by synonymous mutations, which raises the possibility of evolutionary selective pressure acting on the structure of the coding DNA. The homeobox coding DNA may therefore have a secondary function, possibly as a regulatory element. The existence of such element may have important consequences for understanding how these genes are regulated.

  1. Conserved Overlapping Gene Arrangement, Restricted Expression, and Biochemical Activities of DNA Polymerase ν (POLN)*

    PubMed Central

    Takata, Kei-ichi; Tomida, Junya; Reh, Shelley; Swanhart, Lisa M.; Takata, Minoru; Hukriede, Neil A.; Wood, Richard D.


    DNA polymerase ν (POLN) is one of 16 DNA polymerases encoded in vertebrate genomes. It is important to determine its gene expression patterns, biological roles, and biochemical activities. By quantitative analysis of mRNA expression, we found that POLN from the zebrafish Danio rerio is expressed predominantly in testis. POLN is not detectably expressed in zebrafish embryos or in mouse embryonic stem cells. Consistent with this, injection of POLN-specific morpholino antisense oligonucleotides did not interfere with zebrafish embryonic development. Analysis of transcripts revealed that vertebrate POLN has an unusual gene expression arrangement, sharing a first exon with HAUS3, the gene encoding augmin-like complex subunit 3. HAUS3 is broadly expressed in embryonic and adult tissues, in contrast to POLN. Differential expression of POLN and HAUS3 appears to arise by alternate splicing of transcripts in mammalian cells and zebrafish. When POLN was ectopically overexpressed in human cells, it specifically coimmunoprecipitated with the homologous recombination factors BRCA1 and FANCJ, but not with previously suggested interaction partners (HELQ and members of the Fanconi anemia core complex). Purified zebrafish POLN protein is capable of thymine glycol bypass and strand displacement, with activity dependent on a basic amino acid residue known to stabilize the primer-template. These properties are conserved with the human enzyme. Although the physiological function of pol ν remains to be clarified, this study uncovers distinctive aspects of its expression control and evolutionarily conserved properties of this DNA polymerase. PMID:26269593

  2. Transcriptional regulation of the human, porcine and bovine OCTN2 gene by PPARα via a conserved PPRE located in intron 1

    PubMed Central


    Background The novel organic cation transporter 2 (OCTN2) is the physiologically most important carnitine transporter in tissues and is responsible for carnitine absorption in the intestine, carnitine reabsorption in the kidney and distribution of carnitine between tissues. Genetic studies clearly demonstrated that the mouse OCTN2 gene is directly regulated by peroxisome proliferator-activated receptor α (PPARα). Despite its well conserved role as an important regulator of lipid catabolism in general, the specific genes under control of PPARα within each lipid metabolic pathway were shown to differ between species and it is currently unknown whether the OCTN2 gene is also a PPARα target gene in pig, cattle, and human. In the present study we examined the hypothesis that the porcine, bovine, and human OCTN2 gene are also PPARα target genes. Results Using positional cloning and reporter gene assays we identified a functional PPRE, each in the intron 1 of the porcine, bovine, and human OCTN2 gene. Gel shift assay confirmed binding of PPARα to this PPRE in the porcine, bovine, and the human OCTN2 gene. Conclusions The results of the present study show that the porcine, bovine, and human OCTN2 gene, like the mouse OCTN2 gene, is directly regulated by PPARα. This suggests that regulation of genes involved in carnitine uptake by PPARα is highly conserved across species. PMID:25299939

  3. CpG methylation is targeted to transcription units in an invertebrate genome

    PubMed Central

    Suzuki, Miho M.; Kerr, Alastair R.W.; De Sousa, Dina; Bird, Adrian


    DNA is methylated at the dinucleotide CpG in genomes of a wide range of plants and animals. Among animals, variable patterns of genomic CpG methylation have been described, ranging from undetectable levels (e.g., in Caenorhabditis elegans) to high levels of global methylation in the vertebrates. The most frequent pattern in invertebrate animals, however, is mosaic methylation, comprising domains of methylated DNA interspersed with unmethylated domains. To understand the origin of mosaic DNA methylation patterns, we examined the distribution of DNA methylation in the Ciona intestinalis genome. Bisulfite sequencing and computational analysis revealed methylated domains with sharp boundaries that strongly colocalize with ∼60% of transcription units. By contrast, promoters, intergenic DNA, and transposons are not preferentially targeted by DNA methylation. Methylated transcription units include evolutionarily conserved genes, whereas the most highly expressed genes preferentially belong to the unmethylated fraction. The results lend support to the hypothesis that CpG methylation functions to suppress spurious transcriptional initiation within infrequently transcribed genes. PMID:17420183

  4. Plant stem cell maintenance involves direct transcriptional repression of differentiation program.


    Yadav, Ram Kishor; Perales, Mariano; Gruel, Jérémy; Ohno, Carolyn; Heisler, Marcus; Girke, Thomas; Jönsson, Henrik; Reddy, G Venugopala


    In animal systems, master regulatory transcription factors (TFs) mediate stem cell maintenance through a direct transcriptional repression of differentiation promoting TFs. Whether similar mechanisms operate in plants is not known. In plants, shoot apical meristems serve as reservoirs of stem cells that provide cells for all above ground organs. WUSCHEL, a homeodomain TF produced in cells of the niche, migrates into adjacent cells where it specifies stem cells. Through high-resolution genomic analysis, we show that WUSCHEL represses a large number of genes that are expressed in differentiating cells including a group of differentiation promoting TFs involved in leaf development. We show that WUS directly binds to the regulatory regions of differentiation promoting TFs; KANADI1, KANADI2, ASYMMETRICLEAVES2 and YABBY3 to repress their expression. Predictions from a computational model, supported by live imaging, reveal that WUS-mediated repression prevents premature differentiation of stem cell progenitors, being part of a minimal regulatory network for meristem maintenance. Our work shows that direct transcriptional repression of differentiation promoting TFs is an evolutionarily conserved logic for stem cell regulation.

  5. Chemical perturbation of an intrinsically disordered region of TFIID distinguishes two modes of transcription initiation

    PubMed Central

    Zhang, Zhengjian; Boskovic, Zarko; Hussain, Mahmud M; Hu, Wenxin; Inouye, Carla; Kim, Han-Je; Abole, A Katherine; Doud, Mary K; Lewis, Timothy A; Koehler, Angela N; Schreiber, Stuart L; Tjian, Robert


    Intrinsically disordered proteins/regions (IDPs/IDRs) are proteins or peptide segments that fail to form stable 3-dimensional structures in the absence of partner proteins. They are abundant in eukaryotic proteomes and are often associated with human diseases, but their biological functions have been elusive to study. In this study, we report the identification of a tin(IV) oxochloride-derived cluster that binds an evolutionarily conserved IDR within the metazoan TFIID transcription complex. Binding arrests an isomerization of promoter-bound TFIID that is required for the engagement of Pol II during the first (de novo) round of transcription initiation. However, the specific chemical probe does not affect reinitiation, which requires the re-entry of Pol II, thus, mechanistically distinguishing these two modes of transcription initiation. This work also suggests a new avenue for targeting the elusive IDRs by harnessing certain features of metal-based complexes for mechanistic studies, and for the development of novel pharmaceutical interventions. DOI: PMID:26314865

  6. Regulated Formation of LncRNA-DNA Hybrids Enables Faster Transcriptional Induction and Environmental Adaptation

    PubMed Central

    Cloutier, Sara C.; Wang, Siwen; Ma, Wai Kit; Al Husini, Nadra; Dhoondia, Zuzer; Ansari, Athar; Pascuzzi, Pete E.; Tran, Elizabeth J.


    Summary Long non-coding (lnc)RNAs, once thought to merely represent noise from imprecise transcription initiation, have now emerged as major regulatory entities in all eukaryotes. In contrast to the rapidly expanding identification of individual lncRNAs, mechanistic characterization has lagged behind. Here we provide evidence that the GAL lncRNAs in the budding yeast S. cerevisiae promote transcriptional induction in trans by formation of lncRNA-DNA hybrids or R-loops. The evolutionarily conserved RNA helicase Dbp2 regulates formation of these R-loops as genomic deletion or nuclear depletion results in accumulation of these structures across the GAL cluster gene promoters and coding regions. Enhanced transcriptional induction is manifested by lncRNA-dependent displacement of the Cyc8 co-repressor and subsequent gene looping, suggesting that these lncRNAs promote induction by altering chromatin architecture. Moreover, the GAL lncRNAs confer a competitive fitness advantage to yeast cells as expression of these non-coding molecules correlates with faster adaptation in response to an environmental switch. PMID:26833086

  7. The update on transcriptional regulation of autophagy in normal and pathologic cells: A novel therapeutic target.


    Zhang, Zili; Guo, Mei; Zhao, Shifeng; Xu, Wenxuan; Shao, Jiangjuan; Zhang, Feng; Wu, Li; Lu, Yin; Zheng, Shizhong


    Autophagy is a genetically programmed, evolutionarily conserved catabolic process that occurs in response to stress. While short-lived proteins are degraded via the ubiquitin/proteasome pathway in higher eukaryotes, autophagy refers to intracellular pathway for development, differentiation, survival, and homeostasis through the lysosomal-dependent machinery, which regulates the synthesis, degradation, and recycling of long-lived proteins and even whole cytoplasmic organelles. The newly discovery shows that autophagy plays an important role in recycling nutrients upon starvation and maintaining cellular energy homeostasis. Recent basic and clinical investigations further demonstrate that autophagic abnormalities have been considered underlying reasons for lots of human diseases, including liver disease, cardiovascular and cerebrovascular diseases, neurodegenerative diseases, neoplastic diseases, and cancers. Pharmacological modulation of autophagy might point to possible therapeutic strategies for combating a broad range of diseases. Regrettably, although the mechanisms underlying the regulation of autophagy have long been attracted extensive concern of numerous scholars and its acute regulation by nutrient-sensing signaling pathways is well described, the overview on longer-term transcriptional regulation of autophagy is still filled with confusion. This review summarizes current knowledge on transcriptional regulation of autophagy and expands our horizons on the autophagy repertoire. On the other hand, it also offers a glimpse into different strategies that have been used in experimental models to counteract excessive pathological autophagy via transcriptional regulation mechanism in the prevention and treatment of disease.

  8. TOPLESS mediates brassinosteroid-induced transcriptional repression through interaction with BZR1.


    Oh, Eunkyoo; Zhu, Jia-Ying; Ryu, Hojin; Hwang, Ildoo; Wang, Zhi-Yong


    Brassinosteroid (BR) regulates plant development by activating the transcription factor brassinazole resistant 1 (BZR1), which activates and represses different target genes to switch cellular programmes. The mechanisms that determine BZR1's transcriptional activities remain largely unknown. Here we show that BZR1 represses target genes by recruiting the Groucho/TUP1-like transcriptional corepressor TOPLESS (TPL). Specific deletion or mutation of an evolutionarily conserved ERF-associated amphiphilic repression (EAR) motif at the carboxy terminus abolishes BZR1's abilities to regulate gene expression and cell elongation, but these defects are rescued by TPL fusion to the EAR motif-mutated BZR1. The EAR motif in BZR1 mediates recruitment of TPL to BZR1-repressed promoters. A triple tpl mutant (tpl;tpr1;tpr4) shows reduced BR sensitivity and suppresses the gain-of-function bzr1-1D mutant phenotype. BR repression of gene expression also requires histone deacetylases that interact with TPL. Our study demonstrates key roles of the EAR motif and TPL in BR regulation of gene expression and plant growth.

  9. Conserved homeodomain proteins interact with MADS box protein Mcm1 to restrict ECB-dependent transcription to the M/G1 phase of the cell cycle

    PubMed Central

    Pramila, Tata; Miles, Shawna; GuhaThakurta, Debraj; Jemiolo, Dave; Breeden, Linda L.


    Two homeodomain proteins, Yox1 and Yhp1, act as repressors at early cell cycle boxes (ECBs) to restrict their activity to the M/G1 phase of the cell cycle in budding yeast. These proteins bind to Mcm1 and to a typical homeodomain binding site. The expression of Yox1 is periodic and directly correlated with its binding to, and repression of, ECB activity. The absence of Yox1 and Yhp1 or the constitutive expression of Yox1 leads to the loss of cell-cycle regulation of ECB activity. Therefore, the cell-cycle-regulated expression of these repressors defines the interval of ECB-dependent transcription. Twenty-eight genes, including MCM2-7, CDC6, SWI4, CLN3, and a number of genes required during late M phase have been identified that are coordinately regulated by this pathway. PMID:12464633

  10. Genome-Wide Analyses of Nkx2-1 Binding to Transcriptional Target Genes Uncover Novel Regulatory Patterns Conserved in Lung Development and Tumors

    PubMed Central

    Tagne, Jean-Bosco; Gupta, Sumeet; Gower, Adam C.; Shen, Steven S.; Varma, Saaket; Lakshminarayanan, Meenakshi; Cao, Yuxia; Spira, Avrum; Volkert, Thomas L.; Ramirez, Maria I.


    The homeodomain transcription factor Nkx2-1 is essential for normal lung development and homeostasis. In lung tumors, it is considered a lineage survival oncogene and prognostic factor depending on its expression levels. The target genes directly bound by Nkx2-1, that could be the primary effectors of its functions in the different cellular contexts where it is expressed, are mostly unknown. In embryonic day 11.5 (E11.5) mouse lung, epithelial cells expressing Nkx2-1 are predominantly expanding, and in E19.5 prenatal lungs, Nkx2-1-expressing cells are predominantly differentiating in preparation for birth. To evaluate Nkx2-1 regulated networks in these two cell contexts, we analyzed genome-wide binding of Nkx2-1 to DNA regulatory regions by chromatin immunoprecipitation followed by tiling array analysis, and intersected these data to expression data sets. We further determined expression patterns of Nkx2-1 developmental target genes in human lung tumors and correlated their expression levels to that of endogenous NKX2-1. In these studies we uncovered differential Nkx2-1 regulated networks in early and late lung development, and a direct function of Nkx2-1 in regulation of the cell cycle by controlling the expression of proliferation-related genes. New targets, validated in Nkx2-1 shRNA transduced cell lines, include E2f3, Cyclin B1, Cyclin B2, and c-Met. Expression levels of Nkx2-1 direct target genes identified in mouse development significantly correlate or anti-correlate to the levels of endogenous NKX2-1 in a dosage-dependent manner in multiple human lung tumor expression data sets, supporting alternative roles for Nkx2-1 as a transcriptional activator or repressor, and direct regulator of cell cycle progression in development and tumors. PMID:22242187

  11. Ski Regulates Muscle Terminal Differentiation by Transcriptional Activation of Myog in a Complex with Six1 and Eya3*S⃞

    PubMed Central

    Zhang, Hong; Stavnezer, Ed


    Overexpression of the Ski pro-oncogene has been shown to induce myogenesis in non-muscle cells, to promote muscle hypertrophy in postnatal mice, and to activate transcription of muscle-specific genes. However, the precise role of Ski in muscle cell differentiation and its underlying molecular mechanism are not fully understood. To elucidate the involvement of Ski in muscle terminal differentiation, two retroviral systems were used to achieve conditional overexpression or knockdown of Ski in satellite cell-derived C2C12 myoblasts. We found that enforced expression of Ski promoted differentiation, whereas loss of Ski severely impaired it. Compromised terminal differentiation in the absence of Ski was likely because of the failure to induce myogenin (Myog) and p21 despite normal expression of MyoD. Chromatin immunoprecipitation and transcriptional reporter experiments showed that Ski occupied the endogenous Myog regulatory region and activated transcription from the Myog regulatory region upon differentiation. Transactivation of Myog was largely dependent on a MEF3 site bound by Six1, not on the binding site of MyoD or MEF2. Activation of the MEF3 site required direct interaction of Ski with Six1 and Eya3 mediated by the evolutionarily conserved Dachshund homology domain of Ski. Our results indicate that Ski is necessary for muscle terminal differentiation and that it exerts this role, at least in part, through its association with Six1 and Eya3 to regulate the Myog transcription. PMID:19008232

  12. Rapid evolution of a recently retroposed transcription factor YY2 in mammalian genomes

    SciTech Connect

    Luo, C; Lu, X; Stubbs, L; Kim, J


    YY2 was originally identified due to its unusual similarity to the evolutionarily well conserved, zinc-finger gene YY1. In this study, we have determined the evolutionary origin and conservation of YY2 using comparative genomic approaches. Our results indicate that YY2 is a retroposed copy of YY1 that has been inserted into another gene locus named Mbtps2 (membrane-bound transcription factor protease site 2). This retroposition is estimated to have occurred after the divergence of placental mammals from other vertebrates based on the detection of YY2 only in the placental mammals. The N-terminal and C-terminal regions of YY2 have evolved under different selection pressures. The N-terminal region has evolved at a very fast pace with very limited functional constraints whereas the DNA-binding, C-terminal region still maintains very similar sequence structure as YY1 and is also well conserved among placental mammals. In situ hybridizations using different adult mouse tissues indicate that mouse YY2 is expressed at relatively low levels in Purkinje and granular cells of cerebellum, and neuronal cells of cerebrum, but at very high levels in testis. The expression levels of YY2 is much lower than YY1, but the overall spatial expression patterns are similar to those of Mbtps2, suggesting a possible shared transcriptional control between YY2 and Mbtps2. Taken together, the formation and evolution of YY2 represent a very unusual case where a transcription factor was first retroposed into another gene locus encoding a protease and survived with different selection schemes and expression patterns.

