Sample records for excluding non-variable cpg

  1. 76 FR 58398 - Revised Guidance on Marketed Unapproved Drugs; Compliance Policy Guide Sec. 440.100; Marketed New...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-21

    ... enforcement action at any time, without prior notice and without regard to the enforcement priorities set... the enforcement priorities set forth in CPG 440.100 for unapproved new drugs marketed prior to September 19, 2011. The revision to CPG 440.100 excludes from the enforcement priorities set forth in the...

  2. Output variability across animals and levels in a motor system

    PubMed Central

    Norris, Brian J; Günay, Cengiz; Kueh, Daniel

    2018-01-01

    Rhythmic behaviors vary across individuals. We investigated the sources of this output variability across a motor system, from the central pattern generator (CPG) to the motor plant. In the bilaterally symmetric leech heartbeat system, the CPG orchestrates two coordinations in the bilateral hearts with different intersegmental phase relations (Δϕ) and periodic side-to-side switches. Population variability is large. We show that the system is precise within a coordination, that differences in repetitions of a coordination contribute little to population output variability, but that differences between bilaterally homologous cells may contribute to some of this variability. Nevertheless, much output variability is likely associated with genetic and life history differences among individuals. Variability of Δϕ were coordination-specific: similar at all levels in one, but significantly lower for the motor pattern than the CPG pattern in the other. Mechanisms that transform CPG output to motor neurons may limit output variability in the motor pattern. PMID:29345614

  3. Early demethylation of non-CpG, CpC-rich, elements in the myogenin 5′-flanking region

    PubMed Central

    Fuso, Andrea; Ferraguti, Giampiero; Grandoni, Francesco; Ruggeri, Raffaella; Scarpa, Sigfrido; Strom, Roberto

    2010-01-01

    The dynamic changes and structural patterns of DNA methylation of genes without CpG islands are poorly characterized. The relevance of CpG to the non-CpG methylation equilibrium in transcriptional repression is unknown. In this work, we analyzed the DNA methylation pattern of the 5′-flanking of the myogenin gene, a positive regulator of muscle differentiation with no CpG island and low CpG density, in both C2C12 muscle satellite cells and embryonic muscle. Embryonic brain was studied as a non-expressing tissue. High levels of both CpG and non-CpG methylation were observed in non-expressing experimental conditions. Both CpG and non-CpG methylation rapidly dropped during muscle differentiation and myogenin transcriptional activation with active demethylation dynamics. Non-CpG demethylation occurred more rapidly than CpG demethylation. Demethylation spread from initially highly methylated short CpC-rich elements to a virtually unmethylated status. These short elements have a high CpC content and density, share some motifs and largely coincide with putative recognition sequences of some differentiation-related transcription factors. Our findings point to a dynamically controlled equilibrium between CpG and non-CpG active demethylation in the transcriptional control of tissue-specific genes. The short CpC-rich elements are new structural features of the methylation machinery, whose functions may include priming the complete demethylation of a transcriptionally crucial DNA region. PMID:20935518

  4. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  5. Treatment of Tobacco Dependence, a Critical Gap in Czech Clinical Practice Guidelines.

    PubMed

    Zvolská, Kamila; Fraser, Keely; Zvolský, Miroslav; Králíková, Eva

    2017-06-01

    Tobacco related comorbidities and treatment of dependence are relevant to clinicians of all disciplines. Clinicians should provide a brief intervention about tobacco use with smokers at each clinical contact (success rate of 5-10 %). Intensive treatment (success rate >30%) should be available to those who need it. Brief intervention is not yet standard clinical practice. Our aim was to assess clinical practice guidelines (CPG) of selected medical professional societies to determine whether or not tobacco dependence treatment recommendations were included. Between October and December 2013, we conducted a keyword search of CPG for 20 medical professional societies in the Czech Republic. We searched for the keywords "smoking", "tobacco" and "nicotine addiction" in 91 CPG documents, which were freely available on the websites of selected professional societies. We focused specifically on CPG relating to cardiovascular and respiratory diseases as well as cancer. We excluded any CPG focused on acute conditions, diagnostics only, laboratory methods, or administration. There was no mention of smoking in 27.7% (26/94) of CPG documents. Only 16% (15/94) of CPG documents listed smoking as a risk factor. 42.5% (40/94) mentioned smoking related phrases (e.g. "smoking ban"). Only 13.8% (13/94) of CPG included a section on tobacco dependence, referenced tobacco dependence treatment guidelines or mentioned specialized treatment centres where smokers can be referred. Nearly one third of CPG related to cardiovascular and respiratory diseases as well as cancer made no mention of smoking. Despite the clinical significance of smoking, the majority of CPG did not adequately address tobacco dependence and its treatment. Copyright© by the National Institute of Public Health, Prague 2017

  6. Clinical practice guidelines (CPGs) reduce costs in the management of isolated splenic injuries at pediatric trauma centers.

    PubMed

    Gutierrez, Ivan M; Zurakowski, David; Chen, Qiaoli; Mooney, David P

    2013-02-01

    The American Pediatric Surgical Association Trauma Committee proposed the use of a clinical practice guideline (CPG) for the non-operative management of isolated splenic injuries in 1998. An analysis was conducted to determine the financial impact of CPGs on the management of these injuries. The Pediatric Health Information System database, which contains data from 44 children's hospitals, was used to identify children who sustained a graded isolated splenic injury between June 2005 and June 2010. Demographics, length of stay (LOS), readmission rates, and laboratory, imaging, procedural, and total cost data were determined for all hospitals verified as a pediatric trauma center by the American College of Surgeons and/or designated by their local authority. Comparisons were made between facilities self-identifying as having a splenic injury management CPG and those without a CPG. Children (1,154) with isolated splenic injuries (grades 1-4) were cared for in 26 pediatric trauma centers: 20 with a CPG and 6 without (non-CPG). Median costs were significantly lower at CPG than non-CPG centers for imaging (US $163 vs. US $641, P < .001), laboratory (US $629 vs. US $1,044, P < .001), and total hospital stay (US $9,868 vs. US $10,830, P < .001). The median LOS for CPG and non-CPG centers were similar (3 vs. 2 days, P = .38), as were readmission rates within 90 days (3.1 vs. 5.1 %, P = .21). Multiple linear regression indicated that LOS (P < .001) and utilization of a CPG (P = .007) are significant independent predictors of total cost. Utilization of a CPG to manage children with isolated splenic injuries at a pediatric trauma center results in significantly reduced imaging, laboratory, and total hospital costs independent of patient age, gender, grade, and LOS.

  7. Genomic Distribution and Inter-Sample Variation of Non-CpG Methylation across Human Cell Types

    PubMed Central

    Liao, Jing; Zhang, Yingying; Gu, Hongcang; Bock, Christoph; Boyle, Patrick; Epstein, Charles B.; Bernstein, Bradley E.; Lengauer, Thomas; Gnirke, Andreas; Meissner, Alexander

    2011-01-01

    DNA methylation plays an important role in development and disease. The primary sites of DNA methylation in vertebrates are cytosines in the CpG dinucleotide context, which account for roughly three quarters of the total DNA methylation content in human and mouse cells. While the genomic distribution, inter-individual stability, and functional role of CpG methylation are reasonably well understood, little is known about DNA methylation targeting CpA, CpT, and CpC (non-CpG) dinucleotides. Here we report a comprehensive analysis of non-CpG methylation in 76 genome-scale DNA methylation maps across pluripotent and differentiated human cell types. We confirm non-CpG methylation to be predominantly present in pluripotent cell types and observe a decrease upon differentiation and near complete absence in various somatic cell types. Although no function has been assigned to it in pluripotency, our data highlight that non-CpG methylation patterns reappear upon iPS cell reprogramming. Intriguingly, the patterns are highly variable and show little conservation between different pluripotent cell lines. We find a strong correlation of non-CpG methylation and DNMT3 expression levels while showing statistical independence of non-CpG methylation from pluripotency associated gene expression. In line with these findings, we show that knockdown of DNMTA and DNMT3B in hESCs results in a global reduction of non-CpG methylation. Finally, non-CpG methylation appears to be spatially correlated with CpG methylation. In summary these results contribute further to our understanding of cytosine methylation patterns in human cells using a large representative sample set. PMID:22174693

  8. Design and pilot evaluation of a system to develop computer-based site-specific practice guidelines from decision models.

    PubMed

    Sanders, G D; Nease, R F; Owens, D K

    2000-01-01

    Local tailoring of clinical practice guidelines (CPGs) requires experts in medicine and evidence synthesis unavailable in many practice settings. The authors' computer-based system enables developers and users to create, disseminate, and tailor CPGs, using normative decision models (DMs). ALCHEMIST, a web-based system, analyzes a DM, creates a CPG in the form of an annotated algorithm, and displays for the guideline user the optimal strategy. ALCHEMIST'S interface enables remote users to tailor the guideline by changing underlying input variables and observing the new annotated algorithm that is developed automatically. In a pilot evaluation of the system, a DM was used to evaluate strategies for staging non-small-cell lung cancer. Subjects (n = 15) compared the automatically created CPG with published guidelines for this staging and critiqued both using a previously developed instrument to rate the CPGs' usability, accountability, and accuracy on a scale of 0 (worst) to 2 (best), with higher scores reflecting higher quality. The mean overall score for the ALCHEMIST CPG was 1.502, compared with the published-CPG score of 0.987 (p = 0.002). The ALCHEMIST CPG scores for usability, accountability, and accuracy were 1.683, 1.393, and 1.430, respectively; the published CPG scores were 1.192, 0.941, and 0.830 (each comparison p < 0.05). On a scale of 1 (worst) to 5 (best), users' mean ratings of ALCHEMIST'S ease of use, usefulness of content, and presentation format were 4.76, 3.98, and 4.64, respectively. The results demonstrate the feasibility of a web-based system that automatically analyzes a DM and creates a CPG as an annotated algorithm, enabling remote users to develop site-specific CPGs. In the pilot evaluation, the ALCHEMIST guidelines met established criteria for quality and compared favorably with national CPGs. The high usability and usefulness ratings suggest that such systems can be a good tool for guideline development.

  9. DNA Methylation at the DAT Promoter and Risk for Psychopathology: Intergenerational Transmission between School-Age Youths and Their Parents in a Community Sample.

    PubMed

    Cimino, Silvia; Cerniglia, Luca; Ballarotto, Giulia; Marzilli, Eleonora; Pascale, Esterina; D'Addario, Claudio; Adriani, Walter; Tambelli, Renata

    2017-01-01

    The effect of gene polymorphisms and promoter methylation, associated with maladaptive developmental outcomes, vary depending on environmental factors (e.g., parental psychopathology). Most studies have focused on 0- to 5-year-old children, adolescents, or adults, whereas there is dearth of research on school-age youths and pre-adolescents. In a sample of 21 families recruited at schools, we addressed parents' psychopathological symptoms (through SCL-90-R); offspring emotional-behavioral functioning (through CBCL-6-18); dopamine transporter gene (DAT1) for epigenetic status of the 5'-untranslated region (UTR) and for genotype, i.e., variable number of tandem repeats polymorphism at the 3'-UTR. Possible associations were explored between bio-genetic and psychological characteristics within the same individual and between triplets of children, mothers, and fathers. DAT methylation of CpG at positions M1, M6, and M7 in mothers was correlated with maternal (phobic) anxiety, whereas in fathers' position M6 was related to paternal depression, anxiety, hostility, psychoticism, and higher Global Severity Index (GSI). No significant correlations were found between maternal and offspring DAT methylation. Significant correlations were found between fathers' methylation at CpG M1 and children's methylation at CpG M6. Linear regressions showed that mothers and fathers' GSI predicted children's methylation at CpG sites M2, M3, and M6, whereas fathers' GSI predicted children's methylation at CpG sites, particularly M1, M2, and M6. Moreover, offspring methylation of DAT at CpG M2 predicted somatic complaint, internalizing and attention problems; methylation of DAT at CpG M6 predicted withdraw. This study may have important clinical implication for the prevention and treatment of emotional-behavioral difficulties in children, as it adds to previous knowledge about the role of genetic and environmental factors in predicting psychopathological symptoms within non-clinical populations.

  10. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker

    PubMed Central

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-01-01

    Background Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. Methods We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23–60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Results Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=−0.49 to −1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=−0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5–4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Conclusions Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. PMID:26395445

  11. Epigenetic Variation in the Mu-opioid Receptor Gene in Infants with Neonatal Abstinence Syndrome

    PubMed Central

    Wachman, Elisha M; Hayes, Marie J; Lester, Barry M; Terrin, Norma; Brown, Mark S; Nielsen, David A; Davis, Jonathan M

    2014-01-01

    Objective Neonatal abstinence syndrome (NAS) from in utero opioid exposure is highly variable with genetic factors appearing to play an important role. Epigenetic changes in cytosine:guanine (CpG) dinucleotide methylation can occur after drug exposure and may help to explain NAS variability. We correlated DNA methylation levels in the mu-opioid receptor (OPRM1) promoter in opioid-exposed infants and correlate them with NAS outcomes. Study design DNA samples from cord blood or saliva were analyzed for 86 infants being treated for NAS according to institutional protocol. Methylation levels at 16 OPRM1 CpG sites were determined and correlated with NAS outcome measures, including need for treatment, treatment with >2 medications, and length of hospital stay. We adjusted for co-variates and multiple genetic testing. Results Sixty-five percent of infants required treatment for NAS, and 24% required ≥2 medications. Hypermethylation of the OPRM1 promoter was measured at the −10 CpG in treated versus non-treated infants [adjusted difference δ=3.2% (95% CI 0.3–6.0%), p=0.03; NS after multiple testing correction]. There was hypermethylation at the −14 [δ=4.9% (95% CI 1.8–8.1%), p=0.003], −10 [δ=5.0% (95% CI 2.3–7.7%), p=0.0005)], and +84 [δ=3.5% (95% CI 0.6 – 6.4), p=0.02] CpG sites in infants requiring ≥2 medications which remained significant for −14 and −10 after multiple testing correction. Conclusions Increased methylation within the OPRM1 promoter is associated with worse NAS outcomes, consistent with gene silencing. PMID:24996986

  12. Targeted-bisulfite sequence analysis of the methylation of CpG islands in genes encoding PNPLA3, SAMM50, and PARVB of patients with non-alcoholic fatty liver disease.

    PubMed

    Kitamoto, Takuya; Kitamoto, Aya; Ogawa, Yuji; Honda, Yasushi; Imajo, Kento; Saito, Satoru; Yoneda, Masato; Nakamura, Takahiro; Nakajima, Atsushi; Hotta, Kikuko

    2015-08-01

    The pathogenesis of non-alcoholic fatty liver disease (NAFLD) is affected by epigenetic factors as well as by genetic variation. We performed targeted-bisulfite sequencing to determine the levels of DNA methylation of 4 CpG islands (CpG99, CpG71, CpG26, and CpG101) in the regulatory regions of PNPLA3, SAMM50, PARVB variant 1, and PARVB variant 2, respectively. We compared the levels of methylation of DNA in the livers of the first and second sets of patients with mild (fibrosis stages 0 and 1) or advanced (fibrosis stages 2 to 4) NAFLD and in those of patients with mild (F0 to F2) or advanced (F3 and F4) chronic hepatitis C infection. The hepatic mRNA levels of PNPLA3, SAMM50, and PARVB were measured using qPCR. CpG26, which resides in the regulatory region of PARVB variant 1, was markedly hypomethylated in the livers of patients with advanced NAFLD. Conversely, CpG99 in the regulatory region of PNPLA3 was substantially hypermethylated in these patients. These differences in DNA methylation were replicated in a second set of patients with NAFLD or chronic hepatitis C. PNPLA3 mRNA levels in the liver of the same section of a biopsy specimen used for genomic DNA preparation were lower in patients with advanced NAFLD compared with those with mild NAFLD and correlated inversely with CpG99 methylation in liver DNA. Moreover, the levels of CpG99 methylation and PNPLA3 mRNA were affected by the rs738409 genotype. Hypomethylation of CpG26 and hypermethylation of CpG99 may contribute to the severity of fibrosis in patients with NAFLD or chronic hepatitis C infection. Copyright © 2015 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  13. Methylation detection oligonucleotide microarray analysis: a high-resolution method for detection of CpG island methylation

    PubMed Central

    Kamalakaran, Sitharthan; Kendall, Jude; Zhao, Xiaoyue; Tang, Chunlao; Khan, Sohail; Ravi, Kandasamy; Auletta, Theresa; Riggs, Michael; Wang, Yun; Helland, Åslaug; Naume, Bjørn; Dimitrova, Nevenka; Børresen-Dale, Anne-Lise; Hicks, Jim; Lucito, Robert

    2009-01-01

    Methylation of CpG islands associated with genes can affect the expression of the proximal gene, and methylation of non-associated CpG islands correlates to genomic instability. This epigenetic modification has been shown to be important in many pathologies, from development and disease to cancer. We report the development of a novel high-resolution microarray that detects the methylation status of over 25 000 CpG islands in the human genome. Experiments were performed to demonstrate low system noise in the methodology and that the array probes have a high signal to noise ratio. Methylation measurements between different cell lines were validated demonstrating the accuracy of measurement. We then identified alterations in CpG islands, both those associated with gene promoters, as well as non-promoter-associated islands in a set of breast and ovarian tumors. We demonstrate that this methodology accurately identifies methylation profiles in cancer and in principle it can differentiate any CpG methylation alterations and can be adapted to analyze other species. PMID:19474344

  14. Exposure to welding fumes is associated with hypomethylation of the F2RL3 gene: a cardiovascular disease marker.

    PubMed

    Hossain, Mohammad B; Li, Huiqi; Hedmer, Maria; Tinnerberg, Håkan; Albin, Maria; Broberg, Karin

    2015-12-01

    Welders are at risk for cardiovascular disease. Recent studies linked tobacco smoke exposure to hypomethylation of the F2RL3 (coagulation factor II (thrombin) receptor-like 3) gene, a marker for cardiovascular disease prognosis and mortality. However, whether welding fumes cause hypomethylation of F2RL3 remains unknown. We investigated 101 welders (median span of working as a welder: 7 years) and 127 unexposed controls (non-welders with no obvious exposure to respirable dust at work), age range 23-60 years, all currently non-smoking, in Sweden. The participants were interviewed about their work history, lifestyle factors and diseases. Personal sampling of respirable dust was performed for the welders. DNA methylation of F2RL3 in blood was assessed by pyrosequencing of four CpG sites, CpG_2 (corresponds to cg03636183) to CpG_5, in F2RL3. Multivariable linear regression analysis was used to assess the association between exposure to welding fumes and F2RL3 methylation. Welders had 2.6% lower methylation of CpG_5 than controls (p<0.001). Higher concentrations of measured respirable dust among the welders were associated with hypomethylation of CpG_2, CpG_4 and CpG_5 (β=-0.49 to -1.4, p<0.012); p<0.029 adjusted for age, previous smoking, passive smoking, education, current residence and respirator use. Increasing the number of years working as a welder was associated with hypomethylation of CpG_4 (linear regression analysis, β=-0.11, p=0.039, adjusted for previous smoking). Previous tobacco smokers had 1.5-4.7% (p<0.014) lower methylation of 3 of the 4 CpG sites in F2RL3 (CpG_2, CpG_4 and CpG_5) compared to never-smokers. A non-significant lower risk of cardiovascular disease with more methylation was observed for all CpG sites. Welding fumes exposure and previous smoking were associated with F2RL3 hypomethylation. This finding links low-to-moderate exposure to welding fumes to adverse effects on the cardiovascular system, and suggests a potential mechanistic pathway for this link, via epigenetic effects on F2RL3 expression. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  15. Syncope Best Practices: A Syncope Clinical Practice Guideline to Improve Quality.

    PubMed

    Phelps, Heather M; Sachdeva, Ritu; Mahle, William T; McCracken, Courtney E; Kelleman, Michael; McConnell, Michael; Fischbach, Peter S; Cardis, Brian M; Campbell, Robert M; Oster, Matthew E

    2016-05-01

    To determine whether implementation of a standardized clinical practice guideline (CPG) for the evaluation of syncope would decrease practice variability and resource utilization. A retrospective review of medical records of patients presenting to our practice for outpatient evaluation of syncope before and after implementation of the CPG. The guideline included elements of history, physical exam, electrocardiogram, and "red flags" for further testing. Outpatient pediatric cardiology offices of a large pediatric cardiology practice. All new patients between 3 and 21 years old, who presented to cardiology clinic with a chief complaint of syncope. The CPG for the evaluation of pediatric syncope was presented to the providers. Resource utilization was determined by the tests ordered by individual physicians before and after initiation of the CPG. Patient final diagnoses were recorded and the medical records were subsequently reviewed to determine if any patients, who presented again to the system, were ultimately diagnosed with cardiac disease. Of the 1496 patients with an initial visit for syncope, there was no significant difference in the diagnosis of cardiac disease before or after initiation of the CPG: (0.6% vs. 0.4%, P = .55). Electrocardiography provides the highest yield in the evaluation of pediatric syncope. Despite high compliance (86.9%), there were no overall changes in costs ($346.31 vs. $348.53, P = .85) or in resource utilization. There was, however, a decrease in the variability of ordering of echocardiograms among physicians, particularly among those at the extremes of utilization. Although the CPG did not decrease already low costs, it did decrease the wide variability in echo utilization. Evaluation beyond detailed history, physical exam, and electrocardiography provides no additional benefit in the evaluations of pediatric patients presenting with syncope. © 2015 Wiley Periodicals, Inc.

  16. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients.

    PubMed

    Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele

    2011-05-26

    The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.

  17. Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

    PubMed

    Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

    2017-01-01

    Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

  18. Immunotherapeutic potential of CpG oligodeoxynucleotides in veterinary species.

    PubMed

    Manuja, Anju; Manuja, Balvinder K; Kaushik, Jyoti; Singha, Harisankar; Singh, Raj Kumar

    2013-10-01

    Innate immunity plays a critical role in host defense against infectious diseases by discriminating between self and infectious non-self. The recognition of infectious non-self involves germ-line encoded pattern recognition receptors (PRRs) that recognize pathogen-associated molecular patterns (PAMPs). The PAMPs are the components of pathogenic microbes which include not only the cell wall constituents but also the unmethylated 2'-deoxy-ribo-cytosine-phosphate-guanosine (CpG) motifs. These CpG motifs present within bacterial and viral DNA are recognized by toll-like receptor 9 (TLR9), and signaling by this receptor triggers a proinflammatory cytokine response which, in turn, influences both innate and adaptive immune responses. The activation of TLR9 with synthetic CpG oligodeoxynucleotides (ODNs) induces powerful Th1-like immune responses. It has been shown to provide protection against infectious diseases, allergy and cancer in laboratory animal models and some domestic animal species. With better understanding of the basic biology and immune mechanisms, it would be possible to exploit the potential of CpG motifs for animal welfare. The research developments in the area of CpG and TLR9 and the potential applications in animal health have been reviewed in this article.

  19. Interaction of DRD4 Methylation and Phthalate Metabolites Affects Continuous Performance Test Performance in ADHD.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-05-01

    We investigated the interaction effect between the methylation of dopamine receptor D4 (DRD4) and phthalate exposure in ADHD on continuous performance test (CPT) variables. Urine concentrations of mono-(2-ethyl-5-hydroxyhexyl) phthalate (MEHHP), mono-(2-ethyl-5-oxohexyl) phthalate (MEOHP), and mono-n-butyl phthalate (MBP) were tested. The methylation status was analyzed for CpG sites of DRD4. Multivariable linear regression models were applied to investigate the interaction effects of methylation and phthalate levels. There was a significant interaction effect of the methylation of CpG26 and CpG28 with the MEHHP level on omission errors in ADHD patients, but not in controls. The post hoc analysis revealed a significant correlation between the MEHHP concentration and omission errors in the methylated group, but not in the unmethylated group. The interaction between the methylation status of CpG sites of DRD4, particularly CpG26 and CpG28, and phthalate metabolite levels affects the attention level in ADHD patients.

  20. Transcultural Endocrinology: Adapting Type-2 Diabetes Guidelines on a Global Scale.

    PubMed

    Nieto-Martínez, Ramfis; González-Rivas, Juan P; Florez, Hermes; Mechanick, Jeffrey I

    2016-12-01

    Type-2 diabetes (T2D) needs to be prevented and treated effectively to reduce its burden and consequences. White papers, such as evidence-based clinical practice guidelines (CPG) and their more portable versions, clinical practice algorithms and clinical checklists, may improve clinical decision-making and diabetes outcomes. However, CPG are underused and poorly validated. Protocols that translate and implement these CPG are needed. This review presents the global dimension of T2D, details the importance of white papers in the transculturalization process, compares relevant international CPG, analyzes cultural variables, and summarizes translation strategies that can improve care. Specific protocols and algorithmic tools are provided. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Genome-wide DNA methylation profiling identifies ALDH1A3 promoter methylation as a prognostic predictor in G-CIMP- primary glioblastoma.

    PubMed

    Zhang, Wei; Yan, Wei; You, Gan; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; You, Yongping; Jiang, Tao

    2013-01-01

    To date, the aberrations in the DNA methylation patterns that are associated with different prognoses of G-CIMP- primary GBMs remain to be elucidated. Here, DNA methylation profiling of primary GBM tissues from 13 long-term survivors (LTS; overall survival ⩾18months) and 20 short-term survivors (STS; overall survival ⩽9months) was performed. Then G-CIMP+ samples were excluded. The differentially expressed CpG loci were identified between residual 18 STS and 9 LTS G-CIMP- samples. Methylation levels of 11 CpG loci (10genes) were statistically significantly lower, and 43 CpG loci (40genes) were statistically significantly higher in the tumor tissues of LTS than those of STS G-CIMP- samples (P<0.01). Of the 43 CpG loci that were hypermethylated in LTS G-CIMP- samples, 3 CpG loci localized in the promoter of ALDH1A3. Furthermore, using an independent validation cohort containing 37 primary GBM samples without IDH1 mutation and MGMT promoter methylation, the hypermethylation status of ALDH1A3 promoter predicted a better prognosis with an accompanied low expression of ALDH1A3 protein. Taken together, our results defined prognosis-related methylation signatures systematically for the first time in G-CIMP- primary GBMs. ALDH1A3 promoter methylation conferred a favorable prognosis in G-CIMP- primary GBMs. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  2. [Quality and compliance with Clinical Practice Guidelines of Chronic Noncommunicable Diseases in primary care].

    PubMed

    Poblano-Verástegui, Ofelia; Vieyra-Romero, Waldo I; Galván-García, Ángel F; Fernández-Elorriaga, María; Rodríguez-Martínez, Antonia I; Saturno-Hernández, Pedro J

    2017-01-01

    To assess the quality and compliance of clinical practice guidelines (CPG) applicable to chronic non-communicable diseases (CNCD) in primary healthcare (CS), and views of staff on the barriers, facilitators and their use. 18 valued CPG with AGREEII, 3 are selected to develop indicators and assess compliance using lot quality acceptance sample (LQAS, standard 75 / 95% threshold 40 / 75% respectively, α:0. 05, β:0. 10) on 5 CS. 70 professionals surveyed about knowledge and use of CPG. Average quality of the CPG was 57.2%; low rating in domains: "Applicability" (<25%), "Stakeholder involvement" (43.5%) and "Rigour of development" (55.0%). Compliance in CS ranges from 39 to 53.4%. Professionals show uneven knowledge of CPG; 44 to 45% (according to CPG), they declare that they are not used, they identify as main barriers the lack of training, and their difficult accessibility and management. The quality and implementation of evaluated CPG is deficient constituting an opportunity of improvement in health services.

  3. Lack of chart reminder effectiveness on family medicine resident JNC-VI and NCEP III guideline knowledge and attitudes.

    PubMed

    Echlin, Paul S; Upshur, Ross E G; Markova, Tsveti P

    2004-07-05

    The literature demonstrates that medical residents and practicing physicians have an attitudinal-behavioral discordance concerning their positive attitudes towards clinical practice guidelines (CPG), and the implementation of these guidelines into clinical practice patterns. A pilot study was performed to determine if change in a previously identified CPG compliance factor (accessibility) would produce a significant increase in family medicine resident knowledge and attitude toward the guidelines. The primary study intervention involved placing a summary of the Sixth Report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure (JNC VI) and the National Cholesterol Education Program Expert Panel on Detection, Evaluation, and Treatment of High Blood Cholesterol in Adults (NCEP III) CPGs in all patient (>18 yr.) charts for a period of three months. The JNC VI and NCEP III CPGs were also distributed to each Wayne State family medicine resident, and a copy of each CPG was placed in the preceptor's area of the involved clinics. Identical pre- and post- intervention questionnaires were administered to all residents concerning CPG knowledge and attitude. Post-intervention analysis failed to demonstrate a significant difference in CPG knowledge. A statistically significant post-intervention difference was found in only on attitude question. The barriers to CPG compliance were identified as 1) lack of CPG instruction; 2) lack of critical appraisal ability; 3) insufficient time; 4) lack of CPG accessibility; and 5) lack of faculty modeling. This study demonstrated no significant post intervention changes in CPG knowledge, and only one question that reflected attitude change. Wider resident access to dedicated clinic time, increased faculty modeling, and the implementation of an electronic record/reminder system that uses a team-based approach are compliance factors that should be considered for further investigation. The interpretation of CPG non-compliance will benefit from a causal matrix focused on physician knowledge, attitudes, and behavior. Recent findings in resident knowledge-behavior discordance may direct the future investigation of physician CPG non-compliance away from generalized barrier research, and toward the development of information that maximizes the sense of individual practitioner urgency and certainty.

  4. DNA methylation of the BRD2 promoter is associated with juvenile myoclonic epilepsy in Caucasians.

    PubMed

    Pathak, Shilpa; Miller, James; Morris, Emily C; Stewart, William C L; Greenberg, David A

    2018-05-01

    Juvenile myoclonic epilepsy (JME) is a common adolescent-onset genetic generalized epilepsy (GGE) syndrome. Multiple linkage and association studies have found that BRD2 influences the expression of JME. The BRD2-JME connection is further corroborated by our murine model; Brd2 haploinsufficiency produces characteristics that typify the clinical hallmarks of JME. Neither we, nor several large-scale studies of JME, found JME-related BRD2 coding mutations. Therefore, we investigated noncoding BRD2 regions, seeking the origin of BRD2's JME influence. BRD2's promoter harbors a JME-associated single nucleotide polymorphism (rs3918149) and a CpG (C-phosphate-G dinucleotides) island (CpG76), making it a potential "hotspot" for JME-associated epigenetic variants. Methylating promoter CpG sites causes gene silencing, often resulting in reduced gene expression. We tested for differences in DNA methylation at CpG76 in 3 different subgroups: (1) JME patients versus their unaffected family members, (2) JME versus patients with other forms of GGE, and (3) Caucasian versus non-Caucasian JME patients. We used DNA pyrosequencing to analyze the methylation status of 10 BRD2 promoter CpG sites in lymphoblastoid cells from JME patients of Caucasian and non-Caucasian origin, unaffected family members, and also non-JME GGE patients. We also measured global methylation levels and DNA methyl transferase 1 (DNMT1) transcript expression in JME families by standard methods. CpG76 is highly methylated in JME patients compared to unaffected family members. In families with non-JME GGE, we found no relationship between promoter methylation and epilepsy. In non-Caucasian JME families, promoter methylation was mostly not associated with epilepsy. This makes the BRD2 promoter a JME-specific, ethnicity-specific, differentially methylated region. Global methylation was constant across groups. BRD2 promoter methylation in JME, and the lack of methylation in unaffected relatives, in non-JME GGE patients, and in non-Caucasian JME, demonstrate that methylation specificity is a possible seizure susceptibility motif in JME risk and suggests JME therapeutics targeting BRD2. Wiley Periodicals, Inc. © 2018 International League Against Epilepsy.

  5. FBXL19 recruits CDK-Mediator to CpG islands of developmental genes priming them for activation during lineage commitment

    PubMed Central

    Dimitrova, Emilia; Nakayama, Manabu; Koseki, Yoko; Konietzny, Rebecca; Kessler, Benedikt M; Koseki, Haruhiko

    2018-01-01

    CpG islands are gene regulatory elements associated with the majority of mammalian promoters, yet how they regulate gene expression remains poorly understood. Here, we identify FBXL19 as a CpG island-binding protein in mouse embryonic stem (ES) cells and show that it associates with the CDK-Mediator complex. We discover that FBXL19 recruits CDK-Mediator to CpG island-associated promoters of non-transcribed developmental genes to prime these genes for activation during cell lineage commitment. We further show that recognition of CpG islands by FBXL19 is essential for mouse development. Together this reveals a new CpG island-centric mechanism for CDK-Mediator recruitment to developmental gene promoters in ES cells and a requirement for CDK-Mediator in priming these developmental genes for activation during cell lineage commitment. PMID:29809150

  6. Methylation levels of the "long interspersed nucleotide element-1" repetitive sequences predict survival of melanoma patients

    PubMed Central

    2011-01-01

    Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918

  7. Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

    PubMed Central

    Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

    2012-01-01

    A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

  8. Epigenetic Biomarker to Support Classification into Pluripotent and Non-Pluripotent Cells

    NASA Astrophysics Data System (ADS)

    Lenz, Michael; Goetzke, Roman; Schenk, Arne; Schubert, Claudia; Veeck, Jürgen; Hemeda, Hatim; Koschmieder, Steffen; Zenke, Martin; Schuppert, Andreas; Wagner, Wolfgang

    2015-03-01

    Quality control of human induced pluripotent stem cells (iPSCs) can be performed by several methods. These methods are usually relatively labor-intensive, difficult to standardize, or they do not facilitate reliable quantification. Here, we describe a biomarker to distinguish between pluripotent and non-pluripotent cells based on DNA methylation (DNAm) levels at only three specific CpG sites. Two of these CpG sites were selected by their discriminatory power in 258 DNAm profiles - they were either methylated in pluripotent or non-pluripotent cells. The difference between these two β-values provides an Epi-Pluri-Score that was validated on independent DNAm-datasets (264 pluripotent and 1,951 non-pluripotent samples) with 99.9% specificity and 98.9% sensitivity. This score was complemented by a third CpG within the gene POU5F1 (OCT4), which better demarcates early differentiation events. We established pyrosequencing assays for the three relevant CpG sites and thereby correctly classified DNA of 12 pluripotent cell lines and 31 non-pluripotent cell lines. Furthermore, DNAm changes at these three CpGs were tracked in the course of differentiation of iPSCs towards mesenchymal stromal cells. The Epi-Pluri-Score does not give information on lineage-specific differentiation potential, but it provides a simple, reliable, and robust biomarker to support high-throughput classification into either pluripotent or non-pluripotent cells.

  9. EG-05COMBINATION OF GENE COPY GAIN AND EPIGENETIC DEREGULATION ARE ASSOCIATED WITH THE ABERRANT EXPRESSION OF A STEM CELL RELATED HOX-SIGNATURE IN GLIOBLASTOMA

    PubMed Central

    Kurscheid, Sebastian; Bady, Pierre; Sciuscio, Davide; Samarzija, Ivana; Shay, Tal; Vassallo, Irene; Van Criekinge, Wim; Domany, Eytan; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika

    2014-01-01

    We previously reported a stem cell related HOX gene signature associated with resistance to chemo-radiotherapy (TMZ/RT- > TMZ) in glioblastoma. However, underlying mechanisms triggering overexpression remain mostly elusive. Interestingly, HOX genes are neither involved in the developing brain, nor expressed in normal brain, suggestive of an acquired gene expression signature during gliomagenesis. HOXA genes are located on CHR 7 that displays trisomy in most glioblastoma which strongly impacts gene expression on this chromosome, modulated by local regulatory elements. Furthermore we observed more pronounced DNA methylation across the HOXA locus as compared to non-tumoral brain (Human methylation 450K BeadChip Illumina; 59 glioblastoma, 5 non-tumoral brain sampes). CpG probes annotated for HOX-signature genes, contributing most to the variability, served as input into the analysis of DNA methylation and expression to identify key regulatory regions. The structural similarity of the observed correlation matrices between DNA methylation and gene expression in our cohort and an independent data-set from TCGA (106 glioblastoma) was remarkable (RV-coefficient, 0.84; p-value < 0.0001). We identified a CpG located in the promoter region of the HOXA10 locus exerting the strongest mean negative correlation between methylation and expression of the whole HOX-signature. Applying this analysis the same CpG emerged in the external set. We then determined the contribution of both, gene copy aberration (CNA) and methylation at the selected probe to explain expression of the HOX-signature using a linear model. Statistically significant results suggested an additive effect between gene dosage and methylation at the key CpG identified. Similarly, such an additive effect was also observed in the external data-set. Taken together, we hypothesize that overexpression of the stem-cell related HOX signature is triggered by gain of trisomy 7 and escape from compensatory DNA methylation at positions controlling the effect of enhanced gene dose on expression.

  10. A genome-wide methylation study on obesity: differential variability and differential methylation.

    PubMed

    Xu, Xiaojing; Su, Shaoyong; Barnes, Vernon A; De Miguel, Carmen; Pollock, Jennifer; Ownby, Dennis; Shi, Hidong; Zhu, Haidong; Snieder, Harold; Wang, Xiaoling

    2013-05-01

    Besides differential methylation, DNA methylation variation has recently been proposed and demonstrated to be a potential contributing factor to cancer risk. Here we aim to examine whether differential variability in methylation is also an important feature of obesity, a typical non-malignant common complex disease. We analyzed genome-wide methylation profiles of over 470,000 CpGs in peripheral blood samples from 48 obese and 48 lean African-American youth aged 14-20 y old. A substantial number of differentially variable CpG sites (DVCs), using statistics based on variances, as well as a substantial number of differentially methylated CpG sites (DMCs), using statistics based on means, were identified. Similar to the findings in cancers, DVCs generally exhibited an outlier structure and were more variable in cases than in controls. By randomly splitting the current sample into a discovery and validation set, we observed that both the DVCs and DMCs identified from the first set could independently predict obesity status in the second set. Furthermore, both the genes harboring DMCs and the genes harboring DVCs showed significant enrichment of genes identified by genome-wide association studies on obesity and related diseases, such as hypertension, dyslipidemia, type 2 diabetes and certain types of cancers, supporting their roles in the etiology and pathogenesis of obesity. We generalized the recent finding on methylation variability in cancer research to obesity and demonstrated that differential variability is also an important feature of obesity-related methylation changes. Future studies on the epigenetics of obesity will benefit from both statistics based on means and statistics based on variances.

  11. Complete Chloroplast Genome of Pinus massoniana (Pinaceae): Gene Rearrangements, Loss of ndh Genes, and Short Inverted Repeats Contraction, Expansion.

    PubMed

    Ni, ZhouXian; Ye, YouJu; Bai, Tiandao; Xu, Meng; Xu, Li-An

    2017-09-11

    The chloroplast genome (CPG) of Pinus massoniana belonging to the genus Pinus (Pinaceae), which is a primary source of turpentine, was sequenced and analyzed in terms of gene rearrangements, ndh genes loss, and the contraction and expansion of short inverted repeats (IRs). P. massoniana CPG has a typical quadripartite structure that includes large single copy (LSC) (65,563 bp), small single copy (SSC) (53,230 bp) and two IRs (IRa and IRb, 485 bp). The 108 unique genes were identified, including 73 protein-coding genes, 31 tRNAs, and 4 rRNAs. Most of the 81 simple sequence repeats (SSRs) identified in CPG were mononucleotides motifs of A/T types and located in non-coding regions. Comparisons with related species revealed an inversion (21,556 bp) in the LSC region; P. massoniana CPG lacks all 11 intact ndh genes (four ndh genes lost completely; the five remained truncated as pseudogenes; and the other two ndh genes remain as pseudogenes because of short insertions or deletions). A pair of short IRs was found instead of large IRs, and size variations among pine species were observed, which resulted from short insertions or deletions and non-synchronized variations between "IRa" and "IRb". The results of phylogenetic analyses based on whole CPG sequences of 16 conifers indicated that the whole CPG sequences could be used as a powerful tool in phylogenetic analyses.

  12. In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

    PubMed Central

    Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

    2012-01-01

    The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

  13. Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

    PubMed

    Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

    2016-05-01

    We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

  14. A terahertz EO detector with large dynamical range, high modulation depth and signal-noise ratio

    NASA Astrophysics Data System (ADS)

    Pan, Xinjian; Cai, Yi; Zeng, Xuanke; Zheng, Shuiqin; Li, Jingzhen; Xu, Shixiang

    2017-05-01

    The paper presents a novel design for terahertz (THz) free-space time domain electro-optic (EO) detection where the static birefringent phases of the two balanced arms are set close to zero but opposite to each other. Our theoretical and numerical analyses show this design has much stronger ability to cancel the optical background noise than both THz ellipsometer and traditional crossed polarizer geometry (CPG). Its optical modulation depth is about twice as high as that of traditional CPG, but about ten times as high as that of THz ellipsometer. As for the dynamical range, our improved design is comparable to the THz ellipsometer but obviously larger than the traditional CPG. Some experiments for comparing our improved CPG with traditional CPG agree well with the corresponding theoretical predictions. Our experiments also show that the splitting ratio of the used non-polarization beam splitter is critical for the performance of our design.

  15. Characterization of the differentially methylated region of the Impact gene that exhibits Glires-specific imprinting.

    PubMed

    Okamura, Kohji; Wintle, Richard F; Scherer, Stephen W

    2008-01-01

    Imprinted genes are exclusively expressed from one of the two parental alleles in a parent-of-origin-specific manner. In mammals, nearly 100 genes are documented to be imprinted. To understand the mechanism behind this gene regulation and to identify novel imprinted genes, common features of DNA sequences have been analyzed; however, the general features required for genomic imprinting have not yet been identified, possibly due to variability in underlying molecular mechanisms from locus to locus. We performed a thorough comparative genomic analysis of a single locus, Impact, which is imprinted only in Glires (rodents and lagomorphs). The fact that Glires and primates diverged from each other as recent as 70 million years ago makes comparisons between imprinted and non-imprinted orthologues relatively reliable. In species from the Glires clade, Impact bears a differentially methylated region, whereby the maternal allele is hypermethylated. Analysis of this region demonstrated that imprinting was not associated with the presence of direct tandem repeats nor with CpG dinucleotide density. In contrast, a CpG periodicity of 8 bp was observed in this region in species of the Glires clade compared to those of carnivores, artiodactyls, and primates. We show that tandem repeats are dispensable, establishment of the differentially methylated region does not rely on G+C content and CpG density, and the CpG periodicity of 8 bp is meaningful to the imprinting. This interval has recently been reported to be optimal for de novo methylation by the Dnmt3a-Dnmt3L complex, suggesting its importance in the establishment of imprinting in Impact and other genes.

  16. MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

    PubMed

    Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

    2009-07-16

    Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

  17. Racial Differences in DNA-Methylation of CpG Sites Within Preterm-Promoting Genes and Gene Variants.

    PubMed

    Salihu, H M; Das, R; Morton, L; Huang, H; Paothong, A; Wilson, R E; Aliyu, M H; Salemi, J L; Marty, P J

    2016-08-01

    Objective To evaluate the role DNA methylation may play in genes associated with preterm birth for higher rates of preterm births in African-American women. Methods Fetal cord blood samples from births collected at delivery and maternal demographic and medical information were used in a cross-sectional study to examine fetal DNA methylation of genes implicated in preterm birth among black and non-black infants. Allele-specific DNA methylation analysis was performed using a methylation bead array. Targeted maximum likelihood estimation was applied to examine the relationship between race and fetal DNA methylation of candidate preterm birth genes. Receiver-operating characteristic analyses were then conducted to validate the CpG site methylation marker within the two racial groups. Bootstrapping, a method of validation and replication, was employed. Results 42 CpG sites were screened within 20 candidate gene variants reported consistently in the literature as being associated with preterm birth. Of these, three CpG sites on TNFAIP8 and PON1 genes (corresponding to: cg23917399; cg07086380; and cg07404485, respectively) were significantly differentially methylated between black and non-black individuals. The three CpG sites showed lower methylation status among infants of black women. Bootstrapping validated and replicated results. Conclusion for Practice Our study identified significant differences in levels of methylation on specific genes between black and non-black individuals. Understanding the genetic/epigenetic mechanisms that lead to preterm birth may lead to enhanced prevention strategies to reduce morbidity and mortality by eventually providing a means to identify individuals with a genetic predisposition to preterm labor.

  18. Heritable DNA methylation in CD4+ cells among complex families displays genetic and non-genetic effects

    USDA-ARS?s Scientific Manuscript database

    DNA methylation at CpG sites is both heritable and influenced by environment, but the relative contributions of each to DNA methylation levels are unclear. We conducted a heritability analysis of CpG methylation in human CD4+ cells across 975 individuals from 163 families in the Genetics of Lipid-lo...

  19. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. CpG PatternFinder: a Windows-based utility program for easy and rapid identification of the CpG methylation status of DNA.

    PubMed

    Xu, Yi-Hua; Manoharan, Herbert T; Pitot, Henry C

    2007-09-01

    The bisulfite genomic sequencing technique is one of the most widely used techniques to study sequence-specific DNA methylation because of its unambiguous ability to reveal DNA methylation status to the order of a single nucleotide. One characteristic feature of the bisulfite genomic sequencing technique is that a number of sample sequence files will be produced from a single DNA sample. The PCR products of bisulfite-treated DNA samples cannot be sequenced directly because they are heterogeneous in nature; therefore they should be cloned into suitable plasmids and then sequenced. This procedure generates an enormous number of sample DNA sequence files as well as adding extra bases belonging to the plasmids to the sequence, which will cause problems in the final sequence comparison. Finding the methylation status for each CpG in each sample sequence is not an easy job. As a result CpG PatternFinder was developed for this purpose. The main functions of the CpG PatternFinder are: (i) to analyze the reference sequence to obtain CpG and non-CpG-C residue position information. (ii) To tailor sample sequence files (delete insertions and mark deletions from the sample sequence files) based on a configuration of ClustalW multiple alignment. (iii) To align sample sequence files with a reference file to obtain bisulfite conversion efficiency and CpG methylation status. And, (iv) to produce graphics, highlighted aligned sequence text and a summary report which can be easily exported to Microsoft Office suite. CpG PatternFinder is designed to operate cooperatively with BioEdit, a freeware on the internet. It can handle up to 100 files of sample DNA sequences simultaneously, and the total CpG pattern analysis process can be finished in minutes. CpG PatternFinder is an ideal software tool for DNA methylation studies to determine the differential methylation pattern in a large number of individuals in a population. Previously we developed the CpG Analyzer program; CpG PatternFinder is our further effort to create software tools for DNA methylation studies.

  1. Assessing the efficacy of Duddingtonia flagrans chlamydospores per gram of faeces to control Haemonchus contortus larvae.

    PubMed

    Ojeda-Robertos, Nadia Florencia; Torres-Acosta, Juan Felipe de Jesus; Aguilar-Caballero, Armando Jacinto; Ayala-Burgos, Armín; Cob-Galera, Ligia Amira; Sandoval-Castro, Carlos Alfredo; Barrientos-Medina, Roberto Carlos; de Gives, Pedro Mendoza

    2008-12-20

    The aims were (a) to quantify the number of Duddingtonia flagrans chlamydospores per gram of faeces (CPG) recovered from sheep administered with different oral doses and, (b) to describe the relationship between CPG and eggs per gram of faeces (EPG) on the efficacy to reduce Haemonchus contortus infective larvae. Three doses of chlamydospores per kg BW were orally administered during seven days: (T1) non treated control group, (T2) 1 x 10(6), (T3) 2.5 x 10(6) and (T4) 5 x 10(6). Three lambs, infected with H. contortus, were used per group. Faeces were obtained from the rectum of each lamb during the fungal administration period (days 0-6) and for six days after that period. Four coproculture replicates were made from each animal in days 2, 4, 6, 8 and 10. A higher chlamydospore dose produced higher CPG in faeces (p < 0.05), but a clear dose dependent effect was not found either in the larvae reduction or in the CPG:EPG ratio. When ratios were re-analyzed, independently of the treatment groups of origin, a better efficacy was obtained with a ratio from 5 to 10 CPG:EPG and a higher ratio (> 10 per egg) showed a lower reduction efficacy (p < 0.05). The binomial analysis showed that for each unit of increment in CPG:EPG ratio there was a reduction of larvae number until a point (between 5 and 10 CPG:EPG) where no further reduction was detected. The surface response test indicated that the number of larvae was reduced by CPG until possible saturation. The highest CPG:EPG ratios did not necessarily improve efficacy of D. flagrans.

  2. Oral and intraperitoneal administration of phosphorothioate oligodeoxynucleotides leads to control of Cryptosporidium parvum infection in neonatal mice.

    PubMed

    Barrier, Mathieu; Lacroix-Lamandé, Sonia; Mancassola, Roselyne; Auray, Gaël; Bernardet, Nelly; Chaussé, Anne-Marie; Uematsu, Satoshi; Akira, Shizuo; Laurent, Fabrice

    2006-05-15

    Neonates are particularly vulnerable to infections, in part because of the incomplete development of their immune system. Recent advances in immunostimulatory treatments based on conserved microbial components led us to assess the potential of oligodeoxynucleotides (ODNs) for decreasing the sensitivity of neonates to Cryptosporidium parvum infection. Neonate mice were treated orally or intraperitoneally (ip) with CpG ODNs or non-CpG ODNs 24 h before C. parvum infection, and parasite load and cytokine up-regulation were evaluated. CpG ODN 1668 and non-CpG ODN 1668 administered orally, as well as CpG ODN 1668 administered ip, induced an 80%-95% decrease in intestinal parasite load 6 days after infection. Intraperitoneal and oral pretreatment with CpG ODN 1668 led to a strong initial up-regulation of cytokines and CD69 messenger RNA in the intestine and a decrease in parasite load by a Toll-like receptor 9 (TLR9)-dependent mechanism. By contrast, oral administration of non-CpG ODN 1668 decreased parasite load by a TLR9-independent mechanism. The control of neonatal C. parvum infection by ip or oral administration of ODNs is feasible by 2 different mechanisms: (1) the well-known interaction involving CpG/TLR9, leading to the production of cytokines and lymphocyte activation, and (2) a new unknown mechanism that is independent of TLR9 and effective orally.

  3. Association of the CpG Methylation Pattern of the Proximal Insulin Gene Promoter with Type 1 Diabetes

    PubMed Central

    Fradin, Delphine; Le Fur, Sophie; Mille, Clémence; Naoui, Nadia; Groves, Chris; Zelenika, Diana; McCarthy, Mark I.; Lathrop, Mark; Bougnères, Pierre

    2012-01-01

    The insulin (INS) region is the second most important locus associated with Type 1 Diabetes (T1D). The study of the DNA methylation pattern of the 7 CpGs proximal to the TSS in the INS gene promoter revealed that T1D patients have a lower level of methylation of CpG -19, -135 and -234 (p = 2.10−16) and a higher methylation of CpG -180 than controls, while methylation was comparable for CpG -69, -102, -206. The magnitude of the hypomethylation relative to a control population was 8–15% of the corresponding levels in controls and was correlated in CpGs -19 and -135 (r = 0.77) and CpG -135 and -234 (r = 0.65). 70/485 (14%) of T1D patients had a simultaneous decrease in methylation of CpG -19, -135, -234 versus none in 317 controls. CpG methylation did not correlate with glycated hemoglobin or with T1D duration. The methylation of CpG -69, -102, -180, -206, but not CpG -19, -135, -234 was strongly influenced by the cis-genotype at rs689, a SNP known to show a strong association with T1D. We hypothesize that part of this genetic association could in fact be mediated at the statistical and functional level by the underlying changes in neighboring CpG methylation. Our observation of a CpG-specific, locus-specific methylation pattern, although it can provide an epigenetic biomarker of a multifactorial disease, does not indicate whether the reported epigenetic pattern preexists or follows the establishment of T1D. To explore the effect of chronic hyperglycemia on CpG methylation, we studied non obese patients with type 2 diabetes (T2D) who were found to have decreased CpG-19 methylation versus age-matched controls, similar to T1D (p = 2.10−6) but increased CpG-234 methylation (p = 5.10−8), the opposite of T1D. The causality and natural history of the different epigenetic changes associated with T1D or T2D remain to be determined. PMID:22567146

  4. Sex differences in DNA methylation of the cord blood are related to sex-bias psychiatric diseases

    NASA Astrophysics Data System (ADS)

    Maschietto, Mariana; Bastos, Laura Caroline; Tahira, Ana Carolina; Bastos, Elen Pereira; Euclydes, Veronica Luiza Vale; Brentani, Alexandra; Fink, Günther; de Baumont, Angelica; Felipe-Silva, Aloísio; Francisco, Rossana Pulcineli Vieira; Gouveia, Gisele; Grisi, Sandra Josefina Ferraz Ellero; Escobar, Ana Maria Ulhoa; Moreira-Filho, Carlos Alberto; Polanczyk, Guilherme Vanoni; Miguel, Euripedes Constantino; Brentani, Helena

    2017-03-01

    Sex differences in the prevalence of psychiatric disorders are well documented, with exposure to stress during gestation differentially impacting females and males. We explored sex-specific DNA methylation in the cord blood of 39 females and 32 males born at term and with appropriate weight at birth regarding their potential connection to psychiatric outcomes. Mothers were interviewed to gather information about environmental factors (gestational exposure) that could interfere with the methylation profiles in the newborns. Bisulphite converted DNA was hybridized to Illumina HumanMethylation450 BeadChips. Excluding XYS probes, there were 2,332 differentially methylated CpG sites (DMSs) between sexes, which were enriched within brain modules of co-methylated CpGs during brain development and also differentially methylated in the brains of boys and girls. Genes associated with the DMSs were enriched for neurodevelopmental disorders, particularly for CpG sites found differentially methylated in brain tissue between patients with schizophrenia and controls. Moreover, the DMS had an overlap of 890 (38%) CpG sites with a cohort submitted to toxic exposition during gestation. This study supports the evidences that sex differences in DNA methylation of autosomes act as a primary driver of sex differences that are found in psychiatric outcomes.

  5. Sex differences in DNA methylation of the cord blood are related to sex-bias psychiatric diseases

    PubMed Central

    Maschietto, Mariana; Bastos, Laura Caroline; Tahira, Ana Carolina; Bastos, Elen Pereira; Euclydes, Veronica Luiza Vale; Brentani, Alexandra; Fink, Günther; de Baumont, Angelica; Felipe-Silva, Aloísio; Francisco, Rossana Pulcineli Vieira; Gouveia, Gisele; Grisi, Sandra Josefina Ferraz Ellero; Escobar, Ana Maria Ulhoa; Moreira-Filho, Carlos Alberto; Polanczyk, Guilherme Vanoni; Miguel, Euripedes Constantino; Brentani, Helena

    2017-01-01

    Sex differences in the prevalence of psychiatric disorders are well documented, with exposure to stress during gestation differentially impacting females and males. We explored sex-specific DNA methylation in the cord blood of 39 females and 32 males born at term and with appropriate weight at birth regarding their potential connection to psychiatric outcomes. Mothers were interviewed to gather information about environmental factors (gestational exposure) that could interfere with the methylation profiles in the newborns. Bisulphite converted DNA was hybridized to Illumina HumanMethylation450 BeadChips. Excluding XYS probes, there were 2,332 differentially methylated CpG sites (DMSs) between sexes, which were enriched within brain modules of co-methylated CpGs during brain development and also differentially methylated in the brains of boys and girls. Genes associated with the DMSs were enriched for neurodevelopmental disorders, particularly for CpG sites found differentially methylated in brain tissue between patients with schizophrenia and controls. Moreover, the DMS had an overlap of 890 (38%) CpG sites with a cohort submitted to toxic exposition during gestation. This study supports the evidences that sex differences in DNA methylation of autosomes act as a primary driver of sex differences that are found in psychiatric outcomes. PMID:28303968

  6. Potential for diagnosis versus therapy monitoring of attention deficit hyperactivity disorder: a new epigenetic biomarker interacting with both genotype and auto-immunity.

    PubMed

    Adriani, Walter; Romano, Emilia; Pucci, Mariangela; Pascale, Esterina; Cerniglia, Luca; Cimino, Silvia; Tambelli, Renata; Curatolo, Paolo; Granstrem, Oleg; Maccarrone, Mauro; Laviola, Giovanni; D'Addario, Claudio

    2018-02-01

    In view of the need for easily accessible biomarkers, we evaluated in ADHD children the epigenetic status of the 5'-untranslated region (UTR) in the SLC6A3 gene, coding for human dopamine transporter (DAT). We analysed buccal swabs and sera from 30 children who met DSM-IV-TR criteria for ADHD, assigned to treatment according to severity. Methylation levels at six-selected CpG sites (among which, a CGGCGGCGG and a CGCG motif), alone or in combination with serum titers in auto-antibodies against dopamine transporter (DAT aAbs), were analysed for correlation with CGAS scores (by clinicians) and Conners' scales (by parents), collected at recruitment and after 6 weeks. In addition, we characterized the DAT genotype, i.e., the variable number tandem repeat (VNTR) polymorphisms at the 3'-UTR of the gene. DAT methylation levels were greatly reduced in ADHD patients compared to control, healthy children. Within patients carrying at least one DAT 9 allele (DAT 9/x), methylation at positions CpG2 and/or CpG6 correlated with recovery, as evident from delta-CGAS scores as well as delta Conners' scales ('inattentive' and 'hyperactive' subscales). Moreover, hypermethylation at CpG1 position denoted severity, specifically for those patients carrying a DAT 10/10 genotype. Intriguingly, high serum DAT-aAbs titers appeared to corroborate indications from high CpG1 versus high CpG2/CpG6 levels, likewise denoting severity versus recovery in DAT 10/10 versus 9/x patients, respectively. These profiles suggest that DAT 5'UTR epigenetics plus serum aAbs can serve as suitable biomarkers, to confirm ADHD diagnosis and/or to predict the efficacy of treatment.

  7. The Cambridge Prognostic Groups for improved prediction of disease mortality at diagnosis in primary non-metastatic prostate cancer: a validation study.

    PubMed

    Gnanapragasam, V J; Bratt, O; Muir, K; Lee, L S; Huang, H H; Stattin, P; Lophatananon, A

    2018-02-28

    The purpose of this study is to validate a new five-tiered prognostic classification system to better discriminate cancer-specific mortality in men diagnosed with primary non-metastatic prostate cancer. We applied a recently described five-strata model, the Cambridge Prognostic Groups (CPGs 1-5), in two international cohorts and tested prognostic performance against the current standard three-strata classification of low-, intermediate- or high-risk disease. Diagnostic clinico-pathological data for men obtained from the Prostate Cancer data Base Sweden (PCBaSe) and the Singapore Health Study were used. The main outcome measure was prostate cancer mortality (PCM) stratified by age group and treatment modality. The PCBaSe cohort included 72,337 men, of whom 7162 died of prostate cancer. The CPG model successfully classified men with different risks of PCM with competing risk regression confirming significant intergroup distinction (p < 0.0001). The CPGs were significantly better at stratified prediction of PCM compared to the current three-tiered system (concordance index (C-index) 0.81 vs. 0.77, p < 0.0001). This superiority was maintained for every age group division (p < 0.0001). Also in the ethnically different Singapore cohort of 2550 men with 142 prostate cancer deaths, the CPG model outperformed the three strata categories (C-index 0.79 vs. 0.76, p < 0.0001). The model also retained superior prognostic discrimination in the treatment sub-groups: radical prostatectomy (n = 20,586), C-index 0.77 vs. 074; radiotherapy (n = 11,872), C-index 0.73 vs. 0.69; and conservative management (n = 14,950), C-index 0.74 vs. 0.73. The CPG groups that sub-divided the old intermediate-risk (CPG2 vs. CPG3) and high-risk categories (CPG4 vs. CPG5) significantly discriminated PCM outcomes after radical therapy or conservative management (p < 0.0001). This validation study of nearly 75,000 men confirms that the CPG five-tiered prognostic model has superior discrimination compared to the three-tiered model in predicting prostate cancer death across different age and treatment groups. Crucially, it identifies distinct sub-groups of men within the old intermediate-risk and high-risk criteria who have very different prognostic outcomes. We therefore propose adoption of the CPG model as a simple-to-use but more accurate prognostic stratification tool to help guide management for men with newly diagnosed prostate cancer.

  8. Evidence-based clinical practice guideline for adult Still's disease.

    PubMed

    Mimura, Toshihide; Kondo, Yuya; Ohta, Akihide; Iwamoto, Masahiro; Ota, Akiko; Okamoto, Nami; Kawaguchi, Yasushi; Kono, Hajime; Takasaki, Yoshinari; Takei, Shuji; Nishimoto, Norihiro; Fujimoto, Manabu; Asanuma, Yu Funakubo; Mimori, Akio; Okiyama, Naoko; Kaneko, Shunta; Takahashi, Hiroyuki; Yokosawa, Masahiro; Sumida, Takayuki

    2018-05-09

    Using an expert- and data-driven methodology, we have constructed the first clinical practice guidelines (CPGs) for adult Still's disease (ASD) after complete systematic review (SR) of the literature based upon the Medical Information Network Distribution Service (Minds) procedure. The CPG committee for ASD organized by the Research Team for Autoimmune Diseases, the Research Program for Intractable Disease of the Japanese Ministry of Health, Labour, and Welfare has developed CPG for ASD 2017, according to the procedure proposed by Minds. The CPG development process includes (1) clarification of the purpose of CPG, (2) organization of the steering committee, (3) organization of the CPG committee and secretariat, (4) defining the scope (setting of clinical questions (CQs)), (5) SR, (6) development of recommendations, (7) drafting the CPG, (8) external evaluation and public comments, and (9) release. Because we wanted to construct CPG for ASD to encompass both adult-onset Still's disease (AOSD) and adult patients with systemic juvenile idiopathic arthritis (sJIA), we also included SR data from sJIA in this study. Twenty-six CQs were selected and roughly divided into the following items: (1) clinical findings (CQs 1-4), (2) laboratory findings (CQs 5-8), (3) complications (CQs 9-13), (4) treatment with oral medicine (CQs 14-19), (5) treatment with biological reagents (CQs 20-23), and (6) treatments for sJIA (CQs 25-26). Recommendations and the strength of the recommendations for these CQs were decided by a modified Delphi method. We have developed the first published CPG for ASD including AOSD and sJIA, which includes 26 CQs and recommendations. This guideline will help rheumatologists, non-specialized physicians, other healthcare providers, medical and health-related students, and patients and their family members to understand and treat ASD.

  9. Network-based regularization for matched case-control analysis of high-dimensional DNA methylation data.

    PubMed

    Sun, Hokeun; Wang, Shuang

    2013-05-30

    The matched case-control designs are commonly used to control for potential confounding factors in genetic epidemiology studies especially epigenetic studies with DNA methylation. Compared with unmatched case-control studies with high-dimensional genomic or epigenetic data, there have been few variable selection methods for matched sets. In an earlier paper, we proposed the penalized logistic regression model for the analysis of unmatched DNA methylation data using a network-based penalty. However, for popularly applied matched designs in epigenetic studies that compare DNA methylation between tumor and adjacent non-tumor tissues or between pre-treatment and post-treatment conditions, applying ordinary logistic regression ignoring matching is known to bring serious bias in estimation. In this paper, we developed a penalized conditional logistic model using the network-based penalty that encourages a grouping effect of (1) linked Cytosine-phosphate-Guanine (CpG) sites within a gene or (2) linked genes within a genetic pathway for analysis of matched DNA methylation data. In our simulation studies, we demonstrated the superiority of using conditional logistic model over unconditional logistic model in high-dimensional variable selection problems for matched case-control data. We further investigated the benefits of utilizing biological group or graph information for matched case-control data. We applied the proposed method to a genome-wide DNA methylation study on hepatocellular carcinoma (HCC) where we investigated the DNA methylation levels of tumor and adjacent non-tumor tissues from HCC patients by using the Illumina Infinium HumanMethylation27 Beadchip. Several new CpG sites and genes known to be related to HCC were identified but were missed by the standard method in the original paper. Copyright © 2012 John Wiley & Sons, Ltd.

  10. DNA methylation profiles of long- and short-term glioblastoma survivors

    PubMed Central

    Shinawi, Thoraia; Hill, Victoria K.; Krex, Dietmar; Schackert, Gabriele; Gentle, Dean; Morris, Mark R.; Wei, Wenbin; Cruickshank, Garth; Maher, Eamonn R.; Latif, Farida

    2013-01-01

    Glioblastoma (GBM) is the most common and malignant type of primary brain tumor in adults and prognosis of most GBM patients is poor. However, a small percentage of patients show a long term survival of 36 mo or longer after diagnosis. Epigenetic profiles can provide molecular markers for patient prognosis: recently, a G-CIMP positive phenotype associated with IDH1 mutations has been described for GBMs with good prognosis. In the present analysis we performed genome-wide DNA methylation profiling of short-term survivors (STS; overall survival < 1 y) and long-term survivors (LTS; overall survival > 3 y) by utilizing the HumanMethylation450K BeadChips to assess quantitative methylation at > 480,000 CpG sites. Cluster analysis has shown that a subset of LTS showed a G-CIMP positive phenotype that was tightly associated with IDH1 mutation status and was confirmed by analysis of the G-CIMP signature genes. Using high stringency criteria for differential hypermethylation between non-cancer brain and tumor samples, we identified 2,638 hypermethylated CpG loci (890 genes) in STS GBMs, 3,101 hypermethylated CpG loci (1,062 genes) in LTS (wild type IDH1) and 11,293 hypermethylated CpG loci in LTS (mutated for IDH1), reflecting the CIMP positive phenotype. The location of differentially hypermethylated CpG loci with respect to CpG content, neighborhood context and functional genomic distribution was similar in our sample set, with the majority of CpG loci residing in CpG islands and in gene promoters. Our preliminary study also identified a set of CpG loci differentially hypermethylated between STS and LTS cases, including members of the homeobox gene family (HOXD8, HOXD13 and HOXC4), the transcription factors NR2F2 and TFAP2A, and Dickkopf 2, a negative regulator of the wnt/β-catenin signaling pathway. PMID:23291739

  11. [General Strategies for Implementation of Clinical Practice Guidelines].

