Science.gov

Sample records for evolutionarily conserved transcriptional

  1. An evolutionarily conserved RNase-based mechanism for repression of transcriptional positive autoregulation.

    PubMed

    Wurtmann, Elisabeth J; Ratushny, Alexander V; Pan, Min; Beer, Karlyn D; Aitchison, John D; Baliga, Nitin S

    2014-04-01

    It is known that environmental context influences the degree of regulation at the transcriptional and post-transcriptional levels. However, the principles governing the differential usage and interplay of regulation at these two levels are not clear. Here, we show that the integration of transcriptional and post-transcriptional regulatory mechanisms in a characteristic network motif drives efficient environment-dependent state transitions. Through phenotypic screening, systems analysis, and rigorous experimental validation, we discovered an RNase (VNG2099C) in Halobacterium salinarum that is transcriptionally co-regulated with genes of the aerobic physiologic state but acts on transcripts of the anaerobic state. Through modelling and experimentation we show that this arrangement generates an efficient state-transition switch, within which RNase-repression of a transcriptional positive autoregulation (RPAR) loop is critical for shutting down ATP-consuming active potassium uptake to conserve energy required for salinity adaptation under aerobic, high potassium, or dark conditions. Subsequently, we discovered that many Escherichia coli operons with energy-associated functions are also putatively controlled by RPAR indicating that this network motif may have evolved independently in phylogenetically distant organisms. Thus, our data suggest that interplay of transcriptional and post-transcriptional regulation in the RPAR motif is a generalized principle for efficient environment-dependent state transitions across prokaryotes. © 2014 John Wiley & Sons Ltd.

  2. The evolutionarily conserved transcription factor PRDM12 controls sensory neuron development and pain perception.

    PubMed

    Nagy, Vanja; Cole, Tiffany; Van Campenhout, Claude; Khoung, Thang M; Leung, Calvin; Vermeiren, Simon; Novatchkova, Maria; Wenzel, Daniel; Cikes, Domagoj; Polyansky, Anton A; Kozieradzki, Ivona; Meixner, Arabella; Bellefroid, Eric J; Neely, G Gregory; Penninger, Josef M

    2015-01-01

    PR homology domain-containing member 12 (PRDM12) belongs to a family of conserved transcription factors implicated in cell fate decisions. Here we show that PRDM12 is a key regulator of sensory neuronal specification in Xenopus. Modeling of human PRDM12 mutations that cause hereditary sensory and autonomic neuropathy (HSAN) revealed remarkable conservation of the mutated residues in evolution. Expression of wild-type human PRDM12 in Xenopus induced the expression of sensory neuronal markers, which was reduced using various human PRDM12 mutants. In Drosophila, we identified Hamlet as the functional PRDM12 homolog that controls nociceptive behavior in sensory neurons. Furthermore, expression analysis of human patient fibroblasts with PRDM12 mutations uncovered possible downstream target genes. Knockdown of several of these target genes including thyrotropin-releasing hormone degrading enzyme (TRHDE) in Drosophila sensory neurons resulted in altered cellular morphology and impaired nociception. These data show that PRDM12 and its functional fly homolog Hamlet are evolutionary conserved master regulators of sensory neuronal specification and play a critical role in pain perception. Our data also uncover novel pathways in multiple species that regulate evolutionary conserved nociception.

  3. Evolutionarily-conserved role of the NF-kappaB transcription factor in neural plasticity and memory.

    PubMed

    Romano, Arturo; Freudenthal, Ramiro; Merlo, Emiliano; Routtenberg, Aryeh

    2006-09-01

    NF-kappaB is an evolutionarily conserved family of transcription factors (TFs) critically involved in basic cellular mechanisms of the immune response, inflammation, development and apoptosis. In spite of the fact that it is expressed in the central nervous system, particularly in areas involved in memory processing, and is activated by signals such as glutamate and Ca2+, its role in neural plasticity and memory has only recently become apparent. A surprising feature of this molecule is its presence within the synapse. An increasing number of reports have called attention to the role of this TF in processes that require long-term regulation of the synaptic function underlying memory and neural plasticity. Here we review the evidence regarding a dual role for NF-kappaB, as both a signalling molecule after its activation at the synapse and a transcriptional regulator upon reaching the nucleus. The specific role of this signal, as well as the general transcriptional mechanism, in the process of memory formation is discussed. Converging lines of evidence summarized here point to a pivotal role for the NF-kappaB transcription factor as a direct signalling mechanism in the regulation of gene expression involved in long-term memory.

  4. Transcriptional co-regulation of evolutionarily conserved microRNA/cone opsin gene pairs: implications for photoreceptor subtype specification.

    PubMed

    Daido, Yutaka; Hamanishi, Sakurako; Kusakabe, Takehiro G

    2014-08-01

    The vertebrate retina contains two types of photoreceptor cells, rods and cones, which use distinct types of opsins and phototransduction proteins. Cones can be further divided into several subtypes with differing wavelength sensitivity and morphology. Although photoreceptor development has been extensively studied in a variety of vertebrate species, the mechanism by which photoreceptor subtypes are established is still largely unknown. Here we report two microRNAs (miRNAs), miR-726 and miR-729, which are potentially involved in photoreceptor subtype specification. In the medaka Oryzias latipes, the genes encoding miR-726 and miR-729 are located upstream of the red-sensitive opsin gene LWS-A and the UV-sensitive opsin gene SWS1, respectively, and are transcribed in the opposite direction from the respective opsin genes. The miR-726/LWS pair is conserved between teleosts and tetrapods, and the miR-729/SWS1 pair is conserved among teleosts. in situ hybridization analyses and fluorescence reporter assays suggest that these miRNAs are co-expressed with the respective opsins in specific cone subtypes. Potential targets of miR-726 and miR-729 predicted in silico include several transcription factors that regulate photoreceptor development. Functional analyses of cis-regulatory sequences in vivo suggest that transcription of the paired microRNA and opsin genes is co-regulated by common cis-regulatory modules. We propose an evolutionarily conserved mechanism that controls photoreceptor subtype identity through coupling between transcriptional and post-transcriptional regulations. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Transcriptional control of photosynthesis genes: the evolutionarily conserved regulatory mechanism in plastid genome function.

    PubMed

    Puthiyaveetil, Sujith; Ibrahim, Iskander M; Jelicić, Branka; Tomasić, Ana; Fulgosi, Hrvoje; Allen, John F

    2010-01-01

    Chloroplast sensor kinase (CSK) is a bacterial-type sensor histidine kinase found in chloroplasts--photosynthetic plastids--in eukaryotic plants and algae. Using a yeast two-hybrid screen, we demonstrate recognition and interactions between: CSK, plastid transcription kinase (PTK), and a bacterial-type RNA polymerase sigma factor-1 (SIG-1). CSK interacts with itself, with SIG-1, and with PTK. PTK also interacts directly with SIG-1. PTK has previously been shown to catalyze phosphorylation of plastid-encoded RNA polymerase (PEP), suppressing plastid transcription nonspecifically. Phospho-PTK is inactive as a PEP kinase. Here, we propose that phospho-CSK acts as a PTK kinase, releasing PTK repression of chloroplast transcription, while CSK also acts as a SIG-1 kinase, blocking transcription specifically at the gene promoter of chloroplast photosystem I. Oxidation of the photosynthetic electron carrier plastoquinone triggers phosphorylation of CSK, inducing chloroplast photosystem II while suppressing photosystem I. CSK places photosystem gene transcription under the control of photosynthetic electron transport. This redox signaling pathway has its origin in cyanobacteria, photosynthetic prokaryotes from which chloroplasts evolved. The persistence of this mechanism in cytoplasmic organelles of photosynthetic eukaryotes is in precise agreement with the CoRR hypothesis for the function of organellar genomes: the plastid genome and its primary gene products are Co-located for Redox Regulation. Genes are retained in plastids primarily in order for their expression to be subject to this rapid and robust redox regulatory transcriptional control mechanism, whereas plastid genes also encode genetic system components, such as some ribosomal proteins and RNAs, that exist in order to support this primary, redox regulatory control of photosynthesis genes. Plastid genome function permits adaptation of the photosynthetic apparatus to changing environmental conditions of light

  6. In Silico Analysis of Gene Expression Network Components Underlying Pigmentation Phenotypes in the Python Identified Evolutionarily Conserved Clusters of Transcription Factor Binding Sites

    PubMed Central

    2016-01-01

    Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from Python bivittatus. Our results provide insight into pigment phenotypes in pythons. PMID:27698666

  7. MOF as an evolutionarily conserved histone crotonyltransferase and transcriptional activation by histone acetyltransferase-deficient and crotonyltransferase-competent CBP/p300

    PubMed Central

    Liu, Xiaoguang; Wei, Wei; Liu, Yuting; Yang, Xueli; Wu, Jian; Zhang, Yang; Zhang, Qiao; Shi, Tieliu; Du, James X; Zhao, Yingming; Lei, Ming; Zhou, Jin-Qiu; Li, Jiwen; Wong, Jiemin

    2017-01-01

    Recent studies indicate that histones are subjected to various types of acylation including acetylation, propionylation and crotonylation. CBP and p300 have been shown to catalyze multiple types of acylation but are not conserved in evolution, raising the question as to the existence of other enzymes for histone acylation and the functional relationship between well-characterized acetylation and other types of acylation. In this study, we focus on enzymes catalyzing histone crotonylation and demonstrate that among the known histone acetyltransferases, MOF, in addition to CBP and p300, also possesses histone crotonyltransferase (HCT) activity and this activity is conserved in evolution. We provide evidence that CBP and p300 are the major HCTs in mammalian cells. Furthermore, we have generated novel CBP/p300 mutants with deficient histone acetyltransferase but competent HCT activity. These CBP/p300 mutants can substitute the endogenous CBP/p300 to enhance transcriptional activation in the cell, which correlates with enhanced promoter crotonylation and recruitment of DPF2, a selective reader for crotonylated histones. Taken together, we have identified MOF as an evolutionarily conserved HCT and provide first cellular evidence that CBP/p300 can facilitate transcriptional activation through histone acylation other than acetylation, thus supporting an emerging role for the non-acetylation type of histone acylation in transcription and possibly other chromatin-based processes. PMID:28580166

  8. Evolutionarily conserved regulation of TOR signalling.

    PubMed

    Takahara, Terunao; Maeda, Tatsuya

    2013-07-01

    The target of rapamycin (TOR) is an evolutionarily conserved protein kinase that regulates cell growth in response to various environmental as well as intracellular cues through the formation of 2 distinct TOR complexes (TORC), TORC1 and TORC2. Dysregulation of TORC1 and TORC2 activity is closely associated with various diseases, including diabetes, cancer and neurodegenerative disorders. Over the past few years, new regulatory mechanisms of TORC1 and TORC2 activity have been elucidated. Furthermore, recent advances in the study of TOR inhibitors have revealed previously unrecognized cellular functions of TORC1. In this review, we briefly summarize the current understanding of the evolutionarily conserved TOR signalling from upstream regulators to downstream events.

  9. Redundant ERF-VII Transcription Factors Bind to an Evolutionarily Conserved cis-Motif to Regulate Hypoxia-Responsive Gene Expression in Arabidopsis

    PubMed Central

    Gasch, Philipp; Fundinger, Moritz; Müller, Jana T.; Lee, Travis; Mustroph, Angelika

    2016-01-01

    The response of Arabidopsis thaliana to low-oxygen stress (hypoxia), such as during shoot submergence or root waterlogging, includes increasing the levels of ∼50 hypoxia-responsive gene transcripts, many of which encode enzymes associated with anaerobic metabolism. Upregulation of over half of these mRNAs involves stabilization of five group VII ethylene response factor (ERF-VII) transcription factors, which are routinely degraded via the N-end rule pathway of proteolysis in an oxygen- and nitric oxide-dependent manner. Despite their importance, neither the quantitative contribution of individual ERF-VIIs nor the cis-regulatory elements they govern are well understood. Here, using single- and double-null mutants, the constitutively synthesized ERF-VIIs RELATED TO APETALA2.2 (RAP2.2) and RAP2.12 are shown to act redundantly as principle activators of hypoxia-responsive genes; constitutively expressed RAP2.3 contributes to this redundancy, whereas the hypoxia-induced HYPOXIA RESPONSIVE ERF1 (HRE1) and HRE2 play minor roles. An evolutionarily conserved 12-bp cis-regulatory motif that binds to and is sufficient for activation by RAP2.2 and RAP2.12 is identified through a comparative phylogenetic motif search, promoter dissection, yeast one-hybrid assays, and chromatin immunopurification. This motif, designated the hypoxia-responsive promoter element, is enriched in promoters of hypoxia-responsive genes in multiple species. PMID:26668304

  10. An evolutionarily conserved DNA architecture determines target specificity of the TWIST family bHLH transcription factors

    PubMed Central

    Chang, Andrew T.; Liu, Yuanjie; Ayyanathan, Kasirajan; Benner, Chris; Jiang, Yike; Prokop, Jeremy W.; Paz, Helicia; Wang, Dong; Li, Hai-Ri; Fu, Xiang-Dong

    2015-01-01

    Basic helix–loop–helix (bHLH) transcription factors recognize the canonical E-box (CANNTG) to regulate gene transcription; however, given the prevalence of E-boxes in a genome, it has been puzzling how individual bHLH proteins selectively recognize E-box sequences on their targets. TWIST is a bHLH transcription factor that promotes epithelial–mesenchymal transition (EMT) during development and tumor metastasis. High-resolution mapping of TWIST occupancy in human and Drosophila genomes reveals that TWIST, but not other bHLH proteins, recognizes a unique double E-box motif with two E-boxes spaced preferentially by 5 nucleotides. Using molecular modeling and binding kinetic analyses, we found that the strict spatial configuration in the double E-box motif aligns two TWIST–E47 dimers on the same face of DNA, thus providing a high-affinity site for a highly stable intramolecular tetramer. Biochemical analyses showed that the WR domain of TWIST dimerizes to mediate tetramer formation, which is functionally required for TWIST-induced EMT. These results uncover a novel mechanism for a bHLH transcription factor to recognize a unique spatial configuration of E-boxes to achieve target specificity. The WR–WR domain interaction uncovered here sets an example of target gene specificity of a bHLH protein being controlled allosterically by a domain outside of the bHLH region. PMID:25762439

  11. The Populus ARBORKNOX1 homeodomain transcription factor regulates woody growth through binding to evolutionarily conserved target genes of diverse function

    Treesearch

    Lijun Liu; Matthew S. Zinkgraf; H. Earl Petzold; Eric P. Beers; Vladimir Filkov; Andrew Groover

    2014-01-01

    The class I KNOX homeodomain transcription factor ARBORKNOX1 (ARK1) is a key regulator of vascular cambium maintenance and cell differentiation in Populus. Currently, basic information is lacking concerning the distribution, functional characteristics, and evolution of ARK1 binding in the Populus genome.

  12. An evolutionarily conserved Myostatin proximal promoter/enhancer confers basal levels of transcription and spatial specificity in vivo.

    PubMed

    Grade, Carla Vermeulen Carvalho; Salerno, Mônica Senna; Schubert, Frank R; Dietrich, Susanne; Alvares, Lúcia Elvira

    2009-10-01

    Myostatin (Mstn) is a negative regulator of skeletal muscle mass, and Mstn mutations are responsible for the double muscling phenotype observed in many animal species. Moreover, Mstn is a positive regulator of adult muscle stem cell (satellite cell) quiescence, and hence, Mstn is being targeted in therapeutic approaches to muscle diseases. In order to better understand the mechanisms underlying Mstn regulation, we searched for the gene's proximal enhancer and promoter elements, using an evolutionary approach. We identified a 260-bp-long, evolutionary conserved region upstream of tetrapod Mstn and teleost mstn b genes. This region contains binding sites for TATA binding protein, Meis1, NF-Y, and for CREB family members, suggesting the involvement of cAMP in Myostatin regulation. The conserved fragment was able to drive reporter gene expression in C2C12 cells in vitro and in chicken somites in vivo; both normally express Mstn. In contrast, the reporter construct remained silent in the avian neural tube that normally does not express Mstn. This suggests that the identified element serves as a minimal promoter, harboring some spatial specificity. Finally, using bioinformatic approaches, we identified additional genes in the human genome associated with sequences similar to the Mstn proximal promoter/enhancer. Among them are genes important for myogenesis. This suggests that Mstn and these genes may form a synexpression group, regulated by a common signaling pathway.

  13. Evolutionarily conserved sequences on human chromosome 21

    SciTech Connect

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila

    2001-09-01

    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  14. The transcription factor HNF1α induces expression of angiotensin-converting enzyme 2 (ACE2) in pancreatic islets from evolutionarily conserved promoter motifs.

    PubMed

    Pedersen, Kim Brint; Chhabra, Kavaljit H; Nguyen, Van K; Xia, Huijing; Lazartigues, Eric

    2013-11-01

    Pancreatic angiotensin-converting enzyme 2 (ACE2) has previously been shown to be critical for maintaining glycemia and β-cell function. Efforts to maintain or increase ACE2 expression in pancreatic β-cells might therefore have therapeutic potential for treating diabetes. In our study, we investigated the transcriptional role of hepatocyte nuclear factor 1α (HNF1α) and hepatocyte nuclear factor 1β (HNF1β) in induction of ACE2 expression in insulin-secreting cells. A deficient allele of HNF1α or HNF1β causes maturity-onset diabetes of the young (MODY) types 3 and 5, respectively, in humans. We found that ACE2 is primarily transcribed from the proximal part of the ACE2 promoter in the pancreas. In the proximal part of the human ACE2 promoter, we further identified three functional HNF1 binding sites, as they have binding affinity for HNF1α and HNF1β and are required for induction of promoter activity by HNF1β in insulinoma cells. These three sites are well-conserved among mammalian species. Both HNF1α and HNF1β induce expression of ACE2 mRNA and lead to elevated levels of ACE2 protein and ACE2 enzymatic activity in insulinoma cells. Furthermore, HNF1α dose-dependently increases ACE2 expression in primary pancreatic islet cells. We conclude that HNF1α can induce the expression of ACE2 in pancreatic islet cells via evolutionarily conserved HNF1 binding sites in the ACE2 promoter. Potential therapeutics aimed at counteracting functional HNF1α depletion in diabetes and MODY3 will thus have ACE2 induction in pancreatic islets as a likely beneficial effect.

  15. An evolutionarily conserved pathway controls proteasome homeostasis

    PubMed Central

    Rousseau, Adrien; Bertolotti, Anne

    2016-01-01

    The proteasome is essential for the selective degradation of most cellular proteins but how cells maintain adequate amounts of proteasome is unclear. Here we found an evolutionarily conserved signalling pathway controlling proteasome homeostasis. Central to this pathway is TORC1 whose inhibition induced all known yeast 19S regulatory particle assembly-chaperones (RACs) as well as proteasome subunits. Downstream of TORC1 inhibition, the yeast mitogen-activated protein kinase, Mpk1, ensured that the supply of RACs and proteasome subunits increased under challenging conditions to maintain proteasomal degradation and cell viability. This adaptive pathway was evolutionarily conserved, with mTOR and Erk5 controlling the levels of the four mammalian RACs and proteasome abundance. Thus, the central growth and stress controllers, TORC1 and Mpk1/Erk5, endow cells with a rapid and vital adaptive response to adjust proteasome abundance to the rising needs. Enhancing this pathway may be a useful therapeutic approach for diseases resulting from impaired proteasomal degradation. PMID:27462806

  16. An evolutionarily conserved pathway controls proteasome homeostasis.

    PubMed

    Rousseau, Adrien; Bertolotti, Anne

    2016-08-11

    The proteasome is essential for the selective degradation of most cellular proteins, but how cells maintain adequate amounts of proteasome is unclear. Here we show that there is an evolutionarily conserved signalling pathway controlling proteasome homeostasis. Central to this pathway is TORC1, the inhibition of which induced all known yeast 19S regulatory particle assembly-chaperones (RACs), as well as proteasome subunits. Downstream of TORC1 inhibition, the yeast mitogen-activated protein kinase, Mpk1, acts to increase the supply of RACs and proteasome subunits under challenging conditions in order to maintain proteasomal degradation and cell viability. This adaptive pathway was evolutionarily conserved, with mTOR and ERK5 controlling the levels of the four mammalian RACs and proteasome abundance. Thus, the central growth and stress controllers, TORC1 and Mpk1/ERK5, endow cells with a rapid and vital adaptive response to adjust proteasome abundance in response to the rising needs of cells. Enhancing this pathway may be a useful therapeutic approach for diseases resulting from impaired proteasomal degradation.

  17. Evolutionarily conserved genes preferentially accumulate introns

    PubMed Central

    Carmel, Liran; Rogozin, Igor B.; Wolf, Yuri I.; Koonin, Eugene V.

    2007-01-01

    Introns that interrupt eukaryotic protein-coding sequences are generally thought to be nonfunctional. However, for reasons still poorly understood, positions of many introns are highly conserved in evolution. Previous reconstructions of intron gain and loss events during eukaryotic evolution used a variety of simplified evolutionary models that yielded contradicting conclusions and are not suited to reveal some of the key underlying processes. We combine a comprehensive probabilistic model and an extended data set, including 391 conserved genes from 19 eukaryotes, to uncover previously unnoticed aspects of intron evolution—in particular, to assign intron gain and loss rates to individual genes. The rates of intron gain and loss in a gene show moderate positive correlation. A gene’s intron gain rate shows a highly significant negative correlation with the coding-sequence evolution rate; intron loss rate also significantly, but positively, correlates with the sequence evolution rate. Correlations of the opposite signs, albeit less significant ones, are observed between intron gain and loss rates and gene expression level. It is proposed that intron evolution includes a neutral component, which is manifest in the positive correlation between the gain and loss rates and a selection-driven component as reflected in the links between intron gain and loss and sequence evolution. The increased intron gain and decreased intron loss in evolutionarily conserved genes indicate that intron insertion often might be adaptive, whereas some of the intron losses might be deleterious. This apparent functional importance of introns is likely to be due, at least in part, to their multiple effects on gene expression. PMID:17495009

  18. Evolutionarily conserved regulation of hypocretin neuron specification by Lhx9.

    PubMed

    Liu, Justin; Merkle, Florian T; Gandhi, Avni V; Gagnon, James A; Woods, Ian G; Chiu, Cindy N; Shimogori, Tomomi; Schier, Alexander F; Prober, David A

    2015-03-15

    Loss of neurons that express the neuropeptide hypocretin (Hcrt) has been implicated in narcolepsy, a debilitating disorder characterized by excessive daytime sleepiness and cataplexy. Cell replacement therapy, using Hcrt-expressing neurons generated in vitro, is a potentially useful therapeutic approach, but factors sufficient to specify Hcrt neurons are unknown. Using zebrafish as a high-throughput system to screen for factors that can specify Hcrt neurons in vivo, we identified the LIM homeobox transcription factor Lhx9 as necessary and sufficient to specify Hcrt neurons. We found that Lhx9 can directly induce hcrt expression and we identified two potential Lhx9 binding sites in the zebrafish hcrt promoter. Akin to its function in zebrafish, we found that Lhx9 is sufficient to specify Hcrt-expressing neurons in the developing mouse hypothalamus. Our results elucidate an evolutionarily conserved role for Lhx9 in Hcrt neuron specification that improves our understanding of Hcrt neuron development.

  19. The Evolutionarily Conserved C-terminal Domains in the Mammalian Retinoblastoma Tumor Suppressor Family Serve as Dual Regulators of Protein Stability and Transcriptional Potency*

    PubMed Central

    Sengupta, Satyaki; Lingnurkar, Raj; Carey, Timothy S.; Pomaville, Monica; Kar, Parimal; Feig, Michael; Wilson, Catherine A.; Knott, Jason G.; Arnosti, David N.; Henry, R. William

    2015-01-01

    The retinoblastoma (RB) tumor suppressor and related family of proteins play critical roles in development through their regulation of genes involved in cell fate. Multiple regulatory pathways impact RB function, including the ubiquitin-proteasome system with deregulated RB destruction frequently associated with pathogenesis. With the current study we explored the mechanisms connecting proteasome-mediated turnover of the RB family to the regulation of repressor activity. We find that steady state levels of all RB family members, RB, p107, and p130, were diminished during embryonic stem cell differentiation concomitant with their target gene acquisition. Proteasome-dependent turnover of the RB family is mediated by distinct and autonomously acting instability elements (IE) located in their C-terminal regulatory domains in a process that is sensitive to cyclin-dependent kinase (CDK4) perturbation. The IE regions include motifs that contribute to E2F-DP transcription factor interaction, and consistently, p107 and p130 repressor potency was reduced by IE deletion. The juxtaposition of degron sequences and E2F interaction motifs appears to be a conserved feature across the RB family, suggesting the potential for repressor ubiquitination and specific target gene regulation. These findings establish a mechanistic link between regulation of RB family repressor potency and the ubiquitin-proteasome system. PMID:25903125

  20. The murine IL-2 promoter contains distal regulatory elements responsive to the Ah receptor, a member of the evolutionarily conserved bHLH-PAS transcription factor family.

    PubMed

    Jeon, M S; Esser, C

    2000-12-15

    Signaling through the TCR and costimulatory signals primarily control transcription of the IL-2 gene in naive T cells. The minimal promoter necessary for this expression lies proximal, between -300 and the transcription start site. We had previously shown that activation of the arylhydrocarbon receptor (AHR), a member of the bHLH-PAS family of transcription factors, leads to increased mRNA expression of IL-2 in murine fetal thymocytes. The AHR is abundant in the thymus and may play a role for the development of the immune system. Moreover, its overactivation by chemicals such as dioxins leads to immunosuppression and thymic involution. Binding motifs for the liganded AHR can be identified in the distal region -1300 to -800 of the mouse IL-2 promoter. We show here that these DNA motifs, the so-called dioxin response elements, after binding to the liganded AHR are sufficient to transactivate luciferase expression in a reporter gene system. The IL-2 gene can be induced by the AHR also in thymocytes in vivo after injection of 2,3,7, 8-tetrachlorodibenzo-p-dioxin, a potent ligand of the AHR. The AHR mediates the IL-2 induction as shown with AHR-deficient mice. However, in spleen cells in vitro costimulation via the TCR is necessary for optimal IL-2 gene induction. Thus, the IL-2 promoter region contains novel distal regulatory elements that can be addressed by the AHR to induce IL-2 and can cooperate with the proximal promoter in this.

  1. An Evolutionarily Conserved Plant RKD Factor Controls Germ Cell Differentiation.

    PubMed

    Koi, Satoshi; Hisanaga, Tetsuya; Sato, Katsutoshi; Shimamura, Masaki; Yamato, Katsuyuki T; Ishizaki, Kimitsune; Kohchi, Takayuki; Nakajima, Keiji

    2016-07-11

    In contrast to animals, in which the germ cell lineage is established during embryogenesis, plant germ cells are generated in reproductive organs via reprogramming of somatic cells. The factors that control germ cell differentiation and reprogramming in plants are poorly understood. Members of the RKD subfamily of plant-specific RWP-RK transcription factors have been implicated in egg cell formation in Arabidopsis based on their expression patterns and ability to cause an egg-like transcriptome upon ectopic expression [1]; however, genetic evidence of their involvement is lacking, due to possible genetic redundancy, haploid lethality, and the technical difficulty of analyzing egg cell differentiation in angiosperms. Here we analyzed the factors that govern germ cell formation in the liverwort Marchantia polymorpha. This recently revived model bryophyte has several characteristics that make it ideal for studies of germ cell formation, such as low levels of genetic redundancy, readily accessible germ cells, and the ability to propagate asexually via gemma formation [2, 3]. Our analyses revealed that MpRKD, a single RWP-RK factor closely related to angiosperm RKDs, is preferentially expressed in developing eggs and sperm precursors in M. polymorpha. Targeted disruption of MpRKD had no effect on the gross morphology of the vegetative and reproductive organs but led to striking defects in egg and sperm cell differentiation, demonstrating that MpRKD is an essential regulator of germ cell differentiation. Together with previous findings [1, 4-6], our results suggest that RKD factors are evolutionarily conserved regulators of germ cell differentiation in land plants. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  3. Aligning science and policy to achieve evolutionarily enlightened conservation.

    PubMed

    Cook, Carly N; Sgrò, Carla M

    2017-06-01

    There is increasing recognition among conservation scientists that long-term conservation outcomes could be improved through better integration of evolutionary theory into management practices. Despite concerns that the importance of key concepts emerging from evolutionary theory (i.e., evolutionary principles and processes) are not being recognized by managers, there has been little effort to determine the level of integration of evolutionary theory into conservation policy and practice. We assessed conservation policy at 3 scales (international, national, and provincial) on 3 continents to quantify the degree to which key evolutionary concepts, such as genetic diversity and gene flow, are being incorporated into conservation practice. We also evaluated the availability of clear guidance within the applied evolutionary biology literature as to how managers can change their management practices to achieve better conservation outcomes. Despite widespread recognition of the importance of maintaining genetic diversity, conservation policies provide little guidance about how this can be achieved in practice and other relevant evolutionary concepts, such as inbreeding depression, are mentioned rarely. In some cases the poor integration of evolutionary concepts into management reflects a lack of decision-support tools in the literature. Where these tools are available, such as risk-assessment frameworks, they are not being adopted by conservation policy makers, suggesting that the availability of a strong evidence base is not the only barrier to evolutionarily enlightened management. We believe there is a clear need for more engagement by evolutionary biologists with policy makers to develop practical guidelines that will help managers make changes to conservation practice. There is also an urgent need for more research to better understand the barriers to and opportunities for incorporating evolutionary theory into conservation practice. © 2016 Society for Conservation

  4. Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved

    PubMed Central

    Meng, Hao; Agbagwa, Ikechukwu O.; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

    2016-01-01

    DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history. PMID:26760298

  5. Exploitation of evolutionarily conserved amoeba and mammalian processes by Legionella.

    PubMed

    Al-Quadan, Tasneem; Price, Christopher T; Abu Kwaik, Yousef

    2012-06-01

    Legionella pneumophila proliferates within various protists and metazoan cells, where a cadre of ∼300 effectors is injected into the host cell by the defect in organelle trafficking/intracellular multiplication (Dot/Icm) type IVB translocation system. Interkingdom horizontal gene transfer of genes of protists and their subsequent convergent evolution to become translocated effectors has probably enabled L. pneumophila to adapt to the intracellular life within various protists and metazoan cells through exploitation of evolutionarily eukaryotic processes, such as endoplasmic reticulum-to-Golgi vesicle traffic, phosphoinositol metabolism, AMPylation, deAMPylation, prenylation, polyubiquitination, proteasomal degradation and cytosolic amino- and oligo-peptidases. This is highlighted by the ankyrin B (AnkB) F-box effector that exploits multiple conserved eukaryotic machineries to generate high levels of free amino acids as sources of carbon and energy essential for intracellular proliferation in protists and metazoan cells and for manifestation of pulmonary disease in mammals.

  6. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

    PubMed

    Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

    2016-08-19

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Localization of an evolutionarily conserved protein proton pyrophosphatase in evolutionarily distant plants oryza sativa and physcomitrella patens

    USDA-ARS?s Scientific Manuscript database

    Proton Pyrophosphatase (H+-PPase) is a highly evolutionarily conserved protein that is prevalent in the plant kingdom. One of the salient features of H+-PPase expression pattern, at least in vascular plants like Arabidopsis, is its conspicuous localization in both actively dividing cells and the phl...

  8. Evolutionarily Conserved, Multitasking TRP Channels: Lessons from Worms and Flies

    PubMed Central

    Venkatachalam, Kartik; Luo, Junjie; Montell, Craig

    2015-01-01

    The Transient Receptor Potential (TRP) channel family is comprised of a large group of cation-permeable channels, which display an extraordinary diversity of roles in sensory signaling. TRPs allow animals to detect chemicals, mechanical force, light, and changes in temperature. Consequently, these channels control a plethora of animal behaviors. Moreover, their functions are not limited to the classical senses, as they are cellular sensors, which are critical for ionic homeostasis and metabolism. Two genetically tractable invertebrate model organisms, Caenorhabditis elegans and Drosophila melanogaster, have led the way in revealing a wide array of sensory roles and behaviors that depend on TRP channels. Two overriding themes have emerged from these studies. First, TRPs are multitasking proteins, and second, many functions and modes of activation of these channels are evolutionarily conserved, including some that were formerly thought to be unique to invertebrates, such as phototransduction. Thus, worms and flies offer the potential to decipher roles for mammalian TRPs, which would otherwise not be suspected. PMID:24961975

  9. Cilium-independent regulation of Gli protein function by Sufu in Hedgehog signaling is evolutionarily conserved

    PubMed Central

    Chen, Miao-Hsueh; Wilson, Christopher W.; Li, Ya-Jun; Law, Kelvin King Lo; Lu, Chi-Sheng; Gacayan, Rhodora; Zhang, Xiaoyun; Hui, Chi-chung; Chuang, Pao-Tien

    2009-01-01

    A central question in Hedgehog (Hh) signaling is how evolutionarily conserved components of the pathway might use the primary cilium in mammals but not fly. We focus on Suppressor of fused (Sufu), a major Hh regulator in mammals, and reveal that Sufu controls protein levels of full-length Gli transcription factors, thus affecting the production of Gli activators and repressors essential for graded Hh responses. Surprisingly, despite ciliary localization of most Hh pathway components, regulation of Gli protein levels by Sufu is cilium-independent. We propose that Sufu-dependent processes in Hh signaling are evolutionarily conserved. Consistent with this, Sufu regulates Gli protein levels by antagonizing the activity of Spop, a conserved Gli-degrading factor. Furthermore, addition of zebrafish or fly Sufu restores Gli protein function in Sufu-deficient mammalian cells. In contrast, fly Smo is unable to translocate to the primary cilium and activate the mammalian Hh pathway. We also uncover a novel positive role of Sufu in regulating Hh signaling, resulting from its control of both Gli activator and repressor function. Taken together, these studies delineate important aspects of cilium-dependent and cilium-independent Hh signal transduction and provide significant mechanistic insight into Hh signaling in diverse species. PMID:19684112

  10. Comparison of splice sites reveals that long noncoding RNAs are evolutionarily well conserved

    PubMed Central

    Nitsche, Anne; Rose, Dominic; Fasold, Mario; Reiche, Kristin; Stadler, Peter F.

    2015-01-01

    Large-scale RNA sequencing has revealed a large number of long mRNA-like transcripts (lncRNAs) that do not code for proteins. The evolutionary history of these lncRNAs has been notoriously hard to study systematically due to their low level of sequence conservation that precludes comprehensive homology-based surveys and makes them nearly impossible to align. An increasing number of special cases, however, has been shown to be at least as old as the vertebrate lineage. Here we use the conservation of splice sites to trace the evolution of lncRNAs. We show that >85% of the human GENCODE lncRNAs were already present at the divergence of placental mammals and many hundreds of these RNAs date back even further. Nevertheless, we observe a fast turnover of intron/exon structures. We conclude that lncRNA genes are evolutionary ancient components of vertebrate genomes that show an unexpected and unprecedented evolutionary plasticity. We offer a public web service (http://splicemap.bioinf.uni-leipzig.de) that allows to retrieve sets of orthologous splice sites and to produce overview maps of evolutionarily conserved splice sites for visualization and further analysis. An electronic supplement containing the ncRNA data sets used in this study is available at http://www.bioinf.uni-leipzig.de/publications/supplements/12-001. PMID:25802408

  11. Linkage disequilibrium of evolutionarily conserved regions in the human genome

    PubMed Central

    Kato, Mamoru; Sekine, Akihiro; Ohnishi, Yozo; Johnson, Todd A; Tanaka, Toshihiro; Nakamura, Yusuke; Tsunoda, Tatsuhiko

    2006-01-01

    Background The strong linkage disequilibrium (LD) recently found in genic or exonic regions of the human genome demonstrated that LD can be increased by evolutionary mechanisms that select for functionally important loci. This suggests that LD might be stronger in regions conserved among species than in non-conserved regions, since regions exposed to natural selection tend to be conserved. To assess this hypothesis, we used genome-wide polymorphism data from the HapMap project and investigated LD within DNA sequences conserved between the human and mouse genomes. Results Unexpectedly, we observed that LD was significantly weaker in conserved regions than in non-conserved regions. To investigate why, we examined sequence features that may distort the relationship between LD and conserved regions. We found that interspersed repeats, and not other sequence features, were associated with the weak LD tendency in conserved regions. To appropriately understand the relationship between LD and conserved regions, we removed the effect of repetitive elements and found that the high degree of sequence conservation was strongly associated with strong LD in coding regions but not with that in non-coding regions. Conclusion Our work demonstrates that the degree of sequence conservation does not simply increase LD as predicted by the hypothesis. Rather, it implies that purifying selection changes the polymorphic patterns of coding sequences but has little influence on the patterns of functional units such as regulatory elements present in non-coding regions, since the former are generally restricted by the constraint of maintaining a functional protein product across multiple exons while the latter may exist more as individually isolated units. PMID:17192199

  12. Evolutionarily conserved substrate substructures for automated annotation of enzyme superfamilies.

    PubMed

    Chiang, Ranyee A; Sali, Andrej; Babbitt, Patricia C

    2008-08-01

    The evolution of enzymes affects how well a species can adapt to new environmental conditions. During enzyme evolution, certain aspects of molecular function are conserved while other aspects can vary. Aspects of function that are more difficult to change or that need to be reused in multiple contexts are often conserved, while those that vary may indicate functions that are more easily changed or that are no longer required. In analogy to the study of conservation patterns in enzyme sequences and structures, we have examined the patterns of conservation and variation in enzyme function by analyzing graph isomorphisms among enzyme substrates of a large number of enzyme superfamilies. This systematic analysis of substrate substructures establishes the conservation patterns that typify individual superfamilies. Specifically, we determined the chemical substructures that are conserved among all known substrates of a superfamily and the substructures that are reacting in these substrates and then examined the relationship between the two. Across the 42 superfamilies that were analyzed, substantial variation was found in how much of the conserved substructure is reacting, suggesting that superfamilies may not be easily grouped into discrete and separable categories. Instead, our results suggest that many superfamilies may need to be treated individually for analyses of evolution, function prediction, and guiding enzyme engineering strategies. Annotating superfamilies with these conserved and reacting substructure patterns provides information that is orthogonal to information provided by studies of conservation in superfamily sequences and structures, thereby improving the precision with which we can predict the functions of enzymes of unknown function and direct studies in enzyme engineering. Because the method is automated, it is suitable for large-scale characterization and comparison of fundamental functional capabilities of both characterized and uncharacterized

  13. Of flies, mice, and men: evolutionarily conserved tissue damage responses and aging.

    PubMed

    Neves, Joana; Demaria, Marco; Campisi, Judith; Jasper, Heinrich

    2015-01-12

    Studies in flies, mice, and human models have provided a conceptual framework for how paracrine interactions between damaged cells and the surrounding tissue control tissue repair. These studies have amassed evidence for an evolutionarily conserved secretory program that regulates tissue homeostasis. This program coordinates cell survival and proliferation during tissue regeneration and repair in young animals. By virtue of chronic engagement, however, it also contributes to the age-related decline of tissue homeostasis leading to degeneration, metabolic dysfunction, and cancer. Here, we review recent studies that shed light on the nature and regulation of this evolutionarily conserved secretory program.

  14. FGF signaling inhibitor, SPRY4, is evolutionarily conserved target of WNT signaling pathway in progenitor cells.

    PubMed

    Katoh, Yuriko; Katoh, Masaru

    2006-03-01

    WNT, FGF and Hedgehog signaling pathways network together during embryogenesis, tissue regeneration, and carcinogenesis. FGF16, FGF18, and FGF20 genes are targets of WNT-mediated TCF/LEF-beta-catenin-BCL9/BCL9L-PYGO transcriptional complex. SPROUTY (SPRY) and SPRED family genes encode inhibitors for receptor tyrosine kinase signaling cascades, such as those of FGF receptor family members and EGF receptor family members. Here, transcriptional regulation of SPRY1, SPRY2, SPRY3, SPRY4, SPRED1, SPRED2, and SPRED3 genes by WNT/beta-catenin signaling cascade was investigated by using bioinformatics and human intelligence (humint). Because double TCF/LEF-binding sites were identified within the 5'-promoter region of human SPRY4 gene, comparative genomics analyses on SPRY4 orthologs were further performed. SPRY4-FGF1 locus at human chromosome 5q31.3 and FGF2-NUDT6-SPATA5-SPRY1 locus at human chromosome 4q27-q28.1 were paralogous regions within the human genome. Chimpanzee SPRY4 gene was identified within NW_107083.1 genome sequence. Human, chimpanzee, rat and mouse SPRY4 orthologs, consisting of three exons, were well conserved. SPRY4 gene was identified as the evolutionarily conserved target of WNT/beta-catenin signaling pathway based on the conservation of double TCF/LEF-binding sites within 5'-promoter region of mammalian SPRY4 orthologs. Human SPRY4 mRNA was expressed in embryonic stem (ES) cells, brain, pancreatic islet, colon cancer, head and neck tumor, melanoma, and pancreatic cancer. WNT signaling activation in progenitor cells leads to the growth regulation of progenitor cells themselves through SPRY4 induction, and also to the growth stimulation of proliferating cells through FGF secretion. Epigenetic silencing and loss-of-function mutations of SPRY4 gene in progenitor cells could lead to carcinogenesis. SPRY4 is the pharmacogenomics target in the fields of oncology and regenerative medicine.

  15. Evening Expression of Arabidopsis GIGANTEA Is Controlled by Combinatorial Interactions among Evolutionarily Conserved Regulatory Motifs[C][W][OPEN

    PubMed Central

    Nordström, Karl; Cremer, Frédéric; Tóth, Réka; Hartke, Martin; Simon, Samson; Klasen, Jonas R.; Bürstel, Ingmar; Coupland, George

    2014-01-01

    Diurnal patterns of gene transcription are often conferred by complex interactions between circadian clock control and acute responses to environmental cues. Arabidopsis thaliana GIGANTEA (GI) contributes to photoperiodic flowering, circadian clock control, and photoreceptor signaling, and its transcription is regulated by the circadian clock and light. We used phylogenetic shadowing to identify three evolutionarily constrained regions (conserved regulatory modules [CRMs]) within the GI promoter and show that CRM2 is sufficient to confer a similar transcriptional pattern as the full-length promoter. Dissection of CRM2 showed that one subfragment (CRM2-A) contributes light inducibility, while another (CRM2-B) exhibits a diurnal response. Mutational analysis showed that three ABA RESPONSE ELEMENT LIKE (ABREL) motifs in CRM2-A and three EVENING ELEMENTs (EEs) in CRM2-B are essential in combination to confer a high amplitude diurnal pattern of expression. Genome-wide analysis identified characteristic spacing patterns of EEs and 71 A. thaliana promoters containing three EEs. Among these promoters, that of FLAVIN BINDING KELCH REPEAT F-BOX1 was analyzed in detail and shown to harbor a CRM functionally related to GI CRM2. Thus, combinatorial interactions among EEs and ABRELs confer diurnal patterns of transcription via an evolutionarily conserved module present in GI and other evening-expressed genes. PMID:25361953

  16. Oncogenic effects of evolutionarily conserved noncoding RNA ECONEXIN on gliomagenesis.

    PubMed

    Deguchi, S; Katsushima, K; Hatanaka, A; Shinjo, K; Ohka, F; Wakabayashi, T; Zong, H; Natsume, A; Kondo, Y

    2017-04-03

    Accumulating studies have demonstrated the importance of long noncoding RNAs (lncRNAs) during oncogenic transformation. However, because most lncRNAs are currently uncharacterized, the identification of novel oncogenic lncRNAs is difficult. Given that intergenic lncRNA have substantially less sequence conservation patterns than protein-coding genes across species, evolutionary conserved intergenic lncRNAs are likely to be functional. The current study identified a novel intergenic lncRNA, LINC00461 (ECONEXIN) using a combined approach consisting of searching lncRNAs by evolutionary conservation and validating their expression in a glioma mouse model. ECONEXIN was the most highly conserved intergenic lncRNA containing 83.0% homology with the mouse ortholog (C130071C03Rik) for a region over 2500 bp in length within its exon 3. Expressions of ECONEXIN and C130071C03Rik were significantly upregulated in both human and mouse glioma tissues. Moreover, the expression of C130071C03Rik was upregulated even in precancerous conditions and markedly increased during glioma progression. Functional analysis of ECONEXIN in glioma cell lines, U87 and U251, showed it was dominantly located in the cytoplasm and interacted with miR-411-5p via two binding sites within ECONEXIN. Inhibition of ECONEXIN upregulated miR-411-5p together with the downregulation of its target, Topoisomerase 2 alpha (TOP2A), in glioma cell lines, resulting in decreased cell proliferation. Our data demonstrated that ECONEXIN is a potential oncogene that regulates TOP2A by sponging miR-411-5p in glioma. In addition, our investigative approaches to identify conserved lncRNA and their molecular characterization by validation in mouse tumor models may be useful to functionally annotate novel lncRNAs, especially cancer-associated lncRNAs.Oncogene advance online publication, 3 April 2017; doi:10.1038/onc.2017.88.

  17. Evolutionarily Conserved Linkage between Enzyme Fold, Flexibility, and Catalysis

    PubMed Central

    Ramanathan, Arvind; Agarwal, Pratul K.

    2011-01-01

    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 Å away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme–substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme–substrate interactions, thereby

  18. Evolutionarily conserved linkage between enzyme fold, flexibility, and catalysis

    SciTech Connect

    Ramanathan, Arvind; Agarwal, Pratul K

    2011-01-01

    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme substrate interactions, thereby impacting

  19. Evolutionarily conserved linkage between enzyme fold, flexibility, and catalysis.

    PubMed

    Ramanathan, Arvind; Agarwal, Pratul K

    2011-11-01

    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 Å away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme-substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme-substrate interactions, thereby impacting

  20. Evolutionarily conserved intracellular gate of voltage-dependent sodium channels

    NASA Astrophysics Data System (ADS)

    Oelstrom, Kevin; Goldschen-Ohm, Marcel P.; Holmgren, Miguel; Chanda, Baron

    2014-03-01

    Members of the voltage-gated ion channel superfamily (VGIC) regulate ion flux and generate electrical signals in excitable cells by opening and closing pore gates. The location of the gate in voltage-gated sodium channels, a founding member of this superfamily, remains unresolved. Here we explore the chemical modification rates of introduced cysteines along the S6 helix of domain IV in an inactivation-removed background. We find that state-dependent accessibility is demarcated by an S6 hydrophobic residue; substituted cysteines above this site are not modified by charged thiol reagents when the channel is closed. These accessibilities are consistent with those inferred from open- and closed-state structures of prokaryotic sodium channels. Our findings suggest that an intracellular gate composed of a ring of hydrophobic residues is not only responsible for regulating access to the pore of sodium channels, but is also a conserved feature within canonical members of the VGIC superfamily.

  1. Evolutionarily conserved intracellular gate of voltage-dependent sodium channels

    PubMed Central

    Oelstrom, Kevin; Goldschen-Ohm, Marcel P.; Holmgren, Miguel; Chanda, Baron

    2014-01-01

    Members of the voltage-gated ion channel superfamily (VGIC) regulate ion flux and generate electrical signals in excitable cells by opening and closing pore gates. The location of the gate in voltage-gated sodium channels, a founding member of this superfamily, remains unresolved. Here we explore the chemical modification rates of introduced cysteines along the S6 helix of domain IV in an inactivation-removed background. We find that state-dependent accessibility is demarcated by an S6 hydrophobic residue; substituted cysteines above this site are not modified by charged thiol reagents when the channel is closed. These accessibilities are consistent with those inferred from open- and closed-state structures of prokaryotic sodium channels. Our findings suggest that an intracellular gate composed of a ring of hydrophobic residues is not only responsible for regulating access to the pore of sodium channels, but is also a conserved feature within canonical members of the VGIC superfamily. PMID:24619022

  2. An evolutionarily conserved negative feedback mechanism in the Hippo pathway reflects functional difference between LATS1 and LATS2

    PubMed Central

    Park, Gun-Soo; Oh, Hyangyee; Kim, Minchul; Kim, Tackhoon; Johnson, Randy L.; Irvine, Kenneth D.; Lim, Dae-Sik

    2016-01-01

    The Hippo pathway represses YAP oncoprotein activity through phosphorylation by LATS kinases. Although variety of upstream components has been found to participate in the Hippo pathway, the existence and function of negative feedback has remained uncertain. We found that activated YAP, together with TEAD transcription factors, directly induces transcription of LATS2, but not LATS1, to form a negative feedback loop. We also observed increased mRNA levels of Hippo upstream components upon YAP activation. To reveal the physiological role of this negative feedback regulation, we deleted Lats2 or Lats1 in the liver-specific Sav1-knockout mouse model which develops a YAP-induced tumor. Additional deletion of Lats2 severely enhanced YAP-induced tumorigenic phenotypes in a liver specific Sav1 knock-out mouse model while additional deletion of Lats1 mildly affected the phenotype. Only Sav1 and Lats2 double knock-down cells formed larger colonies in soft agar assay, thereby recapitulating accelerated tumorigenesis seen in vivo. Importantly, this negative feedback is evolutionarily conserved, as Drosophila Yorkie (YAP ortholog) induces transcription of Warts (LATS2 ortholog) with Scalloped (TEAD ortholog). Collectively, we demonstrated the existence and function of an evolutionarily conserved negative feedback mechanism in the Hippo pathway, as well as the functional difference between LATS1 and LATS2 in regulation of YAP. PMID:27006470

  3. An evolutionarily conserved negative feedback mechanism in the Hippo pathway reflects functional difference between LATS1 and LATS2.

    PubMed

    Park, Gun-Soo; Oh, Hyangyee; Kim, Minchul; Kim, Tackhoon; Johnson, Randy L; Irvine, Kenneth D; Lim, Dae-Sik

    2016-04-26

    The Hippo pathway represses YAP oncoprotein activity through phosphorylation by LATS kinases. Although variety of upstream components has been found to participate in the Hippo pathway, the existence and function of negative feedback has remained uncertain. We found that activated YAP, together with TEAD transcription factors, directly induces transcription of LATS2, but not LATS1, to form a negative feedback loop. We also observed increased mRNA levels of Hippo upstream components upon YAP activation. To reveal the physiological role of this negative feedback regulation, we deleted Lats2 or Lats1 in the liver-specific Sav1-knockout mouse model which develops a YAP-induced tumor. Additional deletion of Lats2 severely enhanced YAP-induced tumorigenic phenotypes in a liver specific Sav1 knock-out mouse model while additional deletion of Lats1 mildly affected the phenotype. Only Sav1 and Lats2 double knock-down cells formed larger colonies in soft agar assay, thereby recapitulating accelerated tumorigenesis seen in vivo. Importantly, this negative feedback is evolutionarily conserved, as Drosophila Yorkie (YAP ortholog) induces transcription of Warts (LATS2 ortholog) with Scalloped (TEAD ortholog). Collectively, we demonstrated the existence and function of an evolutionarily conserved negative feedback mechanism in the Hippo pathway, as well as the functional difference between LATS1 and LATS2 in regulation of YAP.

  4. Prediction of evolutionarily conserved interologs in Mus musculus

    PubMed Central

    Yellaboina, Sailu; Dudekula, Dawood B; Ko, Minoru SH

    2008-01-01

    Background Identification of protein-protein interactions is an important first step to understand living systems. High-throughput experimental approaches have accumulated large amount of information on protein-protein interactions in human and other model organisms. Such interaction information has been successfully transferred to other species, in which the experimental data are limited. However, the annotation transfer method could yield false positive interologs due to the lack of conservation of interactions when applied to phylogenetically distant organisms. Results To address this issue, we used phylogenetic profile method to filter false positives in interologs based on the notion that evolutionary conserved interactions show similar patterns of occurrence along the genomes. The approach was applied to Mus musculus, in which the experimentally identified interactions are limited. We first inferred the protein-protein interactions in Mus musculus by using two approaches: i) identifying mouse orthologs of interacting proteins (interologs) based on the experimental protein-protein interaction data from other organisms; and ii) analyzing frequency of mouse ortholog co-occurrence in predicted operons of bacteria. We then filtered possible false-positives in the predicted interactions using the phylogenetic profiles. We found that this filtering method significantly increased the frequency of interacting protein-pairs coexpressed in the same cells/tissues in gene expression omnibus (GEO) database as well as the frequency of interacting protein-pairs shared the similar Gene Ontology (GO) terms for biological processes and cellular localizations. The data supports the notion that phylogenetic profile helps to reduce the number of false positives in interologs. Conclusion We have developed protein-protein interaction database in mouse, which contains 41109 interologs. We have also developed a web interface to facilitate the use of database . PMID:18842131

  5. An evolutionarily conserved mutual interdependence between Aire and microRNAs in promiscuous gene expression.

    PubMed

    Ucar, Olga; Tykocinski, Lars-Oliver; Dooley, James; Liston, Adrian; Kyewski, Bruno

    2013-07-01

    The establishment and maintenance of central tolerance depends to a large extent on the ability of medullary thymic epithelial cells to express a variety of tissue-restricted antigens, the so-called promiscuous gene expression (pGE). Autoimmune regulator (Aire) is to date the best characterised transcriptional regulator known to at least partially coordinate pGE. There is accruing evidence that the expression of Aire-dependent and -independent genes is modulated by higher order chromatin configuration, epigenetic modifications and post-transcriptional control. Given the involvement of microRNAs (miRNAs) as potent post-transcriptional modulators of gene expression, we investigated their role in the regulation of pGE in purified mouse and human thymic epithelial cells (TECs). Microarray profiling of TEC subpopulations revealed evolutionarily conserved cell type and differentiation-specific miRNA signatures with a subset of miRNAs being significantly upregulated during terminal medullary thymic epithelial cell differentiation. The differential regulation of this subset of miRNAs was correlated with Aire expression and some of these miRNAs were misexpressed in the Aire knockout thymus. In turn, the specific absence of miRNAs in TECs resulted in a progressive reduction of Aire expression and pGE, affecting both Aire-dependent and -independent genes. In contrast, the absence of miR-29a only affected the Aire-dependent gene pool. These findings reveal a mutual interdependence of miRNA and Aire. © 2013 The Authors. European Journal of Immunology published byWiley-VCH Verlag GmbH & Co. KGaA Weinheim.

  6. Evolutionarily Conserved Principles Predict 3D Chromatin Organization.

    PubMed

    Rowley, M Jordan; Nichols, Michael H; Lyu, Xiaowen; Ando-Kuri, Masami; Rivera, I Sarahi M; Hermetz, Karen; Wang, Ping; Ruan, Yijun; Corces, Victor G

    2017-09-07

    Topologically associating domains (TADs), CTCF loop domains, and A/B compartments have been identified as important structural and functional components of 3D chromatin organization, yet the relationship between these features is not well understood. Using high-resolution Hi-C and HiChIP, we show that Drosophila chromatin is organized into domains we term compartmental domains that correspond precisely with A/B compartments at high resolution. We find that transcriptional state is a major predictor of Hi-C contact maps in several eukaryotes tested, including C. elegans and A. thaliana. Architectural proteins insulate compartmental domains by reducing interaction frequencies between neighboring regions in Drosophila, but CTCF loops do not play a distinct role in this organism. In mammals, compartmental domains exist alongside CTCF loop domains to form topological domains. The results suggest that compartmental domains are responsible for domain structure in all eukaryotes, with CTCF playing an important role in domain formation in mammals. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Blue reflectance in tarantulas is evolutionarily conserved despite nanostructural diversity.

    PubMed

    Hsiung, Bor-Kai; Deheyn, Dimitri D; Shawkey, Matthew D; Blackledge, Todd A

    2015-11-01

    Slight shifts in arrangement within biological photonic nanostructures can produce large color differences, and sexual selection often leads to high color diversity in clades with structural colors. We use phylogenetic reconstruction, electron microscopy, spectrophotometry, and optical modeling to show an opposing pattern of nanostructural diversification accompanied by unusual conservation of blue color in tarantulas (Araneae: Theraphosidae). In contrast to other clades, blue coloration in phylogenetically distant tarantulas peaks within a narrow 20-nm region around 450 nm. Both quasi-ordered and multilayer nanostructures found in different tarantulas produce this blue color. Thus, even within monophyletic lineages, tarantulas have evolved strikingly similar blue coloration through divergent mechanisms. The poor color perception and lack of conspicuous display during courtship of tarantulas argue that these colors are not sexually selected. Therefore, our data contrast with sexual selection that typically produces a diverse array of colors with a single structural mechanism by showing that natural selection on structural color in tarantulas resulted in convergence on similar color through diverse structural mechanisms.

  8. Blue reflectance in tarantulas is evolutionarily conserved despite nanostructural diversity

    PubMed Central

    Hsiung, Bor-Kai; Deheyn, Dimitri D.; Shawkey, Matthew D.; Blackledge, Todd A.

    2015-01-01

    Slight shifts in arrangement within biological photonic nanostructures can produce large color differences, and sexual selection often leads to high color diversity in clades with structural colors. We use phylogenetic reconstruction, electron microscopy, spectrophotometry, and optical modeling to show an opposing pattern of nanostructural diversification accompanied by unusual conservation of blue color in tarantulas (Araneae: Theraphosidae). In contrast to other clades, blue coloration in phylogenetically distant tarantulas peaks within a narrow 20-nm region around 450 nm. Both quasi-ordered and multilayer nanostructures found in different tarantulas produce this blue color. Thus, even within monophyletic lineages, tarantulas have evolved strikingly similar blue coloration through divergent mechanisms. The poor color perception and lack of conspicuous display during courtship of tarantulas argue that these colors are not sexually selected. Therefore, our data contrast with sexual selection that typically produces a diverse array of colors with a single structural mechanism by showing that natural selection on structural color in tarantulas resulted in convergence on similar color through diverse structural mechanisms. PMID:26702433

  9. Genetic Evidence of an Evolutionarily Conserved Role for Nrf2 in the Protection against Oxidative Stress

    PubMed Central

    Mukaigasa, Katsuki; Nguyen, Linh T. P.; Li, Li; Nakajima, Hitomi; Yamamoto, Masayuki

    2012-01-01

    Transcription factor Nrf2 is considered a master regulator of antioxidant defense in mammals. However, it is unclear whether this concept is applicable to nonmammalian vertebrates, because no animal model other than Nrf2 knockout mice has been generated to examine the effects of Nrf2 deficiency. Here, we characterized a recessive loss-of-function mutant of Nrf2 (nrf2fh318) in a lower vertebrate, the zebrafish (Danio rerio). In keeping with the findings in the mouse model, nrf2fh318 mutants exhibited reduced induction of the Nrf2 target genes in response to oxidative stress and electrophiles but were viable and fertile, and their embryos developed normally. The nrf2fh318 larvae displayed enhanced sensitivity to oxidative stress and electrophiles, especially peroxides, and pretreatment with an Nrf2-activating compound, sulforaphane, decreased peroxide-induced lethality in the wild type but not nrf2fh318 mutants, indicating that resistance to oxidative stress is highly dependent on Nrf2 functions. These results reveal an evolutionarily conserved role of vertebrate Nrf2 in protection against oxidative stress. Interestingly, there were no significant differences between wild-type and nrf2fh318 larvae with regard to their sensitivity to superoxide and singlet oxygen generators, suggesting that the importance of Nrf2 in oxidative stress protection varies based on the type of reactive oxygen species (ROS). PMID:22949501

  10. An evolutionarily conserved gene, FUWA, plays a role in determining panicle architecture, grain shape and grain weight in rice.

    PubMed

    Chen, Jun; Gao, He; Zheng, Xiao-Ming; Jin, Mingna; Weng, Jian-Feng; Ma, Jin; Ren, Yulong; Zhou, Kunneng; Wang, Qi; Wang, Jie; Wang, Jiu-Lin; Zhang, Xin; Cheng, Zhijun; Wu, Chuanyin; Wang, Haiyang; Wan, Jian-Min

    2015-08-01

    Plant breeding relies on creation of novel allelic combinations for desired traits. Identification and utilization of beneficial alleles, rare alleles and evolutionarily conserved genes in the germplasm (referred to as 'hidden' genes) provide an effective approach to achieve this goal. Here we show that a chemically induced null mutation in an evolutionarily conserved gene, FUWA, alters multiple important agronomic traits in rice, including panicle architecture, grain shape and grain weight. FUWA encodes an NHL domain-containing protein, with preferential expression in the root meristem, shoot apical meristem and inflorescences, where it restricts excessive cell division. Sequence analysis revealed that FUWA has undergone a bottleneck effect, and become fixed in landraces and modern cultivars during domestication and breeding. We further confirm a highly conserved role of FUWA homologs in determining panicle architecture and grain development in rice, maize and sorghum through genetic transformation. Strikingly, knockdown of the FUWA transcription level by RNA interference results in an erect panicle and increased grain size in both indica and japonica genetic backgrounds. This study illustrates an approach to create new germplasm with improved agronomic traits for crop breeding by tapping into evolutionary conserved genes. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  11. Of flies, mice and men: Evolutionarily conserved tissue damage responses and aging

    PubMed Central

    Neves, Joana; Demaria, Marco; Campisi, Judith; Jasper, Heinrich

    2015-01-01

    SUMMARY Studies in flies, mice, and human models have provided a conceptual framework for how paracrine interactions between damaged cells and the surrounding tissue control tissue repair. These studies have amassed evidence for an evolutionarily conserved secretory program that regulates tissue homeostasis. This program coordinates cell survival and proliferation during tissue regeneration and repair in young animals. By virtue of chronic engagement, however, it also contributes to the age-related decline of tissue homeostasis leading to degeneration, metabolic dysfunction and cancer. Here we review recent studies that shed light on the nature and regulation of this evolutionary conserved secretory program. PMID:25584795

  12. lolal Is an Evolutionarily New Epigenetic Regulator of dpp Transcription during Dorsal–Ventral Axis Formation

    PubMed Central

    Quijano, Janine C.; Wisotzkey, Robert G.; Tran, Nancy Lan; Huang, Yunxian; Stinchfield, Michael J.; Haerry, Theodor E.; Shimmi, Osamu; Newfeld, Stuart J.

    2016-01-01

    Secreted ligands in the Dpp/BMP family drive dorsal–ventral (D/V) axis formation in all Bilaterian species. However, maternal factors regulating Dpp/BMP transcription in this process are largely unknown. We identified the BTB domain protein longitudinals lacking-like (lolal) as a modifier of decapentaplegic (dpp) mutations. We show that Lolal is evolutionarily related to the Trithorax group of chromatin regulators and that lolal interacts genetically with the epigenetic factor Trithorax-like during Dpp D/V signaling. Maternally driven LolalHA is found in oocytes and translocates to zygotic nuclei prior to the point at which dpp transcription begins. lolal maternal and zygotic mutant embryos display significant reductions in dpp, pMad, and zerknullt expression, but they are never absent. The data suggest that lolal is required to maintain dpp transcription during D/V patterning. Phylogenetic data revealed that lolal is an evolutionarily new gene present only in insects and crustaceans. We conclude that Lolal is the first maternal protein identified with a role in dpp D/V transcriptional maintenance, that Lolal and the epigenetic protein Trithorax-like are essential for Dpp D/V signaling and that the architecture of the Dpp D/V pathway evolved in the arthropod lineage after the separation from vertebrates via the incorporation of new genes such as lolal. PMID:27401231

  13. NASP: a parallel program for identifying evolutionarily conserved nucleic acid secondary structures from nucleotide sequence alignments.

    PubMed

    Semegni, J Y; Wamalwa, M; Gaujoux, R; Harkins, G W; Gray, A; Martin, D P

    2011-09-01

    Many natural nucleic acid sequences have evolutionarily conserved secondary structures with diverse biological functions. A reliable computational tool for identifying such structures would be very useful in guiding experimental analyses of their biological functions. NASP (Nucleic Acid Structure Predictor) is a program that takes into account thermodynamic stability, Boltzmann base pair probabilities, alignment uncertainty, covarying sites and evolutionary conservation to identify biologically relevant secondary structures within multiple sequence alignments. Unique to NASP is the consideration of all this information together with a recursive permutation-based approach to progressively identify and list the most conserved probable secondary structures that are likely to have the greatest biological relevance. By focusing on identifying only evolutionarily conserved structures, NASP forgoes the prediction of complete nucleotide folds but outperforms various other secondary structure prediction methods in its ability to selectively identify actual base pairings. Downloable and web-based versions of NASP are freely available at http://web.cbio.uct.ac.za/~yves/nasp_portal.php yves@cbio.uct.ac.za Supplementary data are available at Bioinformatics online.

  14. A novel evolutionarily conserved domain of cell-adhesion GPCRs mediates autoproteolysis

    PubMed Central

    Araç, Demet; Boucard, Antony A; Bolliger, Marc F; Nguyen, Jenna; Soltis, S Michael; Südhof, Thomas C; Brunger, Axel T

    2012-01-01

    The G protein-coupled receptor (GPCR) Proteolysis Site (GPS) of cell-adhesion GPCRs and polycystic kidney disease (PKD) proteins constitutes a highly conserved autoproteolysis sequence, but its catalytic mechanism remains unknown. Here, we show that unexpectedly the ∼40-residue GPS motif represents an integral part of a much larger ∼320-residue domain that we termed GPCR-Autoproteolysis INducing (GAIN) domain. Crystal structures of GAIN domains from two distantly related cell-adhesion GPCRs revealed a conserved novel fold in which the GPS motif forms five β-strands that are tightly integrated into the overall GAIN domain. The GAIN domain is evolutionarily conserved from tetrahymena to mammals, is the only extracellular domain shared by all human cell-adhesion GPCRs and PKD proteins, and is the locus of multiple human disease mutations. Functionally, the GAIN domain is both necessary and sufficient for autoproteolysis, suggesting an autoproteolytic mechanism whereby the overall GAIN domain fine-tunes the chemical environment in the GPS to catalyse peptide bond hydrolysis. Thus, the GAIN domain embodies a unique, evolutionarily ancient and widespread autoproteolytic fold whose function is likely relevant for GPCR signalling and for multiple human diseases. PMID:22333914

  15. Moonlighting glycolytic protein glyceraldehyde-3-phosphate dehydrogenase (GAPDH): an evolutionarily conserved plasminogen receptor on mammalian cells.

    PubMed

    Chauhan, Anoop Singh; Kumar, Manoj; Chaudhary, Surbhi; Patidar, Anil; Dhiman, Asmita; Sheokand, Navdeep; Malhotra, Himanshu; Raje, Chaaya Iyengar; Raje, Manoj

    2017-03-15

    Prokaryotic pathogens establish infection in mammals by capturing the proteolytic enzyme plasminogen (Plg) onto their surface to digest host extracellular matrix (ECM). One of the bacterial surface Plg receptors is the multifunctional glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH). In a defensive response, the host mounts an inflammatory response, which involves infiltration of leukocytes to sites of inflammation. This requires macrophage exit from the blood and migration across basement membranes, a phenomenon dependent on proteolytic remodeling of the ECM utilizing Plg. The ability of Plg to facilitate inflammatory cell recruitment critically depends on receptors on the surface of phagocyte cells. Utilizing a combination of biochemical, cellular, knockdown, and in vivo approaches, we demonstrated that upon inflammation, macrophages recruit GAPDH onto their surface to carry out the same task of capturing Plg to digest ECM to aid rapid phagocyte migration and combat the invading pathogens. We propose that GAPDH is an ancient, evolutionarily conserved receptor that plays a key role in the Plg-dependent regulation of macrophage recruitment in the inflammatory response to microbial aggression, thus pitting prokaryotic GAPDH against mammalian GAPDH, with both involved in a conserved role of Plg activation on the surface of their respective cells, to conflicting ends.-Chauhan, A. S., Kumar, M., Chaudhary, S., Patidar, A., Dhiman, A., Sheokand, N., Malhotra, H., Raje, C. I., Raje, M. Moonlighting glycolytic protein glyceraldehyde-3-phosphate dehydrogenase (GAPDH): an evolutionarily conserved plasminogen receptor on mammalian cells.

  16. Stress-induced cellular adaptive strategies: ancient evolutionarily conserved programs as new anticancer therapeutic targets.

    PubMed

    Cipponi, Arcadi; Thomas, David M

    2014-06-01

    Despite the remarkable achievements of novel targeted anti-cancer drugs, most therapies only produce remission for a limited time, resistance to treatment, and relapse, often being the ultimate outcome. Drug resistance is due to highly efficient adaptive strategies utilized by cancer cells. Exogenous and endogenous stress stimuli are known to induce first-line responses, capable of re-establishing cellular homeostasis and determining cell fate decisions. Cancer cells may also mount second-line adaptive strategies, such as the mutator response. Hypermutable subpopulations of cells may expand under severe selective stress, thereby accelerating the emergence of adapted clones. As with first-line protective responses, these strategies appear highly conserved, and are found in yeasts and bacteria. We hypothesize that evolutionarily conserved programs rheostatically regulate mutability in fluctuating environments, and contribute to drug resistance in cancer cells. Elucidating the conserved genetic and molecular mechanisms may present novel opportunities to increase the effectiveness of cancer therapies. © 2014 WILEY Periodicals, Inc.

  17. The viral transactivator HBx protein exhibits a high potential for regulation via phosphorylation through an evolutionarily conserved mechanism

    PubMed Central

    2012-01-01

    Background Hepatitis B virus (HBV) encodes an oncogenic factor, HBx, which is a multifunctional protein that can induce dysfunctional regulation of signaling pathways, transcription, and cell cycle progression, among other processes, through interactions with target host factors. The subcellular localization of HBx is both cytoplasmic and nuclear. This dynamic distribution of HBx could be essential to the multiple roles of the protein at different stages during HBV infection. Transactivational functions of HBx may be exerted both in the nucleus, via interaction with host DNA-binding proteins, and in the cytoplasm, via signaling pathways. Although there have been many studies describing different pathways altered by HBx, and its innumerable binding partners, the molecular mechanism that regulates its different roles has been difficult to elucidate. Methods In the current study, we took a bioinformatics approach to investigate whether the viral protein HBx might be regulated via phosphorylation by an evolutionarily conserved mechanism. Results We found that the phylogenetically conserved residues Ser25 and Ser41 (both within the negative regulatory domain), and Thr81 (in the transactivation domain) are predicted to be phosphorylated. By molecular 3D modeling of HBx, we further show these residues are all predicted to be exposed on the surface of the protein, making them easily accesible to these types of modifications. Furthermore, we have also identified Yin Yang sites that might have the potential to be phosphorylated and O-β-GlcNAc interplay at the same residues. Conclusions Thus, we propose that the different roles of HBx displayed in different subcellular locations might be regulated by an evolutionarily conserved mechanism of posttranslational modification, via phosphorylation. PMID:23079056

  18. Moonlighting activity of presenilin in plants is independent of γ-secretase and evolutionarily conserved

    PubMed Central

    Khandelwal, Abha; Chandu, Dilip; Roe, Catherine M.; Kopan, Raphael; Quatrano, Ralph S.