  13. Transcription regulatory mechanism of Pitx in the papilla-forming region in the ascidian, Halocynthia roretzi, implies conserved involvement of Otx as the upstream gene in the adhesive organ development of chordates.


    Yoshida, Keita; Ueno, Motoko; Niwano, Tomoko; Saiga, Hidetoshi


    Pitx genes play important roles in a variety of developmental processes in vertebrates. In an ascidian species, Halocynthia roretzi, Hr-Pitx, the only Pitx gene of this species, has been reported to be expressed in the left epidermis at the tailbud stage. In the present study, first, we have shown that Hr-Pitx is also expressed in the papilla-forming region at the neurula to tailbud stages, and then we addressed transcription regulatory mechanisms for the expression of Hr-Pitx in the papilla-forming region. We have identified the genomic region ranging from 850 to 1211 bp upstream from the translation start site of the Hr-Pitx gene as an enhancer region that drives the transcription of Hr-Pitx in the papilla-forming region. Within the enhancer region, putative transcriptional factor binding sites for Otx as well as Fox were shown to be required for its activity. Finally, we carried out knocking down experiments of Hr-Otx function using an antisense morpholino oligonucleotide, in which the knocking down of Hr-Otx function resulted in reduction of the enhancer activity and loss of the expression of Hr-Pitx in the papilla-forming region. In Xenopus laevis, it has been reported that Pitx genes are expressed downstream of Otx function during development of the cement gland, an adhesive organ of its larva. Taken together, it is suggested that the expression regulatory mechanism of Pitx, involving Otx as the upstream gene, in the developing adhesive organ is conserved between ascidians and vertebrates.

  14. The sua8 suppressors of Saccharomyces cerevisiae encode replacements of conserved residues within the largest subunit of RNA polymerase II and affect transcription start site selection similarly to sua7 (TFIIB) mutations.

    PubMed Central

    Berroteran, R W; Ware, D E; Hampsey, M


    Mutations in the Saccharomyces cerevisiae sua8 gene were found to be suppressors of an aberrant ATG translation initiation codon in the leader region of the cyc1 gene. Analysis of cyc1 transcripts from sua8 mutants revealed that suppression is a consequence of diminished transcription initiation at the normal start sites in favor of initiation at downstream sites, including a site between the aberrant and normal ATG start codons. This effect is not cyc1 gene specific since initiation at other genes, including ADH1, CYC7, and HIS4, was similarly affected, although initiation at HIS3 and SPT15 was unaffected. The SUA8 gene was cloned and partially sequenced, revealing identity to RPB1, which encodes the largest subunit of RNA polymerase II. The sua8 suppressors are the result of single amino acid replacements of highly conserved residues. Three replacements were found either within or immediately preceding homology block D, and a fourth was found adjacent to homology block H, indicating that these regions play a role in defining start sites in vivo. Nearly identical effects on start site selection were observed for sua7 suppressors, which encode altered forms of TFIIB. Synthetic lethality was associated with double sua7 sua8 suppressor mutations, and recessive sua7 mutants failed to fully complement recessive sua8 mutants in heterozygous diploids (nonallelic noncomplementation). These data indicate that the largest subunit of RNA polymerase II and TFIIB are important determinants of transcription start site selection in S. cerevisiae and suggest that this function might be conferred by interaction between these two proteins. Images PMID:8264591

  15. A Conserved Oct4/POUV-Dependent Network Links Adhesion and Migration to Progenitor Maintenance

    PubMed Central

    Livigni, Alessandra; Peradziryi, Hanna; Sharov, Alexei A.; Chia, Gloryn; Hammachi, Fella; Migueles, Rosa Portero; Sukparangsi, Woranop; Pernagallo, Salvatore; Bradley, Mark; Nichols, Jennifer; Ko, Minoru S.H.; Brickman, Joshua M.


    Summary Background The class V POU domain transcription factor Oct4 (Pou5f1) is a pivotal regulator of embryonic stem cell (ESC) self-renewal and reprogramming of somatic cells to induced pluripotent stem (iPS) cells. Oct4 is also an important evolutionarily conserved regulator of progenitor cell differentiation during embryonic development. Results Here we examine the function of Oct4 homologs in Xenopus embryos and compare this to the role of Oct4 in maintaining mammalian embryo-derived stem cells. Based on a combination of expression profiling of Oct4/POUV-depleted Xenopus embryos and in silico analysis of existing mammalian Oct4 target data sets, we defined a set of evolutionary-conserved Oct4/POUV targets. Most of these targets were regulators of cell adhesion. This is consistent with Oct4/POUV phenotypes observed in the adherens junctions in Xenopus ectoderm, mouse embryonic, and epiblast stem cells. A number of these targets could rescue both Oct4/POUV phenotypes in cellular adhesion and multipotent progenitor cell maintenance, whereas expression of cadherins on their own could only transiently support adhesion and block differentiation in both ESC and Xenopus embryos. Conclusions Currently, the list of Oct4 transcriptional targets contains thousands of genes. Using evolutionary conservation, we identified a core set of functionally relevant factors that linked the maintenance of adhesion to Oct4/POUV. We found that the regulation of adhesion by the Oct4/POUV network occurred at both transcriptional and posttranslational levels and was required for pluripotency. PMID:24210613

  16. The conserved core domain of the human TATA binding protein is sufficient to assemble the multisubunit RNA polymerase I-specific transcription factor SL1.

    PubMed Central

    Rudloff, U; Eberhard, D; Grummt, I


    The human ribosomal RNA polymerase (Pol) I promoter selectivity factor SL1 is a complex consisting of the TATA binding protein (TBP) and three TBP-associated factors (TAFs). We have investigated which elements of TBP are involved in the assembly of Pol I-specific TBP-TAF complexes by comparing SL1 isolated from two human cell lines, one expressing epitope-tagged full-length TBP and another expressing a deletion of nearly the entire N-terminal domain (e delta NTBP). We have immunopurified epitope-tagged full-length TBP- and e delta NTBP-TAF complexes and show that e delta NTBP reconstitutes SL1 activity almost as well as full-length TBP. Moreover, e delta NTBP is shown to be associated with all three Pol I-specific TAFs. Thus, the core of TBP alone is sufficient for the correct assembly of the Pol I-specific TBP-TAF complex, and the variable N-terminal region of human TBP is not required for transcriptional activity. We also demonstrate by an in vitro protein-protein interaction assay that TBP directly interacts with the smallest TAF, TAFI48. Images PMID:8058785

  17. MucR Is Required for Transcriptional Activation of Conserved Ion Transporters to Support Nitrogen Fixation of Sinorhizobium fredii in Soybean Nodules.


    Jiao, Jian; Wu, Li Juan; Zhang, Biliang; Hu, Yue; Li, Yan; Zhang, Xing Xing; Guo, Hui Juan; Liu, Li Xue; Chen, Wen Xin; Zhang, Ziding; Tian, Chang Fu


    To achieve effective symbiosis with legume, rhizobia should fine-tune their background regulation network in addition to activating key genes involved in nodulation (nod) and nitrogen fixation (nif). Here, we report that an ancestral zinc finger regulator, MucR1, other than its paralog, MucR2, carrying a frameshift mutation, is essential for supporting nitrogen fixation of Sinorhizobium fredii CCBAU45436 within soybean nodules. In contrast to the chromosomal mucR1, mucR2 is located on symbiosis plasmid, indicating its horizontal transfer potential. A MucR2 homolog lacking the frameshift mutation, such as the one from S. fredii NGR234, can complement phenotypic defects of the mucR1 mutant of CCBAU45436. RNA-seq analysis revealed that the MucR1 regulon of CCBAU45436 within nodules exhibits significant difference compared with that of free-living cells. MucR1 is required for active expression of transporters for phosphate, zinc, and elements essential for nitrogenase activity (iron, molybdenum, and sulfur) in nodules but is dispensable for transcription of key genes (nif/fix) involved in nitrogen fixation. Further reverse genetics suggests that S. fredii uses high-affinity transporters to meet the demand for zinc and phosphate within nodules. These findings, together with the horizontal transfer potential of the mucR homolog, imply an intriguing evolutionary role of this ancestral regulator in supporting nitrogen fixation.

  18. CORECLUST: identification of the conserved CRM grammar together with prediction of gene regulation.


    Nikulova, Anna A; Favorov, Alexander V; Sutormin, Roman A; Makeev, Vsevolod J; Mironov, Andrey A


    Identification of transcriptional regulatory regions and tracing their internal organization are important for understanding the eukaryotic cell machinery. Cis-regulatory modules (CRMs) of higher eukaryotes are believed to possess a regulatory 'grammar', or preferred arrangement of binding sites, that is crucial for proper regulation and thus tends to be evolutionarily conserved. Here, we present a method CORECLUST (COnservative REgulatory CLUster STructure) that predicts CRMs based on a set of positional weight matrices. Given regulatory regions of orthologous and/or co-regulated genes, CORECLUST constructs a CRM model by revealing the conserved rules that describe the relative location of binding sites. The constructed model may be consequently used for the genome-wide prediction of similar CRMs, and thus detection of co-regulated genes, and for the investigation of the regulatory grammar of the system. Compared with related methods, CORECLUST shows better performance at identification of CRMs conferring muscle-specific gene expression in vertebrates and early-developmental CRMs in Drosophila.

  19. Global alterations of the transcriptional landscape during yeast growth and development in the absence of Ume6-dependent chromatin modification.


    Lardenois, Aurélie; Becker, Emmanuelle; Walther, Thomas; Law, Michael J; Xie, Bingning; Demougin, Philippe; Strich, Randy; Primig, Michael


    Chromatin modification enzymes are important regulators of gene expression and some are evolutionarily conserved from yeast to human. Saccharomyces cerevisiae is a major model organism for genome-wide studies that aim at the identification of target genes under the control of conserved epigenetic regulators. Ume6 interacts with the upstream repressor site 1 (URS1) and represses transcription by recruiting both the conserved histone deacetylase Rpd3 (through the co-repressor Sin3) and the chromatin-remodeling factor Isw2. Cells lacking Ume6 are defective in growth, stress response, and meiotic development. RNA profiling studies and in vivo protein-DNA binding assays identified mRNAs or transcript isoforms that are directly repressed by Ume6 in mitosis. However, a comprehensive understanding of the transcriptional alterations, which underlie the complex ume6Δ mutant phenotype during fermentation, respiration, or sporulation, is lacking. We report the protein-coding transcriptome of a diploid MAT a/α wild-type and ume6/ume6 mutant strains cultured in rich media with glucose or acetate as a carbon source, or sporulation-inducing medium. We distinguished direct from indirect effects on mRNA levels by combining GeneChip data with URS1 motif predictions and published high-throughput in vivo Ume6-DNA binding data. To gain insight into the molecular interactions between successive waves of Ume6-dependent meiotic genes, we integrated expression data with information on protein networks. Our work identifies novel Ume6 repressed genes during growth and development and reveals a strong effect of the carbon source on the derepression pattern of transcripts in growing and developmentally arrested ume6/ume6 mutant cells. Since yeast is a useful model organism for chromatin-mediated effects on gene expression, our results provide a rich source for further genetic and molecular biological work on the regulation of cell growth and cell differentiation in eukaryotes.

  20. Isolation, cDNA, and genomic structure of a conserved gene (NOF) at chromosome 11q13 next to FAU and oriented in the opposite transcriptional orientation

    SciTech Connect

    Kas, K.; Meyen, E.; Van De Ven, W.J.M.


    In our effort to characterize a gene at chromosome 11q13 involved in a t(11;17)(q13;q21) translocation in B-non-Hodgkin lymphoma, we have identified a novel human gene, NOF (Neighbour of FAU). It maps right next to FAU in a head to head configuration separated by a maximum of 146 nucleotides. cDNA clones representing NOF hybridized to a 2.2-kb mRNA present in all tissues tested. The largest open reading frame appeared to contain 166 amino acids and is proline rich, and the sequence shows no homology with any known gene in the public databases. The NOF gene consists of 4 exons and 3 introns spanning approximately 5 kb, and the boundaries between exons and introns follow the GT/AG rule. The NOF locus is conserved during evolution, with the predicted protein having over 80% identity to three translated mouse and rat ESTs of unknown function. Moreover, the mouse ESTs map in the same organization, closely linked to the FAU gene, in the mouse genome. NOF, however, is not affected by the t(11;17)(q13;121) chromosomal translocation. 14 refs., 2 figs.

  1. Isolation, cDNA, and genomic structure of a conserved gene (NOF) at chromosome 11q13 next to FAU and oriented in the opposite transcriptional orientation.