    PubMed

    Valenzuela-Flores, Adriana Abigail; Viniegra-Osorio, Arturo; Torres-Arreola, Laura Laura

    2015-01-01

    The need to use clinical practice guidelines (CPG) arises from the health conditions and problems that public health institutions in the country face. CPG are informative documents that help improve the quality of care processes and patient safety; having among its objectives, to reduce the variability of medical practice. The Instituto Mexicano del Seguro Social designed a strategic plan for the dissemination, implementation, monitoring and control of CPG to establish an applicable model in the medical units in the three levels of care at the Instituto. This paper summarizes some of the strategies of the plan that were made with the knowledge and experience of clinicians and managers, with which they intend to promote the adoption of the key recommendations of the guidelines, to promote a sense of belonging for health personnel, and to encourage changes in organizational culture.

  12. Hypermethylation of brain natriuretic peptide gene is associated with the risk of rheumatic heart disease

    PubMed Central

    Li, Ni; Zheng, Dawei; Sun, Lebo; Shi, Huoshun; Zhu, Xiuying; Xu, Guodong; Wang, Qinning; Zhu, Caimin

    2016-01-01

    To investigate the contribution of brain natriuretic peptide (BNP) promoter DNA methylation to the risk of rheumatic heart disease (RHD) and the influence of warfarin anticoagulant therapy on BNP methylation levels for RHD patients after surgery. BNP methylation levels were determined by bisulfite pyrosequencing from plasma samples of RHD patients compared with healthy controls. Several factors influencing the RHD patients were included like age, smoking and cholesterol levels. A fragment of five CG sites (CpG1–5) in the promoter region of BNP gene was measured. BNP gene hypermethylation was found in CpG4 and CpG5 in RHD patients compared with non-RHD controls. A significant difference was also observed between RHD patients with long-term administration of warfarin and RHD patients who had recently undergone an operation. Moreover, single CpG4 and CpG5 analysis revealed a significant increase in methylation levels in men. BNP gene body hypermethylation is associated with the risk of RHD, and also influenced by the warfarin anticoagulant therapy of RHD patients after surgery, which could represent novel and promising targets for therapeutic development. PMID:27920275

  13. The Control Region of Mitochondrial DNA Shows an Unusual CpG and Non-CpG Methylation Pattern

    PubMed Central

    Bellizzi, Dina; D'Aquila, Patrizia; Scafone, Teresa; Giordano, Marco; Riso, Vincenzo; Riccio, Andrea; Passarino, Giuseppe

    2013-01-01

    DNA methylation is a common epigenetic modification of the mammalian genome. Conflicting data regarding the possible presence of methylated cytosines within mitochondrial DNA (mtDNA) have been reported. To clarify this point, we analysed the methylation status of mtDNA control region (D-loop) on human and murine DNA samples from blood and cultured cells by bisulphite sequencing and methylated/hydroxymethylated DNA immunoprecipitation assays. We found methylated and hydroxymethylated cytosines in the L-strand of all samples analysed. MtDNA methylation particularly occurs within non-C-phosphate-G (non-CpG) nucleotides, mainly in the promoter region of the heavy strand and in conserved sequence blocks, suggesting its involvement in regulating mtDNA replication and/or transcription. We observed DNA methyltransferases within the mitochondria, but the inactivation of Dnmt1, Dnmt3a, and Dnmt3b in mouse embryonic stem (ES) cells results in a reduction of the CpG methylation, while the non-CpG methylation shows to be not affected. This suggests that D-loop epigenetic modification is only partially established by these enzymes. Our data show that DNA methylation occurs in the mtDNA control region of mammals, not only at symmetrical CpG dinucleotides, typical of nuclear genome, but in a peculiar non-CpG pattern previously reported for plants and fungi. The molecular mechanisms responsible for this pattern remain an open question. PMID:23804556

  14. Improved Prediction of Non-methylated Islands in Vertebrates Highlights Different Characteristic Sequence Patterns

    PubMed Central

    Vingron, Martin

    2016-01-01

    Non-methylated islands (NMIs) of DNA are genomic regions that are important for gene regulation and development. A recent study of genome-wide non-methylation data in vertebrates by Long et al. (eLife 2013;2:e00348) has shown that many experimentally identified non-methylated regions do not overlap with classically defined CpG islands which are computationally predicted using simple DNA sequence features. This is especially true in cold-blooded vertebrates such as Danio rerio (zebrafish). In order to investigate how predictive DNA sequence is of a region’s methylation status, we applied a supervised learning approach using a spectrum kernel support vector machine, to see if a more complex model and supervised learning can be used to improve non-methylated island prediction and to understand the sequence properties of these regions. We demonstrate that DNA sequence is highly predictive of methylation status, and that in contrast to existing CpG island prediction methods our method is able to provide more useful predictions of NMIs genome-wide in all vertebrate organisms that were studied. Our results also show that in cold-blooded vertebrates (Anolis carolinensis, Xenopus tropicalis and Danio rerio) where genome-wide classical CpG island predictions consist primarily of false positives, longer primarily AT-rich DNA sequence features are able to identify these regions much more accurately. PMID:27984582

  15. Modulation of aerial respiratory behaviour in a pond snail.

    PubMed

    Lukowiak, Ken; Martens, Kara; Orr, Mike; Parvez, Kashif; Rosenegger, David; Sangha, Susan

    2006-11-01

    Aerial respiratory in Lymnaea is driven by a three-neuron CPG whose sufficiency and necessity has been directly demonstrated. While this CPG is 'hard-wired' it displays a tremendous amount of plasticity. That is, it is possible by employing specific training procedures to alter how it functions in a specific hypoxic environment. Thus, it is possible to study directly the causal mechanisms of long-term memory formation, forgetting, and modulation of the memory at a single cell level. Thus, it is possible to use a relatively simple three-neuron CPG to study not only important questions concerning regulation of important homeostatic mechanisms but to also use it to study how learning and non-declarative memory are mediated at a cellular level.

  16. DNA methylation levels at chromosome 8q24 in peripheral blood are associated with 8q24 cancer susceptibility loci.

    PubMed

    Barry, Kathryn Hughes; Moore, Lee E; Sampson, Joshua; Yan, Liying; Meyer, Ann; Oler, Andrew J; Chung, Charles C; Wang, Zhaoming; Yeager, Meredith; Amundadottir, Laufey; Berndt, Sonja I

    2014-12-01

    Chromosome 8q24 has emerged as an important region for genetic susceptibility to various cancers, but little is known about the contribution of DNA methylation at 8q24. To evaluate variability in DNA methylation levels at 8q24 and the relationship with cancer susceptibility single nucleotide polymorphisms (SNPs) in this region, we quantified DNA methylation levels in peripheral blood at 145 CpG sites nearby 8q24 cancer susceptibility SNPs or MYC using pyrosequencing among 80 Caucasian men in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial. For the 60 CpG sites meeting quality control, which also demonstrated temporal stability over a 5-year period, we calculated pairwise Spearman correlations for DNA methylation levels at each CpG site with 42 8q24 cancer susceptibility SNPs. To account for multiple testing, we adjusted P values into q values reflecting the false discovery rate (FDR). In contrast to the MYC CpG sites, most sites nearby the SNPs demonstrated good reproducibility, high methylation levels, and moderate-high between-individual variation. We observed 10 statistically significant (FDR < 0.05) CpG site-SNP correlations. These included correlations between an intergenic CpG site at Chr8:128393157 and the prostate cancer SNP rs16902094 (ρ = -0.54; P = 9.7 × 10(-7); q = 0.002), a PRNCR1 CpG site at Chr8:128167809 and the prostate cancer SNP rs1456315 (ρ = 0.52; P = 1.4 × 10(-6); q = 0.002), and two POU5F1B CpG sites and several prostate/colorectal cancer SNPs (for Chr8:128498051 and rs6983267, ρ = 0.46; P = 2.0 × 10(-5); q = 0.01). This is the first report of correlations between blood DNA methylation levels and cancer susceptibility SNPs at 8q24, suggesting that DNA methylation at this important susceptibility locus may contribute to cancer risk. ©2014 American Association for Cancer Research.

  17. Maternal treatment with a high dose of CpG ODN during gestation alters fetal craniofacial and distal limb development in C57BL/6 mice.

    PubMed

    Prater, M Renee; Johnson, Victor J; Germolec, Dori R; Luster, Michael I; Holladay, Steven D

    2006-01-16

    Synthetic oligodeoxynucleotides (ODN) containing CpG motifs, characteristic of bacterial DNA, are currently being evaluated as vaccine adjuvants for inducing protective immunity. Recently, there is increasing pressure to vaccinate pregnant women against maternally transmitted diseases including AIDS and tetanus, as well as against potential bio-weapons such as anthrax. CpG vaccines are effective because they trigger transient increases in T(H)1 cytokine production. Recent literature suggests, however, that a shift toward a T(H)1 cytokine profile during pregnancy may increase the risk of fetal morphologic defects. On this basis, we hypothesized that exposure to CpG motifs during pregnancy could result in T(H)1 inflammation leading to adverse effects on fetal development. To address this hypothesis, pregnant C57BL/6 mice were injected with CpG ODN (0-300 microg/dam) and maternal and fetal outcomes were determined. Injection of dams with the highest dose of CpG ODN resulted in markedly increased fetal resorptions and craniofacial/limb defects, while lower doses had little, if any effects. Histological examination of placentas revealed cellular necrosis with mixed inflammation and calcification in the spongiotrophoblast layer and dysregulation of labyrinthine vascular development. Concomitant elevations in maternal serum cytokine levels were observed including interleukin (IL)-2, IL-10 and IL-12. Treatment with 300 microg of non-CpG ODN did not cause any adverse effects. The 300 microg dose of CpG ODN used in the present study is 30-fold higher than the highest dose that has been administered to humans during clinical trials. These results suggest that the induction of T(H)1 cytokines during pregnancy by CpG motifs may potentially increase the risk of fetal loss and morphologic defects in mice, at least at high doses, and support the need for further investigation of teratogenesis that may result from exposure to vaccine adjuvants designed to produce T(H)1 cytokine profile shifts.

  18. Methylated site display (MSD)-AFLP, a sensitive and affordable method for analysis of CpG methylation profiles.

    PubMed

    Aiba, Toshiki; Saito, Toshiyuki; Hayashi, Akiko; Sato, Shinji; Yunokawa, Harunobu; Maruyama, Toru; Fujibuchi, Wataru; Kurita, Hisaka; Tohyama, Chiharu; Ohsako, Seiichiroh

    2017-03-09

    It has been pointed out that environmental factors or chemicals can cause diseases that are developmental in origin. To detect abnormal epigenetic alterations in DNA methylation, convenient and cost-effective methods are required for such research, in which multiple samples are processed simultaneously. We here present methylated site display (MSD), a unique technique for the preparation of DNA libraries. By combining it with amplified fragment length polymorphism (AFLP) analysis, we developed a new method, MSD-AFLP. Methylated site display libraries consist of only DNAs derived from DNA fragments that are CpG methylated at the 5' end in the original genomic DNA sample. To test the effectiveness of this method, CpG methylation levels in liver, kidney, and hippocampal tissues of mice were compared to examine if MSD-AFLP can detect subtle differences in the levels of tissue-specific differentially methylated CpGs. As a result, many CpG sites suspected to be tissue-specific differentially methylated were detected. Nucleotide sequences adjacent to these methyl-CpG sites were identified and we determined the methylation level by methylation-sensitive restriction endonuclease (MSRE)-PCR analysis to confirm the accuracy of AFLP analysis. The differences of the methylation level among tissues were almost identical among these methods. By MSD-AFLP analysis, we detected many CpGs showing less than 5% statistically significant tissue-specific difference and less than 10% degree of variability. Additionally, MSD-AFLP analysis could be used to identify CpG methylation sites in other organisms including humans. MSD-AFLP analysis can potentially be used to measure slight changes in CpG methylation level. Regarding the remarkable precision, sensitivity, and throughput of MSD-AFLP analysis studies, this method will be advantageous in a variety of epigenetics-based research.

  19. Blood fatty acid composition of pregnant and nonpregnant Korean women: red cells may act as a reservoir of arachidonic acid and docosahexaenoic acid for utilization by the developing fetus.

    PubMed

    Ghebremeskel, K; Min, Y; Crawford, M A; Nam, J H; Kim, A; Koo, J N; Suzuki, H

    2000-05-01

    Relative fatty acid composition of plasma and red blood cell (RBC) choline phosphoglycerides (CPG), and RBC ethanolamine phosphoglycerides (EPG) of pregnant (n = 40) and nonpregnant, nonlactating (n = 40), healthy Korean women was compared. The two groups were of the same ethnic origin and comparable in age and parity. Levels of arachidonic (AA) and docosahexaenoic (DHA) acids were lower (P < 0.05) and palmitic and oleic acids higher (P < 0.0001) in plasma CPG of the pregnant women. Similarly, the RBC CPG and EPG of the pregnant women had lower AA and DHA (P < 0.05) and higher palmitic and oleic acids (P < 0.01). The reduction in DHA and total n-3 fatty acids in plasma CPG of the pregnant women was paralleled by an increase in docosatetraenoic (DTA) and docosapentaenoic (DPA) acids of the n-6 series and in DPA/DTA ratio. In the RBC phospholipids (CPG and EPG) of the pregnant women, DTA and DPA acids of the n-6 series and DPA/DTA ratio did not increase with the decrease of the n-3 metabolites (eicosapentaenoic acid, DPA, and DHA) and total n-3. Since pregnancy was the main identifiable variable between the two groups, the lower levels of AA and DHA in RBC CPG and EPG of the pregnant women suggest that the mothers were mobilizing membrane AA and DHA to meet the high fetal requirement for these nutrients. It may also suggest that RBC play a role as a potential store of AA and DHA and as a vehicle for the transport of these fatty acids from maternal circulation to the placenta to be utilized by the developing fetus.

  20. The correlation of methylation levels measured using Illumina 450K and EPIC BeadChips in blood samples

    PubMed Central

    Logue, Mark W; Smith, Alicia K; Wolf, Erika J; Maniates, Hannah; Stone, Annjanette; Schichman, Steven A; McGlinchey, Regina E; Milberg, William; Miller, Mark W

    2017-01-01

    Aim: We examined concordance of methylation levels across the Illumina Infinium HumanMethylation450 BeadChip and the Infinium MethylationEPIC BeadChip. Methods: We computed the correlation for 145 whole blood DNA samples at each of the 422,524 CpG sites measured by both chips. Results: The correlation at some sites was high (up to r = 0.95), but many sites had low correlation (55% had r < 0.20). The low correspondence between 450K and EPIC measured methylation values at many loci was largely due to the low variability in methylation values for the majority of the CpG sites in blood. Conclusion: Filtering out probes based on the observed correlation or low variability may increase reproducibility of BeadChip-based epidemiological studies. PMID:28809127

  1. The AAHKS Clinical Research Award: What Are the Costs of Knee Osteoarthritis in the Year Prior to Total Knee Arthroplasty?

    PubMed

    Bedard, Nicholas A; Dowdle, Spencer B; Anthony, Christopher A; DeMik, David E; McHugh, Michael A; Bozic, Kevin J; Callaghan, John J

    2017-09-01

    Despite American Academy of Orthopaedic Surgeons Clinical Practice Guidelines (CPGs) related to the non-arthroplasty management of osteoarthritis (OA) of the knee, non-recommended treatments remain in common use. We sought to determine the costs associated with non-arthroplasty management of knee OA in the year prior to total knee arthroplasty (TKA) and stratify them by CPG recommendation status. The Humana database was reviewed from 2007 to 2015 for primary TKA patients. Costs for hyaluronic acid (HA) and corticosteroid injections, physical therapy, braces, wedge insoles, opioids, non-steroidal anti-inflammatories, and tramadol in the year prior to TKA were calculated. Cost was defined as reimbursement paid by the insurance provider. Costs were analyzed relative to the overall non-inpatient costs for knee OA and categorized based on CPG recommendations. In total 86,081 primary TKA patients were analyzed and 65.8% had at least one treatment in the year prior to TKA. Treatments analyzed made up 57.6% of the total non-inpatient cost of knee OA in the year prior to TKA. Only 3 of the 8 treatments studied have a strong recommendation for their use (physical therapy, non-steroidal anti-inflammatories, tramadol) and costs for these interventions represented 12.2% of non-inpatient knee OA cost. In contrast, 29.3% of the costs are due to HA injections alone, which are not supported by CPGs. In the year prior to TKA, over half of the non-inpatient costs associated with knee OA are from injections, therapy, prosthetics, and prescriptions. Approximately 30% of this is due to HA injections alone. If only interventions recommend by the CPG are utilized then costs associated with knee OA could be decreased by 45%. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Global Epigenetic Changes May Underlie Ethnic Differences and Susceptibility to Prostate Cancer

    DTIC Science & Technology

    2013-09-01

    malignancy and can often be found in non-cancerous tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA...methylcytosine (5-meC; [9, 10]). Since the recognition that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to...has also been identified for several genes. One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men

  3. Bio-inspired control of joint torque and knee stiffness in a robotic lower limb exoskeleton using a central pattern generator.

    PubMed

    Schrade, Stefan O; Nager, Yannik; Wu, Amy R; Gassert, Roger; Ijspeert, Auke

    2017-07-01

    Robotic lower limb exoskeletons are becoming increasingly popular in therapy and recreational use. However, most exoskeletons are still rather limited in their locomotion speed and the activities of daily live they can perform. Furthermore, they typically do not allow for a dynamic adaptation to the environment, as they are often controlled with predefined reference trajectories. Inspired by human leg stiffness modulation during walking, variable stiffness actuators increase flexibility without the need for more complex controllers. Actuation with adaptable stiffness is inspired by the human leg stiffness modulation during walking. However, this actuation principle also introduces the stiffness setpoint as an additional degree of freedom that needs to be coordinated with the joint trajectories. As a potential solution to this issue a bio-inspired controller based on a central pattern generator (CPG) is presented in this work. It generates coordinated joint torques and knee stiffness modulations to produce flexible and dynamic gait patterns for an exoskeleton with variable knee stiffness actuation. The CPG controller is evaluated and optimized in simulation using a model of the exoskeleton. The CPG controller produced stable and smooth gait for walking speeds from 0.4 m/s up to 1.57 m/s with a torso stabilizing force that simulated the use of crutches, which are commonly needed by exoskeleton users. Through the CPG, the knee stiffness intrinsically adapted to the frequency and phase of the gait, when the speed was changed. Additionally, it adjusted to changes in the environment in the form of uneven terrain by reacting to ground contact forces. This could allow future exoskeletons to be more adaptive to various environments, thus making ambulation more robust.

  4. The Healthy Weight Commitment Foundation Pledge

    PubMed Central

    Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

    2014-01-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation’s leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (−10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007–2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcals/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcals/capita/day, but there was little change in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 87 kcals/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. PMID:25240967

  5. Neuronal activity in the isolated mouse spinal cord during spontaneous deletions in fictive locomotion: insights into locomotor central pattern generator organization

    PubMed Central

    Zhong, Guisheng; Shevtsova, Natalia A; Rybak, Ilya A; Harris-Warrick, Ronald M

    2012-01-01

    We explored the organization of the spinal central pattern generator (CPG) for locomotion by analysing the activity of spinal interneurons and motoneurons during spontaneous deletions occurring during fictive locomotion in the isolated neonatal mouse spinal cord, following earlier work on locomotor deletions in the cat. In the isolated mouse spinal cord, most spontaneous deletions were non-resetting, with rhythmic activity resuming after an integer number of cycles. Flexor and extensor deletions showed marked asymmetry: flexor deletions were accompanied by sustained ipsilateral extensor activity, whereas rhythmic flexor bursting was not perturbed during extensor deletions. Rhythmic activity on one side of the cord was not perturbed during non-resetting spontaneous deletions on the other side, and these deletions could occur with no input from the other side of the cord. These results suggest that the locomotor CPG has a two-level organization with rhythm-generating (RG) and pattern-forming (PF) networks, in which only the flexor RG network is intrinsically rhythmic. To further explore the neuronal organization of the CPG, we monitored activity of motoneurons and selected identified interneurons during spontaneous non-resetting deletions. Motoneurons lost rhythmic synaptic drive during ipsilateral deletions. Flexor-related commissural interneurons continued to fire rhythmically during non-resetting ipsilateral flexor deletions. Deletion analysis revealed two classes of rhythmic V2a interneurons. Type I V2a interneurons retained rhythmic synaptic drive and firing during ipsilateral motor deletions, while type II V2a interneurons lost rhythmic synaptic input and fell silent during deletions. This suggests that the type I neurons are components of the RG, whereas the type II neurons are components of the PF network. We propose a computational model of the spinal locomotor CPG that reproduces our experimental results. The results may provide novel insights into the organization of spinal locomotor networks. PMID:22869012

  6. Consensus document. Management of non-alcoholic fatty liver disease (NAFLD). Clinical practice guideline.

    PubMed

    Aller, Rocío; Fernández-Rodríguez, Conrado; Lo Iacono, Oreste; Bañares, Rafael; Abad, Javier; Carrión, José Antonio; García-Monzón, Carmelo; Caballería, Joan; Berenguer, Marina; Rodríguez-Perálvarez, Manuel; Miranda, José López; Vilar-Gómez, Eduardo; Crespo, Javier; García-Cortés, Miren; Reig, María; Navarro, José María; Gallego, Rocío; Genescà, Joan; Arias-Loste, María Teresa; Pareja, María Jesús; Albillos, Agustín; Muntané, Jordi; Jorquera, Francisco; Solà, Elsa; Hernández-Guerra, Manuel; Rojo, Miguel Ángel; Salmerón, Javier; Caballería, Llorenc; Diago, Moisés; Molina, Esther; Bataller, Ramón; Romero-Gómez, Manuel

    2018-05-01

    Non-alcoholic fatty liver disease (NAFLD) is the main cause of liver diseases in Spain and the incidence is raising due to the outbreak of type 2 diabetes and obesity. This CPG suggests recommendation about diagnosis, mainly non-invasive biomarkers, and clinical management of this entity. Life-style modifications to achieve weight loss is the main target in the management of NAFLD. Low caloric Mediterranean diet and 200 minutes/week of aerobic exercise are encouraged. In non-responders patients with morbid obesity, bariatric surgery or metabolic endoscopy could be indicated. Pharmacological therapy is indicated in patients with NASH and fibrosis and non-responders to weight loss measures. NAFLD could influence liver transplantation, as a growing indication, the impact of steatosis in the graft viability, de novo NAFLD rate after OLT and a raised cardiovascular risk that modify the management of this entity. The current CPG was the result of the First Spanish NAFLD meeting in Seville. Copyright © 2018 Elsevier España, S.L.U. All rights reserved.

  7. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  8. DNA methylation and transcription in a distal region upstream from the bovine AlphaS1 casein gene after once or twice daily milking.

    PubMed

    Nguyen, Minh; Boutinaud, Marion; Pétridou, Barbara; Gabory, Anne; Pannetier, Maëlle; Chat, Sophie; Bouet, Stephan; Jouneau, Luc; Jaffrezic, Florence; Laloë, Denis; Klopp, Christophe; Brun, Nicolas; Kress, Clémence; Jammes, Hélène; Charlier, Madia; Devinoy, Eve

    2014-01-01

    Once daily milking (ODM) induces a reduction in milk production when compared to twice daily milking (TDM). Unilateral ODM of one udder half and TDM of the other half, enables the study of underlying mechanisms independently of inter-individual variability (same genetic background) and of environmental factors. Our results show that in first-calf heifers three CpG, located 10 kb upstream from the CSN1S1 gene were methylated to 33, 34 and 28%, respectively, after TDM but these levels were higher after ODM, 38, 38 and 33%, respectively. These methylation levels were much lower than those observed in the mammary gland during pregnancy (57, 59 and 50%, respectively) or in the liver (74, 78 and 61%, respectively). The methylation level of a fourth CpG (CpG4), located close by (29% during TDM) was not altered after ODM. CpG4 methylation reached 39.7% and 59.5%, during pregnancy or in the liver, respectively. CpG4 is located within a weak STAT5 binding element, arranged in tandem with a second high affinity STAT5 element. STAT5 binding is only marginally modulated by CpG4 methylation, but it may be altered by the methylation levels of the three other CpG nearby. Our results therefore shed light on mechanisms that help to explain how milk production is almost, but not fully, restored when TDM is resumed (15.1 ± 0.2 kg/day instead of 16.2 ± 0.2 kg/day, p<0.01). The STAT5 elements are 100 bp away from a region transcribed in the antisense orientation, in the mammary gland during lactation, but not during pregnancy or in other reproductive organs (ovary or testes). We now need to clarify whether the transcription of this novel RNA is a consequence of STAT5 interacting with the CSN1S1 distal region, or whether it plays a role in the chromatin structure of this region.

  9. Efficacy of a strategy for implementing a guideline for the control of cardiovascular risk in a primary healthcare setting: the SIRVA2 study a controlled, blinded community intervention trial randomised by clusters

    PubMed Central

    2011-01-01

    This work describes the methodology used to assess a strategy for implementing clinical practice guidelines (CPG) for cardiovascular risk control in a health area of Madrid. Background The results on clinical practice of introducing CPGs have been little studied in Spain. The strategy used to implement a CPG is known to influence its final use. Strategies based on the involvement of opinion leaders and that are easily executed appear to be among the most successful. Aim The main aim of the present work was to compare the effectiveness of two strategies for implementing a CPG designed to reduce cardiovascular risk in the primary healthcare setting, measured in terms of improvements in the recording of calculated cardiovascular risk or specific risk factors in patients' medical records, the control of cardiovascular risk factors, and the incidence of cardiovascular events. Methods This study involved a controlled, blinded community intervention in which the 21 health centres of the Number 2 Health Area of Madrid were randomly assigned by clusters to be involved in either a proposed CPG implementation strategy to reduce cardiovascular risk, or the normal dissemination strategy. The study subjects were patients ≥ 45 years of age whose health cards showed them to belong to the studied health area. The main variable examined was the proportion of patients whose medical histories included the calculation of their cardiovascular risk or that explicitly mentioned the presence of variables necessary for its calculation. The sample size was calculated for a comparison of proportions with alpha = 0.05 and beta = 0.20, and assuming that the intervention would lead to a 15% increase in the measured variables. Corrections were made for the design effect, assigning a sample size to each cluster proportional to the size of the population served by the corresponding health centre, and assuming losses of 20%. This demanded a final sample size of 620 patients. Data were analysed using summary measures for each cluster, both in making estimates and for hypothesis testing. Analysis of the variables was made on an intention-to-treat basis. Trial Registration ClinicalTrials.gov: NCT01270022 PMID:21504570

  10. Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

    PubMed Central

    Maguire, S. M.; Phelps, S. M.

    2017-01-01

    DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

  11. The Healthy Weight Commitment Foundation pledge: calories sold from U.S. consumer packaged goods, 2007-2012.

    PubMed

    Ng, Shu Wen; Slining, Meghan M; Popkin, Barry M

    2014-10-01

    Corporate voluntary pledges to improve the health of Americans have not been held to either explicit measurable outcomes or a framework for independent evaluation. The Healthy Weight Commitment Foundation (HWCF), whose members include 16 of the nation's leading consumer packaged goods (CPG) food and beverage manufacturers, voluntarily pledged to collectively sell 1 trillion fewer calories in the U.S. marketplace by 2012 (against a 2007 baseline), and sell 1.5 trillion fewer calories by 2015. This paper presents the findings of an independent evaluation of the 2012 HWCF marketplace pledge, conducted in 2013. The 16 HWCF companies collectively sold approximately 6.4 trillion fewer calories (-10.6%) in 2012 than in the baseline year of 2007. Taking into account population changes over the 5-year period of 2007-2012, CPG caloric sales from brands included in the HWCF pledge declined by an average of 78 kcal/capita/day. CPG caloric sales from non-HWCF national brands during the same period declined by 11 kcal/capita/day, and there were similar declines in calories from private label products. Thus, the total reduction in CPG caloric sales between 2007 and 2012 was 99 kcal/capita/day. This independent evaluation is the first to evaluate food industry compliance with its calorie reduction pledges and to assess how sales from the CPG food and beverage sector are changing. An accompanying paper investigates the extent to which the HWCF pledge affected household-level changes in CPG calories purchased, controlling for important economic and sociodemographic factors affecting household food purchases over this period. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  12. Analyses of Magnetic Resonance Imaging of Cerebrospinal Fluid Dynamics Pre and Post Short and Long-Duration Space Flights

    NASA Technical Reports Server (NTRS)

    Alperin, Noam; Barr, Yael; Lee, Sang H.; Mason,Sara; Bagci, Ahmet M.

    2015-01-01

    Preliminary results are based on analyses of data from 17 crewmembers. The initial analysis compares pre to post-flight changes in total cerebral blood flow (CBF) and craniospinal CSF flow volume. Total CBF is obtained by summation of the mean flow rates through the 4 blood vessels supplying the brain (right and left internal carotid and vertebral arteries). Volumetric flow rates were obtained using an automated lumen segmentation technique shown to have 3-4-fold improved reproducibility and accuracy over manual lumen segmentation (6). Two cohorts, 5 short-duration and 8 long-duration crewmembers, who were scanned within 3 to 8 days post landing were included (4 short-duration crewmembers with MRI scans occurring beyond 10 days post flight were excluded). The VIIP Clinical Practice Guideline (CPG) classification is being used initially as a measure for VIIP syndrome severity. Median CPG scores of the short and long-duration cohorts were similar, 2. Mean preflight total CBF for the short and long-duration cohorts were similar, 863+/-144 and 747+/-119 mL/min, respectively. Percentage CBF changes for all short duration crewmembers were 11% or lower, within the range of normal physiological fluctuations in healthy individuals. In contrast, in 4 of the 8 long-duration crewmembers, the change in CBF exceeded the range of normal physiological fluctuation. In 3 of the 4 subjects an increase in CBF was measured. Large pre to post-flight changes in the craniospinal CSF flow volume were found in 6 of the 8 long-duration crewmembers. Box-Whisker plots of the CPG and the percent CBF and CSF flow changes for the two cohorts are shown in Figure 4. Examples of CSF flow waveforms for a short and two long-duration (CPG 0 and 3) are shown in Figure 5. Changes in CBF and CSF flow dynamics larger than normal physiological fluctuations were observed in the long-duration crewmembers. Changes in CSF flow were more pronounced than changes in CBF. Decreased CSF flow dynamics were observed in a subject with VIIP signs. Study limitations include a slightly longer landing-to-MRI scan period for the short-duration cohort and limited sensitivity of the subjective discrete ordinal CPG scale. This limitation can be overcome by using imaging based parametric measures of VIIP severity such as globe deformation measures.

  13. Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA

    DTIC Science & Technology

    2005-09-01

    tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such

  14. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

    PubMed Central

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-01-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

  15. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

    PubMed

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-11-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

  16. Using an Artificial Neural Bypass to Restore Cortical Control of Rhythmic Movements in a Human with Quadriplegia

    NASA Astrophysics Data System (ADS)

    Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad

    2016-09-01

    Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis.

  17. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. dbCPG: A web resource for cancer predisposition genes.

    PubMed

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-06-21

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes.

  19. The Healthy Weight Commitment Foundation Pledge

    PubMed Central

    Ng, Shu Wen; Popkin, Barry M.

    2014-01-01

    Context An independent evaluation of the Healthy Weight Commitment Foundation (HWCF) marketplace pledge found that the participating companies met and exceeded their interim 2012 sales reduction pledge. Evidence acquisition This follow-up study conducted in 2013 used purchase data from 2000–2012 among U.S. households with children and compared trends in calorie purchases of HWCF, non-HWCF name brands, and private label (PL) products in the pre-pledge period (2000–2007) and the post-pledge period (2008–2012); controlled for potential effects of concurrent changes in demographic and economic factors, including the Great Recession and food prices; and assessed whether the HWCF marketplace pledge was associated with reductions in consumer packaged goods (CPG) calorie purchases by households with children. Evidence synthesis There has been a significant per capita decline in average daily CPG caloric purchases between 2000 and 2012 among households with children from all brand categories. Based on pre-pledge trends, declines in CPG caloric purchases were already occurring. However, post-pledge reductions in calories purchased from HWCF brands were less than expected, and reductions in calories purchased from non-HWCF name brands and PLs were greater than expected after economic, sociodemographic, and secular factors were accounted for. Conclusions If the 16 HWCF companies had been able to maintain their pre-pledge trajectory, there should have been an additional 42 kcals/capita/day reduction in calories purchased from HWCF products in 2012 among households with children. A lack of change in total CPG calories purchased between 2011 and 2012 calls into question the sustainability of the decline and a need for continued monitoring. PMID:25240968

  20. DNA hypermethylation and X chromosome inactivation are major determinants of phenotypic variation in women heterozygous for G6PD mutations.

    PubMed

    Wang, Jin; Xiao, Qi-Zhi; Chen, You-Ming; Yi, Sheng; Liu, Dun; Liu, Yan-Hui; Zhang, Cui-Mei; Wei, Xiao-Feng; Zhou, Yu-Qiu; Zhong, Xing-Ming; Zhao, Cun-You; Xiong, Fu; Wei, Xiang-Cai; Xu, Xiang-Min

    2014-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked incompletely dominant enzyme deficiency that results from G6PD gene mutations. Women heterozygous for G6PD mutations exhibit variation in the loss of enzyme activity but the cause of this phenotypic variation is unclear. We determined DNA methylation and X-inactivation patterns in 71 G6PD-deficient female heterozygotes and 68 G6PD non-deficient controls with the same missense mutations (G6PD Canton c.1376G>T or Kaiping c.1388G>A) to correlate determinants with variable phenotypes. Specific CpG methylations within the G6PD promoter were significantly higher in G6PD-deficient heterozygotes than in controls. Preferential X-inactivation of the G6PD wild-type allele was determined in heterozygotes. The incidence of preferential X-inactivation was 86.2% in the deficient heterozygote group and 31.7% in the non-deficient heterozygote group. A significant negative correlation was observed between X-inactivation ratios of the wild-type allele and G6PD/6-phosphogluconate dehydrogenase (6PGD) ratios in heterozygous G6PD Canton (r=-0.657, p<0.001) or Kaiping (r=-0.668, p<0.001). Multivariate logistic regression indicated that heterozygotes with hypermethylation of specific CpG sites in the G6PD promoter and preferential X-inactivation of the wild-type allele were at risk of enzyme deficiency. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  2. CpG island methylation profile in non-invasive oral rinse samples is predictive of oral and pharyngeal carcinoma.

    PubMed

    Langevin, Scott M; Eliot, Melissa; Butler, Rondi A; Cheong, Agnes; Zhang, Xiang; McClean, Michael D; Koestler, Devin C; Kelsey, Karl T

    2015-01-01

    There are currently no screening tests in routine use for oral and pharyngeal cancer beyond visual inspection and palpation, which are provided on an opportunistic basis, indicating a need for development of novel methods for early detection, particularly in high-risk populations. We sought to address this need through comprehensive interrogation of CpG island methylation in oral rinse samples. We used the Infinium HumanMethylation450 BeadArray to interrogate DNA methylation in oral rinse samples collected from 154 patients with incident oral or pharyngeal carcinoma prior to treatment and 72 cancer-free control subjects. Subjects were randomly allocated to either a training or a testing set. For each subject, average methylation was calculated for each CpG island represented on the array. We applied a semi-supervised recursively partitioned mixture model to the CpG island methylation data to identify a classifier for prediction of case status in the training set. We then applied the resultant classifier to the testing set for validation and to assess the predictive accuracy. We identified a methylation classifier comprised of 22 CpG islands, which predicted oral and pharyngeal carcinoma with a high degree of accuracy (AUC = 0.92, 95 % CI 0.86, 0.98). This novel methylation panel is a strong predictor of oral and pharyngeal carcinoma case status in oral rinse samples and may have utility in early detection and post-treatment follow-up.

  3. The CpG island searcher: a new WWW resource.

    PubMed

    Takai, Daiya; Jones, Peter A

    2003-01-01

    Clusters of CpG dinucleotides in GC rich regions of the genome called "CpG islands" frequently occur in the 5' ends of genes. Methylation of CpG islands plays a role in transcriptional silencing in higher organisms in certain situations. We have established a CpG-island-extraction algorithm, which we previously developed [Takai and Jones, 2002], on a web site which has a simple user interface to identify CpG islands from submitted sequences of up to 50kb. The web site determines the locations of CpG islands using parameters (lower limit of %GC, ObsCpG/ExpCpG, length) set by the user, to display the value of parameters on each CpG island, and provides a graphical map of CpG dinucleotide distribution and borders of CpG islands. A command-line version of the CpG islands searcher has also been developed for larger sequences. The CpG Island Searcher was applied to the latest sequence and mapping information of human chromosomes 20, 21 and 22, and a total of 2345 CpG islands were extracted and 534 (23%) of them contained first coding exons and 650 (28%) contained other exons. The CpG Island Searcher is available on the World Wide Web at http://www.cpgislands.com or http://www.uscnorris.com/cpgislands/cpg.cgi.

  4. The Composite of Bone Marrow Concentrate and PRP as an Alternative to Autologous Bone Grafting

    PubMed Central

    Hakimi, Mohssen; Grassmann, Jan-Peter; Betsch, Marcel; Schneppendahl, Johannes; Gehrmann, Sebastian; Hakimi, Ahmad-Reza; Kröpil, Patric; Sager, Martin; Herten, Monika; Wild, Michael; Windolf, Joachim; Jungbluth, Pascal

    2014-01-01

    One possible alternative to the application of autologous bone grafts represents the use of autologous bone marrow concentrate (BMC). The purpose of our study was to evaluate the potency of autologous platelet-rich plasma (PRP) in combination with BMC. In 32 mini-pigs a metaphyseal critical-size defect was surgically created at the proximal tibia. The animals were allocated to four treatment groups of eight animals each (1. BMC+CPG group, 2. BMC+CPG+PRP group, 3. autograft group, 4. CPG group). In the BMC+CPG group the defect was filled with autologous BMC in combination with calcium phosphate granules (CPG), whereas in the BMC+CPG+PRP group the defect was filled with the composite of autologous BMC, CPG and autologous PRP. In the autograft group the defect was filled with autologous cancellous graft, whereas in the CPG group the defect was filled with CPG solely. After 6 weeks radiological and histomorphometrical analysis showed significantly more new bone formation in the BMC+CPG+PRP group compared to the BMC+CPG group and the CPG group. There were no significant differences between the BMC+CPG+PRP group and the autograft group. In the PRP platelets were enriched significantly about 4.7-fold compared to native blood. In BMC the count of mononuclear cells increased significantly (3.5-fold) compared to the bone marrow aspirate. This study demonstrates that the composite of BMC+CPG+PRP leads to a significantly higher bone regeneration of critical-size defects at the proximal tibia in mini-pigs than the use of BMC+CPG without PRP. Furthermore, within the limits of the present study the composite BMC+CPG+PRP represents a comparable alternative to autologous bone grafting. PMID:24950251

  5. Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major

    PubMed Central

    Riyahi, Sepand; Sánchez-Delgado, Marta; Calafell, Francesc; Monk, David; Senar, Juan Carlos

    2015-01-01

    DNA methylation is one of the main epigenetic mechanisms that can regulate gene expression and is an important means for creating phenotypic variation. In the present study, we performed methylation profiling of 2 candidate genes for personality traits, namely DRD4 and SERT, in the great tit Parus major to ascertain whether personality traits and behavior within different habitats have evolved with the aid of epigenetic variation. We applied bisulphite PCR and strand-specific sequencing to determine the methylation profile of the CpG dinucleotides in the DRD4 and SERT promoters and also in the CpG island overlapping DRD4 exon 3. Furthermore, we performed pyrosequencing to quantify the total methylation levels at each CpG location. Our results indicated that methylation was ∼1–4% higher in urban than in forest birds, for all loci and tissues analyzed, suggesting that this epigenetic modification is influenced by environmental conditions. Screening of genomic DNA sequence revealed that the SERT promoter is CpG poor region. The methylation at a single CpG dinucleotide located 288 bp from the transcription start site was related to exploration score in urban birds. In addition, the genotypes of the SERT polymorphism SNP234 located within the minimal promoter were significantly correlated with novelty seeking behavior in captivity, with the allele increasing this behavior being more frequent in urban birds. As a conclusion, it seems that both genetic and methylation variability of the SERT gene have an important role in shaping personality traits in great tits, whereas genetic and methylation variation at the DRD4 gene is not strongly involved in behavior and personality traits. PMID:25933062

  6. Exploiting Semantic Web Technologies to Develop OWL-Based Clinical Practice Guideline Execution Engines.

    PubMed

    Jafarpour, Borna; Abidi, Samina Raza; Abidi, Syed Sibte Raza

    2016-01-01

    Computerizing paper-based CPG and then executing them can provide evidence-informed decision support to physicians at the point of care. Semantic web technologies especially web ontology language (OWL) ontologies have been profusely used to represent computerized CPG. Using semantic web reasoning capabilities to execute OWL-based computerized CPG unties them from a specific custom-built CPG execution engine and increases their shareability as any OWL reasoner and triple store can be utilized for CPG execution. However, existing semantic web reasoning-based CPG execution engines suffer from lack of ability to execute CPG with high levels of expressivity, high cognitive load of computerization of paper-based CPG and updating their computerized versions. In order to address these limitations, we have developed three CPG execution engines based on OWL 1 DL, OWL 2 DL and OWL 2 DL + semantic web rule language (SWRL). OWL 1 DL serves as the base execution engine capable of executing a wide range of CPG constructs, however for executing highly complex CPG the OWL 2 DL and OWL 2 DL + SWRL offer additional executional capabilities. We evaluated the technical performance and medical correctness of our execution engines using a range of CPG. Technical evaluations show the efficiency of our CPG execution engines in terms of CPU time and validity of the generated recommendation in comparison to existing CPG execution engines. Medical evaluations by domain experts show the validity of the CPG-mediated therapy plans in terms of relevance, safety, and ordering for a wide range of patient scenarios.

  7. Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

    PubMed

    Peng, Liu; Wei, He; Liren, Li

    2014-01-01

    To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

  8. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications. Electronic supplementary information (ESI) available. See DOI: 10.1039/c2nr31189e

  10. The Healthy Wight Commitment Foundation pledge: calories purchased by U.S. households with children, 2000-2012.

    PubMed

    Ng, Shu Wen; Popkin, Barry M

    2014-10-01

    An independent evaluation of the Healthy Weight Commitment Foundation (HWCF) marketplace pledge found that the participating companies met and exceeded their interim 2012 sales reduction pledge. This follow-up study conducted in 2013 used purchase data from 2000 to 2012 among U.S. households with children and compared trends in calorie purchases of HWCF, non-HWCF name brands, and private label (PL) products in the pre-pledge period (2000-2007) and the post-pledge period (2008-2012); controlled for potential effects of concurrent changes in demographic and economic factors, including the Great Recession and food prices; and assessed whether the HWCF marketplace pledge was associated with reductions in consumer packaged goods (CPG) calorie purchases by households with children. There has been a significant per capita decline in average daily CPG caloric purchases between 2000 and 2012 among households with children from all brand categories. Based on pre-pledge trends, declines in CPG caloric purchases were already occurring. However, post-pledge reductions in calories purchased from HWCF brands were less than expected, and reductions in calories purchased from non-HWCF name brands and PLs were greater than expected after economic, sociodemographic, and secular factors were accounted for. If the 16 HWCF companies had been able to maintain their pre-pledge trajectory, there should have been an additional 42 kcal/capita/day reduction in calories purchased from HWCF products in 2012 among households with children. A lack of change in total CPG calories purchased between 2011 and 2012 calls into question the sustainability of the decline and a need for continued monitoring. Copyright © 2014 American Journal of Preventive Medicine. Published by Elsevier Inc. All rights reserved.

  11. Non-linear patterns in age-related DNA methylation may reflect CD4+ T cell differentiation

    PubMed Central

    Johnson, Nicholas D.; Wiener, Howard W.; Smith, Alicia K.; Nishitani, Shota; Absher, Devin M.; Arnett, Donna K.; Aslibekyan, Stella; Conneely, Karen N.

    2017-01-01

    ABSTRACT DNA methylation (DNAm) is an important epigenetic process involved in the regulation of gene expression. While many studies have identified thousands of loci associated with age, few have differentiated between linear and non-linear DNAm trends with age. Non-linear trends could indicate early- or late-life gene regulatory processes. Using data from the Illumina 450K array on 336 human peripheral blood samples, we identified 21 CpG sites that associated with age (P<1.03E-7) and exhibited changing rates of DNAm change with age (P<1.94E-6). For 2 of these CpG sites (cg07955995 and cg22285878), DNAm increased with age at an increasing rate, indicating that differential DNAm was greatest among elderly individuals. We observed significant replication for both CpG sites (P<5.0E-8) in a second set of peripheral blood samples. In 8 of 9 additional data sets comprising samples of monocytes, T cell subtypes, and brain tissue, we observed a pattern directionally consistent with DNAm increasing with age at an increasing rate, which was nominally significant in the 3 largest data sets (4.3E-15

  12. Methyl-Cytosine-Driven Structural Changes Enhance Adduction Kinetics of an Exon 7 fragment of the p53 Gene

    NASA Astrophysics Data System (ADS)

    Malla, Spundana; Kadimisetty, Karteek; Fu, You-Jun; Choudhary, Dharamainder; Schenkman, John B.; Rusling, James F.

    2017-01-01

    Methylation of cytosine (C) at C-phosphate-guanine (CpG) sites enhances reactivity of DNA towards electrophiles. Mutations at CpG sites on the p53 tumor suppressor gene that can result from these adductions are in turn correlated with specific cancers. Here we describe the first restriction-enzyme-assisted LC-MS/MS sequencing study of the influence of methyl cytosines (MeC) on kinetics of p53 gene adduction by model metabolite benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), using methodology applicable to correlate gene damage sites for drug and pollutant metabolites with mutation sites. This method allows direct kinetic measurements by LC-MS/MS sequencing for oligonucleotides longer than 20 base pairs (bp). We used MeC and non-MeC (C) versions of a 32 bp exon 7 fragment of the p53 gene. Methylation of 19 cytosines increased the rate constant 3-fold for adduction on G at the major reactive CpG in codon 248 vs. the non-MeC fragment. Rate constants for non-CpG codons 244 and 243 were not influenced significantly by MeC. Conformational and hydrophobicity changes in the MeC-p53 exon 7 fragment revealed by CD spectra and molecular modeling increase the BPDE binding constant to G in codon 248 consistent with a pathway in which preceding reactant binding greatly facilitates the rate of covalent SN2 coupling.

  13. dbCPG: A web resource for cancer predisposition genes

    PubMed Central

    Wei, Ran; Yao, Yao; Yang, Wu; Zheng, Chun-Hou; Zhao, Min; Xia, Junfeng

    2016-01-01

    Cancer predisposition genes (CPGs) are genes in which inherited mutations confer highly or moderately increased risks of developing cancer. Identification of these genes and understanding the biological mechanisms that underlie them is crucial for the prevention, early diagnosis, and optimized management of cancer. Over the past decades, great efforts have been made to identify CPGs through multiple strategies. However, information on these CPGs and their molecular functions is scattered. To address this issue and provide a comprehensive resource for researchers, we developed the Cancer Predisposition Gene Database (dbCPG, Database URL: http://bioinfo.ahu.edu.cn:8080/dbCPG/index.jsp), the first literature-based gene resource for exploring human CPGs. It contains 827 human (724 protein-coding, 23 non-coding, and 80 unknown type genes), 637 rats, and 658 mouse CPGs. Furthermore, data mining was performed to gain insights into the understanding of the CPGs data, including functional annotation, gene prioritization, network analysis of prioritized genes and overlap analysis across multiple cancer types. A user-friendly web interface with multiple browse, search, and upload functions was also developed to facilitate access to the latest information on CPGs. Taken together, the dbCPG database provides a comprehensive data resource for further studies of cancer predisposition genes. PMID:27192119

  14. Combined DNA methylation and gene expression profiling in gastrointestinal stromal tumors reveals hypomethylation of SPP1 as an independent prognostic factor.

    PubMed

    Haller, Florian; Zhang, Jitao David; Moskalev, Evgeny A; Braun, Alexander; Otto, Claudia; Geddert, Helene; Riazalhosseini, Yasser; Ward, Aoife; Balwierz, Aleksandra; Schaefer, Inga-Marie; Cameron, Silke; Ghadimi, B Michael; Agaimy, Abbas; Fletcher, Jonathan A; Hoheisel, Jörg; Hartmann, Arndt; Werner, Martin; Wiemann, Stefan; Sahin, Ozgür

    2015-03-01

    Gastrointestinal stromal tumors (GISTs) have distinct gene expression patterns according to localization, genotype and aggressiveness. DNA methylation at CpG dinucleotides is an important mechanism for regulation of gene expression. We performed targeted DNA methylation analysis of 1.505 CpG loci in 807 cancer-related genes in a cohort of 76 GISTs, combined with genome-wide mRNA expression analysis in 22 GISTs, to identify signatures associated with clinicopathological parameters and prognosis. Principal component analysis revealed distinct DNA methylation patterns associated with anatomical localization, genotype, mitotic counts and clinical follow-up. Methylation of a single CpG dinucleotide in the non-CpG island promoter of SPP1 was significantly correlated with shorter disease-free survival. Hypomethylation of this CpG was an independent prognostic parameter in a multivariate analysis compared to anatomical localization, genotype, tumor size and mitotic counts in a cohort of 141 GISTs with clinical follow-up. The epigenetic regulation of SPP1 was confirmed in vitro, and the functional impact of SPP1 protein on tumorigenesis-related signaling pathways was demonstrated. In summary, SPP1 promoter methylation is a novel and independent prognostic parameter in GISTs, and might be helpful in estimating the aggressiveness of GISTs from the intermediate-risk category. © 2014 UICC.

  15. Region of interest methylation analysis: a comparison of MSP with MS-HRM and direct BSP.

    PubMed

    Akika, Reem; Awada, Zainab; Mogharbil, Nahed; Zgheib, Nathalie K

    2017-07-01

    The aim of this study was to compare and contrast three DNA methylation methods of a specific region of interest (ROI): methylation-specific PCR (MSP), methylation-sensitive high resolution melting (MS-HRM) and direct bisulfite sequencing (BSP). The methylation of a CpG area in the promoter region of Estrogen receptor alpha (ESR1) was evaluated by these three methods with samples and standards of different methylation percentages. MSP data were neither reproducible nor sensitive, and the assay was not specific due to non-specific binding of primers. MS-HRM was highly reproducible and a step forward into categorizing the methylation status of the samples as percent ranges. Direct BSP was the most informative method regarding methylation percentage of each CpG site. Though not perfect, it was reproducible and sensitive. We recommend the use of either method depending on the research question and target amplicon, and provided that the designed primers and expected amplicons are within recommendations. If the research question targets a limited number of CpG sites and simple yes/no results are enough, MSP may be attempted. For short amplicons that are crowded with CpG sites and of single melting domain, MS-HRM may be the method of choice though it only indicates the overall methylation percentage of the entire amplicon. Although the assay is highly reproducible, being semi-quantitative makes it of lesser interest to study ROI methylation of samples with little methylation differences. Direct BSP is a step forward as it gives information about the methylation percentage at each CpG site.

  16. Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

    PubMed Central

    Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

    2000-01-01

    Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

  17. Using an Artificial Neural Bypass to Restore Cortical Control of Rhythmic Movements in a Human with Quadriplegia

    PubMed Central

    Sharma, Gaurav; Friedenberg, David A.; Annetta, Nicholas; Glenn, Bradley; Bockbrader, Marcie; Majstorovic, Connor; Domas, Stephanie; Mysiw, W. Jerry; Rezai, Ali; Bouton, Chad

    2016-01-01

    Neuroprosthetic technology has been used to restore cortical control of discrete (non-rhythmic) hand movements in a paralyzed person. However, cortical control of rhythmic movements which originate in the brain but are coordinated by Central Pattern Generator (CPG) neural networks in the spinal cord has not been demonstrated previously. Here we show a demonstration of an artificial neural bypass technology that decodes cortical activity and emulates spinal cord CPG function allowing volitional rhythmic hand movement. The technology uses a combination of signals recorded from the brain, machine-learning algorithms to decode the signals, a numerical model of CPG network, and a neuromuscular electrical stimulation system to evoke rhythmic movements. Using the neural bypass, a quadriplegic participant was able to initiate, sustain, and switch between rhythmic and discrete finger movements, using his thoughts alone. These results have implications in advancing neuroprosthetic technology to restore complex movements in people living with paralysis. PMID:27658585

  18. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

    PubMed Central

    Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

    2010-01-01

    Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

  19. Expression of metastasis suppressor gene AES driven by a Yin Yang (YY) element in a CpG island promoter and transcription factor YY2.

    PubMed

    Kakizaki, Fumihiko; Sonoshita, Masahiro; Miyoshi, Hiroyuki; Itatani, Yoshiro; Ito, Shinji; Kawada, Kenji; Sakai, Yoshiharu; Taketo, M Mark

    2016-11-01

    We recently found that the product of the AES gene functions as a metastasis suppressor of colorectal cancer (CRC) in both humans and mice. Expression of amino-terminal enhancer of split (AES) protein is significantly decreased in liver metastatic lesions compared with primary colon tumors. To investigate its downregulation mechanism in metastases, we searched for transcriptional regulators of AES in human CRC and found that its expression is reduced mainly by transcriptional dysregulation and, in some cases, by additional haploidization of its coding gene. The AES promoter-enhancer is in a typical CpG island, and contains a Yin-Yang transcription factor recognition sequence (YY element). In human epithelial cells of normal colon and primary tumors, transcription factor YY2, a member of the YY family, binds directly to the YY element, and stimulates expression of AES. In a transplantation mouse model of liver metastases, however, expression of Yy2 (and therefore of Aes) is downregulated. In human CRC metastases to the liver, the levels of AES protein are correlated with those of YY2. In addition, we noticed copy-number reduction for the AES coding gene in chromosome 19p13.3 in 12% (5/42) of human CRC cell lines. We excluded other mechanisms such as point or indel mutations in the coding or regulatory regions of the AES gene, CpG methylation in the AES promoter enhancer, expression of microRNAs, and chromatin histone modifications. These results indicate that Aes may belong to a novel family of metastasis suppressors with a CpG-island promoter enhancer, and it is regulated transcriptionally. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

  20. Healthcare professionals' and policy makers' views on implementing a clinical practice guideline of hypertension management: a qualitative study.

    PubMed

    Lee, Ping Yein; Liew, Su May; Abdullah, Adina; Abdullah, Nurdiana; Ng, Chirk Jenn; Hanafi, Nik Sherina; Chia, Yook Chin; Lai, Pauline S M; Wong, Stalia S L; Khoo, Ee Ming

    2015-01-01

    Most studies have reported barriers to guideline usage mainly from doctors' perspective; few have reported the perspective of other stakeholders. This study aimed to determine the views and barriers to adherence of a national clinical practice guideline (CPG) on management of hypertension from the perspectives of policymakers, doctors and allied healthcare professionals. This study used a qualitative approach with purposive sampling. Seven in depth interviews and six focus group discussions were conducted with 35 healthcare professionals (policy makers, doctors, pharmacists and nurses) at a teaching hospital in Kuala Lumpur, Malaysia, between February and June 2013. All interviews were audio-recorded, transcribed verbatim and checked. Thematic approach was used to analyse the data. Two main themes and three sub-themes emerged from this study. The main themes were (1) variation in the use of CPG and (2) barriers to adherence to CPG. The three sub-themes for barriers were issues inherent to the CPG, systems and policy that is not supportive of CPG use, and attitudes and behaviour of stakeholders. The main users of the CPG were the primary care doctors. Pharmacists only partially use the guidelines, while nurses and policy makers were not using the CPG at all. Participants had suggested few strategies to improve usage and adherence to CPG. First, update the CPG regularly and keep its content simple with specific sections for allied health workers. Second, use technology to facilitate CPG accessibility and provide protected time for implementation of CPG recommendations. Third, incorporate local CPG in professional training, link CPG adherence to key performance indicators and provide incentives for its use. Barriers to the use of CPG hypertension management span across all stakeholders. The development and implementation of CPG focused mainly on doctors with lack of involvement of other healthcare stakeholders. Guidelines should be made simple, current, reliable, accessible, inclusive of all stakeholders and with good policy support.

  1. A Knowledge-Modeling Approach to Integrate Multiple Clinical Practice Guidelines to Provide Evidence-Based Clinical Decision Support for Managing Comorbid Conditions.

    PubMed

    Abidi, Samina

    2017-10-26

    Clinical management of comorbidities is a challenge, especially in a clinical decision support setting, as it requires the safe and efficient reconciliation of multiple disease-specific clinical procedures to formulate a comorbid therapeutic plan that is both effective and safe for the patient. In this paper we pursue the integration of multiple disease-specific Clinical Practice Guidelines (CPG) in order to manage co-morbidities within a computerized Clinical Decision Support System (CDSS). We present a CPG integration framework-termed as COMET (Comorbidity Ontological Modeling & ExecuTion) that manifests a knowledge management approach to model, computerize and integrate multiple CPG to yield a comorbid CPG knowledge model that upon execution can provide evidence-based recommendations for handling comorbid patients. COMET exploits semantic web technologies to achieve (a) CPG knowledge synthesis to translate a paper-based CPG to disease-specific clinical pathways (CP) that include specialized co-morbidity management procedures based on input from domain experts; (b) CPG knowledge modeling to computerize the disease-specific CP using a Comorbidity CPG ontology; (c) CPG knowledge integration by aligning multiple ontologically-modeled CP to develop a unified comorbid CPG knowledge model; and (e) CPG knowledge execution using reasoning engines to derive CPG-mediated recommendations for managing patients with comorbidities. We present a web-accessible COMET CDSS that provides family physicians with CPG-mediated comorbidity decision support to manage Atrial Fibrillation and Chronic Heart Failure. We present our qualitative and quantitative analysis of the knowledge content and usability of COMET CDSS.

  2. Immunostimulatory Properties of Lipid Modified CpG Oligonucleotides.

    PubMed

    Yu, Chunsong; An, Myunggi; Li, Meng; Liu, Haipeng

    2017-08-07

    Innate immune responses recognizing pathogen associated molecular patterns play important roles in adaptive immunity. As such, ligands which mimic the conserved products of microbial and activate innate immunity are widely used as adjuvants for vaccines. Synthetic single strand oligodeoxynucleotides (ODNs) containing unmethylated cytosine-guanine (CpG) motifs which bind Toll-like receptor 9 (TLR9) are powerful molecular adjuvants, potentiating both humoral and cellular responses. However, CpG ODN's in vitro potency has not been translated to in vivo settings primarily due to issues associated with delivery and toxicity. A major challenge in clinical application of CpG ODN is the efficient delivery to lymph nodes, the anatomic sites where all the immune responses are initiated. Targeting CpG to the key antigen presenting cells (APC) is essential for its application as a vaccine adjuvant, as it not only enhances CpG's efficacy, but also greatly reduces the systemic toxicity. We recently discovered an "albumin-hitchhiking" approach by which CpG ODNs were conjugated to a lipophilic lipid tail and follow subcutaneous injection, accumulated in lymph nodes by binding and transporting with endogenous albumin. This molecular approach targets CpG to antigen presenting cells in the draining lymph nodes via an endogenous albumin-mediated mechanism and simultaneously improves both the efficacy and safety of CpG as a vaccine adjuvant. Since CpG ODNs can be divided into structurally distinct classes, and each class of CpG ODN activates different types of immune cells and triggers different types of immunostimulatory activities, it is important to thoroughly evaluate the efficacy of this "albumin-hitchhiking" strategy in each class of CpG. Here we compare the immunostimulatory activities of three classes of lipid conjugated CpG ODNs in vitro and in vivo. Three representative sequences of lipid modified CpG ODNs were synthesized and their stimulatory effects as a vaccine adjuvant were evaluated. Our results showed that in vitro, lipid modified class A CpG exhibited enhanced stimulatory activities toward TLR transfected reporter cells or bone-marrow derived dendritic cells, whereas lipid-modification of class B or C CpG reduces the activation of TLR9 by 2-3 fold, as compared with unmodified class B and class C CpG, respectively. However, in vivo coadministration of ovalbumin (OVA) protein antigen mixed with lipid-conjugated class B or C CpG ODNs, but not class A CpGs induced dramatically increased OVA-specific humoral and cytotoxic CD8 + T cells responses compared with OVA mixed with unmodified CpGs. Further, lipid-modification greatly reduces the toxicity associated with CpG by minimizing the systemic dissemination. Taken together, these results demonstrated that amphiphilic modification of three classes of CpG motifs differentially affected and modulated the immunostimulatory activities in vitro and in vivo. Our study highlights the importance of in vivo lymph node targeting of CpG ODNs in fulfilling their use as vaccine adjuvants, providing implications for the rational design of molecular adjuvant for subunit vaccines.

  3. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  4. CpG island mapping by epigenome prediction.

    PubMed

    Bock, Christoph; Walter, Jörn; Paulsen, Martina; Lengauer, Thomas

    2007-06-01

    CpG islands were originally identified by epigenetic and functional properties, namely, absence of DNA methylation and frequent promoter association. However, this concept was quickly replaced by simple DNA sequence criteria, which allowed for genome-wide annotation of CpG islands in the absence of large-scale epigenetic datasets. Although widely used, the current CpG island criteria incur significant disadvantages: (1) reliance on arbitrary threshold parameters that bear little biological justification, (2) failure to account for widespread heterogeneity among CpG islands, and (3) apparent lack of specificity when applied to the human genome. This study is driven by the idea that a quantitative score of "CpG island strength" that incorporates epigenetic and functional aspects can help resolve these issues. We construct an epigenome prediction pipeline that links the DNA sequence of CpG islands to their epigenetic states, including DNA methylation, histone modifications, and chromatin accessibility. By training support vector machines on epigenetic data for CpG islands on human Chromosomes 21 and 22, we identify informative DNA attributes that correlate with open versus compact chromatin structures. These DNA attributes are used to predict the epigenetic states of all CpG islands genome-wide. Combining predictions for multiple epigenetic features, we estimate the inherent CpG island strength for each CpG island in the human genome, i.e., its inherent tendency to exhibit an open and transcriptionally competent chromatin structure. We extensively validate our results on independent datasets, showing that the CpG island strength predictions are applicable and informative across different tissues and cell types, and we derive improved maps of predicted "bona fide" CpG islands. The mapping of CpG islands by epigenome prediction is conceptually superior to identifying CpG islands by widely used sequence criteria since it links CpG island detection to their characteristic epigenetic and functional states. And it is superior to purely experimental epigenome mapping for CpG island detection since it abstracts from specific properties that are limited to a single cell type or tissue. In addition, using computational epigenetics methods we could identify high correlation between the epigenome and characteristics of the DNA sequence, a finding which emphasizes the need for a better understanding of the mechanistic links between genome and epigenome.

  5. Methylation of HPA axis related genes in men with hypersexual disorder.

    PubMed

    Jokinen, Jussi; Boström, Adrian E; Chatzittofis, Andreas; Ciuculete, Diana M; Öberg, Katarina Görts; Flanagan, John N; Arver, Stefan; Schiöth, Helgi B

    2017-06-01

    Hypersexual Disorder (HD) defined as non-paraphilic sexual desire disorder with components of compulsivity, impulsivity and behavioral addiction, and proposed as a diagnosis in the DSM 5, shares some overlapping features with substance use disorder including common neurotransmitter systems and dysregulated hypothalamic-pituitary-adrenal (HPA) axis function. In this study, comprising 67 HD male patients and 39 male healthy volunteers, we aimed to identify HPA-axis coupled CpG-sites, in which modifications of the epigenetic profile are associated with hypersexuality. The genome-wide methylation pattern was measured in whole blood using the Illumina Infinium Methylation EPIC BeadChip, measuring the methylation state of over 850K CpG sites. Prior to analysis, the global DNA methylation pattern was pre-processed according to standard protocols and adjusted for white blood cell type heterogeneity. We included CpG sites located within 2000bp of the transcriptional start site of the following HPA-axis coupled genes: Corticotropin releasing hormone (CRH), corticotropin releasing hormone binding protein (CRHBP), corticotropin releasing hormone receptor 1 (CRHR1), corticotropin releasing hormone receptor 2 (CRHR2), FKBP5 and the glucocorticoid receptor (NR3C1). We performed multiple linear regression models of methylation M-values to a categorical variable of hypersexuality, adjusting for depression, dexamethasone non-suppression status, Childhood Trauma Questionnaire total score and plasma levels of TNF-alpha and IL-6. Of 76 tested individual CpG sites, four were nominally significant (p<0.05), associated with the genes CRH, CRHR2 and NR3C1. Cg23409074-located 48bp upstream of the transcription start site of the CRH gene - was significantly hypomethylated in hypersexual patients after corrections for multiple testing using the FDR-method. Methylation levels of cg23409074 were positively correlated with gene expression of the CRH gene in an independent cohort of 11 healthy male subjects. The methylation levels at the identified CRH site, cg23409074, were significantly correlated between blood and four different brain regions. CRH is an important integrator of neuroendocrine stress responses in the brain, with a key role in the addiction processes. Our results show epigenetic changes in the CRH gene related to hypersexual disorder in men. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Epigenetic Contribution of the Myosin Light Chain Kinase Gene to the Risk for Acute Respiratory Distress Syndrome

    PubMed Central

    Szilágyi, Keely L.; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D.; Zhang, Wei; Garcia, Joe G.N.