    2007-01-01

    Presenilins (PS) provide the catalytic activity for γ-secretase, which cleaves physiologically relevant substrates including Notch, ErbB4, and APP. Recent genetic studies indicated that the contribution of PS1 to mouse development includes γ-secretase-independent functions that cannot be easily explained by any of the demonstrated or hypothesized functions of this protein. To begin a nonbiased analysis of PS1 activity unencumbered by the dominant effect stemming from loss of Notch function, we characterized PS functions in the early land plant Physcomitrella patens, which lacks Notch, ErbB4, and APP. Removal of P. patens PS resulted in phenotypic abnormalities. Further assays performed to delineate the defective pathways in PS-deficient P. patens implicated improper function of the cytoskeletal network. Importantly, this characterization of a nonmetazoan PS uncovered a previously undescribed, evolutionarily conserved function (human PS1 can rescue the growth and light responses) that is γ-secretase-independent (mutants with substitutions of the catalytic aspartyl residues retain the activity). Introduction of PpPS into PS-deficient mouse embryonic fibroblasts rescues normal growth rates, demonstrating that at least some metazoan functions of PS are evolutionarily conserved. PMID:17684101

  19. An evolutionarily conserved NPC subcomplex, which redistributes in part to kinetochores in mammalian cells

    PubMed Central

    Belgareh, Naïma; Rabut, Gwénaël; Baï, Siau Wei; van Overbeek, Megan; Beaudouin, Joël; Daigle, Nathalie; Zatsepina, Olga V.; Pasteau, Fabien; Labas, Valérie; Fromont-Racine, Micheline; Ellenberg, Jan; Doye, Valérie

    2001-01-01

    The nuclear pore complexes (NPCs) are evolutionarily conserved assemblies that allow traffic between the cytoplasm and the nucleus. In this study, we have identified and characterized a novel human nuclear pore protein, hNup133, through its homology with the Saccharomyces cerevisiae nucleoporin scNup133. Two-hybrid screens and immunoprecipitation experiments revealed a direct and evolutionarily conserved interaction between Nup133 and Nup84/Nup107 and indicated that hNup133 and hNup107 are part of a NPC subcomplex that contains two other nucleoporins (the previously characterized hNup96 and a novel nucleoporin designated as hNup120) homologous to constituents of the scNup84 subcomplex. We further demonstrate that hNup133 and hNup107 are localized on both sides of the NPC to which they are stably associated at interphase, remain associated as part of a NPC subcomplex during mitosis, and are targeted at early stages to the reforming nuclear envelope. Throughout mitosis, a fraction of hNup133 and hNup107 localizes to the kinetochores, thus revealing an unexpected connection between structural NPCs constituents and kinetochores. Photobleaching experiments further showed that the mitotic cytoplasm contains kinetochore-binding competent hNup133 molecules and that in contrast to its stable association with the NPCs the interaction of this nucleoporin with kinetochores is dynamic. PMID:11564755

  20. An evolutionarily conserved Rit GTPase–p38 MAPK signaling pathway mediates oxidative stress resistance

    PubMed Central

    Cai, Weikang; Rudolph, Jennifer L.; Harrison, Susan M. W.; Jin, Ling; Frantz, Aubrey L.; Harrison, Douglas A.; Andres, Douglas A.

    2011-01-01

    Ras-related small GTP-binding proteins control a wide range of cellular processes by regulating a variety of effector pathways, including prominent roles in the control of mitogen-activated protein kinase (MAPK) cascades. Although the regulatory role(s) for many Ras family GTPases are well established, the physiological function for the Rit/Rin subfamily has been lacking. Here, using both knockout mice and Drosophila models, we demonstrate an evolutionarily conserved role for Rit subfamily GTPases (mammalian Rit and Rin, and the Drosophila RIC homologue) in governing survival in response to oxidative stress. Primary embryonic fibroblasts derived from Rit knockout mice display increased apoptosis and selective disruption of MAPK signaling following reactive oxygen species (ROS) exposure but not in response to endoplasmic reticulum stress or DNA damage. These deficits include a reduction in ROS-mediated stimulation of a p38-MK2-HSP27 signaling cascade that controls Akt activation, directing Bad phosphorylation to promote cell survival. Furthermore, D-RIC null flies display increased susceptibility to environmental stresses and reduced stress-dependent p38 signaling, extending the Rit-p38 survival pathway to Drosophila. Together, our studies establish the Rit GTPases as critical regulators of an evolutionarily conserved, p38 MAPK–dependent signaling cascade that functions as an important survival mechanism for cells in response to oxidative stress. PMID:21737674

  1. Automatic annotation of experimentally derived, evolutionarily conserved post-translational modifications onto multiple genomes.

    PubMed

    Sridhara, Viswanadham; Marchler-Bauer, Aron; Bryant, Stephen H; Geer, Lewis Y

    2011-01-01

    New generation sequencing technologies have resulted in significant increases in the number of complete genomes. Functional characterization of these genomes, such as by high-throughput proteomics, is an important but challenging task due to the difficulty of scaling up existing experimental techniques. By use of comparative genomics techniques, experimental results can be transferred from one genome to another, while at the same time minimizing errors by requiring discovery in multiple genomes. In this study, protein phosphorylation, an essential component of many cellular processes, is studied using data from large-scale proteomics analyses of the phosphoproteome. Phosphorylation sites from Homo sapiens, Mus musculus and Drosophila melanogaster phosphopeptide data sets were mapped onto conserved domains in NCBI's manually curated portion of Conserved Domain Database (CDD). In this subset, 25 phosphorylation sites are found to be evolutionarily conserved between the three species studied. Transfer of phosphorylation annotation of these conserved sites onto sequences sharing the same conserved domains yield 3253 phosphosite annotations for proteins from coelomata, the taxonomic division that spans H. sapiens, M. musculus and D. melanogaster. The method scales automatically, so as the amount of experimental phosphoproteomics data increases, more conserved phosphorylation sites may be revealed.

  2. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges

    PubMed Central

    Lovci, Michael T; Ghanem, Dana; Marr, Henry; Arnold, Justin; Gee, Sherry; Parra, Marilyn; Liang, Tiffany Y; Stark, Thomas J; Gehman, Lauren T; Hoon, Shawn; Massirer, Katlin B; Pratt, Gabriel A; Black, Douglas L; Gray, Joe W; Conboy, John G; Yeo, Gene W

    2014-01-01

    Alternative splicing (AS) enables programmed diversity of gene expression across tissues and development. We show here that binding in distal intronic regions (>500 nucleotides (nt) from any exon) by Rbfox splicing factors important in development is extensive and is an active mode of splicing regulation. Similarly to exon-proximal sites, distal sites contain evolutionarily conserved GCATG sequences and are associated with AS activation and repression upon modulation of Rbfox abundance in human and mouse experimental systems. As a proof of principle, we validated the activity of two specific Rbfox enhancers in KIF21A and ENAH distal introns and showed that a conserved long-range RNA-RNA base-pairing interaction (an RNA bridge) is necessary for Rbfox-mediated exon inclusion in the ENAH gene. Thus we demonstrate a previously unknown RNA-mediated mechanism for AS control by distally bound RNA-binding proteins. PMID:24213538

  3. Rbfox proteins regulate alternative mRNA splicing through evolutionarily conserved RNA bridges.

    PubMed

    Lovci, Michael T; Ghanem, Dana; Marr, Henry; Arnold, Justin; Gee, Sherry; Parra, Marilyn; Liang, Tiffany Y; Stark, Thomas J; Gehman, Lauren T; Hoon, Shawn; Massirer, Katlin B; Pratt, Gabriel A; Black, Douglas L; Gray, Joe W; Conboy, John G; Yeo, Gene W

    2013-12-01

    Alternative splicing (AS) enables programmed diversity of gene expression across tissues and development. We show here that binding in distal intronic regions (>500 nucleotides (nt) from any exon) by Rbfox splicing factors important in development is extensive and is an active mode of splicing regulation. Similarly to exon-proximal sites, distal sites contain evolutionarily conserved GCATG sequences and are associated with AS activation and repression upon modulation of Rbfox abundance in human and mouse experimental systems. As a proof of principle, we validated the activity of two specific Rbfox enhancers in KIF21A and ENAH distal introns and showed that a conserved long-range RNA-RNA base-pairing interaction (an RNA bridge) is necessary for Rbfox-mediated exon inclusion in the ENAH gene. Thus we demonstrate a previously unknown RNA-mediated mechanism for AS control by distally bound RNA-binding proteins.

  4. Evolutionarily conserved CLE peptide signaling in plant development, symbiosis, and parasitism.

    PubMed

    Miyawaki, Kaori; Tabata, Ryo; Sawa, Shinichiro

    2013-10-01

    Small polypeptides are widely used as signaling molecules in cell-to-cell communication in animals and plants. The CLAVATA3/EMBRYO SURROUNDING REGION-RELATED (CLE) gene family is composed of numerous genes that contain conserved CLE domains in various plant species and plant-parasitic nematodes. Here, we review recent progress in our understanding of CLE signaling during stem cell maintenance in Arabidopsis and grasses. We also summarize the roles of CLE signaling in the legume-Rhizobium symbiosis and infection by plant-parasitic nematodes. CLE signaling is important for diverse aspects of cell-to-cell signaling and long-distance communication, which are critical for survival, and the basic components of the CLE signaling pathway are evolutionarily conserved in both plants and animals.

  5. Evolutionarily conserved coupling of adaptive and excitable networks mediates eukaryotic chemotaxis

    NASA Astrophysics Data System (ADS)

    Tang, Ming; Wang, Mingjie; Shi, Changji; Iglesias, Pablo A.; Devreotes, Peter N.; Huang, Chuan-Hsiang

    2014-10-01

    Numerous models explain how cells sense and migrate towards shallow chemoattractant gradients. Studies show that an excitable signal transduction network acts as a pacemaker that controls the cytoskeleton to drive motility. Here we show that this network is required to link stimuli to actin polymerization and chemotactic motility and we distinguish the various models of chemotaxis. First, signalling activity is suppressed towards the low side in a gradient or following removal of uniform chemoattractant. Second, signalling activities display a rapid shut off and a slower adaptation during which responsiveness to subsequent test stimuli decline. Simulations of various models indicate that these properties require coupled adaptive and excitable networks. Adaptation involves a G-protein-independent inhibitor, as stimulation of cells lacking G-protein function suppresses basal activities. The salient features of the coupled networks were observed for different chemoattractants in Dictyostelium and in human neutrophils, suggesting an evolutionarily conserved mechanism for eukaryotic chemotaxis.

  6. Nuclear autophagy: An evolutionarily conserved mechanism of nuclear degradation in the cytoplasm.

    PubMed

    Luo, Majing; Zhao, Xueya; Song, Ying; Cheng, Hanhua; Zhou, Rongjia

    2016-11-01

    Macroautophagy/autophagy is a catabolic process that is essential for cellular homeostasis. Studies on autophagic degradation of cytoplasmic components have generated interest in nuclear autophagy. Although its mechanisms and roles have remained elusive, tremendous progress has been made toward understanding nuclear autophagy. Nuclear autophagy is evolutionarily conserved in eukaryotes that may target various nuclear components through a series of processes, including nuclear sensing, nuclear export, autophagic substrate encapsulation and autophagic degradation in the cytoplasm. However, the molecular processes and regulatory mechanisms involved in nuclear autophagy remain largely unknown. Numerous studies have highlighted the importance of nuclear autophagy in physiological and pathological processes such as cancer. This review focuses on current advances in nuclear autophagy and provides a summary of its research history and landmark discoveries to offer new perspectives.

  7. EAG2 potassium channel with evolutionarily conserved function as a brain tumor target

    PubMed Central

    Huang, Xi; He, Ye; Dubuc, Adrian M.; Hashizume, Rintaro; Zhang, Wei; Reimand, Jüri; Yang, Huanghe; Wang, Tongfei A.; Stehbens, Samantha J.; Younger, Susan; Barshow, Suzanne; Zhu, Sijun; Cooper, Michael K.; Peacock, John; Ramaswamy, Vijay; Garzia, Livia; Wu, Xiaochong; Remke, Marc; Forester, Craig M.; Kim, Charles C.; Weiss, William A.; James, C. David; Shuman, Marc A.; Bader, Gary D.; Mueller, Sabine; Taylor, Michael D.; Jan, Yuh Nung; Jan, Lily Yeh

    2015-01-01

    Over 20% of the drugs for treating human diseases target ion channels, however, no cancer drug approved by the U.S. Food and Drug Administration (FDA) is intended to target an ion channel. Here, we demonstrate the evolutionarily conserved function of EAG2 potassium channel in promoting brain tumor growth and metastasis, delineate downstream pathways and uncover a mechanism for different potassium channels to functionally corporate and regulate mitotic cell volume and tumor progression. We show that EAG2 potassium channel is enriched at the trailing edge of migrating MB cells to regulate local cell volume dynamics, thereby facilitating cell motility. We identify the FDA-approved antipsychotic drug thioridazine as an EAG2 channel blocker that reduces xenografted MB growth and metastasis, and present a case report of repurposing thioridazine for treating a human patient. Our findings thus illustrate the potential of targeting ion channels in cancer treatment. PMID:26258683

  8. Nuclear autophagy: An evolutionarily conserved mechanism of nuclear degradation in the cytoplasm

    PubMed Central

    Luo, Majing; Zhao, Xueya; Song, Ying; Cheng, Hanhua; Zhou, Rongjia

    2016-01-01

    ABSTRACT Macroautophagy/autophagy is a catabolic process that is essential for cellular homeostasis. Studies on autophagic degradation of cytoplasmic components have generated interest in nuclear autophagy. Although its mechanisms and roles have remained elusive, tremendous progress has been made toward understanding nuclear autophagy. Nuclear autophagy is evolutionarily conserved in eukaryotes that may target various nuclear components through a series of processes, including nuclear sensing, nuclear export, autophagic substrate encapsulation and autophagic degradation in the cytoplasm. However, the molecular processes and regulatory mechanisms involved in nuclear autophagy remain largely unknown. Numerous studies have highlighted the importance of nuclear autophagy in physiological and pathological processes such as cancer. This review focuses on current advances in nuclear autophagy and provides a summary of its research history and landmark discoveries to offer new perspectives. PMID:27541589

  9. Evolutionarily Conserved Repulsive Guidance Role of Slit in the Silkworm Bombyx mori

    PubMed Central

    Liu, Chun; Cui, Wei-Zheng; Mu, Zhi-Mei; Zhao, Xiao; Liu, Qing-Xin

    2014-01-01

    Axon guidance molecule Slit is critical for the axon repulsion in neural tissues, which is evolutionarily conserved from planarians to humans. However, the function of Slit in the silkworm Bombyx mori was unknown. Here we showed that the structure of Bombyx mori Slit (BmSlit) was different from that in most other species in its C-terminal sequence. BmSlit was localized in the midline glial cell, the neuropil, the tendon cell, the muscle and the silk gland and colocalized with BmRobo1 in the neuropil, the muscle and the silk gland. Knock-down of Bmslit by RNA interference (RNAi) resulted in abnormal development of axons and muscles. Our results suggest that BmSlit has a repulsive role in axon guidance and muscle migration. Moreover, the localization of BmSlit in the silk gland argues for its important function in the development of the silk gland. PMID:25285792

  10. Development and Organization of the Evolutionarily Conserved Three-Layered Olfactory Cortex

    PubMed Central

    2017-01-01

    Abstract The olfactory cortex is part of the mammalian cerebral cortex together with the neocortex and the hippocampus. It receives direct input from the olfactory bulbs and participates in odor discrimination, association, and learning (Bekkers and Suzuki, 2013). It is thought to be an evolutionarily conserved paleocortex, which shares common characteristics with the three-layered general cortex of reptiles (Aboitiz et al., 2002). The olfactory cortex has been studied as a “simple model” to address sensory processing, though little is known about its precise cell origin, diversity, and identity. While the development and the cellular diversity of the six-layered neocortex are increasingly understood, the olfactory cortex remains poorly documented in these aspects. Here is a review of current knowledge of the development and organization of the olfactory cortex, keeping the analogy with those of the neocortex. The comparison of olfactory cortex and neocortex will allow the opening of evolutionary perspectives on cortical development. PMID:28144624

  11. RNA editing in bacteria recodes multiple proteins and regulates an evolutionarily conserved toxin-antitoxin system.

    PubMed

    Bar-Yaacov, Dan; Mordret, Ernest; Towers, Ruth; Biniashvili, Tammy; Soyris, Clara; Schwartz, Schraga; Dahan, Orna; Pilpel, Yitzhak

    2017-10-01

    Adenosine (A) to inosine (I) RNA editing is widespread in eukaryotes. In prokaryotes, however, A-to-I RNA editing was only reported to occur in tRNAs but not in protein-coding genes. By comparing DNA and RNA sequences of Escherichia coli, we show for the first time that A-to-I editing occurs also in prokaryotic mRNAs and has the potential to affect the translated proteins and cell physiology. We found 15 novel A-to-I editing events, of which 12 occurred within known protein-coding genes where they always recode a tyrosine (TAC) into a cysteine (TGC) codon. Furthermore, we identified the tRNA-specific adenosine deaminase (tadA) as the editing enzyme of all these editing sites, thus making it the first identified RNA editing enzyme that modifies both tRNAs and mRNAs. Interestingly, several of the editing targets are self-killing toxins that belong to evolutionarily conserved toxin-antitoxin pairs. We focused on hokB, a toxin that confers antibiotic tolerance by growth inhibition, as it demonstrated the highest level of such mRNA editing. We identified a correlated mutation pattern between the edited and a DNA hard-coded Cys residue positions in the toxin and demonstrated that RNA editing occurs in hokB in two additional bacterial species. Thus, not only the toxin is evolutionarily conserved but also the editing itself within the toxin is. Finally, we found that RNA editing in hokB increases as a function of cell density and enhances its toxicity. Our work thus demonstrates the occurrence, regulation, and functional consequences of RNA editing in bacteria. © 2017 Bar-Yaacov et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Phylogenetic Footprinting Reveals Evolutionarily Conserved Regions of the Gonadotropin-Releasing Hormone Gene that Enhance Cell-Specific Expression

    PubMed Central

    GIVENS, MARJORY L.; KUROTANI, REIKO; RAVE-HAREL, NAAMA; MILLER, NICHOL L. G.; MELLON, PAMELA L.

    2010-01-01

    Reproductive function is controlled by the hypothalamic neuropeptide, GnRH, which serves as the central regulator of the hypothalamic-pituitary-gonadal axis. GnRH expression is limited to a small population of neurons in the hypothalamus. Targeting this minute population of neurons (as few as 800 in the mouse) requires regulatory elements upstream of the GnRH gene that remain to be fully characterized. Previously, we have identified an evolutionarily conserved promoter region (−173 to −1) and an enhancer (−1863 to −1571) in the rat gene that targets a subset of the GnRH neurons in vivo. In the present study, we used phylogenetic sequence comparison between human and rodents and analysis of the transcription factor clusters within conserved regions in an attempt to identify additional upstream regulatory elements. This approach led to the characterization of a new upstream enhancer that regulates expression of GnRH in a cell-specific manner. Within this upstream enhancer are nine binding sites for Octamer-binding transcription factor 1 (OCT1), known to be an important transcriptional regulator of GnRH gene expression. In addition, we have identified nuclear factor I (NF1) binding to multiple elements in the GnRH-regulatory regions, each in close proximity to OCT1. We show that OCT1 and NF1 physically and functionally interact. Moreover, the OCT1 and NF1 binding sites in the regulatory regions appear to be essential for appropriate GnRH gene expression. These findings indicate a role for this upstream enhancer and novel OCT1/NF1 complexes in neuron-restricted expression of the GnRH gene. PMID:15319450

  13. Evolutionary conservation of bacterial operons: does transcriptional connectivity matter?

    PubMed

    Hazkani-Covo, Einat; Graur, Dan

    2005-07-01

    In the literature, it has been frequently suggested that the connectivity of a protein, i.e., the number of proteins with which it interacts, is inversely correlated with the rate of evolution. We attempted to extrapolate from proteins to operons by testing the hypothesis that operons with high transcriptional connectivity, i.e., operons that are controlled through interactions with many transcription factors, are evolutionarily more conserved at the structure and sequence levels than low-connectivity operons. With Escherichia coli used as reference, two structural- and two sequence-conservation measures were determined for 82 groups of homologous operons from 30 completely-sequenced bacterial genomes. In E. coli, large operons tend to be regulated by more transcription factors than either smaller operons or single genes. Large E. coli operons that are regulated by single transcription factors were found to be regulated by activators more frequently than by repressors. Levels of sequence conservation and structural conservation of operons were found to be independent of each other, i.e., structurally conserved operons may be divergent in sequence, and vice versa. Transcriptional connectivity was found to influence neither sequence nor structural conservation of operons. Although this finding seems to contradict the situation in genes, a critical review of the literature indicates that although gene connectivity is frequently touted as a factor in determining rates of evolution, only a very small fraction of the variability in degrees of evolutionary conservation is explainable by this factor.

  14. Evolutionarily distinct bacteriophage endolysins featuring conserved peptidoglycan cleavage sites protect mice from MRSA infection

    PubMed Central

    Schmelcher, Mathias; Shen, Yang; Nelson, Daniel C.; Eugster, Marcel R.; Eichenseher, Fritz; Hanke, Daniela C.; Loessner, Martin J.; Dong, Shengli; Pritchard, David G.; Lee, Jean C.; Becker, Stephen C.; Foster-Frey, Juli; Donovan, David M.

    2015-01-01

    Objectives In the light of increasing drug resistance in Staphylococcus aureus, bacteriophage endolysins [peptidoglycan hydrolases (PGHs)] have been suggested as promising antimicrobial agents. The aim of this study was to determine the antimicrobial activity of nine enzymes representing unique homology groups within a diverse class of staphylococcal PGHs. Methods PGHs were recombinantly expressed, purified and tested for staphylolytic activity in multiple in vitro assays (zymogram, turbidity reduction assay and plate lysis) and against a comprehensive set of strains (S. aureus and CoNS). PGH cut sites in the staphylococcal peptidoglycan were determined by biochemical assays (Park–Johnson and Ghuysen procedures) and MS analysis. The enzymes were tested for their ability to eradicate static S. aureus biofilms and compared for their efficacy against systemic MRSA infection in a mouse model. Results Despite similar modular architectures and unexpectedly conserved cleavage sites in the peptidoglycan (conferred by evolutionarily divergent catalytic domains), the enzymes displayed varying degrees of in vitro lytic activity against numerous staphylococcal strains, including cell surface mutants and drug-resistant strains, and proved effective against static biofilms. In a mouse model of systemic MRSA infection, six PGHs provided 100% protection from death, with animals being free of clinical signs at the end of the experiment. Conclusions Our results corroborate the high potential of PGHs for treatment of S. aureus infections and reveal unique antimicrobial and biochemical properties of the different enzymes, suggesting a high diversity of potential applications despite highly conserved peptidoglycan target sites. PMID:25630640

  15. Human growth is associated with distinct patterns of gene expression in evolutionarily conserved networks

    PubMed Central

    2013-01-01

    Background A co-ordinated tissue-independent gene expression profile associated with growth is present in rodent models and this is hypothesised to extend to all mammals. Growth in humans has similarities to other mammals but the return to active long bone growth in the pubertal growth spurt is a distinctly human growth event. The aim of this study was to describe gene expression and biological pathways associated with stages of growth in children and to assess tissue-independent expression patterns in relation to human growth. Results We conducted gene expression analysis on a library of datasets from normal children with age annotation, collated from the NCBI Gene Expression Omnibus (GEO) and EBI Arrayexpress databases. A primary data set was generated using cells of lymphoid origin from normal children; the expression of 688 genes (ANOVA false discovery rate modified p-value, q < 0.1) was associated with age, and subsets of these genes formed clusters that correlated with the phases of growth – infancy, childhood, puberty and final height. Network analysis on these clusters identified evolutionarily conserved growth pathways (NOTCH, VEGF, TGFB, WNT and glucocorticoid receptor – Hyper-geometric test, q < 0.05). The greatest degree of network ‘connectivity’ and hence functional significance was present in infancy (Wilcoxon test, p < 0.05), which then decreased through to adulthood. These observations were confirmed in a separate validation data set from lymphoid tissue. Similar biological pathways were observed to be associated with development-related gene expression in other tissues (conjunctival epithelia, temporal lobe brain tissue and bone marrow) suggesting the existence of a tissue-independent genetic program for human growth and maturation. Conclusions Similar evolutionarily conserved pathways have been associated with gene expression and child growth in multiple tissues. These expression profiles associate with the developmental phases

  16. Evolutionarily divergent spliceosomal snRNAs and a conserved non-coding RNA processing motif in Giardia lamblia

    PubMed Central

    Hudson, Andrew J.; Moore, Ashley N.; Elniski, David; Joseph, Joella; Yee, Janet; Russell, Anthony G.

    2012-01-01

    Non-coding RNAs (ncRNAs) have diverse essential biological functions in all organisms, and in eukaryotes, two such classes of ncRNAs are the small nucleolar (sno) and small nuclear (sn) RNAs. In this study, we have identified and characterized a collection of sno and snRNAs in Giardia lamblia, by exploiting our discovery of a conserved 12 nt RNA processing sequence motif found in the 3′ end regions of a large number of G. lamblia ncRNA genes. RNA end mapping and other experiments indicate the motif serves to mediate ncRNA 3′ end formation from mono- and di-cistronic RNA precursor transcripts. Remarkably, we find the motif is also utilized in the processing pathway of all four previously identified trans-spliced G. lamblia introns, revealing a common RNA processing pathway for ncRNAs and trans-spliced introns in this organism. Motif sequence conservation then allowed for the bioinformatic and experimental identification of additional G. lamblia ncRNAs, including new U1 and U6 spliceosomal snRNA candidates. The U6 snRNA candidate was then used as a tool to identity novel U2 and U4 snRNAs, based on predicted phylogenetically conserved snRNA–snRNA base-pairing interactions, from a set of previously identified G. lamblia ncRNAs without assigned function. The Giardia snRNAs retain the core features of spliceosomal snRNAs but are sufficiently evolutionarily divergent to explain the difficulties in their identification. Most intriguingly, all of these snRNAs show structural features diagnostic of U2-dependent/major and U12-dependent/minor spliceosomal snRNAs. PMID:23019220

  17. Evolutionarily divergent spliceosomal snRNAs and a conserved non-coding RNA processing motif in Giardia lamblia.

    PubMed

    Hudson, Andrew J; Moore, Ashley N; Elniski, David; Joseph, Joella; Yee, Janet; Russell, Anthony G

    2012-11-01

    Non-coding RNAs (ncRNAs) have diverse essential biological functions in all organisms, and in eukaryotes, two such classes of ncRNAs are the small nucleolar (sno) and small nuclear (sn) RNAs. In this study, we have identified and characterized a collection of sno and snRNAs in Giardia lamblia, by exploiting our discovery of a conserved 12 nt RNA processing sequence motif found in the 3' end regions of a large number of G. lamblia ncRNA genes. RNA end mapping and other experiments indicate the motif serves to mediate ncRNA 3' end formation from mono- and di-cistronic RNA precursor transcripts. Remarkably, we find the motif is also utilized in the processing pathway of all four previously identified trans-spliced G. lamblia introns, revealing a common RNA processing pathway for ncRNAs and trans-spliced introns in this organism. Motif sequence conservation then allowed for the bioinformatic and experimental identification of additional G. lamblia ncRNAs, including new U1 and U6 spliceosomal snRNA candidates. The U6 snRNA candidate was then used as a tool to identity novel U2 and U4 snRNAs, based on predicted phylogenetically conserved snRNA-snRNA base-pairing interactions, from a set of previously identified G. lamblia ncRNAs without assigned function. The Giardia snRNAs retain the core features of spliceosomal snRNAs but are sufficiently evolutionarily divergent to explain the difficulties in their identification. Most intriguingly, all of these snRNAs show structural features diagnostic of U2-dependent/major and U12-dependent/minor spliceosomal snRNAs.

  18. Evolutionarily Ancient Association of the FoxJ1 Transcription Factor with the Motile Ciliogenic Program

    PubMed Central

    Ho, Hao Kee; Babu, Deepak; Eitel, Michael; Narasimhan, Vijayashankaranarayanan; Tiku, Varnesh; Westbrook, Jody; Schierwater, Bernd; Roy, Sudipto

    2012-01-01

    It is generally believed that the last eukaryotic common ancestor (LECA) was a unicellular organism with motile cilia. In the vertebrates, the winged-helix transcription factor FoxJ1 functions as the master regulator of motile cilia biogenesis. Despite the antiquity of cilia, their highly conserved structure, and their mechanism of motility, the evolution of the transcriptional program controlling ciliogenesis has remained incompletely understood. In particular, it is presently not known how the generation of motile cilia is programmed outside of the vertebrates, and whether and to what extent the FoxJ1-dependent regulation is conserved. We have performed a survey of numerous eukaryotic genomes and discovered that genes homologous to foxJ1 are restricted only to organisms belonging to the unikont lineage. Using a mis-expression assay, we then obtained evidence of a conserved ability of FoxJ1 proteins from a number of diverse phyletic groups to activate the expression of a host of motile ciliary genes in zebrafish embryos. Conversely, we found that inactivation of a foxJ1 gene in Schmidtea mediterranea, a platyhelminth (flatworm) that utilizes motile cilia for locomotion, led to a profound disruption in the differentiation of motile cilia. Together, all of these findings provide the first evolutionary perspective into the transcriptional control of motile ciliogenesis and allow us to propose a conserved FoxJ1-regulated mechanism for motile cilia biogenesis back to the origin of the metazoans. PMID:23144623

  19. The evolutionarily conserved EBR module of RALT/MIG6 mediates suppression of the EGFR catalytic activity.

    PubMed

    Anastasi, S; Baietti, M F; Frosi, Y; Alemà, S; Segatto, O

    2007-12-13

    Physiological signalling by the epidermal growth factor receptor (EGFR) controls developmental processes and tissue homeostasis, whereas aberrant EGFR activity drives oncogenic cell transformation. Under normal conditions, the EGFR must therefore generate outputs of defined strength and duration. To this aim, cells balance EGFR activity via different modalities of negative signalling. Increasing attention is being drawn on transcriptionally controlled feedback inhibitors of EGFR, namely RALT/MIG6, LRIG1, SOCS4 and SOCS5. Genetic studies in mice have revealed the essential role of Ralt/Mig6 in regulating Egfr-driven skin morphogenesis and tumour formation, yet the mechanisms through which RALT abrogates EGFR activity are still undefined. We report that RALT suppresses EGFR function by inhibiting its catalytic activity. The evolutionarily conserved ErbB-binding region (EBR) is necessary and sufficient to carry out RALT-dependent suppression of EGFR kinase activity in vitro and in intact cells. The mechanism involves binding of the EBR to the 953RYLVIQ958 sequence, which is located in the alphaI helix of the EGFR kinase and has been shown to participate in allosteric control of EGFR catalytic activity. Our results uncover a novel mechanism of temporal regulation of EGFR activity in vertebrate organisms.

  20. Evolutionarily conserved long intergenic non-coding RNAs in the eye

    PubMed Central

    Mustafi, Debarshi; Kevany, Brian M.; Bai, Xiaodong; Maeda, Tadao; Sears, Jonathan E.; Khalil, Ahmad M.; Palczewski, Krzysztof

    2013-01-01

    The discovery that the mammalian transcriptome encodes thousands of long intergenic non-coding (linc) RNA transcripts, together with recent evidence that lincRNAs can regulate protein-coding genes, has added a new level of complexity to cellular transcriptional/translational regulation. Indeed several reports now link mutations in lincRNAs to heritable human disorders. Here, we identified a subset of lincRNAs in terminally differentiated adult human retinal neurons based on their sequence conservation across species. RNA sequencing of eye tissue from several mammalian species with varied rod/cone photoreceptor content identified 18 lincRNAs that were highly conserved across these species. Sixteen of the 18 were conserved in human retinal tissue with 14 of these also conserved in the macular region. A subset of lincRNAs exhibited restricted tissue expression profiles in mice, with preferential expression in the retina. Mouse models with different populations of retinal cells as well as in situ hybridization provided evidence that these lincRNAs localized to specific retinal compartments, most notably to the photoreceptor neuronal layer. Computational genomic loci and promoter region analyses provided a basis for regulated expression of these conserved lincRNAs in retinal post-mitotic neurons. This combined approach identified several lincRNAs that could be critical for retinal and visual maintenance in adults. PMID:23562822

  1. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins.

    PubMed

    Michishita, Eriko; Park, Jean Y; Burneskis, Jenna M; Barrett, J Carl; Horikawa, Izumi

    2005-10-01

    Sir2 is a NAD+-dependent protein deacetylase that extends lifespan in yeast and worms. This study examines seven human proteins homologous to Sir2 (SIRT1 through SIRT7) for cellular localization, expression profiles, protein deacetylation activity, and effects on human cell lifespan. We found that: 1) three nuclear SIRT proteins (SIRT1, SIRT6, and SIRT7) show different subnuclear localizations: SIRT6 and SIRT7 are associated with heterochromatic regions and nucleoli, respectively, where yeast Sir2 functions; 2) SIRT3, SIRT4, and SIRT5 are localized in mitochondria, an organelle that links aging and energy metabolism; 3) cellular p53 is a major in vivo substrate of SIRT1 deacetylase, but not the other six SIRT proteins; 4) SIRT1, but not the other two nuclear SIRT proteins, shows an in vitro deacetylase activity on histone H4 and p53 peptides; and 5) overexpression of any one of the seven SIRT proteins does not extend cellular replicative lifespan in normal human fibroblasts or prostate epithelial cells. This study supports the notion that multiple human SIRT proteins have evolutionarily conserved and nonconserved functions at different cellular locations and reveals that the lifespan of normal human cells, in contrast to that of lower eukaryotes, cannot be manipulated by increased expression of a single SIRT protein.

  2. An evolutionarily conserved element in initiator tRNAs prompts ultimate steps in ribosome maturation.

    PubMed

    Shetty, Sunil; Varshney, Umesh

    2016-10-11

    Ribosome biogenesis, a complex multistep process, results in correct folding of rRNAs, incorporation of >50 ribosomal proteins, and their maturation. Deficiencies in ribosome biogenesis may result in varied faults in translation of mRNAs causing cellular toxicities and ribosomopathies in higher organisms. How cells ensure quality control in ribosome biogenesis for the fidelity of its complex function remains unclear. Using Escherichia coli, we show that initiator tRNA (i-tRNA), specifically the evolutionarily conserved three consecutive GC base pairs in its anticodon stem, play a crucial role in ribosome maturation. Deficiencies in cellular contents of i-tRNA confer cold sensitivity and result in accumulation of ribosomes with immature 3' and 5' ends of the 16S rRNA. Overexpression of i-tRNA in various strains rescues biogenesis defects. Participation of i-tRNA in the first round of initiation complex formation licenses the final steps of ribosome maturation by signaling RNases to trim the terminal extensions of immature 16S rRNA.

  3. An evolutionarily conserved epigenetic element converts wild fungi from metabolic specialists to generalists

    PubMed Central

    Jarosz, Daniel F.; Lancaster, Alex K.; Brown, Jessica C.S.; Lindquist, Susan

    2015-01-01

    SUMMARY [GAR+] is a protein-based element of inheritance that allows yeast (Saccharomyces cerevisiae) to circumvent a normal hallmark of their biology: extreme metabolic specialization for glucose fermentation. When glucose is present, even in trace quantities, yeast will not use other carbon sources. [GAR+] allows cells to circumvent this “glucose repression.” [GAR+] is induced in yeast by a factor secreted by bacteria inhabiting their environment. We report that the de novo rates of [GAR+] appearance correlate with the yeast’s ecological niche. Evolutionarily distant fungi possess similar epigenetic elements that are also induced by bacteria. As expected for a mechanism whose adaptive value originates from the selective pressures of life in biological communities, the ability of bacteria to induce [GAR+] and the ability of yeast to respond to bacterial signals have been extinguished repeatedly during the extended monoculture of domestication. Thus, [GAR+] is a broadly conserved adaptive strategy that links environmental and social cues to heritable changes in metabolism. PMID:25171408

  4. Tubulin Binding and Polymerization Promoting Properties of Tubulin Polymerization Promoting Proteins Are Evolutionarily Conserved.

    PubMed

    Oláh, Judit; Szénási, Tibor; Szabó, Adél; Kovács, Kinga; Lőw, Péter; Štifanić, Mauro; Orosz, Ferenc

    2017-02-21

    Tubulin polymerization promoting proteins (TPPPs) constitute a eukaryotic protein family. There are three TPPP paralogs in the human genome, denoted as TPPP1-TPPP3. TPPP1 and TPPP3 are intrinsically unstructured proteins (IUPs) that bind and polymerize tubulin and stabilize microtubules, but TPPP2 does not. Vertebrate TPPPs originated from the ancient invertebrate TPPP by two-round whole-genome duplication; thus, whether the tubulin/microtubule binding function of TPPP1 and TPPP3 is a newly acquired property or was present in the invertebrate orthologs (generally one TPPP per species) has been an open question. To answer this question, we investigated a TPPP from a simple and early branching animal, the sponge Suberites domuncula. Bioinformatics, biochemical, immunochemical, spectroscopic, and electron microscopic data showed that the properties of the sponge protein correspond to those of TPPP1; namely, it is an IUP that strongly binds tubulin and induces its polymerization, proving that these features of animal TPPPs have been evolutionarily conserved.

  5. Trichohyalin-like proteins have evolutionarily conserved roles in the morphogenesis of skin appendages.

    PubMed

    Mlitz, Veronika; Strasser, Bettina; Jaeger, Karin; Hermann, Marcela; Ghannadan, Minoo; Buchberger, Maria; Alibardi, Lorenzo; Tschachler, Erwin; Eckhart, Leopold

    2014-11-01

    S100 fused-type proteins (SFTPs) such as filaggrin, trichohyalin, and cornulin are differentially expressed in cornifying keratinocytes of the epidermis and various skin appendages. To determine evolutionarily conserved, and thus presumably important, features of SFTPs, we characterized nonmammalian SFTPs and compared their amino acid sequences and expression patterns with those of mammalian SFTPs. We identified an ortholog of cornulin and a previously unknown SFTP, termed scaffoldin, in reptiles and birds, whereas filaggrin was confined to mammals. In contrast to mammalian SFTPs, both cornulin and scaffoldin of the chicken are expressed in the embryonic periderm. However, scaffoldin resembles mammalian trichohyalin with regard to its expression in the filiform papillae of the tongue and in the epithelium underneath the forming tips of the claws. Furthermore, scaffoldin is expressed in the epithelial sheath around growing feathers, reminiscent of trichohyalin expression in the inner root sheath of hair. The results of this study show that SFTP-positive epithelia function as scaffolds for the growth of diverse skin appendages such as claws, nails, hair, and feathers, indicating a common evolutionary origin.

  6. Evolutionarily conserved mechanisms for the selection and maintenance of behavioural activity

    PubMed Central

    Fiore, Vincenzo G.; Dolan, Raymond J.; Strausfeld, Nicholas J.; Hirth, Frank

    2015-01-01

    Survival and reproduction entail the selection of adaptive behavioural repertoires. This selection manifests as phylogenetically acquired activities that depend on evolved nervous system circuitries. Lorenz and Tinbergen already postulated that heritable behaviours and their reliable performance are specified by genetically determined programs. Here we compare the functional anatomy of the insect central complex and vertebrate basal ganglia to illustrate their role in mediating selection and maintenance of adaptive behaviours. Comparative analyses reveal that central complex and basal ganglia circuitries share comparable lineage relationships within clusters of functionally integrated neurons. These clusters are specified by genetic mechanisms that link birth time and order to their neuronal identities and functions. Their subsequent connections and associated functions are characterized by similar mechanisms that implement dimensionality reduction and transition through attractor states, whereby spatially organized parallel-projecting loops integrate and convey sensorimotor representations that select and maintain behavioural activity. In both taxa, these neural systems are modulated by dopamine signalling that also mediates memory-like processes. The multiplicity of similarities between central complex and basal ganglia suggests evolutionarily conserved computational mechanisms for action selection. We speculate that these may have originated from ancestral ground pattern circuitries present in the brain of the last common ancestor of insects and vertebrates. PMID:26554043

  7. Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA

    PubMed Central

    Školáková, Petra; Foldynová-Trantírková, Silvie; Bednářová, Klára; Fiala, Radovan; Vorlíčková, Michaela; Trantírek, Lukáš

    2015-01-01

    There are two basic mechanisms that are associated with the maintenance of the telomere length, which endows cancer cells with unlimited proliferative potential. One mechanism, referred to as alternative lengthening of telomeres (ALT), accounts for approximately 10–15% of all human cancers. Tumours engaged in the ALT pathway are characterised by the presence of the single stranded 5′-C-rich telomeric overhang (C-overhang). This recently identified hallmark of ALT cancers distinguishes them from healthy tissues and renders the C-overhang as a clear target for anticancer therapy. We analysed structures of the 5′-C-rich and 3′-G-rich telomeric overhangs from human and Caenorhabditis elegans, the recently established multicellular in vivo model of ALT tumours. We show that the telomeric DNA from C. elegans and humans forms fundamentally different secondary structures. The unique structural characteristics of C. elegans telomeric DNA that are distinct not only from those of humans but also from those of other multicellular eukaryotes allowed us to identify evolutionarily conserved properties of telomeric DNA. Differences in structural organisation of the telomeric DNA between the C. elegans and human impose limitations on the use of the C. elegans as an ALT tumour model. PMID:25855805

  8. Maximal Expression of the Evolutionarily Conserved Slit2 Gene Promoter Requires Sp1

    PubMed Central

    Saunders, Jacquelyn; Wisidagama, D. Roonalika; Morford, Travis; Malone, Cindy S.

    2015-01-01

    Slit2 is a neural axon guidance and chemorepellent protein that stimulates motility in a variety of cell types. The role of Slit2 in neural development and neoplastic growth and migration has been well established, while the genetic mechanisms underlying regulation of the Slit2 gene have not. We identified the core and proximal promoter of Slit2 by mapping multiple transcriptional start sites, analyzing transcriptional activity, and confirming sequence homology for the Slit2 proximal promoter among a number of species. Deletion series and transient transfection identified the Slit2 proximal promoter as within 399 base pairs upstream of the start of transcription. A crucial region for full expression of the Slit2 proximal promoter lies between 399 base pairs and 296 base pairs upstream of the start of transcription. Computer modeling identified three transcription factor binding consensus sites within this region, of which only site-directed mutagenesis of one of the two identified Sp1 consensus sites inhibited transcriptional activity of the Slit2 proximal promoter (−399 to +253). Bioinformatics analysis of the Slit2 proximal promoter −399 base pair to −296 base pair region shows high sequence conservation over twenty-two species, and that this region follows an expected pattern of sequence divergence through evolution. PMID:26456684

  9. An evolutionarily conserved mode of modulation of Shaw-like K+ channels

    PubMed Central

    Cotella, Diego; Hernandez-Enriquez, Berenice; Duan, Zhibing; Wu, Xilong; Gazula, Valeswara-Rao; Brown, Maile R.; Kaczmarek, Leonard K.; Sesti, Federico

    2013-01-01

    Voltage-gated K+ channels of the Shaw family (also known as the KCNC or Kv3 family) play pivotal roles in mammalian brains, and genetic or pharmacological disruption of their activities in mice results in a spectrum of behavioral defects. We have used the model system of Caenorhabditis elegans to elucidate conserved molecular mechanisms that regulate these channels. We have now found that the C. elegans Shaw channel KHT-1, and its mammalian homologue, murine Kv3.1b, are both modulated by acid phosphatases. Thus, the C. elegans phosphatase ACP-2 is stably associated with KHT-1, while its mammalian homolog, prostatic acid phosphatase (PAP; also known as ACPP-201) stably associates with murine Kv3.1b K+ channels in vitro and in vivo. In biochemical experiments both phosphatases were able to reverse phosphorylation of their associated channel. The effect of phosphorylation on both channels is to produce a decrease in current amplitude and electrophysiological analyses demonstrated that dephosphorylation reversed the effects of phosphorylation on the magnitude of the macroscopic currents. ACP-2 and KHT-1 were colocalized in the nervous system of C. elegans and, in the mouse nervous system, PAP and Kv3.1b were colocalized in subsets of neurons, including in the brain stem and the ventricular zone. Taken together, this body of evidence suggests that acid phosphatases are general regulatory partners of Shaw-like K+ channels.—Cotella, D., Hernandez-Enriquez, B., Duan, Z., Wu, X., Gazula, V.-R., Brown, M. R., Kaczmarek, L. K., and Sesti, F. An evolutionarily conserved mode of modulation of Shaw-like K+ channels. PMID:23233530

  10. Unique amino acid signatures that are evolutionarily conserved distinguish simple-type, epidermal and hair keratins

    PubMed Central

    Strnad, Pavel; Usachov, Valentyn; Debes, Cedric; Gräter, Frauke; Parry, David A. D.; Omary, M. Bishr

    2011-01-01

    Keratins (Ks) consist of central α-helical rod domains that are flanked by non-α-helical head and tail domains. The cellular abundance of keratins, coupled with their selective cell expression patterns, suggests that they diversified to fulfill tissue-specific functions although the primary structure differences between them have not been comprehensively compared. We analyzed keratin sequences from many species: K1, K2, K5, K9, K10, K14 were studied as representatives of epidermal keratins, and compared with K7, K8, K18, K19, K20 and K31, K35, K81, K85, K86, which represent simple-type (single-layered or glandular) epithelial and hair keratins, respectively. We show that keratin domains have striking differences in their amino acids. There are many cysteines in hair keratins but only a small number in epidermal keratins and rare or none in simple-type keratins. The heads and/or tails of epidermal keratins are glycine and phenylalanine rich but alanine poor, whereas parallel domains of hair keratins are abundant in prolines, and those of simple-type epithelial keratins are enriched in acidic and/or basic residues. The observed differences between simple-type, epidermal and hair keratins are highly conserved throughout evolution. Cysteines and histidines, which are infrequent keratin amino acids, are involved in de novo mutations that are markedly overrepresented in keratins. Hence, keratins have evolutionarily conserved and domain-selectively enriched amino acids including glycine and phenylalanine (epidermal), cysteine and proline (hair), and basic and acidic (simple-type epithelial), which reflect unique functions related to structural flexibility, rigidity and solubility, respectively. Our findings also support the importance of human keratin ‘mutation hotspot’ residues and their wild-type counterparts. PMID:22215855

  11. Damping capacity is evolutionarily conserved in the radial silk of orb-weaving spiders.

    PubMed

    Kelly, Sean P; Sensenig, Andrew; Lorentz, Kimberly A; Blackledge, Todd A

    2011-09-01

    Orb-weaving spiders depend upon their two-dimensional silk traps to stop insects in mid flight. While the silks used to construct orb webs must be extremely tough to absorb the tremendous kinetic energy of insect prey, webs must also minimize the return of that energy to prey to prevent insects from bouncing out of oscillating webs. We therefore predict that the damping capacity of major ampullate spider silk, which forms the supporting frames and radial threads of orb webs, should be evolutionarily conserved among orb-weaving spiders. We test this prediction by comparing silk from six diverse species of orb spiders. Silk was taken directly from the radii of orb webs and a Nano Bionix test system was used either to sequentially extend the silk to 25% strain in 5% increments while relaxing it fully between each cycle, or to pull virgin silk samples to 15% strain. Damping capacity was then calculated as the percent difference in loading and unloading energies. Damping capacity increased after yield for all species and typically ranged from 40 to 50% within each cycle for sequentially pulled silk and from 50 to 70% for virgin samples. Lower damping at smaller strains may allow orb webs to withstand minor perturbations from wind and small prey while still retaining the ability to capture large insects. The similarity in damping capacity of silk from the radii spun by diverse spiders highlights the importance of energy absorption by silk for orb-weaving spiders. Copyright © 2011 Elsevier GmbH. All rights reserved.

  12. Evolutionarily-conserved prefrontal-amygdalar dysfunction in early-life anxiety

    PubMed Central

    Birn, Rasmus M.; Shackman, Alexander J.; Oler, Jonathan A.; Williams, Lisa E.; McFarlin, Daniel R.; Rogers, Gregory M.; Shelton, Steven E.; Alexander, Andrew L.; Pine, Daniel S.; Slattery, Marcia J.; Davidson, Richard J.; Fox, Andrew S.; Kalin, Ned H.

    2014-01-01

    Some individuals are endowed with a biology that renders them more reactive to novelty and potential threat. When extreme, this anxious temperament (AT) confers elevated risk for the development of anxiety, depression, and substance abuse. These disorders are highly prevalent, debilitating, and can be challenging to treat. The high-risk AT phenotype is expressed similarly in children and young monkeys and mechanistic work demonstrates that the central nucleus (Ce) of the amygdala is an important substrate. While it is widely believed that the flow of information across the structural network connecting the Ce to other brain regions underlies primates' capacity for flexibly regulating anxiety, the functional architecture of this network has remained poorly understood. Here we used functional magnetic resonance imaging (fMRI) in anesthetized young monkeys and quietly resting children with anxiety disorders to identify an evolutionarily-conserved pattern of functional connectivity relevant to early-life anxiety. Across primate species and levels of awareness, reduced functional connectivity between the dorsolateral prefrontal cortex (dlPFC), a region thought to play a central role in the control of cognition and emotion, and the Ce was associated with increased anxiety assessed outside the scanner. Importantly, high-resolution 18-fluorodeoxyglucose positron emission tomography (FDG-PET) imaging provided evidence that elevated Ce metabolism statistically mediates the association between prefrontal-amygdalar connectivity and elevated anxiety. These results provide new clues about the brain network underlying extreme early-life anxiety and set the stage for mechanistic work aimed at developing improved interventions for pediatric anxiety. PMID:24863147

  13. Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells

    PubMed Central

    Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.

    2017-01-01

    The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID

  14. An Evolutionarily Conserved PLC-PKD-TFEB Pathway for Host Defense.

    PubMed

    Najibi, Mehran; Labed, Sid Ahmed; Visvikis, Orane; Irazoqui, Javier Elbio

    2016-05-24

    The mechanisms that tightly control the transcription of host defense genes have not been fully elucidated. We previously identified TFEB as a transcription factor important for host defense, but the mechanisms that regulate TFEB during infection remained unknown. Here, we used C. elegans to discover a pathway that activates TFEB during infection. Gene dkf-1, which encodes a homolog of protein kinase D (PKD), was required for TFEB activation in nematodes infected with Staphylococcus aureus. Conversely, pharmacological activation of PKD was sufficient to activate TFEB. Furthermore, phospholipase C (PLC) gene plc-1 was also required for TFEB activation, downstream of Gαq homolog egl-30 and upstream of dkf-1. Using reverse and chemical genetics, we discovered a similar PLC-PKD-TFEB axis in Salmonella-infected mouse macrophages. In addition, PKCα was required in macrophages. These observations reveal a previously unknown host defense signaling pathway, which has been conserved across one billion years of evolution.

  15. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling1[OPEN

    PubMed Central

    2015-01-01

    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. PMID:25897001

  16. An Evolutionarily Conserved DOF-CONSTANS Module Controls Plant Photoperiodic Signaling.

    PubMed

    Lucas-Reina, Eva; Romero-Campero, Francisco J; Romero, José M; Valverde, Federico

    2015-06-01

    The response to daylength is a crucial process that evolved very early in plant evolution, entitling the early green eukaryote to predict seasonal variability and attune its physiological responses to the environment. The photoperiod responses evolved into the complex signaling pathways that govern the angiosperm floral transition today. The Chlamydomonas reinhardtii DNA-Binding with One Finger (CrDOF) gene controls transcription in a photoperiod-dependent manner, and its misexpression influences algal growth and viability. In short days, CrDOF enhances CrCO expression, a homolog of plant CONSTANS (CO), by direct binding to its promoter, while it reduces the expression of cell division genes in long days independently of CrCO. In Arabidopsis (Arabidopsis thaliana), transgenic plants overexpressing CrDOF show floral delay and reduced expression of the photoperiodic genes CO and FLOWERING LOCUS T. The conservation of the DOF-CO module during plant evolution could be an important clue to understanding diversification by the inheritance of conserved gene toolkits in key developmental programs. © 2015 American Society of Plant Biologists. All Rights Reserved.

  17. Dissecting the Gene Network of Dietary Restriction to Identify Evolutionarily Conserved Pathways and New Functional Genes

    PubMed Central

    Wuttke, Daniel; Connor, Richard; Vora, Chintan; Craig, Thomas; Li, Yang; Wood, Shona; Vasieva, Olga; Shmookler Reis, Robert; Tang, Fusheng; de Magalhães, João Pedro

    2012-01-01

    Dietary restriction (DR), limiting nutrient intake from diet without causing malnutrition, delays the aging process and extends lifespan in multiple organisms. The conserved life-extending effect of DR suggests the involvement of fundamental mechanisms, although these remain a subject of debate. To help decipher the life-extending mechanisms of DR, we first compiled a list of genes that if genetically altered disrupt or prevent the life-extending effects of DR. We called these DR–essential genes and identified more than 100 in model organisms such as yeast, worms, flies, and mice. In order for other researchers to benefit from this first curated list of genes essential for DR, we established an online database called GenDR (http://genomics.senescence.info/diet/). To dissect the interactions of DR–essential genes and discover the underlying lifespan-extending mechanisms, we then used a variety of network and systems biology approaches to analyze the gene network of DR. We show that DR–essential genes are more conserved at the molecular level and have more molecular interactions than expected by chance. Furthermore, we employed a guilt-by-association method to predict novel DR–essential genes. In budding yeast, we predicted nine genes related to vacuolar functions; we show experimentally that mutations deleting eight of those genes prevent the life-extending effects of DR. Three of these mutants (OPT2, FRE6, and RCR2) had extended lifespan under ad libitum, indicating that the lack of further longevity under DR is not caused by a general compromise of fitness. These results demonstrate how network analyses of DR using GenDR can be used to make phenotypically relevant predictions. Moreover, gene-regulatory circuits reveal that the DR–induced transcriptional signature in yeast involves nutrient-sensing, stress responses and meiotic transcription factors. Finally, comparing the influence of gene expression changes during DR on the interactomes of multiple

  18. Dissecting the gene network of dietary restriction to identify evolutionarily conserved pathways and new functional genes.

    PubMed

    Wuttke, Daniel; Connor, Richard; Vora, Chintan; Craig, Thomas; Li, Yang; Wood, Shona; Vasieva, Olga; Shmookler Reis, Robert; Tang, Fusheng; de Magalhães, João Pedro

    2012-01-01

    Dietary restriction (DR), limiting nutrient intake from diet without causing malnutrition, delays the aging process and extends lifespan in multiple organisms. The conserved life-extending effect of DR suggests the involvement of fundamental mechanisms, although these remain a subject of debate. To help decipher the life-extending mechanisms of DR, we first compiled a list of genes that if genetically altered disrupt or prevent the life-extending effects of DR. We called these DR-essential genes and identified more than 100 in model organisms such as yeast, worms, flies, and mice. In order for other researchers to benefit from this first curated list of genes essential for DR, we established an online database called GenDR (http://genomics.senescence.info/diet/). To dissect the interactions of DR-essential genes and discover the underlying lifespan-extending mechanisms, we then used a variety of network and systems biology approaches to analyze the gene network of DR. We show that DR-essential genes are more conserved at the molecular level and have more molecular interactions than expected by chance. Furthermore, we employed a guilt-by-association method to predict novel DR-essential genes. In budding yeast, we predicted nine genes related to vacuolar functions; we show experimentally that mutations deleting eight of those genes prevent the life-extending effects of DR. Three of these mutants (OPT2, FRE6, and RCR2) had extended lifespan under ad libitum, indicating that the lack of further longevity under DR is not caused by a general compromise of fitness. These results demonstrate how network analyses of DR using GenDR can be used to make phenotypically relevant predictions. Moreover, gene-regulatory circuits reveal that the DR-induced transcriptional signature in yeast involves nutrient-sensing, stress responses and meiotic transcription factors. Finally, comparing the influence of gene expression changes during DR on the interactomes of multiple organisms led

  19. Evolutionarily conserved serum microRNAs predict radiation-induced fatality in nonhuman primates.

    PubMed

    Fendler, Wojciech; Malachowska, Beata; Meghani, Khyati; Konstantinopoulos, Panagiotis A; Guha, Chandan; Singh, Vijay K; Chowdhury, Dipanjan

    2017-03-01

    Effective planning for the medical response to a radiological or nuclear accident is complex. Because of limited resources for medical countermeasures, the key would be to accurately triage and identify victims most likely to benefit from treatment. We used a mouse model system to provide evidence that serum microRNAs (miRNAs) may effectively predict the impact of radiation on the long-term viability of animals. We had previously used nonhuman primates (NHPs) to demonstrate that this concept is conserved and serum miRNA signatures have the potential to serve as prediction biomarkers for radiation-induced fatality in a human population. We identified a signature of seven miRNAs that are altered by irradiation in both mice and NHPs. Genomic analysis of these conserved miRNAs revealed that there is a combination of seven transcription factors that are predicted to regulate these miRNAs in human, mice, and NHPs. Moreover, a combination of three miRNAs (miR-133b, miR-215, and miR-375) can identify, with nearly complete accuracy, NHPs exposed to radiation versus unexposed NHPs. Consistent with historical data, female macaques appeared to be more sensitive to radiation, but the difference was not significant. Sex-based stratification allowed us to identify an interaction between gender and miR-16-2 expression, which affected the outcome of radiation exposure. Moreover, we developed a classifier based on two miRNAs (miR-30a and miR-126) that can reproducibly predict radiation-induced mortality. Together, we have obtained a five-miRNA composite signature that can identify irradiated macaques and predict their probability of survival.

  20. Evolutionarily conserved serum microRNAs predict radiation-induced fatality in non-human primates

    PubMed Central

    Fendler, Wojciech; Malachowska, Beata; Meghani, Khyati; Konstantinopoulos, Panagiotis A.; Guha, Chandan; Singh, Vijay K.; Chowdhury, Dipanjan

    2017-01-01

    Effective planning for the medical response to a radiologic or nuclear accident is complex. Due to limited resources for medical countermeasures, the key would be to accurately triage and identify victims most likely to benefit from treatment. We had used a mouse model system to provide evidence that serum microRNAs (miRNAs) may effectively predict the impact of radiation on long-term viability of animals. Here we use non-human primates (NHPs) to demonstrate that this concept is conserved and serum miRNA signatures have the potential to serve as prediction biomarkers for radiation-induced fatality in a human population. We identified a signature of seven miRNAs that are altered by irradiation in both mice and NHPs. Genomic analysis of these conserved miRNAs revealed that there is a combination of seven transcription factors that are predicted to regulate these miRNAs in human, mice, and NHPs. Moreover, a combination of three miRNAs (miR-133b, miR-215, and miR-375) can identify, with nearly complete accuracy, NHPs exposed to radiation versus unexposed NHPs. Consistent with historical data, female macaques appeared to be more sensitive to radiation, but the difference was not significant. Sex-based stratification allowed us to identify an interaction between gender and miR-16-2 expression, which affected the outcome of radiation exposure. Moreover, we developed a classifier based on two miRNAs (miR-30a and miR-126) that can reproducibly predict radiation-induced mortality. Altogether, we have obtained a 5-miRNA composite signature that can identify irradiated macaques and predict their probability of survival. PMID:28251902

  1. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  2. Microarray meta-analysis identifies evolutionarily conserved BMP signaling targets in developing long bones.

    PubMed

    Prashar, Paritosh; Yadav, Prem Swaroop; Samarjeet, Fnu; Bandyopadhyay, Amitabha

    2014-05-15

    In vertebrates, BMP signaling has been demonstrated to be sufficient for bone formation in several tissue contexts. This suggests that genes necessary for bone formation are expressed in a BMP signaling dependent manner. However, till date no gene has been reported to be expressed in a BMP signaling dependent manner in bone. Our aim was to identify such genes. On searching the literature we found that several microarray experiments have been conducted where the transcriptome of osteogenic cells in absence and presence of BMP signaling activation have been compared. However, till date, there is no evidence to suggest that any of the genes found to be upregulated in presence of BMP signaling in these microarray analyses is indeed a target of BMP signaling in bone. We wanted to utilize this publicly available information to identify candidate BMP signaling target genes in vivo. We performed a meta-analysis of six such comparable microarray datasets. This analysis and subsequent experiments led to the identification of five targets of BMP signaling in bone that are conserved both in mouse and chick. Of these Lox, Klf10 and Gpr97 are likely to be direct transcriptional targets of BMP signaling pathway. Dpysl3, is a novel BMP signaling target identified in our study. Our data demonstrate that Dpysl3 is important for osteogenic differentiation of mesenchymal cells and is involved in cell secretion. We have demonstrated that the expression of Dpysl3 is co-operatively regulated by BMP signaling and Runx2. Based on our experimental data, in silico analysis of the putative promoter-enhancer regions of Bmp target genes and existing literature, we hypothesize that BMP signaling collaborates with multiple signaling pathways to regulate the expression of a unique set of genes involved in endochondral ossification. Copyright © 2014. Published by Elsevier Inc.

  3. The Evolutionarily Conserved LIM Homeodomain Protein LIM-4/LHX6 Specifies the Terminal Identity of a Cholinergic and Peptidergic C. elegans Sensory/Inter/Motor Neuron-Type

    PubMed Central

    Choi, Seong-Kyoon; Huh, Yang Hoon; Fang, Zi; Park, Seo Jin; Kim, Myoung Ok; Ryoo, Zae Young; Kang, Kyeongjin; Kweon, Hee-Seok; Jeon, Won Bae; Li, Chris; Kim, Kyuhyung

    2015-01-01

    The expression of specific transcription factors determines the differentiated features of postmitotic neurons. However, the mechanism by which specific molecules determine neuronal cell fate and the extent to which the functions of transcription factors are conserved in evolution are not fully understood. In C. elegans, the cholinergic and peptidergic SMB sensory/inter/motor neurons innervate muscle quadrants in the head and control the amplitude of sinusoidal movement. Here we show that the LIM homeobox protein LIM-4 determines neuronal characteristics of the SMB neurons. In lim-4 mutant animals, expression of terminal differentiation genes, such as the cholinergic gene battery and the flp-12 neuropeptide gene, is completely abolished and thus the function of the SMB neurons is compromised. LIM-4 activity promotes SMB identity by directly regulating the expression of the SMB marker genes via a distinct cis-regulatory motif. Two human LIM-4 orthologs, LHX6 and LHX8, functionally substitute for LIM-4 in C. elegans. Furthermore, C. elegans LIM-4 or human LHX6 can induce cholinergic and peptidergic characteristics in the human neuronal cell lines. Our results indicate that the evolutionarily conserved LIM-4/LHX6 homeodomain proteins function in generation of precise neuronal subtypes. PMID:26305787

  4. The Evolutionarily Conserved LIM Homeodomain Protein LIM-4/LHX6 Specifies the Terminal Identity of a Cholinergic and Peptidergic C. elegans Sensory/Inter/Motor Neuron-Type.

    PubMed

    Kim, Jinmahn; Yeon, Jihye; Choi, Seong-Kyoon; Huh, Yang Hoon; Fang, Zi; Park, Seo Jin; Kim, Myoung Ok; Ryoo, Zae Young; Kang, Kyeongjin; Kweon, Hee-Seok; Jeon, Won Bae; Li, Chris; Kim, Kyuhyung

    2015-08-01

    The expression of specific transcription factors determines the differentiated features of postmitotic neurons. However, the mechanism by which specific molecules determine neuronal cell fate and the extent to which the functions of transcription factors are conserved in evolution are not fully understood. In C. elegans, the cholinergic and peptidergic SMB sensory/inter/motor neurons innervate muscle quadrants in the head and control the amplitude of sinusoidal movement. Here we show that the LIM homeobox protein LIM-4 determines neuronal characteristics of the SMB neurons. In lim-4 mutant animals, expression of terminal differentiation genes, such as the cholinergic gene battery and the flp-12 neuropeptide gene, is completely abolished and thus the function of the SMB neurons is compromised. LIM-4 activity promotes SMB identity by directly regulating the expression of the SMB marker genes via a distinct cis-regulatory motif. Two human LIM-4 orthologs, LHX6 and LHX8, functionally substitute for LIM-4 in C. elegans. Furthermore, C. elegans LIM-4 or human LHX6 can induce cholinergic and peptidergic characteristics in the human neuronal cell lines. Our results indicate that the evolutionarily conserved LIM-4/LHX6 homeodomain proteins function in generation of precise neuronal subtypes.

  5. Conserved pattern of antisense overlapping transcription in the homologous human ERCC-1 and yeast RAD10 DNA repair gene regions.

    PubMed Central

    van Duin, M; van Den Tol, J; Hoeijmakers, J H; Bootsma, D; Rupp, I P; Reynolds, P; Prakash, L; Prakash, S

    1989-01-01

    We report that the genes for the homologous Saccharomyces cerevisiae RAD10 and human ERCC-1 DNA excision repair proteins harbor overlapping antisense transcription units in their 3' regions. Since naturally occurring antisense transcription is rare in S. cerevisiae and humans (this is the first example in human cells), our findings indicate that antisense transcription in the ERCC-1-RAD10 gene regions represents an evolutionarily conserved feature. Images PMID:2471070

  6. Mental Retardation and Abnormal Skeletal Development (Dyggve-Melchior-Clausen Dysplasia) Due to Mutations in a Novel, Evolutionarily Conserved Gene

    PubMed Central

    Cohn, Daniel H.; Ehtesham, Nadia; Krakow, Deborah; Unger, Sheila; Shanske, Alan; Reinker, Kent; Powell, Berkley R.; Rimoin, David L.

    2003-01-01

    Dyggve-Melchior-Clausen dysplasia (DMC) and Smith-McCort dysplasia (SMC) are similar, rare autosomal recessive osteochondrodysplasias. The radiographic features and cartilage histology in DMC and SMC are identical. However, patients with DMC exhibit significant developmental delay and mental retardation, the major features that distinguish the two conditions. Linkage studies localized the SMC and DMC disease genes to chromosome 18q12-21.1, providing evidence suggesting that they are allelic disorders. Sequence analysis of the coding exons of the FLJ90130 gene, a highly evolutionarily conserved gene within the recombination interval defined in the linkage study, identified mutations in SMC and DMC patients. The affected individuals in two consanguinous DMC families were homozygous for a stop codon mutation and a frameshift mutation, respectively, demonstrating that DMC represents the FLJ90130-null phenotype. The data confirm the hypothesis that SMC and DMC are allelic disorders and identify a gene necessary for normal skeletal development and brain function. PMID:12491225

  7. Evolutionarily conserved recognition and innate immunity to fungal pathogens by the scavenger receptors SCARF1 and CD36

    PubMed Central

    Mylonakis, Eleftherios; Tampakakis, Emmanouil; Colvin, Richard A.; Seung, Edward; Puckett, Lindsay; Tai, Melissa F.; Stewart, Cameron R.; Pukkila-Worley, Read; Hickman, Suzanne E.; Moore, Kathryn J.; Calderwood, Stephen B.; Hacohen, Nir; Luster, Andrew D.; El Khoury, Joseph

    2009-01-01

    Receptors involved in innate immunity to fungal pathogens have not been fully elucidated. We show that the Caenorhabditis elegans receptors CED-1 and C03F11.3, and their mammalian orthologues, the scavenger receptors SCARF1 and CD36, mediate host defense against two prototypic fungal pathogens, Cryptococcus neoformans and Candida albicans. CED-1 and C03F11.1 mediated antimicrobial peptide production and were necessary for nematode survival after C. neoformans infection. SCARF1 and CD36 mediated cytokine production and were required for macrophage binding to C. neoformans, and control of the infection in mice. Binding of these pathogens to SCARF1 and CD36 was β-glucan dependent. Thus, CED-1/SCARF1 and C03F11.3/CD36 are β-glucan binding receptors and define an evolutionarily conserved pathway for the innate sensing of fungal pathogens. PMID:19237602

  8. Evolutionarily conserved binding of translationally controlled tumor protein to eukaryotic elongation factor 1B.

    PubMed

    Wu, Huiwen; Gong, Weibin; Yao, Xingzhe; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2015-04-03

    Translationally controlled tumor protein (TCTP) is an abundant protein that is highly conserved in eukaryotes. However, its primary function is still not clear. Human TCTP interacts with the metazoan-specific eukaryotic elongation factor 1Bδ (eEF1Bδ) and inhibits its guanine nucleotide exchange factor (GEF) activity, but the structural mechanism remains unknown. The interaction between TCTP and eEF1Bδ was investigated by NMR titration, structure determination, paramagnetic relaxation enhancement, site-directed mutagenesis, isothermal titration calorimetry, and HADDOCK docking. We first demonstrated that the catalytic GEF domain of eEF1Bδ is not responsible for binding to TCTP but rather a previously unnoticed central acidic region (CAR) domain in eEF1Bδ. The mutagenesis data and the structural model of the TCTP-eEF1Bδ CAR domain complex revealed the key binding residues. These residues are highly conserved in eukaryotic TCTPs and in eEF1B GEFs, including the eukaryotically conserved eEF1Bα, implying the interaction may be conserved in all eukaryotes. Interactions were confirmed between TCTP and the eEF1Bα CAR domain for human, fission yeast, and unicellular photosynthetic microalgal proteins, suggesting that involvement in protein translation through the conserved interaction with eEF1B represents a primary function of TCTP. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Evolutionarily Conserved Binding of Translationally Controlled Tumor Protein to Eukaryotic Elongation Factor 1B*

    PubMed Central

    Wu, Huiwen; Gong, Weibin; Yao, Xingzhe; Wang, Jinfeng; Perrett, Sarah; Feng, Yingang

    2015-01-01

    Translationally controlled tumor protein (TCTP) is an abundant protein that is highly conserved in eukaryotes. However, its primary function is still not clear. Human TCTP interacts with the metazoan-specific eukaryotic elongation factor 1Bδ (eEF1Bδ) and inhibits its guanine nucleotide exchange factor (GEF) activity, but the structural mechanism remains unknown. The interaction between TCTP and eEF1Bδ was investigated by NMR titration, structure determination, paramagnetic relaxation enhancement, site-directed mutagenesis, isothermal titration calorimetry, and HADDOCK docking. We first demonstrated that the catalytic GEF domain of eEF1Bδ is not responsible for binding to TCTP but rather a previously unnoticed central acidic region (CAR) domain in eEF1Bδ. The mutagenesis data and the structural model of the TCTP-eEF1Bδ CAR domain complex revealed the key binding residues. These residues are highly conserved in eukaryotic TCTPs and in eEF1B GEFs, including the eukaryotically conserved eEF1Bα, implying the interaction may be conserved in all eukaryotes. Interactions were confirmed between TCTP and the eEF1Bα CAR domain for human, fission yeast, and unicellular photosynthetic microalgal proteins, suggesting that involvement in protein translation through the conserved interaction with eEF1B represents a primary function of TCTP. PMID:25635048

  10. Genome-wide identification of evolutionarily conserved alternative splicing events in flowering plants.

    PubMed

    Chamala, Srikar; Feng, Guanqiao; Chavarro, Carolina; Barbazuk, W Brad

    2015-01-01

    Alternative splicing (AS) plays important roles in many plant functions, but its conservation across the plant kingdom is not known. We describe a methodology to identify AS events and identify conserved AS events across large phylogenetic distances using RNA-Seq datasets. We applied this methodology to transcriptome data from nine angiosperms including Amborella, the single sister species to all other extant flowering plants. AS events within 40-70% of the expressed multi-exonic genes per species were found, 27,120 of which are conserved among two or more of the taxa studied. While many events are species specific, many others are shared across long evolutionary distances suggesting they have functional significance. Conservation of AS event data provides an estimate of the number of ancestral AS events present at each node of the tree representing the nine species studied. Furthermore, the presence or absence of AS isoforms between species with different whole genome duplication (WGD) histories provides the opportunity to examine the impact of WDG on AS potential. Examining AS in gene families identifies those with high rates of AS, and conservation can distinguish ancient events vs. recent or species specific adaptations. The MADS-box and SR protein families are found to represent families with low and high occurrences of AS, respectively, yet their AS events were likely present in the MRCA of angiosperms.

  11. Genome-Wide Identification of Evolutionarily Conserved Alternative Splicing Events in Flowering Plants

    PubMed Central

    Chamala, Srikar; Feng, Guanqiao; Chavarro, Carolina; Barbazuk, W. Brad

    2015-01-01

    Alternative splicing (AS) plays important roles in many plant functions, but its conservation across the plant kingdom is not known. We describe a methodology to identify AS events and identify conserved AS events across large phylogenetic distances using RNA-Seq datasets. We applied this methodology to transcriptome data from nine angiosperms including Amborella, the single sister species to all other extant flowering plants. AS events within 40–70% of the expressed multi-exonic genes per species were found, 27,120 of which are conserved among two or more of the taxa studied. While many events are species specific, many others are shared across long evolutionary distances suggesting they have functional significance. Conservation of AS event data provides an estimate of the number of ancestral AS events present at each node of the tree representing the nine species studied. Furthermore, the presence or absence of AS isoforms between species with different whole genome duplication (WGD) histories provides the opportunity to examine the impact of WDG on AS potential. Examining AS in gene families identifies those with high rates of AS, and conservation can distinguish ancient events vs. recent or species specific adaptations. The MADS-box and SR protein families are found to represent families with low and high occurrences of AS, respectively, yet their AS events were likely present in the MRCA of angiosperms. PMID:25859541

  12. The evolutionarily conserved Krueppel-associated box domain defines a subfamily of eukaryotic multifingered proteins

    SciTech Connect

    Bellefroid, E.J.; Poncelet, D.A.; Lecocq, P.J.; Revelant, O.; Martial, J.A. )

    1991-05-01

    The authors have previously shown that the human genome includes hundreds of genes coding for putative factors related to the Krueppel zinc-finger protein, which regulates Drosophila segmentation. They report herein that about one-third of these genes code for proteins that share a very conserved region of about 75 amino acids in their N-terminal nonfinger portion. Homologous regions are found in a number of previously described finger proteins, including mouse Zfp-1 and Xenopus Xfin. They named this region the Krueppel-associated box (KRAB). This domain has the potential to form two amphipathic {alpha}-helices. Southern blot analysis of zoo blots suggests that the Krueppel-associated box is highly conserved during evolution. Northern blot analysis shows that these genes are expressed in most adult tissues and are down-regulated during in vitro terminal differentiation of human myeloid cells.