    Kas, K; Lemahieu, V; Meyen, E; Van de Ven, W J; Merregaert, J


    In our effort to characterize a gene at chromosome 11q13 involved in a t(11;17)(q13;q21) translocation in B-non-Hodgkin lymphoma, we have identified a novel human gene, NOF (Neighbour of FAU). It maps right next to FAU in a head to head configuration separated by a maximum of 146 nucleotides. cDNA clones representing NOF hybridized to a 2. 2-kb mRNA present in all tissues tested. The largest open reading frame appeared to contain 166 amino acids and is proline rich, and the sequence shows no homology with any known gene in the public databases. The NOF gene consists of 4 exons and 3 introns spanning approximately 5 kb, and the boundaries between exons and introns follow the GT/AG rule. The NOF locus is conserved during evolution, with the predicted protein having over 80% identity to three translated mouse and rat ESTs of unknown function. Moreover, the mouse ESTs map in the same organization, closely linked to the FAU gene, in the mouse genome. NOF, however, is not affected by the t(11;17)(q13;q21) chromosomal translocation.

  2. Regulation of PURA gene transcription by three promoters generating distinctly spliced 5-prime leaders: a novel means of fine control over tissue specificity and viral signals

    PubMed Central


    Background Purα is an evolutionarily conserved cellular protein participating in processes of DNA replication, transcription, and RNA transport; all involving binding to nucleic acids and altering conformation and physical positioning. The distinct but related roles of Purα suggest a need for expression regulated differently depending on intracellular and external signals. Results Here we report that human PURA (hPURA) transcription is regulated from three distinct and widely-separated transcription start sites (TSS). Each of these TSS is strongly homologous to a similar site in mouse chromosomal DNA. Transcripts from TSS I and II are characterized by the presence of large and overlapping 5'-UTR introns terminated at the same splice receptor site. Transfection of lung carcinoma cells with wild-type or mutated hPURA 5' upstream sequences identifies different regulatory elements. TSS III, located within 80 bp of the translational start codon, is upregulated by E2F1, CAAT and NF-Y binding elements. Transcription at TSS II is downregulated through the presence of adjacent consensus binding elements for interferon regulatory factors (IRFs). Chromatin immunoprecipitation reveals that IRF-3 protein binds hPURA promoter sequences at TSS II in vivo. By co-transfecting hPURA reporter plasmids with expression plasmids for IRF proteins we demonstrate that several IRFs, including IRF-3, down-regulate PURA transcription. Infection of NIH 3T3 cells with mouse cytomegalovirus results in a rapid decrease in levels of mPURA mRNA and Purα protein. The viral infection alters the degree of splicing of the 5'-UTR introns of TSS II transcripts. Conclusions Results provide evidence for a novel mechanism of transcriptional control by multiple promoters used differently in various tissues and cells. Viral infection alters not only the use of PURA promoters but also the generation of different non-coding RNAs from 5'-UTRs of the resulting transcripts. PMID:21062477

  3. The Arabidopsis thaliana Nuclear Factor Y Transcription Factors

    PubMed Central

    Zhao, Hang; Wu, Di; Kong, Fanying; Lin, Ke; Zhang, Haishen; Li, Gang


    Nuclear factor Y (NF-Y) is an evolutionarily conserved trimeric transcription factor complex present in nearly all eukaryotes. The heterotrimeric NF-Y complex consists of three subunits, NF-YA, NF-YB, and NF-YC, and binds to the CCAAT box in the promoter regions of its target genes to regulate their expression. Yeast and mammal genomes generally have single genes with multiple splicing isoforms that encode each NF-Y subunit. By contrast, plant genomes generally have multi-gene families encoding each subunit and these genes are differentially expressed in various tissues or stages. Therefore, different subunit combinations can lead to a wide variety of NF-Y complexes in various tissues, stages, and growth conditions, indicating the potentially diverse functions of this complex in plants. Indeed, many recent studies have proved that the NF-Y complex plays multiple essential roles in plant growth, development, and stress responses. In this review, we highlight recent progress on NF-Y in Arabidopsis thaliana, including NF-Y protein structure, heterotrimeric complex formation, and the molecular mechanism by which NF-Y regulates downstream target gene expression. We then focus on its biological functions and underlying molecular mechanisms. Finally, possible directions for future research on NF-Y are also presented. PMID:28119722

  4. The Arabidopsis thaliana Nuclear Factor Y Transcription Factors.


    Zhao, Hang; Wu, Di; Kong, Fanying; Lin, Ke; Zhang, Haishen; Li, Gang


    Nuclear factor Y (NF-Y) is an evolutionarily conserved trimeric transcription factor complex present in nearly all eukaryotes. The heterotrimeric NF-Y complex consists of three subunits, NF-YA, NF-YB, and NF-YC, and binds to the CCAAT box in the promoter regions of its target genes to regulate their expression. Yeast and mammal genomes generally have single genes with multiple splicing isoforms that encode each NF-Y subunit. By contrast, plant genomes generally have multi-gene families encoding each subunit and these genes are differentially expressed in various tissues or stages. Therefore, different subunit combinations can lead to a wide variety of NF-Y complexes in various tissues, stages, and growth conditions, indicating the potentially diverse functions of this complex in plants. Indeed, many recent studies have proved that the NF-Y complex plays multiple essential roles in plant growth, development, and stress responses. In this review, we highlight recent progress on NF-Y in Arabidopsis thaliana, including NF-Y protein structure, heterotrimeric complex formation, and the molecular mechanism by which NF-Y regulates downstream target gene expression. We then focus on its biological functions and underlying molecular mechanisms. Finally, possible directions for future research on NF-Y are also presented.

  5. Functional dissection of the ash2 and ash1 transcriptomes provides insights into the transcriptional basis of wing phenotypes and reveals conserved protein interactions

    PubMed Central

    Beltran, Sergi; Angulo, Mireia; Pignatelli, Miguel; Serras, Florenci; Corominas, Montserrat


    Background The trithorax group (trxG) genes absent, small or homeotic discs 1 (ash1) and 2 (ash2) were isolated in a screen for mutants with abnormal imaginal discs. Mutations in either gene cause homeotic transformations but Hox genes are not their only targets. Although analysis of double mutants revealed that ash2 and ash1 mutations enhance each other's phenotypes, suggesting they are functionally related, it was shown that these proteins are subunits of distinct complexes. Results The analysis of wing imaginal disc transcriptomes from ash2 and ash1 mutants showed that they are highly similar. Functional annotation of regulated genes using Gene Ontology allowed identification of severely affected groups of genes that could be correlated to the wing phenotypes observed. Comparison of the differentially expressed genes with those from other genome-wide analyses revealed similarities between ASH2 and Sin3A, suggesting a putative functional relationship. Coimmunoprecipitation studies and immunolocalization on polytene chromosomes demonstrated that ASH2 and Sin3A interact with HCF (host-cell factor). The results of nucleosome western blots and clonal analysis indicated that ASH2 is necessary for trimethylation of the Lys4 on histone 3 (H3K4). Conclusion The similarity between the transcriptomes of ash2 and ash1 mutants supports a model in which the two genes act together to maintain stable states of transcription. Like in humans, both ASH2 and Sin3A bind HCF. Finally, the reduction of H3K4 trimethylation in ash2 mutants is the first evidence in Drosophila regarding the molecular function of this trxG gene. PMID:17466076

  6. Identification and functional characterization of a new IL-1 family member, IL-1Fm2, in most evolutionarily advanced fish.


    Angosto, Diego; Montero, Jana; López-Muñoz, Azucena; Alcaraz-Pérez, Francisca; Bird, Steve; Sarropoulou, Elena; Abellán, Emilia; Meseguer, José; Sepulcre, María P; Mulero, Victoriano


    The IL-1 family consists of 11 members that play an important role as key mediators in inflammation and immunity. Here, we report the identification of a new member of the IL-1 family (IL-1Fm2) that is present in species belonging to the most evolutionarily advanced group of teleost fish (Series Percomorpha), including Perciformes, Beloniformes, Gasterosteiformes, Cyprinodontiformes and Pleuronectiformes. However, IL-1Fm2 seems to be absent in Tetraodontiformes, which also belong to the Percomorpha. The expression pattern of gilthead seabream IL-1Fm2 revealed that although it was hardly induced by PAMPs, the combination of PAMPs and recombinant IL-1Fm2 synergistically induced its expression in macrophages and granulocytes. In addition, recombinant IL-1Fm2 was able to activate the respiratory burst of seabream phagocytes and to synergistically induce the expression of IL-1β, TNF-α, IL-8 and IL-10 when combined with PAMPs. Finally, although gilthead seabream IL-1Fm2 did not show a conserved caspase-1 processing site, macrophages processed IL-1Fm2 before being released. However, both pan-caspase and caspase-1 inhibitors failed to inhibit the processing and release of IL-1Fm2. These results demonstrate an important role of IL-1Fm2 in the regulation of fish immune responses, shed light on the evolution of the IL-1 family in vertebrates and point to the complexity of this cytokine family.

  7. Evolutionary Conservation of ABA Signaling for Stomatal Closure in Ferns.


    Cai, Shengguan; Chen, Guang; Wang, Yuanyuan; Huang, Yuqing; Marchant, Blaine; Wang, Yizhou; Yang, Qian; Dai, Fei; Hills, Adrian; Franks, Peter J; Nevo, Eviatar; Soltis, Doug; Soltis, Pamela; Sessa, Emily; Wolf, Paul G; Xue, Dawei; Zhang, Guoping; Pogson, Barry J; Blatt, Mike R; Chen, Zhong-Hua


    ABA-driven stomatal regulation reportedly evolved after the divergence of ferns, during the early evolution of seed plants approximately 360 Mya. This hypothesis is based on the observation that the stomata of certain fern species are unresponsive to ABA, but exhibit passive hydraulic control. However, ABA-induced stomatal closure was detected in some mosses and lycophytes. Here, we observed that a number of ABA signaling and membrane transporter protein families diversified over the evolutionary history of land plants. The aquatic ferns Azolla filiculoides and Salvinia cucullata have representatives of 23 families of proteins orthologous to those of Arabidopsis thaliana and all other land plant species studied. Phylogenetic analysis of the key ABA signaling proteins indicates an evolutionarily conserved stomatal response to ABA. Moreover, comparative transcriptomic analysis has identified a suite of ABA responsive genes that differentially expressed in a terrestrial fern species, Polystichum proliferum. These genes encode proteins associated with ABA biosynthesis, transport, reception, transcription, signaling, and ion and sugar transport, which fit the general ABA signaling pathway constructed from Arabidopsis thaliana and Hordeum vulgare. The retention of these key ABA-responsive genes could have had a profound effect on the adaptation of ferns to dry conditions. Furthermore, stomatal assays have shown the primary evidence for ABA-induced closure of stomata in two terrestrial fern species P. proliferum and Nephrolepis exaltata. In summary, we report new molecular and physiological evidence for the presence of active stomatal control in ferns.

  8. Divergent Expression Regulation of Gonad Development Genes in Medaka Shows Incomplete Conservation of the Downstream Regulatory Network of Vertebrate Sex Determination

    PubMed Central

    Herpin, Amaury; Adolfi, Mateus C.; Nicol, Barbara; Hinzmann, Maria; Schmidt, Cornelia; Klughammer, Johanna; Engel, Mareen; Tanaka, Minoru; Guiguen, Yann; Schartl, Manfred


    Genetic control of male or female gonad development displays between different groups of organisms a remarkable diversity of “master sex-determining genes” at the top of the genetic hierarchies, whereas downstream components surprisingly appear to be evolutionarily more conserved. Without much further studies, conservation of sequence has been equalized to conservation of function. We have used the medaka fish to investigate the generality of this paradigm. In medaka, the master male sex-determining gene is dmrt1bY, a highly conserved downstream regulator of sex determination in vertebrates. To understand its function in orchestrating the complex gene regulatory network, we have identified targets genes and regulated pathways of Dmrt1bY. Monitoring gene expression and interactions by transgenic fluorescent reporter fish lines, in vivo tissue-chromatin immunoprecipitation and in vitro gene regulation assays revealed concordance but also major discrepancies between mammals and medaka, notably amongst spatial, temporal expression patterns and regulations of the canonical Hedgehog and R-spondin/Wnt/Follistatin signaling pathways. Examination of Foxl2 protein distribution in the medaka ovary defined a new subpopulation of theca cells, where ovarian-type aromatase transcriptional regulation appears to be independent of Foxl2. In summary, these data show that the regulation of the downstream regulatory network of sex determination is less conserved than previously thought. PMID:23883523

  9. Diversity, Phylogeny and Expression Patterns of Pou and Six Homeodomain Transcription Factors in Hydrozoan Jellyfish Craspedacusta sowerbyi

    PubMed Central

    Hroudova, Miluse; Vojta, Petr; Strnad, Hynek; Krejcik, Zdenek; Ridl, Jakub; Paces, Jan; Vlcek, Cestmir; Paces, Vaclav


    Formation of all metazoan bodies is controlled by a group of selector genes including homeobox genes, highly conserved across the entire animal kingdom. The homeobox genes from Pou and Six classes are key members of the regulation cascades determining development of sensory organs, nervous system, gonads and muscles. Besides using common bilaterian models, more attention has recently been targeted at the identification and characterization of these genes within the basal metazoan phyla. Cnidaria as a diploblastic sister group to bilateria with simple and yet specialized organs are suitable models for studies on the sensory organ origin and the associated role of homeobox genes. In this work, Pou and Six homeobox genes, together with a broad range of other sensory-specific transcription factors, were identified in the transcriptome of hydrozoan jellyfish Craspedacusta sowerbyi. Phylogenetic analyses of Pou and Six proteins revealed cnidarian-specific sequence motifs and contributed to the classification of individual factors. The majority of the Craspedacusta sowerbyi Pou and Six homeobox genes are predominantly expressed in statocysts, manubrium and nerve ring, the tissues with sensory and nervous activities. The described diversity and expression patterns of Pou and Six factors in hydrozoan jellyfish highlight their evolutionarily conserved functions. This study extends the knowledge of the cnidarian genome complexity and shows that the transcriptome of hydrozoan jellyfish is generally rich in homeodomain transcription factors employed in the regulation of sensory and nervous functions. PMID:22558464

  10. The AP-2 Transcription Factor APTF-2 Is Required for Neuroblast and Epidermal Morphogenesis in Caenorhabditis elegans Embryogenesis

    PubMed Central

    Budirahardja, Yemima; Tan, Pei Yi; Weisdepp, Peter; Zaidel-Bar, Ronen


    The evolutionarily conserved family of AP-2 transcription factors (TF) regulates proliferation, differentiation, and apoptosis. Mutations in human AP-2 TF have been linked with bronchio-occular-facial syndrome and Char Syndrome, congenital birth defects characterized by craniofacial deformities and patent ductus arteriosus, respectively. How mutations in AP-2 TF cause the disease phenotypes is not well understood. Here, we characterize the aptf-2(qm27) allele in Caenorhabditis elegans, which carries a point mutation in the conserved DNA binding region of AP-2 TF. We show that compromised APTF-2 activity leads to defects in dorsal intercalation, aberrant ventral enclosure and elongation defects, ultimately culminating in the formation of morphologically deformed larvae or complete arrest during epidermal morphogenesis. Using cell lineaging, we demonstrate that APTF-2 regulates the timing of cell division, primarily in ABarp, D and C cell lineages to control the number of neuroblasts, muscle and epidermal cells. Live imaging revealed nuclear enrichment of APTF-2 in lineages affected by the qm27 mutation preceding the relevant morphogenetic events. Finally, we found that another AP-2 TF, APTF-4, is also essential for epidermal morphogenesis, in a similar yet independent manner. Thus, our study provides novel insight on the cellular-level functions of an AP-2 transcription factor in development. PMID:27176626

  11. On Nash Equilibrium and Evolutionarily Stable States That Are Not Characterised by the Folk Theorem.


    Li, Jiawei; Kendall, Graham


    In evolutionary game theory, evolutionarily stable states are characterised by the folk theorem because exact solutions to the replicator equation are difficult to obtain. It is generally assumed that the folk theorem, which is the fundamental theory for non-cooperative games, defines all Nash equilibria in infinitely repeated games. Here, we prove that Nash equilibria that are not characterised by the folk theorem do exist. By adopting specific reactive strategies, a group of players can be better off by coordinating their actions in repeated games. We call it a type-k equilibrium when a group of k players coordinate their actions and they have no incentive to deviate from their strategies simultaneously. The existence and stability of the type-k equilibrium in general games is discussed. This study shows that the sets of Nash equilibria and evolutionarily stable states have greater cardinality than classic game theory has predicted in many repeated games.