    2016-01-01

    Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (~30-40%). Health disparities exist with African descent subjects (ADs) exhibiting greater mortality than European descent individuals (EDs). Myosin light chain kinase (MLCK) is encoded by MYLK whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, i.e. cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK CpGs between ARDS patients and ICU controls overall and by ethnicity in a nested case control study of 39 ARDS cases and 75 non-ARDS intensive care unit controls. Two MYLK CpG sites (cg03892735, cg23344121) were differentially modified between ARDS subjects and controls (p<0.05; q<0.25) in a logistic regression model, where no effect modification from ethnicity or age was found. One CpG site was associated with ARDS in patients less than 58 years old, cg19611163 (intron 19,20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2,3) and CpG (cg16212219, intron 31,32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting mQTL (modified cytosine quantitative trait loci) were identified using linear regression between local genetic variants and modification levels for two ARDS-associated CpGs (cg23344121, cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL, suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. PMID:27543902

  7. Prenatal antidepressant exposure associated with CYP2E1 DNA methylation change in neonates

    PubMed Central

    Gurnot, Cécile; Martin-Subero, Ignacio; Mah, Sarah M; Weikum, Whitney; Goodman, Sarah J; Brain, Ursula; Werker, Janet F; Kobor, Michael S; Esteller, Manel; Oberlander, Tim F; Hensch, Takao K

    2015-01-01

    Some but not all neonates are affected by prenatal exposure to serotonin reuptake inhibitor antidepressants (SRI) and maternal mood disturbances. Distinguishing the impact of these 2 exposures is challenging and raises critical questions about whether pharmacological, genetic, or epigenetic factors can explain the spectrum of reported outcomes. Using unbiased DNA methylation array measurements followed by a detailed candidate gene approach, we examined whether prenatal SRI exposure was associated with neonatal DNA methylation changes and whether such changes were associated with differences in birth outcomes. Prenatal SRI exposure was first associated with increased DNA methylation status primarily at CYP2E1(βNon-exposed = 0.06, βSRI-exposed = 0.30, FDR = 0); however, this finding could not be distinguished from the potential impact of prenatal maternal depressed mood. Then, using pyrosequencing of CYP2E1 regulatory regions in an expanded cohort, higher DNA methylation status—both the mean across 16 CpG sites (P < 0.01) and at each specific CpG site (P < 0.05)—was associated with exposure to lower 3rd trimester maternal depressed mood symptoms only in the SRI-exposed neonates, indicating a maternal mood x SRI exposure interaction. In addition, higher DNA methylation levels at CpG2 (P = 0.04), CpG9 (P = 0.04) and CpG10 (P = 0.02), in the interrogated CYP2E1 region, were associated with increased birth weight independently of prenatal maternal mood, SRI drug exposure, or gestational age at birth. Prenatal SRI antidepressant exposure and maternal depressed mood were associated with altered neonatal CYP2E1 DNA methylation status, which, in turn, appeared to be associated with birth weight. PMID:25891251

  8. The correlation between pulmonary fibrosis and methylation of peripheral Smad3 in cases of pigeon breeder's lung in a Chinese Uygur population.

    PubMed

    Wu, Chao; Ding, Wei; Li, Qifeng; Wang, Wenyi; Deng, Mingqin; Jin, Rong; Pang, Baosen; Yang, Xiaohong

    2017-06-27

    Smad3 is a key protein in the transforming growth factor-beta (TGF-β)/Smad signaling pathway, which is involved in fibrosis in many organs. We investigated the relationship between Smad3 gene methylation and pulmonary fibrosis in pigeon breeder's lung (PBL). Twenty Uygur PBL patients with pulmonary fibrosis in Kashi between October 2015 and March 2016 were enrolled. Twenty PBL-free pigeon breeders and 20 healthy non-pigeon breeders enrolled during the same period constituted the negative and normal control groups, respectively. Participants' data and peripheral blood samples were collected, and three Smad3 CpG loci were examined. Distributions of CpG_2 and CpG_4 methylation rates did not differ across groups, whereas distributions of CpG_3 methylation rates were significantly different among the three groups. The CpG_3 methylation rate was significantly lower in the patient group than in the negative control group. Smad3 mRNA expression was significantly higher in the patient group than in the negative control group but did not differ between the two control groups. TGF-βlevels were significantly higher in the patient group than in either control group (both P<0.01). Smad3 gene methylation and Smad3 mRNA expression were negatively correlated, with a correlation coefficient of -0.84. The number of pigeons bred during the preceding three months was positively correlated with Smad3 mRNA expression, with a correlation coefficient of 0.77. Smad3 gene hypomethylation might promote pulmonary fibrosis in Uygur PBL patients via increased Smad3 mRNA expression. Smad3 methylation, Smad3 mRNA expression and TGF-β level were correlated with the number of pigeons bred by patients.

  9. Murine J774 Macrophages Recognize LPS/IFN-g, Non-CpG DNA or Two-CpG DNA-containing Sequences as Immunologically Distinct

    PubMed Central

    Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.

    2010-01-01

    Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302

  10. Identification and Characterization of Novel Chitin-Binding Proteins from the Larval Cuticle of Silkworm, Bombyx mori.

    PubMed

    Dong, Zhaoming; Zhang, Weiwei; Zhang, Yan; Zhang, Xiaolu; Zhao, Ping; Xia, Qingyou

    2016-05-06

    Cuticle is mainly made of chitin filaments embedded in a matrix of cuticular proteins (CPs). Cuticular chitins have minor differences, whereas CPs are widely variable with respect to their sequences and structures. To understand the molecular basis underlying the mechanical properties of cuticle, it is necessary to know which CPs interact with chitin and how they are assembled into the cuticle structure. In the present study, a chitin-binding assay was performed followed by liquid chromatography-tandem mass spectrometry to identify the extracted proteins from the larval cuticle of silkworm, Bombyx mori. There were 463 proteins identified from the silkworm larval cuticle, 200 of which were recovered in the chitin-binding fraction. A total of 103 proteins were annotated as CPs, which were classified into 11 CP families based on their conserved motifs, including CPR, CPAP, CPT, CPF and CPFL, CPCFC, chitin_bind 3, BmCPH2 homologues, BmCPH9 homologues, BmCPG1 homologues, BmCPG20 homologues, and BmCPG21 homologues. A total of five CP families were newly identified in the chitin-binding fraction, thereby providing new information and insight into the composition, structure, and function of the silkworm larval cuticle.

  11. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  12. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    PubMed

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  13. Immortalization of T-cells is accompanied by gradual changes in CpG methylation resulting in a profile resembling a subset of T-cell leukemias.

    PubMed

    Degerman, Sofie; Landfors, Mattias; Siwicki, Jan Konrad; Revie, John; Borssén, Magnus; Evelönn, Emma; Forestier, Erik; Chrzanowska, Krystyna H; Rydén, Patrik; Keith, W Nicol; Roos, Göran

    2014-07-01

    We have previously described gene expression changes during spontaneous immortalization of T-cells, thereby identifying cellular processes important for cell growth crisis escape and unlimited proliferation. Here, we analyze the same model to investigate the role of genome-wide methylation in the immortalization process at different time points pre-crisis and post-crisis using high-resolution arrays. We show that over time in culture there is an overall accumulation of methylation alterations, with preferential increased methylation close to transcription start sites (TSSs), islands, and shore regions. Methylation and gene expression alterations did not correlate for the majority of genes, but for the fraction that correlated, gain of methylation close to TSS was associated with decreased gene expression. Interestingly, the pattern of CpG site methylation observed in immortal T-cell cultures was similar to clinical T-cell acute lymphoblastic leukemia (T-ALL) samples classified as CpG island methylator phenotype positive. These sites were highly overrepresented by polycomb target genes and involved in developmental, cell adhesion, and cell signaling processes. The presence of non-random methylation events in in vitro immortalized T-cell cultures and diagnostic T-ALL samples indicates altered methylation of CpG sites with a possible role in malignant hematopoiesis. Copyright © 2014 Neoplasia Press, Inc. Published by Elsevier Inc. All rights reserved.

  14. Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection.

    PubMed

    Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi

    2018-01-01

    The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.

  15. Phase 1 testing of detoxified LPS/group B meningococcal outer membrane protein vaccine with and without synthetic CPG 7909 adjuvant for the prevention and treatment of sepsis.

    PubMed

    Cross, Alan S; Greenberg, Nancy; Billington, Melissa; Zhang, Lei; DeFilippi, Christopher; May, Ryan C; Bajwa, Kanwaldeep K

    2015-11-27

    Gram-negative bacteria (GNB) are a leading cause of nosocomial infection and sepsis. Increasing multi-antibiotic resistance has left clinicians with fewer therapeutic options. Antibodies to GNB lipopolysaccharide (LPS, or endotoxin) have reduced morbidity and mortality as a result of infection and are not subject to the resistance mechanisms deployed by bacteria against antibiotics. In this phase 1 study, we administered a vaccine that elicits antibodies against a highly conserved portion of LPS with and without a CpG oligodeoxynucleotide (ODN) TLR9 agonist as adjuvant. A vaccine composed of the detoxified LPS (dLPS) from E. coli O111:B4 (J5 mutant) non-covalently complexed to group B meningococcal outer membrane protein (OMP). Twenty healthy adult subjects received three doses at 0, 29 and 59 days of antigen (10 μg dLPS) with or without CPG 7909 (250 or 500 μg). Subjects were evaluated for local and systemic adverse effects and laboratory findings. Anti-J5 LPS IgG and IgM antibody levels were measured by electrochemiluminesence. Due to premature study termination, not all subjects received all three doses. All vaccine formulations were well-tolerated with no local or systemic events of greater than moderate severity. The vaccine alone group achieved a ≥ 4-fold "responder" response in IgG and IgM antibody in only one of 6 subjects. In contrast, the vaccine plus CPG 7909 groups appeared to have earlier and more sustained (to 180 days) responses, greater mean-fold increases, and a higher proportion of "responders" achieving ≥ 4-fold increases over baseline. Although the study was halted before all enrolled subjects received all three doses, the J5dLPS/OMP vaccine, with or without CpG adjuvant, was safe and well-tolerated. The inclusion of CpG increased the number of subjects with a ≥ 4-fold antibody response, evident even after the second of three planned doses. A vaccine comprising J5dLPS/OMP antigen with CpG adjuvant merits further investigation. ClinicalTrials.gov Identifier: NCT01164514. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. TLR9-ERK-mTOR signaling is critical for autophagic cell death induced by CpG oligodeoxynucleotide 107 combined with irradiation in glioma cells

    PubMed Central

    Li, Xiaoli; Cen, Yanyan; Cai, Yongqing; Liu, Tao; Liu, Huan; Cao, Guanqun; Liu, Dan; Li, Bin; Peng, Wei; Zou, Jintao; Pang, Xueli; Zheng, Jiang; Zhou, Hong

    2016-01-01

    Synthetic oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) function as potential radiosensitizers for glioma treatment, although the underlying mechanism is unclear. It was observed that CpG ODN107, when combined with irradiation, did not induce apoptosis. Herein, the effect of CpG ODN107 + irradiation on autophagy and the related signaling pathways was investigated. In vitro, CpG ODN107 + irradiation induced autophagosome formation, increased the ratio of LC3 II/LC3 I, beclin 1 and decreased p62 expression in U87 cells. Meanwhile, CpG ODN107 also increased LC3 II/LC3 I expression in U251 and CHG-5 cells. In vivo, CpG ODN107 combined with local radiotherapy induced autophagosome formation in orthotopic transplantation tumor. Investigation of the molecular mechanisms demonstrated that CpG ODN107 + irradiation increased the levels of TLR9 and p-ERK, and decreased the level of p-mTOR in glioma cells. Further, TLR9-specific siRNA could affect the expressions of p-ERK and autophagy-related proteins in glioma cells. Taken together, CpG ODN107 combined with irradiation could induce autophagic cell death, and this effect was closely related to the TLR9-ERK-mTOR signaling pathway in glioma cells, providing new insights into the investigation mechanism of CpG ODN. PMID:27251306

  17. [Association between obesity and DNA methylation among the 7-16 year-old twins].

    PubMed

    Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M

    2018-04-10

    Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as <0.05, no positive sites would meet this standard. When DMC CpG site cg05684382, with the smallest P value (1.26E-06) as on chromosome 12, the DVC CpG site cg26188191 with the smallest P value (6.44E-06) appeared in CMIP gene on chromosome 16. Conclusions: In this study, we analyzed the genome-wide DNA methylation and its correlation with obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.

  18. Epigenome-wide association study of fasting measures of glucose, insulin, and HOMA-IR in the Genetics of Lipid Lowering Drugs and Diet Network study.

    PubMed

    Hidalgo, Bertha; Irvin, M Ryan; Sha, Jin; Zhi, Degui; Aslibekyan, Stella; Absher, Devin; Tiwari, Hemant K; Kabagambe, Edmond K; Ordovas, Jose M; Arnett, Donna K

    2014-02-01

    Known genetic susceptibility loci for type 2 diabetes (T2D) explain only a small proportion of heritable T2D risk. We hypothesize that DNA methylation patterns may contribute to variation in diabetes-related risk factors, and this epigenetic variation across the genome can contribute to the missing heritability in T2D and related metabolic traits. We conducted an epigenome-wide association study for fasting glucose, insulin, and homeostasis model assessment of insulin resistance (HOMA-IR) among 837 nondiabetic participants in the Genetics of Lipid Lowering Drugs and Diet Network study, divided into discovery (N = 544) and replication (N = 293) stages. Cytosine guanine dinucleotide (CpG) methylation at ∼470,000 CpG sites was assayed in CD4(+) T cells using the Illumina Infinium HumanMethylation 450 Beadchip. We fit a mixed model with the methylation status of each CpG as the dependent variable, adjusting for age, sex, study site, and T-cell purity as fixed-effects and family structure as a random-effect. A Bonferroni corrected P value of 1.1 × 10(-7) was considered significant in the discovery stage. Significant associations were tested in the replication stage using identical models. Methylation of a CpG site in ABCG1 on chromosome 21 was significantly associated with insulin (P = 1.83 × 10(-7)) and HOMA-IR (P = 1.60 × 10(-9)). Another site in the same gene was significant for HOMA-IR and of borderline significance for insulin (P = 1.29 × 10(-7) and P = 3.36 × 10(-6), respectively). Associations with the top two signals replicated for insulin and HOMA-IR (P = 5.75 × 10(-3) and P = 3.35 × 10(-2), respectively). Our findings suggest that methylation of a CpG site within ABCG1 is associated with fasting insulin and merits further evaluation as a novel disease risk marker.

  19. Predicting aberrant CpG island methylation

    PubMed Central

    Feltus, F. A.; Lee, E. K.; Costello, J. F.; Plass, C.; Vertino, P. M.

    2003-01-01

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context. PMID:14519846

  20. Predicting aberrant CpG island methylation.

    PubMed

    Feltus, F A; Lee, E K; Costello, J F; Plass, C; Vertino, P M

    2003-10-14

    Epigenetic silencing associated with aberrant methylation of promoter region CpG islands is one mechanism leading to loss of tumor suppressor function in human cancer. Profiling of CpG island methylation indicates that some genes are more frequently methylated than others, and that each tumor type is associated with a unique set of methylated genes. However, little is known about why certain genes succumb to this aberrant event. To address this question, we used Restriction Landmark Genome Scanning to analyze the susceptibility of 1,749 unselected CpG islands to de novo methylation driven by overexpression of DNA cytosine-5-methyltransferase 1 (DNMT1). We found that although the overall incidence of CpG island methylation was increased in cells overexpressing DNMT1, not all loci were equally affected. The majority of CpG islands (69.9%) were resistant to de novo methylation, regardless of DNMT1 overexpression. In contrast, we identified a subset of methylation-prone CpG islands (3.8%) that were consistently hypermethylated in multiple DNMT1 overexpressing clones. Methylation-prone and methylation-resistant CpG islands were not significantly different with respect to size, C+G content, CpG frequency, chromosomal location, or promoter association. We used DNA pattern recognition and supervised learning techniques to derive a classification function based on the frequency of seven novel sequence patterns that was capable of discriminating methylation-prone from methylation-resistant CpG islands with 82% accuracy. The data indicate that CpG islands differ in their intrinsic susceptibility to de novo methylation, and suggest that the propensity for a CpG island to become aberrantly methylated can be predicted based on its sequence context.

  1. Implementation of antibiotic use guidelines for fresh traumatic wound at Siriraj Hospital.

    PubMed

    Sirijatuphat, Rujipas; Choochan, Tanatchon; Siritongtaworn, Preecha; Sripojtham, Vipaporn; Thamlikitkul, Visanu

    2015-03-01

    To determine the effectiveness of implementing a clinical practice guideline (CPG) on antibiotic use for adults with fresh traumatic wounds who attended the trauma center at Siriraj Hospital, Bangkok. A prospective study of 600 adult patients who had fresh traumatic wounds (≤ 6 hours) was conducted at Siriraj Trauma Center from March 2013 to March 2014. The CPG was introduced to physicians, nurses and medical students by posting the CPG at the patient care areas of the trauma center. The outcomes were an appropriate classification of wounds according to the CPG recommendations, prevalence of antibiotic prescribing, incidence of wound infection and compliance with the CPG. Clean-contaminated wounds that did not need antibiotic treatment and clean-contaminated and contaminated wounds that required antibiotics were observed in 63.2, 6.7, and 30.1% ofthe patients, respectively. Antibiotics were given to 512 patients (85.3%). Infections occurred in six patients (1.0%). Antibiotic prescription according to CPG recommendations was observed for 243 patients (40.5%). The prevalence of antibiotic use in the CPG-compliant group (65.8%) was significantly less than that in the CPG-noncompliant group (98.6%) (p < 0.001). The patients in the CPG-compliant group had more contaminated wounds than those in the CPG-noncompliant group (51.4 vs. 15.7%, p < 0.001). The incidences of wound infection were very low in both groups and not significantly different (1.2 vs. 0.8%, p = 0.690). Antibiotic prophylaxis was necessary in less than 36.8% of adults with fresh traumatic wounds who attended Siriraj Trauma Center Compliance to CPG implementation using simple intervention seemed to be low. Adhering to CPG recommendations for antibiotic prophylaxis in adults with fresh traumatic wounds can reduce the unnecessary prescribing of antibiotics without increasing the rate of wound infection.

  2. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our results highlight the existence of divergent evolutionary pressures leading to CpG dinucleotide depletion among small ds-DNA viruses infecting vertebrate hosts.

  3. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

  4. CpG DNA in the prevention and treatment of infections.

    PubMed

    Dalpke, Alexander; Zimmermann, Stefan; Heeg, Klaus

    2002-01-01

    Microbial infection is sensed by Toll-like receptors (TLRs) on innate immune cells. Among the ten so far defined TLRs, TLR9 and its ligand are peculiar. TLR9 recognises bacterial DNA characterised by the abundance of unmethylated CpG dinucleotides, which distinguish bacterial DNA (CpG DNA) from mammalian DNA. Moreover, TLR9 shows a restricted cellular and subcellular pattern of expression. In contrast to other TLR agonists, CpG DNA is superior in activation of dendritic dells and induction of costimulatory cytokines such as interleukin (IL)-12 and IL-18. This qualifies CpG DNA as a Th1-promoting adjuvant. During infection, recognition of CpG DNA of intracellular pathogens skews and fine-tunes the ongoing immune response and induces long-lasting Th1 milieus. Thus, CpG DNA might play an important role in driving the immune system to a Th1 profile, preventing undesired Th2 milieus that might favour induction of allergic responses. Since CpG DNA can be synthesised with high purity and sequence fidelity, synthetic CpG DNA will become an important agent for Th1 instruction and be an effective adjuvant during vaccination.

  5. Emergent central pattern generator behavior in chemical coupled two-compartment models with time delay

    NASA Astrophysics Data System (ADS)

    Li, Shanshan; Zhang, Guoshan; Wang, Jiang; Chen, Yingyuan; Deng, Bin

    2018-02-01

    This paper proposes that modified two-compartment Pinsky-Rinzel (PR) neural model can be used to develop the simple form of central pattern generator (CPG). The CPG is called as 'half-central oscillator', which constructed by two inhibitory chemical coupled PR neurons with time delay. Some key properties of PR neural model related to CPG are studied and proved to meet the requirements of CPG. Using the simple CPG network, we first study the relationship between rhythmical output and key factors, including ambient noise, sensory feedback signals, morphological character of single neuron as well as the coupling delay time. We demonstrate that, appropriate intensity noise can enhance synchronization between two coupled neurons. Different output rhythm of CPG network can be entrained by sensory feedback signals. We also show that the morphology of single neuron has strong effect on the output rhythm. The phase synchronization indexes decrease with the increase of morphology parameter's difference. Through adjusting coupled delay time, we can get absolutely phase synchronization and antiphase state of CPG. Those results of simulation show the feasibility of PR neural model as a valid CPG as well as the emergent behaviors of the particularly CPG.

  6. Neural basis of singing in crickets: central pattern generation in abdominal ganglia

    NASA Astrophysics Data System (ADS)

    Schöneich, Stefan; Hedwig, Berthold

    2011-12-01

    The neural mechanisms underlying cricket singing behavior have been the focus of several studies, but the central pattern generator (CPG) for singing has not been localized conclusively. To test if the abdominal ganglia contribute to the singing motor pattern and to analyze if parts of the singing CPG are located in these ganglia, we systematically truncated the abdominal nerve cord of fictively singing crickets while recording the singing motor pattern from a front-wing nerve. Severing the connectives anywhere between terminal ganglion and abdominal ganglion A3 did not preclude singing, although the motor pattern became more variable and failure-prone as more ganglia were disconnected. Singing terminated immediately and permanently after transecting the connectives between the metathoracic ganglion complex and the first unfused abdominal ganglion A3. The contribution of abdominal ganglia for singing pattern generation was confirmed by intracellular interneuron recordings and current injections. During fictive singing, an ascending interneuron with its soma and dendrite in A3 depolarized rhythmically. It spiked 10 ms before the wing-opener activity and hyperpolarized in phase with the wing-closer activity. Depolarizing current injection elicited rhythmic membrane potential oscillations and spike bursts that elicited additional syllables and reliably reset the ongoing chirp rhythm. Our results disclose that the abdominal ganglion A3 is directly involved in generating the singing motor pattern, whereas the more posterior ganglia seem to provide only stabilizing feedback to the CPG circuit. Localizing the singing CPG in the anterior abdominal neuromeres now allows analyzing its circuitry at the level of identified interneurons in subsequent studies.

  7. The Spanish Neurological Society official clinical practice guidelines in epilepsy.

    PubMed

    Mercadé Cerdá, J M; Toledo Argani, M; Mauri Llerda, J A; López Gonzalez, F J; Salas Puig, X; Sancho Rieger, J

    2016-03-01

    Previous Official Clinical Practice Guidelines (CPGs) in Epilepsy were based on expert opinions and developed by the Epilepsy Study Group of the Spanish Neurological Society (GE-SEN). The current CPG in epilepsy is based on the scientific method, which extracts recommendations from published scientific evidence. A reduction in the variability in clinical practice through standardization of medical practice has become its main function. This CPG is focused on comprehensive care for individuals affected by epilepsy as a primary and predominant symptom, regardless of the age of onset and medical policy. 1. Creation of GE-SEN neurologists working group, in collaboration with Neuropediatricians, Neurophysiologists and Neuroradiologists. 2. Identification of clinical areas to be covered: diagnosis, prognosis and treatment. 3. Search and selection of the relevant scientific evidence. 4. Formulation of recommendations based on the classification of the available scientific evidence. It contains 161 recommendations of which 57% are consensus between authors and publishers, due to an important lack of awareness in many fields of this pathology. This Epilepsy CPG formulates recommendations based on explicit scientific evidence as a result of a formal and rigorous methodology, according to the current knowledge in the pre-selected areas. This paper includes the CPG chapter dedicated to emergency situations in seizures and epilepsy, which may present as a first seizure, an unfavorable outcome in a patient with known epilepsy, or status epilepticus as the most severe manifestation. Copyright © 2013 Sociedad Española de Neurología. Published by Elsevier España, S.L.U. All rights reserved.

  8. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.

    PubMed

    Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J

    2016-08-19

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

    PubMed

    Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

    2015-08-01

    DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

  10. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  11. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  12. Systematic CpT (ApG) depletion and CpG excess are unique genomic signatures of large DNA viruses infecting invertebrates.

    PubMed

    Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

    2014-01-01

    Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts.

  13. Identification of the human homolog of the imprinted mouse Air non-coding RNA

    PubMed Central

    Yotova, Iveta Y.; Vlatkovic, Irena M.; Pauler, Florian M.; Warczok, Katarzyna E.; Ambros, Peter F.; Oshimura, Mitsuo; Theussl, Hans-Christian; Gessler, Manfred; Wagner, Erwin F.; Barlow, Denise P.

    2010-01-01

    Genomic imprinting is widely conserved amongst placental mammals. Imprinted expression of IGF2R, however, differs between mice and humans. In mice, Igf2r imprinted expression is seen in all fetal and adult tissues. In humans, adult tissues lack IGF2R imprinted expression, but it is found in fetal tissues and Wilms' tumors where it is polymorphic and only seen in a small proportion of tested samples. Mouse Igf2r imprinted expression is controlled by the Air (Airn) ncRNA whose promoter lies in an intronic maternally-methylated CpG island. The human IGF2R gene carries a homologous intronic maternally-methylated CpG island of unknown function. Here, we use transfection and transgenic studies to show that the human IGF2R intronic CpG island is a ncRNA promoter. We also identify the same ncRNA at the endogenous human locus in 16–40% of Wilms' tumors. Thus, the human IGF2R gene shows evolutionary conservation of key features that control imprinted expression in the mouse. PMID:18789384

  14. Changes in the Coding and Non-coding Transcriptome and DNA Methylome that Define the Schwann Cell Repair Phenotype after Nerve Injury.

    PubMed

    Arthur-Farraj, Peter J; Morgan, Claire C; Adamowicz, Martyna; Gomez-Sanchez, Jose A; Fazal, Shaline V; Beucher, Anthony; Razzaghi, Bonnie; Mirsky, Rhona; Jessen, Kristjan R; Aitman, Timothy J

    2017-09-12

    Repair Schwann cells play a critical role in orchestrating nerve repair after injury, but the cellular and molecular processes that generate them are poorly understood. Here, we perform a combined whole-genome, coding and non-coding RNA and CpG methylation study following nerve injury. We show that genes involved in the epithelial-mesenchymal transition are enriched in repair cells, and we identify several long non-coding RNAs in Schwann cells. We demonstrate that the AP-1 transcription factor C-JUN regulates the expression of certain micro RNAs in repair Schwann cells, in particular miR-21 and miR-34. Surprisingly, unlike during development, changes in CpG methylation are limited in injury, restricted to specific locations, such as enhancer regions of Schwann cell-specific genes (e.g., Nedd4l), and close to local enrichment of AP-1 motifs. These genetic and epigenomic changes broaden our mechanistic understanding of the formation of repair Schwann cell during peripheral nervous system tissue repair. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Habitat assessment of non-wadeable rivers in Michigan.

    PubMed

    Wilhelm, Jennifer G O; Allan, J David; Wessell, Kelly J; Merritt, Richard W; Cummins, Kenneth W

    2005-10-01

    Habitat evaluation of wadeable streams based on accepted protocols provides a rapid and widely used adjunct to biological assessment. However, little effort has been devoted to habitat evaluation in non-wadeable rivers, where it is likely that protocols will differ and field logistics will be more challenging. We developed and tested a non-wadeable habitat index (NWHI) for rivers of Michigan, where non-wadeable rivers were defined as those of order >or=5, drainage area >or=1600 km2, mainstem lengths >or=100 km, and mean annual discharge >or=15 m3/s. This identified 22 candidate rivers that ranged in length from 103 to 825 km and in drainage area from 1620 to 16,860 km2. We measured 171 individual habitat variables over 2-km reaches at 35 locations on 14 rivers during 2000-2002, where mean wetted width was found to range from 32 to 185 m and mean thalweg depth from 0.8 to 8.3 m. We used correlation and principal components analysis to reduce the number of variables, and examined the spatial pattern of retained variables to exclude any that appeared to reflect spatial location rather than reach condition, resulting in 12 variables to be considered in the habitat index. The proposed NWHI included seven variables: riparian width, large woody debris, aquatic vegetation, bottom deposition, bank stability, thalweg substrate, and off-channel habitat. These variables were included because of their statistical association with independently derived measures of human disturbance in the riparian zone and the catchment, and because they are considered important in other habitat protocols or to the ecology of large rivers. Five variables were excluded because they were primarily related to river size rather than anthropogenic disturbance. This index correlated strongly with indices of disturbance based on the riparian (adjusted R2 = 0.62) and the catchment (adjusted R2 = 0.50), and distinguished the 35 river reaches into the categories of poor (2), fair (19), good (13), and excellent (1). Habitat variables retained in the NWHI differ from several used in wadeable streams, and place greater emphasis on known characteristic features of larger rivers.

  16. Profiling CpG island field methylation in both morphologically normal and neoplastic human colonic mucosa.

    PubMed

    Belshaw, N J; Elliott, G O; Foxall, R J; Dainty, J R; Pal, N; Coupe, A; Garg, D; Bradburn, D M; Mathers, J C; Johnson, I T

    2008-07-08

    Aberrant CpG island (CGI) methylation occurs early in colorectal neoplasia. Quantitative methylation-specific PCR profiling applied to biopsies was used to quantify low levels of CGI methylation of 18 genes in the morphologically normal colonic mucosa of neoplasia-free subjects, adenomatous polyp patients, cancer patients and their tumours. Multivariate statistical analyses distinguished tumour from mucosa with a sensitivity of 78.9% and a specificity of 100% (P=3 x 10(-7)). In morphologically normal mucosa, age-dependent CGI methylation was observed for APC, AXIN2, DKK1, HPP1, N33, p16, SFRP1, SFRP2 and SFRP4 genes, and significant differences in CGI methylation levels were detected between groups. Multinomial logistic regression models based on the CGI methylation profiles from normal mucosa correctly identified 78.9% of cancer patients and 87.9% of non-cancer (neoplasia-free+polyp) patients (P=4.93 x 10(-7)) using APC, HPP1, p16, SFRP4, WIF1 and ESR1 methylation as the most informative variables. Similarly, CGI methylation of SFRP4, SFRP5 and WIF1 correctly identified 61.5% of polyp patients and 78.9% of neoplasia-free subjects (P=0.0167). The apparently normal mucosal field of patients presenting with neoplasia has evidently undergone significant epigenetic modification. Methylation of the genes selected by the models may play a role in the earliest stages of the development of colorectal neoplasia.

  17. Genome-Wide DNA Methylation Analysis of Human Pancreatic Islets from Type 2 Diabetic and Non-Diabetic Donors Identifies Candidate Genes That Influence Insulin Secretion

    PubMed Central

    Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte

    2014-01-01

    Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685

  18. Neuromodulation intrinsic to the central pattern generator for escape swimming in Tritonia.

    PubMed

    Katz, P S

    1998-11-16

    Extrinsic neuromodulatory inputs to central pattern generators (CPGs) can alter the properties and synaptic interactions of neurons in those circuits and thereby modify the output of the CPG. Recent work in a number of systems has now demonstrated that neurons intrinsic to CPG can also evoke neuromodulatory actions on other members of the CPG. Such "intrinsic neuromodulation" plays a role in controlling the CPG underlying the escape swim response of the nudibrach mollusc, Tritonia diomedea. The dorsal swim interneurons (DSIs) are a bilaterally represented set of three serotonergic neurons that participate in the generation of the rhythmic swim motor program. Serotonin released from these CPG neurons functions both as a fast neurotransmitter and as a slower neuromodulator. In its modulatory role, serotonin enhances the release of neurotransmitter from another CPG neuron, C2, and also increases C2 excitability by decreasing spike frequency adaptation. These neuromodulatory actions intrinsic to the CPG may be important for the initial self-configuration of the system into a function CPG and for experience-dependent changes in the output such as behavioral sensitization and habituation.

  19. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. T cells are influenced by a long non-coding RNA in the autoimmune associated PTPN2 locus.

    PubMed

    Houtman, Miranda; Shchetynsky, Klementy; Chemin, Karine; Hensvold, Aase Haj; Ramsköld, Daniel; Tandre, Karolina; Eloranta, Maija-Leena; Rönnblom, Lars; Uebe, Steffen; Catrina, Anca Irinel; Malmström, Vivianne; Padyukov, Leonid

    2018-06-01

    Non-coding SNPs in the protein tyrosine phosphatase non-receptor type 2 (PTPN2) locus have been linked with several autoimmune diseases, including rheumatoid arthritis, type I diabetes, and inflammatory bowel disease. However, the functional consequences of these SNPs are poorly characterized. Herein, we show in blood cells that SNPs in the PTPN2 locus are highly correlated with DNA methylation levels at four CpG sites downstream of PTPN2 and expression levels of the long non-coding RNA (lncRNA) LINC01882 downstream of these CpG sites. We observed that LINC01882 is mainly expressed in T cells and that anti-CD3/CD28 activated naïve CD4 + T cells downregulate the expression of LINC01882. RNA sequencing analysis of LINC01882 knockdown in Jurkat T cells, using a combination of antisense oligonucleotides and RNA interference, revealed the upregulation of the transcription factor ZEB1 and kinase MAP2K4, both involved in IL-2 regulation. Overall, our data suggests the involvement of LINC01882 in T cell activation and hints towards an auxiliary role of these non-coding SNPs in autoimmunity associated with the PTPN2 locus. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  2. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  3. Magnifying narrow-band imaging of gastric mucosal morphology predicts the H. pylori-related epigenetic field defect.

    PubMed

    Tahara, Tomomitsu; Yamazaki, Jumpei; Tahara, Sayumi; Okubo, Masaaki; Kawamura, Tomohiko; Horiguchi, Noriyuki; Ishizuka, Takamitsu; Nagasaka, Mitsuo; Nakagawa, Yoshihito; Shibata, Tomoyuki; Kuroda, Makoto; Ohmiya, Naoki

    2017-06-08

    DNA methylation is associated with "field defect" in the gastric mucosa. To characterize "field defect" morphologically, we examined DNA methylation of non-neoplastic gastric mucosa in relation to their morphology seen by narrow-band imaging (NBI) with magnifying endoscopy. Magnifying NBI of non-neoplastic gastric body was classified as follows: normal-small and round pits with uniform subepithelial capillary networks; type 1-a little enlarged round pits with indistinct subepithelial capillary networks; type 2-remarkably enlarged pits with irregular vessels; and type 3-clearly demarcated oval or tubulovillous pits with bulky coiled or wavy vessels. Methylation of nine candidate genes (MYOD1, SLC16A12, GDNF, IGF2, MIR 124A1, CDH1, PRDM5, RORA and MLF1) were determined by bisulfite pyrosequencing. Infinium HumanMethylation450 array was used to characterize the methylation of >450,000 CpG sites. Mean Z score methylation of nine genes positively correlated with the changes of mucosal patterns from normal to types 1, 2, and 3 (P < 0.0001). Genome-wide analysis showed that development of mucosal patterns correlated with methylation accumulation especially at CpG islands. Genes with promoter CpG islands that were gradually methylated with the development of mucosal patterns significantly enriched the genes involved in zinc-related pathways. The results indicates that gastric mucosal morphology predicts a "field defect" in this tissue type. Accumulation of DNA methylation is associated with "field defect" in the non-neoplastic gastric mucosa. Endoscopic identification of "field defect" has important implications for preventing gastric cancer. Our results suggest that magnifying NBI of gastric mucosal morphology predicts a "field defect" in the gastric mucosa.

  4. HumanMethylation450K Array–Identified Biomarkers Predict Tumour Recurrence/Progression at Initial Diagnosis of High-risk Non-muscle Invasive Bladder Cancer

    PubMed Central

    Kitchen, Mark O; Bryan, Richard T; Emes, Richard D; Luscombe, Christopher J; Cheng, KK; Zeegers, Maurice P; James, Nicholas D; Gommersall, Lyndon M; Fryer, Anthony A

    2018-01-01

    Background: High-risk non-muscle invasive bladder cancer (HR-NMIBC) is a clinically unpredictable disease. Despite clinical risk estimation tools, many patients are undertreated with intra-vesical therapies alone, whereas others may be over-treated with early radical surgery. Molecular biomarkers, particularly DNA methylation, have been reported as predictive of tumour/patient outcomes in numerous solid organ and haematologic malignancies; however, there are few reports in HR-NMIBC and none using genome-wide array assessment. We therefore sought to identify novel DNA methylation markers of HR-NMIBC clinical outcomes that might predict tumour behaviour at initial diagnosis and help guide patient management. Patients and methods: A total of 21 primary initial diagnosis HR-NMIBC tumours were analysed by Illumina HumanMethylation450 BeadChip arrays and subsequently bisulphite Pyrosequencing. In all, 7 had not recurred at 1 year after resection and 14 had recurred and/or progressed despite intra-vesical BCG. A further independent cohort of 32 HR-NMIBC tumours (17 no recurrence and 15 recurrence and/or progression despite BCG) were also assessed by bisulphite Pyrosequencing. Results: Array analyses identified 206 CpG loci that segregated non-recurrent HR-NMIBC tumours from clinically more aggressive recurrence/progression tumours. Hypermethylation of CpG cg11850659 and hypomethylation of CpG cg01149192 in combination predicted HR-NMIBC recurrence and/or progression within 1 year of diagnosis with 83% sensitivity, 79% specificity, and 83% positive and 79% negative predictive values. Conclusions: This is the first genome-wide DNA methylation analysis of a unique HR-NMIBC tumour cohort encompassing known 1-year clinical outcomes. Our analyses identified potential novel epigenetic markers that could help guide individual patient management in this clinically unpredictable disease. PMID:29343995

  5. DNA methylation profile distinguishes clear cell sarcoma of the kidney from other pediatric renal tumors.

    PubMed

    Ueno, Hitomi; Okita, Hajime; Akimoto, Shingo; Kobayashi, Kenichiro; Nakabayashi, Kazuhiko; Hata, Kenichiro; Fujimoto, Junichiro; Hata, Jun-Ichi; Fukuzawa, Masahiro; Kiyokawa, Nobutaka

    2013-01-01

    A number of specific, distinct neoplastic entities occur in the pediatric kidney, including Wilms' tumor, clear cell sarcoma of the kidney (CCSK), congenital mesoblastic nephroma (CMN), rhabdoid tumor of the kidney (RTK), and the Ewing's sarcoma family of tumors (ESFT). By employing DNA methylation profiling using Illumina Infinium HumanMethylation27, we analyzed the epigenetic characteristics of the sarcomas including CCSK, RTK, and ESFT in comparison with those of the non-neoplastic kidney (NK), and these tumors exhibited distinct DNA methylation profiles in a tumor-type-specific manner. CCSK is the most frequently hypermethylated, but least frequently hypomethylated, at CpG sites among these sarcomas, and exhibited 490 hypermethylated and 46 hypomethylated CpG sites in compared with NK. We further validated the results by MassARRAY, and revealed that a combination of four genes was sufficient for the DNA methylation profile-based differentiation of these tumors by clustering analysis. Furthermore, THBS1 CpG sites were found to be specifically hypermethylated in CCSK and, thus, the DNA methylation status of these THBS1 sites alone was sufficient for the distinction of CCSK from other pediatric renal tumors, including Wilms' tumor and CMN. Moreover, combined bisulfite restriction analysis could be applied for the detection of hypermethylation of a THBS1 CpG site. Besides the biological significance in the pathogenesis, the DNA methylation profile should be useful for the differential diagnosis of pediatric renal tumors.

  6. Non-specific filtering of beta-distributed data.

    PubMed

    Wang, Xinhui; Laird, Peter W; Hinoue, Toshinori; Groshen, Susan; Siegmund, Kimberly D

    2014-06-19

    Non-specific feature selection is a dimension reduction procedure performed prior to cluster analysis of high dimensional molecular data. Not all measured features are expected to show biological variation, so only the most varying are selected for analysis. In DNA methylation studies, DNA methylation is measured as a proportion, bounded between 0 and 1, with variance a function of the mean. Filtering on standard deviation biases the selection of probes to those with mean values near 0.5. We explore the effect this has on clustering, and develop alternate filter methods that utilize a variance stabilizing transformation for Beta distributed data and do not share this bias. We compared results for 11 different non-specific filters on eight Infinium HumanMethylation data sets, selected to span a variety of biological conditions. We found that for data sets having a small fraction of samples showing abnormal methylation of a subset of normally unmethylated CpGs, a characteristic of the CpG island methylator phenotype in cancer, a novel filter statistic that utilized a variance-stabilizing transformation for Beta distributed data outperformed the common filter of using standard deviation of the DNA methylation proportion, or its log-transformed M-value, in its ability to detect the cancer subtype in a cluster analysis. However, the standard deviation filter always performed among the best for distinguishing subgroups of normal tissue. The novel filter and standard deviation filter tended to favour features in different genome contexts; for the same data set, the novel filter always selected more features from CpG island promoters and the standard deviation filter always selected more features from non-CpG island intergenic regions. Interestingly, despite selecting largely non-overlapping sets of features, the two filters did find sample subsets that overlapped for some real data sets. We found two different filter statistics that tended to prioritize features with different characteristics, each performed well for identifying clusters of cancer and non-cancer tissue, and identifying a cancer CpG island hypermethylation phenotype. Since cluster analysis is for discovery, we would suggest trying both filters on any new data sets, evaluating the overlap of features selected and clusters discovered.

  7. Epigenetic alterations of the BDNF gene in combat-related post-traumatic stress disorder.

    PubMed

    Kim, T Y; Kim, S J; Chung, H G; Choi, J H; Kim, S H; Kang, J I

    2017-02-01

    Brain-derived neurotrophic factor (BDNF) plays a crucial role in modulating resilience and vulnerability to stress. The aim of this study was to investigate whether epigenetic regulation of the BDNF gene is a biomarker of post-traumatic stress disorder (PTSD) development among veterans exposed to combat in the Vietnam War. Using the Clinician-Administered PTSD Scale, combat veterans were grouped into those with (n = 126) and without (n = 122) PTSD. DNA methylation levels at four CpG sites within the BDNF promoter I region were quantified in the peripheral blood using pyrosequencing. The effects of BDNF DNA methylation levels and clinical variables on the diagnosis of PTSD were tested using binary logistic regression analysis. Subjects with PTSD showed a higher DNA methylation of four CpG sites at the BDNF promoter compared with those without PTSD. High methylation levels at the BDNF promoter CpG site, high combat exposure, and alcohol problems were significantly associated with PTSD diagnosis. This study demonstrated an association between higher DNA methylation of the BDNF promoter and PTSD diagnosis in combat-exposed individuals. Our findings suggest that altered BDNF methylation may be a valuable biomarker of PTSD after trauma exposure. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Carbon nanotubes enhance CpG uptake and potentiate antiglioma immunity.

    PubMed

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J; Badie, Behnam

    2011-02-15

    Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Because TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNT) as a CpG delivery vehicle in brain tumor models. Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and antiglioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated proinflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (>3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term antitumor immunity. These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. ©2010 AACR.

  9. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  10. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  11. Carbon Nanotubes Enhance CpG Uptake and Potentiate Anti-Glioma Immunity

    PubMed Central

    Zhao, Dongchang; Alizadeh, Darya; Zhang, Leying; Liu, Wei; Farrukh, Omar; Manuel, Edwin; Diamond, Don J.; Badie, Behnam

    2010-01-01

    Purpose Stimulation of toll-like receptor-9 (TLR9) by CpG oligodeoxynucleotides (CpG) has been shown to counteract the immunosuppressive microenvironment and to inhibit tumor growth in glioma models. Since TLR9 is located intracellularly, we hypothesized that methods that enhance its internalization may also potentiate its immunostimulatory response. The goal of this study was to evaluate carbon nanotubes (CNTs) as a CpG delivery vehicle in brain tumor models. Experimental Design Functionalized single-walled CNTs were conjugated with CpG (CNT-CpG) and evaluated in vitro and in mice bearing intracranial GL261 gliomas. Flow cytometry was used to assess CNT-CpG uptake and anti-glioma immune response. Tumor growth was measured by bioluminescent imaging, histology, and animal survival. Results CNT-CpG was nontoxic and enhanced CpG uptake both in vitro and intracranial gliomas. CNT-mediated CpG delivery also potentiated pro-inflammatory cytokine production by primary monocytes. Interestingly, a single intracranial injection of low-dose CNT-CpG (but not free CpG or blank CNT) eradicated intracranial GL261 gliomas in half of tumor-bearing mice. Moreover, surviving animals exhibited durable tumor-free remission (> 3 months), and were protected from intracranial tumor rechallenge, demonstrating induction of long-term anti-tumor immunity. Conclusions These findings suggest that CNTs can potentiate CpG immunopotency by enhancing its delivery into tumor-associated inflammatory cells. PMID:21088258

  12. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  13. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  14. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  15. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  16. DNA-inorganic hybrid nanovaccine for cancer immunotherapy

    NASA Astrophysics Data System (ADS)

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-01

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy. Electronic supplementary information (ESI) available: ESI materials and methods, characterization of hNVs. See DOI: 10.1039/c5nr08821f

  17. EG-09EPIGENETIC PROFILING REVEALS A CpG HYPERMETHYLATION PHENOTYPE (CIMP) ASSOCIATED WITH WORSE PROGRESSION-FREE SURVIVAL IN MENINGIOMA

    PubMed Central

    Olar, Adriana; Wani, Khalida; Mansouri, Alireza; Zadeh, Gelareh; Wilson, Charmaine; DeMonte, Franco; Fuller, Gregory; Jones, David; Pfister, Stefan; von Deimling, Andreas; Sulman, Erik; Aldape, Kenneth

    2014-01-01

    BACKGROUND: Methylation profiling of solid tumors has revealed biologic subtypes, often with clinical implications. Methylation profiles of meningioma and their clinical implications are not well understood. METHODS: Ninety-two meningioma samples (n = 44 test set and n = 48 validation set) were profiled using the Illumina HumanMethylation450 BeadChip. Unsupervised clustering and analyses for recurrence-free survival (RFS) were performed. RESULTS: Unsupervised clustering of the test set using approximately 900 highly variable markers identified two clearly defined methylation subgroups. One of the groups (n = 19) showed global hypermethylation of a set of markers, analogous to CpG island methylator phenotype (CIMP). These findings were reproducible in the validation set, with 18/48 samples showing the CIMP-positive phenotype. Importantly, of 347 highly variable markers common to both the test and validation set analyses, 107 defined CIMP in the test set and 94 defined CIMP in the validation set, with an overlap of 83 markers between the two datasets. This number is much greater than expected by chance indicating reproducibly of the hypermethylated markers that define CIMP in meningioma. With respect to clinical correlation, the 37 CIMP-positive cases displayed significantly shorter RFS compared to the 55 non-CIMP cases (hazard ratio 2.9, p = 0.013). In an effort to develop a preliminary outcome predictor, a 155-marker subset correlated with RFS was identified in the test dataset. When interrogated in the validation dataset, this 155-marker subset showed a statistical trend (p < 0.1) towards distinguishing survival groups. CONCLUSIONS: This study defines the existence of a CIMP phenotype in meningioma, which involves a substantial proportion (37/92, 40%) of samples with clinical implications. Ongoing work will expand this cohort and examine identification of additional biologic differences (mutational and DNA copy number analysis) to further characterize the aberrant methylation subtype in meningioma. CIMP-positivity with aberrant methylation in recurrent/malignant meningioma suggests a potential therapeutic target for clinically aggressive cases.

  18. Longitudinal study of DNA methylation during the first 5 years of life.

    PubMed

    Urdinguio, Rocio G; Torró, María Isabel; Bayón, Gustavo F; Álvarez-Pitti, Julio; Fernández, Agustín F; Redon, Pau; Fraga, Mario F; Lurbe, Empar

    2016-06-03

    Early life epigenetic programming influences adult health outcomes. Moreover, DNA methylation levels have been found to change more rapidly during the first years of life. Our aim was the identification and characterization of the CpG sites that are modified with time during the first years of life. We hypothesize that these DNA methylation changes would lead to the detection of genes that might be epigenetically modulated by environmental factors during early childhood and which, if disturbed, might contribute to susceptibility to diseases later in life. The study of the DNA methylation pattern of 485577 CpG sites was performed on 30 blood samples from 15 subjects, collected both at birth and at 5 years old, using Illumina(®) Infinium 450 k array. To identify differentially methylated CpG (dmCpG) sites, the methylation status of each probe was examined using linear models and the Empirical Bayes Moderated t test implemented in the limma package of R/Bioconductor. Surogate variable analysis was used to account for batch effects. DNA methylation levels significantly changed from birth to 5 years of age in 6641 CpG sites. Of these, 36.79 % were hypermethylated and were associated with genes related mainly to developmental ontology terms, while 63.21 % were hypomethylated probes and associated with genes related to immune function. Our results suggest that DNA methylation alterations with age during the first years of life might play a significant role in development and the regulation of leukocyte-specific functions. This supports the idea that blood leukocytes experience genome remodeling related to their interaction with environmental factors, underlining the importance of environmental exposures during the first years of life and suggesting that new strategies should be take into consideration for disease prevention.

  19. Multiphase Transport in Porous Media: Gas-Liquid Separation Using Capillary Pressure Gradients International Space Station (ISS) Flight Experiment Development

    NASA Technical Reports Server (NTRS)

    Wheeler, Richard R., Jr.; Holtsnider, John T.; Dahl, Roger W.; Deeks, Dalton; Javanovic, Goran N.; Parker, James M.; Ehlert, Jim

    2013-01-01

    Advances in the understanding of multiphase flow characteristics under variable gravity conditions will ultimately lead to improved and as of yet unknown process designs for advanced space missions. Such novel processes will be of paramount importance to the success of future manned space exploration as we venture into our solar system and beyond. In addition, because of the ubiquitous nature and vital importance of biological and environmental processes involving airwater mixtures, knowledge gained about fundamental interactions and the governing properties of these mixtures will clearly benefit the quality of life here on our home planet. The techniques addressed in the current research involving multiphase transport in porous media and gas-liquid phase separation using capillary pressure gradients are also a logical candidate for a future International Space Station (ISS) flight experiment. Importantly, the novel and potentially very accurate Lattice-Boltzmann (LB) modeling of multiphase transport in porous media developed in this work offers significantly improved predictions of real world fluid physics phenomena, thereby promoting advanced process designs for both space and terrestrial applications.This 3-year research effort has culminated in the design and testing of a zero-g demonstration prototype. Both the hydrophilic (glass) and hydrophobic (Teflon) media Capillary Pressure Gradient (CPG) cartridges prepared during the second years work were evaluated. Results obtained from ground testing at 1-g were compared to those obtained at reduced gravities spanning Martian (13-g), Lunar (16-g) and zero-g. These comparisons clearly demonstrate the relative strength of the CPG phenomena and the efficacy of its application to meet NASAs unique gas-liquid separation (GLS) requirements in non-terrestrial environments.LB modeling software, developed concurrently with the zero-g test effort, was shown to accurately reproduce observed CPG driven gas-liquid separation phenomena. The design and fabrication of a micropost plate-lamina Hele-Shaw (HS) cell was performed which served as a computationally attainable geometric structure facilitating direct comparison between physical phenomena observed in our laboratory and the LB software predictions.

  20. [Comparative evaluation of clinical practice guidelines for the treatment of schizophrenia].

    PubMed

    Delessert, D; Pomini, V; Grasset, F; Baumann, P

    2008-01-01

    Many clinical practice guidelines (CPG) have been published in reply to the development of the concept of "evidence-based medicine" (EBM) and as a solution to the difficulty of synthesizing and selecting relevant medical literature. Taking into account the expansion of new CPG, the question of choice arises: which CPG to consider in a given clinical situation? It is of primary importance to evaluate the quality of the CPG, but until recently, there has been no standardized tool of evaluation or comparison of the quality of the CPG. An instrument of evaluation of the quality of the CPG, called "AGREE" for appraisal of guidelines for research and evaluation was validated in 2002. The six principal CPG concerning the treatment of schizophrenia are compared with the help of the "AGREE" instrument: (1) "the Agence nationale pour le développement de l'évaluation médicale (ANDEM) recommendations"; (2) "The American Psychiatric Association (APA) practice guideline for the treatment of patients with schizophrenia"; (3) "The quick reference guide of APA practice guideline for the treatment of patients with schizophrenia"; (4) "The schizophrenia patient outcomes research team (PORT) treatment recommendations"; (5) "The Texas medication algorithm project (T-MAP)" and (6) "The expert consensus guideline for the treatment of schizophrenia". The results of our study were then compared with those of a similar investigation published in 2005, structured on 24 CPG tackling the treatment of schizophrenia. The "AGREE" tool was also used by two investigators in their study. In general, the scores of the two studies differed little and the two global evaluations of the CPG converged; however, each of the six CPG is perfectible. The rigour of elaboration of the six CPG was in general average. The consideration of the opinion of potential users was incomplete, and an effort made in the presentation of the recommendations would facilitate their clinical use. Moreover, there was little consideration by the authors regarding the applicability of the recommendations. Globally, two CPG are considered as strongly recommended: "the quick reference guide of the APA practice guideline for the treatment of patients with schizophrenia" and "the T-MAP".

  1. Performance of Different Analytical Software Packages in Quantification of DNA Methylation by Pyrosequencing.

    PubMed

    Grasso, Chiara; Trevisan, Morena; Fiano, Valentina; Tarallo, Valentina; De Marco, Laura; Sacerdote, Carlotta; Richiardi, Lorenzo; Merletti, Franco; Gillio-Tos, Anna

    2016-01-01

    Pyrosequencing has emerged as an alternative method of nucleic acid sequencing, well suited for many applications which aim to characterize single nucleotide polymorphisms, mutations, microbial types and CpG methylation in the target DNA. The commercially available pyrosequencing systems can harbor two different types of software which allow analysis in AQ or CpG mode, respectively, both widely employed for DNA methylation analysis. Aim of the study was to assess the performance for DNA methylation analysis at CpG sites of the two pyrosequencing software which allow analysis in AQ or CpG mode, respectively. Despite CpG mode having been specifically generated for CpG methylation quantification, many investigations on this topic have been carried out with AQ mode. As proof of equivalent performance of the two software for this type of analysis is not available, the focus of this paper was to evaluate if the two modes currently used for CpG methylation assessment by pyrosequencing may give overlapping results. We compared the performance of the two software in quantifying DNA methylation in the promoter of selected genes (GSTP1, MGMT, LINE-1) by testing two case series which include DNA from paraffin embedded prostate cancer tissues (PC study, N = 36) and DNA from blood fractions of healthy people (DD study, N = 28), respectively. We found discrepancy in the two pyrosequencing software-based quality assignment of DNA methylation assays. Compared to the software for analysis in the AQ mode, less permissive criteria are supported by the Pyro Q-CpG software, which enables analysis in CpG mode. CpG mode warns the operators about potential unsatisfactory performance of the assay and ensures a more accurate quantitative evaluation of DNA methylation at CpG sites. The implementation of CpG mode is strongly advisable in order to improve the reliability of the methylation analysis results achievable by pyrosequencing.

  2. Epigenetic contribution of the myosin light chain kinase gene to the risk for acute respiratory distress syndrome.

    PubMed

    Szilágyi, Keely L; Liu, Cong; Zhang, Xu; Wang, Ting; Fortman, Jeffrey D; Zhang, Wei; Garcia, Joe G N

    2017-02-01

    Acute respiratory distress syndrome (ARDS) is a devastating clinical syndrome with a considerable case fatality rate (∼30%-40%). Health disparities exist with African descent (AD) subjects exhibiting greater mortality than European descent (ED) individuals. Myosin light chain kinase is encoded by MYLK, whose genetic variants are implicated in ARDS pathogenesis and may influence ARDS mortality. As baseline population-specific epigenetic changes, that is, cytosine modifications, have been observed between AD and ED individuals, epigenetic variations in MYLK may provide insights into ARDS disparities. We compared methylation levels of MYLK cytosine-guanine dinucleotides (CpGs) between ARDS patients and intensive care unit (ICU) controls overall and by ethnicity in a nested case-control study of 39 ARDS cases and 75 non-ARDS ICU controls. Two MYLK CpG sites (cg03892735 and cg23344121) were differentially modified between ARDS subjects and controls (P < 0.05; q < 0.25) in a logistic regression model, where no effect modification by ethnicity or age was found. One CpG site was associated with ARDS in patients aged <58 years, cg19611163 (intron 19, 20). Two CpG sites were associated with ARDS in EDs only, gene body CpG (cg01894985, intron 2, 3) and CpG (cg16212219, intron 31, 32), with higher modification levels exhibited in ARDS subjects than controls. Cis-acting modified cytosine quantitative trait loci (mQTL) were identified using linear regression between local genetic variants and modification levels for 2 ARDS-associated CpGs (cg23344121 and cg16212219). In summary, these ARDS-associated MYLK CpGs with effect modification by ethnicity and local mQTL suggest that MYLK epigenetic variation and local genetic background may contribute to health disparities observed in ARDS. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. DNA-inorganic hybrid nanovaccine for cancer immunotherapy.

    PubMed

    Zhu, Guizhi; Liu, Yijing; Yang, Xiangyu; Kim, Young-Hwa; Zhang, Huimin; Jia, Rui; Liao, Hsien-Shun; Jin, Albert; Lin, Jing; Aronova, Maria; Leapman, Richard; Nie, Zhihong; Niu, Gang; Chen, Xiaoyuan

    2016-03-28

    Cancer evolves to evade or compromise the surveillance of the immune system, and cancer immunotherapy aims to harness the immune system in order to inhibit cancer development. Unmethylated CpG dinucleotide-containing oligonucleotides (CpG), a class of potent adjuvants that activate the toll-like receptor 9 (TLR9) located in the endolysosome of many antigen-presenting cells (APCs), are promising for cancer immunotherapy. However, clinical application of synthetic CpG confronts many challenges such as suboptimal delivery into APCs, unfavorable pharmacokinetics caused by limited biostability and short in vivo half-life, and side effects associated with leaking of CpG into the systemic circulation. Here we present DNA-inorganic hybrid nanovaccines (hNVs) for efficient uptake into APCs, prolonged tumor retention, and potent immunostimulation and cancer immunotherapy. hNVs were self-assembled from concatemer CpG analogs and magnesium pyrophosphate (Mg2PPi). Mg2PPi renders hNVs resistant to nuclease degradation and thermal denaturation, both of which are demanding characteristics for effective vaccination and the storage and transportation of vaccines. Fluorophore-labeled hNVs were tracked to be efficiently internalized into the endolysosomes of APCs, where Mg2PPi was dissolved in an acidic environment and thus CpG analogs were exposed to hNVs. Internalized hNVs in APCs led to (1) elevated secretion of proinflammatory factors, and (2) elevated expression of co-stimulatory factors. Compared with molecular CpG, hNVs dramatically prolonged the tissue retention of CpG analogs and reduced splenomegaly, a common side effect of CpG. In a melanoma mouse model, two injections of hNVs significantly inhibited the tumor growth and outperformed the molecular CpG. These results suggest hNVs are promising for cancer immunotherapy.

  4. Modeling uncertainty in computerized guidelines using fuzzy logic.

    PubMed Central

    Jaulent, M. C.; Joyaux, C.; Colombet, I.; Gillois, P.; Degoulet, P.; Chatellier, G.

    2001-01-01

    Computerized Clinical Practice Guidelines (CPGs) improve quality of care by assisting physicians in their decision making. A number of problems emerges since patients with close characteristics are given contradictory recommendations. In this article, we propose to use fuzzy logic to model uncertainty due to the use of thresholds in CPGs. A fuzzy classification procedure has been developed that provides for each message of the CPG, a strength of recommendation that rates the appropriateness of the recommendation for the patient under consideration. This work is done in the context of a CPG for the diagnosis and the management of hypertension, published in 1997 by the French agency ANAES. A population of 82 patients with mild to moderate hypertension was selected and the results of the classification system were compared to whose given by a classical decision tree. Observed agreement is 86.6% and the variability of recommendations for patients with close characteristics is reduced. PMID:11825196

  5. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  6. The effect of TLR9 agonist CpG oligodeoxynucleotides on the intestinal immune response of cobia (Rachycentron canadum).

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1 β . Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1 β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia.

  7. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  8. Systematic CpT (ApG) Depletion and CpG Excess Are Unique Genomic Signatures of Large DNA Viruses Infecting Invertebrates

    PubMed Central

    Upadhyay, Mohita; Sharma, Neha; Vivekanandan, Perumal

    2014-01-01

    Differences in the relative abundance of dinucleotides, if any may provide important clues on host-driven evolution of viruses. We studied dinucleotide frequencies of large DNA viruses infecting vertebrates (n = 105; viruses infecting mammals = 99; viruses infecting aves = 6; viruses infecting reptiles = 1) and invertebrates (n = 88; viruses infecting insects = 84; viruses infecting crustaceans = 4). We have identified systematic depletion of CpT(ApG) dinucleotides and over-representation of CpG dinucleotides as the unique genomic signature of large DNA viruses infecting invertebrates. Detailed investigation of this unique genomic signature suggests the existence of invertebrate host-induced pressures specifically targeting CpT(ApG) and CpG dinucleotides. The depletion of CpT dinucleotides among large DNA viruses infecting invertebrates is at least in part, explained by non-canonical DNA methylation by the infected host. Our findings highlight the role of invertebrate host-related factors in shaping virus evolution and they also provide the necessary framework for future studies on evolution, epigenetics and molecular biology of viruses infecting this group of hosts. PMID:25369195

  9. Sherlock Holmes and the Curious Case of the Human Locomotor Central Pattern Generator.

    PubMed

    Klarner, Taryn; Zehr, E Paul

    2018-03-14

    Evidence first described in reduced animal models over 100 years ago led to deductions about the control of locomotion through spinal locomotor central pattern generating (CPG) networks. These discoveries in nature were contemporaneous with another form of deductive reasoning found in popular culture-that of Arthur Conan Doyle's detective "Sherlock Holmes". Since the invasive methods used in reduced non-human animal preparations are not amenable to study in humans, we are left instead with deducing from other measures and observations. Using the deductive reasoning approach of Sherlock Holmes as a metaphor for framing research into human CPGs, we speculate and weigh the evidence that should be observable in humans based on knowledge from other species. This review summarizes indirect inference to assess "observable evidence" of pattern generating activity which leads to the logical deduction of CPG contributions to arm and leg activity during locomotion in humans. The question of where a CPG may be housed in the human nervous system remains incompletely resolved at this time. Ongoing understanding, elaboration and application of functioning locomotor CPGs in humans is important for gait rehabilitation strategies in those with neurological injuries.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  11. Association between DNA Methylation in Whole Blood and Measures of Glucose Metabolism: KORA F4 Study

    PubMed Central

    Wahl, Simone; Kunze, Sonja; Molnos, Sophie; Volkova, Nadezda; Schramm, Katharina; Carstensen-Kirberg, Maren; Waldenberger, Melanie; Gieger, Christian; Peters, Annette; Illig, Thomas; Prokisch, Holger; Roden, Michael; Grallert, Harald

    2016-01-01

    Epigenetic regulation has been postulated to affect glucose metabolism, insulin sensitivity and the risk of type 2 diabetes. Therefore, we performed an epigenome-wide association study for measures of glucose metabolism in whole blood samples of the population-based Cooperative Health Research in the Region of Augsburg F4 study using the Illumina HumanMethylation 450 BeadChip. We identified a total of 31 CpG sites where methylation level was associated with measures of glucose metabolism after adjustment for age, sex, smoking, and estimated white blood cell proportions and correction for multiple testing using the Benjamini-Hochberg (B-H) method (four for fasting glucose, seven for fasting insulin, 25 for homeostasis model assessment-insulin resistance [HOMA-IR]; B-H-adjusted p-values between 9.2x10-5 and 0.047). In addition, DNA methylation at cg06500161 (annotated to ABCG1) was associated with all the aforementioned phenotypes and 2-hour glucose (B-H-adjusted p-values between 9.2x10-5 and 3.0x10-3). Methylation status of additional three CpG sites showed an association with fasting insulin only after additional adjustment for body mass index (BMI) (B-H-adjusted p-values = 0.047). Overall, effect strengths were reduced by around 30% after additional adjustment for BMI, suggesting that this variable has an influence on the investigated phenotypes. Furthermore, we found significant associations between methylation status of 21 of the aforementioned CpG sites and 2-hour insulin in a subset of samples with seven significant associations persisting after additional adjustment for BMI. In a subset of 533 participants, methylation of the CpG site cg06500161 (ABCG1) was inversely associated with ABCG1 gene expression (B-H-adjusted p-value = 1.5x10-9). Additionally, we observed an enrichment of the top 1,000 CpG sites for diabetes-related canonical pathways using Ingenuity Pathway Analysis. In conclusion, our study indicates that DNA methylation and diabetes-related traits are associated and that these associations are partially BMI-dependent. Furthermore, the interaction of ABCG1 with glucose metabolism is modulated by epigenetic processes. PMID:27019061

  12. Pattern generating and reflex-like processes controlling aiming movements in the presence of inertia, damping and gravity. A theoretical note.