  13. Evolutionarily conserved regions of the human c-myc protein can be uncoupled from transforming activity

    SciTech Connect

    Sarid, J.; Halazonetis, T.D.; Murphy, W.; Leder, P.

    1987-01-01

    The myc family of oncogenes contains coding sequences that have been preserved in different species for over 400 million years. This conservation (which implies functional selection) is broadly represented throughout the C-terminal portion of the human c-myc protein but is largely restricted to three cluster of amino acid sequences in the N-terminal region. The authors have examined the role that the latter three regions of the c-myc protein might play in the transforming function of the c-myc gene. Several mutations, deletions and frameshifts, were introduced into the c-myc gene, and these mutant genes were tested for their ability to collaborate with the EJ-ras oncogene to transform rat embryo fibroblasts. Complete elimination of the first two N-terminal conserved segments abolished transforming activity. In contrast, genes altered in a portion of the second or the entire third conserved segment retained their transforming activity. Thus, the latter two segments are not required for the transformation process, suggesting that they serve another function related only to the normal expression of the c-myc gene.

  14. The evolutionarily dynamic IFN-inducible GTPase proteins play conserved immune functions in vertebrates and cephalochordates.

    PubMed

    Li, Guang; Zhang, Juyong; Sun, Yi; Wang, Hua; Wang, Yiquan

    2009-07-01

    Interferon (IFN)-inducible GTPases currently include four families of proteins: myxovirus resistant proteins (Mxs), guanylate-binding proteins (GBPs), immunity-related GTPase proteins (IRGs), and very large inducible GTPase proteins (VLIGs). They are all under conserved regulation by IFNs in humans and mice and play a critical role in preventing microbial infections. However, differences between vertebrates are poorly characterized, and their evolutionary origins have not been studied in detail. In this study, we performed comparative genomic analysis of the four families in 18 representative animals that yielded several unexpected results. Firstly, we found that Mx, GBP, and IRG protein families arose before the divergence of chordate subphyla, but VLIG emerged solely in vertebrates. Secondly, IRG, GBP, and VLIG families have experienced a high rate of gene gain and loss during the evolution, with the GBP family being lost entirely in two pufferfish and VLIG family lost in primates and carnivores. Thirdly, the regulation of these genes by IFNs is highly conserved throughout vertebrates although the VLIG protein sequences in fish have lost the first 870 amino acid residues. Finally, amphioxus IFN-inducible GTPase genes are all highly expressed in immune-related organs such as gill, liver, and intestine and are upregulated after challenge with PolyI:C and pathogens, although no IFNs or their receptors were detected in the current amphioxus genome database. These results suggest that IFN-inducible GTPase genes play conserved immune functions both in vertebrates and in cephalochordates.

  15. Regulation of splicing factors by alternative splicing and NMD is conserved between kingdoms yet evolutionarily flexible.

    PubMed

    Lareau, Liana F; Brenner, Steven E

    2015-04-01

    Ultraconserved elements, unusually long regions of perfect sequence identity, are found in genes encoding numerous RNA-binding proteins including arginine-serine rich (SR) splicing factors. Expression of these genes is regulated via alternative splicing of the ultraconserved regions to yield mRNAs that are degraded by nonsense-mediated mRNA decay (NMD), a process termed unproductive splicing (Lareau et al. 2007; Ni et al. 2007). As all human SR genes are affected by alternative splicing and NMD, one might expect this regulation to have originated in an early SR gene and persisted as duplications expanded the SR family. But in fact, unproductive splicing of most human SR genes arose independently (Lareau et al. 2007). This paradox led us to investigate the origin and proliferation of unproductive splicing in SR genes. We demonstrate that unproductive splicing of the splicing factor SRSF5 (SRp40) is conserved among all animals and even observed in fungi; this is a rare example of alternative splicing conserved between kingdoms, yet its effect is to trigger mRNA degradation. As the gene duplicated, the ancient unproductive splicing was lost in paralogs, and distinct unproductive splicing evolved rapidly and repeatedly to take its place. SR genes have consistently employed unproductive splicing, and while it is exceptionally conserved in some of these genes, turnover in specific events among paralogs shows flexible means to the same regulatory end. © The Author 2015. Published by Oxford University Press on behalf of the society for Molecular Biology and Evolution.

  16. Regulation of Splicing Factors by Alternative Splicing and NMD Is Conserved between Kingdoms Yet Evolutionarily Flexible

    PubMed Central

    Lareau, Liana F.; Brenner, Steven E.

    2015-01-01

    Ultraconserved elements, unusually long regions of perfect sequence identity, are found in genes encoding numerous RNA-binding proteins including arginine-serine rich (SR) splicing factors. Expression of these genes is regulated via alternative splicing of the ultraconserved regions to yield mRNAs that are degraded by nonsense-mediated mRNA decay (NMD), a process termed unproductive splicing (Lareau et al. 2007; Ni et al. 2007). As all human SR genes are affected by alternative splicing and NMD, one might expect this regulation to have originated in an early SR gene and persisted as duplications expanded the SR family. But in fact, unproductive splicing of most human SR genes arose independently (Lareau et al. 2007). This paradox led us to investigate the origin and proliferation of unproductive splicing in SR genes. We demonstrate that unproductive splicing of the splicing factor SRSF5 (SRp40) is conserved among all animals and even observed in fungi; this is a rare example of alternative splicing conserved between kingdoms, yet its effect is to trigger mRNA degradation. As the gene duplicated, the ancient unproductive splicing was lost in paralogs, and distinct unproductive splicing evolved rapidly and repeatedly to take its place. SR genes have consistently employed unproductive splicing, and while it is exceptionally conserved in some of these genes, turnover in specific events among paralogs shows flexible means to the same regulatory end. PMID:25576366

  17. Extensive lysine acetylation occurs in evolutionarily conserved metabolic pathways and parasite-specific functions during Plasmodium falciparum intraerythrocytic development

    PubMed Central

    Miao, Jun; Lawrence, Matthew; Jeffers, Victoria; Zhao, Fangqing; Parker, Daniel; Ge, Ying; Sullivan, William J.; Cui, Liwang

    2013-01-01

    Summary Lysine acetylation has emerged as a major posttranslational modification involved in diverse cellular functions. Using a combination of immunoisolation and liquid chromatography coupled to accurate mass spectrometry, we determined the first acetylome of the human malaria parasite Plasmodium falciparum during its active proliferation in erythrocytes with 421 acetylation sites identified in 230 proteins. Lysine-acetylated proteins are distributed in the nucleus, cytoplasm, mitochondrion, and apicoplast. Whereas occurrence of lysine acetylation in a similarly wide range of cellular functions suggests conservation of lysine acetylation through evolution, the Plasmodium acetylome also revealed significant divergence from those of other eukaryotes and even the closely-related parasite Toxoplasma. This divergence is reflected in the acetylation of a large number of Plasmodium-specific proteins and different acetylation sites in evolutionarily conserved acetylated proteins. A prominent example is the abundant acetylation of proteins in the glycolysis pathway but relatively deficient acetylation of enzymes in the citrate cycle. Using specific transgenic lines and inhibitors, we determined that the acetyltransferase PfMYST and lysine deacetylases play important roles in regulating the dynamics of cytoplasmic protein acetylation. The Plasmodium acetylome provides an exciting start point for further exploration of functions of acetylation in the biology of malaria parasites. PMID:23796209

  18. Extensive lysine acetylation occurs in evolutionarily conserved metabolic pathways and parasite-specific functions during Plasmodium falciparum intraerythrocytic development.

    PubMed

    Miao, Jun; Lawrence, Matthew; Jeffers, Victoria; Zhao, Fangqing; Parker, Daniel; Ge, Ying; Sullivan, William J; Cui, Liwang

    2013-08-01

    Lysine acetylation has emerged as a major post-translational modification involved in diverse cellular functions. Using a combination of immunoisolation and liquid chromatography coupled to accurate mass spectrometry, we determined the first acetylome of the human malaria parasite Plasmodium falciparum during its active proliferation in erythrocytes with 421 acetylation sites identified in 230 proteins. Lysine-acetylated proteins are distributed in the nucleus, cytoplasm, mitochondrion and apicoplast. Whereas occurrence of lysine acetylation in a similarly wide range of cellular functions suggests conservation of lysine acetylation through evolution, the Plasmodium acetylome also revealed significant divergence from those of other eukaryotes and even the closely related parasite Toxoplasma. This divergence is reflected in the acetylation of a large number of Plasmodium-specific proteins and different acetylation sites in evolutionarily conserved acetylated proteins. A prominent example is the abundant acetylation of proteins in the glycolysis pathway but relatively deficient acetylation of enzymes in the citrate cycle. Using specific transgenic lines and inhibitors, we determined that the acetyltransferase PfMYST and lysine deacetylases play important roles in regulating the dynamics of cytoplasmic protein acetylation. The Plasmodium acetylome provides an exciting start point for further exploration of functions of acetylation in the biology of malaria parasites. © 2013 John Wiley & Sons Ltd.

  19. Evolutionarily conserved morphogenetic movements at the vertebrate head-trunk interface coordinate the transport and assembly of hypopharyngeal structures.

    PubMed

    Lours-Calet, Corinne; Alvares, Lucia E; El-Hanfy, Amira S; Gandesha, Saniel; Walters, Esther H; Sobreira, Débora Rodrigues; Wotton, Karl R; Jorge, Erika C; Lawson, Jennifer A; Kelsey Lewis, A; Tada, Masazumi; Sharpe, Colin; Kardon, Gabrielle; Dietrich, Susanne

    2014-06-15

    The vertebrate head-trunk interface (occipital region) has been heavily remodelled during evolution, and its development is still poorly understood. In extant jawed vertebrates, this region provides muscle precursors for the throat and tongue (hypopharyngeal/hypobranchial/hypoglossal muscle precursors, HMP) that take a stereotype path rostrally along the pharynx and are thought to reach their target sites via active migration. Yet, this projection pattern emerged in jawless vertebrates before the evolution of migratory muscle precursors. This suggests that a so far elusive, more basic transport mechanism must have existed and may still be traceable today. Here we show for the first time that all occipital tissues participate in well-conserved cell movements. These cell movements are spearheaded by the occipital lateral mesoderm and ectoderm that split into two streams. The rostrally directed stream projects along the floor of the pharynx and reaches as far rostrally as the floor of the mandibular arch and outflow tract of the heart. Notably, this stream leads and engulfs the later emerging HMP, neural crest cells and hypoglossal nerve. When we (i) attempted to redirect hypobranchial/hypoglossal muscle precursors towards various attractants, (ii) placed non-migratory muscle precursors into the occipital environment or (iii) molecularly or (iv) genetically rendered muscle precursors non-migratory, they still followed the trajectory set by the occipital lateral mesoderm and ectoderm. Thus, we have discovered evolutionarily conserved morphogenetic movements, driven by the occipital lateral mesoderm and ectoderm, that ensure cell transport and organ assembly at the head-trunk interface.

  20. Genome-wide assessment of recurrent genomic imbalances in canine leukemia identifies evolutionarily conserved regions for subtype differentiation.

    PubMed

    Roode, Sarah C; Rotroff, Daniel; Avery, Anne C; Suter, Steven E; Bienzle, Dorothee; Schiffman, Joshua D; Motsinger-Reif, Alison; Breen, Matthew

    2015-12-01

    Leukemia in dogs is a heterogeneous disease with survival ranging from days to years, depending on the subtype. Strides have been made in both human and canine leukemia to improve classification and understanding of pathogenesis through immunophenotyping, yet classification and choosing appropriate therapy remains challenging. In this study, we assessed 123 cases of canine leukemia (28 ALLs, 24 AMLs, 25 B-CLLs, and 46 T-CLLs) using high-resolution oligonucleotide array comparative genomic hybridization (oaCGH) to detect DNA copy number alterations (CNAs). For the first time, such data were used to identify recurrent CNAs and inclusive genes that may be potential drivers of subtype-specific pathogenesis. We performed predictive modeling to identify CNAs that could reliably differentiate acute subtypes (ALL vs. AML) and chronic subtypes (B-CLL vs. T-CLL) and used this model to differentiate cases with up to 83.3 and 95.8 % precision, respectively, based on CNAs at only one to three genomic regions. In addition, CGH datasets for canine and human leukemia were compared to reveal evolutionarily conserved copy number changes between species, including the shared gain of HSA 21q in ALL and ∼25 Mb of shared gain of HSA 12 and loss of HSA 13q14 in CLL. These findings support the use of canine leukemia as a relevant in vivo model for human leukemia and justify the need to further explore the conserved genomic regions of interest for their clinical impact.

  1. Evolutionarily conserved differences in pallial and thalamic short-term synaptic plasticity in striatum

    PubMed Central

    Ericsson, Jesper; Stephenson-Jones, Marcus; Kardamakis, Andreas; Robertson, Brita; Silberberg, Gilad; Grillner, Sten

    2013-01-01

    The striatum of the basal ganglia is conserved throughout the vertebrate phylum. Tracing studies in lamprey have shown that its afferent inputs are organized in a manner similar to that of mammals. The main inputs arise from the thalamus (Th) and lateral pallium (LPal; the homologue of cortex) that represents the two principal excitatory glutamatergic inputs in mammals. The aim here was to characterize the pharmacology and synaptic dynamics of afferent fibres from the LPal and Th onto identified striatal neurons to understand the processing taking place in the lamprey striatum. We used whole-cell current-clamp recordings in acute slices of striatum with preserved fibres from the Th and LPal, as well as tract tracing and immunohistochemistry. We show that the Th and LPal produce monosynaptic excitatory glutamatergic input through NMDA and AMPA receptors. The synaptic input from the LPal displayed short-term facilitation, unlike the Th input that instead displayed strong short-term synaptic depression. There was also an activity-dependent recruitment of intrastriatal oligosynaptic inhibition from both inputs. These results indicate that the two principal inputs undergo different activity-dependent short-term synaptic plasticity in the lamprey striatum. The difference observed between Th and LPal (cortical) input is also observed in mammals, suggesting a conserved trait throughout vertebrate evolution. PMID:23148315

  2. Identification of evolutionarily conserved non-AUG-initiated N-terminal extensions in human coding sequences

    PubMed Central

    Ivanov, Ivaylo P.; Firth, Andrew E.; Michel, Audrey M.; Atkins, John F.; Baranov, Pavel V.

    2011-01-01

    In eukaryotes, it is generally assumed that translation initiation occurs at the AUG codon closest to the messenger RNA 5′ cap. However, in certain cases, initiation can occur at codons differing from AUG by a single nucleotide, especially the codons CUG, UUG, GUG, ACG, AUA and AUU. While non-AUG initiation has been experimentally verified for a handful of human genes, the full extent to which this phenomenon is utilized—both for increased coding capacity and potentially also for novel regulatory mechanisms—remains unclear. To address this issue, and hence to improve the quality of existing coding sequence annotations, we developed a methodology based on phylogenetic analysis of predicted 5′ untranslated regions from orthologous genes. We use evolutionary signatures of protein-coding sequences as an indicator of translation initiation upstream of annotated coding sequences. Our search identified novel conserved potential non-AUG-initiated N-terminal extensions in 42 human genes including VANGL2, FGFR1, KCNN4, TRPV6, HDGF, CITED2, EIF4G3 and NTF3, and also affirmed the conservation of known non-AUG-initiated extensions in 17 other genes. In several instances, we have been able to obtain independent experimental evidence of the expression of non-AUG-initiated products from the previously published literature and ribosome profiling data. PMID:21266472

  3. Evolutionarily conserved roles of the dicer helicase domain in regulating RNA interference processing.

    PubMed

    Kidwell, Mary Anne; Chan, Jessica M; Doudna, Jennifer A

    2014-10-10

    The enzyme Dicer generates 21-25 nucleotide RNAs that target specific mRNAs for silencing during RNA interference and related pathways. Although their active sites and RNA binding regions are functionally conserved, the helicase domains have distinct activities in the context of different Dicer enzymes. To examine the evolutionary origins of Dicer helicase functions, we investigated two related Dicer enzymes from the thermophilic fungus Sporotrichum thermophile. RNA cleavage assays showed that S. thermophile Dicer-1 (StDicer-1) can process hairpin precursor microRNAs, whereas StDicer-2 can only cleave linear double-stranded RNAs. Furthermore, only StDicer-2 possesses robust ATP hydrolytic activity in the presence of double-stranded RNA. Deletion of the StDicer-2 helicase domain increases both StDicer-2 cleavage activity and affinity for hairpin RNA. Notably, both StDicer-1 and StDicer-2 could complement the distantly related yeast Schizosaccharomyces pombe lacking its endogenous Dicer gene but only in their full-length forms, underscoring the importance of the helicase domain. These results suggest an in vivo regulatory function for the helicase domain that may be conserved from fungi to humans.

  4. MPS1: a small, evolutionarily conserved zinc finger protein from the protozoan Toxoplasma gondii.

    PubMed

    Mattsson, J G; Soldati, D

    1999-11-15

    Within the expressed sequence tag (EST) dataset of Toxoplasma gondii we have identified several ESTs encoding a protein similar to the small zinc finger protein MPS1. In human it is suggested that MPS1 plays a role as a transcriptional mediator in response to various growth factors and it is used as a tumour marker in sera from cancer patients. However, in rat a cDNA sequence homologous to MPS1 encodes ribosomal protein S27. To further characterise MPS1 in T. gondii we transformed tachyzoites with a c-Myc-tagged version of the Toxoplasma MPS1 cDNA, flanked by SAG1 sequences. Western blot analysis showed that the Myc-MPS1 was only poorly expressed in the stable transformants. In contrast, Northern blot analysis demonstrated that the Myc-MPS1 mRNA was abundantly transcribed and that the endogenous level of MPS1 mRNA was not affected.

  5. Chromosomal mapping and genomic organization of an evolutionarily conserved zinc finger gene ZNF277.

    PubMed

    Liang, H; Guo, W; Nagarajan, L

    2000-06-01

    A novel C2H2 zinc finger gene, ZNF277, has been localized to human chromosome 7q31.1. The gene is encoded by 12 exons in a genomic fragment of >100 kb between the microsatellite markers D7S523 and D7S471, deleted in a number of malignancies. The predicted open reading frame (ORF) of 438 amino acids shows an overall homology of 50% to the putative ORF F46B6.7 of Caenorhabditis elegans. The presence of a 30-amino-acid coiled-coil domain in both the C. elegans ORF F46B6.7 and ZNF277 is suggestive of functional similarities. ESTs for the murine orthologue ZFP277 are found in early embryonic stem cells, 16-cell stage embryo, and blastocysts. The evolutionary conservation and the expression profile suggest ZNF277 to be a critical regulator of development and differentiation. Copyright 2000 Academic Press.

  6. The RNAz web server: prediction of thermodynamically stable and evolutionarily conserved RNA structures

    PubMed Central

    Gruber, Andreas R.; Neuböck, Richard; Hofacker, Ivo L.; Washietl, Stefan

    2007-01-01

    Many non-coding RNA genes and cis-acting regulatory elements of mRNAs contain RNA secondary structures that are critical for their function. Such functional RNAs can be predicted on the basis of thermodynamic stability and evolutionary conservation. We present a web server that uses the RNAz algorithm to detect functional RNA structures in multiple alignments of nucleotide sequences. The server provides access to a complete and fully automatic analysis pipeline that allows not only to analyze single alignments in a variety of formats, but also to conduct complex screens of large genomic regions. Results are presented on a website that is illustrated by various structure representations and can be downloaded for local view. The web server is available at: rna.tbi.univie.ac.at/RNAz. PMID:17452347

  7. Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes

    PubMed Central

    Dekel, Amir; Pitts, Ronald J.; Yakir, Esther; Bohbot, Jonathan D.

    2016-01-01

    Olfaction is a key insect adaptation to a wide range of habitats. In the last thirty years, the detection of octenol by blood-feeding insects has been primarily understood in the context of animal host-seeking. The recent discovery of a conserved octenol receptor gene in the strictly nectar-feeding elephant mosquito Toxorhynchites amboinensis (TaOr8) suggests a different biological role. Here, we show that TaOR8 is a functional ortholog of its counterparts in blood-feeding mosquitoes displaying selectivity towards the (R)-enantiomer of octenol and susceptibility to the insect repellent DEET. These findings suggest that while the function of OR8 has been maintained throughout mosquito evolution, the context in which this receptor is operating has diverged in blood and nectar-feeding mosquitoes. PMID:27849027

  8. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins

    PubMed Central

    Paredez, Alexander R.; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C.; Wang, Chung-Ju Rachel; Cande, W. Z.

    2011-01-01

    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host. PMID:21444821

  9. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins.

    PubMed

    Paredez, Alexander R; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C; Wang, Chung-Ju Rachel; Cande, W Z

    2011-04-12

    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host.

  10. Arachidonic Acid: An Evolutionarily Conserved Signaling Molecule Modulates Plant Stress Signaling Networks[C][W

    PubMed Central

    Savchenko, Tatyana; Walley, Justin W.; Chehab, E. Wassim; Xiao, Yanmei; Kaspi, Roy; Pye, Matthew F.; Mohamed, Maged E.; Lazarus, Colin M.; Bostock, Richard M.; Dehesh, Katayoon

    2010-01-01

    Fatty acid structure affects cellular activities through changes in membrane lipid composition and the generation of a diversity of bioactive derivatives. Eicosapolyenoic acids are released into plants upon infection by oomycete pathogens, suggesting they may elicit plant defenses. We exploited transgenic Arabidopsis thaliana plants (designated EP) producing eicosadienoic, eicosatrienoic, and arachidonic acid (AA), aimed at mimicking pathogen release of these compounds. We also examined their effect on biotic stress resistance by challenging EP plants with fungal, oomycete, and bacterial pathogens and an insect pest. EP plants exhibited enhanced resistance to all biotic challenges, except they were more susceptible to bacteria than the wild type. Levels of jasmonic acid (JA) were elevated and levels of salicylic acid (SA) were reduced in EP plants. Altered expression of JA and SA pathway genes in EP plants shows that eicosapolyenoic acids effectively modulate stress-responsive transcriptional networks. Exogenous application of various fatty acids to wild-type and JA-deficient mutants confirmed AA as the signaling molecule. Moreover, AA treatment elicited heightened expression of general stress-responsive genes. Importantly, tomato (Solanum lycopersicum) leaves treated with AA exhibited reduced susceptibility to Botrytis cinerea infection, confirming AA signaling in other plants. These studies support the role of AA, an ancient metazoan signaling molecule, in eliciting plant stress and defense signaling networks. PMID:20935246

  11. Evolutionarily conserved mechanisms of male germline development in flowering plants and animals.

    PubMed

    Pereira, Patrícia A; Navarro-Costa, Paulo; Martinho, Rui Gonçalo; Becker, Jörg D

    2014-04-01

    Sexual reproduction is the main reproductive strategy of the overwhelming majority of eukaryotes. This suggests that the last eukaryotic common ancestor was able to reproduce sexually. Sexual reproduction reflects the ability to perform meiosis, and ultimately generating gametes, which are cells that carry recombined half sets of the parental genome and are able to fertilize. These functions have been allocated to a highly specialized cell lineage: the germline. Given its significant evolutionary conservation, it is to be expected that the germline programme shares common molecular bases across extremely divergent eukaryotic species. In the present review, we aim to identify the unifying principles of male germline establishment and development by comparing two very disparate kingdoms: plants and animals. We argue that male meiosis defines two temporally regulated gene expression programmes: the first is required for meiotic commitment, and the second is required for the acquisition of fertilizing ability. Small RNA pathways are a further key communality, ultimately ensuring the epigenetic stability of the information conveyed by the male germline.

  12. Redox proteins in mammalian cell death: an evolutionarily conserved function in mitochondria and prokaryotes.

    PubMed

    Punj, Vasu; Chakrabarty, A M

    2003-04-01

    Mammalian cell mitochondria are believed to have prokaryotic ancestry. Mitochondria are not only the powerhouse of energy generation within the eukaryotic cell but they also play a major role in inducing apoptotic cell death through release of redox proteins such as cytochrome c and the apoptosis-inducing factor (AIF), a flavoprotein with NADH oxidase activity. Recent evidence indicates that some present day prokaryotes release redox proteins that induce apoptosis in mammalian cells through stabilization of the tumour suppressor protein p53. p53 interacts with mitochondria either directly or through activation of the genes for pro-apoptotic proteins such as Bax or NOXA or genes that encode redox enzymes responsible for the production of reactive oxygen species (ROS). The analogy between the ancient ancestors of present day bacteria, the mitochondria, and the present day bacteria with regard to their ability to release redox proteins for triggering mammalian cell death is an interesting example of functional conservation during the hundreds of millions of years of evolution. It is possible that the ancestors of the present day prokaryotes released redox proteins to kill the ancestors of the eukaryotes. During evolution of the mitochondria from prokaryotes as obligate endosymbionts, the mitochondria maintained the same functions to programme their own host cell death.

  13. Computational Analysis of an Evolutionarily Conserved VertebrateMuscle Alternative Splicing Program

    SciTech Connect

    Das, Debopriya; Clark, Tyson A.; Schweitzer, Anthony; Marr,Henry; Yamamoto, Miki L.; Parra, Marilyn K.; Arribere, Josh; Minovitsky,Simon; Dubchak, Inna; Blume, John E.; Conboy, John G.

    2006-06-15

    A novel exon microarray format that probes gene expression with single exon resolution was employed to elucidate critical features of a vertebrate muscle alternative splicing program. A dataset of 56 microarray-defined, muscle-enriched exons and their flanking introns were examined computationally in order to investigate coordination of the muscle splicing program. Candidate intron regulatory motifs were required to meet several stringent criteria: significant over-representation near muscle-enriched exons, correlation with muscle expression, and phylogenetic conservation among genomes of several vertebrate orders. Three classes of regulatory motifs were identified in the proximal downstream intron, within 200nt of the target exons: UGCAUG, a specific binding site for Fox-1 related splicing factors; ACUAAC, a novel branchpoint-like element; and UG-/UGC-rich elements characteristic of binding sites for CELF splicing factors. UGCAUG was remarkably enriched, being present in nearly one-half of all cases. These studies suggest that Fox and CELF splicing factors play a major role in enforcing the muscle-specific alternative splicing program, facilitating expression of a set of unique isoforms of cytoskeletal proteins that are critical to muscle cell differentiation. Supplementary materials: There are four supplementary tables and one supplementary figure. The tables provide additional detailed information concerning the muscle-enriched datasets, and about over-represented oligonucleotide sequences in the flanking introns. The supplementary figure shows RT-PCR data confirming the muscle-enriched expression of exons predicted from the microarray analysis.

  14. Circadian regulation of olfaction and an evolutionarily conserved, nontranscriptional marker in Caenorhabditis elegans.

    PubMed

    Olmedo, Maria; O'Neill, John S; Edgar, Rachel S; Valekunja, Utham K; Reddy, Akhilesh B; Merrow, Martha

    2012-12-11

    Circadian clocks provide a temporal structure to processes from gene expression to behavior in organisms from all phyla. Most clocks are synchronized to the environment by alternations of light and dark. However, many organisms experience only muted daily environmental cycles due to their lightless spatial niches (e.g., caves or soil). This has led to speculation that they may dispense with the daily clock. However, recent reports contradict this notion, showing various behavioral and molecular rhythms in Caenorhabditis elegans and in blind cave fish. Based on the ecology of nematodes, we applied low-amplitude temperature cycles to synchronize populations of animals through development. This entrainment regime reveals rhythms on multiple levels: in olfactory cued behavior, in RNA and protein abundance, and in the oxidation state of a broadly conserved peroxiredoxin protein. Our work links the nematode clock with that of other clock model systems; it also emphasizes the importance of daily rhythms in sensory functions that are likely to impact on organism fitness and population structure.

  15. Eukaryotic Initiation Factor 6, an evolutionarily conserved regulator of ribosome biogenesis and protein translation

    SciTech Connect

    Guo, Jianjun; Jin, Zhaoqing; Yang, Xiaohan; Li, Jian-Feng; Chen, Jay

    2011-01-01

    We recently identified Receptor for Activated C Kinase 1 (RACK1) as one of the molecular links between abscisic acid (ABA) signaling and its regulation on protein translation. Moreover, we identified Eukaryotic Initiation Factor 6 (eIF6) as an interacting partner of RACK1. Because the interaction between RACK1 and eIF6 in mammalian cells is known to regulate the ribosome assembly step of protein translation initiation, it was hypothesized that the same process of protein translation in Arabidopsis is also regulated by RACK1 and eIF6. In this article, we analyzed the amino acid sequences of eIF6 in different species from different lineages and discovered some intriguing differences in protein phosphorylation sites that may contribute to its action in ribosome assembly and biogenesis. In addition, we discovered that, distinct from non-plant organisms in which eIF6 is encoded by a single gene, all sequenced plant genomes contain two or more copies of eIF6 genes. While one copy of plant eIF6 is expressed ubiquitously and might possess the conserved function in ribosome biogenesis and protein translation, the other copy seems to be only expressed in specific organs and therefore may have gained some new functions. We proposed some important studies that may help us better understand the function of eIF6 in plants.

  16. The presence of disulfide bonds reveals an evolutionarily conserved mechanism involved in mitochondrial protein translocase assembly

    PubMed Central

    Wrobel, Lidia; Sokol, Anna M.; Chojnacka, Magdalena; Chacinska, Agnieszka

    2016-01-01

    Disulfide bond formation is crucial for the biogenesis and structure of many proteins that are localized in the intermembrane space of mitochondria. The importance of disulfide bond formation within mitochondrial proteins was extended beyond soluble intermembrane space proteins. Tim22, a membrane protein and core component of the mitochondrial translocase TIM22, forms an intramolecular disulfide bond in yeast. Tim22 belongs to the Tim17/Tim22/Tim23 family of protein translocases. Here, we present evidence of the high evolutionary conservation of disulfide bond formation in Tim17 and Tim22 among fungi and metazoa. Topological models are proposed that include the location of disulfide bonds relative to the predicted transmembrane regions. Yeast and human Tim22 variants that are not oxidized do not properly integrate into the membrane complex. Moreover, the lack of Tim17 oxidation disrupts the TIM23 translocase complex. This underlines the importance of disulfide bond formation for mature translocase assembly through membrane stabilization of weak transmembrane domains. PMID:27265872

  17. The evolutionarily conserved RNA binding protein SMOOTH is essential for maintaining normal muscle function.

    PubMed

    Draper, Isabelle; Tabaka, Meg E; Jackson, F Rob; Salomon, Robert N; Kopin, Alan S

    2009-01-01

    The Drosophila smooth gene encodes an RNA binding protein that has been well conserved through evolution. To investigate the pleiotropic functions mediated by the smooth gene, we have selected and characterized two sm mutants, which are viable as adults yet display robust phenotypes (including a significant decrease in lifespan). Utilizing these mutants, we have made the novel observation that disruption of the smooth/CG9218 locus leads to age-dependent muscle degeneration, and motor dysfunction. Histological characterization of adult sm mutants revealed marked abnormalities in the major thoracic tubular muscle: the tergal depressor of the trochanter (TDT). Corresponding defects include extensive loss/disruption of striations and nuclei. These pathological changes are recapitulated in flies that express a smooth RNA interference construct (sm RNAi) in the mesoderm. In contrast, targeting sm RNAi constructs to motor neurons does not alter muscle morphology. In addition to examining the TDT phenotype, we explored whether other muscular abnormalities were evident. Utilizing physiological assays developed in the laboratory, we have found that the thoracic muscle defect is preceded by dysmotility of the gastrointestinal tract. SMOOTH thus joins a growing list of hnRNPs that have previously been linked to muscle physiology/pathophysiology. Our findings in Drosophila set the stage for investigating the role of the corresponding mammalian homolog, hnRNP L, in muscle function.

  18. Antioxidant properties of UCP1 are evolutionarily conserved in mammals and buffer mitochondrial reactive oxygen species.

    PubMed

    Oelkrug, Rebecca; Goetze, Nadja; Meyer, Carola W; Jastroch, Martin

    2014-12-01

    Mitochondrial uncoupling reduces reactive oxygen species (ROS) production and appears to be important for cellular signaling/protection, making it a focus for the treatment of metabolic and age-related diseases. Whereas the physiological role of uncoupling protein 1 (UCP1) of brown adipose tissue is established for thermogenesis, the function of UCP1 in the reduction of ROS in cold-exposed animals is currently under debate. Here, we investigated the role of UCP1 in mitochondrial ROS handling in the Lesser hedgehog tenrec (Echinops telfairi), a unique protoendothermic Malagasy mammal with recently identified brown adipose tissue (BAT). We show that the reduction of ROS by UCP1 activity also occurs in BAT mitochondria of the tenrec, suggesting that the antioxidative role of UCP1 is an ancient mammalian trait. Our analysis shows that the quantity of UCP1 displays strong control over mitochondrial hydrogen peroxide release, whereas other factors, such as mild cold, nonshivering thermogenesis, oxidative capacity, and mitochondrial respiration, do not correlate. Furthermore, hydrogen peroxide release from recoupled BAT mitochondria was positively associated with mitochondrial membrane potential. These findings led to a model of UCP1 controlling mitochondrial ROS release and, presumably, being controlled by high membrane potential, as proposed in the canonical model of "mild uncoupling". Our study further promotes a conserved role for UCP1 in the prevention of oxidative stress, which was presumably established during evolution before UCP1 was physiologically integrated into nonshivering thermogenesis.

  19. Molecular genetic aetiology of general cognitive function is enriched in evolutionarily conserved regions.

    PubMed

    Hill, W D; Davies, G; Harris, S E; Hagenaars, S P; Liewald, D C; Penke, L; Gale, C R; Deary, I J

    2016-12-13

    Differences in general cognitive function have been shown to be partly heritable and to show genetic correlations with several psychiatric and physical disease states. However, to date, few single-nucleotide polymorphisms (SNPs) have demonstrated genome-wide significance, hampering efforts aimed at determining which genetic variants are most important for cognitive function and which regions drive the genetic associations between cognitive function and disease states. Here, we combine multiple large genome-wide association study (GWAS) data sets, from the CHARGE cognitive consortium (n=53 949) and UK Biobank (n=36 035), to partition the genome into 52 functional annotations and an additional 10 annotations describing tissue-specific histone marks. Using stratified linkage disequilibrium score regression we show that, in two measures of cognitive function, SNPs associated with cognitive function cluster in regions of the genome that are under evolutionary negative selective pressure. These conserved regions contained ~2.6% of the SNPs from each GWAS but accounted for ~40% of the SNP-based heritability. The results suggest that the search for causal variants associated with cognitive function, and those variants that exert a pleiotropic effect between cognitive function and health, will be facilitated by examining these enriched regions.

  20. An Evolutionarily Conserved Long Noncoding RNA TUNA Controls Pluripotency and Neural Lineage Commitment

    PubMed Central

    Lin, Nianwei; Chang, Kung-Yen; Li, Zhonghan; Gates, Keith; Rana, Zacharia A.; Dang, Jason; Zhang, Danhua; Han, Tianxu; Yang, Chao-Shun; Cunningham, Thomas J.; Head, Steven R.; Duester, Gregg; Dong, Duc; Rana, Tariq M.

    2014-01-01

    SUMMARY Here, we generated the first genome-scale shRNA library targeting lincRNAs in the mouse. We performed an unbiased loss-of-function study in mouse embryonic stem cells (mESCs) and identified 20 novel lincRNAs involved in the maintenance of pluripotency. Among these, TUNA (Tcl1 Upstream Neuron-Associated lincRNA), was required for pluripotency and formed a complex with three RNA-binding proteins (RBPs). The TUNA–RBP complex was detected at the promoters of Nanog, Sox2, and Fgf4, and knockdown of TUNA or the individual RBPs inhibited neural differentiation of mESCs. TUNA showed striking evolutionary conservation of both sequence and central nervous system-restricted expression in vertebrates. Accordingly, knockdown of tuna in zebrafish caused impaired locomotor function, and TUNA expression in the brains of Huntington’s patients was significantly associated with disease grade. Our results suggest that the lincRNA TUNA plays a vital role in pluripotency and neural differentiation of ESCs and is associated with neurological function of adult vertebrates. PMID:24530304

  1. Molecular genetic aetiology of general cognitive function is enriched in evolutionarily conserved regions

    PubMed Central

    Hill, W D; Davies, G; Harris, S E; Hagenaars, S P; Davies, Gail; Deary, Ian J; Debette, Stephanie; Verbaas, Carla I; Bressler, Jan; Schuur, Maaike; Smith, Albert V; Bis, Joshua C; Bennett, David A; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosley Jr, Thomas H; Liewald, D C; Penke, L; Gale, C R; Deary, I J

    2016-01-01

    Differences in general cognitive function have been shown to be partly heritable and to show genetic correlations with several psychiatric and physical disease states. However, to date, few single-nucleotide polymorphisms (SNPs) have demonstrated genome-wide significance, hampering efforts aimed at determining which genetic variants are most important for cognitive function and which regions drive the genetic associations between cognitive function and disease states. Here, we combine multiple large genome-wide association study (GWAS) data sets, from the CHARGE cognitive consortium (n=53 949) and UK Biobank (n=36 035), to partition the genome into 52 functional annotations and an additional 10 annotations describing tissue-specific histone marks. Using stratified linkage disequilibrium score regression we show that, in two measures of cognitive function, SNPs associated with cognitive function cluster in regions of the genome that are under evolutionary negative selective pressure. These conserved regions contained ~2.6% of the SNPs from each GWAS but accounted for ~40% of the SNP-based heritability. The results suggest that the search for causal variants associated with cognitive function, and those variants that exert a pleiotropic effect between cognitive function and health, will be facilitated by examining these enriched regions. PMID:27959336

  2. Analysis of evolutionarily conserved innate immune components in coral links immunity and symbiosis.

    PubMed

    Kvennefors, E Charlotte E; Leggat, William; Kerr, Caroline C; Ainsworth, Tracy D; Hoegh-Guldberg, Ove; Barnes, Andrew C

    2010-11-01

    Reef-building corals are representatives of one of the earliest diverging metazoan lineages and are experiencing increases in bleaching events (breakdown of the coral-Symbiodinium symbiosis) and disease outbreaks. The present study investigates the roles of two pattern recognition proteins, the mannose binding lectin Millectin and a complement factor C3-like protein (C3-Am), in the coral Acropora millepora. The results indicate that the innate immune functions of these molecules are conserved and arose early in evolution. C3-Am is expressed in response to injury, and may function as an opsonin. In contrast, Millectin expression is up-regulated in response to lipopolysaccharide and peptidoglycan. These observations, coupled with localization of Millectin in nematocysts in epidermal tissue, and reported binding of pathogens, are consistent with a key role for the lectin in innate immunity. Furthermore, Millectin was consistently detected binding to the symbiont Symbiodinium in vivo, indicating that the Millectin function of recognition and binding of non-self-entities may have been co-opted from an ancient innate immune system into a role in symbiosis.

  3. Comparative biology of the pentraxin protein family: evolutionarily conserved component of innate immune system.

    PubMed

    Armstrong, Peter B

    2015-01-01

    The immune system is based on the actions of the collection of specialized immune defense cells and their secreted proteins and peptides that defend the host against infection by parasites. Parasites are organisms that live part or all of their lives in close physical association with the host and extract nutrients from the host and, by releasing toxins and virulence factors, cause disease with the potential for injury and premature death of that host. Parasites of the metazoa can be viruses, eubacteria, fungi, protozoans, and other metazoans. The immune system operates to kill or eliminate parasites and eliminate or detoxify their toxins and virulence factors. Although some of the elements of immune systems are specific to a particular phylum of metazoans, others show extensive evolutionary conservation, being present in several or all major phyla of the metazoa. The pentraxins display this latter character in their roles in immune defense. Pentraxins have been documented in vertebrates, nonvertebrate chordates, arthropods, and mollusks and may be present in other taxa of metazoans. Presumably the pentraxins appeared early in the evolution of metazoa, prior to their evolutionary divergence in the Precambrian epoch into many phyla present today, and have been preserved for the 542 million years since that explosive evolutionary radiation. The fidelity with which these phyla have preserved the pentraxins suggests that the functions of these proteins are important for survival of the members of these diverse taxa of animals.

  4. Evolutionarily Conserved Polyadenosine RNA Binding Protein Nab2 Cooperates with Splicing Machinery To Regulate the Fate of Pre-mRNA

    PubMed Central

    Soucek, Sharon; Zeng, Yi; Bellur, Deepti L.; Bergkessel, Megan; Morris, Kevin J.; Deng, Qiudong; Duong, Duc; Seyfried, Nicholas T.; Guthrie, Christine; Staley, Jonathan P.

    2016-01-01

    Numerous RNA binding proteins are deposited onto an mRNA transcript to modulate posttranscriptional processing events ensuring proper mRNA maturation. Defining the interplay between RNA binding proteins that couple mRNA biogenesis events is crucial for understanding how gene expression is regulated. To explore how RNA binding proteins control mRNA processing, we investigated a role for the evolutionarily conserved polyadenosine RNA binding protein, Nab2, in mRNA maturation within the nucleus. This study reveals that nab2 mutant cells accumulate intron-containing pre-mRNA in vivo. We extend this analysis to identify genetic interactions between mutant alleles of nab2 and genes encoding a splicing factor, MUD2, and RNA exosome, RRP6, with in vivo consequences of altered pre-mRNA splicing and poly(A) tail length control. As further evidence linking Nab2 proteins to splicing, an unbiased proteomic analysis of vertebrate Nab2, ZC3H14, identifies physical interactions with numerous components of the spliceosome. We validated the interaction between ZC3H14 and U2AF2/U2AF65. Taking all the findings into consideration, we present a model where Nab2/ZC3H14 interacts with spliceosome components to allow proper coupling of splicing with subsequent mRNA processing steps contributing to a kinetic proofreading step that allows properly processed mRNA to exit the nucleus and escape Rrp6-dependent degradation. PMID:27528618

  5. Osmotically induced synthesis of the compatible solute hydroxyectoine is mediated by an evolutionarily conserved ectoine hydroxylase.

    PubMed

    Bursy, Jan; Pierik, Antonio J; Pica, Nathalie; Bremer, Erhard

    2007-10-26

    By using natural abundance (13)C NMR spectroscopy, we investigated the types of compatible solutes synthesized in a variety of Bacilli under high salinity growth conditions. Glutamate, proline, and ectoine were the dominant compatible solutes synthesized by the various Bacillus species. The majority of the inspected Bacilli produced the tetrahydropyrimidine ectoine in response to high salinity stress, and a subset of these also synthesized a hydroxylation derivative of ectoine, 5-hydroxyectoine. In Salibacillus salexigens, a representative of the ectoine- and 5-hydroxyectoine-producing species, ectoine production was linearly correlated with the salinity of the growth medium and dependent on an ectABC biosynthetic operon. The formation of 5-hydroxyectoine was primarily a stationary growth phase phenomenon. The enzyme responsible for ectoine hydroxylation (EctD) was purified from S. salexigens to apparent homogeneity. The EctD protein was shown in vitro to directly hydroxylate ectoine in a reaction dependent on iron(II), molecular oxygen, and 2-oxoglutarate. We identified the structural gene (ectD) for the ectoine hydroxylase in S. salexigens. Northern blot analysis showed that the transcript levels of the ectABC and ectD genes increased as a function of salinity. Many EctD-related proteins can be found in data base searches in various Bacteria. Each of these bacterial species also contains an ectABC ectoine biosynthetic gene cluster, suggesting that 5-hydroxyectoine biosynthesis strictly depends on the prior synthesis of ectoine. Our data base searches and the biochemical characterization of the EctD protein from S. salexigens suggest that the EctD-related ectoine hydroxylases are members of a new subfamily within the non-heme-containing, iron(II)- and 2-oxoglutarate-dependent dioxygenase superfamily (EC 1.14.11).

  6. Drosophila KCNQ Channel Displays Evolutionarily Conserved Electrophysiology and Pharmacology with Mammalian KCNQ Channels

    PubMed Central

    Cavaliere, Sonia; Hodge, James J. L.

    2011-01-01

    Of the five human KCNQ (Kv7) channels, KCNQ1 with auxiliary subunit KCNE1 mediates the native cardiac IKs current with mutations causing short and long QT cardiac arrhythmias. KCNQ4 mutations cause deafness. KCNQ2/3 channels form the native M-current controlling excitability of most neurons, with mutations causing benign neonatal febrile convulsions. Drosophila contains a single KCNQ (dKCNQ) that appears to serve alone the functions of all the duplicated mammalian neuronal and cardiac KCNQ channels sharing roughly 50–60% amino acid identity therefore offering a route to investigate these channels. Current information about the functional properties of dKCNQ is lacking therefore we have investigated these properties here. Using whole cell patch clamp electrophysiology we compare the biophysical and pharmacological properties of dKCNQ with the mammalian neuronal and cardiac KCNQ channels expressed in HEK cells. We show that Drosophila KCNQ (dKCNQ) is a slowly activating and slowly-deactivating K+ current open at sub-threshold potentials that has similar properties to neuronal KCNQ2/3 with some features of the cardiac KCNQ1/KCNE1 accompanied by conserved sensitivity to a number of clinically relevant KCNQ blockers (chromanol 293B, XE991, linopirdine) and opener (zinc pyrithione). We also investigate the molecular basis of the differential selectivity of KCNQ channels to the opener retigabine and show a single amino acid substitution (M217W) can confer sensitivity to dKCNQ. We show dKCNQ has similar electrophysiological and pharmacological properties as the mammalian KCNQ channels, allowing future study of physiological and pathological roles of KCNQ in Drosophila and whole organism screening for new modulators of KCNQ channelopathies. PMID:21915266

  7. Evolutionarily Conserved Dual Lysine Motif Determines the Non-Chaperone Function of Secreted Hsp90alpha in Tumor Progression

    PubMed Central

    Sahu, Divya; Hou, Yingping; Tsen, Fred; Tong, Chang; O’Brien, Kathryn; Situ, Alan J.; Schmidt, Thomas; Chen, Mei; Ying, Qilong; Ulmer, Tobias S.; Woodley, David T.; Li, Wei

    2016-01-01

    Both intracellular and extracellular heat shock protein-90 (Hsp90) family proteins (α and β) have been shown to support tumor progression. The tumor-promoting activity of the intracellular Hsp90 proteins is attributed to their N-terminal ATPase-driven chaperone function. What determines the extracellular function of secreted Hsp90 was unclear. Here we show that knocking out Hsp90α nullifies tumor cell abilities to migrate, invade and metastasize without affecting cell survival and growth. Knocking out Hsp90β leads to cell death. Extracellular supplementation with recombinant Hsp90α, but not Hsp90β, protein recovers the tumorigenicity of Hsp90α-knockout cells. Sequential mutagenesis identifies two evolutionarily conserved lysine residues, lys-270 and lys-277, in Hsp90α subfamily that determine the extracellular Hsp90α function. Hsp90β subfamily lacks the dual lysine motif and does not show the same extracellular function. Substitutions of gly-262 and thr-269 in Hsp90β with lysines convert Hsp90β to act as Hsp90α outside the cells. Monoclonal antibody, 1G6-D7, against the dual lysine region of secreted Hsp90α blocks de novo tumor formation and significantly inhibits expansion of already formed tumors. This study suggests an alternative therapeutic approach to selectively target the extracellular Hsp90α to the conventional approach targeting the ATPase of intracellular Hsp90α and Hsp90β in cancer. PMID:27721406

  8. A novel, evolutionarily conserved gene family with putative sequence-specific single-stranded DNA-binding activity.

    PubMed

    Castro, Patricia; Liang, Hong; Liang, Jan C; Nagarajan, Lalitha

    2002-07-01

    Complete and partial deletions of chromosome 5q are recurrent cytogenetic anomalies associated with aggressive myeloid malignancies. Earlier, we identified an approximately 1.5-Mb region of loss at 5q13.3 between the loci D5S672 and D5S620 in primary leukemic blasts. A leukemic cell line, ML3, is diploid for all of chromosome 5, except for an inversion-coupled translocation within the D5S672-D5S620 interval. Here, we report the development of a bacterial artificial chromosome (BAC) contig to define the breakpoint and the identification of a novel gene SSBP2, the target of disruption in ML3 cells. A preliminary evaluation of SSBP2 as a tumor suppressor gene in primary leukemic blasts and cell lines suggests that the remaining allele does not undergo intragenic mutations. SSBP2 is one of three members of a closely related, evolutionarily conserved, and ubiquitously expressed gene family. SSBP3 is the human ortholog of a chicken gene, CSDP, that encodes a sequence-specific single-stranded DNA-binding protein. SSBP3 localizes to chromosome 1p31.3, and the third member, SSBP4, maps to chromosome 19p13.1. Chromosomal localization and the putative single-stranded DNA-binding activity suggest that all three members of this family are capable of potential tumor suppressor activity by gene dosage or other epigenetic mechanisms.

  9. The ZW10 and Rough Deal checkpoint proteins function together in a large, evolutionarily conserved complex targeted to the kinetochore.

    PubMed

    Scaërou, F; Starr, D A; Piano, F; Papoulas, O; Karess, R E; Goldberg, M L

    2001-09-01

    The zeste-white 10 (zw10) and rough deal (rod) genes of Drosophila both encode kinetochore components, and mutations in either gene greatly increase the missegregation of sister chromatids during mitosis. Here, we present genetic, cytological and biochemical evidence for a close, evolutionarily conserved relationship between the ROD and ZW10 proteins. We show that the phenotypes caused by disruption of either gene's function are similar in Drosophila and in C. elegans. No additive effects are observed in zw10; rod double null mutants. In flies, the two proteins always colocalize and, moreover, require each other for their recruitment to the mitotic apparatus. The human ROD and ZW10 homologs also colocalize on HeLa cell kinetochores or kinetochore microtubules throughout most but not all of mitosis. Finally, we show that in both Drosophila and human cells, ROD and ZW10 are in fact physically associated, and in Drosophila these proteins are together constituents of a large (700-900 kDa), soluble macromolecular complex.

  10. The Diversification of Evolutionarily Conserved MAPK Cascades Correlates with the Evolution of Fungal Species and Development of Lifestyles

    PubMed Central

    Xu, Chuan; Liu, Ran; Zhang, Qiangqiang; Chen, Xiaoxuan; Qian, Ying

    2017-01-01

    The fungal kingdom displays an extraordinary diversity of lifestyles, developmental processes, and ecological niches. The MAPK (mitogen-activated protein kinase) cascade consists of interlinked MAPKKK, MAPKK, and MAPK, and collectively such cascades play pivotal roles in cellular regulation in fungi. However, the mechanism by which evolutionarily conserved MAPK cascades regulate diverse output responses in fungi remains unknown. Here we identified the full complement of MAPK cascade components from 231 fungal species encompassing 9 fungal phyla. Using the largest data set to date, we found that MAPK family members could have two ancestors, while MAPKK and MAPKKK family members could have only one ancestor. The current MAPK, MAPKK, and MAPKKK subfamilies resulted from duplications and subsequent subfunctionalization during the emergence of the fungal kingdom. However, the gene structure diversification and gene expansion and loss have resulted in significant diversity in fungal MAPK cascades, correlating with the evolution of fungal species and lifestyles. In particular, a distinct evolutionary trajectory of MAPK cascades was identified in single-celled fungi in the Saccharomycetes. All MAPK, MAPKK, and MAPKKK subfamilies expanded in the Saccharomycetes; genes encoding MAPK cascade components have a similar exon–intron structure in this class that differs from those in other fungi. PMID:26957028

  11. Evolutionarily conserved Wolbachia-encoded factors control pattern of stem-cell niche tropism in Drosophila ovaries and favor infection

    PubMed Central

    Toomey, Michelle E.; Panaram, Kanchana; Fast, Eva M.; Beatty, Catherine; Frydman, Horacio M.

    2013-01-01

    Wolbachia are intracellular bacteria that infect invertebrates at pandemic levels, including insect vectors of devastating infectious diseases. Although Wolbachia are providing novel strategies for the control of several human pathogens, the processes underlying Wolbachia’s successful propagation within and across species remain elusive. Wolbachia are mainly vertically transmitted; however, there is also evidence of extensive horizontal transmission. Here, we provide several lines of evidence supporting Wolbachia’s targeting of ovarian stem cell niches—referred to as “niche tropism”—as a previously overlooked strategy for Wolbachia thriving in nature. Niche tropism is pervasive in Wolbachia infecting the Drosophila genus, and different patterns of niche tropism are evolutionarily conserved. Phylogenetic analysis, confirmed by hybrid introgression and transinfection experiments, demonstrates that bacterial factors are the major determinants of differential patterns of niche tropism. Furthermore, bacterial load is increased in germ-line cells passing through infected niches, supporting previous suggestions of a contribution of Wolbachia from stem-cell niches toward vertical transmission. These results support the role of stem-cell niches as a key component for the spreading of Wolbachia in the Drosophila genus and provide mechanistic insights into this unique tissue tropism. PMID:23744038

  12. Evolutionarily conserved morphogenetic movements at the vertebrate head–trunk interface coordinate the transport and assembly of hypopharyngeal structures

    PubMed Central

    Lours-Calet, Corinne; Alvares, Lucia E.; El-Hanfy, Amira S.; Gandesha, Saniel; Walters, Esther H.; Sobreira, Débora Rodrigues; Wotton, Karl R.; Jorge, Erika C.; Lawson, Jennifer A.; Kelsey Lewis, A.; Tada, Masazumi; Sharpe, Colin; Kardon, Gabrielle; Dietrich, Susanne

    2014-01-01

    The vertebrate head–trunk interface (occipital region) has been heavily remodelled during evolution, and its development is still poorly understood. In extant jawed vertebrates, this region provides muscle precursors for the throat and tongue (hypopharyngeal/hypobranchial/hypoglossal muscle precursors, HMP) that take a stereotype path rostrally along the pharynx and are thought to reach their target sites via active migration. Yet, this projection pattern emerged in jawless vertebrates before the evolution of migratory muscle precursors. This suggests that a so far elusive, more basic transport mechanism must have existed and may still be traceable today. Here we show for the first time that all occipital tissues participate in well-conserved cell movements. These cell movements are spearheaded by the occipital lateral mesoderm and ectoderm that split into two streams. The rostrally directed stream projects along the floor of the pharynx and reaches as far rostrally as the floor of the mandibular arch and outflow tract of the heart. Notably, this stream leads and engulfs the later emerging HMP, neural crest cells and hypoglossal nerve. When we (i) attempted to redirect hypobranchial/hypoglossal muscle precursors towards various attractants, (ii) placed non-migratory muscle precursors into the occipital environment or (iii) molecularly or (iv) genetically rendered muscle precursors non-migratory, they still followed the trajectory set by the occipital lateral mesoderm and ectoderm. Thus, we have discovered evolutionarily conserved morphogenetic movements, driven by the occipital lateral mesoderm and ectoderm, that ensure cell transport and organ assembly at the head–trunk interface. PMID:24662046

  13. Members of the evolutionarily conserved PMT family of protein O-mannosyltransferases form distinct protein complexes among themselves.

    PubMed

    Girrbach, Verena; Strahl, Sabine

    2003-04-04

    Protein O-mannosyltransferases (PMTs) initiate the assembly of O-mannosyl glycans, an essential protein modification. Since PMTs are evolutionarily conserved in fungi but are absent in green plants, the PMT family is a putative target for new antifungal drugs, particularly in fighting the threat of phytopathogenic fungi. The PMT family is phylogenetically classified into PMT1, PMT2, and PMT4 subfamilies, which differ in protein substrate specificity. In the model organism Saccharomyces cerevisiae as well as in many other fungi the PMT family is highly redundant, and only the simultaneous deletion of PMT1/PMT2 and PMT4 subfamily members is lethal. In this study we analyzed the molecular organization of PMT family members in S. cerevisiae. We show that members of the PMT1 subfamily (Pmt1p and Pmt5p) interact in pairs with members of the PMT2 subfamily (Pmt2p and Pmt3p) and that Pmt1p-Pmt2p and Pmt5p-Pmt3p complexes represent the predominant forms. Under certain physiological conditions, however, Pmt1p interacts also with Pmt3p, and Pmt5p with Pmt2p, suggesting a compensatory cooperation that guarantees the maintenance of O-mannosylation. Unlike the PMT1/PMT2 subfamily members, the single member of the PMT4 subfamily (Pmt4p) acts as a homomeric complex. Using mutational analyses we demonstrate that the same conserved protein domains underlie both heteromeric and homomeric interactions, and we identify an invariant arginine residue of transmembrane domain two as essential for the formation and/or stability of PMT complexes in general. Our data suggest that protein-protein interactions between the PMT family members offer a point of attack to shut down overall protein O-mannosylation in fungi.

  14. Genome engineering uncovers 54 evolutionarily conserved and testis-enriched genes that are not required for male fertility in mice.

    PubMed

    Miyata, Haruhiko; Castaneda, Julio M; Fujihara, Yoshitaka; Yu, Zhifeng; Archambeault, Denise R; Isotani, Ayako; Kiyozumi, Daiji; Kriseman, Maya L; Mashiko, Daisuke; Matsumura, Takafumi; Matzuk, Ryan M; Mori, Masashi; Noda, Taichi; Oji, Asami; Okabe, Masaru; Prunskaite-Hyyrylainen, Renata; Ramirez-Solis, Ramiro; Satouh, Yuhkoh; Zhang, Qian; Ikawa, Masahito; Matzuk, Martin M

    2016-07-12

    Gene-expression analysis studies from Schultz et al. estimate that more than 2,300 genes in the mouse genome are expressed predominantly in the male germ line. As of their 2003 publication [Schultz N, Hamra FK, Garbers DL (2003) Proc Natl Acad Sci USA 100(21):12201-12206], the functions of the majority of these testis-enriched genes during spermatogenesis and fertilization were largely unknown. Since the study by Schultz et al., functional analysis of hundreds of reproductive-tract-enriched genes have been performed, but there remain many testis-enriched genes for which their relevance to reproduction remain unexplored or unreported. Historically, a gene knockout is the "gold standard" to determine whether a gene's function is essential in vivo. Although knockout mice without apparent phenotypes are rarely published, these knockout mouse lines and their phenotypic information need to be shared to prevent redundant experiments. Herein, we used bioinformatic and experimental approaches to uncover mouse testis-enriched genes that are evolutionarily conserved in humans. We then used gene-disruption approaches, including Knockout Mouse Project resources (targeting vectors and mice) and CRISPR/Cas9, to mutate and quickly analyze the fertility of these mutant mice. We discovered that 54 mutant mouse lines were fertile. Thus, despite evolutionary conservation of these genes in vertebrates and in some cases in all eukaryotes, our results indicate that these genes are not individually essential for male mouse fertility. Our phenotypic data are highly relevant in this fiscally tight funding period and postgenomic age when large numbers of genomes are being analyzed for disease association, and will prevent unnecessary expenditures and duplications of effort by others.

  15. Diverse splicing mechanisms fuse the evolutionarily conserved bicistronic MOCS1A and MOCS1B open reading frames.

    PubMed

    Gray, T A; Nicholls, R D

    2000-07-01

    Molybdenum is an essential cofactor in many enzymes, but must first be complexed by molybdopterin, whose synthesis requires four enzymatic activities. The first two enzymes of this pathway are encoded by the MOCS1 locus in humans. We describe here a remarkably well-conserved novel mRNA splicing phenomenon that produces both an apparently bicistronic MOCS1AM-OCS1B transcript, as well as a distinct class of monocistronic transcript. The latter are created by a variety of splicing mechanisms (alternative splice donors, alternative splice acceptors, and exon-skipping) to bypass the normal termination nonsense codon of MOCS1A resulting in fusion of the MOCS1A and MOCS1B open reading frames. Therefore, these "no-nonsense" transcripts encode a single bifunctional protein embodying both MOCS1A and MOCS1B activities. This coexpression profile was observed in vertebrates (human, mouse, cow, rabbit, opossum, and chicken) and invertebrates (fruit fly and nematode) spanning at least 700 million years of evolution. Our phylogenetic data also provide evidence that the bicistronic form of MOCS1 mRNA is likely to only produce MOCS1A protein and, combined with Northern analyses, suggests that MOCS1B is translated only as a fusion with MOCS1A. Taken together, the data presented here demonstrate a very highly conserved and physiologically relevant dynamic splicing scheme that profoundly influences the protein-coding potential of the MOCS1 locus.

  16. Evolutionarily conserved dual lysine motif determines the non-chaperone function of secreted Hsp90alpha in tumour progression.

    PubMed

    Zou, M; Bhatia, A; Dong, H; Jayaprakash, P; Guo, J; Sahu, D; Hou, Y; Tsen, F; Tong, C; O'Brien, K; Situ, A J; Schmidt, T; Chen, M; Ying, Q; Ulmer, T S; Woodley, D T; Li, W

    2017-04-01

    Both intracellular and extracellular heat shock protein-90 (Hsp90) family proteins (α and β) have been shown to support tumour progression. The tumour-supporting activity of the intracellular Hsp90 is attributed to their N-terminal ATPase-driven chaperone function. What molecular entity determines the extracellular function of secreted Hsp90 and the distinction between Hsp90α and Hsp90β was unclear. Here we demonstrate that CRISPR/Case9 knocking out Hsp90α nullifies tumour cells' ability to migrate, invade and metastasize without affecting the cell survival and growth. Knocking out Hsp90β leads to tumour cell death. Extracellular supplementation with recombinant Hsp90α, but not Hsp90β, protein recovers tumourigenicity of the Hsp90α-knockout cells. Sequential mutagenesis identifies two evolutionarily conserved lysine residues, lys-270 and lys-277, in the Hsp90α subfamily that determine the extracellular Hsp90α function. Hsp90β subfamily lacks the dual lysine motif and the extracellular function. Substitutions of gly-262 and thr-269 in Hsp90β with lysines convert Hsp90β to a Hsp90α-like protein. Newly constructed monoclonal antibody, 1G6-D7, against the dual lysine region of secreted Hsp90α inhibits both de novo tumour formation and expansion of already formed tumours in mice. This study suggests an alternative therapeutic approach to target Hsp90 in cancer, that is, the tumour-secreted Hsp90α, instead of the intracellular Hsp90α and Hsp90β.

  17. The Evolutionarily Conserved Protein LAS1 Is Required for Pre-rRNA Processing at Both Ends of ITS2

    PubMed Central

    Schillewaert, Stéphanie; Wacheul, Ludivine; Lhomme, Frédéric

    2012-01-01

    Ribosome synthesis entails the formation of mature rRNAs from long precursor molecules, following a complex pre-rRNA processing pathway. Why the generation of mature rRNA ends is so complicated is unclear. Nor is it understood how pre-rRNA processing is coordinated at distant sites on pre-rRNA molecules. Here we characterized, in budding yeast and human cells, the evolutionarily conserved protein Las1. We found that, in both species, Las1 is required to process ITS2, which separates the 5.8S and 25S/28S rRNAs. In yeast, Las1 is required for pre-rRNA processing at both ends of ITS2. It is required for Rrp6-dependent formation of the 5.8S rRNA 3′ end and for Rat1-dependent formation of the 25S rRNA 5′ end. We further show that the Rat1-Rai1 5′-3′ exoribonuclease (exoRNase) complex functionally connects processing at both ends of the 5.8S rRNA. We suggest that pre-rRNA processing is coordinated at both ends of 5.8S rRNA and both ends of ITS2, which are brought together by pre-rRNA folding, by an RNA processing complex. Consistently, we note the conspicuous presence of ∼7- or 8-nucleotide extensions on both ends of 5.8S rRNA precursors and at the 5′ end of pre-25S RNAs suggestive of a protected spacer fragment of similar length. PMID:22083961

  18. Widespread Shortening of 3' Untranslated Regions and Increased Exon Inclusion Are Evolutionarily Conserved Features of Innate Immune Responses to Infection.

    PubMed

    Pai, Athma A; Baharian, Golshid; Pagé Sabourin, Ariane; Brinkworth, Jessica F; Nédélec, Yohann; Foley, Joseph W; Grenier, Jean-Christophe; Siddle, Katherine J; Dumaine, Anne; Yotova, Vania; Johnson, Zachary P; Lanford, Robert E; Burge, Christopher B; Barreiro, Luis B

    2016-09-01

    The contribution of pre-mRNA processing mechanisms to the regulation of immune responses remains poorly studied despite emerging examples of their role as regulators of immune defenses. We sought to investigate the role of mRNA processing in the cellular responses of human macrophages to live bacterial infections. Here, we used mRNA sequencing to quantify gene expression and isoform abundances in primary macrophages from 60 individuals, before and after infection with Listeria monocytogenes and Salmonella typhimurium. In response to both bacteria we identified thousands of genes that significantly change isoform usage in response to infection, characterized by an overall increase in isoform diversity after infection. In response to both bacteria, we found global shifts towards (i) the inclusion of cassette exons and (ii) shorter 3' UTRs, with near-universal shifts towards usage of more upstream polyadenylation sites. Using complementary data collected in non-human primates, we show that these features are evolutionarily conserved among primates. Following infection, we identify candidate RNA processing factors whose expression is associated with individual-specific variation in isoform abundance. Finally, by profiling microRNA levels, we show that 3' UTRs with reduced abundance after infection are significantly enriched for target sites for particular miRNAs. These results suggest that the pervasive usage of shorter 3' UTRs is a mechanism for particular genes to evade repression by immune-activated miRNAs. Collectively, our results suggest that dynamic changes in RNA processing may play key roles in the regulation of innate immune responses.

  19. Identification of evolutionarily conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN8A.

    PubMed

    Drews, Valerie L; Shi, Kehui; de Haan, Georgius; Meisler, Miriam H

    2007-10-01

    SCN8A is a major neuronal sodium channel gene expressed throughout the central and peripheral nervous systems. Mutations of SCN8A result in movement disorders and impaired cognition. To investigate the basis for the tissue-specific expression of SCN8A, we located conserved, potentially regulatory sequences in the human, mouse, chicken, and fish genes by 5' RACE of brain RNA and genomic sequence comparison. A highly conserved 5' noncoding exon, exon 1c, is present in vertebrates from fish to mammals and appears to define the ancestral promoter region. The distance from exon 1c to the first coding exon increased tenfold during vertebrate evolution, largely by insertion of repetitive elements. The mammalian gene acquired three novel, mutually exclusive noncoding exons that are not represented in the lower vertebrates. Within the shared exon 1c, we identified four short sequence elements of 10-20 bp with an unusually high level of evolutionary conservation. The conserved elements are most similar to consensus sites for the transcription factors Pou6f1/Brn5, YY1, and REST/NRSF. Introduction of mutations into the predicted Pou6f1 and REST sites reduced promoter activity in transfected neuronal cells. A 470-bp promoter fragment containing all of the conserved elements directed brain-specific expression of the LacZ reporter in transgenic mice. Transgene expression was highest in hippocampal neurons and cerebellar Purkinje cells, consistent with the expression of the endogenous gene. The compact cluster of conserved regulatory elements in SCN8A provides a useful target for molecular analysis of neuronal gene expression.

  20. RNA editing of the Drosophila para Na(+) channel transcript. Evolutionary conservation and developmental regulation.

    PubMed Central

    Hanrahan, C J; Palladino, M J; Ganetzky, B; Reenan, R A

    2000-01-01

    Post-transcriptional editing of pre-mRNAs through the action of dsRNA adenosine deaminases results in the modification of particular adenosine (A) residues to inosine (I), which can alter the coding potential of the modified transcripts. We describe here three sites in the para transcript, which encodes the major voltage-activated Na(+) channel polypeptide in Drosophila, where RNA editing occurs. The occurrence of RNA editing at the three sites was found to be developmentally regulated. Editing at two of these sites was also conserved across species between the D. melanogaster and D. virilis. In each case, a highly conserved region was found in the intron downstream of the editing site and this region was shown to be complementary to the region of the exonic editing site. Thus, editing at these sites would appear to involve a mechanism whereby the edited exon forms a base-paired secondary structure with the distant conserved noncoding sequences located in adjacent downstream introns, similar to the mechanism shown for A-to-I RNA editing of mammalian glutamate receptor subunits (GluRs). For the third site, neither RNA editing nor the predicted RNA secondary structures were evolutionarily conserved. Transcripts from transgenic Drosophila expressing a minimal editing site construct for this site were shown to faithfully undergo RNA editing. These results demonstrate that Na(+) channel diversity in Drosophila is increased by RNA editing via a mechanism analogous to that described for transcripts encoding mammalian GluRs. PMID:10880477

  1. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki

    2005-01-01

    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  2. TRANSCRIPTION. Structures of the RNA polymerase-σ54 reveal new and conserved regulatory strategies.

    PubMed

    Yang, Yun; Darbari, Vidya C; Zhang, Nan; Lu, Duo; Glyde, Robert; Wang, Yi-Ping; Winkelman, Jared T; Gourse, Richard L; Murakami, Katsuhiko S; Buck, Martin; Zhang, Xiaodong

    2015-08-21

    Transcription by RNA polymerase (RNAP) in bacteria requires specific promoter recognition by σ factors. The major variant σ factor (σ(54)) initially forms a transcriptionally silent complex requiring specialized adenosine triphosphate-dependent activators for initiation. Our crystal structure of the 450-kilodalton RNAP-σ(54) holoenzyme at 3.8 angstroms reveals molecular details of σ(54) and its interactions with RNAP. The structure explains how σ(54) targets different regions in RNAP to exert its inhibitory function. Although σ(54) and the major σ factor, σ(70), have similar functional domains and contact similar regions of RNAP, unanticipated differences are observed in their domain arrangement and interactions with RNAP, explaining their distinct properties. Furthermore, we observe evolutionarily conserved regulatory hotspots in RNAPs that can be targeted by a diverse range of mechanisms to fine tune transcription.

  3. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.

    PubMed

    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2016-04-01

    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. © 2015 Scandinavian Plant Physiology Society.

  4. Relaxed selection against accidental binding of transcription factors with conserved chromatin contexts.

    PubMed

    Babbitt, G A

    2010-10-15

    The spurious (or nonfunctional) binding of transcription factors (TF) to the wrong locations on DNA presents a formidable challenge to genomes given the relatively low ceiling for sequence complexity within the short lengths of most binding motifs. The high potential for the occurrence of random motifs and subsequent nonfunctional binding of many transcription factors should theoretically lead to natural selection against the occurrence of spurious motif throughout the genome. However, because of the active role that chromatin can influence over eukaryotic gene regulation, it may also be expected that many supposed spurious binding sites could escape purifying selection if (A) they simply occur in regions of high nucleosome occupancy or (B) their surrounding chromatin was dynamically involved in their identity and function. We compared nucleosome occupancy and the presence/absence of functionally conserved chromatin context to the strength of selection against spurious binding of various TF binding motifs in Saccharomyces yeast. While we find no direct relationship with nucleosome occupancy, we find strong evidence that transcription factors spatially associated with evolutionarily conserved chromatin states are under relaxed selection against accidental binding. Transcription factors (with/without) a conserved chromatin context were found to occur on average, (87.7%/49.3%) of their expected frequencies. Functional binding motifs with conserved chromatin contexts were also significantly shorter in length and more often clustered. These results indicate a role of chromatin context dependency in relaxing selection against spurious binding in nearly half of all TF binding motifs throughout the yeast genome.

  5. A single transcription factor regulates evolutionarily diverse but functionally linked metabolic pathways in response to nutrient availability.