  12. The DAF-16 FOXO Transcription Factor Regulates natc-1 to Modulate Stress Resistance in Caenorhabditis elegans, Linking Insulin/IGF-1 Signaling to Protein N-Terminal Acetylation

    PubMed Central

    Warnhoff, Kurt; Murphy, John T.; Kumar, Sandeep; Schneider, Daniel L.; Peterson, Michelle; Hsu, Simon; Guthrie, James; Robertson, J. David; Kornfeld, Kerry


    The insulin/IGF-1 signaling pathway plays a critical role in stress resistance and longevity, but the mechanisms are not fully characterized. To identify genes that mediate stress resistance, we screened for C. elegans mutants that can tolerate high levels of dietary zinc. We identified natc-1, which encodes an evolutionarily conserved subunit of the N-terminal acetyltransferase C (NAT) complex. N-terminal acetylation is a widespread modification of eukaryotic proteins; however, relatively little is known about the biological functions of NATs. We demonstrated that loss-of-function mutations in natc-1 cause resistance to a broad-spectrum of physiologic stressors, including multiple metals, heat, and oxidation. The C. elegans FOXO transcription factor DAF-16 is a critical target of the insulin/IGF-1 signaling pathway that mediates stress resistance, and DAF-16 is predicted to directly bind the natc-1 promoter. To characterize the regulation of natc-1 by DAF-16 and the function of natc-1 in insulin/IGF-1 signaling, we analyzed molecular and genetic interactions with key components of the insulin/IGF-1 pathway. natc-1 mRNA levels were repressed by DAF-16 activity, indicating natc-1 is a physiological target of DAF-16. Genetic studies suggested that natc-1 functions downstream of daf-16 to mediate stress resistance and dauer formation. Based on these findings, we hypothesize that natc-1 is directly regulated by the DAF-16 transcription factor, and natc-1 is a physiologically significant effector of the insulin/IGF-1 signaling pathway that mediates stress resistance and dauer formation. These studies identify a novel biological function for natc-1 as a modulator of stress resistance and dauer formation and define a functionally significant downstream effector of the insulin/IGF-1 signaling pathway. Protein N-terminal acetylation mediated by the NatC complex may play an evolutionarily conserved role in regulating stress resistance. PMID:25330323

  13. EAR motif-mediated transcriptional repression in plants: an underlying mechanism for epigenetic regulation of gene expression.


    Kagale, Sateesh; Rozwadowski, Kevin


    Ethylene-responsive element binding factor-associated Amphiphilic Repression (EAR) motif-mediated transcriptional repression is emerging as one of the principal mechanisms of plant gene regulation. The EAR motif, defined by the consensus sequence patterns of either LxLxL or DLNxxP, is the most predominant form of transcriptional repression motif so far identified in plants. Additionally, this active repression motif is highly conserved in transcriptional regulators known to function as negative regulators in a broad range of developmental and physiological processes across evolutionarily diverse plant species. Recent discoveries of co-repressors interacting with EAR motifs, such as TOPLESS (TPL) and AtSAP18, have begun to unravel the mechanisms of EAR motif-mediated repression. The demonstration of genetic interaction between mutants of TPL and AtHDA19, co-complex formation between TPL-related 1 (TPR1) and AtHDA19, as well as direct physical interaction between AtSAP18 and AtHDA19 support a model where EAR repressors, via recruitment of chromatin remodeling factors, facilitate epigenetic regulation of gene expression. Here, we discuss the biological significance of EAR-mediated gene regulation in the broader context of plant biology and present literature evidence in support of a model for EAR motif-mediated repression via the recruitment and action of chromatin modifiers. Additionally, we discuss the possible influences of phosphorylation and ubiquitination on the function and turnover of EAR repressors.

  14. A G-quadruplex structure at the 5′ end of the H19 coding region regulates H19 transcription

    PubMed Central

    Fukuhara, Mitsuko; Ma, Yue; Nagasawa, Kazuo; Toyoshima, Fumiko


    The H19 gene, one of the best known imprinted genes, encodes a long non-coding RNA that regulates cell proliferation and differentiation. H19 RNA is widely expressed in embryonic tissues, but its expression is restricted in only a few tissues after birth. However, regulation of H19 gene expression remains poorly understood outside the context of genomic imprinting. Here we identified evolutionarily conserved guanine (G)-rich repeated motifs at the 5′ end of the H19 coding region that are consistent with theoretically deduced G-quadruplex sequences. Circular dichroism spectroscopy and electrophoretic mobility shift assays with G-quadruplex-specific ligands revealed that the G-rich motif, located immediately downstream of the transcription start site (TSS), forms a G-quadruplex structure in vitro. By using a series of mutant forms of H19 harboring deletion or G-to-A substitutions, we found that the H19-G-quadruplex regulates H19 gene expression. We further showed that transcription factors Sp1 and E2F1 were associated with the H19-G-quadruplex to either suppress or promote the H19 transcription, respectively. Moreover, H19 expression during differentiation of mouse embryonic stem cells appears to be regulated by a genomic H19 G-quadruplex. These results demonstrate that the G-quadruplex structure immediately downstream of the TSS functions as a novel regulatory element for H19 gene expression. PMID:28367967

  15. Alternate transcripts of the Drosophila "activator" E2F are necessary for maintenance of cell cycle exit during development.


    Bradley-Gill, Mary-Rose; Kim, Minhee; Feingold, Daniel; Yergeau, Christine; Houde, Josée; Moon, Nam-Sung


    The E2F family of transcription factors are evolutionarily conserved regulators of the cell cycle that can be divided into two groups based on their ability to either activate or repress transcription. In Drosophila, there is only one "activator" E2F, dE2F1, which provides all of the pro-proliferative activity of E2F during development. Interestingly, the de2f1 gene can be transcribed from multiple promoters resulting in six alternate transcripts. In this study, we sought to investigate the biological significance of the alternate transcriptional start sites. We focused on the de2f1 promoter region where tissue and cell-type specific enhancer activities were observed at the larval stage. While a genomic deletion of this region, de2f1(ΔRA), decreased the overall expression level of dE2F1, flies developed normally with no obvious proliferation defects. However, a detailed analysis of the de2f1(ΔRA) mutant eye imaginal discs revealed that dE2F1 is needed for proper cell cycle exit. We discovered that dE2F1 expression during G1 arrest prior to the differentiation process of the developing eye is important for maintaining cell cycle arrest at a later stage of the eye development. Overall, our study suggests that specific alternate transcripts of "activator" E2F, dE2F1, may have a dual function on cell cycle progression and cannot simply be viewed as a pro-proliferative transcription factor.

  16. Sex Chromosome-wide Transcriptional Suppression and Compensatory Cis-Regulatory Evolution Mediate Gene Expression in the Drosophila Male Germline

    PubMed Central

    Landeen, Emily L.; Muirhead, Christina A.; Meiklejohn, Colin D.; Presgraves, Daven C.


    The evolution of heteromorphic sex chromosomes has repeatedly resulted in the evolution of sex chromosome-specific forms of regulation, including sex chromosome dosage compensation in the soma and meiotic sex chromosome inactivation in the germline. In the male germline of Drosophila melanogaster, a novel but poorly understood form of sex chromosome-specific transcriptional regulation occurs that is distinct from canonical sex chromosome dosage compensation or meiotic inactivation. Previous work shows that expression of reporter genes driven by testis-specific promoters is considerably lower—approximately 3-fold or more—for transgenes inserted into X chromosome versus autosome locations. Here we characterize this transcriptional suppression of X-linked genes in the male germline and its evolutionary consequences. Using transgenes and transpositions, we show that most endogenous X-linked genes, not just testis-specific ones, are transcriptionally suppressed several-fold specifically in the Drosophila male germline. In wild-type testes, this sex chromosome-wide transcriptional suppression is generally undetectable, being effectively compensated by the gene-by-gene evolutionary recruitment of strong promoters on the X chromosome. We identify and experimentally validate a promoter element sequence motif that is enriched upstream of the transcription start sites of hundreds of testis-expressed genes; evolutionarily conserved across species; associated with strong gene expression levels in testes; and overrepresented on the X chromosome. These findings show that the expression of X-linked genes in the Drosophila testes reflects a balance between chromosome-wide epigenetic transcriptional suppression and long-term compensatory adaptation by sex-linked genes. Our results have broad implications for the evolution of gene expression in the Drosophila male germline and for genome evolution. PMID:27404402

  17. Sex Chromosome-wide Transcriptional Suppression and Compensatory Cis-Regulatory Evolution Mediate Gene Expression in the Drosophila Male Germline.


    Landeen, Emily L; Muirhead, Christina A; Wright, Lori; Meiklejohn, Colin D; Presgraves, Daven C


    The evolution of heteromorphic sex chromosomes has repeatedly resulted in the evolution of sex chromosome-specific forms of regulation, including sex chromosome dosage compensation in the soma and meiotic sex chromosome inactivation in the germline. In the male germline of Drosophila melanogaster, a novel but poorly understood form of sex chromosome-specific transcriptional regulation occurs that is distinct from canonical sex chromosome dosage compensation or meiotic inactivation. Previous work shows that expression of reporter genes driven by testis-specific promoters is considerably lower-approximately 3-fold or more-for transgenes inserted into X chromosome versus autosome locations. Here we characterize this transcriptional suppression of X-linked genes in the male germline and its evolutionary consequences. Using transgenes and transpositions, we show that most endogenous X-linked genes, not just testis-specific ones, are transcriptionally suppressed several-fold specifically in the Drosophila male germline. In wild-type testes, this sex chromosome-wide transcriptional suppression is generally undetectable, being effectively compensated by the gene-by-gene evolutionary recruitment of strong promoters on the X chromosome. We identify and experimentally validate a promoter element sequence motif that is enriched upstream of the transcription start sites of hundreds of testis-expressed genes; evolutionarily conserved across species; associated with strong gene expression levels in testes; and overrepresented on the X chromosome. These findings show that the expression of X-linked genes in the Drosophila testes reflects a balance between chromosome-wide epigenetic transcriptional suppression and long-term compensatory adaptation by sex-linked genes. Our results have broad implications for the evolution of gene expression in the Drosophila male germline and for genome evolution.

  18. The Groucho Co-repressor Is Primarily Recruited to Local Target Sites in Active Chromatin to Attenuate Transcription

    PubMed Central

    Jennings, Barbara H.


    Gene expression is regulated by the complex interaction between transcriptional activators and repressors, which function in part by recruiting histone-modifying enzymes to control accessibility of DNA to RNA polymerase. The evolutionarily conserved family of Groucho/Transducin-Like Enhancer of split (Gro/TLE) proteins act as co-repressors for numerous transcription factors. Gro/TLE proteins act in several key pathways during development (including Notch and Wnt signaling), and are implicated in the pathogenesis of several human cancers. Gro/TLE proteins form oligomers and it has been proposed that their ability to exert long-range repression on target genes involves oligomerization over broad regions of chromatin. However, analysis of an endogenous gro mutation in Drosophila revealed that oligomerization of Gro is not always obligatory for repression in vivo. We have used chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) to profile Gro recruitment in two Drosophila cell lines. We find that Gro predominantly binds at discrete peaks (<1 kilobase). We also demonstrate that blocking Gro oligomerization does not reduce peak width as would be expected if Gro oligomerization induced spreading along the chromatin from the site of recruitment. Gro recruitment is enriched in “active” chromatin containing developmentally regulated genes. However, Gro binding is associated with local regions containing hypoacetylated histones H3 and H4, which is indicative of chromatin that is not fully open for efficient transcription. We also find that peaks of Gro binding frequently overlap the transcription start sites of expressed genes that exhibit strong RNA polymerase pausing and that depletion of Gro leads to release of polymerase pausing and increased transcription at a bona fide target gene. Our results demonstrate that Gro is recruited to local sites by transcription factors to attenuate rather than silence gene expression by promoting histone deacetylation

  19. Polycombs and microRNA-223 regulate human granulopoiesis by transcriptional control of target gene expression.


    Zardo, Giuseppe; Ciolfi, Alberto; Vian, Laura; Starnes, Linda M; Billi, Monia; Racanicchi, Serena; Maresca, Carmen; Fazi, Francesco; Travaglini, Lorena; Noguera, Nelida; Mancini, Marco; Nanni, Mauro; Cimino, Giuseppe; Lo-Coco, Francesco; Grignani, Francesco; Nervi, Clara


    Epigenetic modifications regulate developmental genes involved in stem cell identity and lineage choice. NFI-A is a posttranscriptional microRNA-223 (miR-223) target directing human hematopoietic progenitor lineage decision: NFI-A induction or silencing boosts erythropoiesis or granulopoiesis, respectively. Here we show that NFI-A promoter silencing, which allows granulopoiesis, is guaranteed by epigenetic events, including the resolution of opposing chromatin "bivalent domains," hypermethylation, recruitment of polycomb (PcG)-RNAi complexes, and miR-223 promoter targeting activity. During granulopoiesis, miR-223 localizes inside the nucleus and targets the NFI-A promoter region containing PcGs binding sites and miR-223 complementary DNA sequences, evolutionarily conserved in mammalians. Remarkably, both the integrity of the PcGs-RNAi complex and DNA sequences matching the seed region of miR-223 are required to induce NFI-A transcriptional silencing. Moreover, ectopic miR-223 expression in human myeloid progenitors causes heterochromatic repression of NFI-A gene and channels granulopoiesis, whereas its stable knockdown produces the opposite effects. Our findings indicate that, besides the regulation of translation of mRNA targets, endogenous miRs can affect gene expression at the transcriptional level, functioning in a critical interface between chromatin remodeling complexes and the genome to direct fate lineage determination of hematopoietic progenitors.

  20. Gains and Losses of Transcription Factor Binding Sites in Saccharomyces cerevisiae and Saccharomyces paradoxus.


    Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung


    Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains).

  1. Increased expression of X-linked genes in mammals is associated with a higher stability of transcripts and an increased ribosome density.