    PubMed

    Kalveram, K T

    1991-01-01

    A model is proposed, in which goal-directed movements of the forearm are controlled by a central pattern generator (CPG) initiated for exactly one period, and by reflex-analogous processes. Movement width is proportional to the amplitude factor of the CPG's output, and to the square of the CPG's period length. The period duration can be freely selected, thus enabling the CPG to accommodate its time scale to the period of others CPG's. Parameters which influence movement accuracy can be adjusted by means of closed control loop, which are discrete with respect to time: The time unit corresponds to the period of the CPG. For instance, momentum adjustment balances the CPG in such a manner that the velocity of the arm becomes zero on termination of the period, while gain adjustment serves to attain a correct movement length in the presence of an inertial load. Friction, stiffness and gravitational force are neutralized by additional reflex-type processes, interpretable as positive feedback loops with adjustable gain factors, using position and velocity signals.

  13. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  14. A DNA methylation fingerprint of 1628 human samples

    PubMed Central

    Fernandez, Agustin F.; Assenov, Yassen; Martin-Subero, Jose Ignacio; Balint, Balazs; Siebert, Reiner; Taniguchi, Hiroaki; Yamamoto, Hiroyuki; Hidalgo, Manuel; Tan, Aik-Choon; Galm, Oliver; Ferrer, Isidre; Sanchez-Cespedes, Montse; Villanueva, Alberto; Carmona, Javier; Sanchez-Mut, Jose V.; Berdasco, Maria; Moreno, Victor; Capella, Gabriel; Monk, David; Ballestar, Esteban; Ropero, Santiago; Martinez, Ramon; Sanchez-Carbayo, Marta; Prosper, Felipe; Agirre, Xabier; Fraga, Mario F.; Graña, Osvaldo; Perez-Jurado, Luis; Mora, Jaume; Puig, Susana; Prat, Jaime; Badimon, Lina; Puca, Annibale A.; Meltzer, Stephen J.; Lengauer, Thomas; Bridgewater, John; Bock, Christoph; Esteller, Manel

    2012-01-01

    Most of the studies characterizing DNA methylation patterns have been restricted to particular genomic loci in a limited number of human samples and pathological conditions. Herein, we present a compromise between an extremely comprehensive study of a human sample population with an intermediate level of resolution of CpGs at the genomic level. We obtained a DNA methylation fingerprint of 1628 human samples in which we interrogated 1505 CpG sites. The DNA methylation patterns revealed show this epigenetic mark to be critical in tissue-type definition and stemness, particularly around transcription start sites that are not within a CpG island. For disease, the generated DNA methylation fingerprints show that, during tumorigenesis, human cancer cells underwent a progressive gain of promoter CpG-island hypermethylation and a loss of CpG methylation in non-CpG-island promoters. Although transformed cells are those in which DNA methylation disruption is more obvious, we observed that other common human diseases, such as neurological and autoimmune disorders, had their own distinct DNA methylation profiles. Most importantly, we provide proof of principle that the DNA methylation fingerprints obtained might be useful for translational purposes by showing that we are able to identify the tumor type origin of cancers of unknown primary origin (CUPs). Thus, the DNA methylation patterns identified across the largest spectrum of samples, tissues, and diseases reported to date constitute a baseline for developing higher-resolution DNA methylation maps and provide important clues concerning the contribution of CpG methylation to tissue identity and its changes in the most prevalent human diseases. PMID:21613409

  15. The dynamic DNA methylation landscape of the mutL homolog 1 shore is altered by MLH1-93G>A polymorphism in normal tissues and colorectal cancer.

    PubMed

    Savio, Andrea J; Mrkonjic, Miralem; Lemire, Mathieu; Gallinger, Steven; Knight, Julia A; Bapat, Bharat

    2017-01-01

    Colorectal cancers (CRCs) undergo distinct genetic and epigenetic alterations. Expression of mutL homolog 1 ( MLH1 ), a mismatch repair gene that corrects DNA replication errors, is lost in up to 15% of sporadic tumours due to mutation or, more commonly, due to DNA methylation of its promoter CpG island. A single nucleotide polymorphism (SNP) in the CpG island of MLH1 ( MLH1 -93G>A or rs1800734) is associated with CpG island hypermethylation and decreased MLH1 expression in CRC tumours. Further, in peripheral blood mononuclear cell (PBMC) DNA of both CRC cases and non-cancer controls, the variant allele of rs1800734 is associated with hypomethylation at the MLH1 shore, a region upstream of its CpG island that is less dense in CpG sites . To determine whether this genotype-epigenotype association is present in other tissue types, including colorectal tumours, we assessed DNA methylation in matched normal colorectal tissue, tumour, and PBMC DNA from 349 population-based CRC cases recruited from the Ontario Familial Colorectal Cancer Registry. Using the semi-quantitative real-time PCR-based MethyLight assay, MLH1 shore methylation was significantly higher in tumour tissue than normal colon or PBMCs ( P  < 0.01). When shore methylation levels were stratified by SNP genotype, normal colorectal DNA and PBMC DNA were significantly hypomethylated in association with variant SNP genotype ( P  < 0.05). However, this association was lost in tumour DNA. Among distinct stages of CRC, metastatic stage IV CRC tumours incurred significant hypomethylation compared to stage I-III cases, irrespective of genotype status. Shore methylation of MLH1 was not associated with MSI status or promoter CpG island hypermethylation, regardless of genotype. To confirm these results, bisulfite sequencing was performed in matched tumour and normal colorectal specimens from six CRC cases, including two cases per genotype (wildtype, heterozygous, and homozygous variant). Bisulfite sequencing results corroborated the methylation patterns found by MethyLight, with significant hypomethylation in normal colorectal tissue of variant SNP allele carriers. These results indicate that the normal tissue types tested (colorectum and PBMC) experience dynamic genotype-associated epigenetic alterations at the MLH1 shore, whereas tumour DNA incurs aberrant hypermethylation compared to normal DNA.

  16. Royal Australian and New Zealand College of Psychiatrists clinical practice guidelines for the treatment of eating disorders.

    PubMed

    Hay, Phillipa; Chinn, David; Forbes, David; Madden, Sloane; Newton, Richard; Sugenor, Lois; Touyz, Stephen; Ward, Warren

    2014-11-01

    This clinical practice guideline for treatment of DSM-5 feeding and eating disorders was conducted as part of the Royal Australian and New Zealand College of Psychiatrists (RANZCP) Clinical Practice Guidelines (CPG) Project 2013-2014. The CPG was developed in accordance with best practice according to the National Health and Medical Research Council of Australia. Literature of evidence for treatments of anorexia nervosa (AN), bulimia nervosa (BN), binge eating disorder (BED), other specified and unspecified eating disorders and avoidant restrictive food intake disorder (ARFID) was sourced from the previous RANZCP CPG reviews (dated to 2009) and updated with a systematic review (dated 2008-2013). A multidisciplinary working group wrote the draft CPG, which then underwent expert, community and stakeholder consultation, during which process additional evidence was identified. In AN the CPG recommends treatment as an outpatient or day patient in most instances (i.e. in the least restrictive environment), with hospital admission for those at risk of medical and/or psychological compromise. A multi-axial and collaborative approach is recommended, including consideration of nutritional, medical and psychological aspects, the use of family based therapies in younger people and specialist therapist-led manualised based psychological therapies in all age groups and that include longer-term follow-up. A harm minimisation approach is recommended in chronic AN. In BN and BED the CPG recommends an individual psychological therapy for which the best evidence is for therapist-led cognitive behavioural therapy (CBT). There is also a role for CBT adapted for internet delivery, or CBT in a non-specialist guided self-help form. Medications that may be helpful either as an adjunctive or alternative treatment option include an antidepressant, topiramate, or orlistat (the last for people with comorbid obesity). No specific treatment is recommended for ARFID as there are no trials to guide practice. Specific evidence based psychological and pharmacological treatments are recommended for most eating disorders but more trials are needed for specific therapies in AN, and research is urgently needed for all aspects of ARFID assessment and management. Associate Professor Susan Byrne, Dr Angelica Claudino, Dr Anthea Fursland, Associate Professor Jennifer Gaudiani, Dr Susan Hart, Ms Gabriella Heruc, Associate Professor Michael Kohn, Dr Rick Kausman, Dr Sarah Maguire, Ms Peta Marks, Professor Janet Treasure and Mr Andrew Wallis. © The Royal Australian and New Zealand College of Psychiatrists 2014.

  17. Modeling, Simulation, and Analysis of a Decoy State Enabled Quantum Key Distribution System

    DTIC Science & Technology

    2015-03-26

    through the fiber , we assume Alice and Bob have correct basis alignment and timing control for reference frame correction and precise photon detection...optical components ( laser , polarization modulator, electronic variable optical attenuator, fixed optical attenuator, fiber channel, beamsplitter...generated by the laser in the CPG propagate through multiple optical components, each with a unique propagation delay before reaching the OPM. Timing

  18. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei

    PubMed Central

    Waag, David M.; McCluskie, Michael J.; Zhang, Ningli; Krieg, Arthur M.

    2006-01-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders. PMID:16495571

  19. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  20. Methylation analysis of p16, SLIT2, SCARA5, and Runx3 genes in hepatocellular carcinoma

    PubMed Central

    Sun, Gaofeng; Zhang, Chen; Feng, Min; Liu, Wensheng; Xie, Huifang; Qin, Qin; Zhao, E.; Wan, Li

    2017-01-01

    Abstract This study is to investigate the methylation status of multiple tumor suppressor 1 (p16), secreted glycoprotein 2 (SLIT2), scavenger receptor class A, member 5 putative (SCARA5), and human runt-related transcription factor 3 (Runx3) genes in the peripheral blood of hepatocellular carcinoma (HCC). This is a case–control study. The peripheral blood samples were collected from 25 HCC patients, 25 patients with high risk of HCC (defined as “internal control group”), and 25 healthy individuals (defined as “external control group”), respectively. Then the methylation status of p16, SLIT2, SCARA5, and Runx3 genes in the blood samples were analyzed by pyrosequencing. The relationship between the methylation and the clinical features of HCC patients were evaluated. The methylation levels in the 7 CpG loci of p16 gene in HCC patients were low and without statistically significant difference (P > .05) compared to the control groups. Although the methylation levels of CpG3 and CpG4 in SLIT2 gene loci were higher than those of the control groups, there was no statistically significant difference (P > .05). However, the methylation rate of CpG2 locus in SCARA5 gene in HCC patients was significantly higher (P < .05). And the methylation rates of CpG1, CpG2, CpG3, CpG4, CpG5, and CpG8 in Runx3 gene in HCC patients were significantly different to that of control groups (P < .05). We also have analyzed the correlations between the CpG islands methylation of Runx3 or SCARA5 genes and the age, gender, hepatitis B, liver cirrhosis, alpha fetal protein, or hepatitis B surface antigen (HBsAg) of the HCC patients, which all showed no significant correlations (P > .05). The methylation status of SCARA5 and Runx3 genes are abnormal in HCC patients, which may further be used as molecular markers for early auxiliary diagnosis of liver cancer. PMID:29019900

  1. Links between DNA methylation and nucleosome occupancy in the human genome.

    PubMed

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  2. Clinical practice guideline for Sjögren's syndrome 2017.

    PubMed

    Sumida, Takayuki; Azuma, Naoto; Moriyama, Masafumi; Takahashi, Hiroyuki; Asashima, Hiromitsu; Honda, Fumika; Abe, Saori; Ono, Yuko; Hirota, Tomoya; Hirata, Shintaro; Tanaka, Yoshiya; Shimizu, Toshimasa; Nakamura, Hideki; Kawakami, Atsushi; Sano, Hajime; Ogawa, Yoko; Tsubota, Kazuo; Ryo, Koufuchi; Saito, Ichiro; Tanaka, Akihiko; Nakamura, Seiji; Takamura, Etsuko; Tanaka, Masao; Suzuki, Katsuya; Takeuchi, Tsutomu; Yamakawa, Noriyuki; Mimori, Tsuneyo; Ohta, Akiko; Nishiyama, Susumu; Yoshihara, Toshio; Suzuki, Yasunori; Kawano, Mitsuhiro; Tomiita, Minako; Tsuboi, Hiroto

    2018-05-01

    The objective of this study is to develop clinical practice guideline (CPG) for Sjögren's syndrome (SS) based on recently available clinical and therapeutic evidences. The CPG committee for SS was organized by the Research Team for Autoimmune Diseases, Research Program for Intractable Disease of the Ministry of Health, Labor and Welfare (MHLW), Japan. The committee completed a systematic review of evidences for several clinical questions and developed CPG for SS 2017 according to the procedure proposed by the Medical Information Network Distribution Service (Minds). The recommendations and their strength were checked by the modified Delphi method. The CPG for SS 2017 has been officially approved by both Japan College of Rheumatology and the Japanese Society for SS. The CPG committee set 38 clinical questions for clinical symptoms, signs, treatment, and management of SS in pediatric, adult and pregnant patients, using the PICO (P: patients, problem, population, I: interventions, C: comparisons, controls, comparators, O: outcomes) format. A summary of evidence, development of recommendation, recommendation, and strength for these 38 clinical questions are presented in the CPG. The CPG for SS 2017 should contribute to improvement and standardization of diagnosis and treatment of SS.

  3. Substantial reduction in hospital stay of children and adolescents with diabetic ketoacidosis after implementation of Clinical Practice Guidelines in a university hospital in Saudi Arabia.

    PubMed

    Al Nemri, Abdulrahman; Amer, Yasser Sami; Gasim, Hala; Osman, Mohamed Elfaki; Aleyadhy, Ayman; Al Otaibi, Hessah; Iqbal, Shaikh Mohammed; Aljurayyan, Nasir Abdullah; Assiri, Asaad M; Babiker, Amir; Mohamed, Sarar

    2017-02-01

    We aimed to determine the effect of Clinical Practice Guideline (CPG) implementation on length of hospital stay of children and adolescents with diabetic ketoacidosis (DKA). This was a 6-year (2008-2014) case-control retrospective study conducted at King Khalid University Hospital, Riyadh, that compared patients with DKA managed using CPG with those treated before CPG implementation. There were 63 episodes of DKA in 41 patients managed using CPG compared with 40 episodes in 33 patients treated before implementation of CPG. Baseline characteristics of the 2 groups were similar (age, sex, newly diagnosed patients, recurrent DKA, DKA severity, and mean glycosylated hemoglobin). The mean length of hospital stay (±SD) was 68.6 ± 53.1 hours after implementation of CPG compared with 107.4 ± 65.6 hours before implementation (P < .001). The reduction in length of hospital stay equals to 1700 bed days saved per year per 1000 patients. Implementation of CPG for DKA decreased the length of hospital stay. © 2016 John Wiley & Sons, Ltd.

  4. Newly identified CpG ODNs, M5-30 and M6-395, stimulate mouse immune cells to secrete TNF-alpha and enhance Th1-mediated immunity.

    PubMed

    Choi, Sun-Shim; Chung, Eunkyung; Jung, Yu-Jin

    2010-08-01

    Bacterial CpG motifs are known to induce both innate and adaptive immunity in infected hosts via toll-like receptor 9 (TLR9). Because small oligonucleotides (ODNs) mimicking bacterial CpG motifs are easily synthesized, they have found use as immunomodulatory agents in a number of disease models. We have developed a novel bioinformatics approach to identify effective CpG ODN sequences and evaluate their function as TLR9 ligands in a murine system. Among the CpG ODNs we identified, M5-30 and M6-395 showed significant ability to stimulate TNF-alpha and IFN-gamma production in a mouse macrophage cell line and mouse splenocytes, respectively. We also found that these CpG ODNs activated cells through the canonical NF-kappa B signaling pathway. Moreover, both CpG ODNs were able to induce Th1-mediated immunity in Mycobacterium tuberculosis (Mtb)-infected mice. Our results demonstrate that M5-30 and M6-395 function as TLR9-specific ligands, making them useful in the study of TLR9 functionality and signaling in mice.

  5. [Clinical practice guidelines for systemic lupus erythematosus: Recommendations for general clinical management].

    PubMed

    Trujillo-Martín, María M; Rúa-Figueroa Fernández de Larrinoa, Iñigo; Ruíz-Irastorza, Guillermo; Pego-Reigosa, José María; Sabio Sánchez, José Mario; Serrano-Aguilar, Pedro

    2016-05-06

    Systemic lupus erythematosus (SLE) is a complex rheumatic multisystemic disease of autoimmune origin with significant potential morbidity and mortality. It is one of the most common autoimmune diseases with an estimated prevalence of 20-150 cases per 100,000 inhabitants. The clinical spectrum of SLE is wide and variable both in clinical manifestations and severity. This prompted the Spanish Ministry of Health, Social Services and Equality to promote and fund the development of a clinical practice guideline (CPG) for the clinical care of SLE patients within the Programme of CPG in the National Health System which coordinates GuiaSalud. This CPG is is intended as the reference tool in the Spanish National Health System in order to support the comprehensive clinical management of people with SLE by all health professionals involved, regardless of specialty and level of care, helping to standardize and improve the quality of clinical decisions in our context in order to improve the health outcomes of the people affected. The purpose of this document is to present and discuss the rationale of the recommendations on the general management of SLE, specifically, clinical follow-up, general therapeutic approach, healthy lifestyles, photoprotection, and training programmes for patients. These recommendations are based on the best available scientific evidence, on discussion and the consensus of expert groups. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  6. Effects of Interaction Between DRD4 Methylation and Prenatal Maternal Stress on Methylphenidate-Induced Changes in Continuous Performance Test Performance in Youth with Attention-Deficit/Hyperactivity Disorder.

    PubMed

    Kim, Johanna Inhyang; Kim, Jae-Won; Shin, Inkyung; Kim, Bung-Nyun

    2018-06-15

    Environmental factors may interact with genetic factors via the epigenetic process, and this interaction can contribute to inter-individual variability in the treatment response. The purpose of this study was to investigate the interaction effects between dopamine receptor D4 (DRD4) methylation and prenatal maternal stress on the methylphenidate (MPH) response of youth with attention-deficit/hyperactivity disorder (ADHD). This study was an 8-week open-label trial of MPH that included 74 ADHD youth. We investigated the associations between MPH treatment response, which was defined as a score ≤2 on the Clinical Global Impressions-Improvement (CGI-I) scale, and the methylation of 28 cytosine-guanine dinucleotide (CpG) sites of DRD4. Additionally, the interaction effects between DRD4 methylation and prenatal maternal stress on changes in Continuous Performance Test (CPT) scores after MPH treatment were investigated. Although there were no significant sites that showed significant association with treatment response, there was a significant interaction effect of the methylation of CpG7 and prenatal maternal stress on changes in omission errors of the CPT following treatment (p = 0.0001). The present findings indicate that the interaction between methylation of CpG7 of DRD4 and prenatal maternal stress may be predictive of the treatment response to MPH in youth with ADHD.

  7. Microplate array diagonal gel electrophoresis (MADGE), CpG-PCR and temporal thermal ramp-MADGE (Melt-MADGE) for single nucleotide analyses in populations.

    PubMed

    Day, I N; O'Dell, S D; Spanakis, E; Weavind, G P

    1999-02-01

    Important requirements for molecular genetic epidemiological studies are economy, sample parallelism, convenience of setup and accessibility, goals inadequately met by existent approaches. We invented microplate array diagonal gel electrophoresis (MADGE) to gain simultaneously the advantages of simple setup, 96-well microplate compatibility, horizontal electrophoresis, and the resolution of polyacrylamide. At essentially no equipment cost (one simple plastic gel former), 10-100-fold savings on time for sample coding, liquid transfers, and data documentation, in addition to volume reductions and gel re-use, can be achieved. MADGE is compatible with ARMS, restriction analysis and other pattern analyses. CpG-PCR is a general PCR approach to CpG sites (10-20% of all human single base variation): both primers have 3' T, and are abutted to the CpG, forcing a TaqI restriction site if the CpG is intact. Typically, a 52 bp PCR product is then cut in half. CpG-PCR also illustrates that PAGE-MADGE readily permits analysis of 'ultrashort' PCRs. Melt-MADGE employs real-time-variable-temperature electrophoresis to examine duplex mobility during melting, achieving DGGE-like de novo, mutation scanning, but with the conveniences of arbitrary programmability, MADGE compatibility and short run time. This suite of methods enhances our capability to type or scan thousands of samples simultaneously, by 10-100-fold.

  8. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  9. [Web Visit Patterns for the Clinical Practice Guidelines for Management of Depressive Disorder and Alcohol Abuse-Dependence].

    PubMed

    Suárez-Obando, Fernando; Restrepo, Carlos Gómez

    Clinical practice guidelines (CPG) are a set of recommendations for professionals, patients, and families, in order to make decisions about health care. The CPG respond to the need for concise, accurate, practical, and up to date information. In the field of mental health, Colombia has developed three GPC; alcohol (GPC-OH), depression (GPC-TDA), and schizophrenia. To describe the Web Portal traffic related to psychiatry guidelines, with emphasis on the number of visits, distribution throughout Colombian cities, and estimating user behaviour patterns. An evaluation was made of the traffic at the Clinical Practice Guidelines Web Portal of the Ministry of Health and Social Protection between 2013 and 2015 (two years of observation since the inauguration of the Portal). Out of the 45 GPC published on the website, the CPG-OH represented 1.21% of all page views of the Portal. CPG-TDA reached 1.52% (accumulated percentage of 2.73%), being the eighth most consulted guideline, with CPG-OH being number 16. The highest mean monthly number of visits for this group of guideliness was for the CPG-OH for health professionals (353 visits/month), and the lowest was for the CPG-AD for patients and relatives (24 single visits/month). Bogotá D.C. was the city where health carers accessed the guidelines more often. The guidelines for patients and relatives were consulted more in Villavicencio, Cúcuta, Manizales, Pereira, and Pasto. The web portal partially fulfills the purpose of circulating the CPG in Colombia. The visits to the CPG of mental health is quite low, and requires better dissemination strategies that allow the use of information and communication technology. Copyright © 2016 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  10. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

    PubMed

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

    2012-11-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

  11. Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

    PubMed Central

    Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

    2013-01-01

    Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

  12. Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

    PubMed

    Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

    2011-10-01

    Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

  13. Satellite Power System (SPS) mapping of exclusion areas for rectenna sites

    NASA Technical Reports Server (NTRS)

    Blackburn, J. B., Jr.; Bavinger, B. A.

    1978-01-01

    The areas of the United States that were not available as potential sites for receiving antennas that are an integral part of the Satellite Power System concept are presented. Thirty-six variables with the potential to exclude the rectenna were mapped and coded in a computer. Some of these variables exclude a rectenna from locating within the area of its spatial influence, and other variables potentially exclude the rectenna. These maps of variables were assembled from existing data and were mapped on a grid system.

  14. DNA motifs associated with aberrant CpG island methylation.

    PubMed

    Feltus, F Alex; Lee, Eva K; Costello, Joseph F; Plass, Christoph; Vertino, Paula M

    2006-05-01

    Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

  15. Characterization of Immune Responses to an Inactivated Avian Influenza Virus Vaccine Adjuvanted with Nanoparticles Containing CpG ODN.

    PubMed

    Singh, Shirene M; Alkie, Tamiru N; Abdelaziz, Khaled Taha; Hodgins, Douglas C; Novy, Anastasia; Nagy, Éva; Sharif, Shayan

    2016-06-01

    Avian influenza virus (AIV), a mucosal pathogen, gains entry into host chickens through respiratory and gastrointestinal routes. Most commercial AIV vaccines for poultry consist of inactivated, whole virus with adjuvant, delivered by parenteral administration. Recent advances in vaccine development have led to the application of nanoparticle emulsion delivery systems, such as poly (d,l-lactic-co-glycolic acid) (PLGA) nanoparticles to enhance antigen-specific immune responses. In chickens, the Toll-like receptor 21 ligand, CpG oligodeoxynucleotides (ODNs), have been demonstrated to be immunostimulatory. The objective of this study was to compare the adjuvant potential of CpG ODN 2007 encapsulated in PLGA nanoparticles with nonencapsulated CpG ODN 2007 when combined with a formalin-inactivated H9N2 virus, through intramuscular and aerosol delivery routes. Chickens were vaccinated at days 7 and 21 posthatch for the intramuscular route and at days 7, 21, and 35 for the aerosol route. Antibody-mediated responses were evaluated weekly in sera and lacrimal secretions in specific pathogen-free chickens. The results indicate that nonencapsulated CpG ODN 2007 in inactivated AIV vaccines administered by the intramuscular route generated higher antibody responses compared to the encapsulated CpG ODN 2007 formulation by the same route. Additionally, encapsulated CpG ODN 2007 in AIV vaccines administered by the aerosol route elicited higher mucosal responses compared to nonencapsulated CpG ODN 2007. Future studies may be aimed at evaluating protective immune responses induced with PLGA encapsulation of AIV and adjuvants.

  16. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas

    PubMed Central

    Everhard, Sibille; Tost, Jörg; Abdalaoui, Hafida El; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G.; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-01-01

    The O6-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone. PMID:19224763

  17. Identification of regions correlating MGMT promoter methylation and gene expression in glioblastomas.

    PubMed

    Everhard, Sibille; Tost, Jörg; El Abdalaoui, Hafida; Crinière, Emmanuelle; Busato, Florence; Marie, Yannick; Gut, Ivo G; Sanson, Marc; Mokhtari, Karima; Laigle-Donadey, Florence; Hoang-Xuan, Khê; Delattre, Jean-Yves; Thillet, Joëlle

    2009-08-01

    The O(6)-methylguanine-DNA methyltransferase gene (MGMT) is methylated in several cancers, including gliomas. However, the functional role of cysteine-phosphate-guanine (CpG) island (CGI) methylation in MGMT silencing is still controversial. The aim of this study was to investigate whether MGMT CGI methylation correlates inversely with RNA expression of MGMT in glioblastomas and to determine the CpG region whose methylation best reflects the level of expression. The methylation level of CpG sites that are potentially related to expression was investigated in 54 glioblastomas by pyrosequencing, a highly quantitative method, and analyzed with respect to their MGMT mRNA expression status. Three groups of patients were identified according to the methylation pattern of all 52 analyzed CpG sites. Overall, an 85% rate of concordance was observed between methylation and expression (p < 0.0001). When analyzing each CpG separately, six CpG sites were highly correlated with expression (p < 0.0001), and two CpG regions could be used as surrogate markers for RNA expression in 81.5% of the patients. This study indicates that there is good statistical agreement between MGMT methylation and expression, and that some CpG regions better reflect MGMT expression than do others. However, if transcriptional repression is the key mechanism in explaining the higher chemosensitivity of MGMT-methylated tumors, a substantial rate of discordance should lead clinicians to be cautious when deciding on a therapeutic strategy based on MGMT methylation status alone.

  18. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P  < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  19. Improved high-dimensional prediction with Random Forests by the use of co-data.

    PubMed

    Te Beest, Dennis E; Mes, Steven W; Wilting, Saskia M; Brakenhoff, Ruud H; van de Wiel, Mark A

    2017-12-28

    Prediction in high dimensional settings is difficult due to the large number of variables relative to the sample size. We demonstrate how auxiliary 'co-data' can be used to improve the performance of a Random Forest in such a setting. Co-data are incorporated in the Random Forest by replacing the uniform sampling probabilities that are used to draw candidate variables by co-data moderated sampling probabilities. Co-data here are defined as any type information that is available on the variables of the primary data, but does not use its response labels. These moderated sampling probabilities are, inspired by empirical Bayes, learned from the data at hand. We demonstrate the co-data moderated Random Forest (CoRF) with two examples. In the first example we aim to predict the presence of a lymph node metastasis with gene expression data. We demonstrate how a set of external p-values, a gene signature, and the correlation between gene expression and DNA copy number can improve the predictive performance. In the second example we demonstrate how the prediction of cervical (pre-)cancer with methylation data can be improved by including the location of the probe relative to the known CpG islands, the number of CpG sites targeted by a probe, and a set of p-values from a related study. The proposed method is able to utilize auxiliary co-data to improve the performance of a Random Forest.

  20. Overlap in drug-disease associations between clinical practice guidelines and drug structured product label indications.

    PubMed

    Leung, Tiffany I; Dumontier, Michel

    2016-06-08

    Clinical practice guidelines (CPGs) recommend pharmacologic treatments for clinical conditions, and drug structured product labels (SPLs) summarize approved treatment indications. Both resources are intended to promote evidence-based medical practices and guide clinicians' prescribing decisions. However, it is unclear how well CPG recommendations about pharmacologic therapies match SPL indications for recommended drugs. In this study, we perform text mining of CPG summaries to examine drug-disease associations in CPG recommendations and in SPL treatment indications for 15 common chronic conditions. We constructed an initial text corpus of guideline summaries from the National Guideline Clearinghouse (NGC) from a set of manually selected ICD-9 codes for each of the 15 conditions. We obtained 377 relevant guideline summaries and their Major Recommendations section, which excludes guidelines for pediatric patients, pregnant or breastfeeding women, or for medical diagnoses not meeting inclusion criteria. A vocabulary of drug terms was derived from five medical taxonomies. We used named entity recognition, in combination with dictionary-based and ontology-based methods, to identify drug term occurrences in the text corpus and construct drug-disease associations. The ATC (Anatomical Therapeutic Chemical Classification) was utilized to perform drug name and drug class matching to construct the drug-disease associations from CPGs. We then obtained drug-disease associations from SPLs using conditions mentioned in their Indications section in SIDER. The primary outcomes were the frequency of drug-disease associations in CPGs and SPLs, and the frequency of overlap between the two sets of drug-disease associations, with and without using taxonomic information from ATC. Without taxonomic information, we identified 1444 drug-disease associations across CPGs and SPLs for 15 common chronic conditions. Of these, 195 drug-disease associations overlapped between CPGs and SPLs, 917 associations occurred in CPGs only and 332 associations occurred in SPLs only. With taxonomic information, 859 unique drug-disease associations were identified, of which 152 of these drug-disease associations overlapped between CPGs and SPLs, 541 associations occurred in CPGs only, and 166 associations occurred in SPLs only. Our results suggest that CPG-recommended pharmacologic therapies and SPL indications do not overlap frequently when identifying drug-disease associations using named entity recognition, although incorporating taxonomic relationships between drug names and drug classes into the approach improves the overlap. This has important implications in practice because conflicting or inconsistent evidence may complicate clinical decision making and implementation or measurement of best practices.

  1. A modeling approach on why simple central pattern generators are built of irregular neurons.

    PubMed

    Reyes, Marcelo Bussotti; Carelli, Pedro Valadão; Sartorelli, José Carlos; Pinto, Reynaldo Daniel

    2015-01-01

    The crustacean pyloric Central Pattern Generator (CPG) is a nervous circuit that endogenously provides periodic motor patterns. Even after about 40 years of intensive studies, the rhythm genesis is still not rigorously understood in this CPG, mainly because it is made of neurons with irregular intrinsic activity. Using mathematical models we addressed the question of using a network of irregularly behaving elements to generate periodic oscillations, and we show some advantages of using non-periodic neurons with intrinsic behavior in the transition from bursting to tonic spiking (as found in biological pyloric CPGs) as building components. We studied two- and three-neuron model CPGs built either with Hindmarsh-Rose or with conductance-based Hodgkin-Huxley-like model neurons. By changing a model's parameter we could span the neuron's intrinsic dynamical behavior from slow periodic bursting to fast tonic spiking, passing through a transition where irregular bursting was observed. Two-neuron CPG, half center oscillator (HCO), was obtained for each intrinsic behavior of the neurons by coupling them with mutual symmetric synaptic inhibition. Most of these HCOs presented regular antiphasic bursting activity and the changes of the bursting frequencies was studied as a function of the inhibitory synaptic strength. Among all HCOs, those made of intrinsic irregular neurons presented a wider burst frequency range while keeping a reliable regular oscillatory (bursting) behavior. HCOs of periodic neurons tended to be either hard to change their behavior with synaptic strength variations (slow periodic burster neurons) or unable to perform a physiologically meaningful rhythm (fast tonic spiking neurons). Moreover, 3-neuron CPGs with connectivity and output similar to those of the pyloric CPG presented the same results.

  2. 75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    ...] (Formerly Docket No. 1998N-0046) Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration... of Compliance Policy Guide Sec. 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG... relating to decomposition in fish and fishery products, including canned salmon, is provided in CPG Sec...

  3. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination.

    PubMed

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye; Kang, Sang-Moo

    2017-10-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination.

  4. Quantitative, high-resolution epigenetic profiling of CpG loci identifies associations with cord blood plasma homocysteine and birth weight in humans

    PubMed Central

    Ismail, Khaled MK; Haworth, Kim E; Mein, Charles; Carroll, William D

    2011-01-01

    Supplementation with folic acid during pregnancy is known to reduce the risk of neural tube defects and low birth weight. It is thought that folate and other one-carbon intermediates might secure these clinical effects via DNA methylation. We examined the effects of folate on the human methylome using quantitative interrogation of 27,578 CpG loci associated with 14,496 genes at single-nucleotide resolution across 12 fetal cord blood samples. Consistent with previous studies, the majority of CpG dinucleotides located within CpG islands exhibited hypomethylation while those outside CpG islands showed mid-high methylation. However, for the first time in human samples, unbiased analysis of methylation across samples revealed a significant correlation of methylation patterns with plasma homocysteine, LINE-1 methylation and birth weight centile. Additionally, CpG methylation significantly correlated with either birth weight or LINE-1 methylation were predominantly located in CpG islands. These data indicate that levels of folate-associated intermediates in cord blood reflect their influence and consequences for the fetal epigenome and potentially on pregnancy outcome. In these cases, their influence might be exerted during late gestation or reflect those present during the peri-conceptual period. PMID:20864804

  5. Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

    PubMed Central

    Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

    2005-01-01

    Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

  6. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  7. CpG oligodeoxynucleotides augment the murine immune response to the Yersinia pestis F1-V vaccine in bubonic and pneumonic models of plague.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Rogers, Taralyn E; Fast, Randy L; Bassett, Anthony D; Worsham, Patricia L; Powell, Bradford S; Norris, Sarah L; Krieg, Arthur M; Adamovicz, Jeffrey J

    2009-04-06

    The current U.S. Department of Defense candidate plague vaccine is a fusion between two Yersinia pestis proteins: the F1 capsular protein, and the low calcium response (Lcr) V-protein. We hypothesized that an immunomodulator, such as CpG oligodeoxynucleotide (ODN)s, could augment the immune response to the plague F1-V vaccine in a mouse model for plague. CpG ODNs significantly augmented the antibody response and efficacy of a single dose of the plague vaccine in murine bubonic and pneumonic models of plague. In the latter study, we also found an overall significant augmentation the immune response to the individual subunits of the plague vaccine by CpG ODN 2006. In a long-term, prime-boost study, CpG ODN induced a significant early augmentation of the IgG response to the vaccine. The presence of CpG ODN induced a significant increase in the IgG2a subclass response to the vaccine up to 5 months after the boost. Our studies showed that CpG ODNs significantly augmented the IgG antibody response to the plague vaccine, which increased the probability of survival in murine models of plague (P<0.0001).

  8. The evolution of CpG density and lifespan in conserved primate and mammalian promoters

    PubMed Central

    McLain, Adam T.

    2018-01-01

    Gene promoters are evolutionarily conserved across holozoans and enriched in CpG sites, the target for DNA methylation. As animals age, the epigenetic pattern of DNA methylation degrades, with highly methylated CpG sites gradually becoming demethylated while CpG islands increase in methylation. Across vertebrates, aging is a trait that varies among species. We used this variation to determine whether promoter CpG density correlates with species’ maximum lifespan. Human promoter sequences were used to identify conserved regions in 131 mammals and a subset of 28 primate genomes. We identified approximately 1000 gene promoters (5% of the total), that significantly correlated CpG density with lifespan. The correlations were performed via the phylogenetic least squares method to account for trait similarity by common descent using phylogenetic branch lengths. Gene set enrichment analysis revealed no significantly enriched pathways or processes, consistent with the hypothesis that aging is not under positive selection. However, within both mammals and primates, 95% of the promoters showed a positive correlation between increasing CpG density and species lifespan, and two thirds were shared between the primate subset and mammalian datasets. Thus, these genes may require greater buffering capacity against age-related dysregulation of DNA methylation in longer-lived species. PMID:29661983

  9. Effectiveness of a clinical practice guideline implementation strategy for patients with anxiety disorders in primary care: cluster randomized trial.

    PubMed

    Tello-Bernabé, Eugenia; Sanz-Cuesta, Teresa; del Cura-González, Isabel; de Santiago-Hernando, María L; Jurado-Sueiro, Montserrat; Fernández-Girón, Mercedes; García-de Blas, Francisca; Pensado-Freire, Higinio; Góngora-Maldonado, Francisco; de la Puente-Chamorro, María J; Rodríguez-Pasamontes, Carmen; Martín-Iglesias, Susana

    2011-12-01

    Anxiety is a common mental health problem seen in primary care. However, its management in clinical practice varies greatly. Clinical practice guidelines (CPGs) have the potential to reduce variations and improve the care received by patients by promoting interventions of proven benefit. However, uptake and adherence to their recommendations can be low. This study involves a community based on cluster randomized trial in primary healthcare centres in the Madrid Region (Spain). The project aims to determine whether the use of implementation strategy (including training session, information, opinion leader, reminders, audit, and feed-back) of CPG for patients with anxiety disorders in primary care is more effective than usual diffusion. The number of patients required is 296 (148 in each arm), all older than 18 years and diagnosed with generalized anxiety disorder, panic disorder, and panic attacks by the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV). They are chosen by consecutive sampling. The main outcome variable is the change in two or more points into Goldberg anxiety scale at six and twelve months. Secondary outcome variables include quality of life (EuroQol 5D), and degree of compliance with the CPG recommendations on treatment, information, and referrals to mental health services. Main effectiveness will be analyzed by comparing the patients percentage improvement on the Goldberg scale between the intervention group and the control group. Logistic regression with random effects will be used to adjust for prognostic factors. Confounding factors or factors that might alter the effect recorded will be taken into account in this analysis. There is a need to identify effective implementation strategies for CPG for the management of anxiety disorders present in primary care. Ensuring the appropriate uptake of guideline recommendations can reduce clinical variation and improve the care patients receive. ISRCTN: ISRCTN83365316.

  10. Effectiveness of a clinical practice guideline implementation strategy for patients with anxiety disorders in primary care: cluster randomized trial

    PubMed Central

    2011-01-01

    Background Anxiety is a common mental health problem seen in primary care. However, its management in clinical practice varies greatly. Clinical practice guidelines (CPGs) have the potential to reduce variations and improve the care received by patients by promoting interventions of proven benefit. However, uptake and adherence to their recommendations can be low. Method/design This study involves a community based on cluster randomized trial in primary healthcare centres in the Madrid Region (Spain). The project aims to determine whether the use of implementation strategy (including training session, information, opinion leader, reminders, audit, and feed-back) of CPG for patients with anxiety disorders in primary care is more effective than usual diffusion. The number of patients required is 296 (148 in each arm), all older than 18 years and diagnosed with generalized anxiety disorder, panic disorder, and panic attacks by the Diagnostic and Statistical Manual of Mental Disorders-IV (DSM-IV). They are chosen by consecutive sampling. The main outcome variable is the change in two or more points into Goldberg anxiety scale at six and twelve months. Secondary outcome variables include quality of life (EuroQol 5D), and degree of compliance with the CPG recommendations on treatment, information, and referrals to mental health services. Main effectiveness will be analyzed by comparing the patients percentage improvement on the Goldberg scale between the intervention group and the control group. Logistic regression with random effects will be used to adjust for prognostic factors. Confounding factors or factors that might alter the effect recorded will be taken into account in this analysis. Discussion There is a need to identify effective implementation strategies for CPG for the management of anxiety disorders present in primary care. Ensuring the appropriate uptake of guideline recommendations can reduce clinical variation and improve the care patients receive. Trial registration ISRCTN: ISRCTN83365316 PMID:22132861

  11. Gaining insight into the Clinical Practice Guideline development processes: qualitative study in a workshop to implement the GRADE proposal in Spain

    PubMed Central

    Calderón, Carlos; Rotaeche, Rafael; Etxebarria, Arritxu; Marzo, Mercé; Rico, Rosa; Barandiaran, Marta

    2006-01-01

    Background The GRADE method represents a new approach to grading the quality of evidence and strength of recommendations in the preparation of Clinical Practice Guidelines (CPG). In the context of a pilot study to assess the implementability of the system in Spain, we considered it relevant to gain an insight into the significance of the perceptions and attitudes expressed by the actual experts participating in the system try-out. Methods Qualitative research with an ethnographic approach, through non-participant observation and focus groups within the context of a consensus workshop in which 19 CPG experts participated to evaluate the GRADE proposal using 12 evidence tables taken from hypertension, asthma and arthritis CPGs. The interventions were recorded, under a guarantee of confidentiality. The transcriptions and field notes were analyzed, based on a sociological discourse analysis model, and the provisional findings were re-sent to participants in order to improve their validity. Results 1) Certain problems over procedure and terminology hindered the acceptance of this new method as a common reference system for the preparation of CPGs. 2). A greater closeness to clinical practice was accompanied by concerns over value judgments and subjectivity, with a demand for greater explicitness in the consensus process. 3). The type of "evidence" on which the guidelines are based, how and by whom the evidence is prepared, and what the role of the different actors should be, all constitute unresolved concerns in the CPG preparation and implementation processes. 4). The grading process is not neutral: professional background, prior experience and the degree of leadership all condition the participants' input and interactions. Conclusion The findings obtained allow the quantitative evaluation to be better interpreted and, in turn, go beyond the particularities of the GRADE method. Adaptation to the complexities of clinical practice, the need for carefully designed multi-disciplinary work and the reflexivity present in the CPG preparation process, all represent lines of debate that are necessary to improve the CPG quality in the Spanish health care sector. PMID:17059600

  12. Leveraging workflow control patterns in the domain of clinical practice guidelines.

    PubMed

    Kaiser, Katharina; Marcos, Mar

    2016-02-10

    Clinical practice guidelines (CPGs) include recommendations describing appropriate care for the management of patients with a specific clinical condition. A number of representation languages have been developed to support executable CPGs, with associated authoring/editing tools. Even with tool assistance, authoring of CPG models is a labor-intensive task. We aim at facilitating the early stages of CPG modeling task. In this context, we propose to support the authoring of CPG models based on a set of suitable procedural patterns described in an implementation-independent notation that can be then semi-automatically transformed into one of the alternative executable CPG languages. We have started with the workflow control patterns which have been identified in the fields of workflow systems and business process management. We have analyzed the suitability of these patterns by means of a qualitative analysis of CPG texts. Following our analysis we have implemented a selection of workflow patterns in the Asbru and PROforma CPG languages. As implementation-independent notation for the description of patterns we have chosen BPMN 2.0. Finally, we have developed XSLT transformations to convert the BPMN 2.0 version of the patterns into the Asbru and PROforma languages. We showed that although a significant number of workflow control patterns are suitable to describe CPG procedural knowledge, not all of them are applicable in the context of CPGs due to their focus on single-patient care. Moreover, CPGs may require additional patterns not included in the set of workflow control patterns. We also showed that nearly all the CPG-suitable patterns can be conveniently implemented in the Asbru and PROforma languages. Finally, we demonstrated that individual patterns can be semi-automatically transformed from a process specification in BPMN 2.0 to executable implementations in these languages. We propose a pattern and transformation-based approach for the development of CPG models. Such an approach can form the basis of a valid framework for the authoring of CPG models. The identification of adequate patterns and the implementation of transformations to convert patterns from a process specification into different executable implementations are the first necessary steps for our approach.

  13. Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum

    PubMed Central

    Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia

    2017-01-01

    Abstract Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. PMID:28449092

  14. In ovo CpG DNA delivery increases innate and adaptive immune cells in respiratory, gastrointestinal and immune systems post-hatch correlating with lower infectious laryngotracheitis virus infection.

    PubMed

    Abdul-Cader, Mohamed Sarjoon; Amarasinghe, Aruna; Palomino-Tapia, Victor; Ahmed-Hassan, Hanaa; Bakhtawar, Khawaja; Nagy, Eva; Sharif, Shayan; Gomis, Susantha; Abdul-Careem, Mohamed Faizal

    2018-01-01

    Cytosine-guanosine deoxynucleotides (CpG) DNA can be delivered in ovo at embryo day (ED)18 for the stimulation of toll-like receptor (TLR)21 signaling pathway that ultimately protects chickens against a number of bacterial and viral infections. There is a dearth of information understanding the mechanisms of protection induced by in ovo delivered CpG DNA. The objective of this study was to determine the immune cell changes post-hatch following in ovo delivery of the TLR21 ligand, CpG DNA. In order to quantify changes of percentage of KUL01+, IgM+ B, cluster of differentiation (CD)4+ and CD8α+ cells, trachea, lung, duodenum, large intestine, spleen and bursa of Fabricius were collected on day 1 post-hatch. We found increased recruitments of KUL01+ cells, in organs of these body systems post-hatch following in ovo delivery of CpG DNA. Although IgM+ B cells, CD4+ and CD8α+ cells were increased in lungs and immune system organs, these cells were not quantifiable from the trachea, duodenum and large intestine immediately following the hatch. Furthermore, when CpG DNA is delivered in ovo and subsequently infected with infectious laryngotracheitis virus (ILTV) post-hatch on day 1, CpG DNA reduces morbidity and mortality resulting from ILTV infection. This study provides insights into the mechanisms of host responses elicited following in ovo delivery of CpG DNA in avian species.

  15. Rolling Thunder -- Integration of the Solo 161 Stirling engine with the CPG-460 solar concentrator at Ft. Huachuca

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diver, R.B.; Moss, T.A.; Goldberg, V.

    Project Rolling Thunder is a dish/Stirling demonstration project at Ft. Huachuca, a US Army fort in southeastern Arizona (Huachuca means rolling thunder in Apache). It has been supported by the Strategic Environmental Research and Development Program (SERDP), a cooperative program between the Department of Defense (DoD) and the Department of Energy (DOE). As part of a 1992 SERDP project, Cummins Power Generation, Inc. (CPG) installed a CPG 7 kW(c) dish/Stirling system at the Joint Interoperability Test Command (JITC) in Ft. Huachuca, Arizona. The primary objective of the SERDP Dish/Stirling for DoD Applications project was to demonstrate a CPG 7-kW(c) dish/Stirlingmore » system at a military facility. Unfortunately, Cummins Engine Company decided to divest its solar operations. As a direct result of Ft. Huachuca`s interest in the Cummins dish/Stirling technology, Sandia explored the possibility of installing a SOLO 161 Stirling power conversion unit (PCU) on the Ft. Huachuca CPG-460. In January 1997, a decision was made to retrofit a SOLO 161 Stirling engine on the CPG-460 at Ft. Huachuca. Project Rolling Thunder. The SOLO 161 Demonstration at Ft. Huachuca has been a challenge. Although, the SOLO 161 PCU has operated nearly flawlessly and the CPG-460 has been, for the most part, a solid and reliable component, integration of the SOLO PCU with the CPG-460 has required significant attention. In this paper, the integration issues and technical approaches of project Rolling Thunder are presented. Lessons of the project are also discussed.« less

  16. Guideline-Driven Care Improves Outcomes in Patients with Traumatic Rib Fractures.

    PubMed

    Flarity, Kathleen; Rhodes, Whitney C; Berson, Andrew J; Leininger, Brian E; Reckard, Paul E; Riley, Keyan D; Shahan, Charles P; Schroeppel, Thomas J

    2017-09-01

    There is no established national standard for rib fracture management. A clinical practice guideline (CPG) for rib fractures, including monitoring of pulmonary function, early initiation of aggressive loco-regional analgesia, and early identification of deteriorating respiratory function, was implemented in 2013. The objective of the study was to evaluate the effect of the CPG on hospital length of stay. Hospital length of stay (LOS) was compared for adult patients admitted to the hospital with rib fracture(s) two years before and two years after CPG implementation. A separate analysis was done for the patients admitted to the intensive care unit (ICU). Over the 48-month study period, 571 patients met inclusion criteria for the study. Pre-CPG and CPG study groups were well matched with few differences. Multivariable regression did not demonstrate a difference in LOS (B = -0.838; P = 0.095) in the total study cohort. In the ICU cohort (n = 274), patients in the CPG group were older (57 vs 52 years; P = 0.023) and had more rib fractures (4 vs 3; P = 0.003). Multivariable regression identified a significant decrease in LOS for those patients admitted in the CPG period (B = -2.29; P = 0.019). Despite being significantly older with more rib fractures in the ICU cohort, patients admitted after implementation of the CPG had a significantly reduced LOS on multivariable analysis, reducing LOS by over two days. This structured intervention can limit narcotic usage, improve pulmonary function, and decrease LOS in the most injured patients with chest trauma.

  17. Energetic study of cardioplegic hearts under ischaemia/reperfusion and [Ca(2+)] changes in cardiomyocytes of guinea-pig: mitochondrial role.

    PubMed

    Ragone, M I; Torres, N S; Consolini, A E

    2013-02-01

    To study the role of mitochondria in the recovery of guinea-pig hearts exposed to high-K(+)-cardioplegia (CPG) and ischaemia/reperfusion (I/R) METHODS: We measured contractility and heat release in perfused guinea-pig hearts and cytosolic and mitochondrial Ca(2+) by epifluorescence and confocal microscopy in isolated cardiomyocytes loaded with Fluo-4 or Rhod-2. In hearts, CPG increased the postischaemic contractile recovery, and this was potentiated by the mNCX blocker clonazepam and the mKATP opener diazoxide, which also prevented the fall in muscle economy. Moreover, CPG prevented the stunning induced by ouabain, which was reduced by clonazepam. In cardiomyocytes, CPG increased fluorescent signals of cytosolic and mitochondrial Ca(2+), while the addition of a mNCX blocker (CGP37157) increased cytosolic but reduced mitochondrial [Ca(2+)]. Ouabain in CPG increased cytosolic Ca(2+) and resting heat, but the addition of CGP37157 reduced them, as well as mitochondrial Ca(2+). CPG, diazoxide and clonazepam improve postischaemic recovery, respectively, by increasing the Ca(2+) cycling and by reducing the mitochondrial Ca(2+) uptake either by uniporter or by mNCX. The mitochondria compete with the leaky sarcoplasmic reticulum (SR) as sink of Ca(2+) in guinea-pig hearts, affecting the postischaemic contractility. CPG also prevented the ouabain-induced dysfunction by avoiding the Ca(2+) overload. Ouabain reduced the synergism between CPG and clonazepam suggesting that [Na(+)]i and SR load influence the mNCX role. © 2012 The Authors Acta Physiologica © 2012 Scandinavian Physiological Society.

  18. Pharmacist-led management of chronic pain in primary care: results from a randomised controlled exploratory trial

    PubMed Central

    Bruhn, Hanne; Bond, Christine M; Elliott, Alison M; Hannaford, Philip C; Lee, Amanda J; McNamee, Paul; Smith, Blair H; Watson, Margaret C; Holland, Richard; Wright, David

    2013-01-01

    Objectives To compare the effectiveness of pharmacist medication review, with or without pharmacist prescribing, with standard care, for patients with chronic pain. Design An exploratory randomised controlled trial. Setting Six general practices with prescribing pharmacists in Grampian (3) and East Anglia (3). Participants Patients on repeat prescribed pain medication (4815) were screened by general practitioners (GPs), and mailed invitations (1397). 196 were randomised and 180 (92%) completed. Exclusion criteria included: severe mental illness, terminally ill, cancer related pain, history of addiction. Randomisation and intervention Patients were randomised using a remote telephone service to: (1) pharmacist medication review with face-to-face pharmacist prescribing; (2) pharmacist medication review with feedback to GP and no planned patient contact or (3) treatment as usual (TAU). Blinding was not possible. Outcome measures Outcomes were the SF-12v2, the Chronic Pain Grade (CPG), the Health Utilities Index 3 and the Hospital Anxiety and Depression Scale (HADS). Outcomes were collected at 0, 3 and 6 months. Results In the prescribing arm (n=70) two patients were excluded/nine withdrew. In the review arm (n=63) one was excluded/three withdrew. In the TAU arm (n=63) four withdrew. Compared with baseline, patients had an improved CPG in the prescribing arm, 47.7% (21/44; p=0.003) and in the review arm, 38.6% (17/44; p=0.001), but not the TAU group, 31.3% (15/48; ns). The SF-12 Physical Component Score showed no effect in the prescribing or review arms but improvement in TAU (p=0.02). The SF-12 Mental Component Score showed no effect for the prescribing or review arms and deterioration in the TAU arm (p=0.002). HADS scores improved within the prescribing arm for depression (p=0.022) and anxiety (p=0.007), between groups (p=0.022 and p=0.045, respectively). Conclusions This is the first randomised controlled trial of pharmacist prescribing in the UK, and suggests that there may be a benefit for patients with chronic pain. A larger trial is required. Trial registration: www.isrctn.org/ISRCTN06131530. Medical Research Council funding. PMID:23562814

  19. 75 FR 60761 - Government-Owned Inventions; Availability for Licensing

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-10-01

    ... cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to a subject. Methods for treating a tumor... therapeutically effective amount of apoptotic tumor cells conjugated to a K-type CpG oligodeoxynucleotide (ODN) to... the prevention of cancer and other indications Use of CpG oligonucleotides for prophylaxis and/or...

  20. 78 FR 46594 - Prospective Grant of Start-up Exclusive License: Topical Antibiotic With Immune Stimulating...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-01

    ... Speed Wound Healing; and Use of CpG Oligodeoxynucleotides To Induce Epithelial Cell Growth AGENCY... CpG Oligodeoxynucleotides to Induce Epithelial Cell Growth'' to Tollgene having a place of business... 37 CFR part 404. These technologies relate to relate to use of CpG oligodeoxynucleotides (ODNs) to...

  1. Promoter methylation assay of SASH1 gene in breast cancer.

    PubMed

    Sheyu, Lin; Hui, Liu; Junyu, Zhang; Jiawei, Xu; Honglian, Wang; Qing, Sang; Hengwei, Zhang; Xuhui, Guo; Qinghe, Xing; Lin, He

    2013-01-01

    To analyze the relationship between the expression of SASH1 and its methylation level of SASH1 gene promoter in human breast cancer. Expression levels of SASH1 were examined in breast cancer tissues and adjacent normal tissues with immunohistochemistry and with real time PCR (RT-PCR) methylation analysis was performed with MassArray. Immunohistochemistry showed that SASH1 expression was strongly reduced in breast cancer compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed that CpG sites in SASH1 promoter shared similar methylation pattern in tumor tissue and adjacent normal tissue. The CpG sites with significant difference in methylation level were CpG_26.27 and CpG_54.55. Moreover, 5-aza-2'-deoxycytidine (5-Aza-dc) treatment of tumor cell line MDA-MB-231 caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation level in the promoter region of gene SASH1, particularly CpG_26.27 or CpG_54.55 sites, possibly repressed SASH1 expression in breast cancer.

  2. Understanding and treatment of chronic abdominal pain in pediatric primary care.

    PubMed

    Schurman, Jennifer Verrill; Kessler, Emily D; Friesen, Craig A

    2014-10-01

    This study examined the practices used by primary care pediatricians to assess and treat chronic abdominal pain (CAP), as an initial step in guiding clinical practice guideline (CPG) development. A survey was mailed to a random sample of office-based pediatrician members (primary care pediatricians [PCPs]) of the American Medical Association. PCPs (n = 470) provided information about the typical presentation of CAP, assessment/treatment approaches used in their own practice, their definition of a functional gastrointestinal disorder (FGID), and their familiarity with the Rome Criteria for diagnosing FGIDs. Substantial variability among PCPs was noted across all these areas. Results suggest that perceptions and practices of pediatric CAP vary widely among PCPs; no single standard of care emerged to guide development of a CPG for this population. Future research should evaluate the efficacy of specific strategies currently in use to identify potential opportunities for improving assessment and treatment of CAP in pediatric primary care. © The Author(s) 2014.

  3. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  4. Reinforcement learning for a biped robot based on a CPG-actor-critic method.

    PubMed

    Nakamura, Yutaka; Mori, Takeshi; Sato, Masa-aki; Ishii, Shin

    2007-08-01

    Animals' rhythmic movements, such as locomotion, are considered to be controlled by neural circuits called central pattern generators (CPGs), which generate oscillatory signals. Motivated by this biological mechanism, studies have been conducted on the rhythmic movements controlled by CPG. As an autonomous learning framework for a CPG controller, we propose in this article a reinforcement learning method we call the "CPG-actor-critic" method. This method introduces a new architecture to the actor, and its training is roughly based on a stochastic policy gradient algorithm presented recently. We apply this method to an automatic acquisition problem of control for a biped robot. Computer simulations show that training of the CPG can be successfully performed by our method, thus allowing the biped robot to not only walk stably but also adapt to environmental changes.

  5. Methylation oligonucleotide microarray: a novel tool to analyze methylation patterns

    NASA Astrophysics Data System (ADS)

    Hou, Peng; Ji, Meiju; He, Nongyao; Lu, Zuhong

    2003-04-01

    A new technique to analyze methylation patterns in several adjacent CpG sites was developed and reported here. We selected a 336bp segment of the 5"-untranslated region and the first exon of the p16Ink4a gene, which include the most densely packed CpG fragment of the islands containing 32 CpG dinucleotides, as the investigated target. The probes that include all types of methylation patterns were designed to fabricate a DNA microarray to determine the methylation patterns of seven adjacent CpG dinucleotides sites. High accuracy and reproducibility were observed in several parallel experiments. The results led us to the conclusion that the methylation oligonucleotide microarray can be applied as a novel and powerful tool to map methylation patterns and changes in multiple CpG island loci in a variety of tumors.

  6. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.

    PubMed

    Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-08-16

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.

  7. Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity

    PubMed Central

    Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei

    2017-01-01

    Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025

  8. Vitamin D dose response is underestimated by Endocrine Society's Clinical Practice Guideline.

    PubMed

    McKenna, Malachi J; Murray, Barbara F

    2013-06-01

    The recommended daily intakes of vitamin D according to the recent Clinical Practice Guideline (CPG) of the Endocrine Society are three- to fivefold higher than the Institute of Medicine (IOM) report. We speculated that these differences could be explained by different mathematical approaches to the vitamin D dose response. Studies were selected if the daily dose was ≤2000 IU/day, the duration exceeded 3 months, and 25-hydroxyvitamin D (25OHD) concentrations were measured at baseline and post-therapy. The rate constant was estimated according to the CPG approach. The achieved 25OHD result was estimated according to the following: i) the regression equation approach of the IOM; ii) the regression approach of the Vitamin D Supplementation in Older Subjects (ViDOS) study; and iii) the CPG approach using a rate constant of 2.5 (CPG2.5) and a rate constant of 5.0 (CPG5.0). The difference between the expected and the observed 25OHD result was expressed as a percentage of observed and analyzed for significance against a value of 0% for the four groups. Forty-one studies were analyzed. The mean (95% CI) rate constant was 5.3 (4.4-6.2) nmol/l per 100 IU per day, on average twofold higher than the CPG rate constant. The mean (95% CI) for the difference between the expected and observed expressed as a percentage of observed was as follows: i) IOM, -7 (-16,+2)% (t=1.64, P=0.110); ii) ViDOS, +2 (-8,+12)% (t=0.40, P=0.69); iii) CPG2.5, -21 (-27,-15)% (t=7.2, P<0.0001); and iv) CPG5.0+3 (-4,+10)% (t=0.91, P=0.366). The CPG 'rule of thumb' should be doubled to 5.0 nmol/l (2.0 ng/ml) per 100 IU per day, adopting a more risk-averse position.

  9. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  10. Distinct Effects of Monophosphoryl Lipid A, Oligodeoxynucleotide CpG, and Combination Adjuvants on Modulating Innate and Adaptive Immune Responses to Influenza Vaccination

    PubMed Central

    Ko, Eun-Ju; Lee, Young-Tae; Lee, Youri; Kim, Ki-Hye

    2017-01-01

    Monophosphoryl lipid A (MPL) and oligodeoxynucleotide CpG are toll-like receptor (TLR) 4 and 9 agonist, respectively. Here, we investigated the effects of MPL, CpG, and combination adjuvants on stimulating in vitro dendritic cells (DCs), in vivo innate and adaptive immune responses, and protective efficacy of influenza vaccination. Combination of MPL and CpG was found to exhibit distinct effects on stimulating DCs in vitro to secrete IL-12p70 and tumor necrosis factor (TNF)-α and proliferate allogeneic CD8 T cells. Prime immunization of mice with inactivated split influenza vaccine in the presence of low dose MPL+CpG adjuvants increased the induction of virus-specific IgG and IgG2a isotype antibodies. MPL and CpG adjuvants contribute to improving the efficacy of prime influenza vaccination against lethal influenza challenge as determined by body weight monitoring, lung function, viral titers, and histology. A combination of MPL and CpG adjuvants was effective in improving vaccine efficacy as well as in reducing inflammatory immune responses locally and in inducing cellular immune responses upon lethal influenza virus challenge. This study demonstrates unique adjuvant effects of MPL, CpG, and combination adjuvants on modulating innate and adaptive immune responses to influenza prime vaccination. PMID:29093654

  11. Dopamine receptor D4 promoter hypermethylation increases the risk of drug addiction.

    PubMed

    Ji, Huihui; Xu, Xuting; Liu, Guili; Liu, Huifen; Wang, Qinwen; Shen, Wenwen; Li, Longhui; Xie, Xiaohu; Hu, Haochang; Xu, Lei; Zhou, Wenhua; Duan, Shiwei

    2018-02-01

    Heroin and methylamphetamine (METH) are two addictive drugs that cause serious problems for society. Dopamine receptor D4 (DRD4), a key receptor in the dopaminergic system, may facilitate the development of drug addiction. The aim of the present study was to investigate the association between the promoter methylation level of DRD4 gene and drug addiction. Bisulfite pyrosequencing technology was used to measure the methylation levels of DRD4 promoter in 60 drug addicts and 52 matched controls. Significantly higher levels of DRD4 CpG1 and CpG4 methylation were detected in METH and heroin drug addicts compared with controls (P<0.05). Male METH addicts exhibited significantly higher DRD4 CpG1, CpG2 and CpG4 methylation levels compared with sex-matched controls (P<0.05). In heroin addicts, a positive correlation was observed between depression-dejection and DRD4 CpG5 methylation (r=0.537, P=0.039) whereas there was a negative correlation between drug usage frequency and CpG1 methylation (r=-0.632, P=0.011). In METH addicts, methylation levels were not significantly associated with depression-dejection and drug usage frequency. In addition, luciferase assays demonstrated that the target sequence of the DRD4 promoter upregulates gene expression. The results of the present study suggest that DNA methylation of DRD4 may be responsible for the pathophysiology of drug addiction.

  12. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  13. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene.

    PubMed

    Ohtsuki, Shozo; Takahashi, Yuki; Inoue, Takao; Takakura, Yoshinobu; Nishikawa, Makiya

    2017-10-20

    We used human Toll-like receptor 9 (hTLR9)-expressing HEK-Blue hTLR9 cells, which release secreted embryonic alkaline phosphatase (SEAP) upon response to CpG DNA, to evaluate the immunological properties of nucleic acid drug candidates. Our preliminary studies showed that phosphodiester CpG DNA hardly induced any SEAP secretion in HEK-Blue hTLR9 cells. In the current study, therefore, we developed HEK-Blue hTLR9 cells transduced with human macrophage scavenger receptor-1 (hMSR1), a cell-surface DNA receptor, and determined whether HEK-Blue hTLR9/hMSR1 cells respond to phosphorothioate (PS) CpG DNA and phosphodiester (PO) CpG DNA. We selected PS CpG2006, a single-stranded PO CpG DNA (ssCpG), and a tetrapod-like structured DNA (tetrapodna) containing ssCpG (tetraCpG) as model TLR9 ligands. Alexa Fluor 488-labeled ligands were used for flow cytometry. Unlike the mock-transfected HEK-Blue hTLR9 cells, the HEK-Blue hTLR9/hMSR1 cells efficiently took up all three CpG DNAs. SEAP release was almost proportional to the uptake. Treatment of HEK-Blue hTLR9/hMSR1 cells with an anti-hMSR1 antibody significantly reduced the uptake of ssCpG and tetraCpG. Collectively, reconstruction of TLR9-mediated responses to CpG DNA in HEK-Blue hTLR9 cells can be used to evaluate the toxicity of nucleic acid drug candidates with diverse physicochemical properties.