    PubMed

    Schmid, Amy K; Reiss, David J; Pan, Min; Koide, Tie; Baliga, Nitin S

    2009-01-01

    During evolution, enzyme-coding genes are acquired and/or replaced through lateral gene transfer and compiled into metabolic pathways. Gene regulatory networks evolve to fine tune biochemical fluxes through such metabolic pathways, enabling organisms to acclimate to nutrient fluctuations in a competitive environment. Here, we demonstrate that a single TrmB family transcription factor in Halobacterium salinarum NRC-1 globally coordinates functionally linked enzymes of diverse phylogeny in response to changes in carbon source availability. Specifically, during nutritional limitation, TrmB binds a cis-regulatory element to activate or repress 113 promoters of genes encoding enzymes in diverse metabolic pathways. By this mechanism, TrmB coordinates the expression of glycolysis, TCA cycle, and amino-acid biosynthesis pathways with the biosynthesis of their cognate cofactors (e.g. purine and thiamine). Notably, the TrmB-regulated metabolic network includes enzyme-coding genes that are uniquely archaeal as well as those that are conserved across all three domains of life. Simultaneous analysis of metabolic and gene regulatory network architectures suggests an ongoing process of co-evolution in which TrmB integrates the expression of metabolic enzyme-coding genes of diverse origins.

  6. A single transcription factor regulates evolutionarily diverse but functionally linked metabolic pathways in response to nutrient availability

    PubMed Central

    Schmid, Amy K; Reiss, David J; Pan, Min; Koide, Tie; Baliga, Nitin S

    2009-01-01

    During evolution, enzyme-coding genes are acquired and/or replaced through lateral gene transfer and compiled into metabolic pathways. Gene regulatory networks evolve to fine tune biochemical fluxes through such metabolic pathways, enabling organisms to acclimate to nutrient fluctuations in a competitive environment. Here, we demonstrate that a single TrmB family transcription factor in Halobacterium salinarum NRC-1 globally coordinates functionally linked enzymes of diverse phylogeny in response to changes in carbon source availability. Specifically, during nutritional limitation, TrmB binds a cis-regulatory element to activate or repress 113 promoters of genes encoding enzymes in diverse metabolic pathways. By this mechanism, TrmB coordinates the expression of glycolysis, TCA cycle, and amino-acid biosynthesis pathways with the biosynthesis of their cognate cofactors (e.g. purine and thiamine). Notably, the TrmB-regulated metabolic network includes enzyme-coding genes that are uniquely archaeal as well as those that are conserved across all three domains of life. Simultaneous analysis of metabolic and gene regulatory network architectures suggests an ongoing process of co-evolution in which TrmB integrates the expression of metabolic enzyme-coding genes of diverse origins. PMID:19536205

  7. A Functional Genomic Screen for Evolutionarily Conserved Genes Required for Lifespan and Immunity in Germline-Deficient C. elegans

    PubMed Central

    Sinha, Amit; Rae, Robbie

    2014-01-01

    The reproductive system regulates lifespan in insects, nematodes and vertebrates. In Caenorhabditis elegans removal of germline increases lifespan by 60% which is dependent upon insulin signaling, nuclear hormone signaling, autophagy and fat metabolism and their microRNA-regulators. Germline-deficient C. elegans are also more resistant to various bacterial pathogens but the underlying molecular mechanisms are largely unknown. Firstly, we demonstrate that previously identified genes that regulate the extended lifespan of germline-deficient C. elegans (daf-2, daf-16, daf-12, tcer-1, mir-7.1 and nhr-80) are also essential for resistance to the pathogenic bacterium Xenorhabdus nematophila. We then use a novel unbiased approach combining laser cell ablation, whole genome microarrays, RNAi screening and exposure to X. nematophila to generate a comprehensive genome-wide catalog of genes potentially required for increased lifespan and innate immunity in germline-deficient C. elegans. We find 3,440 genes to be upregulated in C. elegans germline-deficient animals in a gonad dependent manner, which are significantly enriched for genes involved in insulin signaling, fatty acid desaturation, translation elongation and proteasome complex function. Using RNAi against a subset of 150 candidate genes selected from the microarray results, we show that the upregulated genes such as transcription factor DAF-16/FOXO, the PTEN homolog lipid phosphatase DAF-18 and several components of the proteasome complex (rpn-6.1, rpn-7, rpn-9, rpn-10, rpt-6, pbs-3 and pbs-6) are essential for both lifespan and immunity of germline deficient animals. We also identify a novel role for genes including par-5 and T12G3.6 in both lifespan-extension and increased survival on X. nematophila. From an evolutionary perspective, most of the genes differentially expressed in germline deficient C. elegans also show a conserved expression pattern in germline deficient Pristionchus pacificus, a nematode species

  8. Small ruminant lentiviral Vif proteins commonly utilize cyclophilin A, an evolutionarily and structurally conserved protein, to degrade ovine and caprine APOBEC3 proteins.

    PubMed

    Yoshikawa, Rokusuke; Izumi, Taisuke; Nakano, Yusuke; Yamada, Eri; Moriwaki, Miyu; Misawa, Naoko; Ren, Fengrong; Kobayashi, Tomoko; Koyanagi, Yoshio; Sato, Kei

    2016-06-01

    Mammals have co-evolved with retroviruses, including lentiviruses, over a long period. Evidence supporting this contention is that viral infectivity factor (Vif) encoded by lentiviruses antagonizes the anti-viral action of cellular apolipoprotein B mRNA editing enzyme catalytic polypeptide-like 3 (APOBEC3) of the host. To orchestrate E3 ubiquitin ligase complex for APOBEC3 degradation, Vifs utilize mammalian proteins such as core-binding factor beta (CBFB; for primate lentiviruses) or cyclophilin A (CYPA; for Maedi-Visna virus [MVV]). However, the co-evolutionary relationship between lentiviral Vif and the mammalian proteins associated with Vif-mediated APOBEC3 degradation is poorly understood. Moreover, it is unclear whether Vif proteins of small ruminant lentiviruses (SRLVs), including MVV and caprine arthritis encephalitis virus (CAEV), commonly utilize CYPA to degrade the APOBEC3 of their hosts. In this study, molecular phylogenetic and protein homology modeling revealed that Vif co-factors are evolutionarily and structurally conserved. It was also found that not only MVV but also CAEV Vifs degrade APOBEC3 of both sheep and goats and that CAEV Vifs interact with CYPA. These findings suggest that lentiviral Vifs chose evolutionarily and structurally stable proteins as their partners (e.g., CBFB or CYPA) for APOBEC3 degradation and, particularly, that SRLV Vifs evolved to utilize CYPA as their co-factor in degradation of ovine and caprine APOBEC3. © 2016 The Societies and John Wiley & Sons Australia, Ltd.

  9. Lariat sequencing in a unicellular yeast identifies regulated alternative splicing of exons that are evolutionarily conserved with humans.

    PubMed

    Awan, Ali R; Manfredo, Amanda; Pleiss, Jeffrey A

    2013-07-30

    Alternative splicing is a potent regulator of gene expression that vastly increases proteomic diversity in multicellular eukaryotes and is associated with organismal complexity. Although alternative splicing is widespread in vertebrates, little is known about the evolutionary origins of this process, in part because of the absence of phylogenetically conserved events that cross major eukaryotic clades. Here we describe a lariat-sequencing approach, which offers high sensitivity for detecting splicing events, and its application to the unicellular fungus, Schizosaccharomyces pombe, an organism that shares many of the hallmarks of alternative splicing in mammalian systems but for which no previous examples of exon-skipping had been demonstrated. Over 200 previously unannotated splicing events were identified, including examples of regulated alternative splicing. Remarkably, an evolutionary analysis of four of the exons identified here as subject to skipping in S. pombe reveals high sequence conservation and perfect length conservation with their homologs in scores of plants, animals, and fungi. Moreover, alternative splicing of two of these exons have been documented in multiple vertebrate organisms, making these the first demonstrations of identical alternative-splicing patterns in species that are separated by over 1 billion y of evolution.

  10. Identification of evolutionarily conserved Momordica charantia microRNAs using computational approach and its utility in phylogeny analysis.

    PubMed

    Thirugnanasambantham, Krishnaraj; Saravanan, Subramanian; Karikalan, Kulandaivelu; Bharanidharan, Rajaraman; Lalitha, Perumal; Ilango, S; HairulIslam, Villianur Ibrahim

    2015-10-01

    Momordica charantia (bitter gourd, bitter melon) is a monoecious Cucurbitaceae with anti-oxidant, anti-microbial, anti-viral and anti-diabetic potential. Molecular studies on this economically valuable plant are very essential to understand its phylogeny and evolution. MicroRNAs (miRNAs) are conserved, small, non-coding RNA with ability to regulate gene expression by bind the 3' UTR region of target mRNA and are evolved at different rates in different plant species. In this study we have utilized homology based computational approach and identified 27 mature miRNAs for the first time from this bio-medically important plant. The phylogenetic tree developed from binary data derived from the data on presence/absence of the identified miRNAs were noticed to be uncertain and biased. Most of the identified miRNAs were highly conserved among the plant species and sequence based phylogeny analysis of miRNAs resolved the above difficulties in phylogeny approach using miRNA. Predicted gene targets of the identified miRNAs revealed their importance in regulation of plant developmental process. Reported miRNAs held sequence conservation in mature miRNAs and the detailed phylogeny analysis of pre-miRNA sequences revealed genus specific segregation of clusters. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. An evolutionarily conserved mechanism for cAMP elicited axonal regeneration involves direct activation of the dual leucine zipper kinase DLK

    PubMed Central

    Hao, Yan; Frey, Erin; Yoon, Choya; Wong, Hetty; Nestorovski, Douglas; Holzman, Lawrence B; Giger, Roman J; DiAntonio, Aaron; Collins, Catherine

    2016-01-01

    A broadly known method to stimulate the growth potential of axons is to elevate intracellular levels of cAMP, however the cellular pathway(s) that mediate this are not known. Here we identify the Dual Leucine-zipper Kinase (DLK, Wnd in Drosophila) as a critical target and effector of cAMP in injured axons. DLK/Wnd is thought to function as an injury ‘sensor’, as it becomes activated after axonal damage. Our findings in both Drosophila and mammalian neurons indicate that the cAMP effector kinase PKA is a conserved and direct upstream activator of Wnd/DLK. PKA is required for the induction of Wnd signaling in injured axons, and DLK is essential for the regenerative effects of cAMP in mammalian DRG neurons. These findings link two important mediators of responses to axonal injury, DLK/Wnd and cAMP/PKA, into a unified and evolutionarily conserved molecular pathway for stimulating the regenerative potential of injured axons. DOI: http://dx.doi.org/10.7554/eLife.14048.001 PMID:27268300

  12. Krüppel-like Factor 11 Regulates the Expression of Metabolic Genes via an Evolutionarily Conserved Protein Interaction Domain Functionally Disrupted in Maturity Onset Diabetes of the Young*

    PubMed Central

    Lomberk, Gwen; Grzenda, Adrienne; Mathison, Angela; Escande, Carlos; Zhang, Jin-San; Calvo, Ezequiel; Miller, Laurence J.; Iovanna, Juan; Chini, Eduardo N.; Fernandez-Zapico, Martin E.; Urrutia, Raul

    2013-01-01

    The function of Krüppel-like factor 11 (KLF11) in the regulation of metabolic pathways is conserved from flies to human. Alterations in KLF11 function result in maturity onset diabetes of the young 7 (MODY7) and neonatal diabetes; however, the mechanisms underlying the role of this protein in metabolic disorders remain unclear. Here, we investigated how the A347S genetic variant, present in MODY7 patients, modulates KLF11 transcriptional activity. A347S affects a previously identified transcriptional regulatory domain 3 (TRD3) for which co-regulators remain unknown. Structure-oriented sequence analyses described here predicted that the KLF11 TRD3 represents an evolutionarily conserved protein domain. Combined yeast two-hybrid and protein array experiments demonstrated that the TRD3 binds WD40, WWI, WWII, and SH3 domain-containing proteins. Using one of these proteins as a model, guanine nucleotide-binding protein β2 (Gβ2), we investigated the functional consequences of KLF11 coupling to a TRD3 binding partner. Combined immunoprecipitation and biomolecular fluorescence complementation assays confirmed that activation of three different metabolic G protein-coupled receptors (β-adrenergic, secretin, and cholecystokinin) induces translocation of Gβ2 to the nucleus where it directly binds KLF11 in a manner that is disrupted by the MODY7 A347S variant. Using genome-wide expression profiles, we identified metabolic gene networks impacted upon TRD3 disruption. Furthermore, A347S disrupted KLF11-mediated increases in basal insulin levels and promoter activity and blunted glucose-stimulated insulin secretion. Thus, this study characterizes a novel protein/protein interaction domain disrupted in a KLF gene variant that associates to MODY7, contributing to our understanding of gene regulation events in complex metabolic diseases. PMID:23589285

  13. Krüppel-like factor 11 regulates the expression of metabolic genes via an evolutionarily conserved protein interaction domain functionally disrupted in maturity onset diabetes of the young.

    PubMed

    Lomberk, Gwen; Grzenda, Adrienne; Mathison, Angela; Escande, Carlos; Zhang, Jin-San; Calvo, Ezequiel; Miller, Laurence J; Iovanna, Juan; Chini, Eduardo N; Fernandez-Zapico, Martin E; Urrutia, Raul

    2013-06-14

    The function of Krüppel-like factor 11 (KLF11) in the regulation of metabolic pathways is conserved from flies to human. Alterations in KLF11 function result in maturity onset diabetes of the young 7 (MODY7) and neonatal diabetes; however, the mechanisms underlying the role of this protein in metabolic disorders remain unclear. Here, we investigated how the A347S genetic variant, present in MODY7 patients, modulates KLF11 transcriptional activity. A347S affects a previously identified transcriptional regulatory domain 3 (TRD3) for which co-regulators remain unknown. Structure-oriented sequence analyses described here predicted that the KLF11 TRD3 represents an evolutionarily conserved protein domain. Combined yeast two-hybrid and protein array experiments demonstrated that the TRD3 binds WD40, WWI, WWII, and SH3 domain-containing proteins. Using one of these proteins as a model, guanine nucleotide-binding protein β2 (Gβ2), we investigated the functional consequences of KLF11 coupling to a TRD3 binding partner. Combined immunoprecipitation and biomolecular fluorescence complementation assays confirmed that activation of three different metabolic G protein-coupled receptors (β-adrenergic, secretin, and cholecystokinin) induces translocation of Gβ2 to the nucleus where it directly binds KLF11 in a manner that is disrupted by the MODY7 A347S variant. Using genome-wide expression profiles, we identified metabolic gene networks impacted upon TRD3 disruption. Furthermore, A347S disrupted KLF11-mediated increases in basal insulin levels and promoter activity and blunted glucose-stimulated insulin secretion. Thus, this study characterizes a novel protein/protein interaction domain disrupted in a KLF gene variant that associates to MODY7, contributing to our understanding of gene regulation events in complex metabolic diseases.

  14. Functional Significance of an Evolutionarily Conserved Alanine (GCA) Resume Codon in tmRNA in Escherichia coli▿

    PubMed Central

    Kapoor, Suman; Samhita, Laasya; Varshney, Umesh

    2011-01-01

    Occasionally, ribosomes stall on mRNAs prior to the completion of the polypeptide chain. In Escherichia coli and other eubacteria, tmRNA-mediated trans-translation is a major mechanism that recycles the stalled ribosomes. The tmRNA possesses a tRNA-like domain and a short mRNA region encoding a short peptide (ANDENYALAA in E. coli) followed by a termination codon. The first amino acid (Ala) of this peptide encoded by the resume codon (GCN) is highly conserved in tmRNAs in different species. However, reasons for the high evolutionary conservation of the resume codon identity have remained unclear. In this study, we show that changing the E. coli tmRNA resume codon to other efficiently translatable codons retains efficient functioning of the tmRNA. However, when the resume codon was replaced with the low-usage codons, its function was adversely affected. Interestingly, expression of tRNAs decoding the low-usage codon from plasmid-borne gene copies restored efficient utilization of tmRNA. We discuss why in E. coli, the GCA (Ala) is one of the best codons and why all codons in the short mRNA of the tmRNA are decoded by the abundant tRNAs. PMID:21602351

  15. The Evolutionarily Conserved Mediator Subunit MDT-15/MED15 Links Protective Innate Immune Responses and Xenobiotic Detoxification

    PubMed Central

    McEwan, Deborah L.; Conery, Annie L.; Ausubel, Frederick M.

    2014-01-01

    Metazoans protect themselves from environmental toxins and virulent pathogens through detoxification and immune responses. We previously identified a small molecule xenobiotic toxin that extends survival of Caenorhabditis elegans infected with human bacterial pathogens by activating the conserved p38 MAP kinase PMK-1 host defense pathway. Here we investigate the cellular mechanisms that couple activation of a detoxification response to innate immunity. From an RNAi screen of 1,420 genes expressed in the C. elegans intestine, we identified the conserved Mediator subunit MDT-15/MED15 and 28 other gene inactivations that abrogate the induction of PMK-1-dependent immune effectors by this small molecule. We demonstrate that MDT-15/MED15 is required for the xenobiotic-induced expression of p38 MAP kinase PMK-1-dependent immune genes and protection from Pseudomonas aeruginosa infection. We also show that MDT-15 controls the induction of detoxification genes and functions to protect the host from bacteria-derived phenazine toxins. These data define a central role for MDT-15/MED15 in the coordination of xenobiotic detoxification and innate immune responses. PMID:24875643

  16. The role of evolutionarily conserved germ-line DH sequence in B-1 cell development and natural antibody production.

    PubMed

    Vale, Andre M; Nobrega, Alberto; Schroeder, Harry W

    2015-12-01

    Because of N addition and variation in the site of VDJ joining, the third complementarity-determining region of the heavy chain (CDR-H3) is the most diverse component of the initial immunoglobulin antigen-binding site repertoire. A large component of the peritoneal cavity B-1 cell component is the product of fetal and perinatal B cell production. The CDR-H3 repertoire is thus depleted of N addition, which increases dependency on germ-line sequence. Cross-species comparisons have shown that DH gene sequence demonstrates conservation of amino acid preferences by reading frame. Preference for reading frame 1, which is enriched for tyrosine and glycine, is created both by rearrangement patterns and by pre-BCR and BCR selection. In previous studies, we have assessed the role of conserved DH sequence by examining peritoneal cavity B-1 cell numbers and antibody production in BALB/c mice with altered DH loci. Here, we review our finding that changes in the constraints normally imposed by germ-line-encoded amino acids within the CDR-H3 repertoire profoundly affect B-1 cell development, especially B-1a cells, and thus natural antibody immunity. Our studies suggest that both natural and somatic selection operate to create a restricted B-1 cell CDR-H3 repertoire.

  17. Identification and Validation of Evolutionarily Conserved Unusually Short Pre-mRNA Introns in the Human Genome

    PubMed Central

    Shimada, Makoto K.; Sasaki-Haraguchi, Noriko; Mayeda, Akila

    2015-01-01

    According to the length distribution of human introns, there is a large population of short introns with a threshold of 65 nucleotides (nt) and a peak at 85 nt. Using human genome and transcriptome databases, we investigated the introns shorter than 66 nt, termed ultra-short introns, the identities of which are scarcely known. Here, we provide for the first time a list of bona fide human ultra-short introns, which have never been characterized elsewhere. By conducting BLAST searches of the databases, we screened 22 introns (37–65 nt) with conserved lengths and sequences among closely related species. We then provide experimental and bioinformatic evidence for the splicing of 15 introns, of which 12 introns were remarkably G-rich and 9 introns contained completely inefficient splice sites and/or branch sites. These unorthodox characteristics of ultra-short introns suggest that there are unknown splicing mechanisms that differ from the well-established mechanism. PMID:25961948

  18. Roundabout controls axon crossing of the CNS midline and defines a novel subfamily of evolutionarily conserved guidance receptors.

    PubMed

    Kidd, T; Brose, K; Mitchell, K J; Fetter, R D; Tessier-Lavigne, M; Goodman, C S; Tear, G

    1998-01-23

    The robo gene in Drosophila was identified in a large-scale mutant screen for genes that control the decision by axons to cross the CNS midline. In robo mutants, too many axons cross and recross the midline. Here we show that robo encodes an axon guidance receptor that defines a novel subfamily of immunoglobulin superfamily proteins that is highly conserved from fruit flies to mammals. For those axons that never cross the midline, Robo is expressed on their growth cones from the outset; for the majority of axons that do cross the midline, Robo is expressed at high levels on their growth cones only after they cross the midline. Transgenic rescue experiments reveal that Robo can function in a cell-autonomous fashion. Robo appears to function as the gatekeeper controlling midline crossing.

  19. The M1 family of vertebrate aminopeptidases: role of evolutionarily conserved tyrosines in the enzymatic mechanism of aminopeptidase B.

    PubMed

    Cadel, Sandrine; Darmon, Cécile; Pernier, Julien; Hervé, Guy; Foulon, Thierry

    2015-02-01

    Aminopeptidase B (Ap-B), a member of the M1 family of Zn(2+)-aminopeptidases, removes basic residues at the NH2-terminus of peptides and is involved in the in vivo proteolytic processing of miniglucagon and cholecystokinin-8. M1 enzymes hydrolyze numerous different peptides and are implicated in many physiological functions. As these enzymes have similar catalytic mechanisms, their respective substrate specificity and/or catalytic efficiency must be based on subtle structural differences at or near the catalytic site. This leads to the hypothesis that each primary structure contains a consensus structural template, strictly necessary for aminopeptidase activity, and a specific amino acid environment localized in or outside the catalytic pocket that finely tunes the substrate specificity and catalytic efficiency of each enzyme. A multiple sequence alignment of M1 peptidases from vertebrates allowed to identify conserved tyrosine amino acids, which are members of this catalytic backbone. In the present work, site-directed mutagenesis and 3D molecular modeling of Ap-B were used to specify the role of four fully (Y281, Y229, Y414, and Y441) and one partially (Y409) conserved residues. Tyrosine to phenylalanine mutations allowed confirming the influence of the hydroxyl groups on the enzyme activity. These groups are implicated in the reaction mechanism (Y414), in substrate specificity and/or catalytic efficiency (Y409), in stabilization of essential amino acids of the active site (Y229, Y409) and potentially in the maintenance of its structural integrity (Y281, Y441). The importance of hydrogen bonds is verified by the Y229H substitution, which preserves the enzyme activity. These data provide new insights into the catalytic mechanism of Ap-B in the M1 family of aminopeptidases. Copyright © 2015 Elsevier B.V. and Société française de biochimie et biologie Moléculaire (SFBBM). All rights reserved.

  20. Evolutionarily Conserved Paired Immunoglobulin-like Receptor α (PILRα) Domain Mediates Its Interaction with Diverse Sialylated Ligands

    PubMed Central

    Sun, Yonglian; Senger, Kate; Baginski, Tomasz K.; Mazloom, Anita; Chinn, Yvonne; Pantua, Homer; Hamidzadeh, Kajal; Ramani, Sree Ranjani; Luis, Elizabeth; Tom, Irene; Sebrell, Andrew; Quinones, Gabriel; Ma, Yan; Mukhyala, Kiran; Sai, Tao; Ding, Jiabing; Haley, Benjamin; Shadnia, Hooman; Kapadia, Sharookh B.; Gonzalez, Lino C.; Hass, Philip E.; Zarrin, Ali A.

    2012-01-01

    Paired immunoglobulin-like receptor (PILR) α is an inhibitory receptor that recognizes several ligands, including mouse CD99, PILR-associating neural protein, and Herpes simplex virus-1 glycoprotein B. The physiological function(s) of interactions between PILRα and its cellular ligands are not well understood, as are the molecular determinants of PILRα/ligand interactions. To address these uncertainties, we sought to identify additional PILRα ligands and further define the molecular basis for PILRα/ligand interactions. Here, we identify two novel PILRα binding partners, neuronal differentiation and proliferation factor-1 (NPDC1), and collectin-12 (COLEC12). We find that sialylated O-glycans on these novel PILRα ligands, and on known PILRα ligands, are compulsory for PILRα binding. Sialylation-dependent ligand recognition is also a property of SIGLEC1, a member of the sialic acid-binding Ig-like lectins. SIGLEC1 Ig domain shares ∼22% sequence identity with PILRα, an identity that includes a conserved arginine localized to position 97 in mouse and human SIGLEC1, position 133 in mouse PILRα and position 126 in human PILRα. We observe that PILRα/ligand interactions require conserved PILRα Arg-133 (mouse) and Arg-126 (human), in correspondence with a previously reported requirement for SIGLEC1 Arg-197 in SIGLEC1/ligand interactions. Homology modeling identifies striking similarities between PILRα and SIGLEC1 ligand binding pockets as well as at least one set of distinctive interactions in the galactoxyl-binding site. Binding studies suggest that PILRα recognizes a complex ligand domain involving both sialic acid and protein motif(s). Thus, PILRα is evolved to engage multiple ligands with common molecular determinants to modulate myeloid cell functions in anatomical settings where PILRα ligands are expressed. PMID:22396535

  1. Characterization of the Six Zebrafish Clade B Fibrillar Procollagen Genes, with Evidence for Evolutionarily Conserved Alternative Splicing within the pro-α1(V) C-propeptide

    PubMed Central

    Hoffman, Guy G.; Branam, Amanda M.; Huang, Guorui; Pelegri, Francisco; Cole, William G.; Wenstrup, Richard M.; Greenspan, Daniel S.

    2010-01-01

    Genes for tetrapod fibrillar procollagen chains can be divided into two clades, A and B, based on sequence homologies and differences in protein domain and gene structures. Although the major fibrillar collagen types I–III comprise only clade A chains, the minor fibrillar collagen types V and XI comprise both clade A chains and the clade B chains pro-α1(V), pro-α3(V), pro-α1(XI) and pro-α2(XI), in which defects can underlie various genetic connective tissue disorders. Here we characterize the clade B procollagen chains of zebrafish. We demonstrate that in contrast to the four tetrapod clade B chains, zebrafish have six clade B chains, designated here as pro-α1(V), proα3(V)a and b, pro-α1(XI)a and b, and pro-α2(XI), based on synteny, sequence homologies, and features of protein domain and gene structures. Spatiotemporal expression patterns are described, as are conserved and non-conserved features that provide insights into the function and evolution of the clade B chain types. Such features include differential alternative splicing of NH2-terminal globular sequences and the first case of a non-triple helical imperfection in the COL1 domain of a clade B, or clade A, fibrillar procollagen chain. Evidence is also provided for previously unknown and evolutionarily conserved alternative splicing within the pro-α1(V) C-propeptide, which may affect selectivity of collagen type V/XI chain associations in species ranging from zebrafish to human. Data presented herein provide insights into the nature of clade B procollagen chains and should facilitate their study in the zebrafish model system. PMID:20102740

  2. Evolutionarily conserved sequences of striated muscle myosin heavy chain isoforms. Epitope mapping by cDNA expression.

    PubMed

    Miller, J B; Teal, S B; Stockdale, F E

    1989-08-05

    A cDNA expression strategy was used to localize amino acid sequences which were specific for fast, as opposed to slow, isoforms of the chicken skeletal muscle myosin heavy chain (MHC) and which were conserved in vertebrate evolution. Five monoclonal antibodies (mAbs), termed F18, F27, F30, F47, and F59, were prepared that reacted with all of the known chicken fast MHC isoforms but did not react with any of the known chicken slow nor with smooth muscle MHC isoforms. The epitopes recognized by mAbs F18, F30, F47, and F59 were on the globular head fragment of the MHC, whereas the epitope recognized by mAb F27 was on the helical tail or rod fragment. Reactivity of all five mAbs also was confined to fast MHCs in the rat, with the exception of mAb F59, which also reacted with the beta-cardiac MHC, the single slow MHC isoform common to both the rat heart and skeletal muscle. None of the five epitopes was expressed on amphioxus, nematode, or Dictyostelium MHC. The F27 and F59 epitopes were found on shark, electric ray, goldfish, newt, frog, turtle, chicken, quail, rabbit, and rat MHCs. The epitopes recognized by these mAbs were conserved, therefore, to varying degrees through vertebrate evolution and differed in sequence from homologous regions of a number of invertebrate MHCs and myosin-like proteins. The sequence of those epitopes on the head were mapped using a two-part cDNA expression strategy. First, Bal31 exonuclease digestion was used to rapidly generate fragments of a chicken embryonic fast MHC cDNA that were progressively deleted from the 3' end. These cDNA fragments were expressed as beta-galactosidase/MHC fusion proteins using the pUR290 vector; the fusion proteins were tested by immunoblotting for reactivity with the mAbs; and the approximate locations of the epitopes were determined from the sizes of the cDNA fragments that encoded a particular epitope. The epitopes were then precisely mapped by expression of overlapping cDNA fragments of known sequence that

  3. Blue-light dependent reactive oxygen species formation by Arabidopsis cryptochrome may define a novel evolutionarily conserved signaling mechanism.

    PubMed

    Consentino, Laurent; Lambert, Stefan; Martino, Carlos; Jourdan, Nathalie; Bouchet, Pierre-Etienne; Witczak, Jacques; Castello, Pablo; El-Esawi, Mohamed; Corbineau, Francoise; d'Harlingue, Alain; Ahmad, Margaret

    2015-06-01

    Cryptochromes are widespread blue-light absorbing flavoproteins with important signaling roles. In plants they mediate de-etiolation, developmental and stress responses resulting from interaction with downstream signaling partners such as transcription factors and components of the proteasome. Recently, it has been shown that Arabidopsis cry1 activation by blue light also results in direct enzymatic conversion of molecular oxygen (O2 ) to reactive oxygen species (ROS) and hydrogen peroxide (H2 O2 ) in vitro. Here we explored whether direct enzymatic synthesis of ROS by Arabidopsis cry1 can play a physiological role in vivo. ROS formation resulting from cry1 expression was measured by fluorescence assay in insect cell cultures and in Arabidopsis protoplasts from cryptochrome mutant seedlings. Cell death was determined by colorimetric assay. We found that ROS formation results from cry1 activation and induces cell death in insect cell cultures. In plant protoplasts, cryptochrome activation results in rapid increase in ROS formation and cell death. We conclude that ROS formation by cryptochromes may indeed be of physiological relevance and could represent a novel paradigm for cryptochrome signaling. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  4. Regulation of carotenoid and bacteriochlorophyll biosynthesis genes and identification of an evolutionarily conserved gene required for bacteriochlorophyll accumulation.

    PubMed

    Armstrong, G A; Cook, D N; Ma, D; Alberti, M; Burke, D H; Hearst, J E

    1993-05-01

    The temporal expression of ten clustered genes required for carotenoid (crt) and bacteriochlorophyll (bch) biosynthesis was examined during the transition from aerobic respiration to anaerobiosis requisite for the development of the photosynthetic membrane in the bacterium Rhodobacter capsulatus. Accumulation of crtA, crtC, crtD, crtE, crtF, crtK, bchC and bchD mRNAs increased transiently and coordinately, up to 12-fold following removal of oxygen from the growth medium, paralleling increases in mRNAs encoding pigment-binding polypeptides of the photosynthetic apparatus. The crtB and crtI genes, in contrast, were expressed similarly in the presence or absence of oxygen. The regulation patterns of promoters for the crtA and crtI genes and the bchCXYZ operon were characterized using lacZ transcriptional fusion and qualitatively reflected the corresponding mRNA accumulation patterns. We also report that the bchI gene product, encoded by a DNA sequence previously considered to be a portion of crtA, shares 49% sequence identity with the nuclear-encoded Arabidopsis thaliana Cs chloroplast protein required for normal pigmentation in plants.

  5. An essential and evolutionarily conserved role of protein arginine methyltransferase 1 for adult intestinal stem cells during postembryonic development.

    PubMed

    Matsuda, Hiroki; Shi, Yun-Bo

    2010-11-01

    Organ-specific adult stem cells are critical for the homeostasis of adult organs and organ repair and regeneration. Unfortunately, it has been difficult to investigate the origins of these stem cells and the mechanisms of their development, especially in mammals. Intestinal remodeling during frog metamorphosis offers a unique opportunity for such studies. During the transition from an herbivorous tadpole to a carnivorous frog, the intestine is completely remodeled as the larval epithelial cells undergo apoptotic degeneration and are replaced by adult epithelial cells developed de novo. The entire metamorphic process is under the control of thyroid hormone, making it possible to control the development of the adult intestinal stem cells. Here, we show that the thyroid hormone receptor-coactivator protein arginine methyltransferase 1 (PRMT1) is upregulated in a small number of larval epithelial cells and that these cells dedifferentiate to become the adult stem cells. More importantly, transgenic overexpression of PRMT1 leads to increased adult stem cells in the intestine, and conversely, knocking down the expression of endogenous PRMT1 reduces the adult stem cell population. In addition, PRMT1 expression pattern during zebrafish and mouse development suggests that PRMT1 may play an evolutionally conserved role in the development of adult intestinal stem cells throughout vertebrates. These findings are not only important for the understanding of organ-specific adult stem cell development but also have important implications in regenerative medicine of the digestive tract.

  6. The phosphomimetic mutation of an evolutionarily conserved serine residue affects the signaling properties of Rho of plants (ROPs).

    PubMed

    Fodor-Dunai, Csilla; Fricke, Inka; Potocký, Martin; Dorjgotov, Dulguun; Domoki, Mónika; Jurca, Manuela E; Otvös, Krisztina; Zárský, Viktor; Berken, Antje; Fehér, Attila

    2011-05-01

    Plant ROP (Rho of plants) proteins form a unique subgroup within the family of Rho-type small G-proteins of eukaryotes. In this paper we demonstrate that the phosphomimetic mutation of a serine residue conserved in all Rho proteins affects the signaling properties of plant ROPs. We found that the S74E mutation in Medicago ROP6 and Arabidopsis ROP4 prevented the binding of these proteins to their plant-specific upstream activator the plant-specific ROP nucleotide exchanger (PRONE)-domain-containing RopGEF (guanine nucleotide exchange factor) protein and abolished the PRONE-mediated nucleotide exchange reaction in vitro. Structural modeling supported the hypothesis that potential phosphorylation of the S74 residue interferes with the binding of the PRONE-domain to the adjacent plant-specific R76 residue which plays an important role in functional ROP-PRONE interaction. Moreover, we show that while the binding of constitutively active MsROP6 to the effector protein RIC (ROP-interactive CRIB-motif-containing protein) was not affected by the S74E mutation, the capability of this mutated protein to bind and activate the RRK1 kinase in vitro was reduced. These observations are in agreement with the morphology of tobacco pollen tubes expressing mutant forms of yellow fluorescent protein (YFP):MsROP6. The S74E mutation in MsROP6 had no influence on pollen tube morphology and attenuated the phenotype of a constitutively active form of MsROP6. The presented Medicago and Arabidopsis data support the notion that the phosphorylation of the serine residue in ROPs corresponding to S74 in Medicago ROP6 could be a general principle for regulating ROP activation and signaling in plants. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  7. An Evolutionarily Conserved Switch in Response to GABA Affects Development and Behavior of the Locomotor Circuit of Caenorhabditis elegans

    PubMed Central

    Han, Bingjie; Bellemer, Andrew; Koelle, Michael R.

    2015-01-01

    The neurotransmitter gamma-aminobutyric acid (GABA) is depolarizing in the developing vertebrate brain, but in older animals switches to hyperpolarizing and becomes the major inhibitory neurotransmitter in adults. We discovered a similar developmental switch in GABA response in Caenorhabditis elegans and have genetically analyzed its mechanism and function in a well-defined circuit. Worm GABA neurons innervate body wall muscles to control locomotion. Activation of GABAA receptors with their agonist muscimol in newly hatched first larval (L1) stage animals excites muscle contraction and thus is depolarizing. At the mid-L1 stage, as the GABAergic neurons rewire onto their mature muscle targets, muscimol shifts to relaxing muscles and thus has switched to hyperpolarizing. This muscimol response switch depends on chloride transporters in the muscles analogous to those that control GABA response in mammalian neurons: the chloride accumulator sodium-potassium-chloride-cotransporter-1 (NKCC-1) is required for the early depolarizing muscimol response, while the two chloride extruders potassium-chloride-cotransporter-2 (KCC-2) and anion-bicarbonate-transporter-1 (ABTS-1) are required for the later hyperpolarizing response. Using mutations that disrupt GABA signaling, we found that neural circuit development still proceeds to completion but with an ∼6-hr delay. Using optogenetic activation of GABAergic neurons, we found that endogenous GABAA signaling in early L1 animals, although presumably depolarizing, does not cause an excitatory response. Thus a developmental depolarizing-to-hyperpolarizing shift is an ancient conserved feature of GABA signaling, but existing theories for why this shift occurs appear inadequate to explain its function upon rigorous genetic analysis of a well-defined neural circuit. PMID:25644702

  8. T cell memory to evolutionarily conserved and shared hemagglutinin epitopes of H1N1 viruses: a pilot scale study

    PubMed Central

    2013-01-01

    Background The 2009 pandemic influenza was milder than expected. Based on the apparent lack of pre-existing cross-protective antibodies to the A (H1N1)pdm09 strain, it was hypothesized that pre-existing CD4+ T cellular immunity provided the crucial immunity that led to an attenuation of disease severity. We carried out a pilot scale study by conducting in silico and in vitro T cellular assays in healthy population, to evaluate the pre-existing immunity to A (H1N1)pdm09 strain. Methods Large-scale epitope prediction analysis was done by examining the NCBI available (H1N1) HA proteins. NetMHCIIpan, an eptiope prediction tool was used to identify the putative and shared CD4+ T cell epitopes between seasonal H1N1 and A (H1N1)pdm09 strains. To identify the immunogenicity of these putative epitopes, human IFN-γ-ELISPOT assays were conducted using the peripheral blood mononuclear cells from fourteen healthy human donors. All donors were screened for the HLA-DRB1 alleles. Results Epitope-specific CD4+ T cellular memory responses (IFN-γ) were generated to highly conserved HA epitopes from majority of the donors (93%). Higher magnitude of the CD4+ T cell responses was observed in the older adults. The study identified two HA2 immunodominant CD4+ T cell epitopes, of which one was found to be novel. Conclusions The current study provides a compelling evidence of HA epitope specific CD4+ T cellular memory towards A (H1N1)pdm09 strain. These well-characterized epitopes could recruit alternative immunological pathways to overcome the challenge of annual seasonal flu vaccine escape. PMID:23641949

  9. Control of plant stem cell function by conserved interacting transcriptional regulators

    PubMed Central

    Zhou, Yun; Liu, Xing; Engstrom, Eric M.; Nimchuk, Zachary L.; Pruneda-Paz, Jose L.; Tarr, Paul T.; Yan, An; Kay, Steve A.; Meyerowitz, Elliot M.

    2014-01-01

    SUMMARY Plant stem cells in the shoot apical meristem (SAM) and root apical meristem (RAM) provide for postembryonic development of above-ground tissues and roots, respectively, while secondary vascular stem cells sustain vascular development1–4. WUSCHEL (WUS), a homeodomain transcription factor expressed in the rib meristem of the SAM, is a key regulatory factor controlling stem cell populations in the Arabidopsis SAM5–6 and is thought to establish the shoot stem cell niche via a feedback circuit with the CLAVATA3 (CLV3) peptide signaling pathway7. WUSCHEL-RELATED HOMEOBOX5 (WOX5), specifically expressed in root quiescent center (QC), defines QC identity and functions interchangeably with WUS in control of shoot and root stem cell niches8. WOX4, expressed in Arabidopsis procambial cells, defines the vascular stem cell niche9–11. WUS/WOX family proteins are evolutionarily and functionally conserved throughout the plant kingdom12 and emerge as key actors in the specification and maintenance of stem cells within all meristems13. However, the nature of the genetic regime in stem cell niches that centers on WOX gene function has been elusive, and molecular links underlying conserved WUS/WOX function in stem cell niches remain unknown. Here we demonstrate that the Arabidopsis HAIRY MERISTEM (HAM)family transcription regulators act as conserved interacting co-factors with WUS/WOX proteins. HAM and WUS share common targets in vivo and their physical interaction is important in driving downstream transcriptional programs and in promoting shoot stem cell proliferation. Differences in the overlapping expression patterns of WOX and HAM family members underlie the formation of diverse stem cell niche locations, and the HAM family is essential for all of these stem cell niches. These findings establish a new framework for the control of stem cell production during plant development. PMID:25363783

  10. Sequence of cDNAs for mammalian H2A.Z, an evolutionarily diverged but highly conserved basal histone H2A isoprotein species.

    PubMed Central

    Hatch, C L; Bonner, W M

    1988-01-01

    The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin. PMID:3344202

  11. Evolutionarily conserved proteins MnmE and GidA catalyze the formation of two methyluridine derivatives at tRNA wobble positions

    PubMed Central

    Moukadiri, Ismaïl; Prado, Silvia; Piera, Julio; Velázquez-Campoy, Adrián; Björk, Glenn R.; Armengod, M.-Eugenia

    2009-01-01

    The wobble uridine of certain bacterial and mitochondrial tRNAs is modified, at position 5, through an unknown reaction pathway that utilizes the evolutionarily conserved MnmE and GidA proteins. The resulting modification (a methyluridine derivative) plays a critical role in decoding NNG/A codons and reading frame maintenance during mRNA translation. The lack of this tRNA modification produces a pleiotropic phenotype in bacteria and has been associated with mitochondrial encephalomyopathies in humans. In this work, we use in vitro and in vivo approaches to characterize the enzymatic pathway controlled by the Escherichia coli MnmE•GidA complex. Surprisingly, this complex catalyzes two different GTP- and FAD-dependent reactions, which produce 5-aminomethyluridine and 5-carboxymethylamino-methyluridine using ammonium and glycine, respectively, as substrates. In both reactions, methylene-tetrahydrofolate is the most probable source to form the C5-methylene moiety, whereas NADH is dispensable in vitro unless FAD levels are limiting. Our results allow us to reformulate the bacterial MnmE•GidA dependent pathway and propose a novel mechanism for the modification reactions performed by the MnmE and GidA family proteins. PMID:19767610

  12. Fragile X mental retardation protein has a unique, evolutionarily conserved neuronal function not shared with FXR1P or FXR2P.

    PubMed

    Coffee, R Lane; Tessier, Charles R; Woodruff, Elvin A; Broadie, Kendal

    2010-01-01

    Fragile X syndrome (FXS), resulting solely from the loss of function of the human fragile X mental retardation 1 (hFMR1) gene, is the most common heritable cause of mental retardation and autism disorders, with syndromic defects also in non-neuronal tissues. In addition, the human genome encodes two closely related hFMR1 paralogs: hFXR1 and hFXR2. The Drosophila genome, by contrast, encodes a single dFMR1 gene with close sequence homology to all three human genes. Drosophila that lack the dFMR1 gene (dfmr1 null mutants) recapitulate FXS-associated molecular, cellular and behavioral phenotypes, suggesting that FMR1 function has been conserved, albeit with specific functions possibly sub-served by the expanded human gene family. To test evolutionary conservation, we used tissue-targeted transgenic expression of all three human genes in the Drosophila disease model to investigate function at (1) molecular, (2) neuronal and (3) non-neuronal levels. In neurons, dfmr1 null mutants exhibit elevated protein levels that alter the central brain and neuromuscular junction (NMJ) synaptic architecture, including an increase in synapse area, branching and bouton numbers. Importantly, hFMR1 can, comparably to dFMR1, fully rescue both the molecular and cellular defects in neurons, whereas hFXR1 and hFXR2 provide absolutely no rescue. For non-neuronal requirements, we assayed male fecundity and testes function. dfmr1 null mutants are effectively sterile owing to disruption of the 9+2 microtubule organization in the sperm tail. Importantly, all three human genes fully and equally rescue mutant fecundity and spermatogenesis defects. These results indicate that FMR1 gene function is evolutionarily conserved in neural mechanisms and cannot be compensated by either FXR1 or FXR2, but that all three proteins can substitute for each other in non-neuronal requirements. We conclude that FMR1 has a neural-specific function that is distinct from its paralogs, and that the unique FMR1 function

  13. spalt encodes an evolutionarily conserved zinc finger protein of novel structure which provides homeotic gene function in the head and tail region of the Drosophila embryo.

    PubMed Central

    Kühnlein, R P; Frommer, G; Friedrich, M; Gonzalez-Gaitan, M; Weber, A; Wagner-Bernholz, J F; Gehring, W J; Jäckle, H; Schuh, R

    1994-01-01

    The region specific homeotic gene spalt (sal) of Drosophila melanogaster promotes the specification of terminal pattern elements as opposed to segments in the trunk. Our results show that the previously reported sal transcription unit was misidentified. Based on P-element mediated germ line transformation and DNA sequence analysis of sal mutant alleles, we identified the transcription unit that carries sal function. sal is located close to the misidentified transcription unit, and it is expressed in similar temporal and spatial patterns during embryogenesis. The sal gene encodes a zinc finger protein of novel structure composed of three widely spaced 'double zinc finger' motifs of internally conserved sequences and a single zinc finger motif of different sequence. Antibodies produced against the sal protein show that sal is first expressed at the blastoderm stage and later in restricted areas of the embryonic nervous system as well as in the developing trachea. The antibodies detect sal homologous proteins in corresponding spatial and temporal patterns in the embryos of related insect species. Sequence analysis of the sal gene of Drosophila virilis, a species which is phylogenetically separated by approximately 60 million years, suggests that the sal function is conserved during evolution, consistent with its proposed role in head formation during arthropod evolution. Images PMID:7905822

  14. IAPs contain an evolutionarily conserved ubiquitin-binding domain that regulates NF-kappaB as well as cell survival and oncogenesis.

    PubMed

    Gyrd-Hansen, Mads; Darding, Maurice; Miasari, Maria; Santoro, Massimo M; Zender, Lars; Xue, Wen; Tenev, Tencho; da Fonseca, Paula C A; Zvelebil, Marketa; Bujnicki, Janusz M; Lowe, Scott; Silke, John; Meier, Pascal

    2008-11-01

    The covalent attachment of ubiquitin to target proteins influences various cellular processes, including DNA repair, NF-kappaB signalling and cell survival. The most common mode of regulation by ubiquitin-conjugation involves specialized ubiquitin-binding proteins that bind to ubiquitylated proteins and link them to downstream biochemical processes. Unravelling how the ubiquitin-message is recognized is essential because aberrant ubiquitin-mediated signalling contributes to tumour formation. Recent evidence indicates that inhibitor of apoptosis (IAP) proteins are frequently overexpressed in cancer and their expression level is implicated in contributing to tumorigenesis, chemoresistance, disease progression and poor patient-survival. Here, we have identified an evolutionarily conserved ubiquitin-associated (UBA) domain in IAPs, which enables them to bind to Lys 63-linked polyubiquitin. We found that the UBA domain is essential for the oncogenic potential of cIAP1, to maintain endothelial cell survival and to protect cells from TNF-alpha-induced apoptosis. Moreover, the UBA domain is required for XIAP and cIAP2-MALT1 to activate NF-kappaB. Our data suggest that the UBA domain of cIAP2-MALT1 stimulates NF-kappaB signalling by binding to polyubiquitylated NEMO. Significantly, 98% of all cIAP2-MALT1 fusion proteins retain the UBA domain, suggesting that ubiquitin-binding contributes to the oncogenic potential of cIAP2-MALT1 in MALT lymphoma. Our data identify IAPs as ubiquitin-binding proteins that contribute to ubiquitin-mediated cell survival, NF-kappaB signalling and oncogenesis.

  15. Gonadal apoptosis during sex reversal of the rice field eel: implications for an evolutionarily conserved role of the molecular chaperone heat shock protein 10.

    PubMed

    He, Yan; Shang, Xuan; Sun, Junhua; Zhang, Lei; Zhao, Wei; Tian, Yihao; Cheng, Hanhua; Zhou, Rongjia

    2010-06-15

    Role of apoptosis in gonadal transformation of the rice field eel remains unknown. Here we report characterization of apoptotic pattern of testis, ovary, and ovotestis of the rice field eel, a vertebrate with natural sex reversal characteristic. DNA laddering assay showed typical ladder with step around 200 bp in the gonads, especially in testis. Terminal transferase dUTP nick end labeling on gonads indicated obvious apoptotic signals in the seminiferous tubules. Western blot analysis revealed that pro-apoptotic genes, Caspase 9 and p53, were upregulated and anti-apoptotic factor Bcl2 was downregulated in testis compared with both ovary and ovotestis. These data indicated that sex reversal process is accompanied by gonadal apoptosis with the highest proportion of cell death in the testis. Furthermore, we identified the Hsp10 by differentially screening of testis, ovary, and ovotestis using microarray technique, which is evolutionarily conserved and differentially expressed during gonadal transformation. Downregulation of Hsp10 is consistent with high apoptosis during the gonadal transformation. Flow cytometry assay confirmed that Hsp10 inhibits the apoptosis in male gonadal cells. Moreover, upregulation and mis-localization at sub-cellular level of the HSP10 together with its partner HSP60 is associated with tumorigenesis in human testis. These results suggest that downregulation of Hsp10 would be one of the main causes of apoptosis in testis, overexpression of Hsp10 suppresses apoptosis, and potentially results in testis tumorigenesis, which provide clues for understanding the mechanisms of germ cell apoptosis. Development of Hsp10 as a diagnostic marker or even treatment target will be promising in testis cancer diagnosis and therapy.

  16. Widespread Shortening of 3’ Untranslated Regions and Increased Exon Inclusion Are Evolutionarily Conserved Features of Innate Immune Responses to Infection

    PubMed Central

    Pagé Sabourin, Ariane; Nédélec, Yohann; Dumaine, Anne; Yotova, Vania; Johnson, Zachary P.; Lanford, Robert E.; Burge, Christopher B.

    2016-01-01

    The contribution of pre-mRNA processing mechanisms to the regulation of immune responses remains poorly studied despite emerging examples of their role as regulators of immune defenses. We sought to investigate the role of mRNA processing in the cellular responses of human macrophages to live bacterial infections. Here, we used mRNA sequencing to quantify gene expression and isoform abundances in primary macrophages from 60 individuals, before and after infection with Listeria monocytogenes and Salmonella typhimurium. In response to both bacteria we identified thousands of genes that significantly change isoform usage in response to infection, characterized by an overall increase in isoform diversity after infection. In response to both bacteria, we found global shifts towards (i) the inclusion of cassette exons and (ii) shorter 3’ UTRs, with near-universal shifts towards usage of more upstream polyadenylation sites. Using complementary data collected in non-human primates, we show that these features are evolutionarily conserved among primates. Following infection, we identify candidate RNA processing factors whose expression is associated with individual-specific variation in isoform abundance. Finally, by profiling microRNA levels, we show that 3’ UTRs with reduced abundance after infection are significantly enriched for target sites for particular miRNAs. These results suggest that the pervasive usage of shorter 3’ UTRs is a mechanism for particular genes to evade repression by immune-activated miRNAs. Collectively, our results suggest that dynamic changes in RNA processing may play key roles in the regulation of innate immune responses. PMID:27690314

  17. BMP, Wnt and FGF signals are integrated through evolutionarily conserved enhancers to achieve robust expression of Pax3 and Zic genes at the zebrafish neural plate border.

    PubMed

    Garnett, Aaron T; Square, Tyler A; Medeiros, Daniel M

    2012-11-01

    Neural crest cells generate a range of cells and tissues in the vertebrate head and trunk, including peripheral neurons, pigment cells, and cartilage. Neural crest cells arise from the edges of the nascent central nervous system, a domain called the neural plate border (NPB). NPB induction is known to involve the BMP, Wnt and FGF signaling pathways. However, little is known about how these signals are integrated to achieve temporally and spatially specific expression of genes in NPB cells. Furthermore, the timing and relative importance of these signals in NPB formation appears to differ between vertebrate species. Here, we use heat-shock overexpression and chemical inhibitors to determine whether, and when, BMP, Wnt and FGF signaling are needed for expression of the NPB specifiers pax3a and zic3 in zebrafish. We then identify four evolutionarily conserved enhancers from the pax3a and zic3 loci and test their response to BMP, Wnt and FGF perturbations. We find that all three signaling pathways are required during gastrulation for the proper expression of pax3a and zic3 in the zebrafish NPB. We also find that, although the expression patterns driven by the pax3a and zic3 enhancers largely overlap, they respond to different combinations of BMP, Wnt and FGF signals. Finally, we show that the combination of the two pax3a enhancers is less susceptible to signaling perturbations than either enhancer alone. Taken together, our results reveal how BMPs, FGFs and Wnts act cooperatively and redundantly through partially redundant enhancers to achieve robust, specific gene expression in the zebrafish NPB.

  18. Effect of Primers Hybridizing to Different Evolutionarily Conserved Regions of the Small-Subunit rRNA Gene in PCR-Based Microbial Community Analyses and Genetic Profiling

    PubMed Central

    Schmalenberger, Achim; Schwieger, Frank; Tebbe, Christoph C.

    2001-01-01

    Genetic profiling techniques of microbial communities based on PCR-amplified signature genes, such as denaturing gradient gel electrophoresis or single-strand-conformation polymorphism (SSCP) analysis, are normally done with PCR products of less than 500-bp. The most common target for diversity analysis, the small-subunit rRNA genes, however, are larger, and thus, only partial sequences can be analyzed. Here, we compared the results obtained by PCR targeting different variable (V) regions (V2 and V3, V4 and V5, and V6 to V8) of the bacterial 16S rRNA gene with primers hybridizing to evolutionarily conserved flanking regions. SSCP analysis of single-stranded PCR products generated from 13 different bacterial species showed fewer bands with products containing V4-V5 (average, 1.7 bands per organism) than with V2-V3 (2.2 bands) and V6-V8 (2.3 bands). We found that the additional bands (>1 per organism) were caused by intraspecies operon heterogeneities or by more than one conformation of the same sequence. Community profiles, generated by PCR-SSCP from bacterial-cell consortia extracted from rhizospheres of field-grown maize (Zea mays), were analyzed by cloning and sequencing of the dominant bands. A total of 48 sequences could be attributed to 34 different strains from 10 taxonomical groups. Independent of the primer pairs, we found proteobacteria (α, β, and γ subgroups) and members of the genus Paenibacillus (low G+C gram-positive) to be the dominant organisms. Other groups, however, were only detected with single primer pairs. This study gives an example of how much the selection of different variable regions combined with different specificities of the flanking “universal” primers can affect a PCR-based microbial community analysis. PMID:11472932

  19. IAA-Ala Resistant3, an evolutionarily conserved target of miR167, mediates Arabidopsis root architecture changes during high osmotic stress.

    PubMed

    Kinoshita, Natsuko; Wang, Huan; Kasahara, Hiroyuki; Liu, Jun; Macpherson, Cameron; Machida, Yasunori; Kamiya, Yuji; Hannah, Matthew A; Chua, Nam-Hai

    2012-09-01

    The functions of microRNAs and their target mRNAs in Arabidopsis thaliana development have been widely documented; however, roles of stress-responsive microRNAs and their targets are not as well understood. Using small RNA deep sequencing and ATH1 microarrays to profile mRNAs, we identified IAA-Ala Resistant3 (IAR3) as a new target of miR167a. As expected, IAR3 mRNA was cleaved at the miR167a complementary site and under high osmotic stress miR167a levels decreased, whereas IAR3 mRNA levels increased. IAR3 hydrolyzes an inactive form of auxin (indole-3-acetic acid [IAA]-alanine) and releases bioactive auxin (IAA), a central phytohormone for root development. In contrast with the wild type, iar3 mutants accumulated reduced IAA levels and did not display high osmotic stress-induced root architecture changes. Transgenic plants expressing a cleavage-resistant form of IAR3 mRNA accumulated high levels of IAR3 mRNAs and showed increased lateral root development compared with transgenic plants expressing wild-type IAR3. Expression of an inducible noncoding RNA to sequester miR167a by target mimicry led to an increase in IAR3 mRNA levels, further confirming the inverse relationship between the two partners. Sequence comparison revealed the miR167 target site on IAR3 mRNA is conserved in evolutionarily distant plant species. Finally, we showed that IAR3 is required for drought tolerance.

  20. Integrative analysis of tissue-specific methylation and alternative splicing identifies conserved transcription factor binding motifs

    PubMed Central

    Wan, Jun; Oliver, Verity F.; Zhu, Heng; Zack, Donald J.; Qian, Jiang; Merbs, Shannath L.

    2013-01-01

    The exact role of intragenic DNA methylation in regulating tissue-specific gene regulation is unclear. Recently, the DNA-binding protein CTCF has been shown to participate in the regulation of alternative splicing in a DNA methylation-dependent manner. To globally evaluate the relationship between DNA methylation and tissue-specific alternative splicing, we performed genome-wide DNA methylation profiling of mouse retina and brain. In protein-coding genes, tissue-specific differentially methylated regions (T-DMRs) were preferentially located in exons and introns. Gene ontology and evolutionary conservation analysis suggest that these T-DMRs are likely to be biologically relevant. More than 14% of alternatively spliced genes were associated with a T-DMR. T-DMR-associated genes were enriched for developmental genes, suggesting that a specific set of alternatively spliced genes may be regulated through DNA methylation. Novel DNA sequences motifs overrepresented in T-DMRs were identified as being associated with positive and/or negative regulation of alternative splicing in a position-dependent context. The majority of these evolutionarily conserved motifs contain a CpG dinucleotide. Some transcription factors, which recognize these motifs, are known to be involved in splicing. Our results suggest that DNA methylation-dependent alternative splicing is widespread and lay the foundation for further mechanistic studies of the role of DNA methylation in tissue-specific splicing regulation. PMID:23887936

  1. Transcription Factors Exhibit Differential Conservation in Bacteria with Reduced Genomes

    PubMed Central

    Galán-Vásquez, Edgardo; Sánchez-Osorio, Ismael; Martínez-Antonio, Agustino

    2016-01-01

    The description of transcriptional regulatory networks has been pivotal in the understanding of operating principles under which organisms respond and adapt to varying conditions. While the study of the topology and dynamics of these networks has been the subject of considerable work, the investigation of the evolution of their topology, as a result of the adaptation of organisms to different environmental conditions, has received little attention. In this work, we study the evolution of transcriptional regulatory networks in bacteria from a genome reduction perspective, which manifests itself as the loss of genes at different degrees. We used the transcriptional regulatory network of Escherichia coli as a reference to compare 113 smaller, phylogenetically-related γ-proteobacteria, including 19 genomes of symbionts. We found that the type of regulatory action exerted by transcription factors, as genomes get progressively smaller, correlates well with their degree of conservation, with dual regulators being more conserved than repressors and activators in conditions of extreme reduction. In addition, we found that the preponderant conservation of dual regulators might be due to their role as both global regulators and nucleoid-associated proteins. We summarize our results in a conceptual model of how each TF type is gradually lost as genomes become smaller and give a rationale for the order in which this phenomenon occurs. PMID:26766575

  2. Cross-species transcriptional network analysis reveals conservation and variation in response to metal stress in cyanobacteria

    PubMed Central

    2013-01-01

    Background As one of the most dominant bacterial groups on Earth, cyanobacteria play a pivotal role in the global carbon cycling and the Earth atmosphere composition. Understanding their molecular responses to environmental perturbations has important scientific and environmental values. Since important biological processes or networks are often evolutionarily conserved, the cross-species transcriptional network analysis offers a useful strategy to decipher conserved and species-specific transcriptional mechanisms that cells utilize to deal with various biotic and abiotic disturbances, and it will eventually lead to a better understanding of associated adaptation and regulatory networks. Results In this study, the Weighted Gene Co-expression Network Analysis (WGCNA) approach was used to establish transcriptional networks for four important cyanobacteria species under metal stress, including iron depletion and high copper conditions. Cross-species network comparison led to discovery of several core response modules and genes possibly essential to metal stress, as well as species-specific hub genes for metal stresses in different cyanobacteria species, shedding light on survival strategies of cyanobacteria responding to different environmental perturbations. Conclusions The WGCNA analysis demonstrated that the application of cross-species transcriptional network analysis will lead to novel insights to molecular response to environmental changes which will otherwise not be achieved by analyzing data from a single species. PMID:23421563

  3. A Conserved Transcriptional Signature of Delayed Aging and Reduced Disease Vulnerability Is Partially Mediated by SIRT3

    PubMed Central

    Newton, Michael A.; da Silva, Cristina; Vann, James A.; Pugh, Thomas D.; Someya, Shinichi; Prolla, Tomas A.; Weindruch, Richard

    2015-01-01

    Aging is the most significant risk factor for a range of diseases, including many cancers, neurodegeneration, cardiovascular disease, and diabetes. Caloric restriction (CR) without malnutrition delays aging in diverse species, and therefore offers unique insights into age-related disease vulnerability. Previous studies suggest that there are shared mechanisms of disease resistance associated with delayed aging, however quantitative support is lacking. We therefore sought to identify a common response to CR in diverse tissues and species and determine whether this signature would reflect health status independent of aging. We analyzed gene expression datasets from eight tissues of mice subjected to CR and identified a common transcriptional signature that includes functional categories of mitochondrial energy metabolism, inflammation and ribosomal structure. This signature is detected in flies, rats, and rhesus monkeys on CR, indicating aspects of CR that are evolutionarily conserved. Detection of the signature in mouse genetic models of slowed aging indicates that it is not unique to CR but rather a common aspect of extended longevity. Mice lacking the NAD-dependent deacetylase SIRT3 fail to induce mitochondrial and anti-inflammatory elements of the signature in response to CR, suggesting a potential mechanism involving SIRT3. The inverse of this transcriptional signature is detected with consumption of a high fat diet, obesity and metabolic disease, and is reversed in response to interventions that decrease disease risk. We propose that this evolutionarily conserved, tissue-independent, transcriptional signature of delayed aging and reduced disease vulnerability is a promising target for developing therapies for age-related diseases. PMID:25830335

  4. Body weight-dependent troponin T alternative splicing is evolutionarily conserved from insects to mammals and is partially impaired in skeletal muscle of obese rats

    PubMed Central

    Schilder, Rudolf J.; Kimball, Scot R.; Marden, James H.; Jefferson, Leonard S.

    2011-01-01

    SUMMARY Do animals know at a physiological level how much they weigh, and, if so, do they make homeostatic adjustments in response to changes in body weight? Skeletal muscle is a likely tissue for such plasticity, as weight-bearing muscles receive mechanical feedback regarding body weight and consume ATP in order to generate forces sufficient to counteract gravity. Using rats, we examined how variation in body weight affected alternative splicing of fast skeletal muscle troponin T (Tnnt3), a component of the thin filament that regulates the actin–myosin interaction during contraction and modulates force output. In response to normal growth and experimental body weight increases, alternative splicing of Tnnt3 in rat gastrocnemius muscle was adjusted in a quantitative fashion. The response depended on weight per se, as externally attached loads had the same effect as an equal change in actual body weight. Examining the association between Tnnt3 alternative splicing and ATP consumption rate, we found that the Tnnt3 splice form profile had a significant association with nocturnal energy expenditure, independently of effects of weight. For a subset of the Tnnt3 splice forms, obese Zucker rats failed to make the same adjustments; that is, they did not show the same relationship between body weight and the relative abundance of five Tnnt3 β splice forms (i.e. Tnnt3 β2–β5 and β8), four of which showed significant effects on nocturnal energy expenditure in Sprague–Dawley rats. Heavier obese Zucker rats displayed certain splice form relative abundances (e.g. Tnnt3 β3) characteristic of much lighter, lean animals, resulting in a mismatch between body weight and muscle molecular composition. Consequently, we suggest that body weight-inappropriate skeletal muscle Tnnt3 expression in obesity is a candidate mechanism for muscle weakness and reduced mobility. Weight-dependent quantitative variation in Tnnt3 alternative splicing appears to be an evolutionarily conserved

  5. Coexpression of Escherichia coli obgE, Encoding the Evolutionarily Conserved Obg GTPase, with Ribosomal Proteins L21 and L27

    PubMed Central

    Maouche, Rim; Burgos, Hector L.; My, Laetitia; Viala, Julie P.

    2016-01-01

    ABSTRACT Multiple essential small GTPases are involved in the assembly of the ribosome or in the control of its activity. Among them, ObgE (CgtA) has been shown recently to act as a ribosome antiassociation factor that binds to ppGpp, a regulator whose best-known target is RNA polymerase. The present study was aimed at elucidating the expression of obgE in Escherichia coli. We show that obgE is cotranscribed with ribosomal protein genes rplU and rpmA and with a gene of unknown function, yhbE. We show here that about 75% of the transcripts terminate before obgE, because there is a transcriptional terminator between rpmA and yhbE. As expected for ribosomal protein operons, expression was highest during exponential growth, decreased during entry into stationary phase, and became almost undetectable thereafter. Expression of the operon was derepressed in mutants lacking ppGpp or DksA. However, regulation by these factors appears to occur post-transcription initiation, since no effects of ppGpp and DksA on rplU promoter activity were observed in vitro. IMPORTANCE The conserved and essential ObgE GTPase binds to the ribosome and affects its assembly. ObgE has also been reported to impact chromosome segregation, cell division, resistance to DNA damage, and, perhaps most interestingly, persister formation and antibiotic tolerance. However, it is unclear whether these effects are related to its role in ribosome formation. Despite its importance, no studies on ObgE expression have been reported. We demonstrate here that obgE is expressed from an operon encoding two ribosomal proteins, that the operon's expression varies with the growth phase, and that it is dependent on the transcription regulators ppGpp and DksA. Our results thus demonstrate that obgE expression is coupled to ribosomal gene expression. PMID:27137500

  6. Conserved hemopoietic transcription factor Cg-SCL delineates hematopoiesis of Pacific oyster Crassostrea gigas.

    PubMed

    Song, Xiaorui; Wang, Hao; Chen, Hao; Sun, Mingzhe; Liang, Zhongxiu; Wang, Lingling; Song, Linsheng

    2016-04-01

    Hemocytes are the effective immunocytes in bivalves, which have been reported to be derived from stem-like cells in gill epithelium of oyster. In the present work, a conserved haematopoietic transcription factor Tal-1/Scl (Stem Cell Leukemia) was identified in Pacific oyster (Cg-SCL), and it was evolutionarily close to the orthologs in deuterostomes. Cg-SCL was highly distributed in the hemocytes as well as gill and mantle. The hemocyte specific genes Integrin, EcSOD and haematopoietic transcription factors GATA3, C-Myb, c-kit, were down-regulated when Cg-SCL was interfered by dsRNA. During the larval developmental stages, the mRNA transcripts of Cg-SCL gradually increased after fertilization and peaked at early trochophore larvae stage (10 hpf, hours post fertilization), then sharply decreased in late trochophore larvae stage (15 hpf) before resuming in umbo larvae (120 hpf). Whole-mount immunofluorescence assay further revealed that the immunoreactivity of Cg-SCL appeared in blastula larvae with two approximate symmetric spots, and this expression pattern lasted in gastrula larvae. By trochophore, the immunoreactivity formed a ring around the dorsal region and then separated into two remarkable spots at the dorsal side in D-veliger larvae. After bacterial challenge, the mRNA expression levels of Cg-SCL were significantly up-regulated in the D-veliger and umbo larvae, indicating the available hematopoietic regulation in oyster larvae. These results demonstrated that Cg-SCL could be used as haematopoietic specific marker to trace potential developmental events of hematopoiesis during ontogenesis of oyster, which occurred early in blastula stage and maintained until D-veliger larvae.

  7. Evolutionarily conserved Ets family members display distinct DNA binding specificities [published erratum appears in J Exp Med 1993 Sep 1;178(3):1133

    PubMed Central

    1992-01-01

    Members of the Ets family of proto-oncogenes encode sequence-specific transcription factors that bind to a purine-rich motif centered around a conserved GGA trinucleotide. Ets binding sites have been identified in the transcriptional regulatory regions of multiple T cell genes including the T cell receptor alpha and beta (TCR-alpha and -beta) enhancers and the IL-2 enhancer, as well as in the enhancers of several T cell-trophic viruses including Maloney sarcoma virus, human leukemia virus type 1, and human immunodeficiency virus-2. T cells express multiple members of the Ets gene family including Ets-1, Ets-2, GABP alpha, Elf-1, and Fli-1. The different patterns of expression and protein-protein interactions of these different Ets family members undoubtedly contribute to their ability to specifically regulate distinct sets of T cell genes. However, previous studies have suggested that different Ets family members might also display distinct DNA binding specificities. In this report, we have examined the DNA binding characteristics of two Ets family members, Ets-1 and Elf-1, that are highly expressed in T cells. The results demonstrate that the minimal DNA binding domain of these proteins consists of adjacent basic and putative alpha-helical regions that are conserved in all of the known Ets family members. Both regions are required for DNA binding activity. In vitro binding studies demonstrated that Ets-1 and Elf-1 display distinct DNA binding specificities, and, thereby interact preferentially with different naturally occurring Ets binding sites. A comparison of known Ets binding sites identified three nucleotides at the 3' end of these sequences that control the differential binding of the Ets-1 and Elf-1 proteins. These results are consistent with a model in which different Ets family members regulate the expression of different T cell genes by binding preferentially to purine-rich sequences that share a GGA core motif, but contain distinct flanking sequences

  8. The Mediator complex of Caenorhabditis elegans: insights into the developmental and physiological roles of a conserved transcriptional coregulator

    PubMed Central

    Grants, Jennifer M.; Goh, Grace Y. S.; Taubert, Stefan

    2015-01-01

    The Mediator multiprotein complex (‘Mediator’) is an important transcriptional coregulator that is evolutionarily conserved throughout eukaryotes. Although some Mediator subunits are essential for the transcription of all protein-coding genes, others influence the expression of only subsets of genes and participate selectively in cellular signaling pathways. Here, we review the current knowledge of Mediator subunit function in the nematode Caenorhabditis elegans, a metazoan in which established and emerging genetic technologies facilitate the study of developmental and physiological regulation in vivo. In this nematode, unbiased genetic screens have revealed critical roles for Mediator components in core developmental pathways such as epidermal growth factor (EGF) and Wnt/β-catenin signaling. More recently, important roles for C. elegans Mediator subunits have emerged in the regulation of lipid metabolism and of systemic stress responses, engaging conserved transcription factors such as nuclear hormone receptors (NHRs). We emphasize instances where similar functions for individual Mediator subunits exist in mammals, highlighting parallels between Mediator subunit action in nematode development and in human cancer biology. We also discuss a parallel between the association of the Mediator subunit MED12 with several human disorders and the role of its C. elegans ortholog mdt-12 as a regulatory hub that interacts with numerous signaling pathways. PMID:25634893

  9. Transcriptional divergence and conservation of human and mouse erythropoiesis.

    PubMed

    Pishesha, Novalia; Thiru, Prathapan; Shi, Jiahai; Eng, Jennifer C; Sankaran, Vijay G; Lodish, Harvey F

    2014-03-18

    Mouse models have been used extensively for decades and have been instrumental in improving our understanding of mammalian erythropoiesis. Nonetheless, there are several examples of variation between human and mouse erythropoiesis. We performed a comparative global gene expression study using data from morphologically identical stage-matched sorted populations of human and mouse erythroid precursors from early to late erythroblasts. Induction and repression of major transcriptional regulators of erythropoiesis, as well as major erythroid-important proteins, are largely conserved between the species. In contrast, at a global level we identified a significant extent of divergence between the species, both at comparable stages and in the transitions between stages, especially for the 500 most highly expressed genes during development. This suggests that the response of multiple developmentally regulated genes to key erythroid transcriptional regulators represents an important modification that has occurred in the course of erythroid evolution. In developing a systematic framework to understand and study conservation and divergence between human and mouse erythropoiesis, we show how mouse models can fail to mimic specific human diseases and provide predictions for translating findings from mouse models to potential therapies for human disease.

  10. Conserved Transcriptional Regulatory Programs Underlying Rice and Barley Germination

    PubMed Central

    Lin, Li; Tian, Shulan; Kaeppler, Shawn; Liu, Zongrang; An, Yong-Qiang (Charles)

    2014-01-01

    Germination is a biological process important to plant development and agricultural production. Barley and rice diverged 50 million years ago, but share a similar germination process. To gain insight into the conservation of their underlying gene regulatory programs, we compared transcriptomes of barley and rice at start, middle and end points of germination, and revealed that germination regulated barley and rice genes (BRs) diverged significantly in expression patterns and/or protein sequences. However, BRs with higher protein sequence similarity tended to have more conserved expression patterns. We identified and characterized 316 sets of conserved barley and rice genes (cBRs) with high similarity in both protein sequences and expression patterns, and provided a comprehensive depiction of the transcriptional regulatory program conserved in barley and rice germination at gene, pathway and systems levels. The cBRs encoded proteins involved in a variety of biological pathways and had a wide range of expression patterns. The cBRs encoding key regulatory components in signaling pathways often had diverse expression patterns. Early germination up-regulation of cell wall metabolic pathway and peroxidases, and late germination up-regulation of chromatin structure and remodeling pathways were conserved in both barley and rice. Protein sequence and expression pattern of a gene change quickly if it is not subjected to a functional constraint. Preserving germination-regulated expression patterns and protein sequences of those cBRs for 50 million years strongly suggests that the cBRs are functionally significant and equivalent in germination, and contribute to the ancient characteristics of germination preserved in barley and rice. The functional significance and equivalence of the cBR genes predicted here can serve as a foundation to further characterize their biological functions and facilitate bridging rice and barley germination research with greater confidence. PMID

  11. Establishment of transgenic lines to monitor and manipulate Yap/Taz-Tead activity in zebrafish reveals both evolutionarily conserved and divergent functions of the Hippo pathway

    PubMed Central

    Miesfeld, Joel B.; Link, Brian A.