    Faucillion, Marie-Line; Larsson, Jan


    Mammalian sex chromosomes evolved from the degeneration of one homolog of a pair of ancestral autosomes, the proto-Y. This resulted in a gene dose imbalance that is believed to be restored (partially or fully) through upregulation of gene expression from the single active X-chromosome in both sexes by a dosage compensatory mechanism. We analyzed multiple genome-wide RNA stability data sets and found significantly longer average half-lives for X-chromosome transcripts than for autosomal transcripts in various human cell lines, both male and female, and in mice. Analysis of ribosome profiling data shows that ribosome density is higher on X-chromosome transcripts than on autosomal transcripts in both humans and mice, suggesting that the higher stability is causally linked to a higher translation rate. Our results and observations are in accordance with a dosage compensatory upregulation of expressed X-linked genes. We therefore propose that differential mRNA stability and translation rates of the autosomes and sex chromosomes contribute to an evolutionarily conserved dosage compensation mechanism in mammals.

  2. Conservation, diversification and expansion of C2H2 zinc finger proteins in the Arabidopsis thaliana genome

    PubMed Central

    Englbrecht, Claudia C; Schoof, Heiko; Böhm, Siegfried


    Background The classical C2H2 zinc finger domain is involved in a wide range of functions and can bind to DNA, RNA and proteins. The comparison of zinc finger proteins in several eukaryotes has shown that there is a lot of lineage specific diversification and expansion. Although the number of characterized plant proteins that carry the classical C2H2 zinc finger motifs is growing, a systematic classification and analysis of a plant genome zinc finger gene set is lacking. Results We found through in silico analysis 176 zinc finger proteins in Arabidopsis thaliana that hence constitute the most abundant family of putative transcriptional regulators in this plant. Only a minority of 33 A. thaliana zinc finger proteins are conserved in other eukaryotes. In contrast, the majority of these proteins (81%) are plant specific. They are derived from extensive duplication events and form expanded families. We assigned the proteins to different subgroups and families and focused specifically on the two largest and evolutionarily youngest families (A1 and C1) that are suggested to be primarily involved in transcriptional regulation. The newly defined family A1 (24 members) comprises proteins with tandemly arranged zinc finger domains. Family C1 (64 members), earlier described as the EPF-family in Petunia, comprises proteins with one isolated or two to five dispersed fingers and a mostly invariant QALGGH motif in the zinc finger helices. Based on the amino acid pattern in these helices we could describe five different signature sequences prevalent in C1 zinc finger domains. We also found a number of non-finger domains that are conserved in these families. Conclusions Our analysis of the few evolutionarily conserved zinc finger proteins of A. thaliana suggests that most of them could be involved in ancient biological processes like RNA metabolism and chromatin-remodeling. In contrast, the majority of the unique A. thaliana zinc finger proteins are known or suggested to be

  3. Conserved noncoding genomic sequences associated with a flowering-time quantitative trait locus in maize

    PubMed Central

    Salvi, Silvio; Sponza, Giorgio; Morgante, Michele; Tomes, Dwight; Niu, Xiaomu; Fengler, Kevin A.; Meeley, Robert; Ananiev, Evgueni V.; Svitashev, Sergei; Bruggemann, Edward; Li, Bailin; Hainey, Christine F.; Radovic, Slobodanka; Zaina, Giusi; Rafalski, J.-Antoni; Tingey, Scott V.; Miao, Guo-Hua; Phillips, Ronald L.; Tuberosa, Roberto


    Flowering time is a fundamental trait of maize adaptation to different agricultural environments. Although a large body of information is available on the map position of quantitative trait loci for flowering time, little is known about the molecular basis of quantitative trait loci. Through positional cloning and association mapping, we resolved the major flowering-time quantitative trait locus, Vegetative to generative transition 1 (Vgt1), to an ≈2-kb noncoding region positioned 70 kb upstream of an Ap2-like transcription factor that we have shown to be involved in flowering-time control. Vgt1 functions as a cis-acting regulatory element as indicated by the correlation of the Vgt1 alleles with the transcript expression levels of the downstream gene. Additionally, within Vgt1, we identified evolutionarily conserved noncoding sequences across the maize–sorghum–rice lineages. Our results support the notion that changes in distant cis-acting regulatory regions are a key component of plant genetic adaptation throughout breeding and evolution. PMID:17595297

  4. B-GATA transcription factors - insights into their structure, regulation, and role in plant development.


    Behringer, Carina; Schwechheimer, Claus


    GATA transcription factors are evolutionarily conserved transcriptional regulators that recognize promoter elements with a G-A-T-A core sequence. In comparison to animal genomes, the GATA transcription factor family in plants is comparatively large with approximately 30 members. Here, we review the current knowledge on B-GATAs, one of four GATA factor subfamilies from Arabidopsis thaliana. We show that B-GATAs can be subdivided based on structural features and their biological function into family members with a C-terminal LLM- (leucine-leucine-methionine) domain or an N-terminal HAN- (HANABA TARANU) domain. The paralogous GNC (GATA, NITRATE-INDUCIBLE, CARBON-METABOLISM INVOLVED) and CGA1/GNL (CYTOKININ-INDUCED GATA1/GNC-LIKE) are introduced as LLM-domain containing B-GATAs from Arabidopsis that control germination, greening, senescence, and flowering time downstream from several growth regulatory signals. Arabidopsis HAN and its monocot-specific paralogs from rice (NECK LEAF1), maize (TASSEL SHEATH1), and barley (THIRD OUTER GLUME) are HAN-domain-containing B-GATAs with a predominant role in embryo development and floral development. We also review GATA23, a regulator of lateral root initiation from Arabidopsis that is closely related to GNC and GNL but has a degenerate LLM-domain that is seemingly specific for the Brassicaceae family. The Brassicaceae-specific GATA23 and the monocot-specific HAN-domain GATAs provide evidence that neofunctionalization of B-GATAs was used during plant evolution to expand the functional repertoire of these transcription factors.

  5. An evolutionarily conserved SSNA1/DIP13 homologue is a component of both basal and apical complexes of Toxoplasma gondii

    PubMed Central

    Lévêque, Maude F.; Berry, Laurence; Besteiro, Sébastien


    Microtubule-based cytoskeletal structures have fundamental roles in several essential eukaryotic processes, including transport of intracellular constituents as well as ciliary and flagellar mobility. Temporal and spatial organisation of microtubules is determined by microtubule organising centers and a number of appendages and accessory proteins. Members of the SSNA1/DIP13 family are coiled coil proteins that are known to localise to microtubular structures like centrosomes and flagella, but are otherwise poorly characterised. We have identified a homologue of SSNA1/DIP13 in the parasitic protist Toxoplasma gondii and found it localises to parasite-specific cytoskeletal structures: the conoid in the apical complex of mature and dividing cells, and the basal complex in elongating daughter cells during cell division. This protein is dispensable for parasite growth in vitro. However, quite remarkably, this coiled coil protein is able to self-associate into higher order structures both in vitro and in vivo, and its overexpression is impairing parasite division. PMID:27324377

  6. The Evolutionarily Conserved Protein PHOTOSYNTHESIS AFFECTED MUTANT71 Is Required for Efficient Manganese Uptake at the Thylakoid Membrane in Arabidopsis

    PubMed Central

    Steinberger, Iris; Herdean, Andrei; Gandini, Chiara; Labs, Mathias; Flügge, Ulf-Ingo; Geimer, Stefan; Schmidt, Sidsel Birkelund; Husted, Søren; Spetea, Cornelia; Leister, Dario


    In plants, algae, and cyanobacteria, photosystem II (PSII) catalyzes the light-driven oxidation of water. The oxygen-evolving complex of PSII is a Mn4CaO5 cluster embedded in a well-defined protein environment in the thylakoid membrane. However, transport of manganese and calcium into the thylakoid lumen remains poorly understood. Here, we show that Arabidopsis thaliana PHOTOSYNTHESIS AFFECTED MUTANT71 (PAM71) is an integral thylakoid membrane protein involved in Mn2+ and Ca2+ homeostasis in chloroplasts. This protein is required for normal operation of the oxygen-evolving complex (as evidenced by oxygen evolution rates) and for manganese incorporation. Manganese binding to PSII was severely reduced in pam71 thylakoids, particularly in PSII supercomplexes. In cation partitioning assays with intact chloroplasts, Mn2+ and Ca2+ ions were differently sequestered in pam71, with Ca2+ enriched in pam71 thylakoids relative to the wild type. The changes in Ca2+ homeostasis were accompanied by an increased contribution of the transmembrane electrical potential to the proton motive force across the thylakoid membrane. PSII activity in pam71 plants and the corresponding Chlamydomonas reinhardtii mutant cgld1 was restored by supplementation with Mn2+, but not Ca2+. Furthermore, PAM71 suppressed the Mn2+-sensitive phenotype of the yeast mutant Δpmr1. Therefore, PAM71 presumably functions in Mn2+ uptake into thylakoids to ensure optimal PSII performance. PMID:27020959

  7. A genome-wide Drosophila screen for heat nociception identifies α2δ3 as an evolutionarily conserved pain gene.


    Neely, G Gregory; Hess, Andreas; Costigan, Michael; Keene, Alex C; Goulas, Spyros; Langeslag, Michiel; Griffin, Robert S; Belfer, Inna; Dai, Feng; Smith, Shad B; Diatchenko, Luda; Gupta, Vaijayanti; Xia, Cui-Ping; Amann, Sabina; Kreitz, Silke; Heindl-Erdmann, Cornelia; Wolz, Susanne; Ly, Cindy V; Arora, Suchir; Sarangi, Rinku; Dan, Debasis; Novatchkova, Maria; Rosenzweig, Mark; Gibson, Dustin G; Truong, Darwin; Schramek, Daniel; Zoranovic, Tamara; Cronin, Shane J F; Angjeli, Belinda; Brune, Kay; Dietzl, Georg; Maixner, William; Meixner, Arabella; Thomas, Winston; Pospisilik, J Andrew; Alenius, Mattias; Kress, Michaela; Subramaniam, Sai; Garrity, Paul A; Bellen, Hugo J; Woolf, Clifford J; Penninger, Josef M


    Worldwide, acute, and chronic pain affects 20% of the adult population and represents an enormous financial and emotional burden. Using genome-wide neuronal-specific RNAi knockdown in Drosophila, we report a global screen for an innate behavior and identify hundreds of genes implicated in heat nociception, including the α2δ family calcium channel subunit straightjacket (stj). Mice mutant for the stj ortholog CACNA2D3 (α2δ3) also exhibit impaired behavioral heat pain sensitivity. In addition, in humans, α2δ3 SNP variants associate with reduced sensitivity to acute noxious heat and chronic back pain. Functional imaging in α2δ3 mutant mice revealed impaired transmission of thermal pain-evoked signals from the thalamus to higher-order pain centers. Intriguingly, in α2δ3 mutant mice, thermal pain and tactile stimulation triggered strong cross-activation, or synesthesia, of brain regions involved in vision, olfaction, and hearing.

  8. Nonclassical MHC class I-dependent invariant T cells are evolutionarily conserved and prominent from early development in amphibians.


    Edholm, Eva-Stina; Albertorio Saez, Liz-Marie; Gill, Ann L; Gill, Steven R; Grayfer, Leon; Haynes, Nikesha; Myers, Jason R; Robert, Jacques


    Human and murine MHC nonclassical class Ib-restricted invariant T (iT) cell subsets, such as invariant natural killer T cells (iNKT) and mucosal-associated invariant T cells, have specialized functions early in immune responses, especially in modulating subsequent adaptive immune responses. Here, we characterize a prominent iT population in the amphibian Xenopus laevis and show the requirement of the class Ib molecule, Xenopus nonclassical gene 10, in its differentiation and function. Using Xenopus nonclassical gene 10 tetramers and RNAi loss of function by transgenesis, we identified a large class Ib-dependent CD8(-)/CD4(-) iT subset in unmanipulated frogs and tadpoles. This population is critical for antiviral immunity during early larval stages when classical MHC class Ia function is suboptimal. Furthermore, in young tadpoles with low class Ia expression, deep sequencing revealed additional preponderant invariant T cell receptor (TCR)α rearrangements, implying other iT cell subsets and a predominant selection process mediated by other class Ib molecules. The restriction and requirement of class Ib molecules for development and antiviral immunity of a mammalian iNKT or mucosal-associated invariant T cell counterpart in the amphibian Xenopus show the importance of iT cells in the emergence and evolution of the adaptive immune system.

  9. Actin is an evolutionarily-conserved damage-associated molecular pattern that signals tissue injury in Drosophila melanogaster

    PubMed Central

    Srinivasan, Naren; Gordon, Oliver; Ahrens, Susan; Franz, Anna; Deddouche, Safia; Chakravarty, Probir; Phillips, David; Yunus, Ali A; Rosen, Michael K; Valente, Rita S; Teixeira, Luis; Thompson, Barry; Dionne, Marc S; Wood, Will; Reis e Sousa, Caetano


    Damage-associated molecular patterns (DAMPs) are molecules released by dead cells that trigger sterile inflammation and, in vertebrates, adaptive immunity. Actin is a DAMP detected in mammals by the receptor, DNGR-1, expressed by dendritic cells (DCs). DNGR-1 is phosphorylated by Src-family kinases and recruits the tyrosine kinase Syk to promote DC cross-presentation of dead cell-associated antigens. Here we report that actin is also a DAMP in invertebrates that lack DCs and adaptive immunity. Administration of actin to Drosophila melanogaster triggers a response characterised by selective induction of STAT target genes in the fat body through the cytokine Upd3 and its JAK/STAT-coupled receptor, Domeless. Notably, this response requires signalling via Shark, the Drosophila orthologue of Syk, and Src42A, a Drosophila Src-family kinase, and is dependent on Nox activity. Thus, extracellular actin detection via a Src-family kinase-dependent cascade is an ancient means of detecting cell injury that precedes the evolution of adaptive immunity. DOI: PMID:27871362

  10. Long-term window of ischemic tolerance: An evolutionarily conserved form of metabolic plasticity regulated by epigenetic modifications?

    PubMed Central

    Khoury, Nathalie; Koronowski, Kevin B.; Perez-Pinzon, Miguel A.


    In the absence of effective neuroprotective agents in the clinic, ischemic and pharmacological preconditioning are gaining increased interest in the field of cerebral ischemia. Our lab recently reported that resveratrol preconditioning affords tolerance against a focal cerebral ischemic insult in mice that can last for at least 14 days in vivo making it the longest window of ischemic tolerance discovered to date by a single administration of a pharmacological agent. The mechanism behind this novel extended window of ischemic tolerance remains elusive. In the below commentary we discuss potential mechanisms that could explain this novel extended window of ischemic tolerance in the context of previously identified windows and the known mechanisms behind them. We also draw parallels from the fields of hibernation and hypoxia-tolerance, which are chronic adaptations to severe conditions of hypoxia and ischemia known to be mediated by a form of metabolic depression. We also briefly discuss the importance of epigenetic modifications in maintaining this depressed state of metabolism. PMID:27796011

  11. Promoter analyses and transcriptional profiling of eggplant polyphenol oxidase 1 gene (SmePPO1) reveal differential response to exogenous methyl jasmonate and salicylic acid.