  14. Extended Plasticity of Visual Cortex in Dark-Reared Animals May Result from Prolonged Expression of cpg15-Like Genes

    PubMed Central

    Lee, Wei-Chung Allen; Nedivi, Elly

    2011-01-01

    cpg15 is an activity-regulated gene that encodes a membrane-bound ligand that coordinately regulates growth of apposing dendritic and axonal arbors and the maturation of their synapses. These properties make it an attractive candidate for participating in plasticity of the mammalian visual system. Here we compare cpg15 expression during normal development of the rat visual system with that seen in response to dark rearing, monocular blockade of retinal action potentials, or monocular deprivation. Our results show that the onset of cpg15 expression in the visual cortex is coincident with eye opening, and it increases until the peak of the critical period at postnatal day 28 (P28). This early expression is independent of both retinal activity and visual experience. After P28, a component of cpg15 expression in the visual cortex, lateral geniculate nucleus (LGN), and superior colliculus (SC) develops a progressively stronger dependence on retinally driven action potentials. Dark rearing does not affect cpg15 mRNA expression in the LGN and SC at any age, but it does significantly affect its expression in the visual cortex from the peak of the critical period and into adulthood. In dark-reared rats, the peak level of cpg15 expression in the visual cortex at P28 is lower than in controls. Rather than showing the normal decline with maturation, these levels are maintained in dark-reared animals. We suggest that the prolonged plasticity in the visual cortex that is seen in dark-reared animals may result from failure to downregulate genes such as cpg15 that could promote structural remodeling and synaptic maturation. PMID:11880509

  15. Provider Adherence to Implementation of Clinical Practice Guidelines for Neurogenic Bowel in Adults With Spinal Cord Injury

    PubMed Central

    Goetz, Lance L; Nelson, Audrey L; Guihan, Marylou; Bosshart, Helen T; Harrow, Jeffrey J; Gerhart, Kevin D; Krasnicka, Barbara; Burns, Stephen P

    2005-01-01

    Background/Objectives: Clinical Practice Guidelines (CPGs) have been published on a number of topics in spinal cord injury (SCI) medicine. Research in the general medical literature shows that the distribution of CPGs has a minimal effect on physician practice without targeted implementation strategies. The purpose of this study was to determine (a) whether dissemination of an SCI CPG improved the likelihood that patients would receive CPG recommended care and (b) whether adherence to CPG recommendations could be improved through a targeted implementation strategy. Specifically, this study addressed the “Neurogenic Bowel Management in Adults with Spinal Cord Injury” Clinical Practice Guideline published in March 1998 by the Consortium for Spinal Cord Medicine Methods: CPG adherence was determined from medical record review at 6 Veterans Affairs SCI centers for 3 time periods: before guideline publication (T1), after guideline publication but before CPG implementation (T2), and after targeted CPG implementation (T3). Specific implementation strategies to enhance guideline adherence were chosen to address the barriers identified by SCI providers in focus groups before the intervention. Results: Overall adherence to recommendations related to neurogenic bowel did not change between T1 and T2 (P = not significant) but increased significantly between T2 and T3 (P < 0.001) for 3 of 6 guideline recommendations. For the other 3 guideline recommendations, adherence rates were noted to be high at T1. Conclusions: While publication of the CPG alone did not alter rates of provider adherence, the use of a targeted implementation plan resulted in increases in adherence rates with some (3 of 6) CPG recommendations for neurogenic bowel management. PMID:16869086

  16. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S -adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  17. Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

    PubMed

    Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

    2013-11-07

    We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

  18. Study on ceramic coating on the enamel surface using a carbon dioxide laser.

    PubMed

    Nihei, Tomotaro; Kurata, Shigeaki; Ohashi, Katsura; Umemoto, Kozo; Teranaka, Toshio

    2011-01-01

    The aims of this study were to evaluate a new restorative method using a carbon dioxide laser (CO(2)-laser) and to evaluate the acid resistance of teeth. Experimental calcium phosphate glass (CPG) powder and two low melting point ceramics (Finesse and zirconium silicate) were fused to enamel surfaces using a CO(2)-laser at an irradiation intensity of 1.0 watt for 30 seconds with a beam size of 0.49 mm at the focal point. The treated teeth were observed with a scanning electron microscope, and the acid resistance of the treated enamel surfaces was evaluated. The CPG fused successfully to the enamel surface, and the treated enamel surface showed high acid resistance compared with the low melting point ceramics and the non-irradiated surfaces. This system may lead to the development of new restorative methods that do not require the use of bonding agents.

  19. [Vesicular and nonvesicular glutamate release in the nucleus accumbens during a forced switch in behavioral strategy].

    PubMed

    Saul'skaia, N B; Mikhaĭlova, M O

    2004-01-01

    By means of in vivo microdialysis combined with HPLC analysis, we have shown that glutamate extracellular level in the rat n. accumbens increases during a forced switch in behavioral strategy. When infused in the n. accumbens, a Na+ channel blocker tetrodotoxin (TTX, 1 microM) completely prevents this increase whereas a potent cystine/glutamate exchanger blocker (S)-4-carboxyphenylglycine ((S)-4-CPG, 5 microM) has no effect. In contrast, TT (1 microM), infused in the n. accumbens, fails to significantly alter basal level of extracellular glutamate in this region whereas (S)-4-CPG (5 microM) produced a significant decrease. Our data suggest that basal and factional glutamate releases in the n. accumbens are differently regulated. The source of basal glutamate release is a non-vesicular release via cystine/glutamate exchanger. Functional glutamate release observed during a forced switch in behavioral strategy derives from vesicular synaptic pool.

  20. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  1. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols

    PubMed Central

    2010-01-01

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species. PMID:20181102

  2. CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols.

    PubMed

    Rozak, David A; Gelhaus, Herbert C; Smith, Mark; Zadeh, Mojgan; Huzella, Louis; Waag, David; Adamovicz, Jeffrey J

    2010-02-05

    Studies have shown that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple bacterial biological warfare agents, we examined survival, histopathology, and cytokine data from CpG ODN-treated C57BL/6 mice to determine whether previously-reported protection extended to aerosolized B. pseudomallei 1026b and highly virulent F. tularensis Schu S4 infections. We found that, although CpG ODN protected mice from aerosolized B. pseudomallei challenges, the immunostimulant failed to benefit the animals exposed to F. tularensis Schu S4 aerosols. Our results, which contrast with earlier F. tularensis LVS studies, highlight potential differences in Francisella species pathogenesis and underscore the need to evaluate immunotherapies against human pathogenic species.

  3. Extensive sequence-influenced DNA methylation polymorphism in the human genome

    PubMed Central

    2010-01-01

    Background Epigenetic polymorphisms are a potential source of human diversity, but their frequency and relationship to genetic polymorphisms are unclear. DNA methylation, an epigenetic mark that is a covalent modification of the DNA itself, plays an important role in the regulation of gene expression. Most studies of DNA methylation in mammalian cells have focused on CpG methylation present in CpG islands (areas of concentrated CpGs often found near promoters), but there are also interesting patterns of CpG methylation found outside of CpG islands. Results We compared DNA methylation patterns on both alleles between many pairs (and larger groups) of related and unrelated individuals. Direct observation and simulation experiments revealed that around 10% of common single nucleotide polymorphisms (SNPs) reside in regions with differences in the propensity for local DNA methylation between the two alleles. We further showed that for the most common form of SNP, a polymorphism at a CpG dinucleotide, the presence of the CpG at the SNP positively affected local DNA methylation in cis. Conclusions Taken together with the known effect of DNA methylation on mutation rate, our results suggest an interesting interdependence between genetics and epigenetics underlying diversity in the human genome. PMID:20497546

  4. DNA activates human immune cells through a CpG sequence-dependent manner

    PubMed Central

    Bauer, M; Heeg, K; Wagner, H; Lipford, G B

    1999-01-01

    While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

  5. [Evaluation of the quality of clinical practice guidelines published in the Annales de Biologie Clinique with the help of the EFLM checklist].

    PubMed

    Wils, Julien; Fonfrède, Michèle; Augereau, Christine; Watine, Joseph

    2014-01-01

    Several tools are available to help evaluate the quality of clinical practice guidelines (CPG). The AGREE instrument (Appraisal of guidelines for research & evaluation) is the most consensual tool but it has been designed to assess CPG methodology only. The European federation of laboratory medicine (EFLM) recently designed a check-list dedicated to laboratory medicine which is supposed to be comprehensive and which therefore makes it possible to evaluate more thoroughly the quality of CPG in laboratory medicine. In the present work we test the comprehensiveness of this check-list on a sample of CPG written in French and published in Annales de biologie clinique (ABC). Thus we show that some work remains to be achieved before a truly comprehensive check-list is designed. We also show that there is some room for improvement for the CPG published in ABC, for example regarding the fact that some of these CPG do not provide any information about allowed durations of transport and of storage of biological samples before analysis, or about standards of minimal analytical performance, or about the sensitivities or the specificities of the recommended tests.

  6. Regulation of glutamate receptor internalization by the spine cytoskeleton is mediated by its PKA-dependent association with CPG2

    PubMed Central

    Loebrich, Sven; Djukic, Biljana; Tong, Zachary J.; Cottrell, Jeffrey R.; Turrigiano, Gina G.; Nedivi, Elly

    2013-01-01

    A key neuronal mechanism for adjusting excitatory synaptic strength is clathrin-mediated endocytosis of postsynaptic glutamate receptors (GluRs). The actin cytoskeleton is critical for clathrin-mediated endocytosis, yet we lack a mechanistic understanding of its interaction with the endocytic process and how it may be regulated. Here we show that F-actin in dendritic spines physically binds the synaptic nuclear envelope 1 gene product candidate plasticity gene 2 (CPG2) in a PKA-dependent manner, and that this association is required for synaptic GluR internalization. Mutating two PKA sites on CPG2 disrupts its cytoskeletal association, attenuating GluR endocytosis and affecting the efficacy of synaptic transmission in vivo. These results identify CPG2 as an F-actin binding partner that functionally mediates interaction of the spine cytoskeleton with postsynaptic endocytosis. Further, the regulation of CPG2/F-actin association by PKA provides a gateway for cellular control of synaptic receptor internalization through second messenger signaling pathways. Recent identification of human synaptic nuclear envelope 1 as a risk locus for bipolar disorder suggests that CPG2 could play a role in synaptic dysfunction underlying neuropsychiatric disease. PMID:24191017

  7. Towards autonomous locomotion: CPG-based control of smooth 3D slithering gait transition of a snake-like robot.

    PubMed

    Bing, Zhenshan; Cheng, Long; Chen, Guang; Röhrbein, Florian; Huang, Kai; Knoll, Alois

    2017-04-04

    Snake-like robots with 3D locomotion ability have significant advantages of adaptive travelling in diverse complex terrain over traditional legged or wheeled mobile robots. Despite numerous developed gaits, these snake-like robots suffer from unsmooth gait transitions by changing the locomotion speed, direction, and body shape, which would potentially cause undesired movement and abnormal torque. Hence, there exists a knowledge gap for snake-like robots to achieve autonomous locomotion. To address this problem, this paper presents the smooth slithering gait transition control based on a lightweight central pattern generator (CPG) model for snake-like robots. First, based on the convergence behavior of the gradient system, a lightweight CPG model with fast computing time was designed and compared with other widely adopted CPG models. Then, by reshaping the body into a more stable geometry, the slithering gait was modified, and studied based on the proposed CPG model, including the gait transition of locomotion speed, moving direction, and body shape. In contrast to sinusoid-based method, extensive simulations and prototype experiments finally demonstrated that smooth slithering gait transition can be effectively achieved using the proposed CPG-based control method without generating undesired locomotion and abnormal torque.

  8. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  9. CpG Oligodeoxynucleotide and Montanide ISA 51 Adjuvant Combination Enhanced the Protective Efficacy of a Subunit Malaria Vaccine

    PubMed Central

    Kumar, Sanjai; Jones, Trevor R.; Oakley, Miranda S.; Zheng, Hong; Kuppusamy, Shanmuga P.; Taye, Alem; Krieg, Arthur M.; Stowers, Anthony W.; Kaslow, David C.; Hoffman, Stephen L.

    2004-01-01

    Unmethylated CpG dinucleotide motifs present in bacterial genomes or synthetic oligodeoxynucleotides (ODNs) serve as strong immunostimulatory agents in mice, monkeys and humans. We determined the adjuvant effect of murine CpG ODN 1826 on the immunogenicity and protective efficacy of the Saccharomyces cerevisiae-expressed 19-kDa C-terminal region of merozoite surface protein 1 (yMSP119) of the murine malaria parasite Plasmodium yoelii. We found that in C57BL/6 mice, following sporozoite challenge, the degree of protective immunity against malaria induced by yMSP119 in a formulation of Montanide ISA 51 (ISA) plus CpG ODN 1826 was similar or superior to that conferred by yMSP119 emulsified in complete Freund's adjuvant (CFA/incomplete Freund's adjuvant). In total, among mice immunized with yMSP119, 22 of 32 (68.7%) with ISA plus CpG 1826, 0 of 4 (0%) with CFA/incomplete Freund’s adjuvant, 0 of 4 (0%) with CpG 1826 mixed with ISA (no yMSP119), and 0 of 11 (0%) with CpG 1826 alone were completely protected against development of erythrocytic stage infection after sporozoite challenge. The adjuvant effect of CpG ODN 1826 was manifested as both significantly improved complete protection from malaria (defined as the absence of detectable erythrocytic form parasites) (P = 0.007, chi square) and reduced parasite burden in infected mice. In vivo depletions of interleukin-12 and gamma interferon cytokines and CD4+ and CD8+ T cells in vaccinated mice had no significant effect on immunity. On the other hand, immunoglobulin G (IgG) isotype levels appeared to correlate with protection. Inclusion of CpG ODN 1826 in the yMSP119 plus ISA vaccine contributed towards the induction of higher levels of IgG2a and IgG2b (Th1 type) antibodies, suggesting that CpG ODN 1826 caused a shift towards a Th1 type of immune response that could be responsible for the higher degree of protective immunity. Our results indicate that this potent adjuvant formulation should be further evaluated for use in clinical trials of recombinant malarial vaccine candidates. PMID:14742540

  10. Inhibitory and modulatory inputs to the vocal central pattern generator of a teleost fish

    PubMed Central

    Rosner, Elisabeth; Rohmann, Kevin N.; Bass, Andrew H.

    2018-01-01

    Abstract Vocalization is a behavioral feature that is shared among multiple vertebrate lineages, including fish. The temporal patterning of vocal communication signals is set, in part, by central pattern generators (CPGs). Toadfishes are well‐established models for CPG coding of vocalization at the hindbrain level. The vocal CPG comprises three topographically separate nuclei: pre‐pacemaker, pacemaker, motor. While the connectivity between these nuclei is well understood, their neurochemical profile remains largely unexplored. The highly vocal Gulf toadfish, Opsanus beta, has been the subject of previous behavioral, neuroanatomical and neurophysiological studies. Combining transneuronal neurobiotin‐labeling with immunohistochemistry, we map the distribution of inhibitory neurotransmitters and neuromodulators along with gap junctions in the vocal CPG of this species. Dense GABAergic and glycinergic label is found throughout the CPG, with labeled somata immediately adjacent to or within CPG nuclei, including a distinct subset of pacemaker neurons co‐labeled with neurobiotin and glycine. Neurobiotin‐labeled motor and pacemaker neurons are densely co‐labeled with the gap junction protein connexin 35/36, supporting the hypothesis that transneuronal neurobiotin‐labeling occurs, at least in part, via gap junction coupling. Serotonergic and catecholaminergic label is also robust within the entire vocal CPG, with additional cholinergic label in pacemaker and prepacemaker nuclei. Likely sources of these putative modulatory inputs are neurons within or immediately adjacent to vocal CPG neurons. Together with prior neurophysiological investigations, the results reveal potential mechanisms for generating multiple classes of social context‐dependent vocalizations with widely divergent temporal and spectral properties. PMID:29424431

  11. Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

    PubMed

    Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

    2018-03-01

    Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

  12. Validation of DAB2IP methylation and its relative significance in predicting outcome in renal cell carcinoma

    PubMed Central

    Zhao, Liang-Yun; Kapur, Payal; Wu, Kai-Jie; Wang, Bin; Yu, Yan-Hong; Liao, Bing; He, Da-Lin; Chen, Wei; Margulis, Vitaly; Hsieh, Jer-Tsong; Luo, Jun-Hang

    2016-01-01

    We have recently reported tumor suppressive role of DAB2IP in RCC development. In this study, We identified one CpG methylation biomarker (DAB2IP CpG1) located UTSS of DAB2IP that was associated with poor overall survival in a cohort of 318 ccRCC patients from the Cancer Genome Atlas (TCGA). We further validated the prognostic accuracy of DAB2IP CpG methylation by pyrosequencing quantitative methylation assay in 224 ccRCC patients from multiple Chinese centers (MCHC set), and 239 patients from University of Texas Southwestern Medical Center at Dallas (UTSW set) by using FFPE samples. DAB2IP CpG1 can predict the overall survival of patients in TCGA, MCHC, and UTSW sets independent of patient age, Fuhrman grade and TNM stage (all p<0.05). DAB2IP CpG1 successfully categorized patients into high-risk and low-risk groups with significant differences of clinical outcome in respective clinical subsets, regardless of age, sex, grade, stage, or race (HR: 1.63-7.83; all p<0.05). The detection of DAB2IP CpG1 methylation was minimally affected by ITH in ccRCC. DAB2IP mRNA expression was regulated by DNA methylation in vitro. DAB2IP CpG1 methylation is a practical and repeatable biomarker for ccRCC, which can provide prognostic value that complements the current staging system. PMID:27129174

  13. CpG Distribution and Methylation Pattern in Porcine Parvovirus

    PubMed Central

    Tóth, Renáta; Mészáros, István; Stefancsik, Rajmund; Bartha, Dániel; Bálint, Ádám; Zádori, Zoltán

    2013-01-01

    Based on GC content and the observed/expected CpG ratio (oCpGr), we found three major groups among the members of subfamily Parvovirinae: Group I parvoviruses with low GC content and low oCpGr values, Group II with low GC content and high oCpGr values and Group III with high GC content and high oCpGr values. Porcine parvovirus belongs to Group I and it features an ascendant CpG distribution by position in its coding regions similarly to the majority of the parvoviruses. The entire PPV genome remains hypomethylated during the viral lifecycle independently from the tissue of origin. In vitro CpG methylation of the genome has a modest inhibitory effect on PPV replication. The in vitro hypermethylation disappears from the replicating PPV genome suggesting that beside the maintenance DNMT1 the de novo DNMT3a and DNMT3b DNA methyltransferases can’t methylate replicating PPV DNA effectively either, despite that the PPV infection does not seem to influence the expression, translation or localization of the DNA methylases. SNP analysis revealed high mutability of the CpG sites in the PPV genome, while introduction of 29 extra CpG sites into the genome has no significant biological effects on PPV replication in vitro. These experiments raise the possibility that beyond natural selection mutational pressure may also significantly contribute to the low level of the CpG sites in the PPV genome. PMID:24392033

  14. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and “BRCA-Like” Status, in Both Blood and Tumour DNA

    PubMed Central

    Burghel, George J.; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D.; Brock, Ian W.; Cramp, Helen E.; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S.; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies. PMID:27463681

  15. Inducible nitric oxide synthase gene methylation and parkinsonism in manganese-exposed welders

    PubMed Central

    Nielsen, Susan Searles; Checkoway, Harvey; Criswell, Susan R.; Farin, Federico M.; Stapleton, Patricia L.; Sheppard, Lianne; Racette, Brad A.

    2015-01-01

    Introduction Neurologist-assessed parkinsonism signs are prevalent among workers exposed to manganese (Mn)-containing welding fume. Neuroinflammation may possibly play a role. Inducible nitric oxide synthase, coded by NOS2, is involved in inflammation, and particulate exposure increases the gene’s expression through methylation of CpG sites in the 5′ region. Methods We assessed DNA methylation at three CpG sites in the NOS2 exon 1 from blood from 201 welders. All were non-Hispanic Caucasian men 25–65 years old who were examined by a neurologist specializing in movement disorders. We categorized the workers according to their Unified Parkinson Disease Rating Scale motor subsection 3 (UPDRS3) scores as parkinsonism cases (UPDRS3 ≥ 15; n = 49), controls (UPDRS3 < 6; n = 103), or intermediate (UPDRS3 ≥6 to <15; n = 49). Results While accounting for age, examiner and experimental plate, parkinsonism cases had lower mean NOS2 methylation than controls (p-value for trend = 0.04), specifically at CpG site 8329 located in an exonic splicing enhancer of NOS2 (p-value for trend = 0.07). These associations were not observed for the intermediate UPDRS3 group (both p-value for trend ≥ 0.59). Conclusions Inflammation mediated by inducible nitric oxide synthase may possibly contribute to the association between welding fume and parkinsonism, but requires verification in a longitudinal study. PMID:25634431

  16. Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

    PubMed

    Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

    2017-06-27

    Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Enhanced early innate and T cell-mediated responses in subjects immunized with Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909).

    PubMed

    Minang, Jacob T; Inglefield, Jon R; Harris, Andrea M; Lathey, Janet L; Alleva, David G; Sweeney, Diane L; Hopkins, Robert J; Lacy, Michael J; Bernton, Edward W

    2014-11-28

    NuThrax™ (Anthrax Vaccine Adsorbed with CPG 7909 Adjuvant) (AV7909) is in development. Samples obtained in a phase Ib clinical trial were tested to confirm biomarkers of innate immunity and evaluate effects of CPG 7909 (PF-03512676) on adaptive immunity. Subjects received two intramuscular doses of commercial BioThrax(®) (Anthrax Vaccine Adsorbed, AVA), or two intramuscular doses of one of four formulations of AV7909. IP-10, IL-6, and C-reactive protein (CRP) levels were elevated 24-48 h after administration of AV7909 formulations, returning to baseline by Day 7. AVA (no CPG 7909) resulted in elevated IL-6 and CRP, but not IP-10. Another marker of CpG, transiently decreased absolute lymphocyte counts (ALCs), correlated with transiently increased IP-10. Cellular recall responses to anthrax protective antigen (PA) or PA peptides were assessed by IFN-γ ELISpot assay performed on cryopreserved PBMCs obtained from subjects prior to immunization and 7 days following the second immunization (study day 21). One-half of subjects that received AV7909 with low-dose (0.25mg/dose) CPG 7909 possessed positive Day 21 T cell responses to PA. In contrast, positive T cell responses occurred at an 11% average rate (1/9) for AVA-treated subjects. Differences in cellular responses due to dose level of CPG 7909 were not associated with differences in humoral anti-PA IgG responses, which were elevated for recipients of AV7909 compared to recipients of AVA. Serum markers at 24 or 48 h (i.e. % ALC decrease, or increase in IL-6, IP-10, or CRP) correlated with the humoral (antibody) responses 1 month later, but did not correlate with cellular ELISpot responses. In summary, biomarkers of early responses to CPG 7909 were confirmed, and adding a CpG adjuvant to a vaccine administered twice resulted in increased T cell effects relative to vaccine alone. Changes in early biomarkers correlated with subsequent adaptive humoral immunity but not cellular immunity. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Quality of clinical practice guidelines of lower extremity venous ulcers.

    PubMed

    Rumbo-Prieto, José María; Arantón-Areosa, Luis; Palomar-Llatas, Federico; Romero-Martín, Manuel

    The clinical variability and professional uncertainty in the prevention and treatment of lower extremity venous ulcers (VU) has as a main consequence, the fact that patients can be subjected to diagnostic and therapeutic tests, sometimes of dubious utility, these may even be harmful to the health of the patient and that, at other times, certain procedures or processes that may be appropriate to the patient's situation and needs may be omitted. It is for this reason that a series of specific documents called clinical practice guidelines for the approach of VU (CPG-VU) have been created, with the aim of improving the effectiveness and quality of care, reducing unjustified variability and establishing homogeneous criteria for its handling. Nevertheless, the literature shows that not all CPGs have the same methodological and evidence-drawing criteria. Many of them are of poor scientific quality and editorial rigor. This implies that CPGs should be periodically reviewed and updated based on the most current evidence and their quality contrasted with validated instruments such as AGREE-II. After an analysis of the quality of six CPG-VU available today, it has been possible to identify what guidelines are recommended for its implementation in the practice of care, which should be modified to improve their applicability and development of the evidence. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  19. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

    PubMed Central

    Scheiermann, Julia; Klinman, Dennis M.

    2014-01-01

    Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

  20. Confidential unit exclusion at the regional blood bank in Montes Claros - Fundação Hemominas

    PubMed Central

    Maia, Caroline Nogueira; Ruas, Munic de Oliveira; Urias, Elaine Veloso Rocha

    2012-01-01

    Objective This study aimed at analyzing the rate of self-exclusion at the Regional Blood Bank in Montes Claros. Methods Data of self-excluding donors from August 2008 to August 2010 were analyzed. The following variables were considered: age, marital status, gender, ethnical background, blood group, Rh factor, number of donations, type of donation and serologic results. Results During the analyzed period, 34,778 individuals donated blood, 215 (0.62%) of which were self-excluded; 12% of donors did not answer, 6.3% ballots were spoilt and 13.6% of the responses were considered non-compliant. The profile of the donors was: male (81.9%), single (50.7%), aged between 19 and 29 years old (52.1%), Mulatto (48.3%), blood group O (32.1%) and positive Rh (32.1%). Most individuals were donating for the 2ndto 5th time (43.7%) and had negative serology (94.4%). Conclusion It was not evident that self-excluding donors had higher rates of seropositivity. PMID:23049378

  1. Plasticity of DNA methylation and gene expression under zinc deficiency in Arabidopsis roots.

    PubMed

    Chen, Xiaochao; Schönberger, Brigitte; Menz, Jochen; Ludewig, Uwe

    2018-05-25

    DNA methylation is a heritable chromatin modification that maintains chromosome stability, regulates transposon silencing and appears to be involved in gene expression in response to environmental conditions. Environmental stress alters DNA methylation patterns that are correlated with gene expression differences. Here, genome-wide differential DNA-methylation was identified upon prolonged Zn deficiency, leading to hypo- and hyper-methylated chromosomal regions. Preferential CpG methylation changes occurred in gene promoters and gene bodies, but did not overlap with transcriptional start sites. Methylation changes were also prominent in transposable elements. By contrast, non-CG methylation differences were exclusively found in promoters of protein coding genes and in transposable elements. Strongly Zn deficiency-induced genes and their promoters were mostly non-methylated, irrespective of Zn supply. Differential DNA methylation in the CpG and CHG, but not in the CHH context, was found close to a few up-regulated Zn-deficiency genes. However, the transcriptional Zn-deficiency response in roots appeared little correlated with associated DNA methylation changes in promoters or gene bodies. Furthermore, under Zn deficiency, developmental defects were identified in an Arabidopsis mutant lacking non-CpG methylation. The root methylome thus responds specifically to a micro-nutrient deficiency and is important for efficient Zn utilization at low availability, but the relationship of differential methylation and differentially expressed genes is surprisingly poor.

  2. Genome-wide DNA methylomes from discrete developmental stages reveal the predominance of non-CpG methylation in Tribolium castaneum.

    PubMed

    Song, Xiaowen; Huang, Fei; Liu, Juanjuan; Li, Chengjun; Gao, Shanshan; Wu, Wei; Zhai, Mengfan; Yu, Xiaojuan; Xiong, Wenfeng; Xie, Jia; Li, Bin

    2017-10-01

    Cytosine DNA methylation is a vital epigenetic regulator of eukaryotic development. Whether this epigenetic modification occurs in Tribolium castaneum has been controversial, its distribution pattern and functions have not been established. Here, using bisulphite sequencing (BS-Seq), we confirmed the existence of DNA methylation and described the methylation profiles of the four life stages of T. castaneum. In the T. castaneum genome, both symmetrical CpG and non-CpG methylcytosines were observed. Symmetrical CpG methylation, which was catalysed by DNMT1 and occupied a small part in T. castaneum methylome, was primarily enriched in gene bodies and was positively correlated with gene expression levels. Asymmetrical non-CpG methylation, which was predominant in the methylome, was strongly concentrated in intergenic regions and introns but absent from exons. Gene body methylation was negatively correlated with gene expression levels. The distribution pattern and functions of this type of methylation were similar only to the methylome of Drosophila melanogaster, which further supports the existence of a novel methyltransferase in the two species responsible for this type of methylation. This first life-cycle methylome of T. castaneum reveals a novel and unique methylation pattern, which will contribute to the further understanding of the variety and functions of DNA methylation in eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  3. A comparative study of South Asian and non-Asian referrals to an eating disorders service in Leicester, UK.

    PubMed

    Abbas, S; Damani, S; Malik, I; Button, E; Aldridge, S; Palmer, R L

    2010-01-01

    Literature on eating disorders (EDs) among South Asian people in Britain is limited. In an extension of an earlier study, referrals to the Leicester Adult Eating Disorders Service were examined between 1991 and 2005. All South-Asians presenting to the service were compared on age, gender and diagnosis with non-Asians. Female Asian patients diagnosed as bulimia nervosa and ED not otherwise specified were compared on a larger number of variables with the same number of non-Asian patients matched for diagnosis. As there were only six Asian patients with anorexia nervosa they were excluded from this comparison. Only 4.5% of female patients were Asian, as opposed to 13.8% of the local young female population in the most recent UK census. Overall, Asian women were significantly younger than the non-Asians but did not differ significantly with regard to clinical features or treatment variables. Asians are under-represented amongst women presenting to the service. The explanation for this remains uncertain. Overall, Asian sufferers who reach secondary specialist services closely resemble non-Asian patients.

  4. Transcutaneous immunization with tetanus toxoid and mutants of Escherichia coli heat-labile enterotoxin as adjuvants elicits strong protective antibody responses.

    PubMed

    Tierney, Rob; Beignon, Anne-Sophie; Rappuoli, Rino; Muller, Sylviane; Sesardic, Dorothea; Partidos, Charalambos D

    2003-09-01

    In this study, the adjuvanticity of 2 nontoxic derivatives (LTK63 and LTR72) of heat-labile enterotoxin of Escherichia coli (LT) was evaluated and was compared with that of a cytosine phosphodiester-guanine (CpG) motif, after transcutaneous immunization with tetanus toxoid (TT). TT plus LTR72 elicited the strongest antibody responses, compared with those elicited by the other vaccines (TT, TT plus LTK63, TT plus CpG, and TT plus LTK63 plus CpG); it neutralized the toxin and conferred full protection after passive transfer in mice. Preexisting immunity to LT mutants did not adversely affect their adjuvant potency. Both LTK63 and LTR72 promoted the induction of IgG1 antibodies. In contrast, mice receiving either CpG motif alone or CpG motif plus LTK63 produced strong IgG2a anti-TT antibody responses. Overall, these findings demonstrate that mutants of enterotoxins with reduced toxicity are effective adjuvants for transcutaneous immunization.

  5. On the Role of Sensory Feedbacks in Rowat–Selverston CPG to Improve Robot Legged Locomotion

    PubMed Central

    Amrollah, Elmira; Henaff, Patrick

    2010-01-01

    This paper presents the use of Rowat and Selverston-type of central pattern generator (CPG) to control locomotion. It focuses on the role of afferent exteroceptive and proprioceptive signals in the dynamic phase synchronization in CPG legged robots. The sensori-motor neural network architecture is evaluated to control a two-joint planar robot leg that slips on a rail. Then, the closed loop between the CPG and the mechanical system allows to study the modulation of rhythmic patterns and the effect of the sensing loop via sensory neurons during the locomotion task. Firstly simulations show that the proposed architecture easily allows to modulate rhythmic patterns of the leg, and therefore the velocity of the robot. Secondly, simulations show that sensori-feedbacks from foot/ground contact of the leg make the hip velocity smoother and larger. The results show that the Rowat–Selverston-type CPG with sensory feedbacks is an effective choice for building adaptive neural CPGs for legged robots. PMID:21228904

  6. [The effect of entrapment of CpG sequence with cationic PLG nanoparticles on the immune responses of mice to pig paratyphoid vaccine].

    PubMed

    Wu, Mei; Shi, Ling; Liu, Shigui; Li, Jiangling; Wu, Kaiyuan; Wang, Lihuan; Shen, Yi; Liu, Kun; Zheng, Yong; Zhang, Xinshen; Gao, Rong

    2005-10-01

    Cationic PLG nanoparticles and liposome were prepared and used as package molecules to pack up pUC18-CpG. The effects of the packed pUC18-CpG on the cellular and humoral immune responses were detected in the mice that were inoculated with pig paratyphoid vaccine. The results showed that compared with the control, the amount of IgG and the titre of specific antibody were significantly increased in the sera of mice immunized with the CpG plasmid entrapped by cationic PLG nanoparticles; the proliferation and induced IL-2 bioactivity of lymphocytes were significantly enhanced in the spleen of the immunized mice; the stimulatory effect of cationic PLG nanoparticles was similar to or stronger than that of cationic liposome. These indicated that cationic PLG nanoparticle could be employed as an effective package molecule to promote the immunostimulatory effect of pUC18-CpG.

  7. DNA Methylation of Gene Expression in Acanthamoeba castellanii Encystation.

    PubMed

    Moon, Eun-Kyung; Hong, Yeonchul; Lee, Hae-Ahm; Quan, Fu-Shi; Kong, Hyun-Hee

    2017-04-01

    Encystation mediating cyst specific cysteine proteinase (CSCP) of Acanthamoeba castellanii is expressed remarkably during encystation. However, the molecular mechanism involved in the regulation of CSCP gene expression remains unclear. In this study, we focused on epigenetic regulation of gene expression during encystation of Acanthamoeba . To evaluate methylation as a potential mechanism involved in the regulation of CSCP expression, we first investigated the correlation between promoter methylation status of CSCP gene and its expression. A 2,878 bp of promoter sequence of CSCP gene was amplified by PCR. Three CpG islands (island 1-3) were detected in this sequence using bioinformatics tools. Methylation of CpG island in trophozoites and cysts was measured by bisulfite sequence PCR. CSCP promoter methylation of CpG island 1 (1,633 bp) was found in 8.2% of trophozoites and 7.3% of cysts. Methylation of CpG island 2 (625 bp) was observed in 4.2% of trophozoites and 5.8% of cysts. Methylation of CpG island 3 (367 bp) in trophozoites and cysts was both 3.6%. These results suggest that DNA methylation system is present in CSCP gene expression of Acanthamoeba . In addition, the expression of encystation mediating CSCP is correlated with promoter CpG island 1 hypomethylation.

  8. Exosome-based tumor antigens-adjuvant co-delivery utilizing genetically engineered tumor cell-derived exosomes with immunostimulatory CpG DNA.

    PubMed

    Morishita, Masaki; Takahashi, Yuki; Matsumoto, Akihiro; Nishikawa, Makiya; Takakura, Yoshinobu

    2016-12-01

    For cancer immunotherapy via tumor antigen vaccination in combination with an adjuvant, major challenges include the identification of a particular tumor antigen and efficient delivery of the antigen as well as adjuvant to antigen-presenting cells. In this study, we proposed an efficient exosome-based tumor antigens-adjuvant co-delivery system using genetically engineered tumor cell-derived exosomes containing endogenous tumor antigens and immunostimulatory CpG DNA. Murine melanoma B16BL6 cells were transfected with a plasmid vector encoding a fusion streptavidin (SAV; a protein that binds to biotin with high affinity)-lactadherin (LA; an exosome-tropic protein) protein, yielding genetically engineered SAV-LA-expressing exosomes (SAV-exo). SAV-exo were combined with biotinylated CpG DNA to prepare CpG DNA-modified exosomes (CpG-SAV-exo). Fluorescent microscopic observation revealed the successful modification of exosomes with CpG DNA by SAV-biotin interaction. CpG-SAV-exo showed efficient and simultaneous delivery of exosomes with CpG DNA to murine dendritic DC2.4 cells in culture. Treatment with CpG-SAV-exo effectively activated DC2.4 cells and enhanced tumor antigen presentation capacity. Immunization with CpG-SAV-exo exhibited stronger in vivo antitumor effects in B16BL6 tumor-bearing mice than simple co-administration of exosomes and CpG DNA. Thus, genetically engineered CpG-SAV-exo is an effective exosome-based tumor antigens-adjuvant co-delivery system that will be useful for cancer immunotherapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

    PubMed Central

    Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

    2014-01-01

    Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

  10. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages

    PubMed Central

    Shi, Yongyu; Felder, Mildred A.R.; Sondel, Paul M.; Rakhmilevich, Alexander L.

    2015-01-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. PMID:25829245

  11. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Use of DNA from human stools to detect aberrant CpG island methylation of genes implicated in colorectal cancer.

    PubMed

    Belshaw, Nigel J; Elliott, Giles O; Williams, Elizabeth A; Bradburn, David M; Mills, Sarah J; Mathers, John C; Johnson, Ian T

    2004-09-01

    Hypermethylation of cytosine residues in the CpG islands of tumor suppressor genes is a key mechanism of colorectal carcinogenesis. Detection and quantification of CpG island methylation in human DNA isolated from stools might provide a novel strategy for the detection and investigation of colorectal neoplasia. To explore the feasibility of this approach, colorectal biopsies and fecal samples were obtained from 32 patients attending for colonoscopy or surgery, who were found to have adenomatous polyps, colorectal cancer, or no evidence of neoplasia. A further 18 fecal samples were obtained from healthy volunteers, with no bowel symptoms. Isolated DNA was modified with sodium bisulfite and analyzed by methylation-specific PCR and combined bisulfite restriction analysis for CpG island methylation of ESR1, MGMT, HPP1, p16(INK4a), APC, and MLH1. CpG island methylation was readily detectable in both mucosal and fecal DNA with methylation-specific PCR. Using combined bisulfite restriction analysis, it was established that, in volunteers from whom biopsies were available, the levels of methylation at two CpG sites within ESR1 assayed using fecal DNA were significantly correlated with methylation in DNA from colorectal mucosa. Thus, noninvasive techniques can be used to obtain quantitative information about the level of CpG island methylation in human colorectal mucosa. The methods described here could be applied to a much expanded range of genes and may be valuable both for screening purposes and to provide greater insight into the functional consequences of epigenetic changes in the colorectal mucosa of free-living individuals.

  13. Marked enhancement of the immune response to BioThrax® (Anthrax Vaccine Adsorbed) by the TLR9 agonist CPG 7909 in healthy volunteers.

    PubMed

    Rynkiewicz, Dianna; Rathkopf, Melinda; Sim, Iain; Waytes, A Thomas; Hopkins, Robert J; Giri, Lallan; DeMuria, Deborah; Ransom, Janet; Quinn, James; Nabors, Gary S; Nielsen, Carl J

    2011-08-26

    Immunization with BioThrax(®) (Anthrax Vaccine Adsorbed) is a safe and effective means of preventing anthrax. Animal studies have demonstrated that the addition of CpG DNA adjuvants to BioThrax can markedly increase the immunogenicity of the vaccine, increasing both serum anti-protective antigen (PA) antibody and anthrax toxin-neutralizing antibody (TNA) concentrations. The immune response to CpG-adjuvanted BioThrax in animals was not only stronger, but was also more rapid and led to higher levels of protection in spore challenge models. The B-class CpG DNA adjuvant CPG 7909, a 24-base synthetic, single-strand oligodeoxynucleotide, was evaluated for its safety profile and adjuvant properties in a Phase 1 clinical trial. A double-blind study was performed in which 69 healthy subjects, age 18-45 years, were randomized to receive three doses of either: (1) BioThrax alone, (2) 1 mg of CPG 7909 alone or (3) BioThrax plus 1 mg of CPG 7909, all given intramuscularly on study days 0, 14 and 28. Subjects were monitored for IgG to PA by ELISA and for TNA titers through study day 56 and for safety through month 6. CPG 7909 increased the antibody response by 6-8-fold at peak, and accelerated the response by 3 weeks compared to the response seen in subjects vaccinated with BioThrax alone. No serious adverse events related to study agents were reported, and the combination was considered to be reasonably well tolerated. The marked acceleration and enhancement of the immune response seen by combining BioThrax and CPG 7909 offers the potential to shorten the course of immunization and reduce the time to protection, and may be particularly useful in the setting of post-exposure prophylaxis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  15. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    PubMed Central

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  16. Genome-wide site-specific differential methylation in the blood of individuals with Klinefelter Syndrome

    PubMed Central

    Wan, Emily S.; Qiu, Weiliang; Morrow, Jarrett; Beaty, Terri H.; Hetmanski, Jacqueline; Make, Barry J.; Lomas, David A.; Silverman, Edwin K.; DeMeo, Dawn L.

    2015-01-01

    Klinefelter syndrome (KS) (47 XXY) is a common sex-chromosome aneuploidy with an estimated prevalence of 1 in every 660 male births. Investigations into the associations between DNA methylation and the highly variable clinical manifestations of KS have largely focused on the supernumerary X chromosome; systematic investigations of the epigenome have been limited. We obtained genome-wide DNA methylation data from peripheral blood using the Illumina HumanMethylation450K platform in 5 KS (47 XXY), 102 male (46 XY), and 113 female (46 XX) control subjects participating in the chronic obstructive pulmonary disease (COPD) Gene Study. Empirical Bayes-mediated models were used to test for differential methylation by KS status. CpG sites with a false-discovery rate <0.05 from the first-generation HumanMethylation27K platform were further examined in an independent replication cohort of 2 KS subjects, 590 male, and 495 female controls drawn from the International COPD Genetics Network (ICGN). Differential methylation at sites throughout the genome were identified, including 86 CpG sites that were differentially methylated in KS subjects relative to both male and female controls. CpG sites annotated to the HEN1 methyltransferase homolog 1 (HENMT1), calcyclin-binding protein (CACYBP), and GTPase-activating protein (SH3 domain)-binding protein 1 (G3BP1) genes were among the “KS-specific” loci that were replicated in ICGN. We therefore conclude that site-specific differential methylation exists throughout the genome in KS. The functional impact and clinical relevance of these differentially methylated loci should be explored in future studies. PMID:25988574

  17. CpG island methylation phenotype (CIMP) in oral cancer: associated with a marked inflammatory response and less aggressive tumour biology.

    PubMed

    Shaw, Richard J; Hall, Gillian L; Lowe, Derek; Bowers, Naomi L; Liloglou, Triantafillos; Field, John K; Woolgar, Julia A; Risk, Janet M

    2007-10-01

    Studies in several tumour sites highlight the significance of the CpG island methylation phenotype (CIMP), with distinct features of histology, biological aggression and outcome. We utilise pyrosequencing techniques of quantitative methylation analysis to investigate the presence of CIMP in oral squamous cell carcinoma (OSCC) for the first time, and evaluate its correlation with allelic imbalance, pathology and clinical behaviour. Tumour tissue, control tissue and PBLs were obtained from 74 patients with oral squamous cell carcinoma. Pyrosequencing was used to analyse methylation patterns in 75-200 bp regions of the CpG rich gene promoters of 10 genes with a broad range of cellular functions. Allelic imbalance was investigated using a multiplexed panel of 11 microsatellite markers. Corresponding variables, histopathological staging and grading were correlated with these genetic and epigenetic aberrations. A cluster of tumours with a greater degree of promoter methylation than would be predicted by chance alone (P=0.001) were designated CIMP+ve. This group had less aggressive tumour biology in terms of tumour thickness (p=0.015) and nodal metastasis (P=0.012), this being apparently independent of tumour diameter. Further, it seems that these CIMP+ve tumours excited a greater host inflammatory response (P=0.019). The exact mechanisms underlying CIMP remain obscure but the association with a greater inflammatory host response supports existing theories relating these features in other tumour sites. As CIMP has significant associations with other well documented prognostic indicators, it may prove beneficial to include methylation analyses in molecular risk modelling of tumours.

  18. Cord blood DNA methylation and adiposity measures in early and mid-childhood.

    PubMed

    Kresovich, Jacob K; Zheng, Yinan; Cardenas, Andres; Joyce, Brian T; Rifas-Shiman, Sheryl L; Oken, Emily; Gillman, Matthew W; Hivert, Marie-France; Baccarelli, Andrea A; Hou, Lifang

    2017-01-01

    Excess adiposity in childhood is associated with numerous adverse health outcomes. As this condition is difficult to treat once present, identification of risk early in life can help inform and implement strategies to prevent the onset of the condition. We performed an epigenome-wide association study to prospectively investigate the relationship between cord blood DNA methylation and adiposity measurements in childhood. We measured genome-wide DNA methylation from 478 children in cord blood and measured overall and central adiposity via skinfold caliper measurements in early (range 3.1-3.3 years) and mid-childhood (age range 7.3-8.3 years) and via dual X-ray absorptiometry (DXA) in mid-childhood. Final models were adjusted for maternal age at enrollment, pre-pregnancy body mass index, education, folate intake during pregnancy, smoking during pregnancy, and gestational weight gain, and child sex, race/ethnicity, current age, and cord blood cell composition. We identified four promoter proximal CpG sites that were associated with adiposity as measured by subscapular (SS) and triceps (TR) ratio (SS:TR) in early childhood, in the genes KPRP , SCL9A10 , MYLK2 , and PRLHR . We additionally identified one gene body CpG site associated with early childhood SS + TR on PPAPDC1A ; this site was nominally associated with SS + TR in mid-childhood. Higher methylation at one promoter proximal CpG site in MMP25 was also associated with SS:TR in mid-childhood. In regional analyses, methylation at an exonal region of GFPT2 was positively associated with SS:TR in early childhood. Finally, we identified regions of two long, non-coding RNAs which were associated with SS:TR (LOC100049716) and fat-free mass index (LOC102723493) in mid-childhood. This analysis identified novel CpG loci associated with adiposity outcomes. However, our results suggest little consistency across the various adiposity outcomes tested, particularly among the more accurate DXA measurements of body composition. We recommend using caution when interpreting these associations.

  19. Radiolabelling of glycosylated MFE-23::CPG2 fusion protein (MFECP1) with 99mTc for quantitation of tumour antibody-enzyme localisation in antibody-directed enzyme pro-drug therapy (ADEPT).

    PubMed

    Francis, R J; Mather, S J; Chester, K; Sharma, S K; Bhatia, J; Pedley, R B; Waibel, R; Green, A J; Begent, R H J

    2004-08-01

    MFECP1 is a glycosylated recombinant fusion protein composed of MFE-23, a high-affinity anti-carcinoembryonic antigen (CEA) single chain Fv (scFv), fused to the enzyme carboxypeptidase G2 (CPG2), and has been constructed for use in antibody-directed enzyme pro-drug therapy (ADEPT). Radiolabelling of glycosylated MFECP1 with technetium-99m was developed for the purpose of determining tumour localisation of MFECP1 in a phase I ADEPT clinical study. The method used was 99mTc-carbonyl [99mTc(H2O)3(CO)3]+ (abbreviated to TcCO) mediated labelling of 99mTc to the hexahistidine (His) tag of MFECP1. MFECP1 fusion protein was labelled with TcCO under a variety of conditions, and this was shown to be a relatively simple and robust method. Tissue biodistribution was assessed in a CEA-expressing LS174T (human colon carcinoma) nude mouse xenograft model. Tissues were taken at 1, 4 and 6 h for assessment of distribution of radioactivity and for measurement of CPG2 enzyme levels. The amount of radioactivity retained by the tumour proved to be an accurate estimation of actual measured enzyme activity, indicating that this radiolabelling method does not appear to damage the antibody-antigen binding or the enzyme activity of MFECP1. However, correlation between CPG2 enzyme activity and measured radioactivity in liver, spleen and kidney was poor, indicating retention of radioactivity in non-tumour sites but loss of enzyme activity. The high retention of technetium radioisotope in normal tissues may limit the clinical applicability of this radiolabelling method for MFECP1; however, these results suggest that this technique does have applicability for measuring the biodistribution of His-tagged recombinant proteins.

  20. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    may protect victims of a biological attack from glanders . Burkholderia mallei , the causative agent of glanders , natu- rally infects equines, but it can...attack from glanders . 15. SUBJECT TERMS Burkholderia mallei , glanders , oligonucleotides, CpG motif, efficacy, laboratory animals, mice 16...Society for Microbiology. All Rights Reserved. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei David M

  1. [Similarity of cycloprolylglycine to piracetam in antihypoxic and neuroprotective effects].

    PubMed

    Kolisnikova, K N; Gudasheva, T A; Nazarova, G A; Antipov, T A; Voronina, T A; Seredenin, S B

    2012-01-01

    The antihypoxic activity of the endogenous cyclic dipeptide cycloprolylglycine (CPG) has been studied on a model of normobaric hypoxia with hypercapnia and its neuroprotective activity has been studied on a model of human neuroblastoma SH-SY5Y cell damage by 6-hydroxydopamine. It is established that CPG exhibits the antihypoxic activity at doses of 0.5 and 1.0 mg/kg (i.p.) on outbred and BALB/c mice, but not on C57B1/6 mice. The neuroprotective activity of CPG was detected in 10(-5) - 10(-8) M concentration range only when the treatment was carried out 24h before toxin introduction. The obtained data confirm the hypothesis that piracetam is a mimetic of the endogenous CPG neuropeptide.

  2. CpG oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by a goose parvovirus vaccine in ducks.

    PubMed

    Lee, Jai-Wei; Lin, Yu-Ming; Yen, Ting-Ying; Yang, Wen-Jen; Chu, Chun-Yen

    2010-11-23

    Recombinant parvovirus VP2 (rVP2) was formulated with different types of adjuvant, including aluminum adjuvant and CpG oligodeoxynucleotides (ODNs), and the immunological responses after vaccination in ducks were examined. In comparison with the control group, production of rVP2-specific antibodies, expression of cytokines in peripheral blood mononuclear cells (PBMC) stimulated by rVP2, and percentage of CD4(+)/CD8(+) cells in PBMC were significantly increased in ducks immunized with rVP2 formulated with CpG ODNs containing 3 copies of GACGTT motif. CpG ODNs with GACGTT motifs might be used to improve the efficacy of vaccines for ducks. Copyright © 2010 Elsevier Ltd. All rights reserved.

  3. A new approach to epigenome-wide discovery of non-invasive methylation biomarkers for colorectal cancer screening in circulating cell-free DNA using pooled samples.

    PubMed

    Gallardo-Gómez, María; Moran, Sebastian; Páez de la Cadena, María; Martínez-Zorzano, Vicenta Soledad; Rodríguez-Berrocal, Francisco Javier; Rodríguez-Girondo, Mar; Esteller, Manel; Cubiella, Joaquín; Bujanda, Luis; Castells, Antoni; Balaguer, Francesc; Jover, Rodrigo; De Chiara, Loretta

    2018-01-01

    Colorectal cancer is the fourth cause of cancer-related deaths worldwide, though detection at early stages associates with good prognosis. Thus, there is a clear demand for novel non-invasive tests for the early detection of colorectal cancer and premalignant advanced adenomas, to be used in population-wide screening programs. Aberrant DNA methylation detected in liquid biopsies, such as serum circulating cell-free DNA (cfDNA), is a promising source of non-invasive biomarkers. This study aimed to assess the feasibility of using cfDNA pooled samples to identify potential serum methylation biomarkers for the detection of advanced colorectal neoplasia (colorectal cancer or advanced adenomas) using microarray-based technology. cfDNA was extracted from serum samples from 20 individuals with no colorectal findings, 20 patients with advanced adenomas, and 20 patients with colorectal cancer (stages I and II). Two pooled samples were prepared for each pathological group using equal amounts of cfDNA from 10 individuals, sex-, age-, and recruitment hospital-matched. We measured the methylation levels of 866,836 CpG positions across the genome using the MethylationEPIC array. Pooled serum cfDNA methylation data meets the quality requirements. The proportion of detected CpG in all pools (> 99% with detection p value < 0.01) exceeded Illumina Infinium methylation data quality metrics of the number of sites detected. The differential methylation analysis revealed 1384 CpG sites (5% false discovery rate) with at least 10% difference in the methylation level between no colorectal findings controls and advanced neoplasia, the majority of which were hypomethylated. Unsupervised clustering showed that cfDNA methylation patterns can distinguish advanced neoplasia from healthy controls, as well as separate tumor tissue from healthy mucosa in an independent dataset. We also observed that advanced adenomas and stage I/II colorectal cancer methylation profiles, grouped as advanced neoplasia, are largely homogenous and clustered close together. This preliminary study shows the viability of microarray-based methylation biomarker discovery using pooled serum cfDNA samples as an alternative approach to tissue specimens. Our strategy sets an open door for deciphering new non-invasive biomarkers not only for colorectal cancer detection, but also for other types of cancers.

  4. Developing a spatial-statistical model and map of historical malaria prevalence in Botswana using a staged variable selection procedure

    PubMed Central

    Craig, Marlies H; Sharp, Brian L; Mabaso, Musawenkosi LH; Kleinschmidt, Immo

    2007-01-01

    Background Several malaria risk maps have been developed in recent years, many from the prevalence of infection data collated by the MARA (Mapping Malaria Risk in Africa) project, and using various environmental data sets as predictors. Variable selection is a major obstacle due to analytical problems caused by over-fitting, confounding and non-independence in the data. Testing and comparing every combination of explanatory variables in a Bayesian spatial framework remains unfeasible for most researchers. The aim of this study was to develop a malaria risk map using a systematic and practicable variable selection process for spatial analysis and mapping of historical malaria risk in Botswana. Results Of 50 potential explanatory variables from eight environmental data themes, 42 were significantly associated with malaria prevalence in univariate logistic regression and were ranked by the Akaike Information Criterion. Those correlated with higher-ranking relatives of the same environmental theme, were temporarily excluded. The remaining 14 candidates were ranked by selection frequency after running automated step-wise selection procedures on 1000 bootstrap samples drawn from the data. A non-spatial multiple-variable model was developed through step-wise inclusion in order of selection frequency. Previously excluded variables were then re-evaluated for inclusion, using further step-wise bootstrap procedures, resulting in the exclusion of another variable. Finally a Bayesian geo-statistical model using Markov Chain Monte Carlo simulation was fitted to the data, resulting in a final model of three predictor variables, namely summer rainfall, mean annual temperature and altitude. Each was independently and significantly associated with malaria prevalence after allowing for spatial correlation. This model was used to predict malaria prevalence at unobserved locations, producing a smooth risk map for the whole country. Conclusion We have produced a highly plausible and parsimonious model of historical malaria risk for Botswana from point-referenced data from a 1961/2 prevalence survey of malaria infection in 1–14 year old children. After starting with a list of 50 potential variables we ended with three highly plausible predictors, by applying a systematic and repeatable staged variable selection procedure that included a spatial analysis, which has application for other environmentally determined infectious diseases. All this was accomplished using general-purpose statistical software. PMID:17892584

  5. Combined study of genetic and epigenetic biomarker risperidone treatment efficacy in Chinese Han schizophrenia patients

    PubMed Central

    Shi, Y; Li, M; Song, C; Xu, Q; Huo, R; Shen, L; Xing, Q; Cui, D; Li, W; Zhao, J; He, L; Qin, S

    2017-01-01

    Nowadays, risperidone is an atypical antipsychotic drug that has been increasingly used for treatment and maintenance therapy in schizophrenia. However, partially affected by genetic or environmental factors, there is significant difference in treatment outcomes among patients. In this study, we aimed to interpret the difference between good and poor responders treated with risperidone in both genetic and epigenetic levels in 288 mainland Chinese patients. We recruited a Henan cohort including 98 patients as initial discovery group and then confirmed our results in Shanghai cohort. In genetic studies, we found 10 candidate single-nucleotide polymorphisms (SNPs) and 2 rare variants in Henan cohort by next-generation sequencing of 100 risperidone-response-related genes. After replication in Shanghai cohort by massarray platform, ultimately, rs6706232 and rs4818 were significantly associated with risperidone response in the two cohort meta-analysis (P=0.024 and 0.04, respectively). Besides, we also selected another reported 17 candidate SNPs associated with risperidone drug response to replicate in our mainland Chinese samples, while, we found no significant SNPs after Bonferroni correction. In epigenetic studies, we investigated the methylation status in promoters or gene-coding region of risperidone drug response-related genes including CYP3A4, CYP2D6, ABCB1, HTR2A, DRD2. Totally we found seven significant CpG sites in the meta-analysis with Bonferroni-corrected PCYP3A4_CpG_-36=0.0014, PCYP3A4_CpG_-258=0.0013, PCYP3A4_CpG_-296=0.0014, PCYP3A4_CpG_-367:-372:-374=0.028, PCYP2D6_CpG_193=0.012, PCYP2D6_CpG_242:244:250=0.00076 and PCYP2D6_CpG_284=0.034, respectively. As genetic and epigenetic factors may interactively affect drug response, we finally carried out a multivariant interaction analysis with multifactor dimensionality reduction and discovered a significant four-locus model (CYP3A4_CpG_-82:-86 +rs6280+rs1800497+rs6265, P=0.038) affecting drug response. These findings could partially explain different risperidone response outcome in Chinese population in a systematic level. PMID:28696411

  6. Evolution in health and medicine Sackler colloquium: Stochastic epigenetic variation as a driving force of development, evolutionary adaptation, and disease.

    PubMed

    Feinberg, Andrew P; Irizarry, Rafael A

    2010-01-26

    Neo-Darwinian evolutionary theory is based on exquisite selection of phenotypes caused by small genetic variations, which is the basis of quantitative trait contribution to phenotype and disease. Epigenetics is the study of nonsequence-based changes, such as DNA methylation, heritable during cell division. Previous attempts to incorporate epigenetics into evolutionary thinking have focused on Lamarckian inheritance, that is, environmentally directed epigenetic changes. Here, we propose a new non-Lamarckian theory for a role of epigenetics in evolution. We suggest that genetic variants that do not change the mean phenotype could change the variability of phenotype; and this could be mediated epigenetically. This inherited stochastic variation model would provide a mechanism to explain an epigenetic role of developmental biology in selectable phenotypic variation, as well as the largely unexplained heritable genetic variation underlying common complex disease. We provide two experimental results as proof of principle. The first result is direct evidence for stochastic epigenetic variation, identifying highly variably DNA-methylated regions in mouse and human liver and mouse brain, associated with development and morphogenesis. The second is a heritable genetic mechanism for variable methylation, namely the loss or gain of CpG dinucleotides over evolutionary time. Finally, we model genetically inherited stochastic variation in evolution, showing that it provides a powerful mechanism for evolutionary adaptation in changing environments that can be mediated epigenetically. These data suggest that genetically inherited propensity to phenotypic variability, even with no change in the mean phenotype, substantially increases fitness while increasing the disease susceptibility of a population with a changing environment.

  7. Association between socioeconomic factors and cancer risk: a population cohort study in Scotland (1991-2006).

    PubMed

    Sharpe, Katharine H; McMahon, Alex D; Raab, Gillian M; Brewster, David H; Conway, David I

    2014-01-01

    Lung and upper aero-digestive tract (UADT) cancer risk are associated with low socioeconomic circumstances and routinely measured using area socioeconomic indices. We investigated effect of country of birth, marital status, one area deprivation measure and individual socioeconomic variables (economic activity, education, occupational social class, car ownership, household tenure) on risk associated with lung, UADT and all cancer combined (excluding non melanoma skin cancer). We linked Scottish Longitudinal Study and Scottish Cancer Registry to follow 203,658 cohort members aged 15+ years from 1991-2006. Relative risks (RR) were calculated using Poisson regression models by sex offset for person-years of follow-up. 21,832 first primary tumours (including 3,505 lung, 1,206 UADT) were diagnosed. Regardless of cancer, economically inactivity (versus activity) was associated with increased risk (male: RR 1.14, 95% CI 1.10-1.18; female: RR 1.06, 95% CI 1.02-1.11). For lung cancer, area deprivation remained significant after full adjustment suggesting the area deprivation cannot be fully explained by individual variables. No or non degree qualification (versus degree) was associated with increased lung risk; likewise for UADT risk (females only). Occupational social class associations were most pronounced and elevated for UADT risk. No car access (versus ownership) was associated with increased risk (excluding all cancer risk, males). Renting (versus home ownership) was associated with increased lung cancer risk, UADT cancer risk (males only) and all cancer risk (females only). Regardless of cancer group, elevated risk was associated with no education and living in deprived areas. Different and independent socioeconomic variables are inversely associated with different cancer risks in both sexes; no one socioeconomic variable captures all aspects of socioeconomic circumstances or life course. Association of multiple socioeconomic variables is likely to reflect the complexity and multifaceted nature of deprivation as well as the various roles of these dimensions over the life course.

  8. Genome-wide methylation analysis identifies a core set of hypermethylated genes in CIMP-H colorectal cancer.

    PubMed

    McInnes, Tyler; Zou, Donghui; Rao, Dasari S; Munro, Francesca M; Phillips, Vicky L; McCall, John L; Black, Michael A; Reeve, Anthony E; Guilford, Parry J

    2017-03-28

    Aberrant DNA methylation profiles are a characteristic of all known cancer types, epitomized by the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Hypermethylation has been observed at CpG islands throughout the genome, but it is unclear which factors determine whether an individual island becomes methylated in cancer. DNA methylation in CRC was analysed using the Illumina HumanMethylation450K array. Differentially methylated loci were identified using Significance Analysis of Microarrays (SAM) and the Wilcoxon Signed Rank (WSR) test. Unsupervised hierarchical clustering was used to identify methylation subtypes in CRC. In this study we characterized the DNA methylation profiles of 94 CRC tissues and their matched normal counterparts. Consistent with previous studies, unsupervized hierarchical clustering of genome-wide methylation data identified three subtypes within the tumour samples, designated CIMP-H, CIMP-L and CIMP-N, that showed high, low and very low methylation levels, respectively. Differential methylation between normal and tumour samples was analysed at the individual CpG level, and at the gene level. The distribution of hypermethylation in CIMP-N tumours showed high inter-tumour variability and appeared to be highly stochastic in nature, whereas CIMP-H tumours exhibited consistent hypermethylation at a subset of genes, in addition to a highly variable background of hypermethylated genes. EYA4, TFPI2 and TLX1 were hypermethylated in more than 90% of all tumours examined. One-hundred thirty-two genes were hypermethylated in 100% of CIMP-H tumours studied and these were highly enriched for functions relating to skeletal system development (Bonferroni adjusted p value =2.88E-15), segment specification (adjusted p value =9.62E-11), embryonic development (adjusted p value =1.52E-04), mesoderm development (adjusted p value =1.14E-20), and ectoderm development (adjusted p value =7.94E-16). Our genome-wide characterization of DNA methylation in colorectal cancer has identified 132 genes hypermethylated in 100% of CIMP-H samples. Three genes, EYA4, TLX1 and TFPI2 are hypermethylated in >90% of all tumour samples, regardless of CIMP subtype.

  9. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    PubMed

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  10. Perception, attitude, and satisfaction of paediatric physicians and nurses towards clinical practice guidelines at a university teaching hospital.

    PubMed

    Amer, Yasser Sami; Al Nemri, Abdulrahman; Osman, Mohamed Elfaki; Saeed, Elshazaly; Assiri, Asaad Mohamed; Mohamed, Sarar

    2018-04-03

    To explore perception, attitude, and satisfaction of paediatric clinicians, trainees, and nurses at King Khalid University Hospital towards clinical practice guidelines (CPGs) including the locally adapted diabetic ketoacidosis CPG (DKA-CPG). A cross-sectional survey was distributed to 260 doctors and nurses working in the paediatrics department. The response rate was 95.4%. The respondents had a positive perception and attitude towards general CPGs and specifically for the DKA-CPG; 98.7% thought CPGs were useful sources of advice, improved safety, and decreased risk, and reduced variation in practice. A total of 99.2% thought CPGs were good clinical tools, 98.3% satisfied with, had confidence in well-developed CPGs, and would recommend them to their colleagues to use, and 94.6% agreed they were cost-effective. The preferred format for CPGs was paper (46.6%) and electronic (42.9%). The DKA-CPG helped in managing patients and respondents were all satisfied and had confidence with it (100%). The rationale and objectives of the DKA-CPG were clear for 99.25%; 98.5% thought the layout was clear and well organized and user-friendly (96.2%). Compared with nurses, physicians had a higher perception towards CPGs in general (P < .05) and the DKA-CPG (P < .05). The paediatric doctors, and nurses have a great perception and satisfaction and positive attitude towards CPGs in general, towards the paediatric diabetic ketoacidosis CPG in particular, which in turn had a positive impact on the acceptability and implementation of the CPGs. These findings could help in sustaining a safe and high-quality health care environment through implementation of evidence-based CPGs. © 2018 John Wiley & Sons, Ltd.

  11. CpG island methylator phenotype-low (CIMP-low) colorectal cancer shows not only few methylated CIMP-high-specific CpG islands, but also low-level methylation at individual loci.

    PubMed

    Kawasaki, Takako; Ohnishi, Mutsuko; Nosho, Katsuhiko; Suemoto, Yuko; Kirkner, Gregory J; Meyerhardt, Jeffrey A; Fuchs, Charles S; Ogino, Shuji

    2008-03-01

    The CpG island methylator phenotype (CIMP or CIMP-high) with widespread promoter methylation is a distinct phenotype in colorectal cancer. However, the concept of CIMP-low with less extensive CpG island methylation is still evolving. Our aim is to examine whether density of methylation in individual CpG islands was different between CIMP-low and CIMP-high tumors. Utilizing MethyLight technology and 889 population-based colorectal cancers, we quantified DNA methylation (methylation index, percentage of methylated reference) at 14 CpG islands, including 8 CIMP-high-specific loci (CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3 and SOCS1). Methylation positivity in each locus was defined as methylation index>4. Low-level methylation (methylation index>0, <20) in each CIMP-high-specific locus was significantly more common in 340 CIMP-low tumors (1/8-5/8 methylation-positive loci) than 133 CIMP-high tumors (> or =6/8 methylation-positive loci) and 416 CIMP-0 tumors (0/8 methylation-positive loci) (P< or =0.002). In the other six loci (CHFR, HIC1, IGFBP3, MGMT, MINT31 and WRN), which were not highly specific for CIMP-high, low-level methylation, was not persistently more prevalent in CIMP-low tumors. In conclusion, compared to CIMP-high and CIMP-0 tumors, CIMP-low colorectal cancers show not only few methylated CIMP-high-specific CpG islands, but also more frequent low-level methylation at individual loci. Our data may provide supporting evidence for a difference in pathogenesis of DNA methylation between CIMP-low and CIMP-high tumors.