    2014-01-01

    To investigate the role of Hippo pathway signaling during vertebrate development transgenic zebrafish lines were generated and validated to dynamically monitor and manipulate Yap/Taz-Tead activity. Spatial and temporal analysis of Yap/Taz-Tead activity suggested the importance of Hippo signaling during cardiac precursor migration and other developmental processes. When the transcriptional co-activators, Yap and Taz were restricted from interacting with DNA-binding Tead transcription factors through expression of a dominant negative transgene, cardiac precursors failed to migrate completely to the midline resulting in strong cardia bifida. Yap/Taz-Tead activity reporters also allowed us to investigate upstream and downstream factors known to regulate Hippo signaling output in Drosophila. While Crumbs mutations in Drosophila eye disc epithelia increase nuclear translocation and activity of Yorkie (the fly homolog of Yap/Taz), zebrafish crb2a mutants lacked nuclear Yap positive cells and down-regulated Yap/Taz-Tead activity reporters in the eye epithelia, despite the loss of apical-basal cell polarity in those cells. However, as an example of evolutionary conservation, the Tondu-domain containing protein Vestigial-like 4b (Vgll4b) was found to down-regulate endogenous Yap/Taz-Tead activity in the retinal pigment epithelium, similar to Drosophila Tgi in imaginal discs. In conclusion, the Yap/Taz-Tead activity reporters revealed the dynamics of Yap/Taz-Tead signaling and novel insights into Hippo pathway regulation for vertebrates. These studies highlight the utility of this transgenic tool-suite for ongoing analysis into the mechanisms of Hippo pathway regulation and the consequences of signaling output. PMID:24560909

  12. Establishment of transgenic lines to monitor and manipulate Yap/Taz-Tead activity in zebrafish reveals both evolutionarily conserved and divergent functions of the Hippo pathway.

    PubMed

    Miesfeld, Joel B; Link, Brian A

    2014-08-01

    To investigate the role of Hippo pathway signaling during vertebrate development transgenic zebrafish lines were generated and validated to dynamically monitor and manipulate Yap/Taz-Tead activity. Spatial and temporal analysis of Yap/Taz-Tead activity suggested the importance of Hippo signaling during cardiac precursor migration and other developmental processes. When the transcriptional co-activators, Yap and Taz were restricted from interacting with DNA-binding Tead transcription factors through expression of a dominant negative transgene, cardiac precursors failed to migrate completely to the midline resulting in strong cardia bifida. Yap/Taz-Tead activity reporters also allowed us to investigate upstream and downstream factors known to regulate Hippo signaling output in Drosophila. While Crumbs mutations in Drosophila eye disc epithelia increase nuclear translocation and activity of Yorkie (the fly homolog of Yap/Taz), zebrafish crb2a mutants lacked nuclear Yap positive cells and down-regulated Yap/Taz-Tead activity reporters in the eye epithelia, despite the loss of apical-basal cell polarity in those cells. However, as an example of evolutionary conservation, the Tondu-domain containing protein Vestigial-like 4b (Vgll4b) was found to down-regulate endogenous Yap/Taz-Tead activity in the retinal pigment epithelium, similar to Drosophila Tgi in imaginal discs. In conclusion, the Yap/Taz-Tead activity reporters revealed the dynamics of Yap/Taz-Tead signaling and novel insights into Hippo pathway regulation for vertebrates. These studies highlight the utility of this transgenic tool-suite for ongoing analysis into the mechanisms of Hippo pathway regulation and the consequences of signaling output. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  13. Evolutionarily Conserved Function of RRP36 in Early Cleavages of the Pre-rRNA and Production of the 40S Ribosomal Subunit ▿ †

    PubMed Central

    Gérus, Marie; Bonnart, Chrystelle; Caizergues-Ferrer, Michèle; Henry, Yves; Henras, Anthony K.

    2010-01-01

    Ribosome biogenesis in eukaryotes is a major cellular activity mobilizing the products of over 200 transcriptionally coregulated genes referred to as the rRNA and ribosome biosynthesis regulon. We investigated the function of an essential, uncharacterized gene of this regulon, renamed RRP36. We show that the Rrp36p protein is nucleolar and interacts with 90S and pre-40S preribosomal particles. Its depletion affects early cleavages of the 35S pre-rRNA and results in a rapid decrease in mature 18S rRNA levels. Rrp36p is a novel component of the 90S preribosome, the assembly of which has been suggested to result from the stepwise incorporation of several modules, including the tUTP/UTP-A, PWP2/UTP-B, and UTP-C subcomplexes. We show that Rrp36p depletion does not impair the incorporation of these subcomplexes and the U3 small nucleolar RNP into preribosomes. In contrast, depletion of components of the UTP-A or UTP-B modules, but not Rrp5p, prevents Rrp36p recruitment and reduces its accumulation levels. In parallel, we studied the human orthologue of Rrp36p in HeLa cells, and we show that the function of this protein in early cleavages of the pre-rRNA has been conserved through evolution in eukaryotes. PMID:20038530

  14. Evolutionarily Conserved TCR Binding Sites, Identification of T Cells in Primary Lymphoid Tissues, and Surprising Trans-Rearrangements in Nurse Shark

    PubMed Central

    Criscitiello, Michael F.; Ohta, Yuko; Saltis, Mark; McKinney, E. Churchill; Flajnik, Martin F.

    2011-01-01

    Cartilaginous fish are the oldest animals that generate RAG-based Ag receptor diversity. We have analyzed the genes and expressed transcripts of the four TCR chains for the first time in a cartilaginous fish, the nurse shark (Ginglymostoma cirratum). Northern blotting found TCR mRNA expression predominantly in lymphoid and mucosal tissues. Southern blotting suggested translocon-type loci encoding all four chains. Based on diversity of V and J segments, the expressed combinatorial diversity for γ is similar to that of human, α and β may be slightly lower, and δ diversity is the highest of any organism studied to date. Nurse shark TCRδ have long CDR3 loops compared with the other three chains, creating binding site topologies comparable to those of mammalian TCR in basic paratope structure; additionally, nurse shark TCRδ CDR3 are more similar to IgH CDR3 in length and heterogeneity than to other TCR chains. Most interestingly, several cDNAs were isolated that contained IgM or IgW V segments rearranged to other gene segments of TCRδ and α. Finally, in situ hybridization experiments demonstrate a conservation of both α/β and γ/δ T cell localization in the thymus across 450 million years of vertebrate evolution, with γ/δ TCR expression especially high in the subcapsular region. Collectively, these data make the first cellular identification of TCR-expressing lymphocytes in a cartilaginous fish. PMID:20488795

  15. Evolutionarily conserved TCR binding sites, identification of T cells in primary lymphoid tissues, and surprising trans-rearrangements in nurse shark.

    PubMed

    Criscitiello, Michael F; Ohta, Yuko; Saltis, Mark; McKinney, E Churchill; Flajnik, Martin F

    2010-06-15

    Cartilaginous fish are the oldest animals that generate RAG-based Ag receptor diversity. We have analyzed the genes and expressed transcripts of the four TCR chains for the first time in a cartilaginous fish, the nurse shark (Ginglymostoma cirratum). Northern blotting found TCR mRNA expression predominantly in lymphoid and mucosal tissues. Southern blotting suggested translocon-type loci encoding all four chains. Based on diversity of V and J segments, the expressed combinatorial diversity for gamma is similar to that of human, alpha and beta may be slightly lower, and delta diversity is the highest of any organism studied to date. Nurse shark TCRdelta have long CDR3 loops compared with the other three chains, creating binding site topologies comparable to those of mammalian TCR in basic paratope structure; additionally, nurse shark TCRdelta CDR3 are more similar to IgH CDR3 in length and heterogeneity than to other TCR chains. Most interestingly, several cDNAs were isolated that contained IgM or IgW V segments rearranged to other gene segments of TCRdelta and alpha. Finally, in situ hybridization experiments demonstrate a conservation of both alpha/beta and gamma/delta T cell localization in the thymus across 450 million years of vertebrate evolution, with gamma/delta TCR expression especially high in the subcapsular region. Collectively, these data make the first cellular identification of TCR-expressing lymphocytes in a cartilaginous fish.

  16. Prediction of synergistic transcription factors by function conservation

    PubMed Central

    Hu, Zihua; Hu, Boyu; Collins, James F

    2007-01-01

    Background Previous methods employed for the identification of synergistic transcription factors (TFs) are based on either TF enrichment from co-regulated genes or phylogenetic footprinting. Despite the success of these methods, both have limitations. Results We propose a new strategy to identify synergistic TFs by function conservation. Rather than aligning the regulatory sequences from orthologous genes and then identifying conserved TF binding sites (TFBSs) in the alignment, we developed computational approaches to implement the novel strategy. These methods include combinatorial TFBS enrichment utilizing distance constraints followed by enrichment of overlapping orthologous genes from human and mouse, whose regulatory sequences contain the enriched TFBS combinations. Subsequently, integration of function conservation from both TFBS and overlapping orthologous genes was achieved by correlation analyses. These techniques have been used for genome-wide promoter analyses, which have led to the identification of 51 homotypic TF combinations; the validity of these approaches has been exemplified by both known TF-TF interactions and function coherence analyses. We further provide computational evidence that our novel methods were able to identify synergistic TFs to a much greater extent than phylogenetic footprinting. Conclusion Function conservation based on the concordance of combinatorial TFBS enrichment along with enrichment of overlapping orthologous genes has been proven to be a successful means for the identification of synergistic TFs. This approach avoids the limitations of phylogenetic footprinting as it does not depend upon sequence alignment. It utilizes existing gene annotation data, such as those available in GO, thus providing an alternative method for functional TF discovery and annotation. PMID:18053230

  17. Large-scale nucleotide sequence alignment and sequence variability assessment to identify the evolutionarily highly conserved regions for universal screening PCR assay design: an example of influenza A virus.

    PubMed

    Nagy, Alexander; Jiřinec, Tomáš; Černíková, Lenka; Jiřincová, Helena; Havlíčková, Martina

    2015-01-01

    The development of a diagnostic polymerase chain reaction (PCR) or quantitative PCR (qPCR) assay for universal detection of highly variable viral genomes is always a difficult task. The purpose of this chapter is to provide a guideline on how to align, process, and evaluate a huge set of homologous nucleotide sequences in order to reveal the evolutionarily most conserved positions suitable for universal qPCR primer and hybridization probe design. Attention is paid to the quantification and clear graphical visualization of the sequence variability at each position of the alignment. In addition, specific problems related to the processing of the extremely large sequence pool are highlighted. All of these steps are performed using an ordinary desktop computer without the need for extensive mathematical or computational skills.

  18. Loneliness, eudaimonia, and the human conserved transcriptional response to adversity

    PubMed Central

    Cole, Steven W.; Levine, Morgan E.; Arevalo, Jesusa M. G.; Ma, Jeffrey; Weir, David R.; Crimmins, Eileen M.

    2015-01-01

    Background Chronic social adversity activates a conserved transcriptional response to adversity (CTRA) marked by increased expression of pro-inflammatory genes and decreased expression of antiviral- and antibody-related genes. Recent findings suggest that some psychological resilience factors may help buffer CTRA activation, but the relative impact of resilience and adversity factors remains poorly understood. Here we examined the relative strength of CTRA association for the two best-established psychological correlates of CTRA gene expression – the risk factor of perceived social isolation (loneliness) and the resilience factor of eudaimonic well-being (purpose and meaning in life). Methods Peripheral blood samples and validated measures of loneliness and eudaimonic well-being were analyzed in 108 community-dwelling older adults participating in the longitudinal US Health and Retirement Study (56% female, mean age 73). Mixed effect linear model analyses quantified the strength of association between CTRA gene expression and measures of loneliness and eudaimonic well-being in separate and joint analyses. Results As in previous studies, separate analyses found CTRA gene expression to be up-regulated in association with loneliness and down-regulated in association with eudaimonic well-being. In joint analyses, effects of loneliness were completely abrogated whereas eudaimonic well-being continued to associate with CTRA down-regulation. Similar eudaimonia-dominant effects were observed for positive and negative affect, optimism and pessimism, and anxiety symptoms. All results were independent of demographic and behavioral health risk factors. Conclusions Eudaimonic well-being may have the potential to compensate for the adverse impact of loneliness on CTRA gene expression. Findings suggest a novel approach to targeting the health risks associated with social isolation by promoting purpose and meaning in life. PMID:26246388

  19. Insights from the cold transcriptome of Physcomitrella patens: global specialization pattern of conserved transcriptional regulators and identification of orphan genes involved in cold acclimation

    PubMed Central

    Beike, Anna K; Lang, Daniel; Zimmer, Andreas D; Wüst, Florian; Trautmann, Danika; Wiedemann, Gertrud; Beyer, Peter; Decker, Eva L; Reski, Ralf

    2015-01-01

    The whole-genome transcriptomic cold stress response of the moss Physcomitrella patens was analyzed and correlated with phenotypic and metabolic changes. Based on time-series microarray experiments and quantitative real-time polymerase chain reaction, we characterized the transcriptomic changes related to early stress signaling and the initiation of cold acclimation. Transcription-associated protein (TAP)-encoding genes of P. patens and Arabidopsis thaliana were classified using generalized linear models. Physiological responses were monitored with pulse-amplitude-modulated fluorometry, high-performance liquid chromatography and targeted high-performance mass spectrometry. The transcript levels of 3220 genes were significantly affected by cold. Comparative classification revealed a global specialization of TAP families, a transcript accumulation of transcriptional regulators of the stimulus/stress response and a transcript decline of developmental regulators. Although transcripts of the intermediate to later response are from evolutionarily conserved genes, the early response is dominated by species-specific genes. These orphan genes may encode as yet unknown acclimation processes. PMID:25209349

  20. Characterization of Drosophila GDNF Receptor-Like and Evidence for Its Evolutionarily Conserved Interaction with Neural Cell Adhesion Molecule (NCAM)/FasII

    PubMed Central

    Kallijärvi, Jukka; Stratoulias, Vassilis; Virtanen, Kristel; Hietakangas, Ville; Heino, Tapio I.; Saarma, Mart

    2012-01-01

    Background Glial cell line-derived neurotrophic factor (GDNF) family ligands are secreted growth factors distantly related to the TGF-β superfamily. In mammals, they bind to the GDNF family receptor α (Gfrα) and signal through the Ret receptor tyrosine kinase. In order to gain insight into the evolution of the Ret-Gfr-Gdnf signaling system, we have cloned and characterized the first invertebrate Gfr-like cDNA (DmGfrl) from Drosophila melanogaster and generated a DmGfrl mutant allele. Results We found that DmGfrl encodes a large GPI-anchored membrane protein with four GFR-like domains. In line with the fact that insects lack GDNF ligands, DmGfrl mediated neither Drosophila Ret phosphorylation nor mammalian RET phosphorylation. In situ hybridization analysis revealed that DmGfrl is expressed in the central and peripheral nervous systems throughout Drosophila development, but, surprisingly, DmGfrl and DmRet expression patterns were largely non-overlapping. We generated a DmGfrl null allele by genomic FLP deletion and found that both DmGfrl null females and males are viable but display fertility defects. The female fertility defect manifested as dorsal appendage malformation, small size and reduced viability of eggs laid by mutant females. In male flies DmGfrl interacted genetically with the Drosophila Ncam (neural cell adhesion molecule) homolog FasII to regulate fertility. Conclusion Our results suggest that Ret and Gfrl did not function as an in cis receptor-coreceptor pair before the emergence of GDNF family ligands, and that the Ncam-Gfr interaction predated the in cis Ret-Gfr interaction in evolution. The fertility defects that we describe in DmGfrl null flies suggest that GDNF receptor-like has an evolutionarily ancient role in regulating male fertility and a previously unrecognized role in regulating oogenesis. Significance These results shed light on the evolutionary aspects of the structure, expression and function of Ret-Gfrα and Ncam-Gfrα signaling

  1. Transcriptome Analysis of Cell Wall and NAC Domain Transcription Factor Genes during Elaeis guineensis Fruit Ripening: Evidence for Widespread Conservation within Monocot and Eudicot Lineages

    PubMed Central

    Tranbarger, Timothy J.; Fooyontphanich, Kim; Roongsattham, Peerapat; Pizot, Maxime; Collin, Myriam; Jantasuriyarat, Chatchawan; Suraninpong, Potjamarn; Tragoonrung, Somvong; Dussert, Stéphane; Verdeil, Jean-Luc; Morcillo, Fabienne

    2017-01-01

    The oil palm (Elaeis guineensis), a monocotyledonous species in the family Arecaceae, has an extraordinarily oil rich fleshy mesocarp, and presents an original model to examine the ripening processes and regulation in this particular monocot fruit. Histochemical analysis and cell parameter measurements revealed cell wall and middle lamella expansion and degradation during ripening and in response to ethylene. Cell wall related transcript profiles suggest a transition from synthesis to degradation is under transcriptional control during ripening, in particular a switch from cellulose, hemicellulose, and pectin synthesis to hydrolysis and degradation. The data provide evidence for the transcriptional activation of expansin, polygalacturonase, mannosidase, beta-galactosidase, and xyloglucan endotransglucosylase/hydrolase proteins in the ripening oil palm mesocarp, suggesting widespread conservation of these activities during ripening for monocotyledonous and eudicotyledonous fruit types. Profiling of the most abundant oil palm polygalacturonase (EgPG4) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) transcripts during development and in response to ethylene demonstrated both are sensitive markers of ethylene production and inducible gene expression during mesocarp ripening, and provide evidence for a conserved regulatory module between ethylene and cell wall pectin degradation. A comprehensive analysis of NAC transcription factors confirmed at least 10 transcripts from diverse NAC domain clades are expressed in the mesocarp during ripening, four of which are induced by ethylene treatment, with the two most inducible (EgNAC6 and EgNAC7) phylogenetically similar to the tomato NAC-NOR master-ripening regulator. Overall, the results provide evidence that despite the phylogenetic distance of the oil palm within the family Arecaceae from the most extensively studied monocot banana fruit, it appears ripening of divergent monocot and eudicot fruit lineages are

  2. Transcriptome Analysis of Cell Wall and NAC Domain Transcription Factor Genes during Elaeis guineensis Fruit Ripening: Evidence for Widespread Conservation within Monocot and Eudicot Lineages.

    PubMed

    Tranbarger, Timothy J; Fooyontphanich, Kim; Roongsattham, Peerapat; Pizot, Maxime; Collin, Myriam; Jantasuriyarat, Chatchawan; Suraninpong, Potjamarn; Tragoonrung, Somvong; Dussert, Stéphane; Verdeil, Jean-Luc; Morcillo, Fabienne

    2017-01-01

    The oil palm (Elaeis guineensis), a monocotyledonous species in the family Arecaceae, has an extraordinarily oil rich fleshy mesocarp, and presents an original model to examine the ripening processes and regulation in this particular monocot fruit. Histochemical analysis and cell parameter measurements revealed cell wall and middle lamella expansion and degradation during ripening and in response to ethylene. Cell wall related transcript profiles suggest a transition from synthesis to degradation is under transcriptional control during ripening, in particular a switch from cellulose, hemicellulose, and pectin synthesis to hydrolysis and degradation. The data provide evidence for the transcriptional activation of expansin, polygalacturonase, mannosidase, beta-galactosidase, and xyloglucan endotransglucosylase/hydrolase proteins in the ripening oil palm mesocarp, suggesting widespread conservation of these activities during ripening for monocotyledonous and eudicotyledonous fruit types. Profiling of the most abundant oil palm polygalacturonase (EgPG4) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) transcripts during development and in response to ethylene demonstrated both are sensitive markers of ethylene production and inducible gene expression during mesocarp ripening, and provide evidence for a conserved regulatory module between ethylene and cell wall pectin degradation. A comprehensive analysis of NAC transcription factors confirmed at least 10 transcripts from diverse NAC domain clades are expressed in the mesocarp during ripening, four of which are induced by ethylene treatment, with the two most inducible (EgNAC6 and EgNAC7) phylogenetically similar to the tomato NAC-NOR master-ripening regulator. Overall, the results provide evidence that despite the phylogenetic distance of the oil palm within the family Arecaceae from the most extensively studied monocot banana fruit, it appears ripening of divergent monocot and eudicot fruit lineages are

  3. Drosophila melanogaster Hox Transcription Factors Access the RNA Polymerase II Machinery through Direct Homeodomain Binding to a Conserved Motif of Mediator Subunit Med19

    PubMed Central

    Boube, Muriel; Hudry, Bruno; Immarigeon, Clément; Carrier, Yannick; Bernat-Fabre, Sandra; Merabet, Samir; Graba, Yacine; Bourbon, Henri-Marc; Cribbs, David L.

    2014-01-01

    Hox genes in species across the metazoa encode transcription factors (TFs) containing highly-conserved homeodomains that bind target DNA sequences to regulate batteries of developmental target genes. DNA-bound Hox proteins, together with other TF partners, induce an appropriate transcriptional response by RNA Polymerase II (PolII) and its associated general transcription factors. How the evolutionarily conserved Hox TFs interface with this general machinery to generate finely regulated transcriptional responses remains obscure. One major component of the PolII machinery, the Mediator (MED) transcription complex, is composed of roughly 30 protein subunits organized in modules that bridge the PolII enzyme to DNA-bound TFs. Here, we investigate the physical and functional interplay between Drosophila melanogaster Hox developmental TFs and MED complex proteins. We find that the Med19 subunit directly binds Hox homeodomains, in vitro and in vivo. Loss-of-function Med19 mutations act as dose-sensitive genetic modifiers that synergistically modulate Hox-directed developmental outcomes. Using clonal analysis, we identify a role for Med19 in Hox-dependent target gene activation. We identify a conserved, animal-specific motif that is required for Med19 homeodomain binding, and for activation of a specific Ultrabithorax target. These results provide the first direct molecular link between Hox homeodomain proteins and the general PolII machinery. They support a role for Med19 as a PolII holoenzyme-embedded “co-factor” that acts together with Hox proteins through their homeodomains in regulated developmental transcription. PMID:24786462

  4. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  5. An evolutionarily conserved motif in the TAB1 C-terminal region is necessary for interaction with and activation of TAK1 MAPKKK.

    PubMed

    Ono, K; Ohtomo, T; Sato, S; Sugamata, Y; Suzuki, M; Hisamoto, N; Ninomiya-Tsuji, J; Tsuchiya, M; Matsumoto, K

    2001-06-29

    TAK1, a member of the MAPKKK family, is involved in the intracellular signaling pathways mediated by transforming growth factor beta, interleukin 1, and Wnt. TAK1 kinase activity is specifically activated by the TAK1-binding protein TAB1. The C-terminal 68-amino acid sequence of TAB1 (TAB1-C68) is sufficient for TAK1 interaction and activation. Analysis of various truncated versions of TAB1-C68 defined a C-terminal 30-amino acid sequence (TAB1-C30) necessary for TAK1 binding and activation. NMR studies revealed that the TAB1-C30 region has a unique alpha-helical structure. We identified a conserved sequence motif, PYVDXA/TXF, in the C-terminal domain of mammalian TAB1, Xenopus TAB1, and its Caenorhabditis elegans homolog TAP-1, suggesting that this motif constitutes a specific TAK1 docking site. Alanine substitution mutagenesis showed that TAB1 Phe-484, located in the conserved motif, is crucial for TAK1 binding and activation. The C. elegans homolog of TAB1, TAP-1, was able to interact with and activate the C. elegans homolog of TAK1, MOM-4. However, the site in TAP-1 corresponding to Phe-484 of TAB1 is an alanine residue (Ala-364), and changing this residue to Phe abrogates the ability of TAP-1 to interact with and activate MOM-4. These results suggest that the Phe or Ala residue within the conserved motif of the TAB1-related proteins is important for interaction with and activation of specific TAK1 MAPKKK family members in vivo.

  6. Identification of proliferation-induced genes in Arabidopsis thaliana. Characterization of a new member of the highly evolutionarily conserved histone H2A.F/Z variant subfamily.

    PubMed Central

    Callard, D; Mazzolini, L

    1997-01-01

    The changes in gene expression associated with the reinitiation of cell division and subsequent progression through the cell cycle in Arabidopsis thaliana cell-suspension cultures were investigated. Partial synchronization of cells was achieved by a technique combining phosphate starvation and a transient treatment with the DNA replication inhibitor aphidicolin. Six cDNAs corresponding to genes highly induced in proliferating cells and showing cell-cycle-regulated expression were obtained by the mRNA differential display technique. Full-length cDNA clones (cH2BAt and cH2AvAt) corresponding to two of the display products were subsequently isolated. The cH2BAt clone codes for a novel histone H2B protein, whereas the cH2AvAt cDNA corresponds to a gene encoding a new member of the highly conserved histone H2A.F/Z subfamily of chromosomal proteins. Further studies indicated that H2AvAt mRNA expression is tightly correlated with cell proliferation in cell-suspension cultures, and that closely related analogs of the encoded protein exist in Arabidopsis. The implications of the conservation of histone H2A.F/Z variants in plants are discussed. PMID:9414552

  7. Conservation of AtTZF1, AtTZF2, and AtTZF3 homolog gene regulation by salt stress in evolutionarily distant plant species

    PubMed Central

    D’Orso, Fabio; De Leonardis, Anna M.; Salvi, Sergio; Gadaleta, Agata; Ruberti, Ida; Cattivelli, Luigi; Morelli, Giorgio; Mastrangelo, Anna M.

    2015-01-01

    Arginine-rich tandem zinc-finger proteins (RR-TZF) participate in a wide range of plant developmental processes and adaptive responses to abiotic stress, such as cold, salt, and drought. This study investigates the conservation of the genes AtTZF1-5 at the level of their sequences and expression across plant species. The genomic sequences of the two RR-TZF genes TdTZF1-A and TdTZF1-B were isolated in durum wheat and assigned to chromosomes 3A and 3B, respectively. Sequence comparisons revealed that they encode proteins that are highly homologous to AtTZF1, AtTZF2, and AtTZF3. The expression profiles of these RR-TZF durum wheat and Arabidopsis proteins support a common function in the regulation of seed germination and responses to abiotic stress. In particular, analysis of plants with attenuated and overexpressed AtTZF3 indicate that AtTZF3 is a negative regulator of seed germination under conditions of salt stress. Finally, comparative sequence analyses establish that the RR-TZF genes are encoded by lower plants, including the bryophyte Physcomitrella patens and the alga Chlamydomonas reinhardtii. The regulation of the Physcomitrella AtTZF1-2-3-like genes by salt stress strongly suggests that a subgroup of the RR-TZF proteins has a function that has been conserved throughout evolution. PMID:26136754

  8. Evolutionarily conserved organization of the dopaminergic system in lamprey: SNc/VTA afferent and efferent connectivity and D2 receptor expression.

    PubMed

    Pérez-Fernández, Juan; Stephenson-Jones, Marcus; Suryanarayana, Shreyas M; Robertson, Brita; Grillner, Sten

    2014-12-01

    The dopaminergic system influences motor behavior, signals reward and novelty, and is an essential component of the basal ganglia in all vertebrates including the lamprey, one of the phylogenetically oldest vertebrates. The intrinsic organization and function of the lamprey basal ganglia is highly conserved. For instance, the direct and indirect pathways are modulated through dopamine D1 and D2 receptors in lamprey and in mammals. The nucleus of the tuberculum posterior, a homologue of the substantia nigra pars compacta (SNc)/ventral tegmental area (VTA) is present in lamprey, but only scarce data exist about its connectivity. Likewise, the D2 receptor is expressed in the striatum, but little is known about its localization in other brain areas. We used in situ hybridization and tracer injections, both in combination with tyrosine hydroxylase immunohistochemistry, to characterize the SNc/VTA efferent and afferent connectivity, and to relate its projection pattern with D2 receptor expression in particular. We show that most features of the dopaminergic system are highly conserved. As in mammals, the direct pallial (cortex in mammals) input and the basal ganglia connectivity with the SNc/VTA are present as part of the evaluation system, as well as input from the tectum as the evolutionary basis for salience/novelty detection. Moreover, the SNc/VTA receives sensory information from the olfactory bulbs, optic tectum, octavolateral area, and dorsal column nucleus, and it innervates, apart from the nigrostriatal pathway, several motor-related areas. This suggests that the dopaminergic system also contributes to the control of different motor centers at the brainstem level.

  9. Chicken T-cell receptor beta-chain diversity: an evolutionarily conserved D beta-encoded glycine turn within the hypervariable CDR3 domain.

    PubMed Central

    McCormack, W T; Tjoelker, L W; Stella, G; Postema, C E; Thompson, C B

    1991-01-01

    Unlike mammals, chickens generate an immunoglobulin (Ig) repertoire by a developmentally regulated process of intrachromosomal gene conversion, which results in nucleotide substitutions throughout the variable regions of the Ig heavy- and light-chain genes. In contrast to chicken Ig genes, we show in this report that diversity of the rearranged chicken T-cell receptor (TCR) beta-chain gene is generated by junctional heterogeneity, as observed in rearranged mammalian TCR genes. This junctional diversity increases during chicken development as a result of an increasing base-pair addition at the V beta-D beta and D beta-J beta joints (where V, D, and J are the variable, diversity, and joining gene segments). Despite the junctional hypervariability, however, almost all functional V beta-D beta-J beta junctions appear to encode a glycine-containing beta-turn. Such a turn may serve to position the amino acid side chains of a hypervariable TCR beta-chain loop with respect to the antigen-binding groove of the major histocompatibility complex molecule. Consistent with this hypothesis, the germ-line D beta nucleotide sequences of chickens, mice, rabbits, and humans have been highly conserved and encode a glycine in all three reading frames. Images PMID:1652759

  10. Expression of human Cfdp1 gene in Drosophila reveals new insights into the function of the evolutionarily conserved BCNT protein family

    PubMed Central

    Messina, Giovanni; Atterrato, Maria Teresa; Fanti, Laura; Giordano, Ennio; Dimitri, Patrizio

    2016-01-01

    The Bucentaur (BCNT) protein family is widely distributed in eukaryotes and is characterized by a highly conserved C-terminal domain. This family was identified two decades ago in ruminants, but its role(s) remained largely unknown. Investigating cellular functions and mechanism of action of BCNT proteins is challenging, because they have been implicated in human craniofacial development. Recently, we found that YETI, the D. melanogaster BCNT, is a chromatin factor that participates to H2A.V deposition. Here we report the effects of in vivo expression of CFDP1, the human BCNT protein, in Drosophila melanogaster. We show that CFDP1, similarly to YETI, binds to chromatin and its expression results in a wide range of abnormalities highly reminiscent of those observed in Yeti null mutants. This indicates that CFDP1 expressed in flies behaves in a dominant negative fashion disrupting the YETI function. Moreover, GST pull-down provides evidence indicating that 1) both YETI and CFDP1 undergo homodimerization and 2) YETI and CFDP1 physically interact each other by forming inactive heterodimers that would trigger the observed dominant-negative effect. Overall, our findings highlight unanticipated evidences suggesting that homodimerization mediated by the BCNT domain is integral to the chromatin functions of BCNT proteins. PMID:27151176

  11. Function of the PEX19-binding site of human adrenoleukodystrophy protein as targeting motif in man and yeast. PMP targeting is evolutionarily conserved.

    PubMed

    Halbach, André; Lorenzen, Stephan; Landgraf, Christiane; Volkmer-Engert, Rudolf; Erdmann, Ralf; Rottensteiner, Hanspeter

    2005-06-03

    We predicted in human peroxisomal membrane proteins (PMPs) the binding sites for PEX19, a key player in the topogenesis of PMPs, by virtue of an algorithm developed for yeast PMPs. The best scoring PEX19-binding site was found in the adrenoleukodystrophy protein (ALDP). The identified site was indeed bound by human PEX19 and was also recognized by the orthologous yeast PEX19 protein. Likewise, both human and yeast PEX19 bound with comparable affinities to the PEX19-binding site of the yeast PMP Pex13p. Interestingly, the identified PEX19-binding site of ALDP coincided with its previously determined targeting motif. We corroborated the requirement of the ALDP PEX19-binding site for peroxisomal targeting in human fibroblasts and showed that the minimal ALDP fragment targets correctly also in yeast, again in a PEX19-binding site-dependent manner. Furthermore, the human PEX19-binding site of ALDP proved interchangeable with that of yeast Pex13p in an in vivo targeting assay. Finally, we showed in vitro that most of the predicted binding sequences of human PMPs represent true binding sites for human PEX19, indicating that human PMPs harbor common PEX19-binding sites that do resemble those of yeast. Our data clearly revealed a role for PEX19-binding sites as PMP-targeting motifs across species, thereby demonstrating the evolutionary conservation of PMP signal sequences from yeast to man.

  12. Conservation of Male Sterility 2 function during spore and pollen wall development supports an evolutionarily early recruitment of a core component in the sporopollenin biosynthetic pathway.

    PubMed

    Wallace, Simon; Chater, Caspar C; Kamisugi, Yasuko; Cuming, Andrew C; Wellman, Charles H; Beerling, David J; Fleming, Andrew J

    2015-01-01

    The early evolution of plants required the acquisition of a number of key adaptations to overcome physiological difficulties associated with survival on land. One of these was a tough sporopollenin wall that enclosed reproductive propagules and provided protection from desiccation and UV-B radiation. All land plants possess such walled spores (or their derived homologue, pollen). We took a reverse genetics approach, consisting of knock-out and complementation experiments to test the functional conservation of the sporopollenin-associated gene MALE STERILTY 2 (which is essential for pollen wall development in Arabidopsis thaliana) in the bryophyte Physcomitrella patens. Knock-outs of a putative moss homologue of the A. thaliana MS2 gene, which is highly expressed in the moss sporophyte, led to spores with highly defective walls comparable to that observed in the A. thaliana ms2 mutant, and extremely compromised germination. Conversely, the moss MS2 gene could not rescue the A. thaliana ms2 phenotype. The results presented here suggest that a core component of the biochemical and developmental pathway required for angiosperm pollen wall development was recruited early in land plant evolution but the continued increase in pollen wall complexity observed in angiosperms has been accompanied by divergence in MS2 gene function.

  13. An evolutionarily conserved interaction of tumor suppressor protein Pdcd4 with the poly(A)-binding protein contributes to translation suppression by Pdcd4.

    PubMed

    Fehler, Olesja; Singh, Priyanka; Haas, Astrid; Ulrich, Diana; Müller, Jan P; Ohnheiser, Johanna; Klempnauer, Karl-Heinz

    2014-01-01

    The tumor suppressor protein programmed cell death 4 (Pdcd4) has been implicated in the translational regulation of specific mRNAs, however, the identities of the natural Pdcd4 target mRNAs and the mechanisms by which Pdcd4 affects their translation are not well understood. Pdcd4 binds to the eukaryotic translation initiation factor eIF4A and inhibits its helicase activity, which has suggested that Pdcd4 suppresses translation initiation of mRNAs containing structured 5'-untranslated regions. Recent work has revealed a second inhibitory mechanism, which is eIF4A-independent and involves direct RNA-binding of Pdcd4 to the target mRNAs. We have now identified the poly(A)-binding protein (PABP) as a novel direct interaction partner of Pdcd4. The ability to interact with PABP is shared between human and Drosophila Pdcd4, indicating that it has been highly conserved during evolution. Mutants of Pdcd4 that have lost the ability to interact with PABP fail to stably associate with ribosomal complexes in sucrose density gradients and to suppress translation, as exemplified by c-myb mRNA. Overall, our work identifies PABP as a novel functionally relevant Pdcd4 interaction partner that contributes to the regulation of translation by Pdcd4.

  14. Two-ligand priming mechanism for potentiated phosphoinositide synthesis is an evolutionarily conserved feature of Sec14-like phosphatidylinositol and phosphatidylcholine exchange proteins

    PubMed Central

    Huang, Jin; Ghosh, Ratna; Tripathi, Ashutosh; Lönnfors, Max; Somerharju, Pentti; Bankaitis, Vytas A.

    2016-01-01

    Lipid signaling, particularly phosphoinositide signaling, plays a key role in regulating the extreme polarized membrane growth that drives root hair development in plants. The Arabidopsis AtSFH1 gene encodes a two-domain protein with an amino-terminal Sec14-like phosphatidylinositol transfer protein (PITP) domain linked to a carboxy-terminal nodulin domain. AtSfh1 is critical for promoting the spatially highly organized phosphatidylinositol-4,5-bisphosphate signaling program required for establishment and maintenance of polarized root hair growth. Here we demonstrate that, like the yeast Sec14, the AtSfh1 PITP domain requires both its phosphatidylinositol (PtdIns)- and phosphatidylcholine (PtdCho)-binding properties to stimulate PtdIns-4-phosphate [PtdIns(4)P] synthesis. Moreover, we show that both phospholipid-binding activities are essential for AtSfh1 activity in supporting polarized root hair growth. Finally, we report genetic and biochemical evidence that the two-ligand mechanism for potentiation of PtdIns 4-OH kinase activity is a broadly conserved feature of plant Sec14-nodulin proteins, and that this strategy appeared only late in plant evolution. Taken together, the data indicate that the PtdIns/PtdCho-exchange mechanism for stimulated PtdIns(4)P synthesis either arose independently during evolution in yeast and in higher plants, or a suitable genetic module was introduced to higher plants from a fungal source and subsequently exploited by them. PMID:27193303

  15. Protein backbone flexibility pattern is evolutionarily conserved in the Flaviviridae family: A case of NS3 protease in Flavivirus and Hepacivirus.

    PubMed

    Palanisamy, Navaneethan; Akaberi, Dario; Lennerstrand, Johan

    2017-09-22

    Viruses belonging to the Flaviviridae family have been an important health concern for humans, animals and birds alike. No specific treatment is available yet for many of the viral infections caused by the members of this family. Lack of specific drugs against these viruses is mainly due to lack of protein structure information. It has been known that protein backbone fluctuation pattern is highly conserved in protein pairs with similar folds, in spite of the lack of sequence similarity. We hypothesized that this concept should also hold true for proteins (especially enzymes) of viruses included in different genera of the Flaviviridae family, as we know that the sequence similarity between them is low. Using available NS3 protease crystal structures of the Flaviviridae family, our preliminary results have shown that the Cα (i.e. backbone) fluctuation patterns are highly similar between Flaviviruses and a Hepacivirus (i.e. hepatitis C virus, HCV). This has to be validated further experimentally. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Structural Insights into the Interaction of the Evolutionarily Conserved ZPR1 Domain Tandem with Eukaryotic EF1A, Receptors, and SMN Complexes

    SciTech Connect

    Mishra,A.; Gangwani, L.; Davis, R.; Lambright, D.

    2007-01-01

    Eukaryotic genomes encode a zinc finger protein (ZPR1) with tandem ZPR1 domains. In response to growth stimuli, ZPR1 assembles into complexes with eukaryotic translation elongation factor 1A (eEF1A) and the survival motor neurons protein. To gain insight into the structural mechanisms underlying the essential function of ZPR1 in diverse organisms, we determined the crystal structure of a ZPR1 domain tandem and characterized the interaction with eEF1A. The ZPR1 domain consists of an elongation initiation factor 2-like zinc finger and a double-stranded {beta} helix with a helical hairpin insertion. ZPR1 binds preferentially to GDP-bound eEF1A but does not directly influence the kinetics of nucleotide exchange or GTP hydrolysis. However, ZPR1 efficiently displaces the exchange factor eEF1B from preformed nucleotide-free complexes, suggesting that it may function as a negative regulator of eEF1A activation. Structure-based mutational and complementation analyses reveal a conserved binding epitope for eEF1A that is required for normal cell growth, proliferation, and cell cycle progression. Structural differences between the ZPR1 domains contribute to the observed functional divergence and provide evidence for distinct modalities of interaction with eEF1A and survival motor neuron complexes.

  17. Decrease in levels of the evolutionarily conserved microRNA miR-124 affects oligodendrocyte numbers in Zebrafish, Danio rerio.

    PubMed

    Morris, Jacqueline K; Chomyk, Anthony; Song, Ping; Parker, Nate; Deckard, Sadie; Trapp, Bruce D; Pimplikar, Sanjay W; Dutta, Ranjan

    2015-09-01

    Oligodendrocytes produce multi-lamellar myelin membranes that surround axons in the central nervous system (CNS). Preservation and generation of myelin are potential therapeutic targets for dysmyelinating and demyelinating diseases. MicroRNAs (miRNAs) play a vital role in oligodendrocyte differentiation and overall CNS development. miR-124 is a well-conserved neuronal miRNA with important roles in neuronal differentiation and function. miR-124 levels increase following loss of myelin in both human and rodent brains. While the role of neuronal miR-124 in neurogenesis has been established, its effects on axonal outgrowth and oligodendrocytes are not currently known. We therefore explored the possible effect of selective knockdown of miR-124 in Danio rerio using a morpholino-based knockdown approach. No morphological abnormalities or loss of motor neurons were detected despite loss of axonal outgrowth. Morpholino-based knockdown of miR-124 led to reciprocal increases in mRNA levels of target genes that inhibit axonal and dendritic projections. Importantly, loss of miR-124 led to decreased oligodendrocyte cell numbers and myelination of axonal projections in the ventral hindbrain. Taken together, our results add a new dimension to the existing complexity of neuron-glial relationships and highlight the utility of Danio rerio as a model system to investigate such interactions.

  18. Strigolactone biosynthesis is evolutionarily conserved, regulated by phosphate starvation and contributes to resistance against phytopathogenic fungi in a moss, Physcomitrella patens.

    PubMed

    Decker, Eva L; Alder, Adrian; Hunn, Stefan; Ferguson, Jenny; Lehtonen, Mikko T; Scheler, Bjoern; Kerres, Klaus L; Wiedemann, Gertrud; Safavi-Rizi, Vajiheh; Nordzieke, Steffen; Balakrishna, Aparna; Baz, Lina; Avalos, Javier; Valkonen, Jari P T; Reski, Ralf; Al-Babili, Salim

    2017-03-06

    In seed plants, strigolactones (SLs) regulate architecture and induce mycorrhizal symbiosis in response to environmental cues. SLs are formed by combined activity of the carotenoid cleavage dioxygenases (CCDs) 7 and 8 from 9-cis-β-carotene, leading to carlactone that is converted by cytochromes P450 (clade 711; MAX1 in Arabidopsis) into various SLs. As Physcomitrella patens possesses CCD7 and CCD8 homologs but lacks MAX1, we investigated if PpCCD7 together with PpCCD8 form carlactone and how deletion of these enzymes influences growth and interactions with the environment. We investigated the enzymatic activity of PpCCD7 and PpCCD8 in vitro, identified the formed products by high performance liquid chromatography (HPLC) and LC-MS, and generated and analysed ΔCCD7 and ΔCCD8 mutants. We defined enzymatic activity of PpCCD7 as a stereospecific 9-cis-CCD and PpCCD8 as a carlactone synthase. ΔCCD7 and ΔCCD8 lines showed enhanced caulonema growth, which was revertible by adding the SL analogue GR24 or carlactone. Wild-type (WT) exudates induced seed germination in Orobanche ramosa. This activity was increased upon phosphate starvation and abolished in exudates of both mutants. Furthermore, both mutants showed increased susceptibility to phytopathogenic fungi. Our study reveals the deep evolutionary conservation of SL biosynthesis, SL function, and its regulation by biotic and abiotic cues.

  19. Evolutionarily conserved regulatory mechanisms of abscisic acid signaling in land plants: characterization of ABSCISIC ACID INSENSITIVE1-like type 2C protein phosphatase in the liverwort Marchantia polymorpha.

    PubMed

    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2010-03-01

    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the beta -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts.

  20. Two-ligand priming mechanism for potentiated phosphoinositide synthesis is an evolutionarily conserved feature of Sec14-like phosphatidylinositol and phosphatidylcholine exchange proteins.

    PubMed

    Huang, Jin; Ghosh, Ratna; Tripathi, Ashutosh; Lönnfors, Max; Somerharju, Pentti; Bankaitis, Vytas A

    2016-07-15

    Lipid signaling, particularly phosphoinositide signaling, plays a key role in regulating the extreme polarized membrane growth that drives root hair development in plants. The Arabidopsis AtSFH1 gene encodes a two-domain protein with an amino-terminal Sec14-like phosphatidylinositol transfer protein (PITP) domain linked to a carboxy-terminal nodulin domain. AtSfh1 is critical for promoting the spatially highly organized phosphatidylinositol-4,5-bisphosphate signaling program required for establishment and maintenance of polarized root hair growth. Here we demonstrate that, like the yeast Sec14, the AtSfh1 PITP domain requires both its phosphatidylinositol (PtdIns)- and phosphatidylcholine (PtdCho)-binding properties to stimulate PtdIns-4-phosphate [PtdIns(4)P] synthesis. Moreover, we show that both phospholipid-binding activities are essential for AtSfh1 activity in supporting polarized root hair growth. Finally, we report genetic and biochemical evidence that the two-ligand mechanism for potentiation of PtdIns 4-OH kinase activity is a broadly conserved feature of plant Sec14-nodulin proteins, and that this strategy appeared only late in plant evolution. Taken together, the data indicate that the PtdIns/PtdCho-exchange mechanism for stimulated PtdIns(4)P synthesis either arose independently during evolution in yeast and in higher plants, or a suitable genetic module was introduced to higher plants from a fungal source and subsequently exploited by them. © 2016 Huang, Ghosh, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  1. C13C4.5/Spinster, an evolutionarily conserved protein that regulates fertility in C. elegans through a lysosome-mediated lipid metabolism process.

    PubMed

    Han, Mei; Chang, Hao; Zhang, Peng; Chen, Tao; Zhao, Yanhua; Zhang, Yongdeng; Liu, Pingsheng; Xu, Tao; Xu, Pingyong

    2013-05-01

    Lipid droplets, which are conserved across almost all species, are cytoplasmic organelles used to store neutral lipids. Identification of lipid droplet regulators will be conducive to resolving obesity and other fat-associated diseases. In this paper, we selected 11 candidates that might be associated with lipid metabolism in Caenorhabditis elegans. Using a BODIPY 493/503-based flow cytometry screen, 6 negative and 3 positive regulators of fat content were identified. We selected one negative regulator of lipid content, C13C4.5, for future study. C13C4.5 was mainly expressed in the worm intestine. We found that this gene was important for maintaining the metabolism of lipid droplets. Biochemical results revealed that 50% of triacylglycerol (TAG) was lost in C13C4.5 knockout worms. Stimulated Raman scattering (SRS) signals in C13C4.5 mutants showed only 49.6% of the fat content in the proximal intestinal region and 86.3% in the distal intestinal region compared with wild type animals. The mean values of lipid droplet size and intensity in C13C4.5 knockout animals were found to be significantly decreased compared with those in wild type worms. The LMP-1-labeled membrane structures in worm intestines were also enlarged in C13C4.5 mutant animals. Finally, fertility defects were found in C13C4.5(ok2087) mutants. Taken together, these results indicate that C13C4.5 may regulate the fertility of C. elegans by changing the size and fat content of lipid droplets by interfering with lysosomal morphology and function.

  2. The Human Arp2/3 Complex Is Composed of Evolutionarily Conserved Subunits and Is Localized to Cellular Regions of Dynamic Actin Filament Assembly

    PubMed Central

    Welch, Matthew D.; DePace, Angela H.; Verma, Suzie; Iwamatsu, Akihiro; Mitchison, Timothy J.

    1997-01-01

    The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells. The human complex consists of seven subunits which include the actin related proteins Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc (Arp complex). We have determined the predicted amino acid sequence of all seven subunits. Each has homologues in diverse eukaryotes, implying that the structure and function of the complex has been conserved through evolution. Human Arp2 and Arp3 are very similar to family members from other species. p41-Arc is a new member of the Sop2 family of WD (tryptophan and aspartate) repeat–containing proteins and may be posttranslationally modified, suggesting that it may be involved in regulating the activity and/or localization of the complex. p34-Arc, p21-Arc, p20-Arc, and p16-Arc define novel protein families. We sought to evaluate the function of the Arp2/3 complex in cells by determining its intracellular distribution. Arp3, p34-Arc, and p21-Arc were localized to the lamellipodia of stationary and locomoting fibroblasts, as well to Listeria monocytogenes assembled actin tails. They were not detected in cellular bundles of actin filaments. Taken together with the ability of the Arp2/3 complex to induce actin polymerization, these observations suggest that the complex promotes actin assembly in lamellipodia and may participate in lamellipodial protrusion. PMID:9230079

  3. The human Arp2/3 complex is composed of evolutionarily conserved subunits and is localized to cellular regions of dynamic actin filament assembly.

    PubMed

    Welch, M D; DePace, A H; Verma, S; Iwamatsu, A; Mitchison, T J

    1997-07-28

    The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells. The human complex consists of seven subunits which include the actin related proteins Arp2 and Arp3, and five others referred to as p41-Arc, p34-Arc, p21-Arc, p20-Arc, and p16-Arc (p omplex). We have determined the predicted amino acid sequence of all seven subunits. Each has homologues in diverse eukaryotes, implying that the structure and function of the complex has been conserved through evolution. Human Arp2 and Arp3 are very similar to family members from other species. p41-Arc is a new member of the Sop2 family of WD (tryptophan and aspartate) repeat-containing proteins and may be posttranslationally modified, suggesting that it may be involved in regulating the activity and/or localization of the complex. p34-Arc, p21-Arc, p20-Arc, and p16-Arc define novel protein families. We sought to evaluate the function of the Arp2/3 complex in cells by determining its intracellular distribution. Arp3, p34-Arc, and p21-Arc were localized to the lamellipodia of stationary and locomoting fibroblasts, as well to Listeria monocytogenes assembled actin tails. They were not detected in cellular bundles of actin filaments. Taken together with the ability of the Arp2/3 complex to induce actin polymerization, these observations suggest that the complex promotes actin assembly in lamellipodia and may participate in lamellipodial protrusion.

  4. The Evolutionarily Conserved Tre2/Bub2/Cdc16 (TBC), Lysin Motif (LysM), Domain Catalytic (TLDc) Domain Is Neuroprotective against Oxidative Stress.

    PubMed

    Finelli, Mattéa J; Sanchez-Pulido, Luis; Liu, Kevin X; Davies, Kay E; Oliver, Peter L

    2016-02-05

    Oxidative stress is a pathological feature of many neurological disorders; therefore, utilizing proteins that are protective against such cellular insults is a potentially valuable therapeutic approach. Oxidation resistance 1 (OXR1) has been shown previously to be critical for oxidative stress resistance in neuronal cells; deletion of this gene causes neurodegeneration in mice, yet conversely, overexpression of OXR1 is protective in cellular and mouse models of amyotrophic lateral sclerosis. However, the molecular mechanisms involved are unclear. OXR1 contains the Tre2/Bub2/Cdc16 (TBC), lysin motif (LysM), domain catalytic (TLDc) domain, a motif present in a family of proteins including TBC1 domain family member 24 (TBC1D24), a protein mutated in a range of disorders characterized by seizures, hearing loss, and neurodegeneration. The TLDc domain is highly conserved across species, although the structure-function relationship is unknown. To understand the role of this domain in the stress response, we carried out systematic analysis of all mammalian TLDc domain-containing proteins, investigating their expression and neuroprotective properties in parallel. In addition, we performed a detailed structural and functional study of this domain in which we identified key residues required for its activity. Finally, we present a new mouse insertional mutant of Oxr1, confirming that specific disruption of the TLDc domain in vivo is sufficient to cause neurodegeneration. Our data demonstrate that the integrity of the TLDc domain is essential for conferring neuroprotection, an important step in understanding the functional significance of all TLDc domain-containing proteins in the cellular stress response and disease. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  5. Profiling of proteolytic enzymes in the gut of the tick Ixodes ricinus reveals an evolutionarily conserved network of aspartic and cysteine peptidases

    PubMed Central

    Sojka, Daniel; Franta, Zdeněk; Horn, Martin; Hajdušek, Ondřej; Caffrey, Conor R; Mareš, Michael; Kopáček, Petr

    2008-01-01

    Background Ticks are vectors for a variety of viral, bacterial and parasitic diseases in human and domestic animals. To survive and reproduce ticks feed on host blood, yet our understanding of the intestinal proteolytic machinery used to derive absorbable nutrients from the blood meal is poor. Intestinal digestive processes are limiting factors for pathogen transmission since the tick gut presents the primary site of infection. Moreover, digestive enzymes may find practical application as anti-tick vaccine targets. Results Using the hard tick, Ixodes ricinus, we performed a functional activity scan of the peptidase complement in gut tissue extracts that demonstrated the presence of five types of peptidases of the cysteine and aspartic classes. We followed up with genetic screens of gut-derived cDNA to identify and clone genes encoding the cysteine peptidases cathepsins B, L and C, an asparaginyl endopeptidase (legumain), and the aspartic peptidase, cathepsin D. By RT-PCR, expression of asparaginyl endopeptidase and cathepsins B and D was restricted to gut tissue and to those developmental stages feeding on blood. Conclusion Overall, our results demonstrate the presence of a network of cysteine and aspartic peptidases that conceivably operates to digest host blood proteins in a concerted manner. Significantly, the peptidase components of this digestive network are orthologous to those described in other parasites, including nematodes and flatworms. Accordingly, the present data and those available for other tick species support the notion of an evolutionary conservation of a cysteine/aspartic peptidase system for digestion that includes ticks, but differs from that of insects relying on serine peptidases. PMID:18348719

  6. Evolutionarily conserved IMPACT impairs various stress responses that require GCN1 for activating the eIF2 kinase GCN2

    SciTech Connect

    Cambiaghi, Tavane D.; Pereira, Catia M.; Shanmugam, Renuka; Bolech, Michael; Wek, Ronald C.; Sattlegger, Evelyn; Castilho, Beatriz A.

    2014-01-10

    Highlights: •GCN1 is required for mammalian and yeast GCN2 function in a variety of conditions. •Mammalian IMPACT competes with GCN2 for GCN1 binding. •IMPACT and its yeast counterpart YIH1 downregulate GCN1-dependent GCN2 activation. -- Abstract: In response to a range of environmental stresses, phosphorylation of the alpha subunit of the translation initiation factor 2 (eIF2α) represses general protein synthesis coincident with increased translation of specific mRNAs, such as those encoding the transcription activators GCN4 and ATF4. The eIF2α kinase GCN2 is activated by amino acid starvation by a mechanism involving GCN2 binding to an activator protein GCN1, along with association with uncharged tRNA that accumulates during nutrient deprivation. We previously showed that mammalian IMPACT and its yeast ortholog YIH1 bind to GCN1, thereby preventing GCN1 association with GCN2 and stimulation of this eIF2α kinase during amino acid depletion. GCN2 activity is also enhanced by other stresses, including proteasome inhibition, UV irradiation and lack of glucose. Here, we provide evidence that IMPACT affects directly and specifically the activation of GCN2 under these stress conditions in mammalian cells. We show that activation of mammalian GCN2 requires its interaction with GCN1 and that IMPACT promotes the dissolution of the GCN2–GCN1 complex. To a similar extent as the overexpression of YIH1, overexpression of IMPACT in yeast cells inhibited growth under all stress conditions that require GCN2 and GCN1 for cell survival, including exposure to acetic acid, high levels of NaCl, H{sub 2}O{sub 2} or benomyl. This study extends our understanding of the roles played by GCN1 in GCN2 activation induced by a variety of stress arrangements and suggests that IMPACT and YIH1 use similar mechanisms for regulating this eIF2α kinase.

  7. Conservation of Transcription Start Sites within Genes across a Bacterial Genus

    SciTech Connect

    Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.; Romine, Margaret F.; Arkin, Adam P.

    2014-07-01

    Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved. Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.

  8. Conservation of transcriptional sensing systems in prokaryotes: A perspective from Escherichia coli

    PubMed Central

    Salgado, Heladia; Martínez-Antonio, Agustino; Janga, Sarath Chandra

    2007-01-01

    The activity of transcription factors is usually governed by allosteric physicochemical signals or metabolites, which are in turn produced in the cell or obtained from the environment by the activity of the products of effector genes. Previously we identified a collection of more than 110 transcription factors and their corresponding effector genes in Escherichia coli K-12. Here we introduce the notion of “triferog”, which relates to the identification of orthologous transcription factors and effector genes across genomes and show that transcriptional sensing systems known in E. coli are poorly conserved beyond Salmonella. We also find that enzymes that act as effector genes for the production of endogenous effector metabolites are more conserved than their corresponding effector genes encoding for transport and two-component systems for sensing exogenous signals. Finally we observe that on an evolutionary scale enzymes are more conserved than their respective TFs, suggesting a homogenous cellular metabolism across genomes and the conservation of transcriptional control of critical cellular processes like DNA replication by a common endogenous signal. We hypothesize that extensive variation in the domain architecture of TFs and changes in endogenous conditions at large phylogenetic distances could be the major contributing factors for the observed differential conservation of TFs and their corresponding effector genes encoding for enzymes, causing variations in transcriptional responses across organisms. PMID:17617412

  9. Conservation of transcriptional sensing systems in prokaryotes: a perspective from Escherichia coli.

    PubMed

    Salgado, Heladia; Martínez-Antonio, Agustino; Janga, Sarath Chandra

    2007-07-24

    The activity of transcription factors is usually governed by allosteric physicochemical signals or metabolites, which are in turn produced in the cell or obtained from the environment by the activity of the products of effector genes. Previously, we identified a collection of more than 110 transcription factors and their corresponding effector genes in Escherichia coli K-12. Here, we introduce the notion of "triferog", which relates to the identification of orthologous transcription factors and effector genes across genomes and show that transcriptional sensing systems known in E. coli are poorly conserved beyond Salmonella. We also find that enzymes that act as effector genes for the production of endogenous effector metabolites are more conserved than their corresponding effector genes encoding for transport and two-component systems for sensing exogenous signals. Finally, we observe that on an evolutionary scale enzymes are more conserved than their respective TFs, suggesting a homogenous cellular metabolism across genomes and the conservation of transcriptional control of critical cellular processes like DNA replication by a common endogenous signal. We hypothesize that extensive variation in the domain architecture of TFs and changes in endogenous conditions at large phylogenetic distances could be the major contributing factors for the observed differential conservation of TFs and their corresponding effector genes encoding for enzymes, causing variations in transcriptional responses across organisms.

  10. Conserved transcriptional regulatory mechanisms in aortic valve development and disease

    PubMed Central

    Wirrig, Elaine E.; Yutzey, Katherine E.

    2014-01-01

    There is increasing evidence for activation of developmental transcriptional regulatory pathways in heart valve disease. Here we review molecular regulatory mechanisms involved in heart valve progenitor development, leaflet morphogenesis, and extracellular matrix organization that also are active in diseased aortic valves. These include regulators of endothelial-to-mesenchymal transitions, such as the Notch pathway effector RBPJ, and the valve progenitor markers Twist1, Msx1/2, and Sox9. Little is known of the potential reparative or pathological functions of these developmental mechanisms in adult aortic valves, but it is tempting to speculate that valve progenitor cells could contribute to repair in the context of disease. Likewise, loss of either RBPJ or Sox9 leads to aortic valve calcification in mice, supporting a potential therapeutic role in prevention of disease. During aortic valve calcification, transcriptional regulators of osteogenic development are activated in addition to valve progenitor regulatory programs. Specifically, the transcription factor Runx2 and its downstream target genes are induced in calcified valves. Runx2 and osteogenic genes also are induced with vascular calcification, but activation of valve progenitor markers and the cellular context of expression are likely to be different for valve and vascular calcification. Additional research is necessary to determine if developmental mechanisms contribute to valve repair or if these pathways can be harnessed for new treatments of heart valve disease. PMID:24665126

  11. Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated

    PubMed Central

    2010-01-01

    Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS") but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) not to be biological transcription factor binding sites ("empirical TFBS"). We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation. PMID:20875111

  12. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes

    PubMed Central

    Fujiwara, Nana; Cave, John W.

    2016-01-01

    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord. PMID:27489533

  13. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes.

    PubMed

    Fujiwara, Nana; Cave, John W

    2016-01-01

    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord.

  14. Structure of a conserved domain common to the transcription factors TFIIS, elongin A, and CRSP70.

    PubMed

    Booth, V; Koth, C M; Edwards, A M; Arrowsmith, C H

    2000-10-06

    TFIIS is a transcription elongation factor that consists of three domains. We have previously solved the structures of domains II and III, which stimulate arrested polymerase II elongation complexes in order to resume transcription. Domain I is conserved in evolution from yeast to human species and is homologous to the transcription factors elongin A and CRSP70. Domain I also interacts with the transcriptionally active RNA polymerase II holoenzyme and therefore, may have a function unrelated to the previously described transcription elongation activity of TFIIS. We have solved the structure of domain I of yeast TFIIS using NMR spectroscopy. Domain I is a compact four-helix bundle that is structurally independent of domains II and III of the TFIIS. Using the yeast structure as a template, we have modeled the homologous domains from elongin A and CRSP70 and identified a conserved positively charged patch on the surface of all three proteins, which may be involved in conserved functional interactions with the transcriptional machinery.

  15. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    DOE Data Explorer

    Loots, Gabriela G. [LLNL; Ovcharenko, I. [LLNL

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. This database of evolutionary conserved regions (ECRs) in vertebrate genomes features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a comprehensive collection of promoters in all vertebrate genomes generated using multiple sources of gene annotation. The database also contains a collection of annotated transcription factor binding sites (TFBSs) in evolutionary conserved and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and fugu genomes. (taken from paper in Journal: Bioinformatics, November 7, 2006, pp. 122-124

  16. Assignment of human myocyte-specific enhancer binding factor 2C (hMEF2C) to human chromosome 5q14 and evidence that MEF2C is evolutionarily conserved

    SciTech Connect

    Krainc, D.; Lipton, S.A.; Haas, M.; Ward, D.C.

    1995-10-10

    Human myocyte-specific enhancer binding factor 2C (hMEF2C) belongs to the MEF2 subfamily of the MADS (MCM1, AGAMOUS, DEF A, serum response factor) family of transcription factors. Members of the MADS family share a conserved domain - the MADS domain - that is necessary for DNA binding. Highly conserved versions of the MADS domain and of an adjacent domain that is known as the MEF2 domain are found in members of the MEF2 subfamily. Both of these domains are necessary for binding to the MEF2 regulatory element. This regulatory element is known to be functionally important in a variety of muscle-specific genes and possibly in the brain creatine kinase gene. The MEF2C gene product activates transcription by binding to the MEF2 element. hMEF2C is expressed at high levels in postmitotic neurons in the brain, where it is most abundant in the cerebral cortex, and is also expressed in differentiated myotubes. Several lines of evidence suggest the existence of a rat homologue of MEF2C, and a mouse homologue has been cloned. The mouse gene was mapped to mouse chromosome 13 in a region that is syntenic to human 5q13-q15. 12 refs., 1 fig.

  17. Analysis of gene order conservation in eukaryotes identifies transcriptionally and functionally linked genes.

    PubMed

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore

    2010-05-14

    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control.

  18. Analysis of Gene Order Conservation in Eukaryotes Identifies Transcriptionally and Functionally Linked Genes

    PubMed Central

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore

    2010-01-01

    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control. PMID:20498846

  19. Parallel embryonic transcriptional programs evolve under distinct constraints and may enable morphological conservation amidst adaptation.

    PubMed

    Malik, Assaf; Gildor, Tsvia; Sher, Noa; Layous, Majed; Ben-Tabou de-Leon, Smadar

    2017-10-01

    Embryonic development evolves by balancing stringent morphological constraints with genetic and environmental variation. The design principle that allows developmental transcriptional programs to conserve embryonic morphology while adapting to environmental changes is still not fully understood. To address this fundamental challenge, we compare developmental transcriptomes of two sea urchin species, Paracentrotus lividus and Strongylocentrotus purpuratus, that shared a common ancestor about 40 million years ago and are geographically distant yet show similar morphology. We find that both developmental and housekeeping genes show highly dynamic and strongly conserved temporal expression patterns. The expression of other gene sets, including homeostasis and response genes, show divergent expression which could result from either evolutionary drift or adaptation to local environmental conditions. The interspecies correlations of developmental gene expressions are highest between morphologically similar developmental time points whereas the interspecies correlations of housekeeping gene expression are high between all the late zygotic time points. Relatedly, the position of the phylotypic stage varies between these two groups of genes: developmental gene expression shows highest conservation at mid-developmental stage, in agreement with the hourglass model while the conservation of housekeeping genes keeps increasing with developmental time. When all genes are combined, the relationship between conservation of gene expression and morphological similarity is partially masked by housekeeping genes and genes with diverged expression. Our study illustrates various transcriptional programs that coexist in the developing embryo and evolve under different constraints. Apparently, morphological constraints underlie the conservation of developmental gene expression while embryonic fitness requires the conservation of housekeeping gene expression and the species

  20. Implementation of meiosis prophase I programme requires a conserved retinoid-independent stabilizer of meiotic transcripts

    PubMed Central

    Abby, Emilie; Tourpin, Sophie; Ribeiro, Jonathan; Daniel, Katrin; Messiaen, Sébastien; Moison, Delphine; Guerquin, Justine; Gaillard, Jean-Charles; Armengaud, Jean; Langa, Francina; Toth, Attila; Martini, Emmanuelle; Livera, Gabriel

    2016-01-01

    Sexual reproduction is crucially dependent on meiosis, a conserved, specialized cell division programme that is essential for the production of haploid gametes. Here we demonstrate that fertility and the implementation of the meiotic programme require a previously uncharacterized meiosis-specific protein, MEIOC. Meioc invalidation in mice induces early and pleiotropic meiotic defects in males and females. MEIOC prevents meiotic transcript degradation and interacts with an RNA helicase that binds numerous meiotic mRNAs. Our results indicate that proper engagement into meiosis necessitates the specific stabilization of meiotic transcripts, a previously little-appreciated feature in mammals. Remarkably, the upregulation of MEIOC at the onset of meiosis does not require retinoic acid and STRA8 signalling. Thus, we propose that the complete induction of the meiotic programme requires both retinoic acid-dependent and -independent mechanisms. The latter process involving post-transcriptional regulation likely represents an ancestral mechanism, given that MEIOC homologues are conserved throughout multicellular animals. PMID:26742488

  1. A conserved heptamer motif for ribosomal RNA transcription termination in animal mitochondria.

    PubMed Central

    Valverde, J R; Marco, R; Garesse, R

    1994-01-01

    A search of sequence data bases for a tridecamer transcription termination signal, previously described in human mtDNA as being responsible for the accumulation of mitochondrial ribosomal RNAs (rRNAs) in excess over the rest of mitochondrial genes, has revealed that this termination signal occurs in equivalent positions in a wide variety of organisms from protozoa to mammals. Due to the compact organization of the mtDNA, the tridecamer motif usually appears as part of the 3' adjacent gene sequence. Because in phylogenetically widely separated organisms the mitochondrial genome has experienced many rearrangements, it is interesting that its occurrence near the 3' end of the large rRNA is independent of the adjacent gene. The tridecamer sequence has diverged in phylogenetically widely separated organisms. Nevertheless, a well-conserved heptamer--TGGCAGA, the mitochondrial rRNA termination box--can be defined. Although extending the experimental evidence of its role as a transcription termination signal in humans will be of great interest, its evolutionary conservation strongly suggests that mitochondrial rRNA transcription termination could be a widely conserved mechanism in animals. Furthermore, the conservation of a homologous tridecamer motif in one of the last 3' secondary loops of nonmitochondrial 23S-like rRNAs suggests that the role of the sequence has changed during mitochondrial evolution. PMID:7515499

  2. Cell cycle regulated transcription of heterochromatin in mammals vs. fission yeast: functional conservation or coincidence?

    PubMed

    Lu, Junjie; Gilbert, David M

    2008-07-01

    Although it is tempting to speculate that the transcription-dependent heterochromatin assembly pathway found in fission yeast may operate in higher mammals, transcription of heterochromatin has been difficult to substantiate in mammalian cells. We recently demonstrated that transcription from the mouse pericentric heterochromatin major (gamma) satellite repeats is under cell cycle control, being sharply downregulated at the metaphase to anaphase transition and resuming in late G(1)-phase dependent upon passage through the restriction point. The highest rates of transcription were in early S-phase and again in mitosis with different RNA products detected at each of these times.(1) Importantly, differences in the percentage of cells in G(1)-phase can account for past discrepancies in the detection of major satellite transcripts and suggest that pericentric heterochromatin transcription takes place in all proliferating mammalian cells. A similar cell cycle regulation of heterochromatin transcription has now been shown in fission yeast,(2,3) providing further support for a conserved mechanism. However, there are still fundamental differences between these two systems that preclude the identification of a functional or mechanistic link.

  3. An Evolutionarily Informed Education Science

    ERIC Educational Resources Information Center

    Geary, David C.