    Shetty, Santoshkumar M; Chandrashekar, Arun; Venkatesh, Yeldur P


    The transcriptional regulation of multigenic eggplant (Solanum melongena) polyphenol oxidase genes (SmePPO) is orchestrated by their corresponding promoters which mediate developmentally regulated expression in response to myriad biotic and abiotic factors. However, information on structural features of SmePPO promoters and modulation of their expression by plant defense signals are lacking. In the present study, SmePPOPROMOTERs were cloned by genome walking, and their transcription start sites (TSS) were determined by RLM-RACE. Extensive sequence analyses revealed the presence of evolutionarily conserved and over-represented putative cis-acting elements involved in light-regulated transcription, biosynthetic pathways (phenylpropanoid/flavonoid), hormone signaling (abscisic acid, gibberellic acid, jasmonate and salicylate), elicitor and stress responses (cold/dehydration responses), sugar metabolism and plant defense signaling (W-BOX/WRKY) that are common to SmePPOPROMOTER1 and 2. The TSS for SmePPO genes are located 9-15bp upstream of ATG with variable lengths of 5' untranslated regions. Transcriptional profiling of SmePPOs in eggplant seedlings has indicated differential response to methyl jasmonate (MeJA) or salicylic acid (SA) treatment. In planta, while MeJA elicited expression of all the six SmePPOs, SA was only able to induce the expression of SmePPO4-6. Interestingly, in dual treatment, SA considerably repressed the MeJA-induced expression of SmePPOs. Functional dissection of SmePPOPROMOTER1 by deletion analyses using Agrobacterium-mediated transient expression in tobacco leaves has shown that MeJA enhances the SmePPOPROMOTER1-β-glucuronidase (GUS) expression in vivo, while SA does not. Histochemical and quantitative GUS assays have also indicated the negative effect of SA on MeJA-induced expression of SmePPOPROMOTER1. By combining in silico analyses, transcriptional profiling and expression of SmePPOPROMOTER1-GUS fusions, the role of SA on the modulation

  12. A functionally conserved Zn2 Cys6 binuclear cluster transcription factor class regulates necrotrophic effector gene expression and host-specific virulence of two major Pleosporales fungal pathogens of wheat.


    Rybak, Kasia; See, Pao Theen; Phan, Huyen T T; Syme, Robert A; Moffat, Caroline S; Oliver, Richard P; Tan, Kar-Chun


    The fungus Parastagonospora nodorum is the causal agent of Septoria nodorum blotch of wheat (Triticum aestivum). The interaction is mediated by multiple fungal necrotrophic effector-dominant host sensitivity gene interactions. The three best-characterized effector-sensitivity gene systems are SnToxA-Tsn1, SnTox1-Snn1 and SnTox3-Snn3. These effector genes are highly expressed during early infection, but expression decreases as the infection progresses to tissue necrosis and sporulation. However, the mechanism of regulation is unknown. We have identified and functionally characterized a gene, referred to as PnPf2, which encodes a putative zinc finger transcription factor. PnPf2 deletion resulted in the down-regulation of SnToxA and SnTox3 expression. Virulence on Tsn1 and Snn3 wheat cultivars was strongly reduced. The SnTox1-Snn1 interaction remained unaffected. Furthermore, we have also identified and deleted an orthologous PtrPf2 from the tan spot fungus Pyrenophora tritici-repentis which possesses a near-identical ToxA that was acquired from P. nodorum via horizontal gene transfer. PtrPf2 deletion also resulted in the down-regulation of PtrToxA expression and a near-complete loss of virulence on Tsn1 wheat. We have demonstrated, for the first time, evidence for a functionally conserved signalling component that plays a role in the regulation of a common/horizontally transferred effector found in two major fungal pathogens of wheat.

  13. Specificity for the hairy/enhancer of split basic helix-loop-helix (bHLH) proteins maps outside the bHLH domain and suggests two separable modes of transcriptional repression.


    Dawson, S R; Turner, D L; Weintraub, H; Parkhurst, S M


    The Hairy/Enhancer of split/Deadpan family of basic helix-loop-helix (bHLH) proteins function as transcriptional repressors. We have examined the mechanisms of repression used by the Hairy and E(SPL) proteins by assaying the antagonism between wild-type or altered Hairy/E(SPL) and Scute bHLH proteins during sex determination in Drosophila melanogaster. Domain swapping and mutagenesis of the Hairy and E(SPL) proteins show that three evolutionarily conserved domains are required for their function: the bHLH, Orange, and WRPW domains. However, the suppression of Scute activity by Hairy does not require the WRPW domain. We show that the Orange domain is an important functional domain that confers specificity among members of the Hairy/E(SPL) family. In addition, we show that a Xenopus Hairy homology conserves not only Hairy's structure but also its biological activity in our assays. We propose that transcriptional repression by the Hairy/E(SPL) family of bHLH proteins involves two separable mechanisms: repression of specific transcriptional activators, such as Scute, through the bHLH and Orange domains and repression of other activators via interaction of the C-terminal WRPW motif with corepressors, such as the Groucho protein.

  14. Fungal CSL transcription factors

    PubMed Central

    Převorovský, Martin; Půta, František; Folk, Petr


    Background The CSL (CBF1/RBP-Jκ/Suppressor of Hairless/LAG-1) transcription factor family members are well-known components of the transmembrane receptor Notch signaling pathway, which plays a critical role in metazoan development. They function as context-dependent activators or repressors of transcription of their responsive genes, the promoters of which harbor the GTG(G/A)GAA consensus elements. Recently, several studies described Notch-independent activities of the CSL proteins. Results We have identified putative CSL genes in several fungal species, showing that this family is not confined to metazoans. We have analyzed their sequence conservation and identified the presence of well-defined domains typical of genuine CSL proteins. Furthermore, we have shown that the candidate fungal protein sequences contain highly conserved regions known to be required for sequence-specific DNA binding in their metazoan counterparts. The phylogenetic analysis of the newly identified fungal CSL proteins revealed the existence of two distinct classes, both of which are present in all the species studied. Conclusion Our findings support the evolutionary origin of the CSL transcription factor family in the last common ancestor of fungi and metazoans. We hypothesize that the ancestral CSL function involved DNA binding and Notch-independent regulation of transcription and that this function may still be shared, to a certain degree, by the present CSL family members from both fungi and metazoans. PMID:17629904

  15. Fourier Analysis of Conservation Patterns in Protein Secondary Structure.


    Palaniappan, Ashok; Jakobsson, Eric


    Residue conservation is a common observation in alignments of protein families, underscoring positions important in protein structure and function. Though many methods measure the level of conservation of particular residue positions, currently we do not have a way to study spatial oscillations occurring in protein conservation patterns. It is known that hydrophobicity shows spatial oscillations in proteins, which is characterized by computing the hydrophobic moment of the protein domains. Here, we advance the study of moments of conservation of protein families to know whether there might exist spatial asymmetry in the conservation patterns of regular secondary structures. Analogous to the hydrophobic moment, the conservation moment is defined as the modulus of the Fourier transform of the conservation function of an alignment of related protein, where the conservation function is the vector of conservation values at each column of the alignment. The profile of the conservation moment is useful in ascertaining any periodicity of conservation, which might correlate with the period of the secondary structure. To demonstrate the concept, conservation in the family of potassium ion channel proteins was analyzed using moments. It was shown that the pore helix of the potassium channel showed oscillations in the moment of conservation matching the period of the α-helix. This implied that one side of the pore helix was evolutionarily conserved in contrast to its opposite side. In addition, the method of conservation moments correctly identified the disposition of the voltage sensor of voltage-gated potassium channels to form a 310 helix in the membrane.

  16. Evolutionary stability of mutualism: interspecific population regulation as an evolutionarily stable strategy

    USGS Publications Warehouse

    Holland, J. Nathaniel; DeAngelis, Donald L.; Schultz, Stewart T.


    Interspecific mutualisms are often vulnerable to instability because low benefit : cost ratios can rapidly lead to extinction or to the conversion of mutualism to parasite–host or predator–prey interactions. We hypothesize that the evolutionary stability of mutualism can depend on how benefits and costs to one mutualist vary with the population density of its partner, and that stability can be maintained if a mutualist can influence demographic rates and regulate the population density of its partner. We test this hypothesis in a model of mutualism with key features of senita cactus (Pachycereus schottii) – senita moth (Upiga virescens) interactions, in which benefits of pollination and costs of larval seed consumption to plant fitness depend on pollinator density. We show that plants can maximize their fitness by allocating resources to the production of excess flowers at the expense of fruit. Fruit abortion resulting from excess flower production reduces pre–adult survival of the pollinating seed–consumer, and maintains its density beneath a threshold that would destabilize the mutualism. Such a strategy of excess flower production and fruit abortion is convergent and evolutionarily stable against invasion by cheater plants that produce few flowers and abort few to no fruit. This novel mechanism of achieving evolutionarily stable mutualism, namely interspecific population regulation, is qualitatively different from other mechanisms invoking partner choice or selective rewards, and may be a general process that helps to preserve mutualistic interactions in nature.

  17. The lateral line confers evolutionarily derived sleep loss in the Mexican cavefish.


    Jaggard, James; Robinson, Beatriz G; Stahl, Bethany A; Oh, Ian; Masek, Pavel; Yoshizawa, Masato; Keene, Alex C


    Sleep is an essential behavior exhibited by nearly all animals, and disruption of this process is associated with an array of physiological and behavioral deficits. Sleep is defined by changes in sensory gating that reduce sensory input to the brain, but little is known about the neural basis for interactions between sleep and sensory processing. Blind Mexican cavefish comprise an extant surface dwelling form and 29 cave morphs that have independently evolved increased numbers of mechanoreceptive lateral line neuromasts and convergent evolution of sleep loss. Ablation of the lateral line enhanced sleep in the Pachón cavefish population, suggesting that heightened sensory input underlies evolutionarily derived sleep loss. Targeted lateral line ablation and behavioral analysis localized the wake-promoting neuromasts in Pachón cavefish to superficial neuromasts of the trunk and cranial regions. Strikingly, lateral line ablation did not affect sleep in four other cavefish populations, suggesting that distinct neural mechanisms regulate the evolution of sleep loss in independently derived cavefish populations. Cavefish are subject to seasonal changes in food availability, raising the possibility that sensory modulation of sleep is influenced by metabolic state. We found that starvation promotes sleep in Pachón cavefish, and is not enhanced by lateral line ablation, suggesting that functional interactions occur between sensory and metabolic regulation of sleep. Taken together, these findings support a model where sensory processing contributes to evolutionarily derived changes in sleep that are modulated in accordance with food availability.

  18. Predictive regulatory models in Drosophila melanogaster by integrative inference of transcriptional networks.


    Marbach, Daniel; Roy, Sushmita; Ay, Ferhat; Meyer, Patrick E; Candeias, Rogerio; Kahveci, Tamer; Bristow, Christopher A; Kellis, Manolis


    Gaining insights on gene regulation from large-scale functional data sets is a grand challenge in systems biology. In this article, we develop and apply methods for transcriptional regulatory network inference from diverse functional genomics data sets and demonstrate their value for gene function and gene expression prediction. We formulate the network inference problem in a machine-learning framework and use both supervised and unsupervised methods to predict regulatory edges by integrating transcription factor (TF) binding, evolutionarily conserved sequence motifs, gene expression, and chromatin modification data sets as input features. Applying these methods to Drosophila melanogaster, we predict ∼300,000 regulatory edges in a network of ∼600 TFs and 12,000 target genes. We validate our predictions using known regulatory interactions, gene functional annotations, tissue-specific expression, protein-protein interactions, and three-dimensional maps of chromosome conformation. We use the inferred network to identify putative functions for hundreds of previously uncharacterized genes, including many in nervous system development, which are independently confirmed based on their tissue-specific expression patterns. Last, we use the regulatory network to predict target gene expression levels as a function of TF expression, and find significantly higher predictive power for integrative networks than for motif or ChIP-based networks. Our work reveals the complementarity between physical evidence of regulatory interactions (TF binding, motif conservation) and functional evidence (coordinated expression or chromatin patterns) and demonstrates the power of data integration for network inference and studies of gene regulation at the systems level.

  19. Transcriptional Regulation of Notch1 Expression by Nkx6.1 in Neural Stem/Progenitor Cells during Ventral Spinal Cord Development

    PubMed Central

    Li, Ying; Tzatzalos, Evangeline; Kwan, Kelvin Y.; Grumet, Martin; Cai, Li


    Notch1 signaling plays a critical role in maintaining and determining neural stem/progenitor cell (NSPC) fate, yet the transcriptional mechanism controlling Notch1 specific expression in NSPCs remains incomplete. Here, we show transcription factor Nkx6.1 interacts with a cis-element (CR2, an evolutionarily conserved non-coding fragment in the second intron of Notch1 locus) and regulates the expression of Notch1 in ventral NSPCs of the developing spinal cord. We show that the Notch1 expression is modulated by the interaction of Nkx6.1 with a 139 bp enhancer sequence within CR2. Knockdown or overexpression of Nkx6.1 leads to down- or up-regulated Notch1 expression, respectively. In CR2-GFP transgenic mouse, GFP expression was found prominent in the ventricular zone and neural progenitor cells from embryonic day 9.5 to postnatal day 7. GFP+ cells were mainly neural progenitors for interneurons and not for motoneurons or glial cells. Moreover, GFP expression persisted in a subset of ependymal cells in the adult spinal cord, suggesting that CR2 is active in both embryonic and adult NSPCs. Together our data reveal a novel mechanism of Notch1 transcriptional regulation in the ventral spinal cord by Nkx6.1 via its binding with Notch1 enhancer CR2 during embryonic development. PMID:27924849

  20. Collections Conservation.

    ERIC Educational Resources Information Center

    DeCandido, Robert

    Collections conservation is an approach to the preservation treatment of books and book-like materials that is conceptualized and organized in terms of large groups of materials. This guide is intended to enable a library to evaluate its current collections conservation activities. The introduction describes collections conservation and gives…

  1. Conservation of small RNA pathways in platypus.


    Murchison, Elizabeth P; Kheradpour, Pouya; Sachidanandam, Ravi; Smith, Carly; Hodges, Emily; Xuan, Zhenyu; Kellis, Manolis; Grützner, Frank; Stark, Alexander; Hannon, Gregory J


    Small RNA pathways play evolutionarily conserved roles in gene regulation and defense from parasitic nucleic acids. The character and expression patterns of small RNAs show conservation throughout animal lineages, but specific animal clades also show variations on these recurring themes, including species-specific small RNAs. The monotremes, with only platypus and four species of echidna as extant members, represent the basal branch of the mammalian lineage. Here, we examine the small RNA pathways of monotremes by deep sequencing of six platypus and echidna tissues. We find that highly conserved microRNA species display their signature tissue-specific expression patterns. In addition, we find a large rapidly evolving cluster of microRNAs on platypus chromosome X1, which is unique to monotremes. Platypus and echidna testes contain a robust Piwi-interacting (piRNA) system, which appears to be participating in ongoing transposon defense.

  2. Conservation of small RNA pathways in platypus

    PubMed Central

    Murchison, Elizabeth P.; Kheradpour, Pouya; Sachidanandam, Ravi; Smith, Carly; Hodges, Emily; Xuan, Zhenyu; Kellis, Manolis; Grützner, Frank; Stark, Alexander; Hannon, Gregory J.