  12. [Comparative analysis of methylation profiles in tissues of oral leukoplakia and oral squamous cell carcinoma].

    PubMed

    Fu, J; Su, Y; Liu, Y; Zhang, X Y

    2018-04-09

    Objective: To compare the methylation profiles in tissues of oral leukoplakia (OLK) and oral squamous cell carcinoma (OSCC) with healthy tissues of oral mucosa, in order to identify the role of DNA methylation played in tumorigenesis. Methods: DNA samples extracted from tissues of 4 healthy oral mucosa, 4 OSCC and 4 OLK collected from patients of the Department of Oral Medicine, Capital Medical University School of Stomatology were examined and compared using Methylation 450 Bead Chip. The genes associated with differentially methylated CpG sites were selected for gene ontology (GO) analysis and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment. Results: Multiple differentially methylated CpG sites were identified by using the above mentioned assay. Hypermethylation constitutes 86.18% (23 290/27 025) of methylation changes in OLK and hypomethylation accounts for 13.82% (3 734/27 025) of methylation changes. Both hypermethylated and hypomethylated CpG sites were markedly increased in OSCC tissue compared with OLK tissue. The majority of differentially methylated CpG sites were located outside CpG islands, with approximately one-fourth in CpG shores flanking the islands, which were considered highly important for gene regulation and tumorigenesis. Pathway analysis revealed that differentially methylated CpG sites in both OLK and OSCC patients shared the same pathway enrichments, most of which were correlated with carcinogenesis and cancer progression (e.g., DNA repair, cell cycle, and apoptosis). Conclusions: In the present study, methylation-associated alterations affect almost all pathways in the cellular network in both OLK and OSCC. OLK and OSCC shared similar methylation changes whether in pathways or genes, indicating that epigenetically they might have the same molecular basis for disease progression.

  13. The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

    PubMed Central

    Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

    2006-01-01

    In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

  14. Intraperitoneal prophylaxis with CpG oligodeoxynucleotides protects neutropenic mice against intracerebral Escherichia coli K1 infection.

    PubMed

    Ribes, Sandra; Meister, Tanja; Ott, Martina; Redlich, Sandra; Janova, Hana; Hanisch, Uwe-Karsten; Nessler, Stefan; Nau, Roland

    2014-01-23

    Prophylaxis with unmethylated cytosine phosphate guanidine (CpG) oligodeoxynucleotides (ODN) protects against several systemic experimental infections. Escherichia coli is a major cause of Gram-negative neonatal bacterial meningitis and also causes meningitis and meningoencephalitis in older and immunocompromised patients. Wild-type (wt) and Toll-like receptor 9 (TLR9)-deficient mice were rendered neutropenic by intraperitoneal administration of the anti-Ly-6G monoclonal antibody. Immunocompetent and neutropenic mice received intraperitoneal CpG ODN or vehicle 72 h prior to induction of E. coli K1 meningoencephalitis. Pre-treatment with CpG ODN significantly increased survival of neutropenic wt mice from 33% to 75% (P = 0.0003) but did not protect neutropenic TLR9-/- mice. The protective effect of CpG ODN was associated with an enhanced production of interleukin (IL)-12/IL-23p40 with sustained increased levels in serum and spleen at least for 17 days after conditioning compared to buffer-treated animals. CpG-treated neutropenic wt mice showed reduced bacterial concentrations and increased recruitment of Ly6ChighCCR2+ monocytes in brain and spleen 42 h after infection. The levels of macrophage inflammatory protein 1α (MIP-1α) and interferon gamma (IFN-γ) in spleen were higher 42 h after infection in CpG-treated compared to buffer-treated neutropenic animals. In immunocompetent mice, prophylaxis with CpG ODN did not significantly increase survival compared to the buffer group (60% vs. 45%, P = 0.2). These findings suggest that systemic administration of CpG ODN may help to prevent bacterial CNS infections in immunocompromised individuals.

  15. Multi-step aberrant CpG island hyper-methylation is associated with the progression of adult T-cell leukemia/lymphoma.

    PubMed

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers.

  16. Multi-Step Aberrant CpG Island Hyper-Methylation Is Associated with the Progression of Adult T–Cell Leukemia/Lymphoma

    PubMed Central

    Sato, Hiaki; Oka, Takashi; Shinnou, Yoko; Kondo, Takami; Washio, Kana; Takano, Masayuki; Takata, Katsuyoshi; Morito, Toshiaki; Huang, Xingang; Tamura, Maiko; Kitamura, Yuta; Ohara, Nobuya; Ouchida, Mamoru; Ohshima, Koichi; Shimizu, Kenji; Tanimoto, Mitsune; Takahashi, Kiyoshi; Matsuoka, Masao; Utsunomiya, Atae; Yoshino, Tadashi

    2010-01-01

    Aberrant CpG island methylation contributes to the pathogenesis of various malignancies. However, little is known about the association of epigenetic abnormalities with multistep tumorigenic events in adult T cell leukemia/lymphoma (ATLL). To determine whether epigenetic abnormalities induce the progression of ATLL, we analyzed the methylation profiles of the SHP1, p15, p16, p73, HCAD, DAPK, hMLH-1, and MGMT genes by methylation specific PCR assay in 65 cases with ATLL patients. The number of CpG island methylated genes increased with disease progression and aberrant hypermethylation in specific genes was detected even in HTLV-1 carriers and correlated with progression to ATLL. The CpG island methylator phenotype (CIMP) was observed most frequently in lymphoma type ATLL and was also closely associated with the progression and crisis of ATLL. The high number of methylated genes and increase of CIMP incidence were shown to be unfavorable prognostic factors and correlated with a shorter overall survival by Kaplan-Meyer analysis. The present findings strongly suggest that the multistep accumulation of aberrant CpG methylation in specific target genes and the presence of CIMP are deeply involved in the crisis, progression, and prognosis of ATLL, as well as indicate the value of CpG methylation and CIMP for new diagnostic and prognostic biomarkers. PMID:20019193

  17. Immunostimulatory CpG on Carbon Nanotubes Selectively Inhibits Migration of Brain Tumor Cells.

    PubMed

    Alizadeh, Darya; White, Ethan E; Sanchez, Teresa C; Liu, Shunan; Zhang, Leying; Badie, Behnam; Berlin, Jacob M

    2018-05-16

    Even when treated with aggressive current therapies, patients with glioblastoma usually survive less than two years and exhibit a high rate of recurrence. CpG is an oligonucleotide that activates the innate immune system via Toll-like receptor 9 (TLR9) activation. Injection of CpG into glioblastoma tumors showed promise as an immunotherapy in mouse models but proved disappointing in human trials. One aspect of glioma that is not addressed by CpG therapy alone is the highly invasive nature of glioma cells, which is associated with resistance to radiation and chemotherapy. Here, we demonstrate that single-walled carbon nanotubes noncovalently functionalized with CpG (SWNT/CpG), which retain the immunostimulatory property of the CpG, selectively inhibit the migration of glioma cells and not macrophages without affecting cell viability or proliferation. SWNT/CpG also selectively decreased NF-κB activation in glioma cells, while activating macrophages by induction of the TLR9/NF-κB pathway, as we have previously reported. The migration inhibition of glioma cells was correlated with selective reduction of intracellular levels of reactive oxygen species (ROS), suggesting that an antioxidant-based mechanism mediates the observed effects. To the best of our knowledge, SWNT/CpG is the first nanomaterial that inhibits the migration of cancer cells while stimulating the immune system.

  18. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer.

    PubMed

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-07-25

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach.

  19. Survival differences of CIMP subtypes integrated with CNA information in human breast cancer

    PubMed Central

    Wang, Huihan; Yan, Weili; Zhang, Shumei; Gu, Yue; Wang, Yihan; Wei, Yanjun; Liu, Hongbo; Wang, Fang; Wu, Qiong; Zhang, Yan

    2017-01-01

    CpG island methylator phenotype of breast cancer is associated with widespread aberrant methylation at specified CpG islands and distinct patient outcomes. However, the influence of copy number contributing to the prognosis of tumors with different CpG island methylator phenotypes is still unclear. We analyzed both genetic (copy number) and epigenetic alterations in 765 breast cancers from The Cancer Genome Atlas data portal and got a panel of 15 biomarkers for copy number and methylation status evaluation. The gene panel identified two groups corresponding to distinct copy number profiles. In status of mere-loss copy number, patients were faced with a greater risk if they presented a higher CpG islands methylation pattern in biomarker panels. But for samples presenting merely-gained copy number, higher methylation level of CpG islands was associated with improved viability. In all, the integration of copy number alteration and methylation information enhanced the classification power on prognosis. Moreover, we found the molecular subtypes of breast cancer presented different distributions in two CpG island methylation phenotypes. Generated by the same set of human methylation 450K data, additional copy number information could provide insights into survival prediction of cancers with less heterogeneity and might help to determine the biomarkers for diagnosis and treatment for breast cancer patients in a more personalized approach. PMID:28415743

  20. DNA Methylation of T1R1 Gene in the Vegetarian Adaptation of Grass Carp Ctenopharyngodon idella.

    PubMed

    Cai, Wenjing; He, Shan; Liang, Xu-Fang; Yuan, Xiaochen

    2018-05-02

    Although previous studies have indicated importance of taste receptors in food habits formation in mammals, little is known about those in fish. Grass carp is an excellent model for studying vegetarian adaptation, as it shows food habit transition from carnivore to herbivore. In the present study, pseudogenization or frameshift mutations of the umami receptors that hypothesized related to dietary switch in vertebrates, were not found in grass carp, suggesting other mechanisms for vegetarian adaptation in grass carp. T1R1 and T1R3 strongly responded to L-Arg and L-Lys, differing from those of zebrafish and medaka, contributing to high species specificity in amino acid preferences and diet selection of grass carp. After food habit transition of grass carp, DNA methylation levels were higher in CPG1 and CPG3 islands of upstream control region of T1R1 gene. Luciferase activity assay of upstream regulatory region of T1R1 (-2500-0 bp) without CPG1 or CPG3 indicated that CPG1 and CPG3 might be involved in transcriptional regulation of T1R1 gene. Subsequently, high DNA methylation decreased expression of T1R1 in intestinal tract. It could be a new mechanism to explain, at least partially, the vegetarian adaptation of grass carp by regulation of expression of umami receptor via epigenetic modification.

  1. A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN–based vaginal microbicide

    PubMed Central

    Shen, Hong; Iwasaki, Akiko

    2006-01-01

    Topical microbicides represent a promising new approach to preventing HIV and other sexually transmitted infections. TLR agonists are ideal candidates for microbicides, as they trigger a multitude of antiviral genes effective against a broad range of viruses. Although vaginal application of CpG oligodeoxynucleotides (ODNs) and poly I:C has been shown to protect mice from genital herpes infection, the mechanism by which these agents provide protection remains unclear. Here, we show that plasmacytoid DCs (pDCs) are required for CpG ODN–mediated protection against lethal vaginal challenge with herpes simplex virus type 2 (HSV-2). Moreover, we demonstrate that cells of both the hematopoietic and stromal compartments must respond to CpG ODN via TLR9 and to type I IFNs through IFN-αβ receptor (IFN-αβR) for protection. Thus, crosstalk between pDCs and vaginal stromal cells provides for optimal microbicide efficacy. Our results imply that temporally and spatially controlled targeting of CpG ODN to pDCs and epithelial cells can potentially maximize their effectiveness as microbicides while minimizing the associated inflammatory responses. PMID:16878177

  2. The contribution of a central pattern generator in a reflex-based neuromuscular model

    PubMed Central

    Dzeladini, Florin; van den Kieboom, Jesse; Ijspeert, Auke

    2014-01-01

    Although the concept of central pattern generators (CPGs) controlling locomotion in vertebrates is widely accepted, the presence of specialized CPGs in human locomotion is still a matter of debate. An interesting numerical model developed in the 90s’ demonstrated the important role CPGs could play in human locomotion, both in terms of stability against perturbations, and in terms of speed control. Recently, a reflex-based neuro-musculo-skeletal model has been proposed, showing a level of stability to perturbations similar to the previous model, without any CPG components. Although exhibiting striking similarities with human gaits, the lack of CPG makes the control of speed/step length in the model difficult. In this paper, we hypothesize that a CPG component will offer a meaningful way of controlling the locomotion speed. After introducing the CPG component in the reflex model, and taking advantage of the resulting properties, a simple model for gait modulation is presented. The results highlight the advantages of a CPG as feedforward component in terms of gait modulation. PMID:25018712

  3. Whole-genome fingerprint of the DNA methylome during human B cell differentiation.

    PubMed

    Kulis, Marta; Merkel, Angelika; Heath, Simon; Queirós, Ana C; Schuyler, Ronald P; Castellano, Giancarlo; Beekman, Renée; Raineri, Emanuele; Esteve, Anna; Clot, Guillem; Verdaguer-Dot, Néria; Duran-Ferrer, Martí; Russiñol, Nuria; Vilarrasa-Blasi, Roser; Ecker, Simone; Pancaldi, Vera; Rico, Daniel; Agueda, Lidia; Blanc, Julie; Richardson, David; Clarke, Laura; Datta, Avik; Pascual, Marien; Agirre, Xabier; Prosper, Felipe; Alignani, Diego; Paiva, Bruno; Caron, Gersende; Fest, Thierry; Muench, Marcus O; Fomin, Marina E; Lee, Seung-Tae; Wiemels, Joseph L; Valencia, Alfonso; Gut, Marta; Flicek, Paul; Stunnenberg, Hendrik G; Siebert, Reiner; Küppers, Ralf; Gut, Ivo G; Campo, Elías; Martín-Subero, José I

    2015-07-01

    We analyzed the DNA methylome of ten subpopulations spanning the entire B cell differentiation program by whole-genome bisulfite sequencing and high-density microarrays. We observed that non-CpG methylation disappeared upon B cell commitment, whereas CpG methylation changed extensively during B cell maturation, showing an accumulative pattern and affecting around 30% of all measured CpG sites. Early differentiation stages mainly displayed enhancer demethylation, which was associated with upregulation of key B cell transcription factors and affected multiple genes involved in B cell biology. Late differentiation stages, in contrast, showed extensive demethylation of heterochromatin and methylation gain at Polycomb-repressed areas, and genes with apparent functional impact in B cells were not affected. This signature, which has previously been linked to aging and cancer, was particularly widespread in mature cells with an extended lifespan. Comparing B cell neoplasms with their normal counterparts, we determined that they frequently acquire methylation changes in regions already undergoing dynamic methylation during normal B cell differentiation.

  4. Association of the Colorectal CpG Island Methylator Phenotype with molecular features, risk factors and family history

    PubMed Central

    Long, Tiffany I.; Buchanan, Daniel D.; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D.; Stern, Mariana C.; LeMarchand, Loic; Lindor, Noralane M.; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A.; Campbell, Peter T.; Casey, Graham; Ahnen, Dennis J.; Baron, John A.; Haile, Robert W.; Hopper, John L.; Young, Joanne P.; Laird, Peter W.; Siegmund, Kimberly D.

    2015-01-01

    Background The CpG Island Methylator Phenotype (CIMP) represents a subset of colorectal cancers (CRCs) characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. Methods We measured the CIMP status of 3,119 primary population-based CRC tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of CRC cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). Results We found associations between tumor CIMP status and MSI-H (ccOR=7.6), BRAF V600E mutation (ccOR=59.8), proximal tumor site (ccOR=9) (all p<0.0001), female sex (ccOR=1.8; 95% CI=1.5-2.1), older age (ccOR=4.0 comparing over 70 years vs under 50; 95% CI=3.0-5.5) and family history of CRC (ccOR=0.6, 95% CI=0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (p=0.0001 and p=0.02, respectively), use of multi-vitamin or calcium supplements did not. Only for female CRCs was CIMP status associated with increased pack-years of smoking (trend p < 0.001) and body mass index (BMI) (trend p = 0.03). Conclusions The frequency of several CRC risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Impact Differences in the associations of a unique DNA methylation-based subgroup of CRC with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of CRCs. PMID:25587051

  5. Association of the colorectal CpG island methylator phenotype with molecular features, risk factors, and family history.

    PubMed

    Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D

    2015-03-01

    The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P < 0.0001), female sex [ccOR = 1.8; 95% confidence interval (CI), 1.5-2.1], older age (ccOR = 4.0 comparing over 70 years vs. under 50; 95% CI, 3.0-5.5), and family history of CRC (ccOR = 0.6; 95% CI, 0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend < 0.001) and body mass index (BMI; Ptrend = 0.03). The frequency of several colorectal cancer risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.

  6. Correlation of pathologic features with CpG island methylator phenotype (CIMP) by quantitative DNA methylation analysis in colorectal carcinoma.

    PubMed

    Ogino, Shuji; Odze, Robert D; Kawasaki, Takako; Brahmandam, Mohan; Kirkner, Gregory J; Laird, Peter W; Loda, Massimo; Fuchs, Charles S

    2006-09-01

    Extensive gene promoter methylation in colorectal carcinoma has been termed the CpG island methylator phenotype (CIMP). Previous studies on CIMP used primarily methylation-specific polymerase chain reaction (PCR), which, unfortunately, may detect low levels of methylation that has little or no biological significance. Utilizing quantitative real-time PCR (MethyLight), we measured DNA methylation in a panel of 5 CIMP-specific gene promoters (CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 459 colorectal carcinomas obtained from 2 large prospective cohort studies. CIMP was defined as tumors that showed methylation in >or=4/5 promoters. CIMP was significantly associated with the presence of mucinous or signet ring cell morphology, marked Crohn's-like lymphoid reaction, tumor infiltrating lymphocytes, marked peritumoral lymphocytic reaction, tumor necrosis, tumor cell sheeting, and poor differentiation. All these features have previously been associated with microsatellite instability (MSI). Therefore, we divided the 459 colorectal carcinomas into 6 subtypes, namely, MSI-high (MSI-H)/CIMP, MSI-H/non-CIMP, MSI-low (MSI-L)/CIMP, MSI-L/non-CIMP, microsatellite stable/CIMP, and micro satellite sstable/non-CIMP. Compared with MSI-H/non-CIMP, MSI-H/CIMP was associated with marked tumor infiltrating lymphocytes, tumor necrosis, sheeting, and poor differentiation (all P

  7. A varying T cell subtype explains apparent tobacco smoking induced single CpG hypomethylation in whole blood.

    PubMed

    Bauer, Mario; Linsel, Gunter; Fink, Beate; Offenberg, Kirsten; Hahn, Anne Maria; Sack, Ulrich; Knaack, Heike; Eszlinger, Markus; Herberth, Gunda

    2015-01-01

    Many recent epigenetic studies report that cigarette smoking reduces DNA methylation in whole blood at the single CpG site cg19859270 within the GPR15 gene. Within two independent cohorts, we confirmed the differentially expression of the GPR15 gene when smokers and non-smokers subjects are compared. By validating the GPR15 protein expression at the cellular level, we found that the observed decreased methylation at this site in white blood cells (WBC) of smokers is mainly caused by the high proportion of CD3+GPR15+ expressing T cells in peripheral blood. In current smokers, the percentage of GPR15+ cells among CD3+ T cells in peripheral blood is significantly higher (15.5 ± 7.2 %, mean ± standard deviation) compared to non-smokers (3.7 ± 1.6 %). Treatment of peripheral blood mononuclear cell (PBMC) cultures with aqueous cigarette smoke extract did not induce a higher proportion of this T cell subtype. Our results underline that DNA hypomethylation at cg19859270 site, observed in WBCs of smokers, did not arise by direct effect of tobacco smoking compounds on methylation of DNA but rather by the enrichment of a tobacco-smoking-induced lymphocyte population in the peripheral blood.

  8. Global Epigenetic Changes May Underlie Ethnic Differences and susceptibility to Prostate Cancer

    DTIC Science & Technology

    2012-09-01

    tissues; in the prostate, hypermethylation of the GSTP1 CpG has been detected in PIA lesions [8]. DNA methylation occurs at CpG sites in the human...that the GSTP1 CpG island was frequently hypermethylated in PCa, more than 40 genes have been reported to be targets of DNA hypermethylation-associated...One study demonstrated that GSTP1 hypermethylation was significantly higher in PCa samples from AA men in comparison with EA and Asians [12]. Another

  9. Experimental murine myopia induces collagen type Iα1 (COL1A1) DNA methylation and altered COL1A1 messenger RNA expression in sclera

    PubMed Central

    Zhou, Xiangtian; Ji, Fengtao; An, Jianhong; Zhao, Fuxin; Shi, Fanjun; Huang, Furong; Li, Yuan; Jiao, Shiming; Yan, Dongsheng; Chen, Xiaoyan; Chen, JiangFan

    2012-01-01

    Purpose To investigate whether myopia development is associated with changes of scleral DNA methylation in cytosine-phosphate-guanine (CpG) sites in the collagen 1A1 (COL1A1) promoter and messenger RNA (mRNA) levels following murine form deprivation myopia. Methods Fifty-seven C57BL/6 mice (postnatal day 23) were randomly assigned to four groups: (1) monocular form deprivation (MD) in which a diffuser lens was placed over one eye for 28 days; (2) normal controls without MD; (3) MD recovery in which the diffuser lens was removed for seven days; and (4) MD recovery normal controls. The DNA methylation pattern in COL1A1 promoter and exon 1 was determined by bisulfite DNA sequencing, and the COL1A1 mRNA level in sclera was determined by quantitative PCR. Results MD was found to induce myopia in the treated eyes. Six CpG sites in the promoter and exon 1 region of COL1A1 were methylated with significantly higher frequency in the treated eyes than normal control eyes (p<0.05), with CpG island methylation in MD-contralateral eyes being intermediate. Consistent with the CpG methylation, scleral COL1A1 mRNA was reduced by 57% in the MD-treated eyes compared to normal controls (p<0.05). After seven days of MD recovery, CpG methylation was significantly reduced (p=0.01). The methylation patterns returned to near normal level in five CpG sites, but the sixth was hypomethylated compared to normal controls. Conclusions In parallel with the development of myopia and the reduced COL1A1 mRNA, the frequency of methylation in CpG sites of the COL1A1 promoter/exon 1 increased during MD and returned to near normal during recovery. Thus, hypermethylation of CpG sites in the promoter/exon 1 of COL1A1 may underlie reduced collagen synthesis at the transcriptional level in myopic scleras. PMID:22690110

  10. Primary care clinical practice guidelines in South Africa: qualitative study exploring perspectives of national stakeholders.

    PubMed

    Kredo, Tamara; Abrams, Amber; Young, Taryn; Louw, Quinette; Volmink, Jimmy; Daniels, Karen

    2017-08-29

    Clinical practice guidelines (CPGs) are common tools in policy and clinical practice informing clinical decisions at the bedside, governance of health facilities, health insurer and government spending, and patient choices. South Africa's health sector is transitioning to a national health insurance system, aiming to build on other primary health care initiatives to transform the previously segregated, inequitable services. Within these plans CPGs are an integral tool for delivering standardised and cost effective care. Currently, there is no accepted standard approach to developing, adapting or implementing CPGs efficiently or effectively in South Africa. We explored the current players; drivers; and the context and processes of primary care CPG development from the perspective of stakeholders operating at national level. We used a qualitative approach. Sampling was initially purposeful, followed by snowballing and further sampling to reach representivity of primary care service providers. Individual in-depth interviews were recorded and transcribed verbatim. We used thematic content analysis to analyse the data. We conducted 37 in-depth interviews from June 2014-July 2015. We found CPG development and implementation were hampered by lack of human and funding resources for technical and methodological work; fragmentation between groups, and between national and provincial health sectors; and lack of agreed systems for CPG development and implementation. Some CPG contributors steadfastly work to improve processes aiming to enhance communication, use of evidence, and transparency to ensure credible guidance is produced. Many interviewed had shared values, and were driven to address inequity, however, resource gaps were perceived to create an enabling environment for commercial interests or personal agendas to drive the CPG development process. Our findings identified strengths and gaps in CPG development processes, and a need for national standards to guide CPG development and implementation. Based on our findings and suggestions from participants, a possible way forward would be for South Africa to have a centrally coordinated CPG unit to address these needs and aspects of fragmentation by devising processes that support collaboration, transparency and credibility across sectors and disciplines. Such an initiative will require adequate resourcing to build capacity and ensure support for the delivery of high quality CPGs for South African primary care.

  11. Hydrocarbon pyrolysis reactor experimentation and modeling for the production of solar absorbing carbon nanoparticles

    NASA Astrophysics Data System (ADS)

    Frederickson, Lee Thomas

    Much of combustion research focuses on reducing soot particulates in emissions. However, current research at San Diego State University (SDSU) Combustion and Solar Energy Laboratory (CSEL) is underway to develop a high temperature solar receiver which will utilize carbon nanoparticles as a solar absorption medium. To produce carbon nanoparticles for the small particle heat exchange receiver (SPHER), a lab-scale carbon particle generator (CPG) has been built and tested. The CPG is a heated ceramic tube reactor with a set point wall temperature of 1100-1300°C operating at 5-6 bar pressure. Natural gas and nitrogen are fed to the CPG where natural gas undergoes pyrolysis resulting in carbon particles. The gas-particle mixture is met downstream with dilution air and sent to the lab scale solar receiver. To predict soot yield and general trends in CPG performance, a model has been setup in Reaction Design CHEMKIN-PRO software. One of the primary goals of this research is to accurately measure particle properties. Mean particle diameter, size distribution, and index of refraction are calculated using Scanning Electron Microscopy (SEM) and a Diesel Particulate Scatterometer (DPS). Filter samples taken during experimentation are analyzed to obtain a particle size distribution with SEM images processed in ImageJ software. These results are compared with the DPS, which calculates the particle size distribution and the index of refraction from light scattering using Mie theory. For testing with the lab scale receiver, a particle diameter range of 200-500 nm is desired. Test conditions are varied to understand effects of operating parameters on particle size and the ability to obtain the size range. Analysis of particle loading is the other important metric for this research. Particle loading is measured downstream of the CPG outlet and dilution air mixing point. The air-particle mixture flows through an extinction tube where opacity of the mixture is measured with a 532 nm laser and detector. Beer's law is then used to calculate particle loading. The CPG needs to produce a certain particle loading for a corresponding receiver test. By obtaining the particle loading in the system, the reaction conversion to solid carbon in the CPG can be calculated to measure the efficiency of the CPG. To predict trends in reaction conversion and particle size from experimentation, the CHEMKIN-PRO computer model for the CPG is run for various flow rates and wall temperature profiles. These predictions were a reason for testing at higher wall set point temperatures. Based on these research goals, it was shown that the CPG consistently produces a mean particle diameter of 200-400 nm at the conditions tested, fitting perfectly inside the desired range. This led to successful lab scale SPHER testing which produced a 10-point efficiency increase and 150°C temperature difference with particles present. Also, at 3 g/s dilution air flow rate, an efficiency of 80% at an outlet temperature above 800°C was obtained. Promise was shown at higher CPG experimental temperatures to produce higher reaction conversion, both experimentally and in the model. However, based on wall temperature data taken during experimentation, it is apparent that the CPG needs to have multiple heating zones with separate temperature controllers in order to have an isothermal zone rather than a parabolic temperature profile. As for the computer model, it predicted much higher reaction conversion at higher temperature. The mass fraction of fuel in the inlet stream was shown to not affect conversion while increasing residence time led to increasing conversion. Particle size distribution in the model was far off and showed a bimodal distribution for one of the statistical methods. Using the results from experimentation and modeling, a preliminary CPG design is presented that will operate in a 5MWth receiver system.

  12. Methylation variable position profiles of hMLH1 promoter CpG islands in human sporadic colorectal carcinoma.

    PubMed

    Huang, Qing; Huang, Jun-Fu; Zhang, Bo; Baum, Larry; Fu, Wei-Ling

    2012-03-01

    Aberrant hypermethylation of CpG islands (CGIs) in hMLH1 promoter regions has been well known to play an important role in the tumorigenesis of human sporadic colorectal carcinoma (SCRC). In this study, bisulfite sequencing was performed to analyze the methylation variable positions (MVPs) profiles of hMLH1 promoter CGIs in 30 clinical SCRC patients, and further analysis was carried out to evaluate the associations between the CGI methylation and the clinicopathological features in SCRC. Among the 2 CGIs in the hMLH1 promoter, that is, CGI-I and CGI-II, 20% (6/30) and 13% (4/30) of the patients had methylated CGI-I and CGI-II, respectively. Suppressed expression of hMLH1was significantly correlated with methylation of CGI-I but not CGI-II. Further analysis of the MVP profiles of CGI-I showed that most of the MVPs were hypermethylated and others were poorly methylated or unmethylated. The profiles could be classified into at least 4 groups based on the methylation status of 3 MVPs at positions 21 to 23 in CGI-I. All 6 patients with methylated CGI-I belonged to group I. This result suggests that the above 3 MVPs in CGI-I should be a targeted region to further analyze the epigenetic features of hMLH1 in human SCRC. Our results further suggest that MVP profiling is useful for identifying the aberrantly methylated CGIs associated with suppressed gene expression.

  13. Enlarged leukocyte referent libraries can explain additional variance in blood-based epigenome-wide association studies.

    PubMed

    Kim, Stephanie; Eliot, Melissa; Koestler, Devin C; Houseman, Eugene A; Wetmur, James G; Wiencke, John K; Kelsey, Karl T

    2016-09-01

    We examined whether variation in blood-based epigenome-wide association studies could be more completely explained by augmenting existing reference DNA methylation libraries. We compared existing and enhanced libraries in predicting variability in three publicly available 450K methylation datasets that collected whole-blood samples. Models were fit separately to each CpG site and used to estimate the additional variability when adjustments for cell composition were made with each library. Calculation of the mean difference in the CpG-specific residual sums of squares error between models for an arthritis, aging and metabolic syndrome dataset, indicated that an enhanced library explained significantly more variation across all three datasets (p < 10(-3)). Pathologically important immune cell subtypes can explain important variability in epigenome-wide association studies done in blood.

  14. Year 2000 (Y2K) computer compliance guide; guidance for FDA personnel. Food and Drug Administration. Notice.

    PubMed

    1999-05-14

    The Food and Drug Administration (FDA) is announcing the availability of a new compliance policy guide (CPG) entitled "Year 2000 (Y2K) Computer Compliance" (section 160-800). This guidance document represents the agency's current thinking on the manufacturing and distribution of domestic and imported products regulated by FDA using computer systems that may not perform properly before, or during, the transition to the year 2000 (Y2K). The text of the CPG is included in this notice. This compliance guidance document is an update to the Compliance Policy Guides Manual (August 1996 edition). It is a new CPG, and it will be included in the next printing of the Compliance Policy Guides Manual. This CPG is intended for FDA personnel, and it is available electronically to the public.

  15. CPG-inspired workspace trajectory generation and adaptive locomotion control for quadruped robots.

    PubMed

    Liu, Chengju; Chen, Qijun; Wang, Danwei

    2011-06-01

    This paper deals with the locomotion control of quadruped robots inspired by the biological concept of central pattern generator (CPG). A control architecture is proposed with a 3-D workspace trajectory generator and a motion engine. The workspace trajectory generator generates adaptive workspace trajectories based on CPGs, and the motion engine realizes joint motion imputes. The proposed architecture is able to generate adaptive workspace trajectories online by tuning the parameters of the CPG network to adapt to various terrains. With feedback information, a quadruped robot can walk through various terrains with adaptive joint control signals. A quadruped platform AIBO is used to validate the proposed locomotion control system. The experimental results confirm the effectiveness of the proposed control architecture. A comparison by experiments shows the superiority of the proposed method against the traditional CPG-joint-space control method.

  16. CPG2 Recruits Endophilin B2 to the Cytoskeleton for Activity-Dependent Endocytosis of Synaptic Glutamate Receptors.

    PubMed

    Loebrich, Sven; Benoit, Marc Robert; Konopka, Jaclyn Aleksandra; Cottrell, Jeffrey Richard; Gibson, Joanne; Nedivi, Elly

    2016-02-08

    Internalization of glutamate receptors at the postsynaptic membrane via clathrin-mediated endocytosis (CME) is a key mechanism for regulating synaptic strength. A role for the F-actin cytoskeleton in CME is well established, and recently, PKA-dependent association of candidate plasticity gene 2 (CPG2) with the spine-cytoskeleton has been shown to mediate synaptic glutamate receptor internalization. Yet, how the endocytic machinery is physically coupled to the actin cytoskeleton to facilitate glutamate receptor internalization has not been demonstrated. Moreover, there has been no distinction of endocytic-machinery components that are specific to activity-dependent versus constitutive glutamate receptor internalization. Here, we show that CPG2, through a direct physical interaction, recruits endophilin B2 (EndoB2) to F-actin, thus anchoring the endocytic machinery to the spine cytoskeleton and facilitating glutamate receptor internalization. Regulation of CPG2 binding to the actin cytoskeleton by protein kinase A directly impacts recruitment of EndoB2 and clathrin. Specific disruption of EndoB2 or the CPG2-EndoB2 interaction impairs activity-dependent, but not constitutive, internalization of both NMDA- and AMPA-type glutamate receptors. These results demonstrate that, through direct interactions with F-actin and EndoB2, CPG2 physically bridges the spine cytoskeleton and the endocytic machinery, and this tripartite association is critical specifically for activity-dependent CME of synaptic glutamate receptors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

    PubMed Central

    Pangeson, Tanapat; Sanguansermsri, Phanchana; Sanguansermsri, Torpong; Seeratanachot, Teerapat; Suwanakhon, Narutchala; Srikummool, Metawee; Kaewkong, Worasak; Mahingsa, Khwanruedee

    2017-01-01

    In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA) deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA. PMID:29162979

  18. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro

    PubMed Central

    2013-01-01

    Background CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. Results We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Conclusions Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics. PMID:24106769

  19. The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice.

    PubMed

    Dang, Duy-Khanh; Shin, Eun-Joo; Tran, Hai-Quyen; Kim, Dae-Joong; Jeong, Ji Hoon; Jang, Choon-Gon; Nah, Seung-Yeol; Sato, Hideyo; Nabeshima, Toshitaka; Yoneda, Yukio; Kim, Hyoung-Chun

    2017-09-01

    The cystine/glutamate antiporter (system Xc - , Sxc) transports cystine into cell in exchange for glutamate. Since xCT is a specific subunit of Sxc, we employed xCT knockout mice and investigated whether this antiporter affected methamphetamine (MA)-induced dopaminergic neurotoxicity. MA treatment significantly increased striatal oxidative burdens in wild type mice. xCT inhibitor [i.e., S-4-carboxy-phenylglycine (CPG), sulfasalazine] or an xCT knockout significantly protected against these oxidative burdens. MA-induced increases in Iba-1 expression and Iba-1-labeled microglial immunoreactivity (Iba-1-IR) were significantly attenuated by CPG or sulfasalazine administration or xCT knockout. CPG or sulfasalazine significantly attenuated MA-induced TUNEL-positive cell populations in the striatum of Taconic ICR mice. The decrease in excitatory amino acid transporter-2 (or glutamate transporter-1) expression and increase in glutamate release were attenuated by CPG, sulfasalazine or xCT knockout. In addition, CPG, sulfasalazine or xCT knockout significantly protected against dopaminergic loss (i.e., decreases in tyrosine hydroxylase expression and immunoreactivity, and an increase in dopamine turnover rate) induced by MA. However, CPG, sulfasalazine or xCT knockout did not significantly affect the impaired glutathione system [i.e., decrease in reduced glutathione (GSH) and increase in oxidized glutathione (GSSG)] induced by MA. Our results suggest that Sxc mediates MA-induced neurotoxicity via facilitating oxidative stress, microgliosis, proapoptosis, and glutamate-related toxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. A Systematic Review and Appraisal of Clinical Practice Guidelines for Musculoskeletal Soft Tissue Injuries and Conditions.

    PubMed

    Pincus, Daniel; Kuhn, John E; Sheth, Ujash; Rizzone, Katie; Colbenson, Kristi; Dwyer, Tim; Karpinos, Ashley; Marks, Paul H; Wasserstein, David

    2017-05-01

    Clinical practice guidelines (CPGs) are published by several sports medicine institutions. A systematic evaluation can help identify the highest quality CPGs for clinical use and identify any deficiencies that remain. To identify and appraise CPGs relevant to clinical sports medicine professionals. Systematic review. Predetermined selection criteria were utilized by 2 reviewers who independently identified published CPGs before January 1, 2014. CPGs were excluded if they focused on injured workers, radiological criteria, medical pathology, or the axial skeleton (back/neck). The remaining guidelines were scored by 6 reviewers with different clinical backgrounds using the Appraisal of Guidelines for Research and Evaluation II (AGREE II). Scores lower than 50% indicated deficiency. Scores were also stratified by the publishing institution and anatomic location and compared using Kruskal-Wallis tests. The Spearman correlation coefficient was used to assess the range of interobserver agreement between the evaluators. Seventeen CPGs met the inclusion criteria. The majority of guidelines pertained to the knee, ankle, or shoulder. Interobserver agreement was strong ( r = 0.548-0.740), and mean total scores between nonsurgical (107.8) and surgical evaluators (109.3) were not statistically different. Overall guideline quality was variable but not deficient for 16 of 17 guidelines (>50%), except regarding clinical "applicability" and "editorial independence." No difference was found between CPGs of the knee, shoulder, foot/ankle, or chronic conditions. However, CPG publishing institutions had significantly different scores; the American Academy of Orthopaedic Surgeons (AAOS) guidelines scored significantly higher (141.4) than the total mean score (108.0). The overall quality of sports medicine CPGs was variable but generally not deficient, except regarding applicability and editorial independence. Bias through poor editorial independence is a concern. To improve future guideline quality, authors should pay particular attention to these areas and use existing highest quality guidelines, or the AGREE II instrument, as templates. CPGs dedicated to anatomic areas other than the knee, ankle, and shoulder are needed.

  1. Systematic Review of Clinical Practice Guidelines for Failed Antidepressant Treatment Response in Major Depressive Disorder, Dysthymia, and Subthreshold Depression in Adults.

    PubMed

    MacQueen, Glenda; Santaguida, Pasqualina; Keshavarz, Homa; Jaworska, Natalia; Levine, Mitchell; Beyene, Joseph; Raina, Parminder

    2017-01-01

    This systematic review critically evaluated clinical practice guidelines (CPGs) for treating adults with major depressive disorder, dysthymia, or subthreshold or minor depression for recommendations following inadequate response to first-line treatment with selective serotonin reuptake inhibitors (SSRIs). Searches for CPGs (January 2004 to November 2014) in English included 7 bibliographic databases and grey literature sources using CPG and depression as the keywords. Two raters selected CPGs on depression with a national scope. Data extraction included definitions of adequate response and recommended treatment options. Two raters assessed quality using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) instrument. From 46,908 citations, 3167 were screened at full text. From these 21 CPG were applicable to adults in primary care and outpatient settings. Five CPGs consider patients with dysthymia or subthreshold or minor depression. None provides recommendations for those who do not respond to first-line SSRI treatment. For adults with MDD, most CPGs do not define an "inadequate response" or provide specific suggestions regarding how to choose alternative medications when switching to an alternative antidepressant. There is variability between CPGs in recommending combination strategies. AGREE II ratings for stakeholder involvement in CPG development, editorial independence, and rigor of development are domains in which depression guidelines are often less robust. About half of patients with depression require second-line treatment to achieve remission. Consistency and clarity in guidelines for second-line treatment of depression are therefore important for clinicians but lacking in most current guidelines. This may reflect a paucity of primary studies upon which to base conclusions.

  2. Quantitative DNA Methylation Analysis Identifies a Single CpG Dinucleotide Important for ZAP-70 Expression and Predictive of Prognosis in Chronic Lymphocytic Leukemia

    PubMed Central

    Claus, Rainer; Lucas, David M.; Stilgenbauer, Stephan; Ruppert, Amy S.; Yu, Lianbo; Zucknick, Manuela; Mertens, Daniel; Bühler, Andreas; Oakes, Christopher C.; Larson, Richard A.; Kay, Neil E.; Jelinek, Diane F.; Kipps, Thomas J.; Rassenti, Laura Z.; Gribben, John G.; Döhner, Hartmut; Heerema, Nyla A.; Marcucci, Guido; Plass, Christoph; Byrd, John C.

    2012-01-01

    Purpose Increased ZAP-70 expression predicts poor prognosis in chronic lymphocytic leukemia (CLL). Current methods for accurately measuring ZAP-70 expression are problematic, preventing widespread application of these tests in clinical decision making. We therefore used comprehensive DNA methylation profiling of the ZAP-70 regulatory region to identify sites important for transcriptional control. Patients and Methods High-resolution quantitative DNA methylation analysis of the entire ZAP-70 gene regulatory regions was conducted on 247 samples from patients with CLL from four independent clinical studies. Results Through this comprehensive analysis, we identified a small area in the 5′ regulatory region of ZAP-70 that showed large variability in methylation in CLL samples but was universally methylated in normal B cells. High correlation with mRNA and protein expression, as well as activity in promoter reporter assays, revealed that within this differentially methylated region, a single CpG dinucleotide and neighboring nucleotides are particularly important in ZAP-70 transcriptional regulation. Furthermore, by using clustering approaches, we identified a prognostic role for this site in four independent data sets of patients with CLL using time to treatment, progression-free survival, and overall survival as clinical end points. Conclusion Comprehensive quantitative DNA methylation analysis of the ZAP-70 gene in CLL identified important regions responsible for transcriptional regulation. In addition, loss of methylation at a specific single CpG dinucleotide in the ZAP-70 5′ regulatory sequence is a highly predictive and reproducible biomarker of poor prognosis in this disease. This work demonstrates the feasibility of using quantitative specific ZAP-70 methylation analysis as a relevant clinically applicable prognostic test in CLL. PMID:22564988

  3. Association between folate levels and CpG island hypermethylation in normal colorectal mucosa

    PubMed Central

    Wallace, Kristin; Grau, Maria V.; Levine, Joan A.; Shen, Lanlan; Hamdan, Randala; Chen, Xinli; Gui, Jiang; Haile, Robert W.; Barry, Elizabeth L.; Ahnen, Dennis; McKeown-Eyssen, Gail; Baron, John A.; Issa, Jean Pierre J.

    2010-01-01

    Background Gene-specific promoter methylation of several genes occurs in aging normal tissues and may predispose to tumorigenesis. In the present study, we investigate the association among blood folate levels, and dietary and lifestyle factors with CpG island methylation in normal colorectal mucosa. Methods Subjects were enrolled in a multi-center chemoprevention trial of aspirin or folic acid for the prevention of large bowel adenomas. We collected 1000 biopsies from 389 patients, 501 samples from the right colon and 499 from the rectum at the follow-up colonoscopy. We measured DNA methylation of estrogen receptor alpha (ERα) and secreted frizzled related protein-1 (SFRP1) using bisulfite pyrosequencing. We used Generalized Estimating Equations regression analysis to examine the association between methylation and selected variables. Results For both ERα and SFRP1, percent methylation was significantly higher in the rectum compared to the right colon (p = 0.001). For each 10 years of age, we observed a 1.7 % increase in methylation level for ERα and a 2.9 % increase for SFRP1 (P < 0.0001). African Americans had a significantly lower level of ERα and SFRP1 methylation compared to Caucasians and Hispanics. Higher RBC folate levels were associated with higher levels of both ERα (p=0.03) and SFRP1 methylation (p=0.01). Conclusions Our results suggest that CpG island methylation in normal colorectal mucosa is related to advancing age, race, rectal location, and RBC folate levels. These data have important implications regarding the safety of supplementary folate administration in healthy adults given the hypothesis that methylation in normal mucosa may predispose to colorectal neoplasia. PMID:21149331

  4. Alignment of practice guidelines with targeted-therapy drug funding policies in Ontario.

    PubMed

    Ramjeesingh, R; Meyer, R M; Brouwers, M; Chen, B E; Booth, C M

    2013-02-01

    We evaluated clinical practice guideline (cpg) recommendations from Cancer Care Ontario's Program in Evidence-Based Care (pebc) for molecularly targeted systemic treatments (tts) and subsequent funding decisions from the Ontario Ministry of Health and Long-Term Care. We identified pebc cpgs on tt published before June 1, 2010, and extracted information regarding the key evidence cited in support of cpg recommendations and the effect size associated with each tt. Those variables were compared with mohltc funding decisions as of June 2011. From 23 guidelines related to 17 tts, we identified 43 recommendations, among which 38 (88%) endorsed tt use. Among all the recommendations, 38 (88%) were based on published key evidence, with 82% (31 of 38) being supported by meta-analyses or phase iii trials. For the 38 recommendations endorsing tts, funding was approved in 28 (74%; odds ratio related to cpg recommendation: 29.9; p = 0.003). We were unable to demonstrate that recommendations associated with statistically significant improvements in overall survival [os: 14 of 16 (88%) vs. 8 of 14 (57%); p = 0.10] or disease- (dfs) or progression-free survival [pfs: 16 of 21 (76%) vs. 3 of 5 (60%); p = 0.59] were more likely to be funded than those with no significant difference. Moreover, we did not observe significant associations between funding approvals and absolute improvements of 3 months or more in os [6 of 6 (100%) vs. 3 of 6 (50%), p = 0.18] or pfs [6 of 8 (75%) vs. 10 of 12 (83%), p = 1.00]. For use of tts, most recommendations in pebc cpgs are based on meta-analyses or phase iii data, and funding decisions were strongly associated with those recommendations. Our data suggest a trend toward increased rates of funding for therapies with statistically significant improvements in os.

  5. Evaluation of all African clinical practice guidelines for hypertension: Quality and opportunities for improvement.

    PubMed

    Okwen, Patrick Mbah; Maweu, Irene; Grimmer, Karen; Margarita Dizon, Janine

    2018-06-14

    Good-quality clinical practice guidelines (CPGs) provide recommendations based on current best-evidence summaries. Hypertension is a prevalent noncommunicable disease in Africa, with disastrous sequelae (stroke, heart, and kidney disease). Its effective management relies on good quality, current, locally relevant evidence. This paper reports on an all African review of the guidance documents currently informing hypertension management. Attempts were made to contact 62 African countries for formal guidance documents used nationally to inform diagnosis and management of hypertension. Their quality was assessed by using Appraisal of Guidelines for Research & Evaluation (AGREE) II, scored by 2 independent reviewers. Differences in domain scores were compared between documents written prior to 2011 and 2011 onward. Findings were compared with earlier African CPG reviews. Guidelines and protocols were provided by 26 countries. Six used country-specific stand-alone hypertension guidelines, and 10 used protocols embedded in Standard Treatment Guidelines for multiple conditions. Six used guidelines developed by the World Health Organization, and 4 indicated ad hoc use of international guidance (US, Portugal, and Brazil). Only 1 guidance document met CPG construction criteria, and none scored well on all AGREE domain scores. The lowest-scoring domain was rigour of development. There was no significant quality difference between pre-2011 and post-2011 guidance documents, and there were variable AGREE II scores for the same CPGs when comparing the African reviews. The quality of hypertension guidance used by African nations could be improved. The need for so many guidance documents is questioned. Adopting a common evidence base from international good-quality CPGs and layering it with local contexts offer 1 way to efficiently improve African hypertension CPG quality and implementation. © 2018 John Wiley & Sons, Ltd.

  6. Association between the CpG island methylator phenotype and its prognostic significance in primary pulmonary adenocarcinoma.

    PubMed

    Koh, Young Wha; Chun, Sung-Min; Park, Young-Soo; Song, Joon Seon; Lee, Geon Kook; Khang, Shin Kwang; Jang, Se Jin

    2016-08-01

    Aberrant methylation of promoter CpG islands is one of the most important inactivation mechanisms for tumor suppressor and tumor-related genes. Previous studies using genome-wide DNA methylation microarray analysis have suggested the existence of a CpG island methylator phenotype (CIMP) in lung adenocarcinomas. Although the biological behavior of these tumors varies according to tumor stage, no large-scale study has examined the CIMP in lung adenocarcinoma patients according to tumor stage. Furthermore, there have been no reported results regarding the clinical significance of each of the six CIMP markers. To examine the CIMP in patients with pulmonary adenocarcinoma after a surgical resection, we performed methylation analysis of six genes (CCNA1, ACAN, GFRA1, EDARADD, MGC45800, and p16 (INK4A)) in 230 pulmonary adenocarcinoma cases using the SEQUENOM MassARRAY platform. Fifty-four patients (28 %, 54/191) were in the CIMP-high (CIMP-H) group associated with high nodal stage (P = 0.007), the presence of micropapillary or solid histology (P = 0.003), and the absence of an epidermal growth factor receptor (EGFR) mutation (P = 0.002). By multivariate analysis, CIMP was an independent prognostic marker for overall survival (OS) and disease-specific survival (P = 0.03 and P = 0.43, respectively). In the stage I subgroups alone, CIMP-H patients had lower OS rates than the CIMP-low (CIMP-L) group (P = 0.041). Of the six CIMP markers, ACAN alone was significantly associated with patient survival. CIMP predicted the risk of progression independently of clinicopathological variables and enables the stratification of pulmonary adenocarcinoma patients, particularly among stage I cases.

  7. Systematic Review of Clinical Practice Guidelines for Failed Antidepressant Treatment Response in Major Depressive Disorder, Dysthymia, and Subthreshold Depression in Adults

    PubMed Central

    MacQueen, Glenda; Santaguida, Pasqualina; Keshavarz, Homa; Jaworska, Natalia; Levine, Mitchell; Beyene, Joseph

    2016-01-01

    Objective: This systematic review critically evaluated clinical practice guidelines (CPGs) for treating adults with major depressive disorder, dysthymia, or subthreshold or minor depression for recommendations following inadequate response to first-line treatment with selective serotonin reuptake inhibitors (SSRIs). Method: Searches for CPGs (January 2004 to November 2014) in English included 7 bibliographic databases and grey literature sources using CPG and depression as the keywords. Two raters selected CPGs on depression with a national scope. Data extraction included definitions of adequate response and recommended treatment options. Two raters assessed quality using the Appraisal of Guidelines for Research and Evaluation II (AGREE II) instrument. Results: From 46,908 citations, 3167 were screened at full text. From these 21 CPG were applicable to adults in primary care and outpatient settings. Five CPGs consider patients with dysthymia or subthreshold or minor depression. None provides recommendations for those who do not respond to first-line SSRI treatment. For adults with MDD, most CPGs do not define an “inadequate response” or provide specific suggestions regarding how to choose alternative medications when switching to an alternative antidepressant. There is variability between CPGs in recommending combination strategies. AGREE II ratings for stakeholder involvement in CPG development, editorial independence, and rigor of development are domains in which depression guidelines are often less robust. Conclusions: About half of patients with depression require second-line treatment to achieve remission. Consistency and clarity in guidelines for second-line treatment of depression are therefore important for clinicians but lacking in most current guidelines. This may reflect a paucity of primary studies upon which to base conclusions. PMID:27554483

  8. The association of serotonin receptor 3A methylation with maternal violence exposure, neural activity, and child aggression.

    PubMed

    Schechter, Daniel S; Moser, Dominik A; Pointet, Virginie C; Aue, Tatjana; Stenz, Ludwig; Paoloni-Giacobino, Ariane; Adouan, Wafae; Manini, Aurélia; Suardi, Francesca; Vital, Marylene; Sancho Rossignol, Ana; Cordero, Maria I; Rothenberg, Molly; Ansermet, François; Rusconi Serpa, Sandra; Dayer, Alexandre G

    2017-05-15

    Methylation of the serotonin 3A receptor gene (HTR3A) has been linked to child maltreatment and adult psychopathology. The present study examined whether HTR3A methylation might be associated with mothers' lifetime exposure to interpersonal violence (IPV), IPV-related psychopathology, child disturbance of attachment, and maternal neural activity. Number of maternal lifetime IPV exposures and measures of maternal psychopathology including posttraumatic stress disorder (PTSD), major depression and aggressive behavior (AgB), and a measure of child attachment disturbance known as "secure base distortion" (SBD) were assessed in a sample of 35 mothers and children aged 12-42 months. Brain fMRI activation was assessed in mothers using 30-s silent film excerpts depicting menacing adult male-female interactions versus prosocial and neutral interactions. Group and continuous analyses were performed to test for associations between clinical and fMRI variables with DNA methylation. Maternal IPV exposure-frequency was associated with maternal PTSD; and maternal IPV-PTSD was in turn associated with child SBD. Methylation status of several CpG sites in the HTR3A gene was associated with maternal IPV and IPV-PTSD severity, AgB and child SBD, in particular, self-endangering behavior. Methylation status at a specific CpG site (CpG2_III) was associated with decreased medial prefrontal cortical (mPFC) activity in response to film-stimuli of adult male-female interactions evocative of violence as compared to prosocial and neutral interactions. Methylation status of the HTR3A gene in mothers is linked to maternal IPV-related psychopathology, trauma-induced brain activation patterns, and child attachment disturbance in the form of SBD during a sensitive period in the development of self-regulation. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Developing prehospital clinical practice guidelines for resource limited settings: why re-invent the wheel?

    PubMed

    McCaul, Michael; de Waal, Ben; Hodkinson, Peter; Pigoga, Jennifer L; Young, Taryn; Wallis, Lee A

    2018-02-05

    Methods on developing new (de novo) clinical practice guidelines (CPGs) have received substantial attention. However, the volume of literature is not matched by research into alternative methods of CPG development using existing CPG documents-a specific issue for guideline development groups in low- and middle-income countries. We report on how we developed a context specific prehospital CPG using an alternative guideline development method. Difficulties experienced and lessons learnt in applying existing global guidelines' recommendations to a national context are highlighted. The project produced the first emergency care CPG for prehospital providers in Africa. It included > 270 CPGs and produced over 1000 recommendations for prehospital emergency care. We encountered various difficulties, including (1) applicability issues: few pre-hospital CPGs applicable to Africa, (2) evidence synthesis: heterogeneous levels of evidence classifications and (3) guideline quality. Learning points included (1) focusing on key CPGs and evidence mapping, (2) searching other resources for CPGs, (3) broad representation on CPG advisory boards and (4) transparency and knowledge translation. Re-inventing the wheel to produce CPGs is not always feasible. We hope this paper will encourage further projects to use existing CPGs in developing guidance to improve patient care in resource-limited settings.

  10. Decreased interferon-α production in response to CpG DNA dysregulates cytokine responses in patients with multiple sclerosis.

    PubMed

    Hirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Yaguchi, Hiroaki; Nakamura, Masakazu; Kikuchi, Seiji; Sasaki, Hidenao

    2012-05-01

    Type I interferons (IFNs), represented by IFN-α and β, activate immune effector cells belonging to the innate and adaptive immune systems. Plasmacytoid dendritic cells (pDCs) produce IFN-α in response to CpG DNA. We aimed to examine the impact of pDC-produced IFN-α on the adaptive immune system in Multiple Sclerosis (MS). Our results demonstrated that CpG DNA-induced IFN-α production was significantly decreased in PBMCs from MS patients. Decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were found in CpG DNA-treated PBMCs of healthy subjects unlike in those from MS patients. In samples pre-treated with IFN-α and IFN-β, decreased levels of IL-12 p70, IFN-γ, and IL-17 and increased level of IL-10 were detected in PBMCs from MS patients. These results suggest that CpG DNA-induced decreased IFN-α production causes pro-inflammatory cytokine secretion, and either IFN-α or IFN-β induces anti-inflammatory cytokine secretion in the adaptive immune system in MS. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Simulation design of high reverse blocking high-K/low-K compound passivation AlGaN/GaN Schottky barrier diode with gated edge termination

    NASA Astrophysics Data System (ADS)

    Bai, Zhiyuan; Du, Jiangfeng; Xin, Qi; Li, Ruonan; Yu, Qi

    2017-11-01

    In this paper, a novel high-K/low-K compound passivation AlGaN/GaN Schottky Barrier Diode (CPG-SBD) is proposed to improve the off-state characteristics of AlGaN/GaN schottky barrier diode with gated edge termination (GET-SBD) by adding low-K blocks in to the high-K passivation layer. The reverse leakage current of CPG-SBD can be reduced to 1.6 nA/mm by reducing the thickness of high-K dielectric under GET region to 5 nm, while the forward voltage and on-state resistance keep 1 V and 3.8 Ω mm, respectively. Breakdown voltage of CPG-SBDs can be improved by inducing discontinuity of the electric field at the high-K/low-K interface. The breakdown voltage of the optimized CPG-SBD with 4 blocks of low-K can reach 1084 V with anode to cathode distance of 5 μm yielding a high FOM of 5.9 GW/cm2. From the C-V simulation results, CPG-SBDs induce no parasitic capacitance by comparison of the GET-SBDs.

  12. Compositional searching of CpG islands in the human genome

    NASA Astrophysics Data System (ADS)

    Luque-Escamilla, Pedro Luis; Martínez-Aroza, José; Oliver, José L.; Gómez-Lopera, Juan Francisco; Román-Roldán, Ramón

    2005-06-01

    We report on an entropic edge detector based on the local calculation of the Jensen-Shannon divergence with application to the search for CpG islands. CpG islands are pieces of the genome related to gene expression and cell differentiation, and thus to cancer formation. Searching for these CpG islands is a major task in genetics and bioinformatics. Some algorithms have been proposed in the literature, based on moving statistics in a sliding window, but its size may greatly influence the results. The local use of Jensen-Shannon divergence is a completely different strategy: the nucleotide composition inside the islands is different from that in their environment, so a statistical distance—the Jensen-Shannon divergence—between the composition of two adjacent windows may be used as a measure of their dissimilarity. Sliding this double window over the entire sequence allows us to segment it compositionally. The fusion of those segments into greater ones that satisfy certain identification criteria must be achieved in order to obtain the definitive results. We find that the local use of Jensen-Shannon divergence is very suitable in processing DNA sequences for searching for compositionally different structures such as CpG islands, as compared to other algorithms in literature.

  13. The coevolution of partner switching and strategy updating in non-excludable public goods game

    NASA Astrophysics Data System (ADS)

    Li, Yixiao; Shen, Bin

    2013-10-01

    Spatial public goods game is a popular metaphor to model the dilemma of collective cooperation on graphs, yet the non-excludable property of public goods has seldom been considered in previous models. Based upon a coevolutionary model where agents play public goods games and adjust their partnerships, the present model incorporates the non-excludable property of public goods: agents are able to adjust their participation in the games hosted by others, whereas they cannot exclude others from their own games. In the coevolution, a directed and dynamical network which represents partnerships among autonomous agents is evolved. We find that non-excludable property counteracts the positive effect of partner switching, i.e., the equilibrium level of cooperation is lower than that in the situation of excludable public goods game. Therefore, we study the effect of individual punishment that cooperative agents pay a personal cost to decrease benefits of those defective neighbors who participate in their hosted games. It is found that the cooperation level in the whole population is heightened in the presence of such a costly behavior.

  14. Genome-Wide Assessment of Differential DNA Methylation Associated with Autoantibody Production in Systemic Lupus Erythematosus.

    PubMed

    Chung, Sharon A; Nititham, Joanne; Elboudwarej, Emon; Quach, Hong L; Taylor, Kimberly E; Barcellos, Lisa F; Criswell, Lindsey A

    2015-01-01

    Systemic lupus erythematosus (SLE) is characterized by the development of autoantibodies associated with specific clinical manifestations. Previous studies have shown an association between differential DNA methylation and SLE susceptibility, but have not investigated SLE-related autoantibodies. Our goal was to determine whether DNA methylation is associated with production of clinically relevant SLE-related autoantibodies, with an emphasis on the anti-dsDNA autoantibody. In this study, we characterized the methylation status of 467,314 CpG sites in 326 women with SLE. Using a discovery and replication study design, we identified and replicated significant associations between anti-dsDNA autoantibody production and the methylation status of 16 CpG sites (pdiscovery<1.07E-07 and preplication<0.0029) in 11 genes. Associations were further investigated using multivariable regression to adjust for estimated leukocyte cell proportions and population substructure. The adjusted mean DNA methylation difference between anti-dsDNA positive and negative cases ranged from 1.2% to 19%, and the adjusted odds ratio for anti-dsDNA autoantibody production comparing the lowest and highest methylation tertiles ranged from 6.8 to 18.2. Differential methylation for these CpG sites was also associated with anti-SSA, anti-Sm, and anti-RNP autoantibody production. Overall, associated CpG sites were hypomethylated in autoantibody positive compared to autoantibody negative cases. Differential methylation of CpG sites within the major histocompatibility region was not strongly associated with autoantibody production. Genes with differentially methylated CpG sites represent multiple biologic pathways, and have not been associated with autoantibody production in genetic association studies. In conclusion, hypomethylation of CpG sites within genes from different pathways is associated with anti-dsDNA, anti-SSA, anti-Sm, and anti-RNP production in SLE, and these associations are not explained by genetic variation. Thus, studies of epigenetic mechanisms such as DNA methylation represent a complementary method to genetic association studies to identify biologic pathways that may contribute to the clinical heterogeneity of autoimmune diseases.

  15. Asymmetric Operation of the Locomotor Central Pattern Generator in the Neonatal Mouse Spinal Cord

    PubMed Central

    Endo, Toshiaki; Kiehn, Ole

    2008-01-01

    The rhythmic voltage oscillations in motor neurons (MNs) during locomotor movements reflect the operation of the pre-MN central pattern generator (CPG) network. Recordings from MNs can thus be used as a method to deduct the organization of CPGs. Here, we use continuous conductance measurements and decomposition methods to quantitatively assess the weighting and phase tuning of synaptic inputs to different flexor and extensor MNs during locomotor-like activity in the isolated neonatal mice lumbar spinal cord preparation. Whole cell recordings were obtained from 22 flexor and 18 extensor MNs in rostral and caudal lumbar segments. In all flexor and the large majority of extensor MNs the extracted excitatory and inhibitory synaptic conductances alternate but with a predominance of inhibitory conductances, most pronounced in extensors. These conductance changes are consistent with a “push–pull” operation of locomotor CPG. The extracted excitatory and inhibitory synaptic conductances varied between 2 and 56% of the mean total conductance. Analysis of the phase tuning of the extracted synaptic conductances in flexor and extensor MNs in the rostral lumbar cord showed that the flexor-phase–related synaptic conductance changes have sharper locomotor-phase tuning than the extensor-phase–related conductances, suggesting a modular organization of premotor CPG networks consisting of reciprocally coupled, but differently composed, flexor and extensor CPG networks. There was a clear difference between phase tuning in rostral and caudal MNs, suggesting a distinct operation of CPG networks in different lumbar segments. The highly asymmetric features were preserved throughout all ranges of locomotor frequencies investigated and with different combinations of locomotor-inducing drugs. The asymmetric nature of CPG operation and phase tuning of the conductance profiles provide important clues to the organization of the rodent locomotor CPG and are compatible with a multilayered and distributed structure of the network. PMID:18829847

  16. Nullomers and High Order Nullomers in Genomic Sequences

    PubMed Central

    Vergni, Davide; Santoni, Daniele

    2016-01-01

    A nullomer is an oligomer that does not occur as a subsequence in a given DNA sequence, i.e. it is an absent word of that sequence. The importance of nullomers in several applications, from drug discovery to forensic practice, is now debated in the literature. Here, we investigated the nature of nullomers, whether their absence in genomes has just a statistical explanation or it is a peculiar feature of genomic sequences. We introduced an extension of the notion of nullomer, namely high order nullomers, which are nullomers whose mutated sequences are still nullomers. We studied different aspects of them: comparison with nullomers of random sequences, CpG distribution and mean helical rise. In agreement with previous results we found that the number of nullomers in the human genome is much larger than expected by chance. Nevertheless antithetical results were found when considering a random DNA sequence preserving dinucleotide frequencies. The analysis of CpG frequencies in nullomers and high order nullomers revealed, as expected, a high CpG content but it also highlighted a strong dependence of CpG frequencies on the dinucleotide position, suggesting that nullomers have their own peculiar structure and are not simply sequences whose CpG frequency is biased. Furthermore, phylogenetic trees were built on eleven species based on both the similarities between the dinucleotide frequencies and the number of nullomers two species share, showing that nullomers are fairly conserved among close species. Finally the study of mean helical rise of nullomers sequences revealed significantly high mean rise values, reinforcing the hypothesis that those sequences have some peculiar structural features. The obtained results show that nullomers are the consequence of the peculiar structure of DNA (also including biased CpG frequency and CpGs islands), so that the hypermutability model, also taking into account CpG islands, seems to be not sufficient to explain nullomer phenomenon. Finally, high order nullomers could emphasize those features that already make simple nullomers useful in several applications. PMID:27906971

  17. Conserved Role of Intragenic DNA Methylation in Regulating Alternative Promoters

    PubMed Central

    Maunakea, Alika K.; Nagarajan, Raman P.; Bilenky, Mikhail; Ballinger, Tracy J.; D’Souza, Cletus; Fouse, Shaun D.; Johnson, Brett E.; Hong, Chibo; Nielsen, Cydney; Zhao, Yongjun; Turecki, Gustavo; Delaney, Allen; Varhol, Richard; Thiessen, Nina; Shchors, Ksenya; Heine, Vivi M.; Rowitch, David H.; Xing, Xiaoyun; Fiore, Chris; Schillebeeckx, Maximiliaan; Jones, Steven J.M.; Haussler, David; Marra, Marco A.; Hirst, Martin; Wang, Ting; Costello, Joseph F.