    2008-01-01

    Schools are a central interface between evolution and culture. They are the contexts in which children learn the evolutionarily novel abilities and knowledge needed to function as adults in modern societies. Evolutionary educational psychology is the study of how an evolved bias in children's learning and motivational systems influences their…

  4. Sense-antisense gene pairs: sequence, transcription, and structure are not conserved between human and mouse

    PubMed Central

    Wood, Emily J.; Chin-Inmanu, Kwanrutai; Jia, Hui; Lipovich, Leonard

    2013-01-01

    Previous efforts to characterize conservation between the human and mouse genomes focused largely on sequence comparisons. These studies are inherently limited because they don't account for gene structure differences, which may exist despite genomic sequence conservation. Recent high-throughput transcriptome studies have revealed widespread and extensive overlaps between genes, and transcripts, encoded on both strands of the genomic sequence. This overlapping gene organization, which produces sense-antisense (SAS) gene pairs, is capable of effecting regulatory cascades through established mechanisms. We present an evolutionary conservation assessment of SAS pairs, on three levels: genomic, transcriptomic, and structural. From a genome-wide dataset of human SAS pairs, we first identified orthologous loci in the mouse genome, then assessed their transcription in the mouse, and finally compared the genomic structures of SAS pairs expressed in both species. We found that approximately half of human SAS loci have single orthologous locations in the mouse genome; however, only half of those orthologous locations have SAS transcriptional activity in the mouse. This suggests that high human-mouse gene conservation overlooks widespread distinctions in SAS pair incidence and expression. We compared gene structures at orthologous SAS loci, finding frequent differences in gene structure between human and orthologous mouse SAS pair members. Our categorization of human SAS pairs with respect to mouse conservation of expression as well as structure points to limitations of mouse models. Gene structure differences, including at SAS loci, may account for some of the phenotypic distinctions between primates and rodents. Genes in non-conserved SAS pairs may contribute to evolutionary lineage-specific regulatory outcomes. PMID:24133500

  5. Conserved and essential transcription factors for cellulase gene expression in ascomycete fungi

    PubMed Central

    Coradetti, Samuel T.; Craig, James P.; Xiong, Yi; Shock, Teresa; Tian, Chaoguang; Glass, N. Louise

    2012-01-01

    Rational engineering of filamentous fungi for improved cellulase production is hampered by our incomplete knowledge of transcriptional regulatory networks. We therefore used the model filamentous fungus Neurospora crassa to search for uncharacterized transcription factors associated with cellulose deconstruction. A screen of a N. crassa transcription factor deletion collection identified two uncharacterized zinc binuclear cluster transcription factors (clr-1 and clr-2) that were required for growth and enzymatic activity on cellulose, but were not required for growth or hemicellulase activity on xylan. Transcriptional profiling with next-generation sequencing methods refined our understanding of the N. crassa transcriptional response to cellulose and demonstrated that clr-1 and clr-2 were required for the bulk of that response, including induction of all major cellulase and some major hemicellulase genes. Functional CLR-1 was necessary for expression of clr-2 and efficient cellobiose utilization. Phylogenetic analyses showed that CLR-1 and CLR-2 are conserved in the genomes of most filamentous ascomycete fungi capable of degrading cellulose. In Aspergillus nidulans, a strain carrying a deletion of the clr-2 homolog (clrB) failed to induce cellulase gene expression and lacked cellulolytic activity on Avicel. Further manipulation of this control system in industrial production strains may significantly improve yields of cellulases for cellulosic biofuel production. PMID:22532664

  6. Conserved transcription factor binding sites of cancer markers derived from primary lung adenocarcinoma microarrays

    PubMed Central

    Yap, Yee Leng; Wong, Maria P.; Zhang, Xue Wu; Hernandez, David; Gras, Robin; Smith, David K.; Danchin, Antoine

    2005-01-01

    Gene transcription in a set of 49 human primary lung adenocarcinomas and 9 normal lung tissue samples was examined using Affymetrix GeneChip technology. A total of 3442 genes, called the set MAD, were found to be either up- or down-regulated by at least 2-fold between the two phenotypes. Genes assigned to a particular gene ontology term were found, in many cases, to be significantly unevenly distributed between the genes in and outside MAD. Terms that were overrepresented in MAD included functions directly implicated in the cancer cell metabolism. Based on their functional roles and expression profiles, genes in MAD were grouped into likely co-regulated gene sets. Highly conserved sequences in the 5 kb region upstream of the genes in these sets were identified with the motif discovery tool, MoDEL. Potential oncogenic transcription factors and their corresponding binding sites were identified in these conserved regions using the TRANSFAC 8.3 database. Several of the transcription factors identified in this study have been shown elsewhere to be involved in oncogenic processes. This study searched beyond phenotypic gene expression profiles in cancer cells, in order to identify the more important regulatory transcription factors that caused these aberrations in gene expression. PMID:15653641

  7. The transcription factor Spn1 regulates gene expression via a highly conserved novel structural motif.

    PubMed

    Pujari, Venugopal; Radebaugh, Catherine A; Chodaparambil, Jayanth V; Muthurajan, Uma M; Almeida, Adam R; Fischbeck, Julie A; Luger, Karolin; Stargell, Laurie A

    2010-11-19

    Spn1/Iws1 plays essential roles in the regulation of gene expression by RNA polymerase II (RNAPII), and it is highly conserved in organisms ranging from yeast to humans. Spn1 physically and/or genetically interacts with RNAPII, TBP (TATA-binding protein), TFIIS (transcription factor IIS), and a number of chromatin remodeling factors (Swi/Snf and Spt6). The central domain of Spn1 (residues 141-305 out of 410) is necessary and sufficient for performing the essential functions of SPN1 in yeast cells. Here, we report the high-resolution (1.85 Å) crystal structure of the conserved central domain of Saccharomyces cerevisiae Spn1. The central domain is composed of eight α-helices in a right-handed superhelical arrangement and exhibits structural similarity to domain I of TFIIS. A unique structural feature of Spn1 is a highly conserved loop, which defines one side of a pronounced cavity. The loop and the other residues forming the cavity are highly conserved at the amino acid level among all Spn1 family members, suggesting that this is a signature motif for Spn1 orthologs. The locations and the molecular characterization of temperature-sensitive mutations in Spn1 indicate that the cavity is a key attribute of Spn1 that is critical for its regulatory functions during RNAPII-mediated transcriptional activity.

  8. Conserved Transcriptional Unit Organization of the Cag Pathogenicity Island among Helicobacter pylori Strains

    PubMed Central

    Ta, Linda H.; Hansen, Lori M.; Sause, William E.; Shiva, Olga; Millstein, Aram; Ottemann, Karen M.; Castillo, Andrea R.; Solnick, Jay V.

    2012-01-01

    The Helicobacter pylori cag pathogenicity island (cag PAI) encodes a type IV secretion system that is more commonly found in strains isolated from patients with gastroduodenal disease than from those with asymptomatic gastritis. Genome-wide organization of the transcriptional units in H. pylori strain 26695 was recently established using RNA sequence analysis (Sharma et al., 2010). Here we used quantitative reverse-transcription polymerase chain reaction of open reading frames and intergenic regions to identify putative cag PAI operons in H. pylori; these operons were analyzed further by transcript profiling after deletion of selected promoter regions. Additionally, we used a promoter-trap system to identify functional cag PAI promoters. The results demonstrated that expression of genes on the H. pylori cag PAI varies by nearly five orders of magnitude and that the organization of cag PAI genes into transcriptional units is conserved among several H. pylori strains, including, 26695, J99, G27, and J166. We found evidence for 20 transcripts within the cag PAI, many of which likely overlap. Our data suggests that there are at least 11 operons: cag1-4, cag3-4, cag10-9, cag8-7, cag6-5, cag11-12, cag16-17, cag19-18, cag21-20, cag23-22, and cag25-24, as well as five monocistronic genes (cag4, cag13, cag14, cag15, and cag26). Additionally, the location of four of our functionally identified promoters suggests they are directing expression of, in one case, a truncated version of cag26 and in the other three, transcripts that are antisense to cag7, cag17, and cag23. We verified expression of two of these antisense transcripts, those antisense to cag17 and cag23, by reverse-transcription polymerase chain reaction. Taken together, our results suggest that the cag PAI transcriptional profile is generally conserved among H. pylori strains, 26695, J99, G27, and J166, and is likely complex. PMID:22919637

  9. Fox transcription factors: from development to disease.

    PubMed

    Golson, Maria L; Kaestner, Klaus H

    2016-12-15

    Forkhead box (Fox) transcription factors are evolutionarily conserved in organisms ranging from yeast to humans. They regulate diverse biological processes both during development and throughout adult life. Mutations in many Fox genes are associated with human disease and, as such, various animal models have been generated to study the function of these transcription factors in mechanistic detail. In many cases, the absence of even a single Fox transcription factor is lethal. In this Primer, we provide an overview of the Fox family, highlighting several key Fox transcription factor families that are important for mammalian development.

  10. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast.

    PubMed

    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon

    2016-04-01

    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeast Schizosaccharomyces pombe Genome-wide studies of the Crz1 and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2 and tunicamycin treatment, as well as a ∆pmr1 genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of the Saccharomyces cerevisiae ortholog Crz1 These genes were functionally enriched for Crz1-conserved processes such as cell-wall biosynthesis. Overexpression of prz1(+)increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of theO-mannosyltransferase encoding gene omh1(+) Loss of omh1(+)abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss of prz1(+)resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the ∆prz1 strain was abrogated by the loss of gsf2(+) or cbf12(+) This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes between Crz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network.

  11. The conserved protein Seb1 drives transcription termination by binding RNA polymerase II and nascent RNA.

    PubMed

    Wittmann, Sina; Renner, Max; Watts, Beth R; Adams, Oliver; Huseyin, Miles; Baejen, Carlo; El Omari, Kamel; Kilchert, Cornelia; Heo, Dong-Hyuk; Kecman, Tea; Cramer, Patrick; Grimes, Jonathan M; Vasiljeva, Lidia

    2017-04-03

    Termination of RNA polymerase II (Pol II) transcription is an important step in the transcription cycle, which involves the dislodgement of polymerase from DNA, leading to release of a functional transcript. Recent studies have identified the key players required for this process and showed that a common feature of these proteins is a conserved domain that interacts with the phosphorylated C-terminus of Pol II (CTD-interacting domain, CID). However, the mechanism by which transcription termination is achieved is not understood. Using genome-wide methods, here we show that the fission yeast CID-protein Seb1 is essential for termination of protein-coding and non-coding genes through interaction with S2-phosphorylated Pol II and nascent RNA. Furthermore, we present the crystal structures of the Seb1 CTD- and RNA-binding modules. Unexpectedly, the latter reveals an intertwined two-domain arrangement of a canonical RRM and second domain. These results provide important insights into the mechanism underlying eukaryotic transcription termination.

  12. A Conserved Role for Human Nup98 in Altering Chromatin Structure and Promoting Epigenetic Transcriptional Memory

    PubMed Central

    Light, William H.; Freaney, Jonathan; Sood, Varun; Thompson, Abbey; D'Urso, Agustina; Horvath, Curt M.; Brickner, Jason H.

    2013-01-01

    The interaction of nuclear pore proteins (Nups) with active genes can promote their transcription. In yeast, some inducible genes interact with the nuclear pore complex both when active and for several generations after being repressed, a phenomenon called epigenetic transcriptional memory. This interaction promotes future reactivation and requires Nup100, a homologue of human Nup98. A similar phenomenon occurs in human cells; for at least four generations after treatment with interferon gamma (IFN-γ), many IFN-γ-inducible genes are induced more rapidly and more strongly than in cells that have not previously been exposed to IFN-γ. In both yeast and human cells, the recently expressed promoters of genes with memory exhibit persistent dimethylation of histone H3 lysine 4 (H3K4me2) and physically interact with Nups and a poised form of RNA polymerase II. However, in human cells, unlike yeast, these interactions occur in the nucleoplasm. In human cells transiently depleted of Nup98 or yeast cells lacking Nup100, transcriptional memory is lost; RNA polymerase II does not remain associated with promoters, H3K4me2 is lost, and the rate of transcriptional reactivation is reduced. These results suggest that Nup100/Nup98 binding to recently expressed promoters plays a conserved role in promoting epigenetic transcriptional memory. PMID:23555195

  13. Dinoflagellate tandem array gene transcripts are highly conserved and not polycistronic

    PubMed Central

    Beauchemin, Mathieu; Roy, Sougata; Daoust, Philippe; Dagenais-Bellefeuille, Steve; Bertomeu, Thierry; Letourneau, Louis; Lang, B. Franz; Morse, David

    2012-01-01

    Dinoflagellates are an important component of the marine biota, but a large genome with high–copy number (up to 5,000) tandem gene arrays has made genomic sequencing problematic. More importantly, little is known about the expression and conservation of these unusual gene arrays. We assembled de novo a gene catalog of 74,655 contigs for the dinoflagellate Lingulodinium polyedrum from RNA-Seq (Illumina) reads. The catalog contains 93% of a Lingulodinium EST dataset deposited in GenBank and 94% of the enzymes in 16 primary metabolic KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, indicating it is a good representation of the transcriptome. Analysis of the catalog shows a marked underrepresentation of DNA-binding proteins and DNA-binding domains compared with other algae. Despite this, we found no evidence to support the proposal of polycistronic transcription, including a marked underrepresentation of sequences corresponding to the intergenic spacers of two tandem array genes. We also have used RNA-Seq to assess the degree of sequence conservation in tandem array genes and found their transcripts to be highly conserved. Interestingly, some of the sequences in the catalog have only bacterial homologs and are potential candidates for horizontal gene transfer. These presumably were transferred as single-copy genes, and because they are now all GC-rich, any derived from AT-rich contexts must have experienced extensive mutation. Our study not only has provided the most complete dinoflagellate gene catalog known to date, it has also exploited RNA-Seq to address fundamental issues in basic transcription mechanisms and sequence conservation in these algae. PMID:23019363

  14. Meta-analysis reveals conserved cell cycle transcriptional network across multiple human cell types.

    PubMed

    Giotti, Bruno; Joshi, Anagha; Freeman, Tom C

    2017-01-05

    Cell division is central to the physiology and pathology of all eukaryotic organisms. The molecular machinery underpinning the cell cycle has been studied extensively in a number of species and core aspects of it have been found to be highly conserved. Similarly, the transcriptional changes associated with this pathway have been studied in different organisms and different cell types. In each case hundreds of genes have been reported to be regulated, however there seems to be little consensus in the genes identified across different studies. In a recent comparison of transcriptomic studies of the cell cycle in different human cell types, only 96 cell cycle genes were reported to be the same across all studies examined. Here we perform a systematic re-examination of published human cell cycle expression data by using a network-based approach to identify groups of genes with a similar expression profile and therefore function. Two clusters in particular, containing 298 transcripts, showed patterns of expression consistent with cell cycle occurrence across the four human cell types assessed. Our analysis shows that there is a far greater conservation of cell cycle-associated gene expression across human cell types than reported previously, which can be separated into two distinct transcriptional networks associated with the G1/S-S and G2-M phases of the cell cycle. This work also highlights the benefits of performing a re-analysis on combined datasets.

  15. Inference of transcriptional networks in Arabidopsis through conserved noncoding sequence analysis.

    PubMed

    Van de Velde, Jan; Heyndrickx, Ken S; Vandepoele, Klaas

    2014-07-01

    Transcriptional regulation plays an important role in establishing gene expression profiles during development or in response to (a)biotic stimuli. Transcription factor binding sites (TFBSs) are the functional elements that determine transcriptional activity, and the identification of individual TFBS in genome sequences is a major goal to inferring regulatory networks. We have developed a phylogenetic footprinting approach for the identification of conserved noncoding sequences (CNSs) across 12 dicot plants. Whereas both alignment and non-alignment-based techniques were applied to identify functional motifs in a multispecies context, our method accounts for incomplete motif conservation as well as high sequence divergence between related species. We identified 69,361 footprints associated with 17,895 genes. Through the integration of known TFBS obtained from the literature and experimental studies, we used the CNSs to compile a gene regulatory network in Arabidopsis thaliana containing 40,758 interactions, of which two-thirds act through binding events located in DNase I hypersensitive sites. This network shows significant enrichment toward in vivo targets of known regulators, and its overall quality was confirmed using five different biological validation metrics. Finally, through the integration of detailed expression and function information, we demonstrate how static CNSs can be converted into condition-dependent regulatory networks, offering opportunities for regulatory gene annotation.

  16. Microbial community transcriptional networks are conserved in three domains at ocean basin scales.

    PubMed

    Aylward, Frank O; Eppley, John M; Smith, Jason M; Chavez, Francisco P; Scholin, Christopher A; DeLong, Edward F

    2015-04-28

    Planktonic microbial communities in the ocean are typically dominated by several cosmopolitan clades of Bacteria, Archaea, and Eukarya characterized by their ribosomal RNA gene phylogenies and genomic features. Although the environments these communities inhabit range from coastal to open ocean waters, how the biological dynamics vary between such disparate habitats is not well known. To gain insight into the differential activities of microbial populations inhabiting different oceanic provinces we compared the daily metatranscriptome profiles of related microbial populations inhabiting surface waters of both a coastal California upwelling region (CC) as well as the oligotrophic North Pacific Subtropical Gyre (NPSG). Transcriptional networks revealed that the dominant photoautotrophic microbes in each environment (Ostreococcus in CC, Prochlorococcus in NPSG) were central determinants of overall community transcriptome dynamics. Furthermore, heterotrophic bacterial clades common to both ecosystems (SAR11, SAR116, SAR86, SAR406, and Roseobacter) displayed conserved, genome-wide inter- and intrataxon transcriptional patterns and diel cycles. Populations of SAR11 and SAR86 clades in particular exhibited tightly coordinated transcriptional patterns in both coastal and pelagic ecosystems, suggesting that specific biological interactions between these groups are widespread in nature. Our results identify common diurnally oscillating behaviors among diverse planktonic microbial species regardless of habitat, suggesting that highly conserved temporally phased biotic interactions are ubiquitous among planktonic microbial communities worldwide.

  17. Conserved Transcription Factors Steer Growth-Related Genomic Programs in Daphnia

    PubMed Central

    Spanier, Katina I.; Jansen, Mieke; Decaestecker, Ellen; Hulselmans, Gert; Becker, Dörthe; Colbourne, John K.; Orsini, Luisa

    2017-01-01

    Abstract Ecological genomics aims to understand the functional association between environmental gradients and the genes underlying adaptive traits. Many genes that are identified by genome-wide screening in ecologically relevant species lack functional annotations. Although gene functions can be inferred from sequence homology, such approaches have limited power. Here, we introduce ecological regulatory genomics by presenting an ontology-free gene prioritization method. Specifically, our method combines transcriptome profiling with high-throughput cis-regulatory sequence analysis in the water fleas Daphnia pulex and Daphnia magna. It screens coexpressed genes for overrepresented DNA motifs that serve as transcription factor binding sites, thereby providing insight into conserved transcription factors and gene regulatory networks shaping the expression profile. We first validated our method, called Daphnia-cisTarget, on a D. pulex heat shock data set, which revealed a network driven by the heat shock factor. Next, we performed RNA-Seq in D. magna exposed to the cyanobacterium Microcystis aeruginosa. Daphnia-cisTarget identified coregulated gene networks that associate with the moulting cycle and potentially regulate life history changes in growth rate and age at maturity. These networks are predicted to be regulated by evolutionary conserved transcription factors such as the homologues of Drosophila Shavenbaby and Grainyhead, nuclear receptors, and a GATA family member. In conclusion, our approach allows prioritising candidate genes in Daphnia without bias towards prior knowledge about functional gene annotation and represents an important step towards exploring the molecular mechanisms of ecological responses in organisms with poorly annotated genomes. PMID:28854641

  18. Microbial community transcriptional networks are conserved in three domains at ocean basin scales

    NASA Astrophysics Data System (ADS)

    Aylward, Frank O.; Eppley, John M.; Smith, Jason M.; Chavez, Francisco P.; Scholin, Christopher A.; DeLong, Edward F.

    2015-04-01

    Planktonic microbial communities in the ocean are typically dominated by several cosmopolitan clades of Bacteria, Archaea, and Eukarya characterized by their ribosomal RNA gene phylogenies and genomic features. Although the environments these communities inhabit range from coastal to open ocean waters, how the biological dynamics vary between such disparate habitats is not well known. To gain insight into the differential activities of microbial populations inhabiting different oceanic provinces we compared the daily metatranscriptome profiles of related microbial populations inhabiting surface waters of both a coastal California upwelling region (CC) as well as the oligotrophic North Pacific Subtropical Gyre (NPSG). Transcriptional networks revealed that the dominant photoautotrophic microbes in each environment (Ostreococcus in CC, Prochlorococcus in NPSG) were central determinants of overall community transcriptome dynamics. Furthermore, heterotrophic bacterial clades common to both ecosystems (SAR11, SAR116, SAR86, SAR406, and Roseobacter) displayed conserved, genome-wide inter- and intrataxon transcriptional patterns and diel cycles. Populations of SAR11 and SAR86 clades in particular exhibited tightly coordinated transcriptional patterns in both coastal and pelagic ecosystems, suggesting that specific biological interactions between these groups are widespread in nature. Our results identify common diurnally oscillating behaviors among diverse planktonic microbial species regardless of habitat, suggesting that highly conserved temporally phased biotic interactions are ubiquitous among planktonic microbial communities worldwide.

  19. Investigating Conservation of the Cell-Cycle-Regulated Transcriptional Program in the Fungal Pathogen, Cryptococcus neoformans

    PubMed Central

    Sierra, Crystal S.; Haase, Steven B.

    2016-01-01

    The pathogenic yeast Cryptococcus neoformans causes fungal meningitis in immune-compromised patients. Cell proliferation in the budding yeast form is required for C. neoformans to infect human hosts, and virulence factors such as capsule formation and melanin production are affected by cell-cycle perturbation. Thus, understanding cell-cycle regulation is critical for a full understanding of virulence factors for disease. Our group and others have demonstrated that a large fraction of genes in Saccharomyces cerevisiae is expressed periodically during the cell cycle, and that proper regulation of this transcriptional program is important for proper cell division. Despite the evolutionary divergence of the two budding yeasts, we found that a similar percentage of all genes (~20%) is periodically expressed during the cell cycle in both yeasts. However, the temporal ordering of periodic expression has diverged for some orthologous cell-cycle genes, especially those related to bud emergence and bud growth. Genes regulating DNA replication and mitosis exhibited a conserved ordering in both yeasts, suggesting that essential cell-cycle processes are conserved in periodicity and in timing of expression (i.e. duplication before division). In S. cerevisiae cells, we have proposed that an interconnected network of periodic transcription factors (TFs) controls the bulk of the cell-cycle transcriptional program. We found that temporal ordering of orthologous network TFs was not always maintained; however, the TF network topology at cell-cycle commitment appears to be conserved in C. neoformans. During the C. neoformans cell cycle, DNA replication genes, mitosis genes, and 40 genes involved in virulence are periodically expressed. Future work toward understanding the gene regulatory network that controls cell-cycle genes is critical for developing novel antifungals to inhibit pathogen proliferation. PMID:27918582

  20. A conserved family of nuclear phosphoproteins localized to sites of polymerase II transcription

    PubMed Central

    1991-01-01

    An antibody was identified previously that recognizes sites of polymerase II transcription on lampbrush chromosomes, puffs on polytene chromosomes, and many small granules in the nucleoplasm of all cells tested. This antibody binds a conserved family of phosphorylated polypeptides in vertebrate and invertebrate cells. We developed a method for purifying these proteins that involves differential solubility in MgCl2. We isolated a Drosophila cDNA encoding one of the proteins using information obtained from microsequencing. In vivo expression studies show that this protein is concentrated on sites of polymerase II transcription and that it is highly phosphorylated. The protein shares a high degree of homology with proteins involved in alternative splicing of pre-mRNA suggesting the possibility that this protein plays a role in pre-mRNA splicing. PMID:1717489

  1. ECRbase: Database of Evolutionary Conserved Regions, Promoters, and Transcription Factor Binding Sites in Vertebrate Genomes

    SciTech Connect

    Loots, G; Ovcharenko, I

    2006-08-08

    Evolutionary conservation of DNA sequences provides a tool for the identification of functional elements in genomes. We have created a database of evolutionary conserved regions (ECRs) in vertebrate genomes entitled ECRbase that is constructed from a collection of pairwise vertebrate genome alignments produced by the ECR Browser database. ECRbase features a database of syntenic blocks that recapitulate the evolution of rearrangements in vertebrates and a collection of promoters in all vertebrate genomes presented in the database. The database also contains a collection of annotated transcription factor binding sites (TFBS) in all ECRs and promoter elements. ECRbase currently includes human, rhesus macaque, dog, opossum, rat, mouse, chicken, frog, zebrafish, and two pufferfish genomes. It is freely accessible at http://ECRbase.dcode.org.

  2. The transcription factor Spn1 regulates gene expression via a highly conserved novel structural motif

    PubMed Central

    Pujari, Venugopal; Radebaugh, Catherine A.; Chodaparambil, Jayanth V.; Muthurajan, Uma M.; Almeida, Adam R.; Fischbeck, Julie A.; Luger, Karolin; Stargell, Laurie A.

    2010-01-01

    Spn1 plays essential roles in the regulation of gene expression by RNA Polymerase II (RNAPII), and it is highly conserved in organisms ranging from yeast to humans. Spn1 physically and/or genetically interacts with RNAPII, TBP, TFIIS and a number of chromatin remodeling factors (Swi/Snf and Spt6). The central domain of Spn1 (residues 141-305 out of 410) is necessary and sufficient for performing the essential functions of SPN1 in yeast cells. Here we report the high-resolution (1.85Å) crystal structure of the conserved central domain of Saccharomyces cerevisiae Spn1. The central domain is comprised of eight alpha-helices in a right handed super helical arrangement, and exhibits structural similarity to domain I of TFIIS. A unique structural feature of Spn1 is a highly conserved loop, which defines one side of a pronounced cavity. The loop and the other residues forming the cavity are highly conserved at the amino acid level among all Spn1 family members, suggesting that this is a signature motif for Spn1 orthologs. The locations and the molecular characterization of temperature-sensitive mutations in Spn1 indicate that the cavity is a key attribute of Spn1 that is critical for its regulatory functions during RNAPII-mediated transcriptional activity. PMID:20875428

  3. Conserved Transcriptional Responses to Nutrient Stress in Bloom-Forming Algae.

    PubMed

    Harke, Matthew J; Juhl, Andrew R; Haley, Sheean T; Alexander, Harriet; Dyhrman, Sonya T

    2017-01-01

    The concentration and composition of bioavailable nitrogen (N) and phosphorus (P) in the upper ocean shape eukaryotic phytoplankton communities and influence their physiological responses. Phytoplankton are known to exhibit similar physiological responses to limiting N and P conditions such as decreased growth rates, chlorosis, and increased assimilation of N and P. Are these responses similar at the molecular level across multiple species? To interrogate this question, five species from biogeochemically important, bloom-forming taxa (Bacillariophyta, Dinophyta, and Haptophyta) were grown under similar low N, low P, and replete nutrient conditions to identify transcriptional patterns and associated changes in biochemical pools related to N and P stress. Metabolic profiles, revealed through the transcriptomes of these taxa, clustered together based on species rather than nutrient stressor, suggesting that the global metabolic response to nutrient stresses was largely, but not exclusively, species-specific. Nutrient stress led to few transcriptional changes in the two dinoflagellates, consistent with other research. An orthologous group analysis examined functionally conserved (i.e., similarly changed) responses to nutrient stress and therefore focused on the diatom and haptophytes. Most conserved ortholog changes were specific to a single nutrient treatment, but a small number of orthologs were similarly changed under both N and P stress in 2 or more species. Many of these orthologs were related to photosynthesis and may represent generalized stress responses. A greater number of orthologs were conserved across more than one species under low P compared to low N. Screening the conserved orthologs for functions related to N and P metabolism revealed increased relative abundance of orthologs for nitrate, nitrite, ammonium, and amino acid transporters under N stress, and increased relative abundance of orthologs related to acquisition of inorganic and organic P

  4. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    SciTech Connect

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.; Iyer, VenkyN.; Eisen, Michael B.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  5. Sea urchin collagen evolutionarily homologous to vertebrate pro-alpha 2(I) collagen.

    PubMed

    Exposito, J Y; D'Alessio, M; Solursh, M; Ramirez, F

    1992-08-05

    We isolated several overlapping cDNA clones covering the 4242 nucleotides of a Strongylocentrotus purpuratus transcript that codes for a fibrillar procollagen chain. The sea urchin polypeptide includes a 124-amino acid long amino pre-propeptide, a 1064-amino acid alpha-chain inclusive of 338 uninterrupted Gly-X-Y repeats, and a 226-residue carboxyl-propeptide. The distribution of the highly conserved cysteines within the last domain together with the structural configuration of the amino-propeptide and the organization of the corresponding coding region, strongly suggest that the sea urchin gene is evolutionarily related to the vertebrate pro-alpha 2(I) collagen. This work, therefore, represents the first report of the complete primary structure of an invertebrate fibrillar procollagen chain. It also provides a new insight into the evolution of the amino-propeptide, the most divergent among the major protein domains of fibrillar procollagen chains.

  6. Identification of conserved micro-RNAs and their target transcripts in opium poppy (Papaver somniferum L.).

    PubMed

    Unver, Turgay; Parmaksiz, Iskender; Dündar, Ekrem

    2010-07-01

    Micro-RNAs (miRNA) are regulatory non-coding class of small RNAs functioning in many organisms. Using computational approaches we have identified 20 conserved opium poppy (Papaver somniferum L.) miRNAs belonging to 16 miRNA families in Expressed Sequence Tags (EST) database. The existence of ESTs suggested that the miRNAs were expressed in P. somniferum. Lengths of mature miRNAs varied from 20 to 23 nucleotides located at the different positions of precursor RNAs. Uracil was found to be a dominant nucleotide in both poppy pre-miRNA sequences (31.28 +/- 7.06% of total nucleotide composition) and in the first position at the 5' end of the mature poppy miRNAs. We have applied quantitative real-time PCR (qRT-PCR) assays to compare and validate expression levels of selected P. somniferum miRNAs and their target transcripts. As a result, some of the predicted miRNAs and their target genes were found to be differentially expressed in P. somniferum leaf and root tissues. A meaningful correlation between three of the four analyzed pairs of miRNAs and their target transcript expression levels was detected. Additionally, using these predicted miRNAs as queries, 41 potential target mRNAs were found in National Center for Biotechnology Information (NCBI) protein-coding nucleotide (mRNA) database of all plant species. Some of the target mRNAs were found to be transcription factors regulating plant development, morphology, and flowering time. Other target mRNAs of identified conserved miRNAs involve in metabolic processes, signal transduction, and stress responses. This study reports the first identification of opium poppy miRNAs.

  7. A prominent and conserved role for YY1 in Xist transcriptional activation

    PubMed Central

    Navarro, Pablo; Neuillet, Damien; Rougeulle, Claire

    2014-01-01

    Accumulation of the non-coding RNA Xist on one X chromosome in female cells is a hallmark of X-chromosome inactivation in eutherians. Here, we uncovered an essential function for the ubiquitous autosomal transcription factor Yin-Yang 1 (YY1) in the transcriptional activation of Xist in both human and mouse. We show that loss of YY1 prevents Xist up-regulation during the initiation and maintenance of X-inactivation, and that YY1 binds directly the Xist 5′ region to trigger the activity of the Xist promoter. Binding of YY1 to the Xist 5′ region prior to X-chromosome inactivation competes with the Xist repressor REX1 while DNA methylation controls mono-allelic fixation of YY1 to Xist at the onset of X-chromosome inactivation. YY1 is thus the first autosomal activating factor involved in a fundamental and conserved pathway of Xist regulation that ensures the asymmetric transcriptional up-regulation of the master regulator of X-chromosome inactivation. PMID:25209548

  8. Divergence of a conserved elongation factor and transcription regulation in budding and fission yeast

    PubMed Central

    Booth, Gregory T.; Wang, Isabel X.; Cheung, Vivian G.; Lis, John T.

    2016-01-01

    Complex regulation of gene expression in mammals has evolved from simpler eukaryotic systems, yet the mechanistic features of this evolution remain elusive. Here, we compared the transcriptional landscapes of the distantly related budding and fission yeast. We adapted the Precision Run-On sequencing (PRO-seq) approach to map the positions of RNA polymerase active sites genome-wide in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Additionally, we mapped preferred sites of transcription initiation in each organism using PRO-cap. Unexpectedly, we identify a pause in early elongation, specific to S. pombe, that requires the conserved elongation factor subunit Spt4 and resembles promoter-proximal pausing in metazoans. PRO-seq profiles in strains lacking Spt4 reveal globally elevated levels of transcribing RNA Polymerase II (Pol II) within genes in both species. Messenger RNA abundance, however, does not reflect the increases in Pol II density, indicating a global reduction in elongation rate. Together, our results provide the first base-pair resolution map of transcription elongation in S. pombe and identify divergent roles for Spt4 in controlling elongation in budding and fission yeast. PMID:27197211

  9. Divergence of a conserved elongation factor and transcription regulation in budding and fission yeast.

    PubMed

    Booth, Gregory T; Wang, Isabel X; Cheung, Vivian G; Lis, John T

    2016-06-01

    Complex regulation of gene expression in mammals has evolved from simpler eukaryotic systems, yet the mechanistic features of this evolution remain elusive. Here, we compared the transcriptional landscapes of the distantly related budding and fission yeast. We adapted the Precision Run-On sequencing (PRO-seq) approach to map the positions of RNA polymerase active sites genome-wide in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Additionally, we mapped preferred sites of transcription initiation in each organism using PRO-cap. Unexpectedly, we identify a pause in early elongation, specific to S. pombe, that requires the conserved elongation factor subunit Spt4 and resembles promoter-proximal pausing in metazoans. PRO-seq profiles in strains lacking Spt4 reveal globally elevated levels of transcribing RNA Polymerase II (Pol II) within genes in both species. Messenger RNA abundance, however, does not reflect the increases in Pol II density, indicating a global reduction in elongation rate. Together, our results provide the first base-pair resolution map of transcription elongation in S. pombe and identify divergent roles for Spt4 in controlling elongation in budding and fission yeast. © 2016 Booth et al.; Published by Cold Spring Harbor Laboratory Press.

  10. [Comparative analysis of conservation and regulatory network on core transcription factors in mouse inner ear development].

    PubMed

    Chen, Zhi-Qiang; Han, Xin-Huan; Wei, Qin-Jun; Xing, Guang-Qian; Cao, Xin

    2013-10-01

    During vertebrate inner ear development, several core genes, such as Six1, Six4, Pax2, Pax8, Foxi1, Dlx5, Gbx2, Irx2/3, and Msx1, are crucial to the regulation of the otic placode induction. In order to get the gene regulatory network during inner ear development, bioinformatics methods were adopted to analyze conservation and regulation of the core transcription factors in mice. Pax2, Pax8, Foxi1, and Dlx5 remained to be the main regulators during inner ear development, which was consistent with the gene regulatory network from literature. Six1 was regulated by many transcription factors, and Gbx2, Irx2/3, and Msx1 played important roles in the regulatory network. The differences in the constructed regulatory network were reasonably analyzed. It was predicted that Msxl regulated the expression of Six1 and Gbx2. In addition, several transcription factors, such as Sox5, Lhx2, Rax, Otx1, Otx2, Pitxl, Pitx2, Nkx2-5, Irx4, Irx6, Dlx2, Hmx1/2/3, Pou4f3, Pax4 and Tlx2, were found to be involved in the regulatory network. Our results provide an improved understanding of the regulatory mechanism during inner ear development.

  11. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  12. Mechanisms Regulating GLUT4 Transcription in Skeletal Muscle Cells Are Highly Conserved across Vertebrates

    PubMed Central

    Marín-Juez, Rubén; Diaz, Mónica; Morata, Jordi; Planas, Josep V.

    2013-01-01

    The glucose transporter 4 (GLUT4) plays a key role in glucose uptake in insulin target tissues. This transporter has been extensively studied in many species in terms of its function, expression and cellular traffic and complex mechanisms are involved in its regulation at many different levels. However, studies investigating the transcription of the GLUT4 gene and its regulation are scarce. In this study, we have identified the GLUT4 gene in a teleost fish, the Fugu (Takifugu rubripes), and have cloned and characterized a functional promoter of this gene for the first time in a non-mammalian vertebrate. In silico analysis of the Fugu GLUT4 promoter identified potential binding sites for transcription factors such as SP1, C/EBP, MEF2, KLF, SREBP-1c and GC-boxes, as well as a CpG island, but failed to identify a TATA box. In vitro analysis revealed three transcription start sites, with the main residing 307 bp upstream of the ATG codon. Deletion analysis determined that the core promoter was located between nucleotides -132/+94. By transfecting a variety of 5´deletion constructs into L6 muscle cells we have determined that Fugu GLUT4 promoter transcription is regulated by insulin, PG-J2, a PPARγ agonist, and electrical pulse stimulation. Furthermore, our results suggest the implication of motifs such as PPARγ/RXR and HIF-1α in the regulation of Fugu GLUT4 promoter activity by PPARγ and contractile activity, respectively. These data suggest that the characteristics and regulation of the GLUT4 promoter have been remarkably conserved during the evolution from fish to mammals, further evidencing the important role of GLUT4 in metabolic regulation in vertebrates. PMID:24260440

  13. Mechanisms regulating GLUT4 transcription in skeletal muscle cells are highly conserved across vertebrates.

    PubMed

    Marín-Juez, Rubén; Diaz, Mónica; Morata, Jordi; Planas, Josep V

    2013-01-01

    The glucose transporter 4 (GLUT4) plays a key role in glucose uptake in insulin target tissues. This transporter has been extensively studied in many species in terms of its function, expression and cellular traffic and complex mechanisms are involved in its regulation at many different levels. However, studies investigating the transcription of the GLUT4 gene and its regulation are scarce. In this study, we have identified the GLUT4 gene in a teleost fish, the Fugu (Takifugu rubripes), and have cloned and characterized a functional promoter of this gene for the first time in a non-mammalian vertebrate. In silico analysis of the Fugu GLUT4 promoter identified potential binding sites for transcription factors such as SP1, C/EBP, MEF2, KLF, SREBP-1c and GC-boxes, as well as a CpG island, but failed to identify a TATA box. In vitro analysis revealed three transcription start sites, with the main residing 307 bp upstream of the ATG codon. Deletion analysis determined that the core promoter was located between nucleotides -132/+94. By transfecting a variety of 5´deletion constructs into L6 muscle cells we have determined that Fugu GLUT4 promoter transcription is regulated by insulin, PG-J2, a PPARγ agonist, and electrical pulse stimulation. Furthermore, our results suggest the implication of motifs such as PPARγ/RXR and HIF-1α in the regulation of Fugu GLUT4 promoter activity by PPARγ and contractile activity, respectively. These data suggest that the characteristics and regulation of the GLUT4 promoter have been remarkably conserved during the evolution from fish to mammals, further evidencing the important role of GLUT4 in metabolic regulation in vertebrates.

  14. Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator.

    PubMed

    Nocedal, Isabel; Mancera, Eugenio; Johnson, Alexander D

    2017-03-22

    The rewiring of gene regulatory networks can generate phenotypic novelty. It remains an open question, however, how the large number of connections needed to form a novel network arise over evolutionary time. Here, we address this question using the network controlled by the fungal transcription regulator Ndt80. This conserved protein has undergone a dramatic switch in function-from an ancestral role regulating sporulation to a derived role regulating biofilm formation. This switch in function corresponded to a large-scale rewiring of the genes regulated by Ndt80. However, we demonstrate that the Ndt80-target gene connections were undergoing extensive rewiring prior to the switch in Ndt80's regulatory function. We propose that extensive drift in the Ndt80 regulon allowed for the exploration of alternative network structures without a loss of ancestral function, thereby facilitating the formation of a network with a new function.

  15. A highly conserved novel family of mammalian developmental transcription factors related to Drosophila grainyhead.

    PubMed

    Wilanowski, Tomasz; Tuckfield, Annabel; Cerruti, Loretta; O'Connell, Sinead; Saint, Robert; Parekh, Vishwas; Tao, Jianning; Cunningham, John M; Jane, Stephen M

    2002-06-01

    The Drosophila transcription factor Grainyhead regulates several key developmental processes. Three mammalian genes, CP2, LBP-1a and LBP-9 have been previously identified as homologues of grainyhead. We now report the cloning of two new mammalian genes (Mammalian grainyhead (MGR) and Brother-of-MGR (BOM)) and one new Drosophila gene (dCP2) that rewrite the phylogeny of this family. We demonstrate that MGR and BOM are more closely related to grh, whereas CP2, LBP-1a and LBP-9 are descendants of the dCP2 gene. MGR shares the greatest sequence homology with grh, is expressed in tissue-restricted patterns more comparable to grh and binds to and transactivates the promoter of the human Engrailed-1 gene, the mammalian homologue of the key grainyhead target gene, engrailed. This sequence and functional conservation indicates that the new mammalian members of this family play important developmental roles.

  16. An ancient transcriptional regulatory module for tip growth has been conserved throughout the vascular plant lineage.

    PubMed

    Cho, Hyung-Taeg

    2017-02-17

    The root hair development of vascular plants can be divided into two major processes, fate determination and hair morphogenesis, and the latter should be governed by the former so as to express the morphogenetic toolkits in a root hair-specific manner. Vascular plants, depending on taxa, show different fate-determining mechanisms for hair cell/non-hair cell fates, which leads to a question whether the downstream mophogenetic regulatory module is diverged accordingly to the upstream fate determiners or not. Our study demonstrates that the module of a transcription factor and a root hair-specific cis-element (RHE) for root hair-specific expression of morphogenetic toolkit genes is conserved in spite of different fate-determing mechanisms.

  17. Dynamic Sumoylation of a Conserved Transcription Corepressor Prevents Persistent Inclusion Formation during Hyperosmotic Stress.

    PubMed

    Oeser, Michelle L; Amen, Triana; Nadel, Cory M; Bradley, Amanda I; Reed, Benjamin J; Jones, Ramon D; Gopalan, Janani; Kaganovich, Daniel; Gardner, Richard G

    2016-01-01

    Cells are often exposed to physical or chemical stresses that can damage the structures of essential biomolecules. Stress-induced cellular damage can become deleterious if not managed appropriately. Rapid and adaptive responses to stresses are therefore crucial for cell survival. In eukaryotic cells, different stresses trigger post-translational modification of proteins with the small ubiquitin-like modifier SUMO. However, the specific regulatory roles of sumoylation in each stress response are not well understood. Here, we examined the sumoylation events that occur in budding yeast after exposure to hyperosmotic stress. We discovered by proteomic and biochemical analyses that hyperosmotic stress incurs the rapid and transient sumoylation of Cyc8 and Tup1, which together form a conserved transcription corepressor complex that regulates hundreds of genes. Gene expression and cell biological analyses revealed that sumoylation of each protein directs distinct outcomes. In particular, we discovered that Cyc8 sumoylation prevents the persistence of hyperosmotic stress-induced Cyc8-Tup1 inclusions, which involves a glutamine-rich prion domain in Cyc8. We propose that sumoylation protects against persistent inclusion formation during hyperosmotic stress, allowing optimal transcriptional function of the Cyc8-Tup1 complex.

  18. Sphingolipids, Transcription Factors, and Conserved Toolkit Genes: Developmental Plasticity in the Ant Cardiocondyla obscurior

    PubMed Central

    Schrader, Lukas; Simola, Daniel F.; Heinze, Jürgen; Oettler, Jan

    2015-01-01

    Developmental plasticity allows for the remarkable morphological specialization of individuals into castes in eusocial species of Hymenoptera. Developmental trajectories that lead to alternative caste fates are typically determined by specific environmental stimuli that induce larvae to express and maintain distinct gene expression patterns. Although most eusocial species express two castes, queens and workers, the ant Cardiocondyla obscurior expresses diphenic females and males; this provides a unique system with four discrete phenotypes to study the genomic basis of developmental plasticity in ants. We sequenced and analyzed the transcriptomes of 28 individual C. obscurior larvae of known developmental trajectory, providing the first in-depth analysis of gene expression in eusocial insect larvae. Clustering and transcription factor binding site analyses revealed that different transcription factors and functionally distinct sets of genes are recruited during larval development to induce the four alternative trajectories. In particular, we found complex patterns of gene regulation pertaining to sphingolipid metabolism, a conserved molecular pathway involved in development, obesity, and aging. PMID:25725431

  19. Dynamic Sumoylation of a Conserved Transcription Corepressor Prevents Persistent Inclusion Formation during Hyperosmotic Stress

    PubMed Central

    Oeser, Michelle L.; Amen, Triana; Nadel, Cory M.; Bradley, Amanda I.; Reed, Benjamin J.; Jones, Ramon D.; Gopalan, Janani; Kaganovich, Daniel; Gardner, Richard G.

    2016-01-01

    Cells are often exposed to physical or chemical stresses that can damage the structures of essential biomolecules. Stress-induced cellular damage can become deleterious if not managed appropriately. Rapid and adaptive responses to stresses are therefore crucial for cell survival. In eukaryotic cells, different stresses trigger post-translational modification of proteins with the small ubiquitin-like modifier SUMO. However, the specific regulatory roles of sumoylation in each stress response are not well understood. Here, we examined the sumoylation events that occur in budding yeast after exposure to hyperosmotic stress. We discovered by proteomic and biochemical analyses that hyperosmotic stress incurs the rapid and transient sumoylation of Cyc8 and Tup1, which together form a conserved transcription corepressor complex that regulates hundreds of genes. Gene expression and cell biological analyses revealed that sumoylation of each protein directs distinct outcomes. In particular, we discovered that Cyc8 sumoylation prevents the persistence of hyperosmotic stress-induced Cyc8-Tup1 inclusions, which involves a glutamine-rich prion domain in Cyc8. We propose that sumoylation protects against persistent inclusion formation during hyperosmotic stress, allowing optimal transcriptional function of the Cyc8-Tup1 complex. PMID:26800527

  20. Conservation of lipid metabolic gene transcriptional regulatory networks in fish and mammals.

    PubMed

    Carmona-Antoñanzas, Greta; Tocher, Douglas R; Martinez-Rubio, Laura; Leaver, Michael J

    2014-01-15

    Lipid content and composition in aquafeeds have changed rapidly as a result of the recent drive to replace ecologically limited marine ingredients, fishmeal and fish oil (FO). Terrestrial plant products are the most economic and sustainable alternative; however, plant meals and oils are devoid of physiologically important cholesterol and long-chain polyunsaturated fatty acids (LC-PUFA), eicosapentaenoic (EPA), docosahexaenoic (DHA) and arachidonic (ARA) acids. Although replacement of dietary FO with vegetable oil (VO) has little effect on growth in Atlantic salmon (Salmo salar), several studies have shown major effects on the activity and expression of genes involved in lipid homeostasis. In vertebrates, sterols and LC-PUFA play crucial roles in lipid metabolism by direct interaction with lipid-sensing transcription factors (TFs) and consequent regulation of target genes. The primary aim of the present study was to elucidate the role of key TFs in the transcriptional regulation of lipid metabolism in fish by transfection and overexpression of TFs. The results show that the expression of genes of LC-PUFA biosynthesis (elovl and fads2) and cholesterol metabolism (abca1) are regulated by Lxr and Srebp TFs in salmon, indicating highly conserved regulatory mechanism across vertebrates. In addition, srebp1 and srebp2 mRNA respond to replacement of dietary FO with VO. Thus, Atlantic salmon adjust lipid metabolism in response to dietary lipid composition through the transcriptional regulation of gene expression. It may be possible to further increase efficient and effective use of sustainable alternatives to marine products in aquaculture by considering these important molecular interactions when formulating diets. © 2013.

  1. A conserved structural module regulates transcriptional responses to diverse stress signals in bacteria

    SciTech Connect

    Campbell, Elizabeth A.; Greenwell, Roger S.; Anthony, Jennifer R.; Wang, Sheng; Lim, Lee; Das, Kakoli; Sofia, Heidi J.; Donohue, Timothy J.; Darst, Seth A.

    2007-09-07

    In Rhodbacter sphaeroides, transcriptional response to singlet oxygen is controlled by the ECF (extracytoplasmic function) transcription factor, σΕ. ECF σ’s comprise the largest and most divergent group of the σ70-family members and are negatively regulated by their cognate anti-σ factor. Here, we determine the crystal structure of the Rhodobacter sphaeroides ECF σ factor, σE, in an inhibitory complex with its anti-σ, ChrR. The structure reveals that ChrR is composed of two structural domains separated by a flexible linker. The N-terminal domain sterically occludes the two primary binding determinants on σE for core RNA polymerase and is thus referred to as the ASD (anti-σ domain). Genetic and biochemical characterization of the two domains show that the ASD is sufficient to inhibit σE dependant transcription and the C-terminal domain is required for response to singlet oxygen and the release of σE from the ASD. In addition, structural and sequence analyses of the ASD of ChrR and other ECF anti-σ’s, reveal that the N-terminal domain of different groups of ECF anti-σ’s share a common structural fold with some sequence similarity. Bioinformatics studies show that the ASD occurs in as many as one third of ECF anti-σ’s, many of which have diverse C-terminal domains. The conserved ASD are sometimes fused to diverse C-terminal domains. These studies reveal that the ASD class of anti-σ’s are extraordinarily diverse, based on the type of σΕ factors they are associated with and the C-terminal domains to which they are linked.

  2. Conserved Regional Patterns of GABA-Related Transcript Expression in the Neocortex of Subjects With Schizophrenia

    PubMed Central

    Hashimoto, Takanori; Bazmi, H. Holly; Mirnics, Karoly; Wu, Qiang; Sampson, Allan R.; Lewis, David A.

    2010-01-01

    Objective Individuals with schizophrenia exhibit disturbances in a number of cognitive, affective, sensory, and motor functions that depend on the circuitry of different cortical areas. The cognitive deficits associated with dysfunction of the dorsolateral prefrontal cortex result, at least in part, from abnormalities in GABA neurotransmission, as reflected in a specific pattern of altered expression of GABA-related genes. Consequently, the authors sought to determine whether this pattern of altered gene expression is restricted to the dorsolateral prefrontal cortex or could also contribute to the dysfunction of other cortical areas in subjects with schizophrenia. Method Real-time quantitative polymerase chain reaction was used to assess the levels of eight GABA-related transcripts in four cortical areas (dorsolateral prefrontal cortex, anterior cingulate cortex, and primary motor and primary visual cortices) of subjects (N=12) with schizophrenia and matched normal comparison subjects. Results Expression levels of seven transcripts were lower in subjects with schizophrenia, with the magnitude of reduction for each transcript comparable across the four areas. The largest reductions were detected for mRNA encoding somatostatin and parvalbumin, followed by moderate decreases in mRNA expression for the 67-kilodalton isoform of glutamic acid decarboxylase, the GABA membrane transporter GAT-1, and the α1 and δ subunits of GABAA receptors. In contrast, the expression of calretinin mRNA did not differ between the subject groups in any of the four areas. Conclusions Because the areas examined represent the major functional domains (e.g., association, limbic, motor, and sensory) of the cerebral cortex, our findings suggest that a conserved set of molecular alterations affecting GABA neurotransmission contribute to the pathophysiology of different clinical features of schizophrenia. PMID:18281411

  3. Characterization of Bombyx mori mitochondrial transcription factor A, a conserved regulator of mitochondrial DNA.

    PubMed

    Sumitani, Megumi; Kondo, Mari; Kasashima, Katsumi; Endo, Hitoshi; Nakamura, Kaoru; Misawa, Toshihiko; Tanaka, Hiromitsu; Sezutsu, Hideki

    2017-04-15

    In the present study, we initially cloned and characterized a mitochondrial transcription factor A (Tfam) homologue in the silkworm, Bombyx mori. Bombyx mori TFAM (BmTFAM) localized to mitochondria in cultured silkworm and human cells, and co-localized with mtDNA nucleoids in human HeLa cells. In an immunoprecipitation analysis, BmTFAM was found to associate with human mtDNA in mitochondria, indicating its feature as a non-specific DNA-binding protein. In spite of the low identity between BmTFAM and human TFAM (26.5%), the expression of BmTFAM rescued mtDNA copy number reductions and enlarged mtDNA nucleoids in HeLa cells, which were induced by human Tfam knockdown. Thus, BmTFAM compensates for the function of human TFAM in HeLa cells, demonstrating that the mitochondrial function of TFAM is highly conserved between silkworms and humans. BmTfam mRNA was strongly expressed in early embryos. Through double-stranded RNA (dsRNA)-based RNA interference (RNAi) in silkworm embryos, we found that the knockdown of BmTFAM reduced the amount of mtDNA and induced growth retardation at the larval stage. Collectively, these results demonstrate that BmTFAM is a highly conserved mtDNA regulator and may be a good candidate for investigating and modulating mtDNA metabolism in this model organism. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Functional conservation between members of an ancient duplicated transcription factor family, LSF/Grainyhead.

    PubMed

    Venkatesan, Kavitha; McManus, Heather R; Mello, Craig C; Smith, Temple F; Hansen, Ulla

    2003-08-01

    The LSF/Grainyhead transcription factor family is involved in many important biological processes, including cell cycle, cell growth and development. In order to investigate the evolutionary conservation of these biological roles, we have characterized two new family members in Caenorhabditis elegans and Xenopus laevis. The C.elegans member, Ce-GRH-1, groups with the Grainyhead subfamily, while the X.laevis member, Xl-LSF, groups with the LSF subfamily. Ce-GRH-1 binds DNA in a sequence-specific manner identical to that of Drosophila melanogaster Grainyhead. In addition, Ce-GRH-1 binds to sequences upstream of the C.elegans gene encoding aromatic L-amino-acid decarboxylase and genes involved in post-embryonic development, mab-5 and dbl-1. All three C.elegans genes are homologs of D.melanogaster Grainyhead-regulated genes. RNA-mediated interference of Ce-grh-1 results in embryonic lethality in worms, accompanied by soft, defective cuticles. These phenotypes are strikingly similar to those observed previously in D.melanogaster grainyhead mutants, suggesting conservation of the developmental role of these family members over the course of evolution. Our phylogenetic analysis of the expanded LSF/GRH family (including other previously unrecognized proteins/ESTs) suggests that the structural and functional dichotomy of this family dates back more than 700 million years, i.e. to the time when the first multicellular organisms are thought to have arisen.

  5. Conserved transcriptional responses to cyanobacterial stressors are mediated by alternate regulation of paralogous genes in Daphnia.

    PubMed

    Asselman, Jana; Pfrender, Michael E; Lopez, Jacqueline A; De Coninck, Dieter I M; Janssen, Colin R; Shaw, Joseph R; De Schamphelaere, Karel A C

    2015-04-01

    Despite a significant increase in genomic data, our knowledge of gene functions and their transcriptional responses to environmental stimuli remains limited. Here, we use the model keystone species Daphnia pulex to study environmental responses of genes in the context of their gene family history to better understand the relationship between genome structure and gene function in response to environmental stimuli. Daphnia were exposed to five different treatments, each consisting of a diet supplemented with one of five cyanobacterial species, and a control treatment consisting of a diet of only green algae. Differential gene expression profiles of Daphnia exposed to each of these five cyanobacterial species showed that genes with known functions are more likely to be shared by different expression profiles, whereas genes specific to the lineage of Daphnia are more likely to be unique to a given expression profile. Furthermore, while only a small number of nonlineage-specific genes were conserved across treatment type, there was a high degree of overlap in expression profiles at the functional level. The conservation of functional responses across the different cyanobacterial treatments can be attributed to the treatment-specific expression of different paralogous genes within the same gene family. Comparison with available gene expression data in the literature suggests differences in nutritional composition in diets with cyanobacterial species compared to diets of green algae as a primary driver for cyanobacterial effects on Daphnia. We conclude that conserved functional responses in Daphnia across different cyanobacterial treatments are mediated through alternate regulation of paralogous gene families. © 2015 John Wiley & Sons Ltd.

  6. A Conserved Nuclear Cyclophilin Is Required for Both RNA Polymerase II Elongation and Co-transcriptional Splicing in Caenorhabditis elegans

    PubMed Central

    Ahn, Jeong H.; Rechsteiner, Andreas; Strome, Susan; Kelly, William G.

    2016-01-01

    The elongation phase of transcription by RNA Polymerase II (Pol II) involves numerous events that are tightly coordinated, including RNA processing, histone modification, and chromatin remodeling. RNA splicing factors are associated with elongating Pol II, and the interdependent coupling of splicing and elongation has been documented in several systems. Here we identify a conserved, multi-domain cyclophilin family member, SIG-7, as an essential factor for both normal transcription elongation and co-transcriptional splicing. In embryos depleted for SIG-7, RNA levels for over a thousand zygotically expressed genes are substantially reduced, Pol II becomes significantly reduced at the 3’ end of genes, marks of transcription elongation are reduced, and unspliced mRNAs accumulate. Our findings suggest that SIG-7 plays a central role in both Pol II elongation and co-transcriptional splicing and may provide an important link for their coordination and regulation. PMID:27541139

  7. Thioredoxins in evolutionarily primitive organisms

    NASA Technical Reports Server (NTRS)

    Buchanan, B. B.

    1986-01-01

    Thioredoxins are low molecular weight redox proteins, alternating between the S-S (oxidized) and SH (reduced) states, that function in a number of biochemical processes, including DNA synthesis, DNA replication, and enzyme regulation. Until recently, reduced ferredoxin was known to serve as the source of reducing power for the reduction of thioredoxins only in oxygenic photosynthetic cells. In all other organisms, the source of hydrogen (electrons) for thioredoxin reduction was considered to be NADPH. It was found that Clostridium pasteurianum, an anaerobic organism normally living in the soil unexposed to light, resembles photosynthetic cells in using ferredoxin for the reduction of thioredoxin. The results reveal the existence of a pathway in which ferredoxin, provides the reducing power for the reduction of thioredoxin via the flavoprotein enzyme, ferredoxinthioredoxin reductase. In related studies, it was found that Chromatium vinosum, an anaerobic photosynthetic purple sulfur bacterium, resembles evolutionarily more advanced micro-organisms in having an NADP-thioredoxin system composed of a single thioredoxin which is reduced by NADPH via NADP-thioredoxin reductase. The adoption of the NADP-thioredoxin system by Chromatium seems appropriate in view of evidence tha the organi sm utilizes ATP-driven reverse electron transport. Finally, results of research directed towards the identification of target enzymes of the ferredoxin/thioredoxin system in a cyanobacterium (Nostoc muscorum), show that thioredoxin-linked photosynthetic enzymes of cyanobateria are similar to those of chloroplasts. It now seems that the ferredoxin/thioredoxin system functions in regulating CO2 assimilation via the reductive pentose phosphate cycle in oxygenic but not anoxygenic photosynthetic cells.

  8. Thioredoxins in evolutionarily primitive organisms

    NASA Technical Reports Server (NTRS)

    Buchanan, B. B.

    1986-01-01

    Thioredoxins are low molecular weight redox proteins, alternating between the S-S (oxidized) and SH (reduced) states, that function in a number of biochemical processes, including DNA synthesis, DNA replication, and enzyme regulation. Until recently, reduced ferredoxin was known to serve as the source of reducing power for the reduction of thioredoxins only in oxygenic photosynthetic cells. In all other organisms, the source of hydrogen (electrons) for thioredoxin reduction was considered to be NADPH. It was found that Clostridium pasteurianum, an anaerobic organism normally living in the soil unexposed to light, resembles photosynthetic cells in using ferredoxin for the reduction of thioredoxin. The results reveal the existence of a pathway in which ferredoxin, provides the reducing power for the reduction of thioredoxin via the flavoprotein enzyme, ferredoxinthioredoxin reductase. In related studies, it was found that Chromatium vinosum, an anaerobic photosynthetic purple sulfur bacterium, resembles evolutionarily more advanced micro-organisms in having an NADP-thioredoxin system composed of a single thioredoxin which is reduced by NADPH via NADP-thioredoxin reductase. The adoption of the NADP-thioredoxin system by Chromatium seems appropriate in view of evidence tha the organi sm utilizes ATP-driven reverse electron transport. Finally, results of research directed towards the identification of target enzymes of the ferredoxin/thioredoxin system in a cyanobacterium (Nostoc muscorum), show that thioredoxin-linked photosynthetic enzymes of cyanobateria are similar to those of chloroplasts. It now seems that the ferredoxin/thioredoxin system functions in regulating CO2 assimilation via the reductive pentose phosphate cycle in oxygenic but not anoxygenic photosynthetic cells.

  9. A conserved structural motif reveals the essential transcriptional repression function of Spen proteins and their role in developmental signaling.

    PubMed

    Ariyoshi, Mariko; Schwabe, John W R

    2003-08-01

    Spen proteins regulate the expression of key transcriptional effectors in diverse signaling pathways. They are large proteins characterized by N-terminal RNA-binding motifs and a highly conserved C-terminal SPOC domain. The specific biological role of the SPOC domain (Spen paralog and ortholog C-terminal domain), and hence, the common function of Spen proteins, has been unclear to date. The Spen protein, SHARP (SMRT/HDAC1-associated repressor protein), was identified as a component of transcriptional repression complexes in both nuclear receptor and Notch/RBP-Jkappa signaling pathways. We have determined the 1.8 A crystal structure of the SPOC domain from SHARP. This structure shows that essentially all of the conserved surface residues map to a positively charged patch. Structure-based mutational analysis indicates that this conserved region is responsible for the interaction between SHARP and the universal transcriptional corepressor SMRT/NCoR (silencing mediator for retinoid and thyroid receptors/nuclear receptor corepressor. We demonstrate that this interaction involves a highly conserved acidic motif at the C terminus of SMRT/NCoR. These findings suggest that the conserved function of the SPOC domain is to mediate interaction with SMRT/NCoR corepressors, and that Spen proteins play an essential role in the repression complex.

  10. The Conserved Foot Domain of RNA Pol II Associates with Proteins Involved in Transcriptional Initiation and/or Early Elongation

    PubMed Central

    García-López, M. Carmen; Pelechano, Vicent; Mirón-García, M. Carmen; Garrido-Godino, Ana I.; García, Alicia; Calvo, Olga; Werner, Michel; Pérez-Ortín, José E.; Navarro, Francisco

    2011-01-01

    RNA polymerase (pol) II establishes many protein–protein interactions with transcriptional regulators to coordinate different steps of transcription. Although some of these interactions have been well described, little is known about the existence of RNA pol II regions involved in contact with transcriptional regulators. We hypothesize that conserved regions on the surface of RNA pol II contact transcriptional regulators. We identified such an RNA pol II conserved region that includes the majority of the “foot” domain and identified interactions of this region with Mvp1, a protein required for sorting proteins to the vacuole, and Spo14, a phospholipase D. Deletion of MVP1 and SPO14 affects the transcription of their target genes and increases phosphorylation of Ser5 in the carboxy-terminal domain (CTD). Genetic, phenotypic, and functional analyses point to a role for these proteins in transcriptional initiation and/or early elongation, consistent with their genetic interactions with CEG1, a guanylyltransferase subunit of the Saccharomyces cerevisiae capping enzyme. PMID:21954159

  11. Stable Binding of the Conserved Transcription Factor Grainy Head to its Target Genes Throughout Drosophila melanogaster Development.

    PubMed

    Nevil, Markus; Bondra, Eliana R; Schulz, Katharine N; Kaplan, Tommy; Harrison, Melissa M

    2017-02-01

    It has been suggested that transcription factor binding is temporally dynamic, and that changes in binding determine transcriptional output. Nonetheless, this model is based on relatively few examples in which transcription factor binding has been assayed at multiple developmental stages. The essential transcription factor Grainy head (Grh) is conserved from fungi to humans, and controls epithelial development and barrier formation in numerous tissues. Drosophila melanogaster, which possess a single grainy head (grh) gene, provide an excellent system to study this conserved factor. To determine whether temporally distinct binding events allow Grh to control cell fate specification in different tissue types, we used a combination of ChIP-seq and RNA-seq to elucidate the gene regulatory network controlled by Grh during four stages of embryonic development (spanning stages 5-17) and in larval tissue. Contrary to expectations, we discovered that Grh remains bound to at least 1146 genomic loci over days of development. In contrast to this stable DNA occupancy, the subset of genes whose expression is regulated by Grh varies. Grh transitions from functioning primarily as a transcriptional repressor early in development to functioning predominantly as an activator later. Our data reveal that Grh binds to target genes well before the Grh-dependent transcriptional program commences, suggesting it sets the stage for subsequent recruitment of additional factors that execute stage-specific Grh functions.

  12. Gene regulatory network plasticity predates a switch in function of a conserved transcription regulator

    PubMed Central

    Nocedal, Isabel; Mancera, Eugenio; Johnson, Alexander D

    2017-01-01

    The rewiring of gene regulatory networks can generate phenotypic novelty. It remains an open question, however, how the large number of connections needed to form a novel network arise over evolutionary time. Here, we address this question using the network controlled by the fungal transcription regulator Ndt80. This conserved protein has undergone a dramatic switch in function—from an ancestral role regulating sporulation to a derived role regulating biofilm formation. This switch in function corresponded to a large-scale rewiring of the genes regulated by Ndt80. However, we demonstrate that the Ndt80-target gene connections were undergoing extensive rewiring prior to the switch in Ndt80’s regulatory function. We propose that extensive drift in the Ndt80 regulon allowed for the exploration of alternative network structures without a loss of ancestral function, thereby facilitating the formation of a network with a new function. DOI: http://dx.doi.org/10.7554/eLife.23250.001 PMID:28327289

  13. Evolutionary and molecular analysis of Dof transcription factors identified a conserved motif for intercellular protein trafficking.

    PubMed

    Chen, Huan; Ahmad, Munawar; Rim, Yeonggil; Lucas, William J; Kim, Jae-Yean

    2013-06-01

    · Cell-to-cell trafficking of transcription factors (TFs) has been shown to play an important role in the regulation of plant developmental events, but the evolutionary relationship between cell-autonomous and noncell-autonomous (NCA) TFs remains elusive. · AtDof4.1, named INTERCELLULAR TRAFFICKING DOF 1 (ITD1), was chosen as a representative NCA member to explore this evolutionary relationship. Using domain structure-function analyses and swapping studies, we examined the cell-to-cell trafficking of plant-specific Dof TF family members across Arabidopsis and other species. · We identified a conserved intercellular trafficking motif (ITM) that is necessary and sufficient for selective cell-to-cell trafficking and can impart gain-of-function cell-to-cell movement capacity to an otherwise cell-autonomous TF. The functionality of related motifs from Dof members across the plant kingdom extended, surprisingly, to a unicellular alga that lacked plasmodesmata. By contrast, the algal homeodomain related to the NCA KNOX homeodomain was either inefficient or unable to impart such cell-to-cell movement function. · The Dof ITM appears to predate the evolution of selective plasmodesmal trafficking in the plant kingdom, which may well have acted as a molecular template for the evolution of Dof proteins as NCA TFs. However, the ability to efficiently traffic for KNOX homeodomain (HD) proteins may have been acquired during the evolution of early nonvascular plants.

  14. Conservation of transcription factor binding specificities across 600 million years of bilateria evolution

    PubMed Central

    Nitta, Kazuhiro R; Jolma, Arttu; Yin, Yimeng; Morgunova, Ekaterina; Kivioja, Teemu; Akhtar, Junaid; Hens, Korneel; Toivonen, Jarkko; Deplancke, Bart; Furlong, Eileen E M; Taipale, Jussi

    2015-01-01

    Divergent morphology of species has largely been ascribed to genetic differences in the tissue-specific expression of proteins, which could be achieved by divergence in cis-regulatory elements or by altering the binding specificity of transcription factors (TFs). The relative importance of the latter has been difficult to assess, as previous systematic analyses of TF binding specificity have been performed using different methods in different species. To address this, we determined the binding specificities of 242 Drosophila TFs, and compared them to human and mouse data. This analysis revealed that TF binding specificities are highly conserved between Drosophila and mammals, and that for orthologous TFs, the similarity extends even to the level of very subtle dinucleotide binding preferences. The few human TFs with divergent specificities function in cell types not found in fruit flies, suggesting that evolution of TF specificities contributes to emergence of novel types of differentiated cells. DOI: http://dx.doi.org/10.7554/eLife.04837.001 PMID:25779349

  15. The highly conserved MraZ protein is a transcriptional regulator in Escherichia coli

    SciTech Connect

    Eraso, Jesus M.; Markillie, Lye Meng; Mitchell, Hugh D.; Taylor, Ronald C.; Orr, Galya; Margolin, William

    2014-05-05

    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and location at the head of the division and cell wall (dcw) gene cluster. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin, and MraW is known to methylate ribosomal RNA, mraZ and mraW null mutants have no detectable growth phenotype in any species tested to date, hampering progress in understanding their physiological role. Here we show that overproduction of Escherichia coli MraZ perturbs cell division and the cell envelope, is more lethal at high levels or in minimal growth medium, and that MraW antagonizes these effects. MraZGFP localizes to the nucleoid, suggesting that it binds DNA. Indeed, purified MraZ directly binds a region upstream from its own promoter containing three direct repeats to regulate its own expression and that of downstream cell division and cell wall genes. MraZ-LacZ fusions are repressed by excess MraZ but not when DNA binding by MraZ is inhibited. RNAseq analysis indicates that MraZ is a global transcriptional regulator with numerous targets in addition to dcw genes. One of these targets, mioC, is directly bound by MraZ in a region with three direct repeats.

  16. Conserved elements within first intron of aquaporin-5 (Aqp5) function as transcriptional enhancers

    PubMed Central

    Flodby, Per; Zhou, Beiyun; Ann, David K.; Kim, Kwang-Jin; Minoo, Parviz; Crandall, Edward D.; Borok, Zea

    2007-01-01

    A 4.3-kb rat aquaporin-5 (Aqp5) promoter that directs lung and salivary cell-specific expression in vitro directs low level expression of a GFP reporter in lungs of transgenic mice. Alignment of rat, mouse and human AQP5 genomic sequences identified a highly conserved region in the 3′ portion of intron 1, here termed ci1. To investigate the role of ci1 in Aqp5 expression, transient transfections were undertaken in AQP5-expressing mouse lung epithelial (MLE-15) and rat salivary (Pa-4) cells and AQP5-non-expressing NIH/3T3 cells. A 536 bp ci1 fragment enhanced transcriptional activity of the rat Aqp5 minimal promoter specifically in MLE-15 cells in an orientation-independent manner. Enhancer activity was Aqp5 promoter-specific, since no increase in activity was detected with the TK promoter. These results suggest that expression of transgenes in mouse lungs under direction of the 4.3 kb rat Aqp5 promoter may be augmented by inclusion of ci1 in transgenic constructs. PMID:17339032

  17. Surprising flexibility in a conserved Hox transcription factor over 550 million years of evolution

    PubMed Central

    Heffer, Alison; Shultz, Jeffrey W.; Pick, Leslie

    2010-01-01

    Although metazoan body plans are remarkably diverse, the structure and function of many embryonic regulatory genes are conserved because large changes would be detrimental to development. However, the fushi tarazu (ftz) gene has changed dramatically during arthropod evolution from Hox-like to a pair-rule segmentation gene in Drosophila. Changes in both expression and protein sequence contributed to this new function: ftz expression switched from Hox-like to stripes and changes in Ftz cofactor interaction motifs led to loss of homeotic and gain of segmentation potential. Here, we reconstructed ftz changes in a rigorous phylogenetic context. We found that ftz did not simply switch from Hox-like to segmentation function; rather, ftz is remarkably labile, having undergone multiple changes in sequence and expression. The segmentation LXXLL motif was stably acquired in holometabolous insects after the appearance of striped expression in early insect lineages. The homeotic YPWM motif independently degenerated multiple times. These “degen-YPWMs” showed varying degrees of homeotic potential when expressed in Drosophila, suggesting variable loss of Hox function in different arthropods. Finally, the intensity of ftz Hox-like expression decreased to marginal levels in some crustaceans. We propose that decreased expression levels permitted ftz variants to arise and persist in populations without disadvantaging organismal development. This process, in turn, allowed evolutionary transitions in protein function, as weakly expressed “hopeful gene variants” were coopted into alternative developmental pathways. Our findings show that variation of a pleiotropic transcription factor is more extensive than previously imagined, suggesting that evolutionary plasticity may be widespread among regulatory genes. PMID:20921393

  18. Conserved archetypal configuration of the transcriptional control region during the course of BK polyomavirus evolution.

    PubMed

    Yogo, Yoshiaki; Zhong, Shan; Xu, Yawei; Zhu, Mengyun; Chao, Yuegen; Sugimoto, Chie; Ikegaya, Hiroshi; Shibuya, Ayako; Kitamura, Tadaichi

    2008-08-01

    BK polyomavirus (BKV) is widespread among humans, asymptomatically infecting children and then persisting in renal tissue. The transcriptional control region (TCR) of the BKV genome is variable among clinical isolates. Thus, archetypal TCRs with a common basic configuration generally occur in BKV isolates from the urine of immunocompromised patients, but rearranged TCRs that possibly arise from the archetypal configuration have also been detected in clinical specimens. To examine the hypothesis that archetypal strains represent wild-type strains circulating in the human population (the archetype hypothesis), we analysed 145 complete viral genomes amplified directly from the urine of non-immunocompromised individuals worldwide. These genomes included 82, three, two and 58 sequences classified as belonging to subtypes I, II, III and IV, respectively. Rearranged TCRs with long duplications or deletions were detected from two subtype I and two subtype IV genomes, but not from the other 141 genomes (thus, the TCRs of these genomes were judged to be archetypal). The variations in the archetypal TCRs were nucleotide substitutions and single-nucleotide deletions, most of which were unique to particular subtypes or subgroups. We confirmed that the four complete BKV genomes with rearranged TCRs did not form a unique lineage on a phylogenetic tree. Collectively, the findings demonstrate that the archetypal TCR configuration has been conserved during the evolution of BKV, providing support for the archetype hypothesis. Additionally, we suggest that 'archetype' should be used as a conceptual term that denotes a prototypical structure that can generate various rearranged TCRs during viral growth in vivo and in vitro.

  19. A Conserved Transcriptional Regulator Governs Fungal Morphology in Widely Diverged Species

    PubMed Central

    Cain, Christopher W.; Lohse, Matthew B.; Homann, Oliver R.; Sil, Anita; Johnson, Alexander D.

    2012-01-01

    Fungi exhibit a large variety of morphological forms. Here, we examine the functions of a deeply conserved regulator of morphology in three fungal species: Saccharomyces cerevisiae, Candida albicans, and Histoplasma capsulatum. We show that, despite an estimated 600 million years since those species diverged from a common ancestor, Wor1 in C. albicans, Ryp1 in H. capsulatum, and Mit1 in S. cerevisiae are transcriptional regulators that recognize the same DNA sequence. Previous work established that Wor1 regulates white–opaque switching in C. albicans and that its ortholog Ryp1 regulates the yeast to mycelial transition in H. capsulatum. Here we show that the ortholog Mit1 in S. cerevisiae is also a master regulator of a morphological transition, in this case pseudohyphal growth. Full-genome chromatin immunoprecipitation experiments show that Mit1 binds to the control regions of the previously known regulators of pseudohyphal growth as well as those of many additional genes. Through a comparison of binding sites for Mit1 in S. cerevisiae, Wor1 in C. albicans, and Wor1 ectopically expressed in S. cerevisiae, we conclude that the genes controlled by the orthologous regulators overlap only slightly between these two species despite the fact that the DNA binding specificity of the regulators has remained largely unchanged. We suggest that the ancestral Wor1/Mit1/Ryp1 protein controlled aspects of cell morphology and that movement of genes in and out of the Wor1/Mit1/Ryp1 regulon is responsible, in part, for the differences of morphological forms among these species. PMID:22095082

  20. Psychological Well-Being and the Human Conserved Transcriptional Response to Adversity

    PubMed Central

    Fredrickson, Barbara L.; Grewen, Karen M.; Algoe, Sara B.; Firestine, Ann M.; Arevalo, Jesusa M. G.; Ma, Jeffrey; Cole, Steve W.