    Small RNA pathways play evolutionarily conserved roles in gene regulation and defense from parasitic nucleic acids. The character and expression patterns of small RNAs show conservation throughout animal lineages, but specific animal clades also show variations on these recurring themes, including species-specific small RNAs. The monotremes, with only platypus and four species of echidna as extant members, represent the basal branch of the mammalian lineage. Here, we examine the small RNA pathways of monotremes by deep sequencing of six platypus and echidna tissues. We find that highly conserved microRNA species display their signature tissue-specific expression patterns. In addition, we find a large rapidly evolving cluster of microRNAs on platypus chromosome X1, which is unique to monotremes. Platypus and echidna testes contain a robust Piwi-interacting (piRNA) system, which appears to be participating in ongoing transposon defense. PMID:18463306

  3. The ATP-dependent chromatin remodeling enzyme Fun30 represses transcription by sliding promoter-proximal nucleosomes.


    Byeon, Boseon; Wang, Wei; Barski, Artem; Ranallo, Ryan T; Bao, Kan; Schones, Dustin E; Zhao, Keji; Wu, Carl; Wu, Wei-Hua


    The evolutionarily conserved ATP-dependent chromatin remodeling enzyme Fun30 has recently been shown to play important roles in heterochromatin silencing and DNA repair. However, how Fun30 remodels nucleosomes is not clear. Here we report a nucleosome sliding activity of Fun30 and its role in transcriptional repression. We observed that Fun30 repressed the expression of genes involved in amino acid and carbohydrate metabolism, the stress response, and meiosis. In addition, Fun30 was localized at the 5' and 3' ends of genes and within the open reading frames of its targets. Consistent with its role in gene repression, we observed that Fun30 target genes lacked histone modifications often associated with gene activation and showed an increased level of ubiquitinated histone H2B. Furthermore, a genome-wide nucleosome mapping analysis revealed that the length of the nucleosome-free region at the 5' end of a subset of genes was changed in Fun30-depleted cells. In addition, the positions of the -1, +2, and +3 nucleosomes at the 5' end of target genes were shifted significantly, whereas the position of the +1 nucleosome remained largely unchanged in the fun30Δ mutant. Finally, we demonstrated that affinity-purified, single-component Fun30 exhibited a nucleosome sliding activity in an ATP-dependent manner. These results define a role for Fun30 in the regulation of transcription and indicate that Fun30 remodels chromatin at the 5' end of genes by sliding promoter-proximal nucleosomes.

  4. Transcription factor modularity in a gene-centered C. elegans core neuronal protein–DNA interaction network

    PubMed Central

    Vermeirssen, Vanessa; Barrasa, M. Inmaculada; Hidalgo, César A.; Babon, Jenny Aurielle B.; Sequerra, Reynaldo; Doucette-Stamm, Lynn; Barabási, Albert-László; Walhout, Albertha J.M.


    Transcription regulatory networks play a pivotal role in the development, function, and pathology of metazoan organisms. Such networks are comprised of protein–DNA interactions between transcription factors (TFs) and their target genes. An important question pertains to how the architecture of such networks relates to network functionality. Here, we show that a Caenorhabditis elegans core neuronal protein–DNA interaction network is organized into two TF modules. These modules contain TFs that bind to a relatively small number of target genes and are more systems specific than the TF hubs that connect the modules. Each module relates to different functional aspects of the network. One module contains TFs involved in reproduction and target genes that are expressed in neurons as well as in other tissues. The second module is enriched for paired homeodomain TFs and connects to target genes that are often exclusively neuronal. We find that paired homeodomain TFs are specifically expressed in C. elegans and mouse neurons, indicating that the neuronal function of paired homeodomains is evolutionarily conserved. Taken together, we show that a core neuronal C. elegans protein–DNA interaction network possesses TF modules that relate to different functional aspects of the complete network. PMID:17513831

  5. Excess of Yra1 RNA-Binding Factor Causes Transcription-Dependent Genome Instability, Replication Impairment and Telomere Shortening.


    Gavaldá, Sandra; Santos-Pereira, José M; García-Rubio, María L; Luna, Rosa; Aguilera, Andrés


    Yra1 is an essential nuclear factor of the evolutionarily conserved family of hnRNP-like export factors that when overexpressed impairs mRNA export and cell growth. To investigate further the relevance of proper Yra1 stoichiometry in the cell, we overexpressed Yra1 by transforming yeast cells with YRA1 intron-less constructs and analyzed its effect on gene expression and genome integrity. We found that YRA1 overexpression induces DNA damage and leads to a transcription-associated hyperrecombination phenotype that is mediated by RNA:DNA hybrids. In addition, it confers a genome-wide replication retardation as seen by reduced BrdU incorporation and accumulation of the Rrm3 helicase. In addition, YRA1 overexpression causes a cell senescence-like phenotype and telomere shortening. ChIP-chip analysis shows that overexpressed Yra1 is loaded to transcribed chromatin along the genome and to Y' telomeric regions, where Rrm3 is also accumulated, suggesting an impairment of telomere replication. Our work not only demonstrates that a proper stoichiometry of the Yra1 mRNA binding and export factor is required to maintain genome integrity and telomere homeostasis, but suggests that the cellular imbalance between transcribed RNA and specific RNA-binding factors may become a major cause of genome instability mediated by co-transcriptional replication impairment.

  6. RNA helicase HEL-1 promotes longevity by specifically activating DAF-16/FOXO transcription factor signaling in Caenorhabditis elegans.


    Seo, Mihwa; Seo, Keunhee; Hwang, Wooseon; Koo, Hee Jung; Hahm, Jeong-Hoon; Yang, Jae-Seong; Han, Seong Kyu; Hwang, Daehee; Kim, Sanguk; Jang, Sung Key; Lee, Yoontae; Nam, Hong Gil; Lee, Seung-Jae V


    The homeostatic maintenance of the genomic DNA is crucial for regulating aging processes. However, the role of RNA homeostasis in aging processes remains unknown. RNA helicases are a large family of enzymes that regulate the biogenesis and homeostasis of RNA. However, the functional significance of RNA helicases in aging has not been explored. Here, we report that a large fraction of RNA helicases regulate the lifespan of Caenorhabditis elegans. In particular, we show that a DEAD-box RNA helicase, helicase 1 (HEL-1), promotes longevity by specifically activating the DAF-16/forkhead box O (FOXO) transcription factor signaling pathway. We find that HEL-1 is required for the longevity conferred by reduced insulin/insulin-like growth factor 1 (IGF-1) signaling (IIS) and is sufficient for extending lifespan. We further show that the expression of HEL-1 in the intestine and neurons contributes to longevity. HEL-1 enhances the induction of a large fraction of DAF-16 target genes. Thus, the RNA helicase HEL-1 appears to promote longevity in response to decreased IIS as a transcription coregulator of DAF-16. Because HEL-1 and IIS are evolutionarily well conserved, a similar mechanism for longevity regulation via an RNA helicase-dependent regulation of FOXO signaling may operate in mammals, including humans.

  7. Excess of Yra1 RNA-Binding Factor Causes Transcription-Dependent Genome Instability, Replication Impairment and Telomere Shortening

    PubMed Central

    Gavaldá, Sandra; Santos-Pereira, José M.; García-Rubio, María L.; Luna, Rosa; Aguilera, Andrés


    Yra1 is an essential nuclear factor of the evolutionarily conserved family of hnRNP-like export factors that when overexpressed impairs mRNA export and cell growth. To investigate further the relevance of proper Yra1 stoichiometry in the cell, we overexpressed Yra1 by transforming yeast cells with YRA1 intron-less constructs and analyzed its effect on gene expression and genome integrity. We found that YRA1 overexpression induces DNA damage and leads to a transcription-associated hyperrecombination phenotype that is mediated by RNA:DNA hybrids. In addition, it confers a genome-wide replication retardation as seen by reduced BrdU incorporation and accumulation of the Rrm3 helicase. In addition, YRA1 overexpression causes a cell senescence-like phenotype and telomere shortening. ChIP-chip analysis shows that overexpressed Yra1 is loaded to transcribed chromatin along the genome and to Y’ telomeric regions, where Rrm3 is also accumulated, suggesting an impairment of telomere replication. Our work not only demonstrates that a proper stoichiometry of the Yra1 mRNA binding and export factor is required to maintain genome integrity and telomere homeostasis, but suggests that the cellular imbalance between transcribed RNA and specific RNA-binding factors may become a major cause of genome instability mediated by co-transcriptional replication impairment. PMID:27035147

  8. The Ribosome Biogenesis Factor Nol11 Is Required for Optimal rDNA Transcription and Craniofacial Development in Xenopus

    PubMed Central

    Griffin, John N.; Sondalle, Samuel B.; del Viso, Florencia; Baserga, Susan J.; Khokha, Mustafa K.


    The production of ribosomes is ubiquitous and fundamental to life. As such, it is surprising that defects in ribosome biogenesis underlie a growing number of symptomatically distinct inherited disorders, collectively called ribosomopathies. We previously determined that the nucleolar protein, NOL11, is essential for optimal pre-rRNA transcription and processing in human tissue culture cells. However, the role of NOL11 in the development of a multicellular organism remains unknown. Here, we reveal a critical function for NOL11 in vertebrate ribosome biogenesis and craniofacial development. Nol11 is strongly expressed in the developing cranial neural crest (CNC) of both amphibians and mammals, and knockdown of Xenopus nol11 results in impaired pre-rRNA transcription and processing, increased apoptosis, and abnormal development of the craniofacial cartilages. Inhibition of p53 rescues this skeletal phenotype, but not the underlying ribosome biogenesis defect, demonstrating an evolutionarily conserved control mechanism through which ribosome-impaired craniofacial cells are removed. Excessive activation of this mechanism impairs craniofacial development. Together, our findings reveal a novel requirement for Nol11 in craniofacial development, present the first frog model of a ribosomopathy, and provide further insight into the clinically important relationship between specific ribosome biogenesis proteins and craniofacial cell survival. PMID:25756904

  9. Activation of transcriptional activities of AP-1 and SRE by a new zinc-finger protein ZNF641

    SciTech Connect

    Qi Xingzhu; Li Yongqing; Xiao Jing; Yuan Wuzhou; Yan Yan; Wang Yuequn; Liang Shuyuan; Zhu Chuanbing; Chen Yingduan; Liu Mingyao . E-mail:; Wu Xiushan


    Mitogen-activated protein kinases (MAPKs) are evolutionarily conserved enzymes in cell signal transduction connecting cell-surface receptors to critical regulatory targets within cells and control cell survival, adaptation, and proliferation. Previous studies revealed that zinc-finger proteins are involved in the regulation of the MAPK signaling pathways. Here, we report the identification and characterization of a novel human zinc-finger protein, ZNF641. The cDNA of ZNF641 is 4.9 kb, encoding 438 amino acids in the nucleus. The protein is highly conserved in evolution across different vertebrate species from mouse to human. Northern blot analysis indicates that ZNF641 is expressed in most of the examined human tissues, with a high level in skeletal muscle. Overexpression of pCMV-Tag2B-ZNF641 in the COS-7 cells activates the transcriptional activities of AP-1 and SRE. Deletion analysis indicates that the linker between KRAB box and C{sub 2}H{sub 2}-type zinc-fingers represents the basal activation domain. These results suggest that ZNF641 may be a positive regulator in MAPK-mediated signaling pathways that lead to the activation of AP-1 and SRE.

  10. Structure of the leukemia oncogene LMO2: implications for the assembly of a hematopoietic transcription factor complex.


    El Omari, Kamel; Hoosdally, Sarah J; Tuladhar, Kapil; Karia, Dimple; Vyas, Paresh; Patient, Roger; Porcher, Catherine; Mancini, Erika J


    The LIM only protein 2 (LMO2) is a key regulator of hematopoietic stem cell development whose ectopic expression in T cells leads to the onset of acute lymphoblastic leukemia. Through its LIM domains, LMO2 is thought to function as the scaffold for a DNA-binding transcription regulator complex, including the basic helix-loop-helix proteins SCL/TAL1 and E47, the zinc finger protein GATA-1, and LIM-domain interacting protein LDB1. To understand the role of LMO2 in the formation of this complex and ultimately to dissect its function in normal and aberrant hematopoiesis, we solved the crystal structure of LMO2 in complex with the LID domain of LDB1 at 2.4 Å resolution. We observe a largely unstructured LMO2 kept in register by the LID binding both LIM domains. Comparison of independently determined crystal structures of LMO2 reveals large movements around a conserved hinge between the LIM domains. We demonstrate that such conformational flexibility is necessary for binding of LMO2 to its partner protein SCL/TAL1 in vitro and for the function of this complex in vivo. These results, together with molecular docking and analysis of evolutionarily conserved residues, yield the first structural model of the DNA-binding complex containing LMO2, LDB1, SCL/TAL1, and GATA-1.

  11. DDR complex facilitates global association of RNA polymerase V to promoters and evolutionarily young transposons.


    Zhong, Xuehua; Hale, Christopher J; Law, Julie A; Johnson, Lianna M; Feng, Suhua; Tu, Andy; Jacobsen, Steven E


    The plant-specific DNA-dependent RNA polymerase V (Pol V) evolved from Pol II to function in an RNA-directed DNA methylation pathway. Here, we have identified targets of Pol V in Arabidopsis thaliana on a genome-wide scale using ChIP-seq of NRPE1, the largest catalytic subunit of Pol V. We found that Pol V is enriched at promoters and evolutionarily recent transposons. This localization pattern is highly correlated with Pol V-dependent DNA methylation and small RNA accumulation. We also show that genome-wide chromatin association of Pol V is dependent on all members of a putative chromatin-remodeling complex termed DDR. Our study presents a genome-wide view of Pol V occupancy and sheds light on the mechanistic basis of Pol V localization. Furthermore, these findings suggest a role for Pol V and RNA-directed DNA methylation in genome surveillance and in responding to genome evolution.

  12. Perfect reciprocity is the only evolutionarily stable strategy in the continuous iterated prisoner's dilemma.


    André, Jean-Baptiste; Day, Troy


    Theoretical studies have shown that cooperation tends to evolve when interacting individuals have positively correlated phenotypes. In the present article, we explore the situation where this correlation results from information exchange between social partners, and behavioral flexibility. We consider the game 'continuous iterated prisoner's dilemma'. The level of cooperation expressed by individuals in this game, together with their ability to respond to one another, both evolve as two aspects of their behavioral strategy. The conditions for a strategy to be evolutionarily stable in this game are degenerate, and earlier works were thus unable to find a single ESS. However, a detailed invasion analysis, together with the study of evolution in finite populations, reveals that natural selection favors strategies whereby individuals respond to their opponent's actions in a perfectly mirrored (i.e., correlated) fashion. As a corollary, the overall payoff of social interactions (i.e., the amount of cooperation) is maximized because couples of correlated partners effectively become the units of selection.

  13. A human endogenous long terminal repeat provides a polyadenylation signal to a novel, alternatively spliced transcript in normal placenta.


    Goodchild, N L; Wilkinson, D A; Mager, D L


    We have been investigating the impact that the long terminal repeats (LTRs) of the RTVL-H family of human endogenous retroviral-like elements may have on the expression of adjacent cellular genes. Using a differential hybridization strategy, we have screened a cDNA library from a normal full-term human placenta and have identified two clones containing non-RTVL-H-related cellular sequences that have been polyadenylated within an RTVL-H LTR. One of these clones, cPj-LTR, contains an open reading frame (ORF) of 223 amino acids. Southern analysis indicated that the corresponding gene, termed PLT, is most probably a single multi-exon locus and that related sequences are present in the mouse genome, suggesting that this gene has been evolutionarily conserved. Database searches detected no significant homology to previously published sequences, indicating that PLT is a novel gene. Northern analysis identified several PLT-related transcripts in placental RNA samples, one of which is associated with the LTR. The presence of this PLT-LTR fusion transcript in normal placenta was also confirmed by PCR. Additional hybridization studies with RNAs from various cell lines suggested that the PLT locus is differentially expressed in different cell types. To investigate the structure of the non-LTR-associated PLT-related transcripts, additional clones were isolated from the placental cDNA library. Analysis of these clones suggests that the PLT mRNA undergoes alternative splicing at its 3' end, with polyadenylation within an RTVL-H LTR occurring in one of the resulting transcripts.