    2014-01-01

    While the methylation of DNA in 5′ promoters suppresses gene expression, the role of DNA methylation in gene bodies is unclear1–5. In mammals, tissue- and cell type-specific methylation is present in a small percentage of 5′ CpG island (CGI) promoters, while a far greater proportion occurs across gene bodies, coinciding with highly conserved sequences5–10. Tissue-specific intragenic methylation might reduce,3 or, paradoxically, enhance transcription elongation efficiency1,2,4,5. Capped analysis of gene expression (CAGE) experiments also indicate that transcription commonly initiates within and between genes11–15. To investigate the role of intragenic methylation, we generated a map of DNA methylation from human brain encompassing 24.7 million of the 28 million CpG sites. From the dense, high-resolution coverage of CpG islands, the majority of methylated CpG islands were revealed to be in intragenic and intergenic regions, while less than 3% of CpG islands in 5′ promoters were methylated. The CpG islands in all three locations overlapped with RNA markers of transcription initiation, and unmethylated CpG islands also overlapped significantly with trimethylation of H3K4, a histone modification enriched at promoters16. The general and CpG-island-specific patterns of methylation are conserved in mouse tissues. An in-depth investigation of the human SHANK3 locus17,18 and its mouse homologue demonstrated that this tissue-specific DNA methylation regulates intragenic promoter activity in vitro and in vivo. These methylation-regulated, alternative transcripts are expressed in a tissue and cell type-specific manner, and are expressed differentially within a single cell type from distinct brain regions. These results support a major role for intragenic methylation in regulating cell context-specific alternative promoters in gene bodies. PMID:20613842

  18. Production and quality of clinical practice guidelines in Argentina (1994–2004): a cross-sectional study

    PubMed Central

    Esandi, María Eugenia; Ortiz, Zulma; Chapman, Evelina; Dieguez, Marcelo García; Mejía, Raúl; Bernztein, Ricardo

    2008-01-01

    Background In the last decades, a sustained increment of Clinical Practice Guidelines (CPG) production in the world has been accompanied by a growing concern about their quality. Many studies related to quality assessment of guidelines produced in High Income Countries were published; however, evidence on this topic is scarce in Low and Middle Income Countries (LMIC). The objectives of this research were: a) to describe guideline production in Argentina at different levels of the health system (macro, meso and micro) from 1994 to 2004; and b) to assess their quality by using the AGREE instrument. Methods A cross-sectional study was undertaken to describe guidelines production in Argentina between 1994 and 2004. CPG were identified through Internet and electronic databases (MEDLINE and LILACS). Explicit inclusion and exclusion criteria were used to select guidelines. Each CPG was independently assessed by two reviewers using the AGREE instrument. Domain scores were calculated as recommended by the AGREE Collaboration. The internal consistency of each domain was evaluated using Cronbach's alpha and inter-observer agreement by the Intraclass Correlation Coefficient (ICC). Results A total amount of 431 potential CPG were identified, but only 144 were considered CPG. At the end, 101 CPG were included for further assessment. Median standardized score for each domain were: scope = 39%; stakeholder involvement = 13%; rigour of development = 10%; clarity = 42%; applicability = 6%; editorial independence = 0%. Only 22 CPG were recommended with modifications by both appraisers. ICC and Cronbach's alpha for each domain were in all cases moderate or high (greater than 0.40), except for editorial independence. Conclusion This study has systematically employed the AGREE instrument for the critical assessment of guidelines produced in a LMIC. Guideline development and diffusion in Argentina from 1994 to 2004 shows a constant increment, although quality of reporting did not improve; moreover, in some aspects it seemed to decline. Much room for improvement of the guideline development process was found at all levels of the health system. PMID:18851739

  19. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  20. Identification and prognostic value of anterior gradient protein 2 expression in breast cancer based on tissue microarray.

    PubMed

    Guo, Jilong; Gong, Guohua; Zhang, Bin

    2017-07-01

    Breast cancer has attracted substantial attention as one of the major cancers causing death in women. It is crucial to find potential biomarkers of prognostic value in breast cancer. In this study, the expression pattern of anterior gradient protein 2 in breast cancer was identified based on the main molecular subgroups. Through analysis of 69 samples from the Gene Expression Omnibus database, we found that anterior gradient protein 2 expression was significantly higher in non-triple-negative breast cancer tissues compared with normal tissues and triple-negative breast cancer tissues (p < 0.05). The data from a total of 622 patients from The Cancer Genome Atlas were analysed. The data from The Cancer Genome Atlas and results from quantitative reverse transcription polymerase chain reaction also verified the anterior gradient protein 2 expression pattern. Furthermore, we performed immunohistochemical analysis. The quantification results revealed that anterior gradient protein 2 is highly expressed in non-triple-negative breast cancer (grade 3 excluded) and grade 1 + 2 (triple-negative breast cancer excluded) tumours compared with normal tissues. Anterior gradient protein 2 was significantly highly expressed in non-triple-negative breast cancer (grade 3 excluded) and non-triple-negative breast cancer tissues compared with triple-negative breast cancer tissues (p < 0.01). In addition, anterior gradient protein 2 was significantly highly expressed in grade 1 + 2 (triple-negative breast cancer excluded) and grade 1 + 2 tissues compared with grade 3 tissues (p < 0.05). Analysis by Fisher's exact test revealed that anterior gradient protein 2 expression was significantly associated with histologic type, histological grade, oestrogen status and progesterone status. Univariate analysis of clinicopathological variables showed that anterior gradient protein 2 expression, tumour size and lymph node status were significantly correlated with overall survival in patients with grade 1 and 2 tumours. Cox multivariate analysis revealed anterior gradient protein 2 as a putative independent indicator of unfavourable outcomes (p = 0.031). All these data clearly showed that anterior gradient protein 2 is highly expressed in breast cancer and can be regarded as a putative biomarker for breast cancer prognosis.

  1. Characterizing Uncertainty and Variability in PBPK Models ...

    EPA Pesticide Factsheets

    Mode-of-action based risk and safety assessments can rely upon tissue dosimetry estimates in animals and humans obtained from physiologically-based pharmacokinetic (PBPK) modeling. However, risk assessment also increasingly requires characterization of uncertainty and variability; such characterization for PBPK model predictions represents a continuing challenge to both modelers and users. Current practices show significant progress in specifying deterministic biological models and the non-deterministic (often statistical) models, estimating their parameters using diverse data sets from multiple sources, and using them to make predictions and characterize uncertainty and variability. The International Workshop on Uncertainty and Variability in PBPK Models, held Oct 31-Nov 2, 2006, sought to identify the state-of-the-science in this area and recommend priorities for research and changes in practice and implementation. For the short term, these include: (1) multidisciplinary teams to integrate deterministic and non-deterministic/statistical models; (2) broader use of sensitivity analyses, including for structural and global (rather than local) parameter changes; and (3) enhanced transparency and reproducibility through more complete documentation of the model structure(s) and parameter values, the results of sensitivity and other analyses, and supporting, discrepant, or excluded data. Longer-term needs include: (1) theoretic and practical methodological impro

  2. Automating Guidelines for Clinical Decision Support: Knowledge Engineering and Implementation.

    PubMed

    Tso, Geoffrey J; Tu, Samson W; Oshiro, Connie; Martins, Susana; Ashcraft, Michael; Yuen, Kaeli W; Wang, Dan; Robinson, Amy; Heidenreich, Paul A; Goldstein, Mary K

    2016-01-01

    As utilization of clinical decision support (CDS) increases, it is important to continue the development and refinement of methods to accurately translate the intention of clinical practice guidelines (CPG) into a computable form. In this study, we validate and extend the 13 steps that Shiffman et al. 5 identified for translating CPG knowledge for use in CDS. During an implementation project of ATHENA-CDS, we encoded complex CPG recommendations for five common chronic conditions for integration into an existing clinical dashboard. Major decisions made during the implementation process were recorded and categorized according to the 13 steps. During the implementation period, we categorized 119 decisions and identified 8 new categories required to complete the project. We provide details on an updated model that outlines all of the steps used to translate CPG knowledge into a CDS integrated with existing health information technology.

  3. Neonatal testosterone suppresses a neuroendocrine pulse generator required for reproduction

    NASA Astrophysics Data System (ADS)

    Israel, Jean-Marc; Cabelguen, Jean-Marie; Le Masson, Gwendal; Oliet, Stéphane H.; Ciofi, Philippe

    2014-02-01

    The pituitary gland releases hormones in a pulsatile fashion guaranteeing signalling efficiency. The determinants of pulsatility are poorly circumscribed. Here we show in magnocellular hypothalamo-neurohypophyseal oxytocin (OT) neurons that the bursting activity underlying the neurohormonal pulses necessary for parturition and the milk-ejection reflex is entirely driven by a female-specific central pattern generator (CPG). Surprisingly, this CPG is active in both male and female neonates, but is inactivated in males after the first week of life. CPG activity can be restored in males by orchidectomy or silenced in females by exogenous testosterone. This steroid effect is aromatase and caspase dependent, and is mediated via oestrogen receptor-α. This indicates the apoptosis of the CPG network during hypothalamic sexual differentiation, explaining why OT neurons do not burst in adult males. This supports the view that stereotypic neuroendocrine pulsatility is governed by CPGs, some of which are subjected to gender-specific perinatal programming.

  4. Identification of HIV infection-related DNA methylation sites and advanced epigenetic aging in HIV-positive, treatment-naive U.S. veterans.

    PubMed

    Nelson, Kristin N; Hui, Qin; Rimland, David; Xu, Ke; Freiberg, Matthew S; Justice, Amy C; Marconi, Vincent C; Sun, Yan V

    2017-02-20

    HIV-positive individuals are at higher risk than healthy persons for aging-related diseases, including myocardial infarction and non-AIDS defining cancers. Recent evidence suggests that HIV infection may modulate changes in the host cell epigenome, and these changes represent a potential mechanism through which HIV infection accelerates aging. We assessed the difference in DNA methylation (DNAm) age, an aging marker involving multiple age-related cytosine-guanine dinucleotide (CpG) sites, among antiretroviral treatment (ART)-naive HIV-positive and HIV-negative individuals in a cohort of veterans from the Veterans Aging Cohort Study. Peripheral blood samples were collected from 19 ART-naive, HIV-positive, and 19 HIV-negative male participants, matched by age and race. Blood samples were collected from HIV-positive participants 7-11 years after ART initiation. We compared DNAm age between HIV-positive and HIV-negative groups at baseline and between HIV-positive patients at baseline and follow-up. We also performed an epigenome-wide analysis to identify CpG methylation sites associated with HIV infection. DNAm age in HIV-positive individuals is, on average, 11.2 years higher than HIV study participants at baseline, and two of 10 HIV-positive individuals showed an increase in DNAm age after ART initiation. Epigenome-wide association studies showed an association of HIV infection with one site, in gene VPS37B, which approached statistical significance in our cohort (P = 3.30 × 10, Bonferroni-corrected threshold = 1.22 × 10) and was replicated in a second, larger cohort. ART treatment-naive HIV-positive individuals have significantly older DNAm age compared to HIV-negative individuals in the Veterans Aging Cohort Study cohort. Longitudinal changes in DNAm age are highly variable across individuals after initiation of antiretroviral therapy.

  5. CpG ODN 1668 induce innate and adaptive immune responses in rock bream (Oplegnathus fasciatus) against rock bream iridovirus (RBIV) infection.

    PubMed

    Jung, Myung-Hwa; Jung, Sung-Ju

    2017-10-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream in Korea. CpG ODN 1668 showed promise as immunoprotective agents against RBIV infection in rock bream. In this study, we assessed innate/adaptive-related gene expression patterns in RBIV-infected rock bream with and without CpG ODN 1668 administration to determine important immune defense related factors that may affect fish survival. In the CpG ODN 1668+virus-injected group, virus copies were more than 7.4- to 790591-fold lower than in the virus-injected group at 4 d (8.79 × 10 4 and 6.58 × 10 5 /μl, respectively), 7 d (5.30 × 10 2 and 2.29 × 10 7 /μl, respectively) and 10 dpi (7.79 × 10 1 and 6.16 × 10 7 /μl, respectively). Furthermore, in the CpG ODN 1668+virus-injected group, significantly higher levels of MyD88 (6 h, 1 d, 4 d and 7 dpi), IL1β (1 d, 2 d and 7 dpi) and perforin/granzyme (1 dpi) expression were observed, whereas these genes were not significantly expressed in the virus-injected group at that time points. Mx, ISG15 and PKR were significantly highly expressed at 4 d and 7 dpi and reduced when low viral loads at 10 dpi in the CpG ODN 1668+virus-injected group. Conversely, in the virus-injected group, Mx, ISG15 and PKR expression were significantly higher than the control group until 10 dpi. However, MHC class I, CD8, Fas, Fas ligand and caspases (3, 8 and 9) expression levels showed no statistically significant differences between virus- and CpG ODN 1668+virus-injected group. In summary, CpG ODN 1668 administration in fish induces innate immune response or cell death pathway, which could be a major contributing factor to effective fish control over viral transcription on 4 d to 10 dpi. Expression of MyD88, IL1β, perforin and granzyme-related immune gene response is critical factor for inhibition of RBIV replication. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. The quality of laboratory aspects of troponin testing in clinical practice guidelines and consensus documents needs to be improved.

    PubMed

    Aakre, Kristin M; Langlois, Michel R; Barth, Julian H; Misra, Shivani; Watine, Joseph; Oosterhuis, Wytze P

    2014-11-01

    The European Federation of Laboratory Medicine (EFLM) and the Union of European Medical Specialists (UEMS) joint Working Group on guidelines recently proposed a checklist to help standardize the description of laboratory investigations in clinical practice guidelines (CPG). Nine CPGs or consensus documents published from 2011 to 2013 describing the investigation of chest pain, diagnosis of acute coronary syndrome, or myocardial infarction were evaluated against the published checklist. Clinical use of troponin analysis are commonly dealt with but the publications present variable, vague and sometimes conflicting information regarding this laboratory test being very much relied on upon making a diagnosis of acute coronary syndrome. Most of the laboratory related checklist items are not considered or need to be updated e.g. suggested analytical quality goals are not applicable for the high sensitive assays and important interferences that may lead to false positive or negative diagnoses are commonly not mentioned. The current paper sums up important analytical and biological issues related to troponin assays and gives suggestions for analytical quality goals that could be included in CPG's. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. DNA methylation of ANKK1 and response to aripiprazole in patients with acute schizophrenia: A preliminary study.

    PubMed

    Miura, Itaru; Kunii, Yasuto; Hino, Mizuki; Hoshino, Hiroshi; Matsumoto, Junya; Kanno-Nozaki, Keiko; Horikoshi, Sho; Kaneko, Haruka; Bundo, Miki; Iwamoto, Kazuya; Yabe, Hirooki

    2018-05-01

    Epigenetic modification including DNA methylation may affect pathophysiology and the response to antipsychotic drugs in patients with schizophrenia. The objective of the present study was to investigate the effect of the DNA methylation of ANKK1 (ankyrin repeat and kinase domain containing 1) on the response to aripiprazole and plasma levels of monoamine metabolites in antipsychotic-free acute schizophrenia patients. The subjects were 34 Japanese patients with schizophrenia who had been treated with aripiprazole for 6 weeks. Comprehensive DNA methylation of ANKK1 was determined using a next-generation sequencer. DNA methylation levels at CpG site 387 of ANKK1 were higher in responders to treatment with aripiprazole and correlated with the changes in Positive and Negative Syndrome Scale scores, although the associations did not remain significant after Bonferroni correction. In responders, methylation at all CpG sites was significantly correlated with plasma levels of homovanillic acid (r = 0.587, p = 0.035) and 3-methoxy-4hydroxyphenylglycol (r = 0.684, p = 0.010) at baseline. Despite our non-significant results after multiple correction, our preliminary findings suggest that methylation levels at CpG site 387 of ANKK1 may be associated with treatment response to aripiprazole. Furthermore, methylation of ANKK1 may affect dopaminergic neural transmission in the treatment of schizophrenia, and may influence treatment response. Caution is needed in interpreting these findings because of the small sample size, and further studies are needed to confirm and expand our preliminary results. Copyright © 2018. Published by Elsevier Ltd.

  8. Aging effects on DNA methylation modules in human brain and blood tissue

    PubMed Central

    2012-01-01

    Background Several recent studies reported aging effects on DNA methylation levels of individual CpG dinucleotides. But it is not yet known whether aging-related consensus modules, in the form of clusters of correlated CpG markers, can be found that are present in multiple human tissues. Such a module could facilitate the understanding of aging effects on multiple tissues. Results We therefore employed weighted correlation network analysis of 2,442 Illumina DNA methylation arrays from brain and blood tissues, which enabled the identification of an age-related co-methylation module. Module preservation analysis confirmed that this module can also be found in diverse independent data sets. Biological evaluation showed that module membership is associated with Polycomb group target occupancy counts, CpG island status and autosomal chromosome location. Functional enrichment analysis revealed that the aging-related consensus module comprises genes that are involved in nervous system development, neuron differentiation and neurogenesis, and that it contains promoter CpGs of genes known to be down-regulated in early Alzheimer's disease. A comparison with a standard, non-module based meta-analysis revealed that selecting CpGs based on module membership leads to significantly increased gene ontology enrichment, thus demonstrating that studying aging effects via consensus network analysis enhances the biological insights gained. Conclusions Overall, our analysis revealed a robustly defined age-related co-methylation module that is present in multiple human tissues, including blood and brain. We conclude that blood is a promising surrogate for brain tissue when studying the effects of age on DNA methylation profiles. PMID:23034122

  9. Obesity and menopause modify the epigenomic profile of breast cancer.

    PubMed

    Crujeiras, Ana B; Diaz-Lagares, Angel; Stefansson, Olafur A; Macias-Gonzalez, Manuel; Sandoval, Juan; Cueva, Juan; Lopez-Lopez, Rafael; Moran, Sebastian; Jonasson, Jon G; Tryggvadottir, Laufey; Olafsdottir, Elinborg; Tinahones, Francisco J; Carreira, Marcos C; Casanueva, Felipe F; Esteller, Manel

    2017-07-01

    Obesity is a high risk factor for breast cancer. This relationship could be marked by a specific methylome. The current work was aimed to explore the impact of obesity and menopausal status on variation in breast cancer methylomes. Data from Infinium 450K array-based methylomes of 64 breast tumors were coupled with information on BMI and menopausal status. Additionally, DNA methylation results were validated in 18 non-tumor and 81 tumor breast samples. Breast tumors arising in either pre- or postmenopausal women stratified by BMI or menopausal status alone were not associated with a specific DNA methylation pattern. Intriguingly, the DNA methylation pattern identified in association with the high-risk group (postmenopausal women with high BMI (>25) and premenopausal women with normal or low BMI < 25) exclusively characterized by hypermethylation of 1287 CpG sites as compared with the low-risk group. These CpG sites included the promoter region of fourteen protein-coding genes of which CpG methylation over the ZNF577 promoter region represents the top scoring associated event. In an independent cohort, the ZNF577 promoter methylation remained statistically significant in association with the high-risk group. Additionally, the impact of ZNF577 promoter methylation on mRNA expression levels was demonstrated in breast cancer cell lines after treatment with a demethylating agent (5-azacytidine). In conclusion, the epigenome of breast tumors is affected by a complex interaction between BMI and menopausal status. The ZNF577 methylation quantification is clearly relevant for the development of novel biomarkers of precision therapy in breast cancer. © 2017 Society for Endocrinology.

  10. Evidence that the methylation state of the monoamine oxidase A (MAOA) gene predicts brain activity of MAO A enzyme in healthy men.

    PubMed

    Shumay, Elena; Logan, Jean; Volkow, Nora D; Fowler, Joanna S

    2012-10-01

    Human brain function is mediated by biochemical processes, many of which can be visualized and quantified by positron emission tomography (PET). PET brain imaging of monoamine oxidase A (MAO A)-an enzyme metabolizing neurotransmitters-revealed that MAO A levels vary widely between healthy men and this variability was not explained by the common MAOA genotype (VNTR genotype), suggesting that environmental factors, through epigenetic modifications, may mediate it. Here, we analyzed MAOA methylation in white blood cells (by bisulphite conversion of genomic DNA and subsequent sequencing of cloned DNA products) and measured brain MAO A levels (using PET and [(11)C]clorgyline, a radiotracer with specificity for MAO A) in 34 healthy non-smoking male volunteers. We found significant interindividual differences in methylation status and methylation patterns of the core MAOA promoter. The VNTR genotype did not influence the methylation status of the gene or brain MAO A activity. In contrast, we found a robust association of the regional and CpG site-specific methylation of the core MAOA promoter with brain MAO A levels. These results suggest that the methylation status of the MAOA promoter (detected in white blood cells) can reliably predict the brain endophenotype. Therefore, the status of MAOA methylation observed in healthy males merits consideration as a variable contributing to interindividual differences in behavior.

  11. Evidence that the methylation state of the monoamine oxidase A (MAOA) gene predicts brain activity of MAOA enzyme in healthy men

    PubMed Central

    Shumay, Elena; Logan, Jean; Volkow, Nora D.; Fowler, Joanna S.

    2012-01-01

    Human brain function is mediated by biochemical processes, many of which can be visualized and quantified by positron emission tomography (PET). PET brain imaging of monoamine oxidase A (MAOA)—an enzyme metabolizing neurotransmitters—revealed that MAOA levels vary widely between healthy men and this variability was not explained by the common MAOA genotype (VNTR genotype), suggesting that environmental factors, through epigenetic modifications, may mediate it. Here, we analyzed MAOA methylation in white blood cells (by bisulphite conversion of genomic DNA and subsequent sequencing of cloned DNA products) and measured brain MAOA levels (using PET and [11C]clorgyline, a radiotracer with specificity for MAOA) in 34 healthy non-smoking male volunteers. We found significant interindividual differences in methylation status and methylation patterns of the core MAOA promoter. The VNTR genotype did not influence the methylation status of the gene or brain MAOA activity. In contrast, we found a robust association of the regional and CpG site-specific methylation of the core MAOA promoter with brain MAOA levels. These results suggest that the methylation status of the MAOA promoter (detected in white blood cells) can reliably predict the brain endophenotype. Therefore, the status of MAOA methylation observed in healthy males merits consideration as a variable contributing to interindividual differences in behavior. PMID:22948232

  12. Species-environment interactions changed by introduced herbivores in an oceanic high-mountain ecosystem.

    PubMed

    Seguí, Jaume; López-Darias, Marta; Pérez, Antonio J; Nogales, Manuel; Traveset, Anna

    2017-01-05

    Summit areas of oceanic islands constitute some of the most isolated ecosystems on earth, highly vulnerable to climate change and introduced species. Within the unique high-elevation communities of Tenerife (Canary Islands), reproductive success and thus long-term survival of species may depend on environmental suitability as well as threat by introduced herbivores. By experimentally modifying the endemic and vulnerable species Viola cheiranthifolia along its entire altitudinal occurrence range, we studied plant performance, autofertility, pollen limitation and visitation rate and the interactive effect of grazing by non-native rabbits on them. We assessed the grazing effects by recording (1) the proportion of consumed plants and flowers along the gradient, (2) comparing fitness traits of herbivore-excluded plants along the gradient, and (3) comparing fitness traits, autofertility and pollen limitation between plants excluded from herbivores with unexcluded plants at the same locality. Our results showed that V. cheiranthifolia performance is mainly affected by inter-annual and microhabitat variability along the gradient, especially in the lowest edge. Despite the increasingly adverse environmental conditions, the plant showed no pollen limitation with elevation, which is attributed to the increase in autofertility levels (≥ 50% of reproductive output) and decrease in competition for pollinators at higher elevations. Plant fitness is, however, extremely reduced owing to the presence of non-native rabbits in the area (consuming more than 75% of the individuals in some localities), which in turn change plant trait-environment interactions along the gradient. Taken together, these findings indicate that the elevational variation found on plant performance results from the combined action of non-native rabbits with the microhabitat variability, exerting intricate ecological influences that threaten the survival of this violet species. Published by Oxford University Press on behalf of the Annals of Botany Company.

  13. Body Size, Physical Activity and Risk of Colorectal Cancer with or without the CpG Island Methylator Phenotype (CIMP)

    PubMed Central

    Hughes, Laura A. E.; Simons, Colinda C. J. M.; van den Brandt, Piet A.; Goldbohm, R. Alexandra; de Goeij, Anton F.; de Bruïne, Adriaan P.; van Engeland, Manon; Weijenberg, Matty P.

    2011-01-01

    Background We investigated how body size and physical activity influence the risk of the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). Methods In the Netherlands Cohort Study (n = 120,852), risk factors were self-reported at baseline in 1986. After 7.3 years of follow-up, 603 cases and 4,631 sub-cohort members were available. CIMP status according to the Weisenberger markers was determined using methylation specific PCR on DNA from paraffin embedded tumor tissue. Hazard rate ratios (HR) and 95% confidence intervals for CIMP (27.7%) and non-CIMP (72.3%) tumors were calculated according to BMI, BMI at age 20, BMI change, trouser/skirt size, height, and physical activity. Results BMI modeled per 5 kg/m2 increase was associated with both CIMP and non-CIMP tumors, however, HRs were attenuated when additionally adjusted for trouser/skirt size. Trouser/skirt size, per 2 size increase, was associated with both tumor subtypes, even after adjustment for BMI (CIMP HR: 1.20, 95%CI: 1.01–1.43; non-CIMP HR: 1.14, 95%CI: 1.04–1.28). Height per 5 cm was associated with both tumor sub-types, but HRs were attenuated when adjusted for body weight. BMI at age 20 was positively associated with increased risk of CIMP tumors and the association was significantly less pronounced for non-CIMP tumors (P-heterogeneity = 0.01). Physical activity was inversely associated with both subtypes, but a dose-response association was observed only for non-CIMP tumors (P-trend = 0.02). Conclusions Body size, especially central adiposity, may increase the risk of both CIMP and non-CIMP tumors. Body fat at young age may differentially influence risk. Physical activity appears to decrease the risk of CRC regardless of these molecular subtypes. PMID:21483668

  14. Body size, physical activity and risk of colorectal cancer with or without the CpG island methylator phenotype (CIMP).

    PubMed

    Hughes, Laura A E; Simons, Colinda C J M; van den Brandt, Piet A; Goldbohm, R Alexandra; de Goeij, Anton F; de Bruïne, Adriaan P; van Engeland, Manon; Weijenberg, Matty P

    2011-04-05

    We investigated how body size and physical activity influence the risk of the CpG island methylator phenotype (CIMP) in colorectal cancer (CRC). In the Netherlands Cohort Study (n = 120,852), risk factors were self-reported at baseline in 1986. After 7.3 years of follow-up, 603 cases and 4,631 sub-cohort members were available. CIMP status according to the Weisenberger markers was determined using methylation specific PCR on DNA from paraffin embedded tumor tissue. Hazard rate ratios (HR) and 95% confidence intervals for CIMP (27.7%) and non-CIMP (72.3%) tumors were calculated according to BMI, BMI at age 20, BMI change, trouser/skirt size, height, and physical activity. BMI modeled per 5 kg/m(2) increase was associated with both CIMP and non-CIMP tumors, however, HRs were attenuated when additionally adjusted for trouser/skirt size. Trouser/skirt size, per 2 size increase, was associated with both tumor subtypes, even after adjustment for BMI (CIMP HR: 1.20, 95%CI: 1.01-1.43; non-CIMP HR: 1.14, 95%CI: 1.04-1.28). Height per 5 cm was associated with both tumor sub-types, but HRs were attenuated when adjusted for body weight. BMI at age 20 was positively associated with increased risk of CIMP tumors and the association was significantly less pronounced for non-CIMP tumors (P-heterogeneity = 0.01). Physical activity was inversely associated with both subtypes, but a dose-response association was observed only for non-CIMP tumors (P-trend = 0.02). Body size, especially central adiposity, may increase the risk of both CIMP and non-CIMP tumors. Body fat at young age may differentially influence risk. Physical activity appears to decrease the risk of CRC regardless of these molecular subtypes.

  15. Altered DNA Methylation and Expression Profiles of 8-Oxoguanine DNA Glycosylase 1 in Lens Tissue from Age-related Cataract Patients.

    PubMed

    Wang, Yong; Li, Fei; Zhang, Guowei; Kang, Lihua; Qin, Bai; Guan, Huaijin

    2015-01-01

    Oxidative stress and DNA damage contribute to the pathogenesis of age-related cataract (ARC). Most oxidative DNA lesions are repaired via the base excision repair (BER) proteins including 8-oxoguanine DNA glycosylase 1 (OGG1). This study examined DNA methylation of CpG islands upstream of OGG1 and their relation to the gene expression in lens cortex from ARC patients. The clinical case-control study consisted of 15 cortical type of ARC patients and 15 age-matched non-ARC controls who received transparent lens extraction due to vitreoretinal diseases. OGG1 expression in lens cortex was analyzed by qRT-PCR and Western blot. The localization and the proportion of cells positive for OGG1 were determined by immunofluorescence. Bisulfite-sequencing PCR (BSP) was performed to evaluate the methylation status of CpG islands near OGG1 in DNA extracted from lens cortex. To test relationship between the methylation and the expression of the gene of interest, 5-Aza-2'-deoxycytidine (5-Aza-dC) was used to induce demethylation of cultured human lens epithelium B-3 (HLE B-3). To test the role of OGG1 in the repair of cellular damage, HLE B-3 was transfected with OGG1 vector, followed by ultraviolet radiation b (UVB) exposure to induce apoptosis. The mRNA and protein levels of OGG1 were significantly reduced in the lens cortex of ARC. Immunofluorescence showed that the proportion of OGG1-positive cells decreased significantly in ARC cortex in comparison with the control. The CpG island in first exon of OGG1 displayed hypermethylation in the DNA extracted from the lens cortex of ARC. Treatment of HLEB-3 cells with 5-Aza-dC upregulated OGG1 expression. UVB-induced apoptosis was attenuated after transfection with OGG1. A reduced OGG1 expression was correlated with hypermethylation of a CpG island of OGG1 in lens cortex of ARC. The role of epigenetic change in OGG1 gene in the susceptibility to oxidative stress induced cortical ARC is warranted to further study.

  16. 76 FR 28308 - Compliance Policy Guide: Surgeons' Gloves and Patient Examination Gloves; Defects-Criteria for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-17

    ... quality levels (AQLs) for leaks and visual defects observed during FDA testing of medical gloves. The CPG... practices regulation (21 CFR 10.115). The CPG represents FDA's current thinking on the criteria for direct...

  17. Adjuvant-Loaded Spiky Gold Nanoparticles for Activation of Innate Immune Cells.

    PubMed

    Nam, Jutaek; Son, Sejin; Moon, James J

    2017-10-01

    Gold nanoparticles are versatile carriers for delivery of biomacromolecules. Here, we have developed spiky gold nanoparticles (SGNPs) that can efficiently deliver immunostimulatory agents. Our goal was to develop a platform technology for co-delivery of multiple adjuvant molecules for synergistic stimulation and maturation of innate immune cells. SGNPs were synthesized by a seed-mediated, surfactant-free synthesis method and incorporated with polyinosinic-polycytidylic acid (pIC) and DNA oligonucleotide containing unmethylated CpG motif (CpG) by an electrostatic layer-by-layer approach. Adjuvant-loaded SGNP nano-complexes were examined for their biophysical and biochemical properties and studied for immune activation using bone marrow-derived dendritic cells (BMDCs). We have synthesized SGNPs with branched nano-spikes layered with pIC and/or CpG. Adjuvant-loaded SGNP nano-complexes promoted cellular uptake of the adjuvants. Importantly, we achieved spatio-temporal control over co-delivery of pIC and CpG via SGNPs, which produced synergistic enhancement in cytokine release (IL-6, TNF-α) and upregulation of co-stimulatory markers (CD40, CD80, CD86) in BMDCs, compared with pIC, CpG, or their admixtures. SGNPs serve as a versatile delivery platform that allows flexible and on-demand cargo fabrication for strong activation of innate immune cells.

  18. A multifaceted knowledge translation strategy can increase compliance with guideline recommendations for mechanical bowel preparation.

    PubMed

    Eskicioglu, Cagla; Pearsall, Emily; Victor, J Charles; Aarts, Mary-Anne; Okrainec, Allan; McLeod, Robin S

    2015-01-01

    The successful transfer of evidence into clinical practice is a slow and haphazard process. We report the outcome of a 5-year knowledge translation (KT) strategy to increase adherence with a clinical practice guideline (CPG) for mechanical bowel preparation (MBP) for elective colorectal surgery patients. A locally tailored CPG recommending MBP practices was developed. Data on MBP practices were collected at six University of Toronto hospitals before CPG implementation as well as after two separate KT strategies. KT strategy #1 included development of the CPG, education by opinion leaders, reminder cards, and presentations of data. KT strategy #2 included selection of hospital champions, development of communities of practice, education, reminder cards, electronic updates, pre-printed standardized orders, and audit and feedback. A total of 744 patients (400 males, 344 females, mean age 57.0) were included. Compliance increased from 58.6 to 70.4% after KT strategy #1 and to 81.1% after KT strategy #2 (p < 0.001). Using a tailored KT strategy, increased compliance was observed with CPG recommendations over time suggesting that a longitudinal KT strategy is required to increase and sustain compliance with recommendations. Furthermore, different strategies may be required at different times (i.e., educational sessions initially and reminders and standardized orders to maintain adherence).

  19. Length of paternal lifespan is manifested in the DNA methylome of their nonagenarian progeny

    PubMed Central

    Marttila, Saara; Kananen, Laura; Jylhävä, Juulia; Nevalainen, Tapio; Hervonen, Antti; Jylhä, Marja; Hurme, Mikko

    2015-01-01

    The heritability of lifespan is 20-30%, but only a few genes associated with longevity have been identified. To explain this discrepancy, the inheritance of epigenetic features, such as DNA methylation, have been proposed to contribute to the heritability of lifespan. We investigated whether parental lifespan is associated with DNA methylation profile in nonagenarians. A regression model, adjusted for differences in blood cell proportions, identified 659 CpG sites where the level of methylation was associated with paternal lifespan. However, no association was observed between maternal lifespan and DNA methylation. The 659 CpG sites associated with paternal lifespan were enriched outside of CpG islands and were located in genes associated with development and morphogenesis, as well as cell signaling. The largest difference in the level of methylation between the progeny of the shortest-lived and longest-lived fathers was identified for CpG sites mapping to CXXC5. In addition, the level of methylation in three Notch-genes (NOTCH1, NOTCH3 and NOTCH4) was also associated with paternal lifespan. There are implications for the inheritance of acquired traits via epigenetic mechanisms in mammals. Here we describe DNA methylation features that are associated with paternal lifespan, and we speculate that the identified CpG sites may represent intergenerational epigenetic inheritance. PMID:26436701

  20. Synthetic Poly(L-Glutamic Acid)-conjugated CpG Exhibits Antitumor Efficacy With Increased Retention in Tumor and Draining Lymph Nodes After Intratumoral Injection in a Mouse Model of Melanoma.

    PubMed

    Ma, Qing; Zhou, Dapeng; DeLyria, Elizabeth S; Wen, Xiaoxia; Lu, Wei; Thapa, Prakash; Liu, Chengwen; Li, Dan; Bassett, Roland L; Overwijk, Willem W; Hwu, Patrick; Li, Chun

    2017-01-01

    There is an urgent need for new clinically applicable drug-delivery methods to enhance accumulation of immune-activating drugs in tumors. We synthesized a poly(L-glutamic acid)-CpG ODN2216 conjugate (PG-CpG) and injected it intratumorally into C57BL/6 mice bearing subcutaneous B16-ovalbumin melanoma. PG-CpG elicited the same potent antitumoral activity as CpG with respect to reducing tumor growth and triggering antigen-specific CD8 T-cell responses in this well-established solid tumor model. Moreover, PG-CpG was retained significantly longer in both tumor and draining lymph nodes than was free CpG after intratumoral injection. Specifically, 48 hours after injection, 26.5%±16.9% of the injected PG-CpG dose versus 4.72%±2.61% of free CpG remained at the tumor, and 1.53%±1.22% of the injected PG-CpG versus 0.37%±0.33% of free CpG was retained in the draining inguinal lymph nodes. These findings indicate that PG is an effective synthetic polymeric carrier for delivery of immunostimulatory agents to tumors and lymph nodes.

  1. COBRA-Seq: Sensitive and Quantitative Methylome Profiling

    PubMed Central

    Varinli, Hilal; Statham, Aaron L.; Clark, Susan J.; Molloy, Peter L.; Ross, Jason P.

    2015-01-01

    Combined Bisulfite Restriction Analysis (COBRA) quantifies DNA methylation at a specific locus. It does so via digestion of PCR amplicons produced from bisulfite-treated DNA, using a restriction enzyme that contains a cytosine within its recognition sequence, such as TaqI. Here, we introduce COBRA-seq, a genome wide reduced methylome method that requires minimal DNA input (0.1–1.0 μg) and can either use PCR or linear amplification to amplify the sequencing library. Variants of COBRA-seq can be used to explore CpG-depleted as well as CpG-rich regions in vertebrate DNA. The choice of enzyme influences enrichment for specific genomic features, such as CpG-rich promoters and CpG islands, or enrichment for less CpG dense regions such as enhancers. COBRA-seq coupled with linear amplification has the additional advantage of reduced PCR bias by producing full length fragments at high abundance. Unlike other reduced representative methylome methods, COBRA-seq has great flexibility in the choice of enzyme and can be multiplexed and tuned, to reduce sequencing costs and to interrogate different numbers of sites. Moreover, COBRA-seq is applicable to non-model organisms without the reference genome and compatible with the investigation of non-CpG methylation by using restriction enzymes containing CpA, CpT, and CpC in their recognition site. PMID:26512698

  2. The genotypes and methylation of MAO genes as factors behind smoking behavior.

    PubMed

    Tiili, Emmi M; Mitiushkina, Natalia V; Sukhovskaya, Olga A; Imyanitov, Evgeny N; Hirvonen, Ari P

    2017-11-01

    Smoking dependence is the main cause for tobacco-related illnesses. The addiction-causing substance in tobacco, nicotine, acts through the dopamine pathway in the brain, causing several pleasurable experiences through cigarette smoking. Thus, both genetic and epigenetic factors related to dopamine metabolism may play an important role in influencing an individual's smoking behavior. We studied the 1460 C/T variation and the variable number tandem repeat polymorphism in the MAOA gene and A/G variation in intron 13 in the MAOB gene together with four DNA methylation sites in both of these genes in relation to several smoking-related phenotypes in a study population of 1230 Whites of Russian origin. The genotypes studied were found to be associated with smoking status in women; the MAOB G variant allele was more prevalent in female smokers than nonsmokers [odds ratio (OR): 2.16, 95% confidence interval (CI): 1.08-4.33], whereas a reverse relation was observed for the MAOA 1460 T-variant allele (OR: 0.44, 95% CI: 0.21-0.91) and variable number tandem repeat low-activity alleles (OR: 0.49, 95% CI: 0.24-0.98). Moreover, the mean methylation values of the CpG sites studied in the MAOA gene were related to smoking behavior in women. Similarly, several methylation patterns in the MAOB gene were associated with a smoking history, with each CpG site showing a remarkable sex dependence. Smoking behavior seems to be related to the genetic and epigenetic profile of MAO genes, with considerable individual and sex-related differences.

  3. Critical Appraisal of International Clinical Practice Guidelines in Kidney Transplantation Using the Appraisal of Guidelines for Research and Education (AGREE) II Tool: A Systematic Review.

    PubMed

    OʼDonoghue, Katriona Jane Marie; Reed, Rhiannon D; Knight, Simon R; O'Callaghan, John M; Ayaz-Shah, Anam A; Hassan, Sevda; Weissenbacher, Annemarie; Morris, Peter J; Pengel, Liset H M

    2018-05-22

    Whilst Clinical Practice Guidelines (CPGs) are used for the development of local protocols in kidney transplantation (Ktx), the quality of their methodology is variable. This systematic review aimed to critically appraise international CPGs in all aspects of Ktx using the Appraisal of Guidelines for Research and Evaluation (AGREE) II tool. CPGs in Ktx and donation published between 2010 and 2017 were identified from MEDLINE, Embase, National Guideline Clearinghouse, NHS and NICE Evidence Searches, and the websites of transplant societies. Using AGREE II, 3 appraisers assessed the quality of CPGs. Interrater reliability was measured using the intraclass correlation coefficient (ICC). Searches identified 3,168 records and 115 CPGs were included. The highest scoring AGREE II domain was 'Scope and Purpose' (80%; Range 30-100%), followed by 'Clarity of Presentation' (77%; Range 43-98%), 'Editorial independence' (52%; Range 0-94%), 'Rigour of Development' (47%; Range 6-97%) and 'Stakeholder Involvement' (41%; Range 11-85%). The poorest scoring domain was 'Applicability' (31%; Range 3-74%). Most CPGs were recommended for future use either with (63%) or without modifications (18%). A small number were not recommended for future use (14%) or reviewers did not agree on recommending the CPG (5%). The overall mean CPG quality score was 4 out of 7 (Range 2-7). The mean ICC of 0.74 indicated substantial agreement between reviewers. The quality of international CPGs in Ktx was variable, and most CPGs lacked key aspects of methodological robustness and transparency. Improvements in methodology, patient involvement and strategies for implementation are required.

  4. Effects of CPG ODN on biological behavior of PANC-1 and expression of TLR9 in pancreatic cancer.

    PubMed

    Wu, Han-Qing; Wang, Bo; Zhu, Shi-Kai; Tian, Yuan; Zhang, Jing-Hui; Wu, He-Shui

    2011-02-28

    To determine the expression of toll-like receptor 9 (TLR9) in pancreatic tumor and the effects of cytosine phosphate-guanosine oligodeoxynucleotides 2216 (CPG ODN2216) on biological behavior of pancreatic carcinoma cell line PANC-1 and explore their clinical significance. The immunohistochemistry and Western blot were used to determine the expression of TLR9 protein in pancreatic cancer tissues, and immunofluorescence staining was performed to detect the TLR9 protein expression in pancreatic carcinoma cell line PANC-1. To assess the effects of CPG ODN2216 on the invasive property of Panc-1 cells, in vitro cell adhesion, wound-healing scrape, and invasion and cell colony formation were evaluated. TLR9 was highly expressed in pancreatic cancer tissues and PANC-1 cells. The percentage of positive cells expressing TLR9 protein in human pancreatic tissues, paracancerous tissues and normal tissues were 73.3%, 33.3% and 20.0%, respectively, and the protein expression level of TLR9 was gradually descending (P < 0.05). In vitro tests in wound-healing scrape, cell adhesion, colony formation and matrigel invasion showed that the adhesion and motility of PANC-1 cells in CPG ODN 2216 treatment group were significantly lower than in the control group (P < 0.05). The cell growth assay showed that the proliferative ability of PANC-1 cells in treatment group was significantly decreased and CPG ODN2216 had an inhibitive effect in the growth of Panc-1 cells in a dose and time-dependent manner (P < 0.05). The gene of TLR9 is correlated with the invasive and metastatic potential of human pancreatic carcinoma, and CPG ODN2216 induces the inhibition of migration and invasion of Panc-1 cells.

  5. Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

    PubMed Central

    Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

    2013-01-01

    Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

  6. Repetition priming of motor activity mediated by a central pattern generator: the importance of extrinsic vs. intrinsic program initiators

    PubMed Central

    Siniscalchi, Michael J.; Jing, Jian; Weiss, Klaudiusz R.

    2016-01-01

    Repetition priming is characterized by increased performance as a behavior is repeated. Although this phenomenon is ubiquitous, mediating mechanisms are poorly understood. We address this issue in a model system, the feeding network of Aplysia. This network generates both ingestive and egestive motor programs. Previous data suggest a chemical coding model: ingestive and egestive inputs to the feeding central pattern generator (CPG) release different modulators, which act via different second messengers to prime motor activity in different ways. The ingestive input to the CPG (neuron CBI-2) releases the peptides feeding circuit activating peptide and cerebral peptide 2, which produce an ingestive pattern of activity. The egestive input to the CPG (the esophageal nerve) releases the peptide small cardioactive peptide. This model is based on research that focused on a single aspect of motor control (radula opening). Here we ask whether repetition priming is observed if activity is triggered with a neuron within the core CPG itself and demonstrate that it is not. Moreover, previous studies demonstrated that effects of modulatory neurotransmitters that induce repetition priming persist. This suggests that it should be possible to “prime” motor programs triggered from within the CPG by first stimulating extrinsic modulatory inputs. We demonstrate that programs triggered after ingestive input activation are ingestive and programs triggered after egestive input activation are egestive. We ask where this priming occurs and demonstrate modifications within the CPG itself. This arrangement is likely to have important consequences for “task” switching, i.e., the cessation of one type of motor activity and the initiation of another. PMID:27466134

  7. Comprehensive DNA methylation analysis of human neuroblastoma cells treated with blonanserin.

    PubMed

    Murata, Yui; Nishioka, Masaki; Bundo, Miki; Sunaga, Fumiko; Kasai, Kiyoto; Iwamoto, Kazuya

    2014-03-20

    Blonanserin is a second-generation antipsychotic drug for schizophrenia. The pharmacological actions of blonanserin are shown to be the antagonism of dopamine receptor 2 and serotonin receptors. However, its molecular mechanisms in brain cells have not been fully characterized. Accumulating evidence suggests that antipsychotic drugs and mood stabilizers show epigenetic effects on a wide range of genes in animal and cellular models. We performed genome-wide DNA methylation analysis targeting 479,814 CpG sites of cultured human neuroblastoma cells administered with blonanserin. We found that 3,057 CpG sites showed statistically significant changes in DNA methylation at two different doses of blonanserin (1.36 nM and 13.6 nM). These included hypermethylated CpG sites that were enriched in genes related to axonogenesis and cell morphogenesis involved in neuron differentiation. We also showed that the global effect on DNA methylome depends on the concentration of the drug. With a high dose of blonanserin, the overall methylation levels across all CpG sites significantly increased. These increases in DNA methylation were prominent in the CpG sites distant from promoter regions. We further examined DNA methylation changes in specific genes implicated for the actions of antipsychotic drugs, such as the dopamine receptor 2 (DRD2) gene and the serotonin receptor 2A (HTR2A) gene. We observed that CpG sites that were located within DRD2 and HTR2A genes were significantly hypermethylated by blonanserin. The DNA methylation changes induced by the treatment with blonanserin will be useful for understanding its pharmacological actions at the cellular level. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Polycomb-like proteins link the PRC2 complex to CpG islands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haojie; Liefke, Robert; Jiang, Junyi

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood.more » Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.« less

  9. Silencing of GSTP1 gene by CpG island DNA hypermethylation in HBV-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Tang, Mandy W; Yeo, Winnie; Liu, Cuiling; Lo, Y M Dennis; Johnson, Philip J

    2002-04-01

    Glutathione S-transferases, enzymes that defend cells against damage mediated by oxidant and electrophilic carcinogens, may be critical determinants of cancer pathogenesis. In this report, we assess the role of epigenetic silencing of the GSTP1 gene, a gene encoding the pi-class glutathione S-transferase, in the pathogenesis of hepatitis B virus (HBV)-associated hepatocellular carcinomas (HCC). The cell lines Hep3B, HepG2, and a cohort of 43 HBV-associated HCC tissue specimens and corresponding nontumor tissues were subjected to analysis for GSTP1 epigenetic alteration and expression. GSTP1 "CpG" island DNA hypermethylation in the liver cell lines, and the tissue specimens were determined by methylation-specific PCR and correlated with expression of the gene using reverse-transcription PCR, immunoblotting, and immunohistochemistry. GSTP1 CpG island DNA hypermethylation was detected in 28 of 43 (65.1%) HCC tissues and 4 of 40 (10%) corresponding nontumor tissues. GSTP1 protein was absent in those cases showing hypermethylation of the gene. Similarly, DNA from Hep3B and HepG2 cell lines displayed complete GSTP1 hypermethylation in the CpG island, and they failed to express GSTP1 mRNA and the corresponding protein product. Treatment of the cell lines with the DNA methyltransferase inhibitor 5-aza-deoxycytidine reversed the hypermethylation, and restored GSTP1 mRNA and polypeptide expression. These data indicate that epigenetic silencing of GSTP1 gene expression by CpG island DNA hypermethylation is common in human HBV-associated HCC. In addition, somatic GSTP1 inactivation via CpG island hypermethylation may contribute to the pathogenesis of this malignancy.

  10. Adopting Health Behavior Change Theory throughout the Clinical Practice Guideline Process

    ERIC Educational Resources Information Center

    Ceccato, Natalie E.; Ferris, Lorraine E.; Manuel, Douglas; Grimshaw, Jeremy M.

    2007-01-01

    Adopting a theoretical framework throughout the clinical practice guideline (CPG) process (development, dissemination, implementation, and evaluation) can be useful in systematically identifying, addressing, and explaining behavioral influences impacting CPG uptake and effectiveness. This article argues that using a theoretical framework should…

  11. 78 FR 42526 - Salmonella

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-16

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2013-D-0254] Salmonella Contamination of Dry Dog Food; Withdrawal of Compliance Policy Guide AGENCY: Food and Drug... entitled ``Sec. 690.700 Salmonella Contamination of Dry Dog Food (CPG 690.700)'' on October 1, 1980. CPG...

  12. CpG islands: algorithms and applications in methylation studies.

    PubMed

    Zhao, Zhongming; Han, Leng

    2009-05-15

    Methylation occurs frequently at 5'-cytosine of the CpG dinucleotides in vertebrate genomes; however, this epigenetic feature is rarely observed in CpG islands (CGIs) or CpG clusters in the promoter regions of genes. Aberrant methylation of the promoter-associated CGIs might influence gene expression and cause carcinogenesis. Because of the functional importance, multiple algorithms have been available for identifying CGIs in a genome or a sequence. They can be categorized into the traditional algorithms (e.g., Gardiner-Garden and Frommer (1987), Takai and Jones (2002), and CpGPRoD (2002)) or statistical property based algorithms (CpGcluster (2006) and CG cluster (2007)). We reviewed the features of these algorithms and evaluated their performance on identifying functional CGIs using genome-wide methylation data. Moreover, identification of CGIs is an initial step in many recent studies for predicting methylation status as well as in the design of methylation detection platforms. We reviewed the benchmarks and features used in these studies.

  13. Gait Planning and Stability Control of a Quadruped Robot

    PubMed Central

    Li, Junmin; Wang, Jinge; Yang, Simon X.; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype. PMID:27143959

  14. Gait Planning and Stability Control of a Quadruped Robot.

    PubMed

    Li, Junmin; Wang, Jinge; Yang, Simon X; Zhou, Kedong; Tang, Huijuan

    2016-01-01

    In order to realize smooth gait planning and stability control of a quadruped robot, a new controller algorithm based on CPG-ZMP (central pattern generator-zero moment point) is put forward in this paper. To generate smooth gait and shorten the adjusting time of the model oscillation system, a new CPG model controller and its gait switching strategy based on Wilson-Cowan model are presented in the paper. The control signals of knee-hip joints are obtained by the improved multi-DOF reduced order control theory. To realize stability control, the adaptive speed adjustment and gait switch are completed by the real-time computing of ZMP. Experiment results show that the quadruped robot's gaits are efficiently generated and the gait switch is smooth in the CPG control algorithm. Meanwhile, the stability of robot's movement is improved greatly with the CPG-ZMP algorithm. The algorithm in this paper has good practicability, which lays a foundation for the production of the robot prototype.

  15. Cancer immunotherapeutic effects of novel CpG ODN in murine tumor model.

    PubMed

    Cho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-Ki

    2008-10-01

    While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the numbers of usable CpG ODNs are limited in current clinical settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the number of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the number of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.

  16. Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

    PubMed

    Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

    2014-02-01

    Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

    PubMed Central

    Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

    2014-01-01

    Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

  18. pH-Responsive Nanoparticle Vaccines for Dual-Delivery of Antigens and Immunostimulatory Oligonucleotides

    PubMed Central

    Wilson, John T.; Keller, Salka; Manganiello, Matthew J.; Cheng, Connie; Lee, Chen-Chang; Opara, Chinonso; Convertine, Anthony; Stayton, Patrick S.

    2013-01-01

    Protein subunit vaccines offer important potential advantages over live vaccine vectors, but generally elicit weaker and shorter-lived cellular immune responses. Here we investigate the use of pH-responsive, endosomolytic polymer nanoparticles that were originally developed for RNA delivery as vaccine delivery vehicles for enhancing cellular and humoral immune responses. Micellar nanoparticles were assembled from amphiphilic diblock copolymers composed of an ampholytic core-forming block and a re-designed polycationic corona block doped with thiol-reactive pyridyl disulfide groups to enable dual-delivery of antigens and immunostimulatory CpG oligodeoxynucleotide (CpG ODN) adjuvants. Polymers assembled into 23 nm particles with simultaneous packaging of CpG ODN and a thiolated protein antigen, ovalbumin (ova). Conjugation of ova to nanoparticles significantly enhanced antigen cross-presentation in vitro relative to free ova or an unconjugated, physical mixture of the parent compounds. Subcutaneous vaccination of mice with ova-nanoparticle conjugates elicited a significantly higher CD8+ T cell response (0.5% IFN-ɣ+ of CD8+) compared to mice vaccinated with free ova or a physical mixture of the two components. Significantly, immunization with ova-nanoparticle conjugates electrostatically complexed with CpG ODN (dual-delivery) enhanced CD8+ T cell responses (3.4% IFN-ɣ+ of CD8+) 7-, 18-, and 8-fold relative to immunization with conjugates, ova administered with free CpG, or a formulation containing free ova and CpG complexed to micelles, respectively. Similarly, dual-delivery carriers significantly increased CD4+IFN-ɣ+ (Th1) responses, and elicited a balanced IgG1/IgG2c antibody response. Intradermal administration further augmented cellular immune responses, with dual-delivery carriers inducing ~7% antigen-specific CD8+ T cells. This work demonstrates the ability of pH-responsive, endosomolytic nanoparticles to actively promote antigen cross-presentation and augment cellular and humoral immune responses via dual-delivery of protein antigens and CpG ODN. Hence, pH-responsive polymeric nanoparticles offer promise as a delivery platform for protein subunit vaccines. PMID:23590591

  19. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

  20. Quantitative methylation level of the EPHX1 promoter in peripheral blood DNA is associated with polycystic ovary syndrome.

    PubMed

    Sang, Qing; Li, Xin; Wang, Haojue; Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

    2014-01-01

    Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13-14 (P<0.05), 15-16 (P<0.001), and 19-24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13-14 and CpG cluster 19-24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction.

  1. Quantitative Methylation Level of the EPHX1 Promoter in Peripheral Blood DNA Is Associated with Polycystic Ovary Syndrome

    PubMed Central

    Wang, Huan; Zhang, Shaozhen; Feng, Ruizhi; Xu, Yao; Li, Qiaoli; Zhao, Xinzhi; Xing, Qinghe; Jin, Li; He, Lin; Wang, Lei

    2014-01-01

    Steroid synthesis and metabolic pathways play important roles in the pathophysiology of PCOS, but until now there have been no studies on the methylation profiles of specific genes in steroid synthesis pathways that are known to be associated with PCOS. Here we used MassARRAY quantitative methylation analysis to determine the methylation levels of each CpG site or cluster in the promoters of EPHX1, SRD5A1, and CYP11A1 in 64 peripheral blood samples. We further examined the methylation level of EPHX1 in an independent cohort consisting of 116 people. Finally, we investigated the role of EPHX1 in steroidogenesis in the KGN cell line. For SRD5A1 and CYP11A1, there was no significant difference in methylation level between patients and controls. For EPHX1, however, the methylation levels of a few consecutive CpG sites and clusters were found to be significantly associated with PCOS. The methylation levels of a number of CpG clusters or sites were significantly lower in patients than in controls in the first cohort consisting of 64 people, such as clusters 13–14 (P<0.05), 15–16 (P<0.001), and 19–24 (P<0.001) and sites CpG_53 (P<0.01) and CpG_54 (P<0.05). Among differentiated methylation sites and clusters, the methylation levels of the CpG cluster 13–14 and CpG cluster 19–24 in PCOS patients were significantly lower than in controls in the second cohort of 116 people (P<0.05 for both). In addition, knockdown and overexpression experiments in KGN cells showed that EPHX1 can regulate estradiol concentrations, and this indicates a role for EPHX1 in steroidogenesis. Our study has demonstrated that methylation of the EPHX1 promoter might be associated with PCOS. This study provides direct evidence that methylation plays an important role in PCOS and demonstrates a novel role for EPHX1 in female reproduction. PMID:24505354

  2. Motor recovery in post-stroke patients with aphasia: the role of specific linguistic abilities.

    PubMed

    Ginex, Valeria; Veronelli, Laura; Vanacore, Nicola; Lacorte, Eleonora; Monti, Alessia; Corbo, Massimo

    2017-09-01

    Aphasia is a serious consequence of stroke but aphasics patients have been routinely excluded from participation in some areas of stroke research. To assess the role of specific linguistic and non-verbal cognitive abilities on the short-term motor recovery of patients with aphasia due to first-ever stroke to the left hemisphere after an intensive rehabilitation treatment. 48 post-acute aphasic patients, who underwent physiotherapy and speech language therapy, were enrolled for this retrospective cohort-study. Four types of possible predictive factors were taken into account: clinical variables, functional status, language and non-verbal cognitive abilities. The motor FIM at discharge was used as the main dependent variable. Patients were classified as follows: 6 amnestic, 9 Broca's, 7 Wernicke's, and 26 global aphasics. Motor FIM at admission (p = 0.003) and at discharge (p = 0.042), all linguistic subtests of Aachener AphasieTest (p = 0.001), and non-verbal reasoning abilities (Raven's CPM, p = 0.006) resulted significantly different across different types of aphasia. Post-hoc analyses showed differences only between global aphasia and the other groups. A Multiple Linear Regression shows that admission motor FIM (p = 0.001) and Token test (p = 0.040), adjusted for clinical, language, and non-verbal reasoning variables, resulted as independent predictors of motor FIM scores at discharge, while Raven's CPM resulted close to statistical significance. Motor function at admission resulted as the variable that most affects the motor recovery of post-stroke patients with aphasia after rehabilitation. A linguistic test requiring also non-linguistic abilities, including attention and working memory (i.e. Token test) is an independent predictor as well.

  3. Aberrant DNA methylation at genes associated with a stem cell-like phenotype in cholangiocarcinoma tumours

    PubMed Central

    Dai, Wei; Siddiq, Afshan; Walley, Andrew J; Limpaiboon, Temduang; Brown, Robert

    2013-01-01

    Genetic abnormalities of cholangiocarcinoma have been widely studied; however, epigenomic changes related to cholangiocarcinogenesis have been less well characterised. We have profiled the DNA methylomes of 28 primary cholangiocarcinoma and six matched adjacent normal tissues using Infinium’s HumanMethylation27 BeadChips with the aim of identifying gene sets aberrantly epigenetically regulated in this tumour type. Using a linear model for microarray data we identified 1610 differentially methylated autosomal CpG sites with 809 CpG sites (representing 603 genes) being hypermethylated and 801 CpG sites (representing 712 genes) being hypomethylated in cholangiocarcinoma versus adjacent normal tissues (false discovery rate ≤ 0.05). Gene ontology and gene set enrichment analyses identified gene sets significantly associated with hypermethylation at linked CpG sites in cholangiocarcinoma including homeobox genes and target genes of PRC2, EED, SUZ12 and histone H3 trimethylation at lysine 27. We confirmed frequent hypermethylation at the homeobox genes HOXA9 and HOXD9 by bisulfite pyrosequencing in a larger cohort of cholangiocarcinoma (n = 102). Our findings indicate a key role for hypermethylation of multiple CpG sites at genes associated with a stem cell-like phenotype as a common molecular aberration in cholangiocarcinoma. These data have implications for cholangiocarcinogenesis, as well as possible novel treatment options using histone methyltransferase inhibitors. PMID:24089088

  4. Differential methylation of the oxytocin receptor gene in patients with anorexia nervosa: a pilot study.

    PubMed

    Kim, Youl-Ri; Kim, Jeong-Hyun; Kim, Mi Jeong; Treasure, Janet

    2014-01-01

    Recent studies in patients with anorexia nervosa suggest that oxytocin may be involved in the pathophysiology of anorexia nervosa. We examined whether there was evidence of variation in methylation status of the oxytocin receptor (OXTR) gene in patients with anorexia nervosa that might account for these findings. We analyzed the methylation status of the CpG sites in a region from the exon 1 to the MT2 regions of the OXTR gene in buccal cells from 15 patients and 36 healthy women using bisulfite sequencing. We further examined whether methylation status was associated with markers of illness severity or form. We identified six CpG sites with significant differences in average methylation levels between the patient and control groups. Among the six differentially methylated CpG sites, five showed higher than average methylation levels in patients than those in the control group (64.9-88.8% vs. 6.6-45.0%). The methylation levels of these five CpG sites were negatively associated with body mass index (BMI). BMI, eating disorders psychopathology, and anxiety were identified in a regression analysis as factors affecting the methylation levels of these CpG sites with more variation accounted for by BMI. Epigenetic misregulation of the OXTR gene may be implicated in anorexia nervosa, which may either be a mechanism linking environmental adversity to risk or may be a secondary consequence of the illness.

  5. DNA methylation profiles of donor nuclei cells and tissues of cloned bovine fetuses.

    PubMed

    Kremenskoy, Maksym; Kremenska, Yuliya; Suzuki, Masako; Imai, Kei; Takahashi, Seiya; Hashizume, Kazuyoshi; Yagi, Shintaro; Shiota, Kunio

    2006-04-01

    Methylation of DNA in CpG islands plays an important role during fetal development and differentiation because CpG islands are preferentially located in upstream regions of mammalian genomic DNA, including the transcription start site of housekeeping genes and are also associated with tissue-specific genes. Somatic nuclear transfer (NT) technology has been used to generate live clones in numerous mammalian species, but only a low percentage of nuclear transferred animals develop to term. Abnormal epigenetic changes in the CpG islands of donor nuclei after nuclear transfer could contribute to a high rate of abortion during early gestation and increase perinatal death. These changes have yet to be explored. Thus, we investigated the genome-wide DNA methylation profiles of CpG islands in nuclei donor cells and NT animals. Using Restriction Landmark Genomic Scanning (RLGS), we showed, for the first time, the epigenetic profile formation of tissues from NT bovine fetuses produced from cumulus cells. From approximately 2600 unmethylated NotI sites visualized on the RLGS profile, at least 35 NotI sites showed different methylation statuses. Moreover, we proved that fetal and placental tissues from artificially inseminated and cloned cattle have tissue-specific differences in the genome-wide methylation profiles of the CpG islands. We also found that possible abnormalities occurred in the fetal brain and placental tissues of cloned animals.

  6. The influence of providing a clinical practice guideline on dental students' decision making.

    PubMed

    van der Sanden, Wil J M; Mettes, Dirk G; Plasschaert, Alphons J M; Mulder, Jan; Verdonschot, Emiel H

    2004-02-01

    The aim of this study was to assess the effect of the provision of a clinical practice guideline (CPG) on dental students' decisions to remove asymptomatic, impacted lower third molars. All dental students, who in 2001 were in the 3rd, 4th or 5th (final) year of their study at the Nijmegen College of Dental Sciences, were invited to participate. A pre-test-post-test control group design was used. Given 36 patient cases, all dental students were asked to assess the need for removal of asymptomatic, impacted lower third molars. All pre-test respondents were randomly allocated to the control or intervention group. After the provision of a CPG to the intervention group, both groups were asked to assess the same cases again. Frequencies of decisions to remove the third molars were calculated. Chi-square tests and anova were used to test the influence of study year and gender on the drop-out rate and on the effect of the provision of a CPG on students' treatment decisions. The decrease in indications to remove third molars by the intervention group was statistically significant (P < 0.05). In the control group, no significant decrease was observed. It was concluded that the provision of a CPG significantly influences dental students' decision making about treatment in a third-molar decision task. Students who used the CPG showed more guideline-conformed decision making.

  7. Response of immune response genes to adjuvants poly [di(sodium carboxylatoethylphenoxy)phosphazene] (PCEP), CpG oligodeoxynucleotide and emulsigen at intradermal injection site in pigs.

    PubMed

    Magiri, R B; Lai, K; Chaffey, A M; Wilson, H L; Berry, W E; Szafron, M L; Mutwiri, G K

    2016-07-01

    Understanding the mechanisms by which adjuvants mediate their effects provide critical information on how innate immunity influences the development of adaptive immunity. Despite being a critical vaccine component, the mechanisms by which adjuvants mediate their effects are not fully understood and this is especially true when they are used in large animals. This lack of understanding limits our ability to design effective vaccines. In the present study, we administered polyphosphazene (PCEP), CpG oligodeoxynucleotides (CpG), emulsigen or saline via an intradermal injection into pigs and assessed the impact on the expression of reported 'adjuvant response genes' over time. CpG induced a strong upregulation of the chemokine CXL10 several 'Interferon Response Genes', as well as TNFα, and IL-10, and a down-regulation of IL-17 genes. Emulsigen upregulated expression of chemokines CCL2 and CCL5, proinflammatory cytokines IL-6 and TNFα, as well as TLR9, and several IFN response genes. PCEP induced the expression of chemokine CCL2 and proinflammatory cytokine IL-6. These results suggest that emulsigen and CpG may promote recruitment of innate immune cells and Th1 type cytokine production but that PCEP may promote a Th-2 type immune response through the induction of IL-6, an inducer of B cell activity and differentiation. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Does Epileptiform Activity Represent a Failure of Neuromodulation to Control Central Pattern Generator-Like Neocortical Behavior?