    2015-01-01

    Research in human social genomics has identified a conserved transcriptional response to adversity (CTRA) characterized by up-regulated expression of pro-inflammatory genes and down-regulated expression of Type I interferon- and antibody-related genes. This report seeks to identify the specific aspects of positive psychological well-being that oppose such effects and predict reduced CTRA gene expression. In a new confirmation study of 122 healthy adults that replicated the approach of a previously reported discovery study, mixed effect linear model analyses identified a significant inverse association between expression of CTRA indicator genes and a summary measure of eudaimonic well-being from the Mental Health Continuum – Short Form. Analyses of a 2- representation of eudaimonia converged in finding correlated psychological and social subdomains of eudaimonic well-being to be the primary carriers of CTRA associations. Hedonic well-being showed no consistent CTRA association independent of eudaimonic well-being, and summary measures integrating hedonic and eudaimonic well-being showed less stable CTRA associations than did focal measures of eudaimonia (psychological and social well-being). Similar results emerged from analyses of pooled discovery and confirmation samples (n = 198). Similar results also emerged from analyses of a second new generalization study of 107 healthy adults that included the more detailed Ryff Scales of Psychological Well-being and found this more robust measure of eudaimonic well-being to also associate with reduced CTRA gene expression. Five of the 6 major sub-domains of psychological well-being predicted reduced CTRA gene expression when analyzed separately, and 3 remained distinctively prognostic in mutually adjusted analyses. All associations were independent of demographic characteristics, health-related confounders, and RNA indicators of leukocyte subset distribution. These results identify specific sub-dimensions of eudaimonic

  1. The Highly Conserved MraZ Protein Is a Transcriptional Regulator in Escherichia coli

    PubMed Central

    Eraso, Jesus M.; Markillie, Lye M.; Mitchell, Hugh D.; Taylor, Ronald C.; Orr, Galya

    2014-01-01

    The mraZ and mraW genes are highly conserved in bacteria, both in sequence and in their position at the head of the division and cell wall (dcw) gene cluster. Located directly upstream of the mraZ gene, the Pmra promoter drives the transcription of mraZ and mraW, as well as many essential cell division and cell wall genes, but no regulator of Pmra has been found to date. Although MraZ has structural similarity to the AbrB transition state regulator and the MazE antitoxin and MraW is known to methylate the 16S rRNA, mraZ and mraW null mutants have no detectable phenotypes. Here we show that overproduction of Escherichia coli MraZ inhibited cell division and was lethal in rich medium at high induction levels and in minimal medium at low induction levels. Co-overproduction of MraW suppressed MraZ toxicity, and loss of MraW enhanced MraZ toxicity, suggesting that MraZ and MraW have antagonistic functions. MraZ-green fluorescent protein localized to the nucleoid, suggesting that it binds DNA. Consistent with this idea, purified MraZ directly bound a region of DNA containing three direct repeats between Pmra and the mraZ gene. Excess MraZ reduced the expression of an mraZ-lacZ reporter, suggesting that MraZ acts as a repressor of Pmra, whereas a DNA-binding mutant form of MraZ failed to repress expression. Transcriptome sequencing (RNA-seq) analysis suggested that MraZ also regulates the expression of genes outside the dcw cluster. In support of this, purified MraZ could directly bind to a putative operator site upstream of mioC, one of the repressed genes identified by RNA-seq. PMID:24659771

  2. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.

    PubMed

    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P

    2015-12-01

    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  3. The many roles of the conserved eukaryotic Paf1 complex in regulating transcription, histone modifications, and disease states

    PubMed Central

    Tomson, Brett N.; Arndt, Karen M.

    2012-01-01

    The Paf1 complex was originally identified over fifteen years ago in budding yeast through its physical association with RNA polymerase II. The Paf1 complex is now known to be conserved throughout eukaryotes and is well studied for promoting RNA polymerase II transcription elongation and transcription-coupled histone modifications. Through these critical regulatory functions, the Paf1 complex participates in numerous cellular processes such as gene expression and silencing, RNA maturation, DNA repair, cell cycle progression and prevention of disease states in higher eukaryotes. In this review, we describe the historic and current research involving the eukaryotic Paf1 complex to explain the cellular roles that underlie its conservation and functional importance. PMID:22982193

  4. The endopeptidase activity and the activation by Cl- of angiotensin-converting enzyme is evolutionarily conserved: purification and properties of an an angiotensin-converting enzyme from the housefly, Musca domestica.

    PubMed Central

    Lamango, N S; Sajid, M; Isaac, R E

    1996-01-01

    A soluble 67 kDa angiotensin-converting enzyme (ACE) has been purified by lisinopril-Sepharose affinity column chromatography from adult houseflies, Musca domestica. The dipeptidyl carboxypeptidase activity towards benzoyl-Gly-His-Leu was inhibited by captopril (IC50 50 nM) and fosinoprilat (IC50 251 nM), two inhibitors of mammalian ACE, and was activated by Cl- (optimal Cl- concentration 600 mM). Musca ACE removed C-terminal dipeptides from angiotensin I, bradykinin [Leu5]enkephalin and [Met5]enkephalin and also functioned as an endopeptidase by hydrolysing dipeptideamides from [Leu5]enkephalinamide and [Met5]enkephalinamide, and a dipeptideamide and a tripeptideamide from substance P. Musca ACE was also able to cleave a tripeptide from both the N-terminus and C-terminus of luteinizing hormone-releasing hormone, with C-terminal hydrolysis predominating. Maximal N-terminal tripeptidase activity occurred at 150 mM NaCl, whereas the C-terminal tripeptidase activity continued to rise with increasing concentration of Cl- (0-0.5 M). Musca ACE displays properties of both the N- and C-domains of human ACE, indicating a high degree of conservation during evolution of the substrate specificity of ACE and its response to Cl-. PMID:8670080

  5. Conserved interaction between distinct Krüppel-associated box domains and the transcriptional intermediary factor 1 β

    PubMed Central

    Abrink, Magnus; Ortiz, José A.; Mark, Charlotta; Sanchez, Cecilia; Looman, Camilla; Hellman, Lars; Chambon, Pierre; Losson, Régine

    2001-01-01

    The Krüppel-associated box (KRAB) domain, originally identified as a 75-aa sequence present in numerous Krüppel-type zinc-finger proteins, is a potent DNA-binding-dependent transcriptional repression domain that is believed to function through interaction with the transcriptional intermediary factor 1 (TIF1) β. On the basis of sequence comparison and phylogenetic analysis, we have recently defined three distinct subfamilies of KRAB domains. In the present study, individual members of each subfamily were tested for transcriptional repression and interaction with TIF1β and two other closely related family members (TIF1α and TIF1γ). All KRAB variants were shown, (i) to repress transcription when targeted to DNA through fusion to a heterologous DNA-binding domain in mammalian cells, and (ii) to interact specifically with TIF1β, but not with TIF1α or TIF1γ. Taken together, these results implicate TIF1β as a common transcriptional corepressor for the three distinct subfamilies of KRAB zinc-finger proteins and suggest a high degree of conservation in the molecular mechanism underlying their transcriptional repression activity. PMID:11171966

  6. Conserved rates and patterns of transcription errors across bacterial growth states and lifestyles

    PubMed Central

    Traverse, Charles C.; Ochman, Howard

    2016-01-01

    Errors that occur during transcription have received much less attention than the mutations that occur in DNA because transcription errors are not heritable and usually result in a very limited number of altered proteins. However, transcription error rates are typically several orders of magnitude higher than the mutation rate. Also, individual transcripts can be translated multiple times, so a single error can have substantial effects on the pool of proteins. Transcription errors can also contribute to cellular noise, thereby influencing cell survival under stressful conditions, such as starvation or antibiotic stress. Implementing a method that captures transcription errors genome-wide, we measured the rates and spectra of transcription errors in Escherichia coli and in endosymbionts for which mutation and/or substitution rates are greatly elevated over those of E. coli. Under all tested conditions, across all species, and even for different categories of RNA sequences (mRNA and rRNAs), there were no significant differences in rates of transcription errors, which ranged from 2.3 × 10−5 per nucleotide in mRNA of the endosymbiont Buchnera aphidicola to 5.2 × 10−5 per nucleotide in rRNA of the endosymbiont Carsonella ruddii. The similarity of transcription error rates in these bacterial endosymbionts to that in E. coli (4.63 × 10−5 per nucleotide) is all the more surprising given that genomic erosion has resulted in the loss of transcription fidelity factors in both Buchnera and Carsonella. PMID:26884158

  7. Evolutionarily Conserved Regulatory Mechanisms of Abscisic Acid Signaling in Land Plants: Characterization of ABSCISIC ACID INSENSITIVE1-Like Type 2C Protein Phosphatase in the Liverwort Marchantia polymorpha1[C][OA

    PubMed Central

    Tougane, Ken; Komatsu, Kenji; Bhyan, Salma Begum; Sakata, Yoichi; Ishizaki, Kimitsune; Yamato, Katsuyuki T.; Kohchi, Takayuki; Takezawa, Daisuke

    2010-01-01

    Abscisic acid (ABA) is postulated to be a ubiquitous hormone that plays a central role in seed development and responses to environmental stresses of vascular plants. However, in liverworts (Marchantiophyta), which represent the oldest extant lineage of land plants, the role of ABA has been least emphasized; thus, very little information is available on the molecular mechanisms underlying ABA responses. In this study, we isolated and characterized MpABI1, an ortholog of ABSCISIC ACID INSENSITIVE1 (ABI1), from the liverwort Marchantia polymorpha. The MpABI1 cDNA encoded a 568-amino acid protein consisting of the carboxy-terminal protein phosphatase 2C (PP2C) domain and a novel amino-terminal regulatory domain. The MpABI1 transcript was detected in the gametophyte, and its expression level was increased by exogenous ABA treatment in the gemma, whose growth was strongly inhibited by ABA. Experiments using green fluorescent protein fusion constructs indicated that MpABI1 was mainly localized in the nucleus and that its nuclear localization was directed by the amino-terminal domain. Transient overexpression of MpABI1 in M. polymorpha and Physcomitrella patens cells resulted in suppression of ABA-induced expression of the wheat Em promoter fused to the β -glucuronidase gene. Transgenic P. patens expressing MpABI1 and its mutant construct, MpABI1-d2, lacking the amino-terminal domain, had reduced freezing and osmotic stress tolerance, and associated with reduced accumulation of ABA-induced late embryogenesis abundant-like boiling-soluble proteins. Furthermore, ABA-induced morphological changes leading to brood cells were not prominent in these transgenic plants. These results suggest that MpABI1 is a negative regulator of ABA signaling, providing unequivocal molecular evidence of PP2C-mediated ABA response mechanisms functioning in liverworts. PMID:20097789

  8. Comparative Analysis of P450 Signature Motifs EXXR and CXG in the Large and Diverse Kingdom of Fungi: Identification of Evolutionarily Conserved Amino Acid Patterns Characteristic of P450 Family

    PubMed Central

    Syed, Khajamohiddin; Mashele, Samson Sitheni

    2014-01-01

    Cytochrome P450 monooxygenases (P450s) are heme-thiolate proteins distributed across the biological kingdoms. P450s are catalytically versatile and play key roles in organisms primary and secondary metabolism. Identification of P450s across the biological kingdoms depends largely on the identification of two P450 signature motifs, EXXR and CXG, in the protein sequence. Once a putative protein has been identified as P450, it will be assigned to a family and subfamily based on the criteria that P450s within a family share more than 40% homology and members of subfamilies share more than 55% homology. However, to date, no evidence has been presented that can distinguish members of a P450 family. Here, for the first time we report the identification of EXXR- and CXG-motifs-based amino acid patterns that are characteristic of the P450 family. Analysis of P450 signature motifs in the under-explored fungal P450s from four different phyla, ascomycota, basidiomycota, zygomycota and chytridiomycota, indicated that the EXXR motif is highly variable and the CXG motif is somewhat variable. The amino acids threonine and leucine are preferred as second and third amino acids in the EXXR motif and proline and glycine are preferred as second and third amino acids in the CXG motif in fungal P450s. Analysis of 67 P450 families from biological kingdoms such as plants, animals, bacteria and fungi showed conservation of a set of amino acid patterns characteristic of a particular P450 family in EXXR and CXG motifs. This suggests that during the divergence of P450 families from a common ancestor these amino acids patterns evolve and are retained in each P450 family as a signature of that family. The role of amino acid patterns characteristic of a P450 family in the structural and/or functional aspects of members of the P450 family is a topic for future research. PMID:24743800

  9. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes.

    PubMed

    Uhl, Juli D; Zandvakili, Arya; Gebelein, Brian

    2016-04-01

    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints.

  10. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes

    PubMed Central

    Uhl, Juli D.; Zandvakili, Arya; Gebelein, Brian

    2016-01-01

    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints. PMID:27058369

  11. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  12. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  13. Evolutionary conserved mechanisms pervade structure and transcriptional modulation of allograft inflammatory factor-1 from sea anemone Anemonia viridis.

    PubMed

    Cuttitta, Angela; Ragusa, Maria Antonietta; Costa, Salvatore; Bennici, Carmelo; Colombo, Paolo; Mazzola, Salvatore; Gianguzza, Fabrizio; Nicosia, Aldo

    2017-08-01

    Gene family encoding allograft inflammatory factor-1 (AIF-1) is well conserved among organisms; however, there is limited knowledge in lower organisms. In this study, the first AIF-1 homologue from cnidarians was identified and characterised in the sea anemone Anemonia viridis. The full-length cDNA of AvAIF-1 was of 913 bp with a 5' -untranslated region (UTR) of 148 bp, a 3'-UTR of 315 and an open reading frame (ORF) of 450 bp encoding a polypeptide with149 amino acid residues and predicted molecular weight of about 17 kDa. The predicted protein possesses evolutionary conserved EF hand Ca(2+) binding motifs, post-transcriptional modification sites and a 3D structure which can be superimposed with human members of AIF-1 family. The AvAIF-1 transcript was constitutively expressed in all tested tissues of unchallenged sea anemone, suggesting that AvAIF-1 could serve as a general protective factor under normal physiological conditions. Moreover, we profiled the transcriptional activation of AvAIF-1 after challenges with different abiotic/biotic stresses showing induction by warming conditions, heavy metals exposure and immune stimulation. Thus, mechanisms associated to inflammation and immune challenges up-regulated AvAIF-1 mRNA levels. Our results suggest its involvement in the inflammatory processes and immune response of A. viridis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Conserved sequence-specific lincRNA-steroid receptor interactions drive transcriptional repression and direct cell fate

    SciTech Connect

    Hudson, William H.; Pickard, Mark R.; de Vera, Ian Mitchelle S.; Kuiper, Emily G.; Mourtada-Maarabouni, Mirna; Conn, Graeme L.; Kojetin, Douglas J.; Williams, Gwyn T.; Ortlund, Eric A.

    2014-12-23

    The majority of the eukaryotic genome is transcribed, generating a significant number of long intergenic noncoding RNAs (lincRNAs). Although lincRNAs represent the most poorly understood product of transcription, recent work has shown lincRNAs fulfill important cellular functions. In addition to low sequence conservation, poor understanding of structural mechanisms driving lincRNA biology hinders systematic prediction of their function. Here we report the molecular requirements for the recognition of steroid receptors (SRs) by the lincRNA growth arrest-specific 5 (Gas5), which regulates steroid-mediated transcriptional regulation, growth arrest and apoptosis. We identify the functional Gas5-SR interface and generate point mutations that ablate the SR-Gas5 lincRNA interaction, altering Gas5-driven apoptosis in cancer cell lines. Further, we find that the Gas5 SR-recognition sequence is conserved among haplorhines, with its evolutionary origin as a splice acceptor site. This study demonstrates that lincRNAs can recognize protein targets in a conserved, sequence-specific manner in order to affect critical cell functions.

  15. Structural and functional conservation of CLEC-2 with the species-specific regulation of transcript expression in evolution.

    PubMed

    Wang, Lan; Ren, Shifang; Zhu, Haiyan; Zhang, Dongmei; Hao, Yuqing; Ruan, Yuanyuan; Zhou, Lei; Lee, Chiayu; Qiu, Lin; Yun, Xiaojing; Xie, Jianhui

    2012-08-01

    CLEC-2 was first identified by sequence similarity to C-type lectin-like molecules with immune functions and has been reported as a receptor for the platelet-aggregating snake venom toxin rhodocytin and the endogenous sialoglycoprotein podoplanin. Recent researches indicate that CLEC-2-deficient mice were lethal at the embryonic stage associated with disorganized and blood-filled lymphatic vessels and severe edema. In view of a necessary role of CLEC-2 in the individual development, it is of interest to investigate its phylogenetic homology and highly conserved functional regions. In this work, we reported that CLEC-2 from different species holds with an extraordinary conservation by sequence alignment and phylogenetic tree analysis. The functional structures including N-linked oligosaccharide sites and ligand-binding domain implement a structural and functional conservation in a variety of species. The glycosylation sites (N120 and N134) are necessary for the surface expression CLEC-2. CLEC-2 from different species possesses the binding activity of mouse podoplanin. Nevertheless, the expression of CLEC-2 is regulated with a species-specific manner. The alternative splicing of pre-mRNA, a regulatory mechanism of gene expression, and the binding sites on promoter for several key transcription factors vary between different species. Therefore, CLEC-2 shares high sequence homology and functional identity. However the transcript expression might be tightly regulated by different mechanisms in evolution.

  16. Indole: An evolutionarily conserved influencer of behavior across kingdoms.

    PubMed

    Tomberlin, Jeffery K; Crippen, Tawni L; Wu, Guoyao; Griffin, Ashleigh S; Wood, Thomas K; Kilner, Rebecca M

    2017-02-01

    Indole is a key environmental cue that is used by many organisms. Based on its biochemistry, we suggest indole is used so universally, and by such different organisms, because it derives from the metabolism of tryptophan, a resource essential for many species yet rare in nature. These properties make it a valuable, environmental cue for resources almost universally important for promoting fitness. We then describe how indole is used to coordinate actions within organisms, to influence the behavior of conspecifics and can even be used to change the behavior of species that belong to other kingdoms. Drawing on the evolutionary framework that has been developed for understanding animal communication, we show how this is diversely achieved by indole acting as a cue, a manipulative signal, and an honest signal, as well as how indole can be used synergistically to amplify information conveyed by other molecules. Clarifying these distinct functions of indole identifies patterns that transcend different kingdoms of organisms. © 2016 WILEY Periodicals, Inc.

  17. Indole: An evolutionarily conserved influencer of behavior across kingdoms

    USDA-ARS?s Scientific Manuscript database

    Indole, which is produced from the breakdown of the essential amino acid tryptophan, is a key environmental cue that is used by many organisms. But why is its use so ubiquitous, and how does it function to modulate interactions among such diverse organisms? Here, we review the literature to addres...

  18. The basic helix-loop-helix leucine zipper transcription factor Mitf is conserved in Drosophila and functions in eye development.

    PubMed Central

    Hallsson, Jón H; Haflidadóttir, Benedikta S; Stivers, Chad; Odenwald, Ward; Arnheiter, Heinz; Pignoni, Francesca; Steingrímsson, Eiríkur

    2004-01-01

    The MITF protein is a member of the MYC family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors and is most closely related to the TFE3, TFEC, and TFEB proteins. In the mouse, MITF is required for the development of several different cell types, including the retinal pigment epithelial (RPE) cells of the eye. In Mitf mutant mice, the presumptive RPE cells hyperproliferate, abnormally express the retinal transcriptional regulator Pax6, and form an ectopic neural retina. Here we report the structure of the Mitf gene in Drosophila and demonstrate expression during embryonic development and in the eye-antennal imaginal disc. In vitro, transcriptional regulation by Drosophila Mitf, like its mouse counterpart, is modified by the Eyeless (Drosophila Pax6) transcription factor. In vivo, targeted expression of wild-type or dominant-negative Drosophila Mitf results in developmental abnormalities reminiscent of Mitf function in mouse eye development. Our results suggest that the Mitf gene is the original member of the Mitf-Tfe subfamily of bHLH-Zip proteins and that its developmental function is at least partially conserved between vertebrates and invertebrates. These findings further support the common origin of the vertebrate and invertebrate eyes. PMID:15166150

  19. Amphibian interorder nuclear transfer embryos reveal conserved embryonic gene transcription, but deficient DNA replication or chromosome segregation.

    PubMed

    Narbonne, Patrick; Gurdon, John B

    2012-01-01

    Early interspecies nuclear transfer (iNT) experiments suggested that a foreign nucleus may become permanently damaged after a few rounds of cell division in the cytoplasm of another species. That is, in some distant species combinations, nucleocytoplasmic hybrid (cybrid) blastula nuclei can no longer support development, even if they are back-transferred into their own kind of egg cytoplasm. We monitored foreign DNA amplification and RNA production by quantitative PCR (qPCR) and RT-qPCR in interorder amphibian hybrids and cybrids formed by the transfer of newt (Pleurodeles waltl) embryonic nuclei into intact and enucleated frog (Xenopus laevis) eggs. We found a dramatic reduction in the expansion of foreign DNA and cell numbers in developing cybrid embryos that correlated with reduced gene transcription. Interestingly, expansion in cell numbers was rescued by the recipient species (Xenopus) maternal genome in iNT hybrids, but it did not improve P. waltl DNA expansion or gene transcription. Also, foreign gene transcripts, normalized to DNA copy numbers, were mostly normal in both iNT hybrids and cybrids. Thus, incomplete foreign DNA replication and/or chromosome segregation during cell division may be the major form of nuclear damage occurring as a result of nuclear replication in a foreign cytoplasmic environment. It also shows that the mechanisms of embryonic gene transcription are highly conserved across amphibians and may not be a major cause of cybrid lethality.

  20. Identification and Characterization of Elf1, a Conserved Transcription Elongation Factor in Saccharomyces cerevisiae

    PubMed Central

    Prather, Donald; Krogan, Nevan J.; Emili, Andrew; Greenblatt, Jack F.; Winston, Fred

    2005-01-01

    In order to identify previously unknown transcription elongation factors, a genetic screen was carried out to identify mutations that cause lethality when combined with mutations in the genes encoding the elongation factors TFIIS and Spt6. This screen identified a mutation in YKL160W, hereafter named ELF1 (elongation factor 1). Further analysis identified synthetic lethality between an elf1Δ mutation and mutations in genes encoding several known elongation factors, including Spt4, Spt5, Spt6, and members of the Paf1 complex. Genome-wide synthetic lethality studies confirmed that elf1Δ specifically interacts with mutations in genes affecting transcription elongation. Chromatin immunoprecipitation experiments show that Elf1 is cotranscriptionally recruited over actively transcribed regions and that this association is partially dependent on Spt4 and Spt6. Analysis of elf1Δ mutants suggests a role for this factor in maintaining proper chromatin structure in regions of active transcription. Finally, purification of Elf1 suggests an association with casein kinase II, previously implicated in roles in transcription. Together, these results suggest an important role for Elf1 in the regulation of transcription elongation. PMID:16260625

  1. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  2. Conserved miRNAs Are Candidate Post-Transcriptional Regulators of Developmental Arrest in Free-Living and Parasitic Nematodes

    PubMed Central

    Ahmed, Rina; Chang, Zisong; Younis, Abuelhassan Elshazly; Langnick, Claudia; Li, Na; Chen, Wei; Brattig, Norbert; Dieterich, Christoph

    2013-01-01

    Animal development is complex yet surprisingly robust. Animals may develop alternative phenotypes conditional on environmental changes. Under unfavorable conditions, Caenorhabditis elegans larvae enter the dauer stage, a developmentally arrested, long-lived, and stress-resistant state. Dauer larvae of free-living nematodes and infective larvae of parasitic nematodes share many traits including a conserved endocrine signaling module (DA/DAF-12), which is essential for the formation of dauer and infective larvae. We speculated that conserved post-transcriptional regulatory mechanism might also be involved in executing the dauer and infective larvae fate. We used an unbiased sequencing strategy to characterize the microRNA (miRNA) gene complement in C. elegans, Pristionchus pacificus, and Strongyloides ratti. Our study raised the number of described miRNA genes to 257 for C. elegans, tripled the known gene set for P. pacificus to 362 miRNAs, and is the first to describe miRNAs in a Strongyloides parasite. Moreover, we found a limited core set of 24 conserved miRNA families in all three species. Interestingly, our estimated expression fold changes between dauer versus nondauer stages and infective larvae versus free-living stages reveal that despite the speed of miRNA gene set evolution in nematodes, homologous gene families with conserved “dauer-infective” expression signatures are present. These findings suggest that common post-transcriptional regulatory mechanisms are at work and that the same miRNA families play important roles in developmental arrest and long-term survival in free-living and parasitic nematodes. PMID:23729632

  3. A Conserved Structural Module Regulates Transcriptional Responses to Diverse Stress Signals in Bacteria

    PubMed Central

    Campbell, Elizabeth A.; Greenwell, Roger; Anthony, Jennifer R.; Wang, Sheng; Lim, Lionel; Das, Kalyan; Sofia, Heidi J.; Donohue, Timothy J.; Darst, Seth A.

    2008-01-01

    SUMMARY A transcriptional response to singlet oxygen in Rhodobacter sphaeroides is controlled by the group IV σ factor σE and its cognate anti-σ ChrR. Crystal structures of the σE/ChrR complex reveal a modular, two-domain architecture for ChrR. The ChrR N-terminal anti-σ domain (ASD) binds a Zn2+ ion, contacts σE, and is sufficient to inhibit σE-dependent transcription. The ChrR C-terminal domain adopts a cupin fold, can coordinate an additional Zn2+, and is required for the transcriptional response to singlet oxygen. Structure-based sequence analyses predict that the ASD defines a common structural fold among predicted group IV antiσs. These ASDs are fused to diverse C-terminal domains that are likely involved in responding to specific environmental signals that control the activity of their cognate σ factor. PMID:17803943

  4. Studying the functional conservation of cis-regulatory modules and their transcriptional output.

    PubMed

    Bauer, Denis C; Bailey, Timothy L

    2008-04-29

    Cis-regulatory modules (CRMs) are distinct, genomic regions surrounding the target gene that can independently activate the promoter to drive transcription. The activation of a CRM is controlled by the binding of a certain combination of transcription factors (TFs). It would be of great benefit if the transcriptional output mediated by a specific CRM could be predicted. Of equal benefit would be identifying in silico a specific CRM as the driver of the expression in a specific tissue or situation. We extend a recently developed biochemical modeling approach to manage both prediction tasks. Given a set of TFs, their protein concentrations, and the positions and binding strengths of each of the TFs in a putative CRM, the model predicts the transcriptional output of the gene. Our approach predicts the location of the regulating CRM by using predicted TF binding sites in regions near the gene as input to the model and searching for the region that yields a predicted transcription rate most closely matching the known rate. Here we show the ability of the model on the example of one of the CRMs regulating the eve gene, MSE2. A model trained on the MSE2 in D. melanogaster was applied to the surrounding sequence of the eve gene in seven other Drosophila species. The model successfully predicts the correct MSE2 location and output in six out of eight Drosophila species we examine. The model is able to generalize from D. melanogaster to other Drosophila species and accurately predicts the location and transcriptional output of MSE2 in those species. However, we also show that the current model is not specific enough to function as a genome-wide CRM scanner, because it incorrectly predicts other genomic regions to be MSE2s.

  5. Rethinking transcription coupled DNA repair.

    PubMed

    Kamarthapu, Venu; Nudler, Evgeny

    2015-04-01

    Nucleotide excision repair (NER) is an evolutionarily conserved, multistep process that can detect a wide variety of DNA lesions. Transcription coupled repair (TCR) is a subpathway of NER that repairs the transcribed DNA strand faster than the rest of the genome. RNA polymerase (RNAP) stalled at DNA lesions mediates the recruitment of NER enzymes to the damage site. In this review we focus on a newly identified bacterial TCR pathway in which the NER enzyme UvrD, in conjunction with NusA, plays a major role in initiating the repair process. We discuss the tradeoff between the new and conventional models of TCR, how and when each pathway operates to repair DNA damage, and the necessity of pervasive transcription in maintaining genome integrity. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Computational identification of conserved transcription factor binding sites upstream of genes induced in rat brain by transient focal ischemic stroke.

    PubMed

    Pulliam, John V K; Xu, Zhenfeng; Ford, Gregory D; Liu, Cuimei; Li, Yonggang; Stovall, Kyndra C; Cannon, Virginetta S; Tewolde, Teclemichael; Moreno, Carlos S; Ford, Byron D

    2013-02-07

    Microarray analysis has been used to understand how gene regulation plays a critical role in neuronal injury, survival and repair following ischemic stroke. To identify the transcriptional regulatory elements responsible for ischemia-induced gene expression, we examined gene expression profiles of rat brains following focal ischemia and performed computational analysis of consensus transcription factor binding sites (TFBS) in the genes of the dataset. In this study, rats were sacrificed 24 h after middle cerebral artery occlusion (MCAO) stroke and gene transcription in brain tissues following ischemia/reperfusion was examined using Affymetrix GeneChip technology. The CONserved transcription FACtor binding site (CONFAC) software package was used to identify over-represented TFBS in the upstream promoter regions of ischemia-induced genes compared to control datasets. CONFAC identified 12 TFBS that were statistically over-represented from our dataset of ischemia-induced genes, including three members of the Ets-1 family of transcription factors (TFs). Microarray results showed that mRNA for Ets-1 was increased following tMCAO but not pMCAO. Immunohistochemical analysis of Ets-1 protein in rat brains following MCAO showed that Ets-1 was highly expressed in neurons in the brain of sham control animals. Ets-1 protein expression was virtually abolished in injured neurons of the ischemic brain but was unchanged in peri-infarct brain areas. These data indicate that TFs, including Ets-1, may influence neuronal injury following ischemia. These findings could provide important insights into the mechanisms that lead to brain injury and could provide avenues for the development of novel therapies. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Evolutionary conservation of otd/Otx2 transcription factor action: a genome-wide microarray analysis in Drosophila

    PubMed Central

    Montalta-He, Haiqiong; Leemans, Ronny; Loop, Thomas; Strahm, Martin; Certa, Ulrich; Primig, Michael; Acampora, Dario; Simeone, Antonio; Reichert, Heinrich

    2002-01-01

    Background Homeobox genes of the orthodenticle (otd)/Otx family have conserved roles in the embryogenesis of head and brain. Gene replacement experiments show that the Drosophila otd gene and orthologous mammalian Otx genes are functionally equivalent, in that overexpression of either gene in null mutants of Drosophila or mouse can restore defects in cephalic and brain development. This suggests that otd and Otx genes control a comparable subset of downstream target genes in either organism. Here we use quantitative transcript imaging to analyze this equivalence of otd and Otx gene action at a genomic level. Results Oligonucleotide arrays representing 13,400 annotated Drosophila genes were used to study differential gene expression in flies in which either the Drosophila otd gene or the human Otx2 gene was overexpressed. Two hundred and eighty-seven identified transcripts showed highly significant changes in expression levels in response to otd overexpression, and 682 identified transcripts showed highly significant changes in expression levels in response to Otx2 overexpression. Among these, 93 showed differential expression changes following overexpression of either otd or Otx2, and for 90 of these, comparable changes were observed under both experimental conditions. We postulate that these transcripts are common downstream targets of the fly otd gene and the human Otx2 gene in Drosophila. Conclusion Our experiments indicate that approximately one third of the otd-regulated transcripts also respond to overexpression of the human Otx2 gene in Drosophila. These common otd/Otx2 downstream genes are likely to represent the molecular basis of the functional equivalence of otd and Otx2 gene action in Drosophila. PMID:11983056

  8. Identification of conserved core xylem gene sets: conifer cDNA microarray development, transcript profiling and computational analyses.

    PubMed

    Pavy, Nathalie; Boyle, Brian; Nelson, Colleen; Paule, Charles; Giguère, Isabelle; Caron, Sébastien; Parsons, Lee S; Dallaire, Nancy; Bedon, Frank; Bérubé, Hugo; Cooke, Janice; Mackay, John

    2008-01-01

    One approach for investigating the molecular basis of wood formation is to integrate microarray profiling data sets and sequence analyses, comparing tree species with model plants such as Arabidopsis. Conifers may be included in comparative studies thanks to large-scale expressed sequence tag (EST) analyses, which enable the development of cDNA microarrays with very significant genome coverage. A microarray of 10,400 low-redundancy sequences was designed starting from white spruce (Picea glauca (Moench.) Voss) cDNAs. Computational procedures that were developed to ensure broad transcriptome coverage and efficient PCR amplification were used to select cDNA clones, which were re-sequenced in the microarray manufacture process. White spruce transcript profiling experiments that compared secondary xylem to phloem and needles identified 360 xylem-preferential gene sequences. The functional annotations of all differentially expressed sequences were highly consistent with the results of similar analyses carried out in angiosperm trees and herbaceous plants. Computational analyses comparing the spruce microarray sequences and core xylem gene sets from Arabidopsis identified 31 transcripts that were highly conserved in angiosperms and gymnosperms, in terms of both sequence and xylem expression. Several other spruce sequences have not previously been linked to xylem differentiation (including genes encoding TUBBY-like domain proteins (TLPs) and a gibberellin insensitive (gai) gene sequence) or were shown to encode proteins of unknown function encompassing diverse conserved domains of unknown function.

  9. Phosphorylation of the Conserved Transcription Factor ATF-7 by PMK-1 p38 MAPK Regulates Innate Immunity in Caenorhabditis elegans

    PubMed Central

    Kooistra, Tristan; Richardson, Claire E.; Reddy, Kirthi C.; Whitney, Janelle K.; Kamanzi, Odile; Matsumoto, Kunihiro; Hisamoto, Naoki; Kim, Dennis H.

    2010-01-01

    Innate immunity in Caenorhabditis elegans requires a conserved PMK-1 p38 mitogen-activated protein kinase (MAPK) pathway that regulates the basal and pathogen-induced expression of immune effectors. The mechanisms by which PMK-1 p38 MAPK regulates the transcriptional activation of the C. elegans immune response have not been identified. Furthermore, in mammalian systems the genetic analysis of physiological targets of p38 MAPK in immunity has been limited. Here, we show that C. elegans ATF-7, a member of the conserved cyclic AMP–responsive element binding (CREB)/activating transcription factor (ATF) family of basic-region leucine zipper (bZIP) transcription factors and an ortholog of mammalian ATF2/ATF7, has a pivotal role in the regulation of PMK-1–mediated innate immunity. Genetic analysis of loss-of-function alleles and a gain-of-function allele of atf-7, combined with expression analysis of PMK-1–regulated genes and biochemical characterization of the interaction between ATF-7 and PMK-1, suggest that ATF-7 functions as a repressor of PMK-1–regulated genes that undergoes a switch to an activator upon phosphorylation by PMK-1. Whereas loss-of-function mutations in atf-7 can restore basal expression of PMK-1–regulated genes observed in the pmk-1 null mutant, the induction of PMK-1–regulated genes by pathogenic Pseudomonas aeruginosa PA14 is abrogated. The switching modes of ATF-7 activity, from repressor to activator in response to activated PMK-1 p38 MAPK, are reminiscent of the mechanism of regulation mediated by the corresponding ancestral Sko1p and Hog1p proteins in the yeast response to osmotic stress. Our data point to the regulation of the ATF2/ATF7/CREB5 family of transcriptional regulators by p38 MAPK as an ancient conserved mechanism for the control of innate immunity in metazoans, and suggest that ATF2/ATF7 may function in a similar manner in the regulation of mammalian innate immunity. PMID:20369020

  10. Phosphorylation of the conserved transcription factor ATF-7 by PMK-1 p38 MAPK regulates innate immunity in Caenorhabditis elegans.

    PubMed

    Shivers, Robert P; Pagano, Daniel J; Kooistra, Tristan; Richardson, Claire E; Reddy, Kirthi C; Whitney, Janelle K; Kamanzi, Odile; Matsumoto, Kunihiro; Hisamoto, Naoki; Kim, Dennis H

    2010-04-01

    Innate immunity in Caenorhabditis elegans requires a conserved PMK-1 p38 mitogen-activated protein kinase (MAPK) pathway that regulates the basal and pathogen-induced expression of immune effectors. The mechanisms by which PMK-1 p38 MAPK regulates the transcriptional activation of the C. elegans immune response have not been identified. Furthermore, in mammalian systems the genetic analysis of physiological targets of p38 MAPK in immunity has been limited. Here, we show that C. elegans ATF-7, a member of the conserved cyclic AMP-responsive element binding (CREB)/activating transcription factor (ATF) family of basic-region leucine zipper (bZIP) transcription factors and an ortholog of mammalian ATF2/ATF7, has a pivotal role in the regulation of PMK-1-mediated innate immunity. Genetic analysis of loss-of-function alleles and a gain-of-function allele of atf-7, combined with expression analysis of PMK-1-regulated genes and biochemical characterization of the interaction between ATF-7 and PMK-1, suggest that ATF-7 functions as a repressor of PMK-1-regulated genes that undergoes a switch to an activator upon phosphorylation by PMK-1. Whereas loss-of-function mutations in atf-7 can restore basal expression of PMK-1-regulated genes observed in the pmk-1 null mutant, the induction of PMK-1-regulated genes by pathogenic Pseudomonas aeruginosa PA14 is abrogated. The switching modes of ATF-7 activity, from repressor to activator in response to activated PMK-1 p38 MAPK, are reminiscent of the mechanism of regulation mediated by the corresponding ancestral Sko1p and Hog1p proteins in the yeast response to osmotic stress. Our data point to the regulation of the ATF2/ATF7/CREB5 family of transcriptional regulators by p38 MAPK as an ancient conserved mechanism for the control of innate immunity in metazoans, and suggest that ATF2/ATF7 may function in a similar manner in the regulation of mammalian innate immunity.

  11. uPEPperoni: an online tool for upstream open reading frame location and analysis of transcript conservation.

    PubMed

    Skarshewski, Adam; Stanton-Cook, Mitchell; Huber, Thomas; Al Mansoori, Sumaya; Smith, Ross; Beatson, Scott A; Rothnagel, Joseph A

    2014-02-01

    Several small open reading frames located within the 5' untranslated regions of mRNAs have recently been shown to be translated. In humans, about 50% of mRNAs contain at least one upstream open reading frame representing a large resource of coding potential. We propose that some upstream open reading frames encode peptides that are functional and contribute to proteome complexity in humans and other organisms. We use the term uPEPs to describe peptides encoded by upstream open reading frames. We have developed an online tool, termed uPEPperoni, to facilitate the identification of putative bioactive peptides. uPEPperoni detects conserved upstream open reading frames in eukaryotic transcripts by comparing query nucleotide sequences against mRNA sequences within the NCBI RefSeq database. The algorithm first locates the main coding sequence and then searches for open reading frames 5' to the main start codon which are subsequently analysed for conservation. uPEPperoni also determines the substitution frequency for both the upstream open reading frames and the main coding sequence. In addition, the uPEPperoni tool produces sequence identity heatmaps which allow rapid visual inspection of conserved regions in paired mRNAs. uPEPperoni features user-nominated settings including, nucleotide match/mismatch, gap penalties, Ka/Ks ratios and output mode. The heatmap output shows levels of identity between any two sequences and provides easy recognition of conserved regions. Furthermore, this web tool allows comparison of evolutionary pressures acting on the upstream open reading frame against other regions of the mRNA. Additionally, the heatmap web applet can also be used to visualise the degree of conservation in any pair of sequences. uPEPperoni is freely available on an interactive web server at http://upep-scmb.biosci.uq.edu.au.

  12. Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone

    PubMed Central

    Melia, Tisha; Hao, Pengying; Yilmaz, Feyza

    2015-01-01

    Long intergenic noncoding RNAs (lincRNAs) are increasingly recognized as key chromatin regulators, yet few studies have characterized lincRNAs in a single tissue under diverse conditions. Here, we analyzed 45 mouse liver RNA sequencing (RNA-Seq) data sets collected under diverse conditions to systematically characterize 4,961 liver lincRNAs, 59% of them novel, with regard to gene structures, species conservation, chromatin accessibility, transcription factor binding, and epigenetic states. To investigate the potential for functionality, we focused on the responses of the liver lincRNAs to growth hormone stimulation, which imparts clinically relevant sex differences to hepatic metabolism and liver disease susceptibility. Sex-biased expression characterized 247 liver lincRNAs, with many being nuclear RNA enriched and regulated by growth hormone. The sex-biased lincRNA genes are enriched for nearby and correspondingly sex-biased accessible chromatin regions, as well as sex-biased binding sites for growth hormone-regulated transcriptional activators (STAT5, hepatocyte nuclear factor 6 [HNF6], FOXA1, and FOXA2) and transcriptional repressors (CUX2 and BCL6). Repression of female-specific lincRNAs in male liver, but not that of male-specific lincRNAs in female liver, was associated with enrichment of H3K27me3-associated inactive states and poised (bivalent) enhancer states. Strikingly, we found that liver-specific lincRNA gene promoters are more highly species conserved and have a significantly higher frequency of proximal binding by liver transcription factors than liver-specific protein-coding gene promoters. Orthologs for many liver lincRNAs were identified in one or more supraprimates, including two rat lincRNAs showing the same growth hormone-regulated, sex-biased expression as their mouse counterparts. This integrative analysis of liver lincRNA chromatin states, transcription factor occupancy, and growth hormone regulation provides novel insights into the

  13. Hepatic Long Intergenic Noncoding RNAs: High Promoter Conservation and Dynamic, Sex-Dependent Transcriptional Regulation by Growth Hormone.

    PubMed

    Melia, Tisha; Hao, Pengying; Yilmaz, Feyza; Waxman, David J

    2016-01-01

    Long intergenic noncoding RNAs (lincRNAs) are increasingly recognized as key chromatin regulators, yet few studies have characterized lincRNAs in a single tissue under diverse conditions. Here, we analyzed 45 mouse liver RNA sequencing (RNA-Seq) data sets collected under diverse conditions to systematically characterize 4,961 liver lincRNAs, 59% of them novel, with regard to gene structures, species conservation, chromatin accessibility, transcription factor binding, and epigenetic states. To investigate the potential for functionality, we focused on the responses of the liver lincRNAs to growth hormone stimulation, which imparts clinically relevant sex differences to hepatic metabolism and liver disease susceptibility. Sex-biased expression characterized 247 liver lincRNAs, with many being nuclear RNA enriched and regulated by growth hormone. The sex-biased lincRNA genes are enriched for nearby and correspondingly sex-biased accessible chromatin regions, as well as sex-biased binding sites for growth hormone-regulated transcriptional activators (STAT5, hepatocyte nuclear factor 6 [HNF6], FOXA1, and FOXA2) and transcriptional repressors (CUX2 and BCL6). Repression of female-specific lincRNAs in male liver, but not that of male-specific lincRNAs in female liver, was associated with enrichment of H3K27me3-associated inactive states and poised (bivalent) enhancer states. Strikingly, we found that liver-specific lincRNA gene promoters are more highly species conserved and have a significantly higher frequency of proximal binding by liver transcription factors than liver-specific protein-coding gene promoters. Orthologs for many liver lincRNAs were identified in one or more supraprimates, including two rat lincRNAs showing the same growth hormone-regulated, sex-biased expression as their mouse counterparts. This integrative analysis of liver lincRNA chromatin states, transcription factor occupancy, and growth hormone regulation provides novel insights into the

  14. A Conserved Transcript Pattern in Response to a Specialist and a Generalist HerbivoreW⃞

    PubMed Central

    Reymond, Philippe; Bodenhausen, Natacha; Van Poecke, Remco M.P.; Krishnamurthy, Venkatesh; Dicke, Marcel; Farmer, Edward E.

    2004-01-01

    Transcript patterns elicited in response to attack reveal, at the molecular level, how plants respond to aggressors. These patterns are fashioned both by inflicted physical damage as well as by biological components displayed or released by the attacker. Different types of attacking organisms might therefore be expected to elicit different transcription programs in the host. Using a large-scale DNA microarray, we characterized gene expression in damaged as well as in distal Arabidopsis thaliana leaves in response to the specialist insect, Pieris rapae. More than 100 insect-responsive genes potentially involved in defense were identified, including genes involved in pathogenesis, indole glucosinolate metabolism, detoxification and cell survival, and signal transduction. Of these 114 genes, 111 were induced in Pieris feeding, and only three were repressed. Expression patterns in distal leaves were markedly similar to those of local leaves. Analysis of wild-type and jasmonate mutant plants, coupled with jasmonate treatment, showed that between 67 and 84% of Pieris-regulated gene expression was controlled, totally or in part, by the jasmonate pathway. This was correlated with increased larval performance on the coronatine insensitive1 glabrous1 (coi1-1 gl1) mutant. Independent mutations in COI1 and GL1 led to a faster larval weight gain, but the gl1 mutation had relatively little effect on the expression of the insect-responsive genes examined. Finally, we compared transcript patterns in Arabidopis in response to larvae of the specialist P. rapae and to a generalist insect, Spodoptera littoralis. Surprisingly, given the complex nature of insect salivary components and reported differences between species, almost identical transcript profiles were observed. This study also provides a robustly characterized gene set for the further investigation of plant–insect interaction. PMID:15494554

  15. Regulation of Nav1.7: A Conserved SCN9A Natural Antisense Transcript Expressed in Dorsal Root Ganglia.

    PubMed

    Koenig, Jennifer; Werdehausen, Robert; Linley, John E; Habib, Abdella M; Vernon, Jeffrey; Lolignier, Stephane; Eijkelkamp, Niels; Zhao, Jing; Okorokov, Andrei L; Woods, C Geoffrey; Wood, John N; Cox, James J

    2015-01-01

    The Nav1.7 voltage-gated sodium channel, encoded by SCN9A, is critical for human pain perception yet the transcriptional and post-transcriptional mechanisms that regulate this gene are still incompletely understood. Here, we describe a novel natural antisense transcript (NAT) for SCN9A that is conserved in humans and mice. The NAT has a similar tissue expression pattern to the sense gene and is alternatively spliced within dorsal root ganglia. The human and mouse NATs exist in cis with the sense gene in a tail-to-tail orientation and both share sequences that are complementary to the terminal exon of SCN9A/Scn9a. Overexpression analyses of the human NAT in human embryonic kidney (HEK293A) and human neuroblastoma (SH-SY5Y) cell lines show that it can function to downregulate Nav1.7 mRNA, protein levels and currents. The NAT may play an important role in regulating human pain thresholds and is a potential candidate gene for individuals with chronic pain disorders that map to the SCN9A locus, such as Inherited Primary Erythromelalgia, Paroxysmal Extreme Pain Disorder and Painful Small Fibre Neuropathy, but who do not contain mutations in the sense gene. Our results strongly suggest the SCN9A NAT as a prime candidate for new therapies based upon augmentation of existing antisense RNAs in the treatment of chronic pain conditions in man.

  16. Novel PDE10A transcript diversity in the human striatum: Insights into gene complexity, conservation and regulation.

    PubMed

    MacMullen, Courtney M; Fallahi, Mohammad; Davis, Ronald L

    2017-03-30

    PDE10A is a cAMP/cGMP phosphodiesterase important in signal transduction within medium spiny neurons of the human striatum. This gene region has been associated with bipolar disorder via case-control and linkage studies. The three most studied human PDE10A isoforms differ in both their N-termini and trafficking within the cell with PDE10A2 found predominantly at the plasma membrane and PDE10A1 and PDE10A19 remaining primarily within the cytosol. RNA-sequencing and 5' RLM-RACE studies of the human putamen and caudate nucleus revealed 16 new exons and 12 novel transcripts of PDE10A, 3 of which are predicted to produce proteins with unique N-termini. The novel first exons of these transcripts are highly conserved in non-human primate species and are rarely found in other mammals. One hundred and eight previously classified intronic SNPs were found within the novel PDE10A exons of which 78% were classified as rare variants. Since most of the rare variants localize to 5' UTR regions, they may influence PDE10A transcription, translation, or mRNA stability. Dysregulation of cAMP signaling has been proposed as a cause of bipolar disorder and PDE10A inhibitors have been investigated as potential therapeutics for schizophrenia. Understanding the mechanisms contributing to PDE10A expression in the human striatum may provide evidence linking this gene to the phenotypes observed in neuropsychiatric disorders.

  17. Minimal promoter systems reveal the importance of conserved residues in the B-finger of human transcription factor IIB.

    PubMed

    Thompson, Nancy E; Glaser, Bryan T; Foley, Katherine M; Burton, Zachary F; Burgess, Richard R

    2009-09-11

    The "B-finger" of transcription factor IIB (TFIIB) is highly conserved and believed to play a role in the initiation process. We performed alanine substitutions across the B-finger of human TFIIB, made change-of-charge mutations in selected residues, and substituted the B-finger sequence from other organisms. Mutant proteins were examined in two minimal promoter systems (containing only RNA polymerase II, TATA-binding protein, and TFIIB) and in a complex system, using TFIIB-immunodepleted HeLa cell nuclear extract (NE). Mutations in conserved residues located on the sides of the B-finger had the greatest effect on activity in both minimal promoter systems, with mutations in residues Glu-51 and Arg-66 eliminating activity. The double change-of-charge mutant (E51R:R66E) did not show activity in either minimal promoter system. Mutations in the nonconserved residues at the tip of the B-finger did not significantly affect activity. However, all of the mutations in the B-finger showed at least 25% activity in the HeLa cell NE. Chimeric proteins, containing B-finger sequences from species with conserved residues on the side of the B-finger, showed wild-type activity in a minimal promoter system and in the HeLa cell NE. However, chimeric proteins whose sequence showed divergence on the sides of the B-finger had reduced activity. Transcription factor IIF (TFIIF) partially restored activity of the inactive mutants in the minimal promoter system, suggesting that TFIIF in HeLa cell NE helps to rescue the inactive mutations by interacting with either the B-finger or another component of the initiation complex that is influenced by the B-finger.

  18. A Conserved Structural Module Regulates Transcriptional Responses to Diverse Stress Signals in Eubacteria

    SciTech Connect

    Campbell,E.; Greenwell, R.; Anthony, J.; Wang, S.; Lim, L.; Das, K.; Sofia, H.; Donohue, T.; Darst, S.

    2007-01-01

    A transcriptional response to singlet oxygen in Rhodobacter sphaeroides is controlled by the group IV {sigma} factor {sigma}{sup E} and its cognate anti-{sigma} ChrR. Crystal structures of the {sigma}{sup E}/ChrR complex reveal a modular, two-domain architecture for ChrR. The ChrR N-terminal anti-{sigma} domain (ASD) binds a Zn{sup 2+} ion, contacts {sigma}{sup E}, and is sufficient to inhibit {sigma}{sup E}-dependent transcription. The ChrR C-terminal domain adopts a cupin fold, can coordinate an additional Zn{sup 2+}, and is required for the transcriptional response to singlet oxygen. Structure-based sequence analyses predict that the ASD defines a common structural fold among predicted group IV anti-{sigma}s. These ASDs are fused to diverse C-terminal domains that are likely involved in responding to specific environmental signals that control the activity of their cognate {sigma} factor.

  19. A conserved role for Snail as a potentiator of active transcription

    PubMed Central

    Rembold, Martina; Ciglar, Lucia; Yáñez-Cuna, J. Omar; Zinzen, Robert P.; Girardot, Charles; Jain, Ankit; Welte, Michael A.; Stark, Alexander; Leptin, Maria; Furlong, Eileen E.M.

    2014-01-01

    The transcription factors of the Snail family are key regulators of epithelial–mesenchymal transitions, cell morphogenesis, and tumor metastasis. Since its discovery in Drosophila ∼25 years ago, Snail has been extensively studied for its role as a transcriptional repressor. Here we demonstrate that Drosophila Snail can positively modulate transcriptional activation. By combining information on in vivo occupancy with expression profiling of hand-selected, staged snail mutant embryos, we identified 106 genes that are potentially directly regulated by Snail during mesoderm development. In addition to the expected Snail-repressed genes, almost 50% of Snail targets showed an unanticipated activation. The majority of “Snail-activated” genes have enhancer elements cobound by Twist and are expressed in the mesoderm at the stages of Snail occupancy. Snail can potentiate Twist-mediated enhancer activation in vitro and is essential for enhancer activity in vivo. Using a machine learning approach, we show that differentially enriched motifs are sufficient to predict Snail's regulatory response. In silico mutagenesis revealed a likely causative motif, which we demonstrate is essential for enhancer activation. Taken together, these data indicate that Snail can potentiate enhancer activation by collaborating with different activators, providing a new mechanism by which Snail regulates development. PMID:24402316

  20. Mosaic genome structure of the barley powdery mildew pathogen and conservation of transcriptional programs in divergent hosts

    PubMed Central

    Hacquard, Stéphane; Kracher, Barbara; Maekawa, Takaki; Vernaldi, Saskia; Schulze-Lefert, Paul; Ver Loren van Themaat, Emiel

    2013-01-01

    Barley powdery mildew, Blumeria graminis f. sp. hordei (Bgh), is an obligate biotrophic ascomycete fungal pathogen that can grow and reproduce only on living cells of wild or domesticated barley (Hordeum sp.). Domestication and deployment of resistant barley cultivars by humans selected for amplification of Bgh isolates with different virulence combinations. We sequenced the genomes of two European Bgh isolates, A6 and K1, for comparative analysis with the reference genome of isolate DH14. This revealed a mosaic genome structure consisting of large isolate-specific DNA blocks with either high or low SNP densities. Some of the highly polymorphic blocks likely accumulated SNPs for over 10,000 years, well before the domestication of barley. These isolate-specific blocks of alternating monomorphic and polymorphic regions imply an exceptionally large standing genetic variation in the Bgh population and might be generated and maintained by rare outbreeding and frequent clonal reproduction. RNA-sequencing experiments with isolates A6 and K1 during four early stages of compatible and incompatible interactions on leaves of partially immunocompromised Arabidopsis mutants revealed a conserved Bgh transcriptional program during pathogenesis compared with the natural host barley despite ∼200 million years of reproductive isolation of these hosts. Transcripts encoding candidate-secreted effector proteins are massively induced in successive waves. A specific decrease in candidate-secreted effector protein transcript abundance in the incompatible interaction follows extensive transcriptional reprogramming of the host transcriptome and coincides with the onset of localized host cell death, suggesting a host-inducible defense mechanism that targets fungal effector secretion or production. PMID:23696672

  1. Conserved themes in target recognition by the PAH1 and PAH2 domains of the Sin3 transcriptional corepressor.

    PubMed

    Sahu, Sarata C; Swanson, Kurt A; Kang, Richard S; Huang, Kai; Brubaker, Kurt; Ratcliff, Kathleen; Radhakrishnan, Ishwar

    2008-02-01

    The recruitment of chromatin-modifying coregulator complexes by transcription factors to specific sites of the genome constitutes an important step in many eukaryotic transcriptional regulatory pathways. The histone deacetylase-associated Sin3 corepressor complex is recruited by a large and diverse array of transcription factors through direct interactions with the N-terminal PAH domains of Sin3. Here, we describe the solution structures of the mSin3A PAH1 domain in the apo form and when bound to SAP25, a component of the corepressor complex. Unlike the apo-mSin3A PAH2 domain, the apo-PAH1 domain is conformationally pure and is largely, but not completely, folded. Portions of the interacting segments of both mSin3A PAH1 and SAP25 undergo folding upon complex formation. SAP25 binds through an amphipathic helix to a predominantly hydrophobic cleft on the surface of PAH1. Remarkably, the orientation of the helix is reversed compared to that adopted by NRSF, a transcription factor unrelated to SAP25, upon binding to the mSin3B PAH1 domain. The reversal in helical orientations is correlated with a reversal in the underlying PAH1-interaction motifs, echoing a theme previously described for the mSin3A PAH2 domain. The definition of these so-called type I and type II PAH1-interaction motifs has allowed us to predict the precise location of these motifs within previously experimentally characterized PAH1 binders. Finally, we explore the specificity determinants of protein-protein interactions involving the PAH1 and PAH2 domains. These studies reveal that even conservative replacements of PAH2 residues with equivalent PAH1 residues are sufficient to alter the affinity and specificity of these protein-protein interactions dramatically.

  2. Different requirements for conserved post-transcriptional regulators in planarian regeneration and stem cell maintenance.

    PubMed

    Rouhana, Labib; Shibata, Norito; Nishimura, Osamu; Agata, Kiyokazu

    2010-05-15

    Planarian regeneration depends on the presence and precise regulation of pluripotent adult somatic stem cells named neoblasts, which differentiate to replace cells of any missing tissue. A characteristic feature of neoblasts is the presence of large perinuclear nonmembranous organelles named "chromatoid bodies", which are comparable to ribonucleoprotein structures found in germ cells of organisms across different phyla. In order to better understand regulation of gene expression in neoblasts, and potentially the function and composition of chromatoid bodies, we characterized homologues to known germ and soma ribonucleoprotein granule components from other organisms and analyzed their function during regeneration of the planarian Dugesia japonica. Expression in neoblasts was detected for 49 of 55 analyzed genes, highlighting the prevalence of post-transcriptional regulation in planarian stem cells. RNAi-mediated knockdown of two factors [ago-2 and bruli] lead to loss of neoblasts, and consequently loss of regeneration, corroborating with results previously reported for a bruli ortholog in the planarian Schmidtea mediterranea (Guo et al., 2006). Conversely, depletion mRNA turnover factors [edc-4 or upf-1], exoribonucleases [xrn-1 or xrn-2], or DEAD box RNA helicases [Djcbc-1 or vas-1] inhibited planarian regeneration, but did not reduce neoblast proliferation or abundance. We also found that depletion of cap-dependent translation initiation factors eIF-3A or eIF-2A interrupted cell cycle progression outside the M-phase of mitosis. Our results show that a set of post-transcriptional regulators is required to maintain the stem cell identity in neoblasts, while another facilitates proper differentiation. We propose that planarian neoblasts maintain pluripotency by employing mechanisms of post-transcriptional regulation exhibited in germ cells and early development of most metazoans. Copyright 2010 Elsevier Inc. All rights reserved.

  3. Discovery and Characterization of Human Exonic Transcriptional Regulatory Elements

    PubMed Central

    Khan, Arshad H.; Lin, Andy; Smith, Desmond J.

    2012-01-01

    We sought exonic transcriptional regulatory elements by shotgun cloning human cDNA fragments into luciferase reporter vectors and measuring the resulting expression levels in liver cells. We uncovered seven regulatory elements within coding regions and three within 3' untranslated regions (UTRs). Two of the putative regulatory elements were enhancers and eight were silencers. The regulatory elements were generally but not consistently evolutionarily conserved and also showed a trend toward decreased population diversity. Furthermore, the exonic regulatory elements were enriched in known transcription factor binding sites (TFBSs) and were associated with several histone modifications and transcriptionally relevant chromatin. Evidence was obtained for bidirectional cis-regulation of a coding region element within a tubulin gene, TUBA1B, by the transcription factors PPARA and RORA. We estimate that hundreds of exonic transcriptional regulatory elements exist, an unexpected finding that highlights a surprising multi-functionality of sequences in the human genome. PMID:23029400

  4. Interaction of PC4 with melted DNA inhibits transcription.

    PubMed

    Werten, S; Stelzer, G; Goppelt, A; Langen, F M; Gros, P; Timmers, H T; Van der Vliet, P C; Meisterernst, M

    1998-09-01

    PC4 is a nuclear DNA-binding protein that stimulates activator-dependent class II gene transcription in vitro. Recent biochemical and X-ray analyses have revealed a unique structure within the C-terminal domain of PC4 that binds tightly to unpaired double-stranded (ds)DNA. The cellular function of this evolutionarily conserved dimeric DNA-binding fold is unknown. Here we demonstrate that PC4 represses transcription through this motif. Interaction with melted promoters is not required for activator-dependent transcription in vitro. The inhibitory activity is attenuated on bona fide promoters by (i) transcription factor TFIIH and (ii) phosphorylation of PC4. PC4 remains a potent inhibitor of transcription in regions containing unpaired ds DNA, in single-stranded DNA that can fold into two antiparallel strands, and on DNA ends. Our observations are consistent with a novel inhibitory function of PC4.

  5. Evolutionary conservation of the placodal transcriptional network during sexual and asexual development in chordates.

    PubMed

    Gasparini, Fabio; Degasperi, Valentina; Shimeld, Sebastian M; Burighel, Paolo; Manni, Lucia

    2013-06-01

    An important question behind vertebrate evolution is whether the cranial placodes originated de novo, or if their precursors were present in the ancestor of chordates. In this respect, tunicates are of particular interest as they are considered the closest relatives to vertebrates. They are also the only chordate group possessing species that reproduce both sexually and asexually, allowing both types of development to be studied to address whether embryonic pathways have been co-opted during budding to build the same structures. We studied the expression of members of the transcriptional network associated with vertebrate placodal formation (Six, Eya, and FoxI) in the colonial tunicate Botryllus schlosseri. During both sexual and asexual development, each transcript is expressed in branchial fissures and in two discrete regions proposed to be homologues to groups of vertebrate placodes. Results reinforce the idea that placode origin predates the origin of vertebrates and that the molecular network involving these genes was co-opted in the evolution of asexual reproduction. Considering that gill slit formation in deuterostomes is based on similar expression patterns, we discuss possible alternative evolutionary scenarios depicting gene co-option as critical step in placode and pharynx evolution. Copyright © 2013 Wiley Periodicals, Inc.

  6. Regulation of tyrosine hydroxylase transcription by hnRNP K and DNA secondary structure

    PubMed Central

    Banerjee, Kasturi; Wang, Meng; Cai, Elizabeth; Fujiwara, Nana; Baker, Harriet; Cave, John W.

    2014-01-01

    Regulation of tyrosine hydroxylase gene (Th) transcription is critical for specifying and maintaining the dopaminergic neuronal phenotype. Here we define a molecular regulatory mechanism for Th transcription conserved in tetrapod vertebrates. We show that heterogeneous nuclear ribonucleoprotein (hnRNP) K is a transactivator of Th transcription. It binds to previously unreported and evolutionarily conserved G:C-rich regions in the Th proximal promoter. hnRNP K directly binds C-rich single DNA strands within these conserved regions and also associates with double-stranded sequences when proteins, such as CREB, are bound to an adjacent cis-regulatory element. The single DNA strands within the conserved G:C-rich regions adopt either G-quadruplex or i-motif secondary structures. We also show that small molecule-mediated stabilization of these secondary structures represses Th promoter activity. These data suggest that these secondary structures are targets for pharmacological modulation of the dopaminergic phenotype. PMID:25493445

  7. Integrated, multi-cohort analysis identifies conserved transcriptional signatures across multiple respiratory viruses

    PubMed Central

    Andres-Terre, Marta; McGuire, Helen M; Pouliot, Yannick; Bongen, Erika; Sweeney, Timothy E.; Tato, Cristina M; Khatri, Purvesh

    2015-01-01

    Respiratory viral infections are a significant burden to healthcare worldwide. Many whole genome expression profiles have identified different respiratory viral infection signatures, but these have not translated to clinical practice. Here, we performed two integrated, multi-cohort analyses of publicly available transcriptional data of viral infections. First, we identified a common host signature across different respiratory viral infections that could distinguish (a) individuals with viral infections from healthy controls and from those with bacterial infections, and (b) symptomatic from asymptomatic subjects prior to symptom onset in challenge studies. Second, we identified an influenza-specific host response signature that (a) could distinguish influenza-infected samples from those with bacterial and other respiratory viral infections, (b) was a diagnostic and prognostic marker in influenza-pneumonia patients and influenza challenge studies, and (c) was predictive of response to influenza vaccine. Our results have applications in the diagnosis, prognosis, and identification of drug targets in viral infections. PMID:26682989

  8. Co-operative DNA binding by GAGA transcription factor requires the conserved BTB/POZ domain and reorganizes promoter topology.

    PubMed Central

    Katsani, K R; Hajibagheri, M A; Verrijzer, C P

    1999-01-01

    The POZ domain is a conserved protein-protein interaction motif present in a variety of transcription factors involved in development, chromatin remodelling and human cancers. Here, we study the role of the POZ domain of the GAGA transcription factor in promoter recognition. Natural target promoters for GAGA typically contain multiple GAGA-binding elements. Our results show that the POZ domain mediates strong co-operative binding to multiple sites but inhibits binding to single sites. Protein cross-linking and gel filtration chromatography experiments established that the POZ domain is required for GAGA oligomerization into higher order complexes. Thus, GAGA oligomerization increases binding specificity by selecting only promoters with multiple sites. Electron microscopy revealed that GAGA binds to multiple sites as a large oligomer and induces bending of the promoter DNA. Our results indicate a novel mode of DNA binding by GAGA, in which a large GAGA complex binds multiple GAGA elements that are spread out over a region of a few hundred base pairs. We suggest a model in which the promoter DNA is wrapped around a GAGA multimer in a conformation that may exclude normal nucleosome formation. PMID:9927429

  9. Sexually Dimorphic Differentiation of a C. elegans Hub Neuron Is Cell Autonomously Controlled by a Conserved Transcription Factor.

    PubMed

    Serrano-Saiz, Esther; Oren-Suissa, Meital; Bayer, Emily A; Hobert, Oliver

    2017-01-23

    Functional and anatomical sexual dimorphisms in the brain are either the result of cells that are generated only in one sex or a manifestation of sex-specific differentiation of neurons present in both sexes. The PHC neuron pair of the nematode C. elegans differentiates in a strikingly sex-specific manner. In hermaphrodites the PHC neurons display a canonical pattern of synaptic connectivity similar to that of other sensory neurons, but in males PHC differentiates into a densely connected hub sensory neuron/interneuron, integrating a large number of male-specific synaptic inputs and conveying them to both male-specific and sex-shared circuitry. We show that the differentiation into such a hub neuron involves the sex-specific scaling of several components of the synaptic vesicle machinery, including the vesicular glutamate transporter eat-4/VGLUT, induction of neuropeptide expression, changes in axonal projection morphology, and a switch in neuronal function. We demonstrate that these molecular and anatomical remodeling events are controlled cell autonomously by the phylogenetically conserved Doublesex homolog dmd-3, which is both required and sufficient for sex-specific PHC differentiation. Cellular specificity of dmd-3 action is ensured by its collaboration with non-sex-specific terminal selector-type transcription factors, whereas the sex specificity of dmd-3 action is ensured by the hermaphrodite-specific transcriptional master regulator of hermaphroditic cell identity tra-1, which represses the transcription of dmd-3 in hermaphrodite PHC. Taken together, our studies provide mechanistic insights into how neurons are specified in a sexually dimorphic manner.

  10. High conservation of a 5' element required for RNA editing of a C target in chloroplast psbE transcripts.

    PubMed

    Hayes, Michael L; Hanson, Maureen R

    2008-09-01

    C-to-U editing modifies 30-40 distinct nucleotides within higher-plant chloroplast transcripts. Many C targets are located at the same position in homologous genes from different plants; these either could have emerged independently or could share a common origin. The 5' sequence GCCGUU, required for editing of C214 in tobacco psbE in vitro, is one of the few identified editing cis-elements. We investigated psbE sequences from many plant species to determine in what lineage(s) editing of psbE C214 emerged and whether the cis-element identified in tobacco is conserved in plants with a C214. The GCCGUU sequence is present at a high frequency in plants that carry a C214 in psbE. However, Sciadopitys verticillata (Pinophyta) edits C214 despite the presence of nucleotide differences compared to the conserved cis-element. The C214 site in psbE genes is represented in members of four branches of spermatophytes but not in gnetophytes, resulting in the parsimonious prediction that editing of psbE C214 was present in the ancestor of spermatophytes. Extracts from chloroplasts from a species that has a difference in the motif and lacks the C target are incapable of editing tobacco psbE C214 substrates, implying that the critical trans-acting protein factors were not retained without a C target. Because noncoding sequences are less constrained than coding regions, we analyzed sequences 5' to two C editing targets located within coding regions to search for possible editing-related conserved elements. Putative editing cis-elements were uncovered in the 5' UTRs near editing sites psbL C2 and ndhD C2.

  11. The Highly Conserved Escherichia coli Transcription Factor YhaJ Regulates Aromatic Compound Degradation

    PubMed Central

    Palevsky, Noa; Shemer, Benjamin; Connolly, James P. R.; Belkin, Shimshon

    2016-01-01

    The aromatic compound 2,4-dinitrotoluene (DNT), a common impurity in 2,4,6-trinitrotoluene (TNT) production, has been suggested as a tracer for the presence of TNT-based landmines due to its stability and high volatility. We have previously described an Escherichia coli bioreporter capable of detecting the presence of DNT vapors, harboring a fusion of the yqjF gene promoter to a reporter element. However, the DNT metabolite which is the direct inducer of yqjF, has not yet been identified, nor has the regulatory mechanism of the induction been clarified. We demonstrate here that the YhaJ protein, a member of the LysR type family, acts as a transcriptional regulator of yqjF activation, as well as of a panel of additional E. coli genes. This group of genes share a common sequence motif in their promoters, which is suggested here as a putative YhaJ-box. In addition, we have linked YhaJ to the regulation of quinol-like compound degradation in the cell, and identified yhaK as playing a role in the degradation of DNT. PMID:27713734

  12. Multiple Genes Encoding the Conserved CCAAT-Box Transcription Factor Complex Are Expressed in Arabidopsis

    PubMed Central

    Edwards, David; Murray, James A.H.; Smith, Alison G.

    1998-01-01

    The CCAAT motif is found in the promoters of many eukaryotic genes. In yeast a single complex of three proteins, termed HAP2, HAP3, and HAP5, binds to this sequence, and in mammals the three components of the equivalent complex (called variously NF-Y, CBF, or CP1) are also represented by single genes. Here we report the presence of multiple genes for each of the components of the CCAAT-binding complex, HAP2,3,5, from Arabidopsis. Three independent Arabidopsis HAP subunit 2 (AtHAP2) cDNAs were cloned by functional complementation of a yeast hap2 mutant, and two independent forms each of AtHAP3 and AtHAP5 cDNAs were detected in the expressed sequence tag database. Additional homologs (two of AtHAP3 and one of AtHAP5) have been identified from available Arabidopsis genomic sequences. Northern-blot analysis indicated ubiquitous expression for each AtHAP2 and AtHAP5 cDNA in a range of tissues, whereas expression of each AtHAP3 cDNA was under developmental and/or environmental regulation. The unexpected presence of multiple forms of each HAP homolog in Arabidopsis, compared with the single genes in yeast and vertebrates, suggests that the HAP2,3,5 complex may play diverse roles in gene transcription in higher plants. PMID:9662544

  13. Functional cross-kingdom conservation of mammalian and moss (Physcomitrella patens) transcription, translation and secretion machineries.

    PubMed

    Gitzinger, Marc; Parsons, Juliana; Reski, Ralf; Fussenegger, Martin

    2009-01-01

    Plants and mammals are separated by a huge evolutionary distance. Consequently, biotechnology and genetics have traditionally been divided into 'green' and 'red'. Here, we provide comprehensive evidence that key components of the mammalian transcription, translation and secretion machineries are functional in the model plant Physcomitrella patens. Cross-kingdom compatibility of different expression modalities originally designed for mammalian cells, such as native and synthetic promoters and polyadenylation sites, viral and cellular internal ribosome entry sites, secretion signal peptides and secreted product proteins, and synthetic transactivators and transrepressors, was established. This mammalian expression portfolio enabled constitutive, conditional and autoregulated expression of different product genes in a multicistronic expression format, optionally adjusted by various trigger molecules, such as butyrolactones, macrolide antibiotics and ethanol. Capitalizing on a cross-kingdom-compatible expression platform, we pioneered a prototype biopharmaceutical manufacturing scenario using microencapsulated transgenic P. patens protoplasts cultivated in a Wave Bioreactor. Vascular endothelial growth factor 121 (VEGF(121)) titres matched those typically achieved by standard protonema populations grown in stirred-tank bioreactors. The full compatibility of mammalian expression systems in P. patens further promotes the use of moss as a cost-effective alternative for the manufacture of complex biopharmaceuticals, and as a valuable host system to advance synthetic biology in plants.