  14. Rare, Evolutionarily Unlikely Missense Substitutions in ATM Confer Increased Risk of Breast Cancer

    PubMed Central

    Tavtigian, Sean V.; Oefner, Peter J.; Babikyan, Davit; Hartmann, Anne; Healey, Sue; Le Calvez-Kelm, Florence; Lesueur, Fabienne; Byrnes, Graham B.; Chuang, Shu-Chun; Forey, Nathalie; Feuchtinger, Corinna; Gioia, Lydie; Hall, Janet; Hashibe, Mia; Herte, Barbara; McKay-Chopin, Sandrine; Thomas, Alun; Vallée, Maxime P.; Voegele, Catherine; Webb, Penelope M.; Whiteman, David C.; Sangrajrang, Suleeporn; Hopper, John L.; Southey, Melissa C.; Andrulis, Irene L.; John, Esther M.; Chenevix-Trench, Georgia


    The susceptibility gene for ataxia telangiectasia, ATM, is also an intermediate-risk breast-cancer-susceptibility gene. However, the spectrum and frequency distribution of ATM mutations that confer increased risk of breast cancer have been controversial. To assess the contribution of rare variants in this gene to risk of breast cancer, we pooled data from seven published ATM case-control mutation-screening studies, including a total of 1544 breast cancer cases and 1224 controls, with data from our own mutation screening of an additional 987 breast cancer cases and 1021 controls. Using an in silico missense-substitution analysis that provides a ranking of missense substitutions from evolutionarily most likely to least likely, we carried out analyses of protein-truncating variants, splice-junction variants, and rare missense variants. We found marginal evidence that the combination of ATM protein-truncating and splice-junction variants contribute to breast cancer risk. There was stronger evidence that a subset of rare, evolutionarily unlikely missense substitutions confer increased risk. On the basis of subset analyses, we hypothesize that rare missense substitutions falling in and around the FAT, kinase, and FATC domains of the protein may be disproportionately responsible for that risk and that a subset of these may confer higher risk than do protein-truncating variants. We conclude that a comparison between the graded distributions of missense substitutions in cases versus controls can complement analyses of truncating variants and help identify susceptibility genes and that this approach will aid interpretation of the data emerging from new sequencing technologies. PMID:19781682

  15. Differential Binding of Three Major Human ADAR Isoforms to Coding and Long Non-Coding Transcripts

    PubMed Central

    Galipon, Josephine; Ishii, Rintaro; Suzuki, Yutaka; Tomita, Masaru; Ui-Tei, Kumiko


    RNA editing by deamination of adenosine to inosine is an evolutionarily conserved process involved in many cellular pathways, from alternative splicing to miRNA targeting. In humans, it is carried out by no less than three major adenosine deaminases acting on RNA (ADARs): ADAR1-p150, ADAR1-p110, and ADAR2. However, the first two derive from alternative splicing, so that it is currently impossible to delete ADAR1-p110 without also knocking out ADAR1-p150 expression. Furthermore, the expression levels of ADARs varies wildly among cell types, and no study has systematically explored the effect of each of these isoforms on the cell transcriptome. In this study, RNA immunoprecipitation (RIP)-sequencing on overexpressed ADAR isoforms tagged with green fluorescent protein (GFP) shows that each ADAR is associated with a specific set of differentially expressed genes, and that they each bind to distinct set of RNA targets. Our results show a good overlap with known edited transcripts, establishing RIP-seq as a valid method for the investigation of RNA editing biology. PMID:28208661

  16. Finer delineation and transcript map of the 7q31 locus deleted in myeloid neoplasms.


    Liang, Hong; Castro, Patricia D; Ma, Jin; Nagarajan, Lalitha


    Acquired complete and partial deletions of chromosome 7 are associated with several malignancies. In acute myelogenous leukemia (AML) and preleukemic myelodysplasia (MDS), loss of chromosome 7 portends a poor clinical outcome. The identity of a classical leukemia suppressor gene, however, has been elusive. Previously, we defined a candidate suppressor locus of approximately 6 Mb in the 7q31 interval. Here we report an island of retention of heterozygosity within this interval in a case of monosomy 7. Allelotyping of AML cell lines revealed that ML3 and HEL cells, karyotypically diploid for chromosome 7, are hemizygous for all the 7q31 loci, implicating loss of the wild type and duplication of the remaining chromosome 7. Based on the completed genomic sequence of chromosome 7, we have generated a transcript map of the critical region of loss (between the D7S525 and D7S2502 loci). Notably, a recently characterized tumor suppressor gene, DOCK4, and an evolutionarily conserved zinc finger gene, ZNF277, localize to this interval, head to head, within <0.5 kb of each other. Thus, the reagents generated in this study will be valuable in elucidating the role of loss of 7q31 loci in the pathogenesis of AML.

  17. GRLD-1 regulates cell-wide abundance of glutamate receptor through post-transcriptional regulation

    PubMed Central

    Wang, George J.; Kang, Lijun; Kim, Julie E.; Maro, Géraldine S.; Xu, X. Z. Shawn; Shen, Kang


    AMPA receptors mediate most of the fast postsynaptic response at glutamatergic synapses. The abundance of AMPA receptors in neurons and at postsynaptic membranes is tightly regulated. Changes in synaptic AMPA receptor levels have been proposed to be a key regulatory event in synaptic plasticity and learning and memory. While the local, synapse-specific regulation of AMPA receptors has been intensely studied, the global, cell-wide control is less well understood. Using a forward genetic approach, we identified Glutamate Receptor Level Decreased-1 (GRLD-1), a putative RNA-binding protein that is required for efficient production of GLR-1 in the AVE interneurons in the nematode Caenorhabditis elegans. In grld-1 mutants, GLR-1 levels were drastically reduced. Consistently, both glutamate-induced currents in AVE and glr-1-dependent nose-touch avoidance behavior were defective in grld-1 mutants. We propose that this evolutionarily conserved family of proteins controls the abundance of GLR-1 by regulating glr-1 transcript splicing. PMID:21037582

  18. Novel Genomic and Evolutionary Insight of WRKY Transcription Factors in Plant Lineage

    PubMed Central

    Mohanta, Tapan Kumar; Park, Yong-Hwan; Bae, Hanhong


    The evolutionarily conserved WRKY transcription factor (TF) regulates different aspects of gene expression in plants, and modulates growth, development, as well as biotic and abiotic stress responses. Therefore, understanding the details regarding WRKY TFs is very important. In this study, large-scale genomic analyses of the WRKY TF gene family from 43 plant species were conducted. The results of our study revealed that WRKY TFs could be grouped and specifically classified as those belonging to the monocot or dicot plant lineage. In this study, we identified several novel WRKY TFs. To our knowledge, this is the first report on a revised grouping system of the WRKY TF gene family in plants. The different forms of novel chimeric forms of WRKY TFs in the plant genome might play a crucial role in their evolution. Tissue-specific gene expression analyses in Glycine max and Phaseolus vulgaris showed that WRKY11-1, WRKY11-2 and WRKY11-3 were ubiquitously expressed in all tissue types, and WRKY15-2 was highly expressed in the stem, root, nodule and pod tissues in G. max and P. vulgaris. PMID:27853303

  19. Transcriptional control of stem cell fate by E2Fs and pocket proteins

    PubMed Central

    Julian, Lisa M.; Blais, Alexandre


    E2F transcription factors and their regulatory partners, the pocket proteins (PPs), have emerged as essential regulators of stem cell fate control in a number of lineages. In mammals, this role extends from both pluripotent stem cells to those encompassing all embryonic germ layers, as well as extra-embryonic lineages. E2F/PP-mediated regulation of stem cell decisions is highly evolutionarily conserved, and is likely a pivotal biological mechanism underlying stem cell homeostasis. This has immense implications for organismal development, tissue maintenance, and regeneration. In this article, we discuss the roles of E2F factors and PPs in stem cell populations, focusing on mammalian systems. We discuss emerging findings that position the E2F and PP families as widespread and dynamic epigenetic regulators of cell fate decisions. Additionally, we focus on the ever expanding landscape of E2F/PP target genes, and explore the possibility that E2Fs are not simply regulators of general ‘multi-purpose’ cell fate genes but can execute tissue- and cell type-specific gene regulatory programs. PMID:25972892

  20. Expression of transcription factor grainyhead-like 2 is diminished in cervical cancer

    PubMed Central

    Torres-Reyes, Luis A; Alvarado-Ruiz, Liliana; Piña-Sánchez, Patricia; Martínez-Silva, María G; Ramos-Solano, Moisés; Olimón-Andalón, Vicente; Ortiz-Lazareno, Pablo C; Hernández-Flores, Georgina; Bravo-Cuellar, Alejandro; Aguilar-Lemarroy, Adriana; Jave-Suarez, Luis F


    The transcription factor grainyhead-like 2 (GRHL2) is evolutionarily conserved in many different species, and is involved in morphogenesis, epithelial differentiation, and the control of the epithelial-mesenchymal transition. It has also recently been implicated in carcinogenesis, but its role in this remains controversial. Expression of GRHL2 has not previously been reported in cervical cancer, so the present study aimed to characterize GRHL2 expression in cervical cancer-derived cell lines (CCCLs) and cervical tissues with different grades of lesions. Microarray analysis found that the expression of 58 genes was down-regulated in CCCLs compared to HaCaT cells (non-tumorigenic human epithelial cell line). The expression of eight of these genes was validated by quantitative real-time PCR (qPCR), and GRHL2 was found to be the most down-regulated. Western blot assays corroborated that GRHL2 protein levels were strongly down-regulated in CCCLs. Cervical cells from women without cervical lesions were shown to express GRHL2, while immunohistochemistry found that positivity to GRHL2 decreased in cervical cancer tissues. In conclusion, a loss or strong reduction in GRHL2 expression appears to be a characteristic of cervical cancer, suggesting that GRHL2 down-regulation is a necessary step during cervical carcinogenesis. However, further studies are needed to delineate the role of GRHL2 in cervical cancer and during malignant progression. PMID:25550776

  1. The transcription factor Apontic-like controls diverse colouration pattern in caterpillars.


    Yoda, Shinichi; Yamaguchi, Junichi; Mita, Kazuei; Yamamoto, Kimiko; Banno, Yutaka; Ando, Toshiya; Daimon, Takaaki; Fujiwara, Haruhiko


    Genetic polymorphisms underlie the convergent and divergent evolution of various phenotypes. Diverse colour patterns on caterpillars, which are ecologically important, are good models for understanding the molecular backgrounds of phenotypic diversity. Here we show that a single evolutionarily conserved gene apontic-like (apt-like) encoding for a putative transcription factor accounts for the silkworm p locus, which causes at least 15 different larval markings involved in branch-like markings and eye-spot formation. The expression of apt-like and melanin synthesis genes are upregulated in association with pigmented areas of marking mutants Striped (p(S)) and normal (+(p)) but not in the non-marking allele plain (p). Functional analyses, ectopic expression, RNAi and TALEN, demonstrate that apt-like causes melanin pigmentation in a cell-autonomous manner. These results suggest that variation in p alleles is caused by the differential expression of the gene apt-like which induces targeted elevation of gene expressions in the melanin synthesis pathway.

  2. Functional differentiation of SWI/SNF remodelers in transcription and cell cycle control.


    Moshkin, Yuri M; Mohrmann, Lisette; van Ijcken, Wilfred F J; Verrijzer, C Peter


    Drosophila BAP and PBAP represent two evolutionarily conserved subclasses of SWI/SNF chromatin remodelers. The two complexes share the same core subunits, including the BRM ATPase, but differ in a few signature subunits: OSA defines BAP, whereas Polybromo (PB) and BAP170 specify PBAP. Here, we present a comprehensive structure-function analysis of BAP and PBAP. An RNA interference knockdown survey revealed that the core subunits BRM and MOR are critical for the structural integrity of both complexes. Whole-genome expression profiling suggested that the SWI/SNF core complex is largely dysfunctional in cells. Regulation of the majority of target genes required the signature subunit OSA, PB, or BAP170, suggesting that SWI/SNF remodelers function mostly as holoenzymes. BAP and PBAP execute similar, independent, or antagonistic functions in transcription control and appear to direct mostly distinct biological processes. BAP, but not PBAP, is required for cell cycle progression through mitosis. Because in yeast the PBAP-homologous complex, RSC, controls cell cycle progression, our finding reveals a functional switch during evolution. BAP mediates G(2)/M transition through direct regulation of string/cdc25. Its signature subunit, OSA, is required for directing BAP to the string/cdc25 promoter. Our results suggest that the core subunits play architectural and enzymatic roles but that the signature subunits determine most of the functional specificity of SWI/SNF holoenzymes in general gene control.

  3. Computational evidence for hundreds of non-conserved plant microRNAs

    PubMed Central

    Lindow, Morten; Krogh, Anders


    Background MicroRNAs (miRNA) are small (20–25 nt) non-coding RNA molecules that regulate gene expression through interaction with mRNA in plants and metazoans. A few hundred miRNAs are known or predicted, and most of those are evolutionarily conserved. In general plant miRNA are different from their animal counterpart: most plant miRNAs show near perfect complementarity to their targets. Exploiting this complementarity we have developed a method for identification plant miRNAs that does not rely on phylogenetic conservation. Results Using the presumed targets for the known miRNA as positive controls, we list and filter all segments of the genome of length ~20 that are complementary to a target mRNA-transcript. From the positive control we recover 41 (of 92 possible) of the already known miRNA-genes (representing 14 of 16 families) with only four false positives. Applying the procedure to find possible new miRNAs targeting any annotated mRNA, we predict of 592 new miRNA genes, many of which are not conserved in other plant genomes. A subset of our predicted miRNAs is additionally supported by having more than one target that are not homologues. Conclusion These results indicate that it is possible to reliably predict miRNA-genes without using genome comparisons. Furthermore it suggests that the number of plant miRNAs have been underestimated and points to the existence of recently evolved miRNAs in Arabidopsis. PMID:16159385

  4. Conservation Laws

    NASA Astrophysics Data System (ADS)

    Dewitt, Bryce; Christensen, Steven M.

    In the case of the free particle, we interpreted various components of the energy-momentum-stress density as fluxes of energy and momentum. This interpretation can obviously be extended also to particle ensembles and gases. When we speak of fluxes we usually think of quantities that are conserved. In special relativity, energy and momentum are conserved. In general relativity, they are no longer generally conserved, at least if we do not include the energy and momentum of the gravitational field itself. Nevertheless, their densities and fluxes satisfy a covariant generalization of a true conservation law, which is quite easy to obtain.

  5. Transcription-coupled changes to chromatin underpin gene silencing by transcriptional interference.


    Ard, Ryan; Allshire, Robin C


    Long non-coding RNA (lncRNA)