  14. Yeast general transcription factor GFI: sequence requirements for binding to DNA and evolutionary conservation.

    PubMed Central

    Dorsman, J C; van Heeswijk, W C; Grivell, L A

    1990-01-01

    GFI is an abundant DNA binding protein in the yeast S. cerevisiae. The protein binds to specific sequences in both ARS elements and the upstream regions of a large number of genes and is likely to play an important role in yeast cell growth. To get insight into the relative strength of the various GFI-DNA binding sites within the yeast genome, we have determined dissociation rates for several GFI-DNA complexes and found them to vary over a 70-fold range. Strong binding sites for GFI are present in the upstream activating sequences of the gene encoding the 40 kDa subunit II of the QH2:cytochrome c reductase, the gene encoding ribosomal protein S33 and in the intron of the actin gene. The binding site in the ARS1-TRP1 region is of intermediate strength. All strong binding sites conform to the sequence 5' RTCRYYYNNNACG-3'. Modification interference experiments and studies with mutant binding sites indicate that critical bases for GFI recognition are within the two elements of the consensus DNA recognition sequence. Proteins with the DNA binding specificities of GFI and GFII can also be detected in the yeast K. lactis, suggesting evolutionary conservation of at least the respective DNA-binding domains in both yeasts. Images PMID:2187179

  15. Crystal Structures of Two Transcriptional Regulators from Bacillus cereus Define the Conserved Structural Features of a PadR Subfamily

    PubMed Central

    Fibriansah, Guntur; Kovács, Ákos T.; Pool, Trijntje J.; Boonstra, Mirjam; Kuipers, Oscar P.; Thunnissen, Andy-Mark W. H.

    2012-01-01

    PadR-like transcriptional regulators form a structurally-related family of proteins that control the expression of genes associated with detoxification, virulence and multi-drug resistance in bacteria. Only a few members of this family have been studied by genetic, biochemical and biophysical methods, and their structure/function relationships are still largely undefined. Here, we report the crystal structures of two PadR-like proteins from Bacillus cereus, which we named bcPadR1 and bcPadR2 (products of gene loci BC4206 and BCE3449 in strains ATCC 14579 and ATCC 10987, respectively). BC4206, together with its neighboring gene BC4207, was previously shown to become significantly upregulated in presence of the bacteriocin AS-48. DNA mobility shift assays reveal that bcPadR1 binds to a 250 bp intergenic region containing the putative BC4206–BC4207 promoter sequence, while in-situ expression of bcPadR1 decreases bacteriocin tolerance, together suggesting a role for bcPadR1 as repressor of BC4206–BC4207 transcription. The function of bcPadR2 (48% identical in sequence to bcPadR1) is unknown, but the location of its gene just upstream from genes encoding a putative antibiotic ABC efflux pump, suggests a role in regulating antibiotic resistance. The bcPadR proteins are structurally similar to LmrR, a PadR-like transcription regulator in Lactococcus lactis that controls expression of a multidrug ABC transporter via a mechanism of multidrug binding and induction. Together these proteins define a subfamily of conserved, relatively small PadR proteins characterized by a single C-terminal helix for dimerization. Unlike LmrR, bcPadR1 and bcPadR2 lack a central pore for ligand binding, making it unclear whether the transcriptional regulatory roles of bcPadR1 and bcPadR2 involve direct ligand recognition and induction. PMID:23189126

  16. A belief-based evolutionarily stable strategy.

    PubMed

    Deng, Xinyang; Wang, Zhen; Liu, Qi; Deng, Yong; Mahadevan, Sankaran

    2014-11-21

    As an equilibrium refinement of the Nash equilibrium, evolutionarily stable strategy (ESS) is a key concept in evolutionary game theory and has attracted growing interest. An ESS can be either a pure strategy or a mixed strategy. Even though the randomness is allowed in mixed strategy, the selection probability of pure strategy in a mixed strategy may fluctuate due to the impact of many factors. The fluctuation can lead to more uncertainty. In this paper, such uncertainty involved in mixed strategy has been further taken into consideration: a belief strategy is proposed in terms of Dempster-Shafer evidence theory. Furthermore, based on the proposed belief strategy, a belief-based ESS has been developed. The belief strategy and belief-based ESS can reduce to the mixed strategy and mixed ESS, which provide more realistic and powerful tools to describe interactions among agents. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Evolutionarily stable sex ratios and mutation load.

    PubMed

    Hough, Josh; Immler, Simone; Barrett, Spencer C H; Otto, Sarah P

    2013-07-01

    Frequency-dependent selection should drive dioecious populations toward a 1:1 sex ratio, but biased sex ratios are widespread, especially among plants with sex chromosomes. Here, we develop population genetic models to investigate the relationships between evolutionarily stable sex ratios, haploid selection, and deleterious mutation load. We confirm that when haploid selection acts only on the relative fitness of X- and Y-bearing pollen and the sex ratio is controlled by the maternal genotype, seed sex ratios evolve toward 1:1. When we also consider haploid selection acting on deleterious mutations, however, we find that biased sex ratios can be stably maintained, reflecting a balance between the advantages of purging deleterious mutations via haploid selection, and the disadvantages of haploid selection on the sex ratio. Our results provide a plausible evolutionary explanation for biased sex ratios in dioecious plants, given the extensive gene expression that occurs across plant genomes at the haploid stage.

  18. Two mammalian MOF complexes regulate transcription activation by distinct mechanisms.

    PubMed

    Li, Xiangzhi; Wu, Lipeng; Corsa, Callie Ann Sprunger; Kunkel, Steve; Dou, Yali

    2009-10-23

    In mammals, MYST family histone acetyltransferase MOF plays important roles in transcription activation by acetylating histone H4 on K16, a prevalent mark associated with chromatin decondensation, and transcription factor p53 on K120, which is important for activation of proapoptotic genes. However, little is known about MOF regulation in higher eukaryotes. Here, we report that the acetyltransferase activity of MOF is tightly regulated in two different but evolutionarily conserved complexes, MSL and MOF-MSL1v1. Importantly, we demonstrate that while the two MOF complexes have indistinguishable activity on histone H4 K16, they differ dramatically in acetylating nonhistone substrate p53. We further demonstrate that MOF-MSL1v1 is specifically required for optimal transcription activation of p53 target genes both in vitro and in vivo. Our results support a model that these two MOF complexes regulate distinct stages of transcription activation in cooperation with other histone modifying activities.

  19. Mapping the Transcription Start Points of the Staphylococcus aureus eap, emp, and vwb Promoters Reveals a Conserved Octanucleotide Sequence That Is Essential for Expression of These Genes▿ †

    PubMed Central

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp. PMID:17965149

  20. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

    PubMed

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  1. Changing a conserved amino acid in R2R3-MYB transcription repressors results in cytoplasmic accumulation and abolishes their repressive activity in Arabidopsis.

    PubMed

    Zhou, Meiliang; Sun, Zhanmin; Wang, Chenglong; Zhang, Xinquan; Tang, Yixiong; Zhu, Xuemei; Shao, Jirong; Wu, Yanmin

    2015-10-01

    Sub-group 4 R2R3-type MYB transcription factors, including MYB3, MYB4, MYB7 and MYB32, act as repressors in phenylpropanoid metabolism. These proteins contain the conserved MYB domain and the ethylene-responsive element binding factor-associated amphiphilic repression (EAR) repression domain. Additionally, MYB4, MYB7 and MYB32 possess a putative zinc-finger domain and a conserved GY/FDFLGL motif in their C-termini. The protein 'sensitive to ABA and drought 2' (SAD2) recognizes the nuclear pore complex, which then transports the SAD2-MYB4 complex into the nucleus. Here, we show that the conserved GY/FDFLGL motif contributes to the interaction between MYB factors and SAD2. The Asp → Asn mutation in the GY/FDFLGL motif abolishes the interaction between MYB transcription factors and SAD2, and therefore they cannot be transported into the nucleus and cannot repress their target genes. We found that MYB4(D261N) loses the capacity to repress expression of the cinnamate 4-hydroxylase (C4H) gene and biosynthesis of sinapoyl malate. Our results indicate conservation among MYB transcription factors in terms of their interaction with SAD2. Therefore, the Asp → Asn mutation may be used to engineer transcription factors.

  2. Arabidopsis NAC Transcription Factor JUNGBRUNNEN1 Exerts Conserved Control Over Gibberellin and Brassinosteroid Metabolism and Signaling Genes in Tomato

    PubMed Central

    Shahnejat-Bushehri, Sara; Allu, Annapurna D.; Mehterov, Nikolay; Thirumalaikumar, Venkatesh P.; Alseekh, Saleh; Fernie, Alisdair R.; Mueller-Roeber, Bernd; Balazadeh, Salma

    2017-01-01

    The Arabidopsis thaliana NAC transcription factor JUNGBRUNNEN1 (AtJUB1) regulates growth by directly repressing GA3ox1 and DWF4, two key genes involved in gibberellin (GA) and brassinosteroid (BR) biosynthesis, respectively, leading to GA and BR deficiency phenotypes. AtJUB1 also reduces the expression of PIF4, a bHLH transcription factor that positively controls cell elongation, while it stimulates the expression of DELLA genes, which are important repressors of growth. Here, we extend our previous findings by demonstrating that AtJUB1 induces similar GA and BR deficiency phenotypes and changes in gene expression when overexpressed in tomato (Solanum lycopersicum). Importantly, and in accordance with the growth phenotypes observed, AtJUB1 inhibits the expression of growth-supporting genes, namely the tomato orthologs of GA3ox1, DWF4 and PIF4, but activates the expression of DELLA orthologs, by directly binding to their promoters. Overexpression of AtJUB1 in tomato delays fruit ripening, which is accompanied by reduced expression of several ripening-related genes, and leads to an increase in the levels of various amino acids (mostly proline, β-alanine, and phenylalanine), γ-aminobutyric acid (GABA), and major organic acids including glutamic acid and aspartic acid. The fact that AtJUB1 exerts an inhibitory effect on the GA/BR biosynthesis and PIF4 genes but acts as a direct activator of DELLA genes in both, Arabidopsis and tomato, strongly supports the model that the molecular constituents of the JUNGBRUNNEN1 growth control module are considerably conserved across species. PMID:28326087

  3. Conserved role of Ovo in germline development in mouse and Drosophila

    PubMed Central

    Hayashi, Makoto; Shinozuka, Yuko; Shigenobu, Shuji; Sato, Masanao; Sugimoto, Michihiko; Ito, Seiji; Abe, Kuniya; Kobayashi, Satoru

    2017-01-01

    Ovo, which encodes a transcription factor with Zn-finger domains, is evolutionarily conserved among animals. In Drosophila, in addition to its zygotic function for egg production, maternal ovo activity is required in primordial germ cells (PGCs) for expression of germline genes such as vasa and nanos. In this study, we found that maternal Ovo accumulates in PGC nuclei during embryogenesis. In these cells, ovo serves a dual function: activation of genes expressed predominantly in PGCs, and conversely suppression of somatic genes. Reduction of ovo activity in PGCs makes them unable to develop normally into germ cells of both sexes. In mice, knockout of the ovo ortholog, Ovol2, which is expressed in PGCs, decreases the number of PGCs during early embryogenesis. These data strongly suggest that ovo acts as part of an evolutionarily conserved mechanism that regulates germline development in animals. PMID:28059165

  4. New insights on the transcriptional regulation of CD69 gene through a potent enhancer located in the conserved non-coding sequence 2.

    PubMed

    Laguna, Teresa; Notario, Laura; Pippa, Raffaella; Fontela, Miguel G; Vázquez, Berta N; Maicas, Miren; Aguilera-Montilla, Noemí; Corbí, Ángel L; Odero, María D; Lauzurica, Pilar

    2015-08-01

    The CD69 type II C-type lectin is one of the earliest indicators of leukocyte activation acting in lymphocyte migration and cytokine secretion. CD69 expression in hematopoietic lineage undergoes rapid changes depending on the cell-lineage, the activation state or the localization of the cell where it is expressed, suggesting a complex and tightly controlled regulation. Here we provide new insights on the transcriptional regulation of CD69 gene in mammal species. Through in silico studies, we analyzed several regulatory features of the 4 upstream conserved non-coding sequences (CNS 1-4) previously described, confirming a major function of CNS2 in the transcriptional regulation of CD69. In addition, multiple transcription binding sites are identified in the CNS2 region by DNA cross-species conservation analysis. By functional approaches we defined a core region of 226bp located within CNS2 as the main enhancer element of CD69 transcription in the hematopoietic cells analyzed. By chromatin immunoprecipitation, binding of RUNX1 to the core-CNS2 was shown in a T cell line. In addition, we found an activating but not essential role of RUNX1 in CD69 gene transcription by site-directed mutagenesis and RNA silencing, probably through the interaction with this potent enhancer specifically in the hematopoietic lineage. In summary, in this study we contribute with new evidences to the landscape of the transcriptional regulation of the CD69 gene. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Human and mouse ZFY genes produce a conserved testis-specific transcript encoding a zinc finger protein with a short acidic domain and modified transactivation potential.

    PubMed

    Decarpentrie, Fanny; Vernet, Nadège; Mahadevaiah, Shantha K; Longepied, Guy; Streichemberger, Eric; Aknin-Seifer, Isabelle; Ojarikre, Obah A; Burgoyne, Paul S; Metzler-Guillemain, Catherine; Mitchell, Michael J

    2012-06-15

    Mammalian ZFY genes are located on the Y chromosome, and code putative transcription factors with 12-13 zinc fingers preceded by a large acidic (activating) domain. In mice, there are two genes, Zfy1 and Zfy2, which are expressed mainly in the testis. Their transcription increases in germ cells as they enter meiosis, both are silenced by meiotic sex chromosome inactivation (MSCI) during pachytene, and Zfy2 is strongly reactivated later in spermatids. Recently, we have shown that mouse Zfy2, but not Zfy1, is involved in triggering the apoptotic elimination of specific types of sex chromosomally aberrant spermatocytes. In humans, there is a single widely transcribed ZFY gene, and there is no evidence for a specific role in the testis. Here, we characterize ZFY transcription during spermatogenesis in mice and humans. In mice, we define a variety of Zfy transcripts, among which is a Zfy2 transcript that predominates in spermatids, and a Zfy1 transcript, lacking an exon encoding approximately half of the acidic domain, which predominates prior to MSCI. In humans, we have identified a major testis-specific ZFY transcript that encodes a protein with the same short acidic domain. This represents the first evidence that ZFY has a conserved function during human spermatogenesis. We further show that, in contrast to the full acidic domain, the short domain does not activate transcription in yeast, and we hypothesize that this explains the functional difference observed between Zfy1 and Zfy2 during mouse meiosis.

  6. Elucidating the evolutionary conserved DNA-binding specificities of WRKY transcription factors by molecular dynamics and in vitro binding assays

    PubMed Central

    Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk

    2013-01-01

    WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197

  7. Correlation of the exon/intron organization to the conserved domains of the mouse transcriptional corepressor TIF1beta.

    PubMed

    Cammas, F; Garnier, J; Chambon, P; Losson, R

    2000-08-08

    TIF1beta, a member of the transcriptional intermediary factor 1 family, has been reported to function as a corepressor for the large class of KRAB domain-containing zinc finger proteins of the Krüppel type. In this study, we report the genomic organization and nucleotide sequence of the mouse TIF1beta gene. This gene comprises 17 coding exons located within 7 kb of genomic DNA. Exon sizes vary from 37 bp (exon 10) to 901 bp (exon 1), and intron sizes range from 71 bp to 1843 bp. All introns have the conserved GT and AG dinucleotides present at the donor and acceptor sites, respectively. The functional/homology regions of the TIF1beta protein are encoded by distinct exons. The amino-terminal RING finger is encoded by two exons interrupted by a small intron. The B boxes lie within individual exons. Similarly to the RING finger, the PHD finger is encoded by two exons. Three exons constitute the carboxy-terminal bromodomain, and their position correlates well with the secondary structure elements of the domain as predicted by computer modeling. Taken together, these results will facilitate the genetic manipulation of TIF1beta for future in vivo structure-function studies.

  8. Characterization of barley (Hordeum vulgare L.) NAC transcription factors suggests conserved functions compared to both monocots and dicots

    PubMed Central

    2011-01-01

    Background The NAC transcription factor family is involved in the regulation of traits in both monocots and dicots of high agronomic importance. Understanding the precise functions of the NAC genes can be of utmost importance for the improvement of cereal crop plants through plant breeding. For the cereal crop plant barley (Hordeum vulgare L.) only a few NAC genes have so far been investigated. Results Through searches in publicly available barley sequence databases we have obtained a list of 48 barley NAC genes (HvNACs) with 43 of them representing full-length coding sequences. Phylogenetic comparisons to Brachypodium, rice, and Arabidopsis NAC proteins indicate that the barley NAC family includes members from all of the eight NAC subfamilies, although by comparison to these species a number of HvNACs still remains to be identified. Using qRT-PCR we investigated the expression profiles of 46 HvNACs across eight barley tissues (young flag leaf, senescing flag leaf, young ear, old ear, milk grain, late dough grain, roots, and developing stem) and two hormone treatments (abscisic acid and methyl jasmonate). Conclusions Comparisons of expression profiles of selected barley NAC genes with the published functions of closely related NAC genes from other plant species, including both monocots and dicots, suggest conserved functions in the areas of secondary cell wall biosynthesis, leaf senescence, root development, seed development, and hormone regulated stress responses. PMID:21851648

  9. Conserved XPB Core Structure and Motifs for DNA Unwinding:Implications for Pathway Selection of Transcription or ExcisionRepair

    SciTech Connect

    Fan, Li; Arval, Andrew S.; Cooper, Priscilla K.; Iwai, Shigenori; Hanaoka, Fumio; Tainer, John A.

    2005-04-01

    The human xeroderma pigmentosum group B (XPB) helicase is essential for transcription, nucleotide excision repair, and TFIIH functional assembly. Here, we determined crystal structures of an Archaeoglobus fulgidus XPB homolog (AfXPB) that characterize two RecA-like XPB helicase domains and discover a DNA damage recognition domain (DRD), a unique RED motif, a flexible thumb motif (ThM), and implied conformational changes within a conserved functional core. RED motif mutations dramatically reduce helicase activity, and the DRD and ThM, which flank the RED motif, appear structurally as well as functionally analogous to the MutS mismatch recognition and DNA polymerase thumb domains. Substrate specificity is altered by DNA damage, such that AfXPB unwinds dsDNA with 3' extensions, but not blunt-ended dsDNA, unless it contains a lesion, as shown for CPD or (6-4) photoproducts. Together, these results provide an unexpected mechanism of DNA unwinding with Implications for XPB damage verification in nucleotide excision repair.

  10. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms.

    PubMed

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun

    2017-01-01

    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions.

  11. An evolutionary conserved interaction between the Gcm transcription factor and the SF1 nuclear receptor in the female reproductive system

    PubMed Central

    Cattenoz, Pierre B.; Delaporte, Claude; Bazzi, Wael; Giangrande, Angela

    2016-01-01

    NR5A1 is essential for the development and for the function of steroid producing glands of the reproductive system. Moreover, its misregulation is associated with endometriosis, which is the first cause of infertility in women. Hr39, the Drosophila ortholog of NR5A1, is expressed and required in the secretory cells of the spermatheca, the female exocrine gland that ensures fertility by secreting substances that attract and capacitate the spermatozoids. We here identify a direct regulator of Hr39 in the spermatheca: the Gcm transcription factor. Furthermore, lack of Gcm prevents the production of the secretory cells and leads to female sterility in Drosophila. Hr39 regulation by Gcm seems conserved in mammals and involves the modification of the DNA methylation profile of mNr5a1. This study identifies a new molecular pathway in female reproductive system development and suggests a role for hGCM in the progression of reproductive tract diseases in humans. PMID:27886257

  12. Multi-species, multi-transcription factor binding highlights conserved control of tissue-specific biological pathways

    PubMed Central

    Ballester, Benoit; Medina-Rivera, Alejandra; Schmidt, Dominic; Gonzàlez-Porta, Mar; Carlucci, Matthew; Chen, Xiaoting; Chessman, Kyle; Faure, Andre J; Funnell, Alister PW; Goncalves, Angela; Kutter, Claudia; Lukk, Margus; Menon, Suraj; McLaren, William M; Stefflova, Klara; Watt, Stephen; Weirauch, Matthew T; Crossley, Merlin; Marioni, John C; Odom, Duncan T; Flicek, Paul; Wilson, Michael D

    2014-01-01

    As exome sequencing gives way to genome sequencing, the need to interpret the function of regulatory DNA becomes increasingly important. To test whether evolutionary conservation of cis-regulatory modules (CRMs) gives insight into human gene regulation, we determined transcription factor (TF) binding locations of four liver-essential TFs in liver tissue from human, macaque, mouse, rat, and dog. Approximately, two thirds of the TF-bound regions fell into CRMs. Less than half of the human CRMs were found as a CRM in the orthologous region of a second species. Shared CRMs were associated with liver pathways and disease loci identified by genome-wide association studies. Recurrent rare human disease causing mutations at the promoters of several blood coagulation and lipid metabolism genes were also identified within CRMs shared in multiple species. This suggests that multi-species analyses of experimentally determined combinatorial TF binding will help identify genomic regions critical for tissue-specific gene control. DOI: http://dx.doi.org/10.7554/eLife.02626.001 PMID:25279814

  13. First Insights into the Subterranean Crustacean Bathynellacea Transcriptome: Transcriptionally Reduced Opsin Repertoire and Evidence of Conserved Homeostasis Regulatory Mechanisms

    PubMed Central

    Kim, Bo-Mi; Kang, Seunghyun; Ahn, Do-Hwan; Kim, Jin-Hyoung; Ahn, Inhye; Lee, Chi-Woo; Cho, Joo-Lae; Min, Gi-Sik; Park, Hyun

    2017-01-01

    Bathynellacea (Crustacea, Syncarida, Parabathynellidae) are subterranean aquatic crustaceans that typically inhabit freshwater interstitial spaces (e.g., groundwater) and are occasionally found in caves and even hot springs. In this study, we sequenced the whole transcriptome of Allobathynella bangokensis using RNA-seq. De novo sequence assembly produced 74,866 contigs including 28,934 BLAST hits. Overall, the gene sequences were most similar to those of the waterflea Daphnia pulex. In the A. bangokensis transcriptome, no opsin or related sequences were identified, and no contig aligned to the crustacean visual opsins and non-visual opsins (i.e. arthropsins, peropsins, and melaopsins), suggesting potential regressive adaptation to the dark environment. However, A. bangokensis expressed conserved gene family sets, such as heat shock proteins and those related to key innate immunity pathways and antioxidant defense systems, at the transcriptional level, suggesting that this species has evolved adaptations involving molecular mechanisms of homeostasis. The transcriptomic information of A. bangokensis will be useful for investigating molecular adaptations and response mechanisms to subterranean environmental conditions. PMID:28107438

  14. Cytokinin Response Factor 5 has transcriptional activity governed by its C-terminal domain.

    PubMed

    Striberny, Bernd; Melton, Anthony E; Schwacke, Rainer; Krause, Kirsten; Fischer, Karsten; Goertzen, Leslie R; Rashotte, Aaron M

    2017-02-01

    Cytokinin Response Factors (CRFs) are AP2/ERF transcription factors involved in cytokinin signal transduction. CRF proteins consist of a N-terminal dimerization domain (CRF domain), an AP2 DNA-binding domain, and a clade-specific C-terminal region of unknown function. Using a series of sequential deletions in yeast-2-hybrid assays, we provide evidence that the C-terminal region of Arabidopsis CRF5 can confer transactivation activity. Although comparative analyses identified evolutionarily conserved protein sequence within the C-terminal region, deletion experiments suggest that this transactivation domain has a partially redundant modular structure required for activation of target gene transcription.

  15. Inferring Functional Relationships from Conservation of Gene Order.

    PubMed

    Moreno-Hagelsieb, Gabriel

    2017-01-01

    Predicting functional associations using the Gene Neighbor Method depends on the simple idea that if genes are conserved next to each other in evolutionarily distant prokaryotes they might belong to a polycistronic transcription unit. The procedure presented in this chapter starts with the organization of the genes within genomes into pairs of adjacent genes. Then, the pairs of adjacent genes in a genome of interest are mapped to their corresponding orthologs in other, informative, genomes. The final step is to verify if the mapped orthologs are also pairs of adjacent genes in the informative genomes.

  16. The evolutionarily stable distribution of fitness effects.

    PubMed

    Rice, Daniel P; Good, Benjamin H; Desai, Michael M

    2015-05-01

    The distribution of fitness effects (DFE) of new mutations is a key parameter in determining the course of evolution. This fact has motivated extensive efforts to measure the DFE or to predict it from first principles. However, just as the DFE determines the course of evolution, the evolutionary process itself constrains the DFE. Here, we analyze a simple model of genome evolution in a constant environment in which natural selection drives the population toward a dynamic steady state where beneficial and deleterious substitutions balance. The distribution of fitness effects at this steady state is stable under further evolution and provides a natural null expectation for the DFE in a population that has evolved in a constant environment for a long time. We calculate how the shape of the evolutionarily stable DFE depends on the underlying population genetic parameters. We show that, in the absence of epistasis, the ratio of beneficial to deleterious mutations of a given fitness effect obeys a simple relationship independent of population genetic details. Finally, we analyze how the stable DFE changes in the presence of a simple form of diminishing-returns epistasis.

  17. The Evolutionarily Stable Distribution of Fitness Effects

    PubMed Central

    Rice, Daniel P.; Good, Benjamin H.; Desai, Michael M.

    2015-01-01

    The distribution of fitness effects (DFE) of new mutations is a key parameter in determining the course of evolution. This fact has motivated extensive efforts to measure the DFE or to predict it from first principles. However, just as the DFE determines the course of evolution, the evolutionary process itself constrains the DFE. Here, we analyze a simple model of genome evolution in a constant environment in which natural selection drives the population toward a dynamic steady state where beneficial and deleterious substitutions balance. The distribution of fitness effects at this steady state is stable under further evolution and provides a natural null expectation for the DFE in a population that has evolved in a constant environment for a long time. We calculate how the shape of the evolutionarily stable DFE depends on the underlying population genetic parameters. We show that, in the absence of epistasis, the ratio of beneficial to deleterious mutations of a given fitness effect obeys a simple relationship independent of population genetic details. Finally, we analyze how the stable DFE changes in the presence of a simple form of diminishing-returns epistasis. PMID:25762525

  18. A Phylogenetically Conserved Group of Nuclear Factor-Y Transcription Factors Interact to Control Nodulation in Legumes1[OPEN

    PubMed Central

    Laloum, Tom; Lepage, Agnès; Ariel, Federico; Frances, Lisa; Gamas, Pascal; de Carvalho-Niebel, Fernanda

    2015-01-01

    The endosymbiotic association between legumes and soil bacteria called rhizobia leads to the formation of a new root-derived organ called the nodule in which differentiated bacteria convert atmospheric nitrogen into a form that can be assimilated by the host plant. Successful root infection by rhizobia and nodule organogenesis require the activation of symbiotic genes that are controlled by a set of transcription factors (TFs). We recently identified Medicago truncatula nuclear factor-YA1 (MtNF-YA1) and MtNF-YA2 as two M. truncatula TFs playing a central role during key steps of the Sinorhizobium meliloti-M. truncatula symbiotic interaction. NF-YA TFs interact with NF-YB and NF-YC subunits to regulate target genes containing the CCAAT box consensus sequence. In this study, using a yeast two-hybrid screen approach, we identified the NF-YB and NF-YC subunits able to interact with MtNF-YA1 and MtNF-YA2. In yeast (Saccharomyces cerevisiae) and in planta, we further demonstrated by both coimmunoprecipitation and bimolecular fluorescence complementation that these NF-YA, -B, and -C subunits interact and form a stable NF-Y heterotrimeric complex. Reverse genetic and chromatin immunoprecipitation-PCR approaches revealed the importance of these newly identified NF-YB and NF-YC subunits for rhizobial symbiosis and binding to the promoter of MtERN1 (for Ethylene Responsive factor required for Nodulation), a direct target gene of MtNF-YA1 and MtNF-YA2. Finally, we verified that a similar trimer is formed in planta by the common bean (Phaseolus vulgaris) NF-Y subunits, revealing the existence of evolutionary conserved NF-Y protein complexes to control nodulation in leguminous plants. This sheds light on the process whereby an ancient heterotrimeric TF mainly controlling cell division in animals has acquired specialized functions in plants. PMID:26432878

  19. A Phylogenetically Conserved Group of Nuclear Factor-Y Transcription Factors Interact to Control Nodulation in Legumes.

    PubMed

    Baudin, Maël; Laloum, Tom; Lepage, Agnès; Rípodas, Carolina; Ariel, Federico; Frances, Lisa; Crespi, Martin; Gamas, Pascal; Blanco, Flavio Antonio; Zanetti, Maria Eugenia; de Carvalho-Niebel, Fernanda; Niebel, Andreas

    2015-12-01

    The endosymbiotic association between legumes and soil bacteria called rhizobia leads to the formation of a new root-derived organ called the nodule in which differentiated bacteria convert atmospheric nitrogen into a form that can be assimilated by the host plant. Successful root infection by rhizobia and nodule organogenesis require the activation of symbiotic genes that are controlled by a set of transcription factors (TFs). We recently identified Medicago truncatula nuclear factor-YA1 (MtNF-YA1) and MtNF-YA2 as two M. truncatula TFs playing a central role during key steps of the Sinorhizobium meliloti-M. truncatula symbiotic interaction. NF-YA TFs interact with NF-YB and NF-YC subunits to regulate target genes containing the CCAAT box consensus sequence. In this study, using a yeast two-hybrid screen approach, we identified the NF-YB and NF-YC subunits able to interact with MtNF-YA1 and MtNF-YA2. In yeast (Saccharomyces cerevisiae) and in planta, we further demonstrated by both coimmunoprecipitation and bimolecular fluorescence complementation that these NF-YA, -B, and -C subunits interact and form a stable NF-Y heterotrimeric complex. Reverse genetic and chromatin immunoprecipitation-PCR approaches revealed the importance of these newly identified NF-YB and NF-YC subunits for rhizobial symbiosis and binding to the promoter of MtERN1 (for Ethylene Responsive factor required for Nodulation), a direct target gene of MtNF-YA1 and MtNF-YA2. Finally, we verified that a similar trimer is formed in planta by the common bean (Phaseolus vulgaris) NF-Y subunits, revealing the existence of evolutionary conserved NF-Y protein complexes to control nodulation in leguminous plants. This sheds light on the process whereby an ancient heterotrimeric TF mainly controlling cell division in animals has acquired specialized functions in plants.

  20. Transcription of mammalian cytochrome c oxidase subunit IV-2 is controlled by a novel conserved oxygen responsive element.

    PubMed

    Hüttemann, Maik; Lee, Icksoo; Liu, Jenney; Grossman, Lawrence I

    2007-11-01

    Subunit 4 of cytochrome c oxidase (CcO) is a nuclear-encoded regulatory subunit of the terminal complex of the mitochondrial electron transport chain. We have recently discovered an isoform of CcO 4 (CcO4-2) which is specific to lung and trachea, and is induced after birth. The role of CcO as the major cellular oxygen consumer, and the lung-specific expression of CcO4-2, led us to investigate CcO4-2 gene regulation. We cloned the CcO4-2 promoter regions of cow, rat and mouse and compared them with the human promoter. Promoter activity is localized within a 118-bp proximal region of the human promoter and is stimulated by hypoxia, reaching a maximum (threefold) under 4% oxygen compared with normoxia. CcO4-2 oxygen responsiveness was assigned by mutagenesis to a novel promoter element (5'-GGACGTTCCCACG-3') that lies within a 24-bp region that is 79% conserved in all four species. This element is able to bind protein, and competition experiments revealed that, within the element, the four core bases 5'-TCNCA-3' are obligatory for transcription factor binding. CcO isolated from lung showed a 2.5-fold increased maximal turnover compared with liver CcO. We propose that CcO4-2 expression in highly oxygenated lung and trachea protects these tissues from oxidative damage by accelerating the last step in the electron transport chain, leading to a decrease in available electrons for free radical formation.

  1. Lipopolysaccharide-induced inhibition of transcription of tlr4 in vitro is reversed by dexamethasone and correlates with presence of conserved NFκB binding sites

    SciTech Connect

    Bonin, Camila P.; Baccarin, Raquel Y.A.; Nostell, Katarina; Nahum, Laila A.; Fossum, Caroline; Camargo, Maristela M. de

    2013-03-08

    Highlights: ► Chimpanzees, horses and humans have regions of similarity on TLR4 and MD2 promoters. ► Rodents have few regions of similarity on TLR4 promoter when compared to primates. ► Conserved NFkB binding sites were found in the promoters of TLR4 and MD2. ► LPS-induced inhibition of TLR4 transcription is reversed by dexamethasone. ► LPS-induced transcription of MD2 is inhibited by dexamethasone. -- Abstract: Engagement of Toll-like receptor 4 (TLR4) by lipopolysaccharide (LPS) is a master trigger of the deleterious effects of septic shock. Horses and humans are considered the most sensitive species to septic shock, but the mechanisms explaining these phenomena remain elusive. Analysis of tlr4 promoters revealed high similarity among LPS-sensitive species (human, chimpanzee, and horse) and low similarity with LPS-resistant species (mouse and rat). Four conserved nuclear factor kappa B (NFκB) binding sites were found in the tlr4 promoter and two in the md2 promoter sequences that are likely to be targets for dexamethasone regulation. In vitro treatment of equine peripheral blood mononuclear cells (eqPBMC) with LPS decreased transcripts of tlr4 and increased transcription of md2 (myeloid differentiation factor 2) and cd14 (cluster of differentiation 14). Treatment with dexamethasone rescued transcription of tlr4 after LPS inhibition. LPS-induced transcription of md2 was inhibited in the presence of dexamethasone. Dexamethasone alone did not affect transcription of tlr4 and md2.

  2. Prediction of the general transcription factors associated with RNA polymerase II in Plasmodium falciparum: conserved features and differences relative to other eukaryotes

    PubMed Central

    Callebaut, Isabelle; Prat, Karine; Meurice, Edwige; Mornon, Jean-Paul; Tomavo, Stanislas

    2005-01-01

    Background To date, only a few transcription factors have been identified in the genome of the parasite Plasmodium falciparum, the causative agent of malaria. Moreover, no detailed molecular analysis of its basal transcription machinery, which is otherwise well-conserved in the crown group of eukaryotes, has yet been reported. In this study, we have used a combination of sensitive sequence analysis methods to predict the existence of several parasite encoded general transcription factors associated with RNA polymerase II. Results Several orthologs of general transcription factors associated with RNA polymerase II can be predicted among the hypothetical proteins of the P. falciparum genome using the two-dimensional Hydrophobic Cluster Analysis (HCA) together with profile-based search methods (PSI-BLAST). These predicted orthologous genes encoding putative transcription factors include the large subunit of TFIIA and two candidates for its small subunit, the TFIIE β-subunit, which would associate with the previously known TFIIE α-subunit, the TFIIF β-subunit, as well as the p62/TFB1 subunit of the TFIIH core. Within TFIID, the putative orthologs of TAF1, TAF2, TAF7 and TAF10 were also predicted. However, no candidates for TAFs with classical histone fold domain (HFD) were found, suggesting an unusual architecture of TFIID complex of RNA polymerase II in the parasite. Conclusion Taken together, these results suggest that more general transcription factors may be present in the P. falciparum proteome than initially thought. The prediction of these orthologous general transcription factors opens the way for further studies dealing with transcriptional regulation in P. falciparum. These alternative and sensitive sequence analysis methods can help to identify candidates for other transcriptional regulatory factors in P. falciparum. They will also facilitate the prediction of biological functions for several orphan proteins from other apicomplexan parasites such as

  3. Uncovering ancient transcription systems with a novel evolutionary indicator

    PubMed Central

    Adachi, Naruhiko; Senda, Toshiya; Horikoshi, Masami

    2016-01-01

    TBP and TFIIB are evolutionarily conserved transcription initiation factors in archaea and eukaryotes. Information about their ancestral genes would be expected to provide insight into the origin of the RNA polymerase II-type transcription apparatus. In obtaining such information, the nucleotide sequences of current genes of both archaea and eukaryotes should be included in the analysis. However, the present methods of evolutionary analysis require that a subset of the genes should be excluded as an outer group. To overcome this limitation, we propose an innovative concept for evolutionary analysis that does not require an outer group. This approach utilizes the similarity in intramolecular direct repeats present in TBP and TFIIB as an evolutionary measure revealing the degree of similarity between the present offspring genes and their ancestors. Information on the properties of the ancestors and the order of emergence of TBP and TFIIB was also revealed. These findings imply that, for evolutionarily early transcription systems billions of years ago, interaction of RNA polymerase II with transcription initiation factors and the regulation of its enzymatic activity was required prior to the accurate positioning of the enzyme. Our approach provides a new way to discuss mechanistic and system evolution in a quantitative manner. PMID:27307191

  4. A comparative analysis of distribution and conservation of microsatellites in the transcripts of sequenced Fusarium species and development of genic-SSR markers for polymorphism analysis.

    PubMed

    Mahfooz, Sahil; Srivastava, Arpita; Srivastava, Alok K; Arora, Dilip K

    2015-09-01

    We used an in silico approach to survey and compare microsatellites in transcript sequences of four sequenced members of genus Fusarium. G + C content of transcripts was found to be positively correlated with the frequency of SSRs. Our analysis revealed that, in all the four transcript sequences studied, the occurrence, relative abundance and density of microsatellites varied and was not influenced by transcript sizes. No correlation between relative abundance and transcript sizes was observed. The relative abundance and density of microsatellites were highest in the transcripts of Fusarium solani when compared with F. graminearum, F. verticillioides and F. oxysporum. The maximum frequency of SSRs among all four sequence sets was of trinucleotide repeats (67.8%), whereas the dinucleotide repeat represents <1%. Among all classes of repeats, 36.5% motifs were found conserved within Fusarium species. In order to study polymorphism within Fusarium isolates, 11 polymorphic genic-SSR markers were developed. Of the 11 markers, 5 were from F. oxysporum and remaining 6 belongs to F. solani. SSR markers from F. oxysporum were found to be more polymorphic (38%) as compared to F. solani (26%). Eleven polymorphic markers obtained in this study clearly demonstrate the utility of newly developed SSR markers in establishing genetic relationships among different isolates of Fusarium.

  5. Genome-wide analysis reveals conserved transcriptional responses downstream of resting potential change in Xenopus embryos, axolotl regeneration, and human mesenchymal cell differentiation.

    PubMed

    Pai, Vaibhav P; Martyniuk, Christopher J; Echeverri, Karen; Sundelacruz, Sarah; Kaplan, David L; Levin, Michael

    2016-02-01

    Endogenous bioelectric signaling via changes in cellular resting potential (V mem) is a key regulator of patterning during regeneration and embryogenesis in numerous model systems. Depolarization of V mem has been functionally implicated in dedifferentiation, tumorigenesis, anatomical re-specification, and appendage regeneration. However, no unbiased analyses have been performed to understand genome-wide transcriptional responses to V mem change in vivo. Moreover, it is unknown which genes or gene networks represent conserved targets of bioelectrical signaling across different patterning contexts and species. Here, we use microarray analysis to comparatively analyze transcriptional responses to V mem depolarization. We compare the response of the transcriptome during embryogenesis (Xenopus development), regeneration (axolotl regeneration), and stem cell differentiation (human mesenchymal stem cells in culture) to identify common networks across model species that are associated with depolarization. Both subnetwork enrichment and PANTHER analyses identified a number of key genetic modules as targets of V mem change, and also revealed important (well-conserved) commonalities in bioelectric signal transduction, despite highly diverse experimental contexts and species. Depolarization regulates specific transcriptional networks across all three germ layers (ectoderm, mesoderm, and endoderm) such as cell differentiation and apoptosis, and this information will be used for developing mechanistic models of bioelectric regulation of patterning. Moreover, our analysis reveals that V mem change regulates transcripts related to important disease pathways such as cancer and neurodegeneration, which may represent novel targets for emerging electroceutical therapies.

  6. Genome‐wide analysis reveals conserved transcriptional responses downstream of resting potential change in Xenopus embryos, axolotl regeneration, and human mesenchymal cell differentiation

    PubMed Central

    Pai, Vaibhav P.; Martyniuk, Christopher J.; Echeverri, Karen; Sundelacruz, Sarah; Kaplan, David L.

    2015-01-01

    Abstract Endogenous bioelectric signaling via changes in cellular resting potential (V mem) is a key regulator of patterning during regeneration and embryogenesis in numerous model systems. Depolarization of V mem has been functionally implicated in dedifferentiation, tumorigenesis, anatomical re‐specification, and appendage regeneration. However, no unbiased analyses have been performed to understand genome‐wide transcriptional responses to V mem change in vivo. Moreover, it is unknown which genes or gene networks represent conserved targets of bioelectrical signaling across different patterning contexts and species. Here, we use microarray analysis to comparatively analyze transcriptional responses to V mem depolarization. We compare the response of the transcriptome during embryogenesis (Xenopus development), regeneration (axolotl regeneration), and stem cell differentiation (human mesenchymal stem cells in culture) to identify common networks across model species that are associated with depolarization. Both subnetwork enrichment and PANTHER analyses identified a number of key genetic modules as targets of V mem change, and also revealed important (well‐conserved) commonalities in bioelectric signal transduction, despite highly diverse experimental contexts and species. Depolarization regulates specific transcriptional networks across all three germ layers (ectoderm, mesoderm, and endoderm) such as cell differentiation and apoptosis, and this information will be used for developing mechanistic models of bioelectric regulation of patterning. Moreover, our analysis reveals that V mem change regulates transcripts related to important disease pathways such as cancer and neurodegeneration, which may represent novel targets for emerging electroceutical therapies. PMID:27499876

  7. Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

    NASA Technical Reports Server (NTRS)

    Romano, Laura A.; Wray, Gregory A.

    2003-01-01

    Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

  8. Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

    NASA Technical Reports Server (NTRS)

    Romano, Laura A.; Wray, Gregory A.

    2003-01-01

    Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

  9. Nucleotide sequence conservation of novel and established cis-regulatory sites within the tyrosine hydroxylase gene promoter

    PubMed Central

    Wang, Meng; Banerjee, Kasturi; Baker, Harriet; Cave, John W.

    2015-01-01

    Tyrosine hydroxylase (TH) is the rate-limiting enzyme in catecholamine biosynthesis and its gene proximal promoter ( < 1 kb upstream from the transcription start site) is essential for regulating transcription in both the developing and adult nervous systems. Several putative regulatory elements within the TH proximal promoter have been reported, but evolutionary conservation of these elements has not been thoroughly investigated. Since many vertebrate species are used to model development, function and disorders of human catecholaminergic neurons, identifying evolutionarily conserved transcription regulatory mechanisms is a high priority. In this study, we align TH proximal promoter nucleotide sequences from several vertebrate species to identify evolutionarily conserved motifs. This analysis identified three elements (a TATA box, cyclic AMP response element (CRE) and a 5′-GGTGG-3′ site) that constitute the core of an ancient vertebrate TH promoter. Focusing on only eutherian mammals, two regions of high conservation within the proximal promoter were identified: a ∼250 bp region adjacent to the transcription start site and a ∼85 bp region located approximately 350 bp further upstream. Within both regions, conservation of previously reported cis-regulatory motifs and human single nucleotide variants was evaluated. Transcription reporter assays in a TH -expressing cell line demonstrated the functionality of highly conserved motifs in the proximal promoter regions and electromobility shift assays showed that brain-region specific complexes assemble on these motifs. These studies also identified a non-canonical CRE binding (CREB) protein recognition element in the proximal promoter. Together, these studies provide a detailed analysis of evolutionary conservation within the TH promoter and identify potential cis-regulatory motifs that underlie a core set of regulatory mechanisms in mammals. PMID:25774193

  10. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    SciTech Connect

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.; Salzberg, Steven L.; Rubin, Gerald M.; Eisen, Michael B.; Celniker, SusanE.

    2004-08-06

    Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.

  11. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    SciTech Connect

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.; Salzberg, Steven L.; Rubin, Gerald M.; Eisen, Michael B.; Celniker, SusanE.

    2004-08-06

    The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.

  12. Identification of new TSGA10 transcript variants in human testis with conserved regulatory RNA elements in 5'untranslated region and distinct expression in breast cancer.

    PubMed

    Salehipour, Pouya; Nematzadeh, Mahsa; Mobasheri, Maryam Beigom; Afsharpad, Mandana; Mansouri, Kamran; Modarressi, Mohammad Hossein

    2017-09-01

    Testis specific gene antigen 10 (TSGA10) is a cancer testis antigen involved in the process of spermatogenesis. TSGA10 could also play an important role in the inhibition of angiogenesis by preventing nuclear localization of HIF-1α. Although it has been shown that TSGA10 messenger RNA (mRNA) is mainly expressed in testis and some tumors, the transcription pattern and regulatory mechanisms of this gene remain largely unknown. Here, we report that human TSGA10 comprises at least 22 exons and generates four different transcript variants. It was identified that using two distinct promoters and splicing of exons 4 and 7 produced these transcript variants, which have the same coding sequence, but the sequence of 5'untanslated region (5'UTR) is different between them. This is significant because conserved regulatory RNA elements like upstream open reading frame (uORF) and putative internal ribosome entry site (IRES) were found in this region which have different combinations in each transcript variant and it may influence translational efficiency of them in normal or unusual environmental conditions like hypoxia. To indicate the transcription pattern of TSGA10 in breast cancer, expression of identified transcript variants was analyzed in 62 breast cancer samples. We found that TSGA10 tends to express variants with shorter 5'UTR and fewer uORF elements in breast cancer tissues. Our study demonstrates for the first time the expression of different TSGA10 transcript variants in testis and breast cancer tissues and provides a first clue to a role of TSGA10 5'UTR in regulation of translation in unusual environmental conditions like hypoxia. Copyright © 2017. Published by Elsevier B.V.

  13. Amino Acids of Epstein-Barr Virus Nuclear Antigen 3A Essential for Repression of Jκ-Mediated Transcription and Their Evolutionary Conservation

    PubMed Central

    Dalbiès-Tran, Rozenn; Stigger-Rosser, Evelyn; Dotson, Travis; Sample, Clare E.

    2001-01-01

    Epstein-Barr virus (EBV) nuclear antigen 3A (EBNA-3A) is essential for virus-mediated immortalization of B lymphocytes in vitro and is believed to regulate transcription of cellular and/or viral genes. One known mechanism of regulation is through its interaction with the cellular transcription factor Jκ. This interaction downregulates transcription mediated by EBNA-2 and Jκ. To identify the amino acids that play a role in this interaction, we have generated mutant EBNA-3A proteins. A mutant EBNA-3A protein in which alanine residues were substituted for amino acids 199, 200, and 202 no longer downregulated transcription. Surprisingly, this mutant protein remained able to coimmunoprecipitate with Jκ. Using a reporter gene assay based on the recruitment of Jκ by various regions spanning EBNA-3A, we have shown that this mutation abolished binding of Jκ to the N-proximal region (amino acids 125 to 222) and that no other region of EBNA-3A alone was sufficient to mediate an association with Jκ. To determine the biological significance of the interaction of EBNA-3A with Jκ, we have studied its conservation in the simian lymphocryptovirus herpesvirus papio (HVP) by cloning HVP-3A, the homolog of EBNA-3A encoded by this virus. This 903-amino-acid protein exhibited 37% identity with its EBV counterpart, mainly within the amino-terminal half. HVP-3A also interacted with Jκ through a region located between amino acids 127 and 223 and also repressed transcription mediated through EBNA-2 and Jκ. The evolutionary conservation of this function, in proteins that have otherwise significantly diverged, argues strongly for an important biological role in virus-mediated immortalization of B lymphocytes. PMID:11119577

  14. Transcriptional Control of the TNF Gene

    PubMed Central

    Falvo, James V.; Tsytsykova, Alla V.; Goldfeld, Anne E.

    2016-01-01

    The cytokine TNF is a critical mediator of immune and inflammatory responses. The TNF gene is an immediate early gene, rapidly transcribed in a variety of cell types following exposure to a broad range of pathogens and signals of inflammation and stress. Regulation of TNF gene expression at the transcriptional level is cell type- and stimulus-specific, involving the recruitment of distinct sets of transcription factors to a compact and modular promoter region. In this review, we describe our current understanding of the mechanisms through which TNF transcription is specifically activated by a variety of extracellular stimuli in multiple cell types, including T cells, B cells, macrophages, mast cells, dendritic cells, and fibroblasts. We discuss the role of nuclear factor of activated T cells and other transcription factors and coactivators in enhanceosome formation, as well as the contradictory evidence for a role for nuclear factor κB as a classical activator of the TNF gene. We describe the impact of evolutionarily conserved cis-regulatory DNA motifs in the TNF locus upon TNF gene transcription, in contrast to the neutral effect of single nucleotide polymorphisms. We also assess the regulatory role of chromatin organization, epigenetic modifications, and long-range chromosomal interactions at the TNF locus. PMID:20173386

  15. Differential conservation of transcriptional domains of mammalian Prophet of Pit-1 proteins revealed by structural studies of the bovine gene and comparative functional analysis of the protein.

    PubMed

    Showalter, Aaron D; Smith, Timothy P L; Bennett, Gary L; Sloop, Kyle W; Whitsett, Julie A; Rhodes, Simon J

    2002-05-29

    The Prophet of Pit-1 (PROP1) gene encodes a paired class homeodomain transcription factor that is exclusively expressed in the developing mammalian pituitary gland. PROP1 function is essential for anterior pituitary organogenesis, and heritable mutations in the gene are associated with combined pituitary hormone deficiency in human patients and animals. By cloning the bovine PROP1 gene and by comparative analysis, we demonstrate that the homeodomains and carboxyl termini of mammalian PROP1 proteins are highly conserved while the amino termini are diverged. Whereas the carboxyl termini of the human and bovine PROP1 proteins contain potent transcriptional activation domains, the amino termini and homeodomains have repressive activities. The bovine PROP1 gene has four exons and three introns and maps to a region of chromosome seven carrying a quantitative trait locus affecting ovulation rate. Two alleles of the bovine gene were found that encode distinct protein products with different DNA binding and transcriptional activities. These experiments demonstrate that mammalian PROP1 genes encode proteins with complex regulatory capacities and that modest changes in protein sequence can significantly alter the activity of this pituitary developmental transcription factor.

  16. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  17. INO80-dependent regression of ecdysone-induced transcriptional responses regulates developmental timing in Drosophila.

    PubMed

    Neuman, Sarah D; Ihry, Robert J; Gruetzmacher, Kelly M; Bashirullah, Arash

    2014-03-15

    Sequential pulses of the steroid hormone ecdysone regulate the major developmental transitions in Drosophila, and the duration of each developmental stage is determined by the length of time between ecdysone pulses. Ecdysone regulates biological responses by directly initiating target gene transcription. In turn, these transcriptional responses are known to be self-limiting, with mechanisms in place to ensure regression of hormone-dependent transcription. However, the biological significance of these transcriptional repression mechanisms remains unclear. Here we show that the chromatin remodeling protein INO80 facilitates transcriptional repression of ecdysone-regulated genes during prepupal development. In ino80 mutant animals, inefficient repression of transcriptional responses to the late larval ecdysone pulse delays the onset of the subsequent prepupal ecdysone pulse, resulting in a significantly longer prepupal stage. Conversely, increased expression of ino80 is sufficient to shorten the prepupal stage by increasing the rate of transcriptional repression. Furthermore, we demonstrate that enhancing the rate of regression of the mid-prepupal competence factor βFTZ-F1 is sufficient to determine the timing of head eversion and thus the duration of prepupal development. Although ino80 is conserved from yeast to humans, this study represents the first characterization of a bona fide ino80 mutation in any metazoan, raising the possibility that the functions of ino80 in transcriptional repression and developmental timing are evolutionarily conserved.

  18. Invited Commentary: Integrating Genomics and Social Epidemiology-Analysis of Late-Life Low Socioeconomic Status and the Conserved Transcriptional Response to Adversity.

    PubMed

    Belsky, Daniel W; Snyder-Mackler, Noah

    2017-09-01

    Socially disadvantaged children face increased morbidity and mortality as they age. Understanding mechanisms through which social disadvantage becomes biologically embedded and devising measurements that can track this embedding are critical priorities for research to address social gradients in health. The analysis by Levine et al. (Am J Epidemiol. 2017;186(5):503-509) of genome-wide gene expression in a subsample of US Health and Retirement Study participants suggests important new directions for the field. Specifically, findings suggest promise in integrating gene expression data into population studies and provide further evidence for the conserved transcriptional response to adversity as a marker of biological embedding of social disadvantage. The study also highlights methodological issues related to the analysis of gene expression data and social gradients in health and a need to examine the conserved transcriptional response to adversity alongside other proposed measurements of biological embedding. Looking to the future, advances in genome science are opening new opportunities for sociogenomic epidemiology. © The Author(s) 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Conservation of the sizes of 53 introns and over 100 intronic sequences for the binding of common transcription factors in the human and mouse genes for type II procollagen (COL2A1).

    PubMed Central

    Ala-Kokko, L; Kvist, A P; Metsäranta, M; Kivirikko, K I; de Crombrugghe, B; Prockop, D J; Vuorio, E

    1995-01-01

    Over 11,000 bp of previously undefined sequences of the human COL2A1 gene were defined. The results made it possible to compare the intron structures of a highly complex gene from man and mouse. Surprisingly, the sizes of the 53 introns of the two genes were highly conserved with a mean difference of 13%. After alignment of the sequences, 69% of the intron sequences were identical. The introns contained consensus sequences for the binding of over 100 different transcription factors that were conserved in the introns of the two genes. The first intron of the gene contained 80 conserved consensus sequences and the remaining 52 introns of the gene contained 106 conserved sequences for the binding of transcription factors. The 5'-end of intron 2 in both genes had a potential for forming a stem loop in RNA transcripts. Images Figure 4 PMID:8948452

  20. Transcription factors that influence RNA polymerases I and II: To what extent is mechanism of action conserved?

    PubMed

    Zhang, Yinfeng; Najmi, Saman M; Schneider, David A

    2017-02-01

    In eukaryotic cells, nuclear RNA synthesis is accomplished by at least three unique, multisubunit RNA polymerases. The roles of these enzymes are generally partitioned into the synthesis of the three major classes of RNA: rRNA, mRNA, and tRNA for RNA polymerases I, II, and III respectively. Consistent with their unique cellular roles, each enzyme has a complement of specialized transcription factors and enzymatic properties. However, not all transcription factors have evolved to affect only one eukaryotic RNA polymerase. In fact, many factors have been shown to influence the activities of multiple nuclear RNA polymerases. This review focuses on a subset of these factors, specifically addressing the mechanisms by which these proteins influence RNA polymerases I and II.

  1. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E

    1986-01-01

    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  2. The conserved histone deacetylase Rpd3 and the DNA binding regulator Ume6 repress BOI1's meiotic transcript isoform during vegetative growth in Saccharomyces cerevisiae.

    PubMed

    Liu, Yuchen; Stuparevic, Igor; Xie, Bingning; Becker, Emmanuelle; Law, Michael J; Primig, Michael

    2015-05-01

    BOI1 and BOI2 are paralogs important for the actin cytoskeleton and polar growth. BOI1 encodes a meiotic transcript isoform with an extended 5'-untranslated region predicted to impair protein translation. It is, however, unknown how the isoform is repressed during mitosis, and if Boi1 is present during sporulation. By interpreting microarray data from MATa cells, MATa/α cells, a starving MATα/α control, and a meiosis-impaired rrp6 mutant, we classified BOI1's extended isoform as early meiosis-specific. These results were confirmed by RNA-Sequencing, and extended by a 5'-RACE assay and Northern blotting, showing that meiotic cells induce the long isoform while the mitotic isoform remains detectable during meiosis. We provide evidence via motif predictions, an in vivo binding assay and genetic experiments that the Rpd3/Sin3/Ume6 histone deacetylase complex, which represses meiotic genes during mitosis, also prevents the induction of BOI1's 5'-extended isoform in mitosis by direct binding of Ume6 to its URS1 target. Finally, we find that Boi1 protein levels decline when cells switch from fermentation to respiration and sporulation. The histone deacetylase Rpd3 is conserved, and eukaryotic genes frequently encode transcripts with variable 5'-UTRs. Our findings are therefore relevant for regulatory mechanisms involved in the control of transcript isoforms in multi-cellular organisms. © 2015 John Wiley & Sons Ltd.

  3. Genomic and Biochemical Insights into the Specificity of ETS Transcription Factors

    PubMed Central

    Hollenhorst, Peter C.; McIntosh, Lawrence P.; Graves, Barbara J.

    2017-01-01

    ETS proteins are a group of evolutionarily related, DNA-binding transcriptional factors. These proteins direct gene expression in diverse normal and disease states by binding to specific promoters and enhancers and facilitating assembly of other components of the transcriptional machinery. The highly conserved DNA-binding ETS domain defines the family and is responsible for specific recognition of a common sequence motif, 5′-GGA(A/T)-3′. Attaining specificity for biological regulation in such a family is thus a conundrum. We present the current knowledge of routes to functional diversity and DNA binding specificity, including divergent properties of the conserved ETS and PNT domains, the involvement of flanking structured and unstructured regions appended to these dynamic domains, posttranslational modifications, and protein partnerships with other DNA-binding proteins and coregulators. The review emphasizes recent advances from biochemical and biophysical approaches, as well as insights from genomic studies that detect ETS-factor occupancy in living cells. PMID:21548782

  4. Post-transcriptional regulation of cytokine genes in fish: A role for conserved AU-rich elements located in the 3'-untranslated region of their mRNAs.

    PubMed

    Roca, Francisco J; Cayuela, María L; Secombes, Chris J; Meseguer, José; Mulero, Victoriano

    2007-01-01

    The overproduction of cytokines, such us interleukin-1beta (IL-1beta) and tumor necrosis factor alpha (TNFalpha), contributes to the pathological complications observed in many inflammatory diseases caused by bacterial endotoxins. The synthesis of these cytokines is tightly regulated at both transcriptional and post-transcriptional levels. Post-transcriptional regulation of gene expression depends on specific cis-acting sequences and trans-acting factors. Thus, the presence of adenylate- and uridylate-rich (AU-rich) elements (AREs) has been described in the 3'-untranslated regions (UTRs) of many unstable mammalian mRNAs. Although, it represents the most widespread, phylogenetically conserved and efficient determinant of mRNA stability among those so far characterized in mammalian cells, no studies are available on the functional relevance of this sequence in non-mammalian vertebrates. In this contribution, we study the enzymatic activity of various luciferase reporter constructs, containing or lacking the 3'UTR of IL-1beta and TNFalpha from different fish species, and report the finding that bony fish AREs are able to decrease luciferase activity but are less potent than their mammalian counterparts. Surprisingly, the 3'UTR of the IL-1beta from the cartilaginous fish small spotted catshark had the greatest ability to decrease luciferase activity. Lastly, the functional significance of the above was confirmed by measuring the half-life of IL-1beta and TNFalpha mRNAs in gilthead seabream leukocytes by blocking transcription with actinomycin D. Both cytokine mRNAs were unstable with an estimated half-life of about 45 min in control and activated cells.

  5. c-Myb protein interacts with Rcd-1, a component of the CCR4 transcription mediator complex.

    PubMed

    Haas, Martin; Siegert, Michaela; Schürmann, André; Sodeik, Beate; Wolfes, Heiner

    2004-06-29

    Transcriptional initiation of eukaryotic genes depends on the cooperative interaction of various transcription factors. Using the yeast two-hybrid assay, we have identified the murine Rcd-1 protein as a cofactor of the c-myb proto-oncogene product. Rcd-1 is evolutionarily conserved among many species, and moreover the yeast homologue CAF40 is part of the carbon catabolite repressor protein transcriptional mediator thought to be involved in the negative regulation of genes transcribed by RNA polymerase II. Rcd-1 is located mainly in the nucleus, and it interacts with c-Myb both in vitro and in vivo. The activation of the myeloid c-myb-specific mim-1 promoter is repressed by Rcd-1. Interestingly, rcd-1 is an erythropoietin regulated gene, which also represses the action of the AP-1 transcription factor on its target genes.

  6. Nuclear localization and transactivation by Vitis CBF transcription factors are regulated by combinations of conserved amino acid domains.

    PubMed

    Carlow, Chevonne E; Faultless, J Trent; Lee, Christine; Siddiqua, Mahbuba; Edge, Alison; Nassuth, Annette

    2017-09-01

    The highly conserved CBF pathway is crucial in the regulation of plant responses to low temperatures. Extensive analysis of Arabidopsis CBF proteins revealed that their functions rely on several conserved amino acid domains although the exact function of each domain is disputed. The question was what functions similar domains have in CBFs from other, overwintering woody plants such as Vitis, which likely have a more involved regulation than the model plant Arabidopsis. A total of seven CBF genes were cloned and sequenced from V. riparia and the less frost tolerant V. vinifera. The deduced species-specific amino acid sequences differ in only a few amino acids, mostly in non-conserved regions. Amino acid sequence comparison and phylogenetic analysis showed two distinct groups of Vitis CBFs. One group contains CBF1, CBF2, CBF3 and CBF8 and the other group contains CBF4, CBF5 and CBF6. Transient transactivation assays showed that all Vitis CBFs except CBF5 activate via a CRT or DRE promoter element, whereby Vitis CBF3 and 4 prefer a CRT element. The hydrophobic domains in the C-terminal end of VrCBF6 were shown to be important for how well it activates. The putative nuclear localization domain of Vitis CBF1 was shown to be sufficient for nuclear localization, in contrast to previous reports for AtCBF1, and also important for transactivation. The latter highlights the value of careful analysis of domain functions instead of reliance on computer predictions and published data for other related proteins. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. A Conserved Network of Transcriptional Activators and Repressors Regulates Anthocyanin Pigmentation in Eudicots[C][W][OPEN

    PubMed Central

    Albert, Nick W.; Davies, Kevin M.; Lewis, David H.; Zhang, Huaibi; Montefiori, Mirco; Brendolise, Cyril; Boase, Murray R.; Ngo, Hanh; Jameson, Paula E.; Schwinn, Kathy E.

    2014-01-01

    Plants require sophisticated regulatory mechanisms to ensure the degree of anthocyanin pigmentation is appropriate to myriad developmental and environmental signals. Central to this process are the activity of MYB-bHLH-WD repeat (MBW) complexes that regulate the transcription of anthocyanin genes. In this study, the gene regulatory network that regulates anthocyanin synthesis in petunia (Petunia hybrida) has been characterized. Genetic and molecular evidence show that the R2R3-MYB, MYB27, is an anthocyanin repressor that functions as part of the MBW complex and represses transcription through its C-terminal EAR motif. MYB27 targets both the anthocyanin pathway genes and basic-helix-loop-helix (bHLH) ANTHOCYANIN1 (AN1), itself an essential component of the MBW activation complex for pigmentation. Other features of the regulatory network identified include inhibition of AN1 activity by the competitive R3-MYB repressor MYBx and the activation of AN1, MYB27, and MYBx by the MBW activation complex, providing for both reinforcement and feedback regulation. We also demonstrate the intercellular movement of the WDR protein (AN11) and R3-repressor (MYBx), which may facilitate anthocyanin pigment pattern formation. The fundamental features of this regulatory network in the Asterid model of petunia are similar to those in the Rosid model of Arabidopsis thaliana and are thus likely to be widespread in the Eudicots. PMID:24642943

  8. Nucleotide excision repair (NER) machinery recruitment by the transcription-repair coupling factor involves unmasking of a conserved intramolecular interface

    PubMed Central

    Deaconescu, Alexandra M.; Sevostyanova, Anastasia; Artsimovitch, Irina; Grigorieff, Nikolaus

    2012-01-01

    Transcription-coupled DNA repair targets DNA lesions that block progression of elongating RNA polymerases. In bacteria, the transcription-repair coupling factor (TRCF; also known as Mfd) SF2 ATPase recognizes RNA polymerase stalled at a site of DNA damage, removes the enzyme from the DNA, and recruits the Uvr(A)BC nucleotide excision repair machinery via UvrA binding. Previous studies of TRCF revealed a molecular architecture incompatible with UvrA binding, leaving its recruitment mechanism unclear. Here, we examine the UvrA recognition determinants of TRCF using X-ray crystallography of a core TRCF–UvrA complex and probe the conformational flexibility of TRCF in the absence and presence of nucleotides using small-angle X-ray scattering. We demonstrate that the C-terminal domain of TRCF is inhibitory for UvrA binding, but not RNA polymerase release, and show that nucleotide binding induces concerted multidomain motions. Our studies suggest that autoinhibition of UvrA binding in TRCF may be relieved only upon engaging the DNA damage. PMID:22331906

  9. Cks1-dependent proteasome recruitment and activation of CDC20 transcription in budding yeast.

    PubMed

    Morris, May C; Kaiser, Peter; Rudyak, Stanislav; Baskerville, Chris; Watson, Mark H; Reed, Steven I

    2003-06-26

    Cks proteins are small evolutionarily conserved proteins that interact genetically and physically with cyclin-dependent kinases. However, in spite of a large body of genetic, biochemical and structural research, no compelling unifying model of their functions has emerged. Here we show, by investigating the essential role of Cks1 in Saccharomyces cerevisiae, that the protein is primarily involved in promoting mitosis by modulating the transcriptional activation of the APC/C protein-ubiquitin ligase activator Cdc20. Cks1 is required for both the periodic dissociation of Cdc28 kinase from the CDC20 promoter and the periodic association of the proteasome with the promoter. We propose that the essential role of Cks1 is to recruit the proteasome to, and/or dissociate the Cdc28 kinase from, the CDC20 promoter, thus facilitating transcription by remodelling transcriptional complexes or chromatin associated with the CDC20 gene.

  10. Transcriptional coordination of hepatic autophagy by nutrient-sensing nuclear receptor PPARα and FXR

    PubMed Central

    2016-01-01

    Nuclear receptors are in general ligand-dependent transcription factors that control a variety of mammalian physiologies including development, differentiation, proliferation, and homeostasis. Recent studies have found that two nutrient-sensing nuclear receptors, peroxisome proliferator-activated receptor α and farnesoid x receptor, responding to fasting or feeding state, respectively are able to regulate autophagy, an evolutionarily conserved catabolic process involved in lysosomal degradation. In this review, we discuss the role of these nutrient-sensing nuclear receptors in an aspect of transcriptional regulation of autophagy, and how these nuclear receptor-driven transcriptional programs integrate lipophagy, a lipid autophagy with fatty acid oxidation to coordinate hepatic lipid metabolism in the fasted state of the liver. PMID:28164071

  11. Transcriptional coordination of hepatic autophagy by nutrient-sensing nuclear receptor PPARα and FXR.

    PubMed

    Lee, Jae Man

    2016-12-01

    Nuclear receptors are in general ligand-dependent transcription factors that control a variety of mammalian physiologies including development, differentiation, proliferation, and homeostasis. Recent studies have found that two nutrient-sensing nuclear receptors, peroxisome proliferator-activated receptor α and farnesoid x receptor, responding to fasting or feeding state, respectively are able to regulate autophagy, an evolutionarily conserved catabolic process involved in lysosomal degradation. In this review, we discuss the role of these nutrient-sensing nuclear receptors in an aspect of transcriptional regulation of autophagy, and how these nuclear receptor-driven transcriptional programs integrate lipophagy, a lipid autophagy with fatty acid oxidation to coordinate hepatic lipid metabolism in the fasted state of the liver.

  12. An expansive human regulatory lexicon encoded in transcription factor footprints.

    PubMed

    Neph, Shane; Vierstra, Jeff; Stergachis, Andrew B; Reynolds, Alex P; Haugen, Eric; Vernot, Benjamin; Thurman, Robert E; John, Sam; Sandstrom, Richard; Johnson, Audra K; Maurano, Matthew T; Humbert, Richard; Rynes, Eric; Wang, Hao; Vong, Shinny; Lee, Kristen; Bates, Daniel; Diegel, Morgan; Roach, Vaughn; Dunn, Douglas; Neri, Jun; Schafer, Anthony; Hansen, R Scott; Kutyavin, Tanya; Giste, Erika; Weaver, Molly; Canfield, Theresa; Sabo, Peter; Zhang, Miaohua; Balasundaram, Gayathri; Byron, Rachel; MacCoss, Michael J; Akey, Joshua M; Bender, M A; Groudine, Mark; Kaul, Rajinder; Stamatoyannopoulos, John A

    2012-09-06

    Regulatory factor binding to genomic DNA protects the underlying sequence from cleavage by DNase I, leaving nucleotide-resolution footprints. Using genomic DNase I footprinting across 41 diverse cell and tissue types, we detected 45 million transcription factor occupancy events within regulatory regions, representing differential binding to 8.4 million distinct short sequence elements. Here we show that this small genomic sequence compartment, roughly twice the size of the exome, encodes an expansive repertoire of conserved recognition sequences for DNA-binding proteins that nearly doubles the size of the human cis-regulatory lexicon. We find that genetic variants affecting allelic chromatin states are concentrated in footprints, and that these elements are preferentially sheltered from DNA methylation. High-resolution DNase I cleavage patterns mirror nucleotide-level evolutionary conservation and track the crystallographic topography of protein-DNA interfaces, indicating that transcription factor structure has been evolutionarily imprinted on the human genome sequence. We identify a stereotyped 50-base-pair footprint that precisely defines the site of transcript origination within thousands of human promoters. Finally, we describe a large collection of novel regulatory factor recognition motifs that are highly conserved in both sequence and function, and exhibit cell-selective occupancy patterns that closely parallel major regulators of development, differentiation and pluripotency.

  13. Drosophila OVO regulates ovarian tumor transcription by binding unusually near the transcription start site.

    PubMed

    Lü, J; Oliver, B

    2001-05-01

    Evolutionarily conserved ovo loci encode developmentally regulated, sequence-specific, DNA-binding, C(2)H(2)-zinc-finger proteins required in the germline and epidermal cells of flies and mice. The direct targets of OVO activity are not known. Genetic experiments suggest that ovo acts in the same regulatory network as ovarian tumor (otu), but the relative position of these genes in the pathway is controversial. Three OVO-binding sites exist in a compact regulatory region that controls germline expression of the otu gene. Interestingly, the strongest OVO-binding site is very near the otu transcription start, where basal transcriptional complexes must function. Loss-of-function, gain-of-function and promoter swapping constructs demonstrate that OVO binding near the transcription start site is required for OVO-dependent otu transcription in vivo. These data unambiguously identify otu as a direct OVO target gene and raise the tantalizing possibility that an OVO site, at the location normally occupied by basal components, functions as part of a specialized core promoter.

  14. Transcription factors and induction in Xenopus laevis embryos.

    PubMed

    Knöchel, W; Kaufmann, E

    1997-04-01

    Studies with amphibian embryos have contributed major insights into the molecular basis of induction processes and the formation of germ layers during vertebrate embryogenesis. Primary signals that have been identified as growth factors or growth factor-related ligands act as inducing factors on their target cells and, by a change of the genetic program, evoke a specification of the cellular differentiation pathways. While at present the signal transduction mechanisms leading from the ligands via cognate receptors to the nuclei are still poorly understood, there is growing information on transcription factors which are activated upon induction. They govern the expression of other regulatory molecules and co-ordinate the expression of cell type-specific structural genes. Meanwhile, it is generally accepted that development and cellular differentiation in all multicellular organisms depends upon a cascade of evolutionarily conserved transcription factors. Striking structural similarities within their DNA-binding domains allow many of these factors to be subdivided into different transcription factor families. Most of the basic knowledge on these factors emerged from the pioneering work done with Drosophila embryos which was greatly facilitated by the availability of numerous mutants. Despite the fact that Drosophila development until the blastoderm stage proceeds in a multinuclear syncytium and thus is significantly different from that in vertebrate organisms, the primary structures of many embryonic transcription factors have been conserved in higher organisms. This especially holds true for the various DNA binding motifs and it facilitated the isolation and characterization of vertebrate homologues to factors previously identified in lower organisms.