    PubMed Central

    Traub, Roger D.; Whittington, Miles A.; Hall, Stephen P.

    2017-01-01

    Rhythmic motor patterns in invertebrates are often driven by specialized “central pattern generators” (CPGs), containing small numbers of neurons, which are likely to be “identifiable” in one individual compared with another. The dynamics of any particular CPG lies under the control of modulatory substances, amines, or peptides, entering the CPG from outside it, or released by internal constituent neurons; consequently, a particular CPG can generate a given rhythm at different frequencies and amplitudes, and perhaps even generate a repertoire of distinctive patterns. The mechanisms exploited by neuromodulators in this respect are manifold: Intrinsic conductances (e.g., calcium, potassium channels), conductance state of postsynaptic receptors, degree of plasticity, and magnitude and kinetics of transmitter release can all be affected. The CPG concept has been generalized to vertebrate motor pattern generating circuits (e.g., for locomotion), which may contain large numbers of neurons – a construct that is sensible, if there is enough redundancy: that is, the large number of neurons consists of only a small number of classes, and the cells within any one class act stereotypically. Here we suggest that CPG and modulator ideas may also help to understand cortical oscillations, normal ones, and particularly transition to epileptiform pathology. Furthermore, in the case illustrated, the mechanism of the transition appears to be an exaggerated form of a normal modulatory action used to influence sensory processing. PMID:29093667

  9. Quality assessment of osteoporosis clinical practice guidelines for physical activity and safe movement: an AGREE II appraisal.

    PubMed

    Armstrong, James Jacob; Rodrigues, Isabel Braganca; Wasiuta, Tom; MacDermid, Joy C

    2016-01-01

    Many osteoporosis clinical practice guidelines are published, and the extent to which physical activity and safe movement is addressed varies. To better inform clinical decision-making, a quality assessment and structured analysis of recommendations was undertaken. Guideline quality varied substantially, and improvement is necessary in physical activity and safe movement recommendations. The purpose of the present study is to survey available osteoporosis clinical practice guidelines (CPGs) containing physical activity and safe movement recommendations in order to assess the methodological quality with which they were developed. An analysis of the various physical activity and safe movement recommendations was conducted to determine variability between CPGs. An online literature search revealed 19 CPGs meeting our inclusion criteria. Three independent scorers evaluated CPG quality using the Appraisal of Guidelines for Research and Evaluation version II (AGREE II) instrument. Two separate individuals used a standard table to extract relevant recommendations. Intra-reviewer AGREE II score agreement ranged from fair to good (intra-class correlation coefficient (ICC) = 0.34 to 0.65). The quality of the 19 included CPGs was variable (AGREE sub-scores: 14 to 100%). CPGs scored higher in the "scope and purpose" and "clarity of presentation" domains. They scored the lowest in "applicability" and "editorial independence." Four CPGs were classified as high quality, ten average quality, and five low quality. Most CPGs recommended weight-bearing, muscle-strengthening, and resistance exercises. Information on exercise dosage, progression, and contraindications was often absent. Immobility and movements involving spinal flexion and/or torsion were discouraged. There were several high-quality CPGs; however, variability in quality and lack of specific parameters for implementation necessitates caution and critical examination by readers. CPG development groups should pay special attention to the clinical applicability of their CPGs as well as fully disclosing conflicts of interest. CPGs were in general an agreement regarding safe physical activity and safe movement recommendations. However, recommendations were often vague and the more specific recommendations were inconsistent between CPGs.

  10. Potential link between Fusobacterium enrichment and DNA methylation accumulation in the inflammatory colonic mucosa in ulcerative colitis

    PubMed Central

    Tahara, Tomomitsu; Hirata, Ichiro; Nakano, Naoko; Tahara, Sayumi; Horiguchi, Noriyuki; Kawamura, Tomohiko; Okubo, Masaaki; Ishizuka, Takamitsu; Yamada, Hyuga; Yoshida, Dai; Ohmori, Takafumi; Maeda, Kohei; Komura, Naruomi; Ikuno, Hirokazu; Jodai, Yasutaka; Kamano, Toshiaki; Nagasaka, Mitsuo; Nakagawa, Yoshihito; Tuskamoto, Tetsuya; Urano, Makoto; Shibata, Tomoyuki; Kuroda, Makoto; Ohmiya, Naoki

    2017-01-01

    BACKGROUND AND AIM Fusobacterium enrichment has been associated with colorectal cancer development. Ulcerative colitis (UC) associated tumorigenesis is characterized as high degree of methylation accumulation through continuous colonic inflammation. The aim of this study was to investigate a potential link between Fusobacterium enrichment and DNA methylation accumulation in the inflammatory colonic mucosa in UC. METHODS In the candidate analysis, inflamed colonic mucosa from 86 UC patients were characterized the methylation status of colorectal a panel of cancer related 24 genes. In the genome-wide analysis, an Infinium HumanMethylation450 BeadChip array was utilized to characterize the methylation status of >450,000 CpG sites for fourteen UC patients. Results were correlated with Fusobacterium status. RESULTS UC with Fusobacterium enrichment (FB-high) was characterized as high degree of type C (for cancer-specific) methylation compared to other (FB-low/neg) samples (P<0.01). Genes hypermethylated in FB-high samples included well-known type C genes in colorectal cancer, such as MINT2 and 31, P16 and NEUROG1. Multivariate analysis demonstrated that the FB high status held an increased likelihood for methylation high as an independent factor (odds ratio: 16.18, 95% confidence interval: 1.94-135.2, P=0.01). Genome-wide methylation analysis demonstrated a unique methylome signature of FB-high cases irrespective of promoter, outside promoter, CpG and non-CpG sites. Group of promoter CpG sites that were exclusively hypermethylated in FB-high cases significantly codified the genes related to the catalytic activity (P=0.039). CONCLUSION Our findings suggest that Fusobacterium accelerates DNA methylation in specific groups of genes in the inflammatory colonic mucosa in UC. PMID:28977914

  11. Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation

    PubMed Central

    Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

    2015-01-01

    Background Fetal exposure to hyperglycemia impacts negatively kidney development and function. Objective Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Design Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Results Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)—a key enzyme involved in gene expression during early development–was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Conclusion Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function. PMID:26258530

  12. Kidney Dysfunction in Adult Offspring Exposed In Utero to Type 1 Diabetes Is Associated with Alterations in Genome-Wide DNA Methylation.

    PubMed

    Gautier, Jean-François; Porcher, Raphaël; Abi Khalil, Charbel; Bellili-Munoz, Naima; Fetita, Lila Sabrina; Travert, Florence; Choukem, Simeon-Pierre; Riveline, Jean-Pierre; Hadjadj, Samy; Larger, Etienne; Boudou, Philippe; Blondeau, Bertrand; Roussel, Ronan; Ferré, Pascal; Ravussin, Eric; Rouzet, François; Marre, Michel

    2015-01-01

    Fetal exposure to hyperglycemia impacts negatively kidney development and function. Our objective was to determine whether fetal exposure to moderate hyperglycemia is associated with epigenetic alterations in DNA methylation in peripheral blood cells and whether those alterations are related to impaired kidney function in adult offspring. Twenty nine adult, non-diabetic offspring of mothers with type 1 diabetes (T1D) (case group) were matched with 28 offspring of T1D fathers (control group) for the study of their leukocyte genome-wide DNA methylation profile (27,578 CpG sites, Human Methylation 27 BeadChip, Illumina Infinium). In a subset of 19 cases and 18 controls, we assessed renal vascular development by measuring Glomerular Filtration Rate (GFR) and Effective Renal Plasma Flow (ERPF) at baseline and during vasodilatation produced by amino acid infusion. Globally, DNA was under-methylated in cases vs. controls. Among the 87 CpG sites differently methylated, 74 sites were less methylated and 13 sites more methylated in cases vs. controls. None of these CpG sites were located on a gene known to be directly involved in kidney development and/or function. However, the gene encoding DNA methyltransferase 1 (DNMT1)--a key enzyme involved in gene expression during early development--was under-methylated in cases. The average methylation of the 74 under-methylated sites differently correlated with GFR in cases and controls. Alterations in methylation profile imprinted by the hyperglycemic milieu of T1D mothers during fetal development may impact kidney function in adult offspring. The involved pathways seem to be a nonspecific imprinting process rather than specific to kidney development or function.

  13. Synthetic orocutaneous stimulation entrains preterm infants with feeding difficulties to suck

    PubMed Central

    Barlow, SM; Finan, DS; Lee, J; Chu, S

    2013-01-01

    Background Prematurity can disrupt the development of a specialized neural circuit known as suck central pattern generator (sCPG), which often leads to poor feeding skills. The extent to which suck can be entrained using a synthetically patterned orocutaneous input to promote its development in preterm infants who lack a functional suck is unknown. Objective To evaluate the effects of a new motorized ‘pulsating’ pacifier capable of entraining the sCPG in tube-fed premature infants who lack a functional suck and exhibit feeding disorders. Methods Prospective cohort study of 31 preterm infants assigned to either the oral patterned entrainment intervention (study) or non-treated (controls) group, matched by gestational age, birth weight, oxygen supplementation history, and oral feed status. Study infants received a daily regimen of orocutaneous pulse trains through a pneumatically-controlled silicone pacifier concurrent with gavage feeds. Results The patterned orocutaneous stimulus was highly effective in accelerating the development of NNS in preterm infants. A repeated-measure multivariate analysis of covariance revealed significant increases in minute-rates for total oral compressions, NNS bursts, and NNS cycles, suck cycles per burst, and the ratiometric measure of NNS cycles as a percentage of total ororhythmic output. Moreover, study infants also manifest significantly greater success at achieving oral feeds, surpassing their control counterparts by a factor of 3.1× (72.8% daily oral feed versus 23.3% daily oral feed, respectively). Conclusion Functional expression of the sCPG among preterm infants who lack an organized suck can be induced through the delivery of synthetically patterned orocutaneous pulse trains. The rapid emergence of NNS in treated infants is accompanied by a significant increase in the proportion of nutrient taken orally. PMID:18548084

  14. Assisted reproduction treatment and epigenetic inheritance

    PubMed Central

    van Montfoort, A.P.A.; Hanssen, L.L.P.; de Sutter, P.; Viville, S.; Geraedts, J.P.M.; de Boer, P.

    2012-01-01

    BACKGROUND The subject of epigenetic risk of assisted reproduction treatment (ART), initiated by reports on an increase of children with the Beckwith–Wiedemann imprinting disorder, is very topical. Hence, there is a growing literature, including mouse studies. METHODS In order to gain information on transgenerational epigenetic inheritance and epigenetic effects induced by ART, literature databases were searched for papers on this topic using relevant keywords. RESULTS At the level of genomic imprinting involving CpG methylation, ART-induced epigenetic defects are convincingly observed in mice, especially for placenta, and seem more frequent than in humans. Data generally provide a warning as to the use of ovulation induction and in vitro culture. In human sperm from compromised spermatogenesis, sequence-specific DNA hypomethylation is observed repeatedly. Transmittance of sperm and oocyte DNA methylation defects is possible but, as deduced from the limited data available, largely prevented by selection of gametes for ART and/or non-viability of the resulting embryos. Some evidence indicates that subfertility itself is a risk factor for imprinting diseases. As in mouse, physiological effects from ART are observed in humans. In the human, indications for a broader target for changes in CpG methylation than imprinted DNA sequences alone have been found. In the mouse, a broader range of CpG sequences has not yet been studied. Also, a multigeneration study of systematic ART on epigenetic parameters is lacking. CONCLUSIONS The field of epigenetic inheritance within the lifespan of an individual and between generations (via mitosis and meiosis, respectively) is growing, driven by the expansion of chromatin research. ART can induce epigenetic variation that might be transmitted to the next generation. PMID:22267841

  15. [Factors associated with insulin resistence in rural populations].

    PubMed

    Mendes, Larissa Loures; Gazzinelli, Andréa; Velásquez-Meléndez, Gustavo

    2009-04-01

    This study explores the relations of anthropometric, body composition assessments, biochemical and hemodynamic parameters with insulin resistance in two rural communities. Sample was composed by adults aged 18 or older, both sexes. Participants were excluded if pregnant and diabetic. Data collection included demographic lifestyle, hemodynamic, anthropometric and biochemical variables. From the 567 subjects, 50.4% were men and 49.6%, women. Most of the sample was non-white (75.7%), lived with partner (69.3%) and had low educational level. Overweight and obesity prevalences were 17.4% and 5.5%, respectively. Multivariate analysis found risk factors associated to insulin resistance for non-diabetic adults with low income and educational level: overweight, obesity, elevated waist-to-hip ratio, C-reactive protein and skin color.

  16. Immunoregulation of GVHD by triggering the innate immune system with CpG.

    PubMed

    Morecki, Shoshana; Slavin, Shimon

    2009-08-01

    Stimulation of Toll-like receptors by oligodeoxynucleotide sequences containing a CpG motif provides signals capable of triggering the innate and adaptive immune systems, thereby leading either to stimulation or suppression of immunoreactivities. Similar immunoregulatory capabilities are necessary for achieving the fine balance between engraftment and graft-versus-host disease required in the setup of allogeneic cell therapy. Ligation of CpG to its Toll-like receptors can be accomplished by treatment of the host or pretransplant treatment of the donor in vivo. These different strategies are presented in this review, which summarizes the attempts to maximize beneficial alloreactivity against malignant or other undesirable host cells, while controlling graft-versus-host disease.

  17. CpG methylation in human papillomavirus (HPV) type 31 long control region (LCR) in cervical infections associated with cytological abnormalities.

    PubMed

    László, Brigitta; Ferenczi, Annamária; Madar, László; Gyöngyösi, Eszter; Szalmás, Anita; Szakács, Levente; Veress, György; Kónya, József

    2016-08-01

    The mechanisms that regulate papillomavirus gene expression include DNA methylation. The transcription of papillomavirus oncogenes E6 and E7 is controlled by certain regulatory elements in the LCR, which include binding sites for the E2 protein, a viral regulator of oncogene expression. In HPV-31-infected exfoliated cervical cells, the CpG methylation of the entire LCR was determined by next-generation sequencing after bisulfite modification. Six of the 22 cases had methylated CpG sites in the HPV-31 LCR, including position 7479 and/or 7485, at the promoter distal E2 binding site, thus suggesting a potential regulatory mechanism for papillomavirus transcription.

  18. Efficacy of QCDCR formulated CpG ODN 2007 in Nile tilapia against Streptococcus iniae and identification of upregulated genes

    USDA-ARS?s Scientific Manuscript database

    The potential of using a QCDCR (quilA:cholesterol:dimethyl dioctadecyl ammonium bromide:carbopol:R1005 glycolipid) formulated CpG oligodeoxynucleotide (ODN), ODN 2007, to confer protection in Nile tilapia against Streptococcus iniae infection was evaluated in this study. At two days post treatment, ...

  19. CpG DNA: A pathogenic factor in systemic lupus erythematosus?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krieg, A.M.

    1995-11-01

    Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentiallymore » allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.« less

  20. CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics

    PubMed Central

    Sepulveda, Antonia R.; Jones, Dan; Ogino, Shuji; Samowitz, Wade; Gulley, Margaret L.; Edwards, Robin; Levenson, Victor; Pratt, Victoria M.; Yang, Bin; Nafa, Khedoudja; Yan, Liying; Vitazka, Patrick

    2009-01-01

    Methylation of CpG islands in gene promoter regions is a major molecular mechanism of gene silencing and underlies both cancer development and progression. In molecular oncology, testing for the CpG methylation of tissue DNA has emerged as a clinically useful tool for tumor detection, outcome prediction, and treatment selection, as well as for assessing the efficacy of treatment with the use of demethylating agents and monitoring for tumor recurrence. In addition, because CpG methylation occurs early in pre-neoplastic tissues, methylation tests may be useful as markers of cancer risk in patients with either infectious or inflammatory conditions. The Methylation Working Group of the Clinical Practice Committee of the Association of Molecular Pathology has reviewed the current state of clinical testing in this area. We report here our summary of both the advantages and disadvantages of various methods, as well as the needs for standardization and reporting. We then conclude by summarizing the most promising areas for future clinical testing in cancer molecular diagnostics. PMID:19541921

  1. Multivariable harmonic balance analysis of the neuronal oscillator for leech swimming.

    PubMed

    Chen, Zhiyong; Zheng, Min; Friesen, W Otto; Iwasaki, Tetsuya

    2008-12-01

    Biological systems, and particularly neuronal circuits, embody a very high level of complexity. Mathematical modeling is therefore essential for understanding how large sets of neurons with complex multiple interconnections work as a functional system. With the increase in computing power, it is now possible to numerically integrate a model with many variables to simulate behavior. However, such analysis can be time-consuming and may not reveal the mechanisms underlying the observed phenomena. An alternative, complementary approach is mathematical analysis, which can demonstrate direct and explicit relationships between a property of interest and system parameters. This paper introduces a mathematical tool for analyzing neuronal oscillator circuits based on multivariable harmonic balance (MHB). The tool is applied to a model of the central pattern generator (CPG) for leech swimming, which comprises a chain of weakly coupled segmental oscillators. The results demonstrate the effectiveness of the MHB method and provide analytical explanations for some CPG properties. In particular, the intersegmental phase lag is estimated to be the sum of a nominal value and a perturbation, where the former depends on the structure and span of the neuronal connections and the latter is roughly proportional to the period gradient, communication delay, and the reciprocal of the intersegmental coupling strength.

  2. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies.

    PubMed

    Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S

    2006-07-01

    The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, p<10(-5)) and non-CIMP MSS tumours (6.6%, p<10(-4)), respectively). CIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.

  3. Potential roles of DNA methylation in the initiation and establishment of replicative senescence revealed by array-based methylome and transcriptome analyses

    PubMed Central

    Sakaki, Mizuho; Ebihara, Yukiko; Okamura, Kohji; Nakabayashi, Kazuhiko; Igarashi, Arisa; Matsumoto, Kenji; Hata, Kenichiro; Kobayashi, Yoshiro

    2017-01-01

    Cellular senescence is classified into two groups: replicative and premature senescence. Gene expression and epigenetic changes are reported to differ between these two groups and cell types. Normal human diploid fibroblast TIG-3 cells have often been used in cellular senescence research; however, their epigenetic profiles are still not fully understood. To elucidate how cellular senescence is epigenetically regulated in TIG-3 cells, we analyzed the gene expression and DNA methylation profiles of three types of senescent cells, namely, replicatively senescent, ras-induced senescent (RIS), and non-permissive temperature-induced senescent SVts8 cells, using gene expression and DNA methylation microarrays. The expression of genes involved in the cell cycle and immune response was commonly either down- or up-regulated in the three types of senescent cells, respectively. The altered DNA methylation patterns were observed in replicatively senescent cells, but not in prematurely senescent cells. Interestingly, hypomethylated CpG sites detected on non-CpG island regions (“open sea”) were enriched in immune response-related genes that had non-CpG island promoters. The integrated analysis of gene expression and methylation in replicatively senescent cells demonstrated that differentially expressed 867 genes, including cell cycle- and immune response-related genes, were associated with DNA methylation changes in CpG sites close to the transcription start sites (TSSs). Furthermore, several miRNAs regulated in part through DNA methylation were found to affect the expression of their targeted genes. Taken together, these results indicate that the epigenetic changes of DNA methylation regulate the expression of a certain portion of genes and partly contribute to the introduction and establishment of replicative senescence. PMID:28158250

  4. pcDNA-IL-12 vaccination blocks eosinophilic inflammation but not airway hyperresponsiveness following murine Toxocara canis infection.

    PubMed

    Malheiro, Adriana; Aníbal, Fernanda F; Martins-Filho, Olindo Assis; Teixeira-Carvalho, Andréa; Perini, Adenir; Martins, Milton A; Medeiros, Alexandra I; Turato, Walter M; Acencio, Milene P M; Brandão, Izaíra T; Nomizo, Auro; Silva, Célio L; Faccioli, Lúcia H

    2008-01-17

    We have investigated the effect of pcDNA3-CpG and pcDNA-IL-12, delivered by intradermal gene gun administration, on the blood/lung eosinophilia, airway hyperresponsiveness as well as the immune response in a murine model of toxocariasis. Our results demonstrated that pcDNA-IL-12 but not pcDNA3-CpG vaccination led to a persistent lower blood/bronchoalveolar eosinophilia following Toxocara canis infection, as pcDNA3-CpG led only to an early transient blockage of eosinophil transmigration into bronchoalveolar fluid following T. canis infection. Prominent Type-1 immune response was pointed out as the hallmark of T. canis infection following pcDNA-IL-12 vaccination. Outstanding IFN-gamma/IL-4 ratio besides low levels of IgG1 with subsequent high IgG2a/IgG1 ratio further characterized a Type-1 polarized immunological profile in pcDNA-IL-12-vaccinated animals. Nevertheless, only pcDNA3-CpG was able to prevent airway hyperresponsiveness induced by T. canis infection. The persistent airway hyperresponsiveness observed in pcDNA-IL-12-vaccinated animals demonstrated that the airway constriction involved other immunological mediator than those blocked by pcDNA-IL-12. Together, these data indicated that pcDNA-IL-12 and pcDNA3-CpG vaccines have distinct therapeutic benefits regarding the eosinophilic inflammation/airway hyperresponsiveness triggered by T. canis infection, suggesting their possible use in further combined therapeutic interventions.

  5. Oxytocin Receptor Genetic and Epigenetic Variations: Association With Child Abuse and Adult Psychiatric Symptoms.

    PubMed

    Smearman, Erica L; Almli, Lynn M; Conneely, Karen N; Brody, Gene H; Sales, Jessica M; Bradley, Bekh; Ressler, Kerry J; Smith, Alicia K

    2016-01-01

    Childhood abuse can alter biological systems and increase risk for adult psychopathology. Epigenetic mechanisms, alterations in DNA structure that regulate the gene expression, are a potential mechanism underlying this risk. While abuse associates with methylation of certain genes, particularly those in the stress response system, no study to date has evaluated abuse and methylation of the oxytocin receptor (OXTR). However, studies support a role for OXTR in the link between abuse and adverse adult outcomes, showing that abuse can confer greater risk for psychiatric symptoms in those with specific OXTR genotypes. This study therefore sought to (a) assess the role of epigenetics in the link between abuse and psychopathology and (b) begin to integrate the genetic and epigenetic literature by exploring associations between OXTR genotypes and DNA CpG methylation. Data on 18 OXTR CpG sites, 44 single nucleotide polymorphisms, childhood abuse, and adult depression and anxiety symptoms were assessed in 393 African American adults (age = 41 ± 12.8 years). Overall, 68% of genotypes were associated with methylation of nearby CpG sites, with a subset surviving multiple test correction. Child abuse associated with higher methylation of two CpG sites yet did not survive correction or serve as a mediator of psychopathology. However, abuse interacted with CpG methylation to predict psychopathology. These findings suggest a role for OXTR in understanding the influence of early environments on adult psychiatric symptoms. © 2016 The Authors. Child Development © 2016 Society for Research in Child Development, Inc.

  6. Genomic sequencing and in vivo footprinting of an expression-specific DNase I-hypersensitive site of avian vitellogenin II promoter reveal a demethylation of a mCpG and a change in specific interactions of proteins with DNA.

    PubMed Central

    Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P

    1988-01-01

    Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118

  7. Changes in the activity of a CpG neuron after the reinforcement of an operantly conditioned behavior in Lymnaea.

    PubMed

    Spencer, Gaynor E; Kazmi, Mustapha H; Syed, Naweed I; Lukowiak, Ken

    2002-10-01

    We have previously shown that the aerial respiratory behavior of the mollusk Lymnaea stagnalis can be operantly conditioned, and the central pattern generating (CPG) neurons underlying this behavior have been identified. As neural correlates of operant conditioning remain poorly defined in both vertebrates and invertebrates, we have used the Lymnaea respiratory CPG to investigate neuronal changes associated with the change in behavior after conditioning. After operant conditioning of the intact animals, semi-intact preparations were dissected, so that changes in the respiratory behavior (pneumostome openings) and underlying activity of the identified CPG neuron, right pedal dorsal 1 (RPeD1), could be monitored simultaneously. RPeD1 was studied because it initiates the rhythmic activity of the CPG and receives chemo-sensory input from the pneumostome area. Pneumostome openings and RPeD1 activity were monitored both before and after a reinforcing training stimulus applied to the open pneumostome of operantly conditioned and yoked control preparations. After presentation of the reinforcing stimulus, there was a significant reduction in both breathing behavior and RPeD1 activity in operant preparations but not in yoked and naïve controls. Furthermore these changes were only significant in the subgroup of operantly conditioned animals described as good learners and not in poor learners. These data strongly suggest that changes in RPeD1 activity may underlie the behavioral changes associated with the reinforcement of operant conditioning of the respiratory behavior.

  8. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

    PubMed Central

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

    2017-01-01

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

  9. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  10. Peripheral oxygen-sensing cells directly modulate the output of an identified respiratory central pattern generating neuron.

    PubMed

    Bell, Harold J; Inoue, Takuya; Shum, Kelly; Luk, Collin; Syed, Naweed I

    2007-06-01

    Breathing is an essential homeostatic behavior regulated by central neuronal networks, often called central pattern generators (CPGs). Despite ongoing advances in our understanding of the neural control of breathing, the basic mechanisms by which peripheral input modulates the activities of the central respiratory CPG remain elusive. This lack of fundamental knowledge vis-à-vis the role of peripheral influences in the control of the respiratory CPG is due in large part to the complexity of mammalian respiratory control centres. We have therefore developed a simpler invertebrate model to study the basic cellular and synaptic mechanisms by which a peripheral chemosensory input affects the central respiratory CPG. Here we report on the identification and characterization of peripheral chemoreceptor cells (PCRCs) that relay hypoxia-sensitive chemosensory information to the known respiratory CPG neuron right pedal dorsal 1 in the mollusk Lymnaea stagnalis. Selective perfusion of these PCRCs with hypoxic saline triggered bursting activity in these neurons and when isolated in cell culture these cells also demonstrated hypoxic sensitivity that resulted in membrane depolarization and spiking activity. When cocultured with right pedal dorsal 1, the PCRCs developed synapses that exhibited a form of short-term synaptic plasticity in response to hypoxia. Finally, osphradial denervation in intact animals significantly perturbed respiratory activity compared with their sham counterparts. This study provides evidence for direct synaptic connectivity between a peripheral regulatory element and a central respiratory CPG neuron, revealing a potential locus for hypoxia-induced synaptic plasticity underlying breathing behavior.

  11. Identification of Gene Networks Associated with Acute Myeloid Leukemia by Comparative Molecular Methylation and Expression Profiling

    PubMed Central

    Dellett, Margaret; O’Hagan, Kathleen Ann; Colyer, Hilary Ann Alexandra; Mills, Ken I.

    2010-01-01

    Around 80% of acute myeloid leukemia (AML) patients achieve a complete remission, however many will relapse and ultimately die of their disease. The association between karyotype and prognosis has been studied extensively and identified patient cohorts as having favourable [e.g. t(8; 21), inv (16)/t(16; 16), t(15; 17)], intermediate [e.g. cytogenetically normal (NK-AML)] or adverse risk [e.g. complex karyotypes]. Previous studies have shown that gene expression profiling signatures can classify the sub-types of AML, although few reports have shown a similar feature by using methylation markers. The global methylation patterns in 19 diagnostic AML samples were investigated using the Methylated CpG Island Amplification Microarray (MCAM) method and CpG island microarrays containing 12,000 CpG sites. The first analysis, comparing favourable and intermediate cytogenetic risk groups, revealed significantly differentially methylated CpG sites (594 CpG islands) between the two subgroups. Mutations in the NPM1 gene occur at a high frequency (40%) within the NK-AML subgroup and are associated with a more favourable prognosis in these patients. A second analysis comparing the NPM1 mutant and wild-type research study subjects again identified distinct methylation profiles between these two subgroups. Network and pathway analysis revealed possible molecular mechanisms associated with the different risk and/or mutation sub-groups. This may result in a better classification of the risk groups, improved monitoring targets, or the identification of novel molecular therapies. PMID:24179384

  12. A study of binary Kuiper belt objects

    NASA Astrophysics Data System (ADS)

    Kern, Susan Diane

    2006-06-01

    About 10 5 bodies larger than 100km in diameter (Jewitt 1998) reside in the Kuiper Belt, beyond the orbit of Neptune. Since 1992 observational surveys have discovered over one thousand of these objects, believed to be fossil remnants of events that occurred nearly 4.5 billion years ago. Sixteen of these objects are currently known to be binaries, and many more are expected to be discovered. As part of the Deep Ecliptic Survey (DES) I have helped catalog nearly one third of the known Kuiper Belt object (KBO) population, and used that database for further physical studies. Recovery observations for dynamical studies of newly discovered objects with the Magellan telescopes and a high resolution imager, MagIC, revealed three binaries, 88611 (2001QT297), 2003QY90, and 2005EO304. One binary was found in the discovery observations, 2003UN284. Lightcurve measurements of these, and other non-binary KBOs, were obtained to look for unique rotational characteristics. Eleven of thirty-three objects, excluding the binaries, were found to have measurable variability. One of these objects, 2002GW32 has a particularly large amplitude (> 1 magnitude) of variability, and 2002GP32 has a relatively short (~3.3 hours, single-peaked) lightcurve. Among the binary population all the observed objects showed some level of variation. The secondary of 88611 was fit with a single-peaked period of 5.5±0.02 hours while the primary component appears to be non-variable above the measurement errors (0.05 magnitudes). Neither component appears to be color variable. The components of 2003QY90 are both highly variable yielding single- peaked rotation periods of 3.5±1.1 and 7.2±2.9 hours with amplitudes of 0.34±0.06 and 0.90±0.18 magnitudes, respectively. The rotation periods are comparable to those of other non-binary KBOs although distinct from that of an identified contact binary. Orbits and partial orbits for Kuiper belt binaries (KBBs) show a wide range of eccentricities, and an increasing number of binaries with decreasing binary semi-major axis. These characteristics exclude the formation models proposed by Funato et al. (2003) and Weidenschilling (2002), respectively. Conversely, the formation models of Astakhov et al. (2005) and Goldreich et al. (2002) appear to describe the observations, at least in part. (Copies available exclusively from MIT Libraries, Rm. 14-0551, Cambridge, MA 02139-4307. Ph. 617-253-5668; Fax 617-253-1690.)

  13. Effects of probiotics, probiotic DNA and the CpG oligodeoxynucleotides on ovalbumin-sensitized Brown-Norway rats via TLR9/NF-κB pathway.

    PubMed

    Zhong, Yan; Huang, Juan; Tang, Wenjing; Chen, Bing; Cai, Wei

    2012-10-01

    The aim of the study was to investigate the effect of living probiotics, probiotic DNA and the synthetic oligodeoxynucleotides containing CpG motifs (CpG-ODN) on both immune response and intestinal barrier function in ovalbumin-sensitized rat and the underlying mechanisms. Brown-Norway rats were orally sensitized with ovalbumin, and living probiotics, probiotic DNA extraction, synthetic CpG-ODN or non-CpG ODN control was administered. In the living probiotics, probiotic DNA and CpG-ODN groups, the allergic response was significantly inhibited, the Th1/Th2 cytokine balance was shifted away from Th2 side, the percentage of CD4(+) CD25(+high) Treg cells was increased, and the intestinal barrier function was improved. The levels of toll-like receptor (TLR) 9 mRNA and nuclear factor (NF)-κB activity, as well as the IκB-α phosphorylation (p-IκB-α) was significantly increased in these three intervention groups compared with the OVA-positive group, whereas no such effects were found in the non-CpG ODN control group. These data show that the probiotic genomic DNA and the synthetic CpG-ODN was comparable with living probiotics in preventing food allergic response by immune modulation and intestinal barrier function enhancement, and the activation of TLR9/NF-κB signal pathway might be involved in this process. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  14. Use of caloric and non-caloric sweeteners in US consumer packaged foods, 2005–9

    PubMed Central

    Ng, Shu Wen; Slining, Meghan M.; Popkin, Barry M.

    2012-01-01

    Our understanding of the use of caloric (CS) and non-caloric sweeteners (NCS) in the US food supply is limited. This study utilizes full ingredient list and nutrition facts panel (NFP) data from Gladson Nutrition Database, and nationally representative purchases of consumer packaged foods from Nielsen Homescan in 2005 through 2009 to understand the use of CS (including FJC) and NCS in CPG foods. Of the 85,451 uniquely formulated foods purchased during 2005–2009, 75% contain sweeteners (68% with CS only, 1% with NCS only, 6% with both CS and NCS). CS are in >95% of cakes/cookies/pies, granola/protein/energy bars, ready-to-eat cereals, sweet snacks, and sugar-sweetened beverages. NCS are in >33% of yogurts and sports/energy drinks, 42% of waters (plain or flavored), and most diet sweetened beverages. Across unique products, corn syrup is the most commonly listed sweetener, followed by sorghum, cane sugar, high fructose corn syrup and FJC. Also, 77% of all calories purchased in the US in 2005–2009 contained CS and 3% contained NCS, while 73% of the volume of foods purchased contained CS and 15% contained NCS. Trends during this period suggest a shift towards the purchase of NCS-containing products.Our study poses a challenge toward monitoring sweetener consumption in the US by discussing the need and options available to improve measures of CS and NCS, and additional requirements on NFPs on CPG foods. PMID:23102182

  15. Enhanced Detection of Chromosomal Abnormalities in Chronic Lymphocytic Leukemia by Conventional Cytogenetics Using CpG Oligonucleotide in Combination with Pokeweed Mitogen and Phorbol Myristate Acetate

    PubMed Central

    Muthusamy, Natarajan; Breidenbach, Heather; Andritsos, Leslie; Flynn, Joseph; Jones, Jeffrey; Ramanunni, Asha; Mo, Xiaokui; Jarjoura, David; Byrd, John C.; Heerema, Nyla A.

    2011-01-01

    Reproducible cytogenetic analysis in CLL has been limited by the inability to obtain reliable metaphase cells for analysis. CpG oligonucleotide and cytokine stimulation have been shown to improve metaphase analysis of CLL cytogenetic abnormalities, but is limited by variability in the cytokine receptor levels, stability and biological activity of the cytokine in culture conditions and high costs associated with these reagents. We report here use of a novel, stable CpG, GNKG168 along with pokeweed mitogen (PWM) and phorbol 12-myristate 13-acetate (PMA) for conventional cytogenetic assessment in CLL. We demonstrate that the combined use of GNKG168+PWM/PMA increased the sensitivity of detection of chromosomal abnormalities compared to PWM/PMA (n=207, odds ratio=2.2, p=0.0002) and GNKG168 (n=219, odds ratio=1.5, p=0.0452). Further, a significant increase in sensitivity to detect complexity ≥3 with GNKG168+PWM/PMA compared to GNKG168 alone (odds ratio 8.0, p=0.0022) or PWM/PMA alone (odds ratio 9.6, p=0.0007) was observed. The trend toward detection of higher complexity was significantly greater with GNKG168+PWM/PMA compared to GNKG168 alone (p=0.0412). The increased sensitivity was mainly attributed to the addition of PWM/PMA with GNKG168 because GNKG168 alone showed no difference in sensitivity for detection of complex abnormalities (p=0.17). Comparison of fluorescence in situ hybridization (FISH) results with karyotypic results showed a high degree of consistency, although some complex karyotypes were present in cases with no adverse FISH abnormality. These studies provide evidence for potential use of GNKG168 in combination with PWM and PMA in karyotypic analysis of CLL patient samples to better identify chromosomal abnormalities for risk stratification. PMID:21494579

  16. Fragile X mental retardation 1 (FMR1) intron 1 methylation in blood predicts verbal cognitive impairment in female carriers of expanded FMR1 alleles: evidence from a pilot study.

    PubMed

    Godler, David E; Slater, Howard R; Bui, Quang M; Storey, Elsdon; Ono, Michele Y; Gehling, Freya; Inaba, Yoshimi; Francis, David; Hopper, John L; Kinsella, Glynda; Amor, David J; Hagerman, Randi J; Loesch, Danuta Z

    2012-03-01

    Cognitive status in females with mutations in the FMR1 (fragile X mental retardation 1) gene is highly variable. A biomarker would be of value for predicting which individuals were liable to develop cognitive impairment and could benefit from early intervention. A detailed analysis of CpG sites bridging exon 1 and intron 1 of FMR1, known as fragile X-related epigenetic element 2 (FREE2), suggests that a simple blood test could identify these individuals. Study participants included 74 control females (<40 CGG repeats), 62 premutation (PM) females (55-200 CGG repeats), and 18 full-mutation (FM) females assessed with Wechsler intelligence quotient (IQ) tests. We used MALDI-TOF mass spectrometry to determine the methylation status of FREE2 CpG sites that best identified low-functioning (IQ <70) FM females (>200 CGG repeats), compared the results with those for Southern blot FMR1 activation ratios, and related these assessments to the level of production of the FMR1 protein product in blood. A methylation analysis of intron 1 CpG sites 10-12 showed the highest diagnostic sensitivity (100%) and specificity (98%) of all the molecular measures tested for detecting females with a standardized verbal IQ of <70 among the study participants. In the group consisting of only FM females, methylation of these sites was significantly correlated with full-scale IQ, verbal IQ, and performance IQ. Several verbal subtest scores showed strong correlation with the methylation of these sites (P = 1.2 × 10(-5)) after adjustment for multiple measures. The data suggest that hypermethylation of the FMR1 intron 1 sites in blood is predictive of cognitive impairment in FM females, with implications for improved fragile X syndrome diagnostics in young children and screening of the newborn population.

  17. TRAF3 Epigenetic Regulation Is Associated With Vascular Recurrence in Patients With Ischemic Stroke.

    PubMed

    Gallego-Fabrega, Cristina; Carrera, Caty; Reny, Jean-Luc; Fontana, Pierre; Slowik, Agnieszka; Pera, Joanna; Pezzini, Alessandro; Serrano-Heras, Gemma; Segura, Tomás; Martí-Fàbregas, Joan; Muiño, Elena; Cullell, Natalia; Montaner, Joan; Krupinski, Jerzy; Fernandez-Cadenas, Israel

    2016-05-01

    Clopidogrel is one of the most used antiplatelet drugs in patients with cardiovascular disease. However, 16% to 50% of patients have a high on-clopidogrel platelet reactivity and an increased risk of ischemic events. The pathogenesis of high on-treatment platelet reactivity in patients with stroke is only partially explained by genetic variations. This study aims to find differentially methylated sites across the genome associated with vascular recurrence in ischemic stroke patients treated with clopidogrel. From a cohort of 1900 patients with ischemic stroke, we selected 42 patients treated with clopidogrel, including 21 with a recurrent vascular event and 21 without vascular recurrence during the first year of follow-up. Over 480 000 DNA methylation sites were analyzed across the genome. Differentially methylated CpG sites were identified by nonparametric testing using R. Replication analysis was performed in a new cohort of 191 subjects and results were correlated with platelet reactivity in a subset of 90 subjects using light transmission aggregometry. A total of 73 differentially methylated CpG sites (P<1×10(-05)) were identified; 3 of them were selected for further replication: cg03548645 (P=1.42×10(-05), TRAF3), cg09533145 (P=7.81×10(-06), ADAMTS2), and cg15107336 (P=1.89×10(-05), XRCC1). The cg03548645 CpG remained significant in the replication study (P=0.034), a deep analysis of this region revealed another methylation site associated with vascular recurrence, P=0.037. Lower cg03548645 (TRAF3) DNA methylation levels were correlated with an increased platelet aggregation (ρ=-0.29, P=0.0075). This study suggests for the first time that epigenetics may significantly contribute to the variability of clopidogrel response and recurrence of ischemic events in patients with stroke. © 2016 American Heart Association, Inc.

  18. Effect of dietary betaine supplementation on lipogenesis gene expression and CpG methylation of lipoprotein lipase gene in broilers.

    PubMed

    Xing, Jinyi; Kang, Li; Jiang, Yunliang

    2011-03-01

    Experiments were conducted to investigate the effect of betaine supplementation on mRNA expression levels of lipogenesis genes and CpG methylation of lipoprotein lipase gene (LPL) in broilers. From 22 days of age, 78 broilers were feed basal diet without betaine and basal diet supplemented with 0.1% betaine, respectively, and at 56 and 66 days of age, the traits of 15 chickens (7 males and 8 females) of each group were recorded and abdominal fat pads were collected. The mRNA expression levels of several lipogenesis gene were analyzed by semi-quantitative RT-PCR and real-time quantitative RT-PCR (qPCR), respectively. The CpG methylation profile at the promoter region of LPL gene in 66-day-old broilers was determined by bisulfite sequencing. The average daily gain and percent abdominal fat traits were slightly improved in 56-day-old and 66-day-old broilers after dietary supplementation of betaine to diet. After adding 0.1% betaine to diet, the mRNA levels of fatty acid synthase (FAS) and adipocyte-type fatty acid-binding protein genes in abdominal adipose were significantly decreased in 56-day-old broilers, and those of LPL and FAS genes in abdominal adipose were significantly decreased in 66-day-old broilers comparing with the control group (P < 0.05 and P < 0.001). Moreover, in 66-day-old broilers fed 0.1% betaine diet, a different CpG methylation pattern was observed: the CpG dinucleotides of 1st, 6th, 7th, 8th and from 10th to 50th were less methylated; however, those of 2nd, 5th and 9th were more heavily methylated. The results suggest that transcription of some lipogenesis genes was decreased by betaine supplementation and betaine may decrease LPL mRNA expression by altering CpG methylation pattern on LPL promoter region.

  19. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in reef corals and potential roles of epigenetics on survival and fitness in the face of global climate change.

  20. Gene expression profiling of chicken cecal tonsils and ileum following oral exposure to soluble and PLGA-encapsulated CpG ODN, and lysate of Campylobacter jejuni.

    PubMed

    Taha-Abdelaziz, Khaled; Alkie, Tamiru Negash; Hodgins, Douglas C; Yitbarek, Alexander; Shojadoost, Bahram; Sharif, Shayan

    2017-12-01

    Campylobacter jejuni (C. jejuni) is a leading bacterial cause of food-borne illness in humans. Contaminated chicken meat is an important source of infection for humans. Chickens are not clinically affected by colonization, and immune responses following natural infection have limited effects on bacterial load in the gut. Induction of intestinal immune responses may possibly lead to a breakdown of the commensal relationship of chickens with Campylobacter. We have recently shown that soluble and poly D, L-lactic-co-glycolic acid (PLGA)-encapsulated CpG oligodeoxynucleotide (ODN) as well as C. jejuni lysate, are effective in reducing the intestinal burden of C. jejuni in chickens; however, the mechanisms behind this protection have yet to be determined. The present study was undertaken to investigate the mechanisms of host responses conferred by these treatments. Chickens were treated orally with soluble CpG ODN, or PLGA-encapsulated CpG ODN, or C. jejuni lysate, and expression of cytokines and antimicrobial peptides was evaluated in cecal tonsils and ileum using quantitative RT-PCR. Oral administration of soluble CpG ODN upregulated the expression of interferon (IFN)-γ, interleukin (IL)-1β, CXCLi2, transforming growth factor (TGF)-β4/1, IL-10 and IL-13, while treatment with PLGA-encapsulated CpG ODN upregulated the expression of IL-1β, CXCLi2, TGF-β4/1, IL-13, avian β-defensin (AvBD) 1, AvBD2 and cathelicidin 3 (CATHL-3). C. jejuni lysate upregulated the expression of IFN-γ, IL-1β, TGF-β4/1, IL-13, AvBD1, and CATHL-3. In conclusion, induction of cytokine and antimicrobial peptides expression in intestinal microenvironments may provide a means of reducing C. jejuni colonization in broiler chickens, a key step in reducing the incidence of campylobacteriosis in humans. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

    PubMed

    Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

    2017-01-01

    Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Enhanced immune response to gastric cancer specific antigen Peptide by coencapsulation with CpG oligodeoxynucleotides in nanoemulsion.

    PubMed

    Shi, Rui; Hong, Liu; Wu, Daocheng; Ning, Xiaoxuan; Chen, Yu; Lin, Tao; Fan, Daiming; Wu, Kaichun

    2005-02-01

    CpG oligodeoxynucleotides (CpG ODN) have been shown to have potent adjuvant activity for a wide range of antigens. Of particular interest is their improved activity when closely associated with the antigen. The purpose of this study is to construct a nanovaccine coencapsulated with a gastric cancer specific antigen MG7 mimotope peptide and adjuvant CpG ODN 1645 using new nanotechnology as nanoemulsion and evaluate its immunocompetence. Nanoemulsion vaccine was prepared using magnetic ultrasound methods. BALB/c mice were immunized and the in vivo effectiveness was evaluated using tumor challenge assay. It was shown that the tumor masses formed in the mice immunized with coencapsulated nanovaccine (0.0825 g) markedly smaller (P < 0.01) than those formed in the mice immunized with nanovaccine encapsulated with antigen peptide alone (0.4465 g). A tumor inhibiting rate as high as 82.5% of the coencapsulated nanovaccine was obtained, while nanovaccine encapsulated with peptide only could not achieve the same effect (28.5%) (P < 0.01). Enzyme-linked immunospot assay (ELISPOT) showed that immunization using MG7 mimotope peptide coencapsulated with CpG ODN within the same nanoemulsion enhanced the frequency of splenocytes secreting IFN-gamma significantly (P < 0.01) when compared with immunization using MG7 peptide encapsulated in nanoemulsion alone (197spots/1 x 10(6) vs. 73 spots/1 x 10(6)). Cellular ELISA indicated that serum titer of antibody against MG7-Ag was significantly higher (P < 0.01) in mice immunized with coencapsulation form nanovaccine (0.7884) than that in the group immunized with nanovaccine encapsulated with MG7 peptide alone (0.3616). Using intracellular flow cytometric analysis, it was found that the IFN-gamma response was contributed by CD4+ T-cells. Our experiments suggest that a vaccinal approach using nano-delivery system carrying in tumoral epitope and CpG ODN as adjuvant may have important implications for cancer therapy.

  3. Hypermethylation of the Human Glutathione S-Transferase-π Gene (GSTP1) CpG Island Is Present in a Subset of Proliferative Inflammatory Atrophy Lesions but Not in Normal or Hyperplastic Epithelium of the Prostate

    PubMed Central

    Nakayama, Masashi; Bennett, Christina J.; Hicks, Jessica L.; Epstein, Jonathan I.; Platz, Elizabeth A.; Nelson, William G.; De Marzo, Angelo M.

    2003-01-01

    Somatic inactivation of the glutathione S-transferase-π gene (GSTP1) via CpG island hypermethylation occurs early during prostate carcinogenesis, present in ∼70% of high-grade prostatic intraepithelial neoplasia (high-grade PIN) lesions and more than 90% of adenocarcinomas. Recently, there has been a resurgence of the concept that foci of prostatic atrophy (referred to as proliferative inflammatory atrophy or PIA) may be precursor lesions for the development of prostate cancer and/or high-grade PIN. Many of the cells within PIA lesions contain elevated levels of GSTP1, glutathione S-transferase-α (GSTA1), and cyclooxygenase-II proteins, suggesting a stress response. Because not all PIA cells are positive for GSTP1 protein, we hypothesized that some of the cells within these regions acquire GSTP1 CpG island hypermethylation, increasing the chance of progression to high-grade PIN and/or adenocarcinoma. Separate regions (n =199) from 27 formalin-fixed paraffin-embedded prostates were microdissected by laser-capture microdissection (Arcturus PixCell II). These regions included normal epithelium (n = 48), hyperplasticepithelium from benign prostatic hyperplasia nodules (n = 22), PIA (n = 64), high-grade PIN (n = 32), and adenocarcinoma (n = 33). Genomic DNA was isolated and assessed for GSTP1 CpG island hypermethylation by methylation-specific polymerase chain reaction. GSTP1 CpG island hypermethylation was not detected in normal epithelium (0 of 48) or in hyperplastic epithelium (0 of 22), but was found in 4 of 64 (6.3%) PIA lesions. The difference in the frequency of GSTP1 CpG island hypermethylation between normal or hyperplastic epithelium and PIA was statistically significant (P = 0.049). Similar to studies using nonmicrodissected cases, hypermethylation was found in 22 of 32 (68.8%) high-grade PIN lesions and in 30 of 33 (90.9%) adenocarcinoma lesions. Unlike normal or hyperplastic epithelium, GSTP1 CpG island hypermethylation can be detected in some PIA lesions. These data support the hypothesis that atrophic epithelium in a subset of PIA lesions may lead to high-grade PIN and/or adenocarcinoma. Because these atrophic lesions are so prevalent and extensive, even though only a small subset contains this somatic DNA alteration, the clinical impact may be substantial. PMID:12937133

  4. DNA methylation and exposure to ambient air pollution in two prospective cohorts.

    PubMed

    Plusquin, Michelle; Guida, Florence; Polidoro, Silvia; Vermeulen, Roel; Raaschou-Nielsen, Ole; Campanella, Gianluca; Hoek, Gerard; Kyrtopoulos, Soterios A; Georgiadis, Panagiotis; Naccarati, Alessio; Sacerdote, Carlotta; Krogh, Vittorio; Bas Bueno-de-Mesquita, H; Monique Verschuren, W M; Sayols-Baixeras, Sergi; Panni, Tommaso; Peters, Annette; Hebels, Dennie G A J; Kleinjans, Jos; Vineis, Paolo; Chadeau-Hyam, Marc

    2017-11-01

    Long-term exposure to air pollution has been associated with several adverse health effects including cardiovascular, respiratory diseases and cancers. However, underlying molecular alterations remain to be further investigated. The aim of this study is to investigate the effects of long-term exposure to air pollutants on (a) average DNA methylation at functional regions and, (b) individual differentially methylated CpG sites. An assumption is that omic measurements, including the methylome, are more sensitive to low doses than hard health outcomes. This study included blood-derived DNA methylation (Illumina-HM450 methylation) for 454 Italian and 159 Dutch participants from the European Prospective Investigation into Cancer and Nutrition (EPIC). Long-term air pollution exposure levels, including NO 2 , NO x , PM 2.5 , PM coarse , PM 10 , PM 2.5 absorbance (soot) were estimated using models developed within the ESCAPE project, and back-extrapolated to the time of sampling when possible. We meta-analysed the associations between the air pollutants and global DNA methylation, methylation in functional regions and epigenome-wide methylation. CpG sites found differentially methylated with air pollution were further investigated for functional interpretation in an independent population (EnviroGenoMarkers project), where (N=613) participants had both methylation and gene expression data available. Exposure to NO 2 was associated with a significant global somatic hypomethylation (p-value=0.014). Hypomethylation of CpG island's shores and shelves and gene bodies was significantly associated with higher exposures to NO 2 and NO x . Meta-analysing the epigenome-wide findings of the 2 cohorts did not show genome-wide significant associations at single CpG site level. However, several significant CpG were found if the analyses were separated by countries. By regressing gene expression levels against methylation levels of the exposure-related CpG sites, we identified several significant CpG-transcript pairs and highlighted 5 enriched pathways for NO 2 and 9 for NO x mainly related to the immune system and its regulation. Our findings support results on global hypomethylation associated with air pollution, and suggest that the shores and shelves of CpG islands and gene bodies are mostly affected by higher exposure to NO 2 and NO x . Functional differences in the immune system were suggested by transcriptome analyses. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. The relationship between psychological symptoms, lung function and quality of life in children and adolescents with non-cystic fibrosis bronchiectasis.

    PubMed

    Bahali, Kayhan; Gedik, Ahmet Hakan; Bilgic, Ayhan; Cakir, Erkan; Ustabas Kahraman, Feyza; Keskin Osmanoglu, Nurcan; Uzuner, Selcuk; Kilicoglu, Ali Guven

    2014-01-01

    The aim of this study was to evaluate the relationship between psychological symptoms and quality of life (QOL) and clinical variables in a cohort of children and adolescents with non-cystic fibrosis (non-CF) bronchiectasis. Seventy-six patients (aged 8-17years) participated in this study. Questionnaires were used to evaluate the psychological status and QOL of the patients and healthy controls. The patient and control groups were divided into child and adolescent groups to exclude the effect of puberty on psychological status. No significant difference was found between patient and control groups for mean depression and trait anxiety scores. Only the child-rated physical health QOL scores were significantly lower for patients than the controls. Also, excepting physical health scores in adolescent group, all of the parent-rated QOL scores were significantly lower in both group and total subjects. Regarding determinants of QOL, age of children and FEV1/FVC percent predicted had positive effects, while dyspnea severity and trait anxiety had negative effects, for the sample as a whole. Non-CF bronchiectasis is associated with poorer QOL in childhood. The impact of the disease on QOL occurs through both clinical and psychological variables. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Anxiety Associated Increased CpG Methylation in the Promoter of Asb1: A Translational Approach Evidenced by Epidemiological and Clinical Studies and a Murine Model.

    PubMed

    Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz

    2018-01-01

    Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32-72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress-responsive Asb1 gene in anxiety-related phenotypes. Further studies are necessary to elucidate the causal direction of this association and the potential role of Asb1-mediated immune dysregulation in anxiety disorders.

  7. Anxiety Associated Increased CpG Methylation in the Promoter of Asb1: A Translational Approach Evidenced by Epidemiological and Clinical Studies and a Murine Model

    PubMed Central

    Emeny, Rebecca T; Baumert, Jens; Zannas, Anthony S; Kunze, Sonja; Wahl, Simone; Iurato, Stella; Arloth, Janine; Erhardt, Angelika; Balsevich, Georgia; Schmidt, Mathias V; Weber, Peter; Kretschmer, Anja; Pfeiffer, Liliane; Kruse, Johannes; Strauch, Konstantin; Roden, Michael; Herder, Christian; Koenig, Wolfgang; Gieger, Christian; Waldenberger, Melanie; Peters, Annette; Binder, Elisabeth B; Ladwig, Karl-Heinz

    2018-01-01

    Epigenetic regulation in anxiety is suggested, but evidence from large studies is needed. We conducted an epigenome-wide association study (EWAS) on anxiety in a population-based cohort and validated our finding in a clinical cohort as well as a murine model. In the KORA cohort, participants (n=1522, age 32–72 years) were administered the Generalized Anxiety Disorder (GAD-7) instrument, whole blood DNA methylation was measured (Illumina 450K BeadChip), and circulating levels of hs-CRP and IL-18 were assessed in the association between anxiety and methylation. DNA methylation was measured using the same instrument in a study of patients with anxiety disorders recruited at the Max Planck Institute of Psychiatry (MPIP, 131 non-medicated cases and 169 controls). To expand our mechanistic understanding, these findings were reverse translated in a mouse model of acute social defeat stress. In the KORA study, participants were classified according to mild, moderate, or severe levels of anxiety (29.4%/6.0%/1.5%, respectively). Severe anxiety was associated with 48.5% increased methylation at a single CpG site (cg12701571) located in the promoter of the gene encoding Asb1 (β-coefficient=0.56 standard error (SE)=0.10, p (Bonferroni)=0.005), a protein hypothetically involved in regulation of cytokine signaling. An interaction between IL-18 and severe anxiety with methylation of this CpG cite showed a tendency towards significance in the total population (p=0.083) and a significant interaction among women (p=0.014). Methylation of the same CpG was positively associated with Panic and Agoraphobia scale (PAS) scores (β=0.005, SE=0.002, p=0.021, n=131) among cases in the MPIP study. In a murine model of acute social defeat stress, Asb1 gene expression was significantly upregulated in a tissue-specific manner (p=0.006), which correlated with upregulation of the neuroimmunomodulating cytokine interleukin 1 beta. Our findings suggest epigenetic regulation of the stress-responsive Asb1 gene in anxiety-related phenotypes. Further studies are necessary to elucidate the causal direction of this association and the potential role of Asb1-mediated immune dysregulation in anxiety disorders. PMID:28540928

  8. A Sustained Dietary Change Increases Epigenetic Variation in Isogenic Mice

    PubMed Central

    Cowley, Mark J.; Preiss, Thomas; Martin, David I. K.; Suter, Catherine M.

    2011-01-01

    Epigenetic changes can be induced by adverse environmental exposures, such as nutritional imbalance, but little is known about the nature or extent of these changes. Here we have explored the epigenomic effects of a sustained nutritional change, excess dietary methyl donors, by assessing genomic CpG methylation patterns in isogenic mice exposed for one or six generations. We find stochastic variation in methylation levels at many loci; exposure to methyl donors increases the magnitude of this variation and the number of variable loci. Several gene ontology categories are significantly overrepresented in genes proximal to these methylation-variable loci, suggesting that certain pathways are susceptible to environmental influence on their epigenetic states. Long-term exposure to the diet (six generations) results in a larger number of loci exhibiting epigenetic variability, suggesting that some of the induced changes are heritable. This finding presents the possibility that epigenetic variation within populations can be induced by environmental change, providing a vehicle for disease predisposition and possibly a substrate for natural selection. PMID:21541011

  9. Collaborations between CpG sites in DNA methylation

    NASA Astrophysics Data System (ADS)

    Song, You; Ren, Honglei; Lei, Jinzhi

    2017-08-01

    DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

  10. Pathogenic mechanisms of intracellular bacteria.

    PubMed

    Niller, Hans Helmut; Masa, Roland; Venkei, Annamária; Mészáros, Sándor; Minarovits, Janos

    2017-06-01

    We wished to overview recent data on a subset of epigenetic changes elicited by intracellular bacteria in human cells. Reprogramming the gene expression pattern of various host cells may facilitate bacterial growth, survival, and spread. DNA-(cytosine C5)-methyltransferases of Mycoplasma hyorhinis targeting cytosine-phosphate-guanine (CpG) dinucleotides and a Mycobacterium tuberculosis methyltransferase targeting non-CpG sites methylated the host cell DNA and altered the pattern of gene expression. Gene silencing by CpG methylation and histone deacetylation, mediated by cellular enzymes, also occurred in M. tuberculosis-infected macrophages. M. tuberculosis elicited cell type-specific epigenetic changes: it caused increased DNA methylation in macrophages, but induced demethylation, deposition of euchromatic histone marks and activation of immune-related genes in dendritic cells. A secreted transposase of Acinetobacter baumannii silenced a cellular gene, whereas Mycobacterium leprae altered the epigenotype, phenotype, and fate of infected Schwann cells. The 'keystone pathogen' oral bacterium Porphyromonas gingivalis induced local DNA methylation and increased the level of histone acetylation in host cells. These epigenetic changes at the biofilm-gingiva interface may contribute to the development of periodontitis. Epigenetic regulators produced by intracellular bacteria alter the epigenotype and gene expression pattern of host cells and play an important role in pathogenesis.

  11. KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands

    PubMed Central

    Farcas, Anca M; Blackledge, Neil P; Sudbery, Ian; Long, Hannah K; McGouran, Joanna F; Rose, Nathan R; Lee, Sheena; Sims, David; Cerase, Andrea; Sheahan, Thomas W; Koseki, Haruhiko; Brockdorff, Neil; Ponting, Chris P; Kessler, Benedikt M; Klose, Robert J

    2012-01-01

    CpG islands (CGIs) are associated with most mammalian gene promoters. A subset of CGIs act as polycomb response elements (PREs) and are recognized by the polycomb silencing systems to regulate expression of genes involved in early development. How CGIs function mechanistically as nucleation sites for polycomb repressive complexes remains unknown. Here we discover that KDM2B (FBXL10) specifically recognizes non-methylated DNA in CGIs and recruits the polycomb repressive complex 1 (PRC1). This contributes to histone H2A lysine 119 ubiquitylation (H2AK119ub1) and gene repression. Unexpectedly, we also find that CGIs are occupied by low levels of PRC1 throughout the genome, suggesting that the KDM2B-PRC1 complex may sample CGI-associated genes for susceptibility to polycomb-mediated silencing. These observations demonstrate an unexpected and direct link between recognition of CGIs by KDM2B and targeting of the polycomb repressive system. This provides the basis for a new model describing the functionality of CGIs as mammalian PREs. DOI: http://dx.doi.org/10.7554/eLife.00205.001 PMID:23256043

  12. CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas.

    PubMed

    Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

    2014-05-01

    CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance.

  13. CpG island methylator phenotype and its association with malignancy in sporadic duodenal adenomas

    PubMed Central

    Sun, Lifeng; Guzzetta, Angela A; Fu, Tao; Chen, Jinming; Jeschke, Jana; Kwak, Ruby; Vatapalli, Rajita; Baylin, Stephen B; Iacobuzio-Donahue, Christine A; Wolfgang, Christopher L; Ahuja, Nita

    2014-01-01

    CpG island methylator phenotype (CIMP) has been found in multiple precancerous and cancerous lesions, including colorectal adenomas, colorectal cancers, and duodenal adenocarcinomas. There are no reports in the literature of a relationship between CIMP status and clinicopathologic features of sporadic duodenal adenomas. This study sought to elucidate the role of methylation in duodenal adenomas and correlate it with KRAS and BRAF mutations. CIMP+ (with more than 2 markers methylated) was seen in 33.3% of duodenal adenomas; 61% of these CIMP+ adenomas were CIMP-high (with more than 3 markers methylated). Furthermore, CIMP+ status significantly correlated with older age of patients, larger size and villous type of tumor, coexistent dysplasia and periampullary location. MLH1 methylation was seen in 11.1% of duodenal adenomas and was significantly associated with CIMP+ tumors, while p16 methylation was an infrequent event. KRAS mutations were frequent and seen in 26.3% of adenomas; however, no BRAF mutations were detected. Furthermore, CIMP-high status was associated with larger size and villous type of tumor and race (non-white). These results suggest that CIMP+ duodenal adenomas may have a higher risk for developing malignancy and may require more aggressive management and surveillance. PMID:24518818

  14. Long-Range Correlations in Stride Intervals May Emerge from Non-Chaotic Walking Dynamics

    PubMed Central

    Ahn, Jooeun; Hogan, Neville

    2013-01-01

    Stride intervals of normal human walking exhibit long-range temporal correlations. Similar to the fractal-like behaviors observed in brain and heart activity, long-range correlations in walking have commonly been interpreted to result from chaotic dynamics and be a signature of health. Several mathematical models have reproduced this behavior by assuming a dominant role of neural central pattern generators (CPGs) and/or nonlinear biomechanics to evoke chaos. In this study, we show that a simple walking model without a CPG or biomechanics capable of chaos can reproduce long-range correlations. Stride intervals of the model revealed long-range correlations observed in human walking when the model had moderate orbital stability, which enabled the current stride to affect a future stride even after many steps. This provides a clear counterexample to the common hypothesis that a CPG and/or chaotic dynamics is required to explain the long-range correlations in healthy human walking. Instead, our results suggest that the long-range correlation may result from a combination of noise that is ubiquitous in biological systems and orbital stability that is essential in general rhythmic movements. PMID:24086274

  15. Crossovers are associated with mutation and biased gene conversion at recombination hotspots.

    PubMed

    Arbeithuber, Barbara; Betancourt, Andrea J; Ebner, Thomas; Tiemann-Boege, Irene

    2015-02-17

    Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination.

  16. Crossovers are associated with mutation and biased gene conversion at recombination hotspots

    PubMed Central

    Arbeithuber, Barbara; Betancourt, Andrea J.; Ebner, Thomas; Tiemann-Boege, Irene

    2015-01-01

    Meiosis is a potentially important source of germline mutations, as sites of meiotic recombination experience recurrent double-strand breaks (DSBs). However, evidence for a local mutagenic effect of recombination from population sequence data has been equivocal, likely because mutation is only one of several forces shaping sequence variation. By sequencing large numbers of single crossover molecules obtained from human sperm for two recombination hotspots, we find direct evidence that recombination is mutagenic: Crossovers carry more de novo mutations than nonrecombinant DNA molecules analyzed for the same donors and hotspots. The observed mutations were primarily CG to TA transitions, with a higher frequency of transitions at CpG than non-CpGs sites. This enrichment of mutations at CpG sites at hotspots could predominate in methylated regions involving frequent single-stranded DNA processing as part of DSB repair. In addition, our data set provides evidence that GC alleles are preferentially transmitted during crossing over, opposing mutation, and shows that GC-biased gene conversion (gBGC) predominates over mutation in the sequence evolution of hotspots. These findings are consistent with the idea that gBGC could be an adaptation to counteract the mutational load of recombination. PMID:25646453

  17. Changes in DNA methylation over the growing season differ between North Carolina farmworkers and non-farmworkers.

    PubMed

    Howard, Timothy D; Hsu, Fang-Chi; Chen, Haiying; Quandt, Sara A; Talton, Jennifer W; Summers, Phillip; Arcury, Thomas A

    2016-10-01

    The occupational risk to farmworkers, particularly chronic exposure to pesticides, is an acknowledged environmental and work-related health problem. Epigenetics has recently been shown to contribute to a number of complex diseases and traits, including measures of cognitive function and preclinical neurodegenerative disease. We sought to determine whether changes in DNA methylation existed between farmworker and non-farmworker populations and to identify the genes most likely involved in those changes. Eighty-three farmworkers and 60 non-farmworkers were selected from PACE4, a community-based, participatory research project comparing occupational exposures between immigrant Latino farmworker and non-farmworker manual workers. Measurements of DNA methylation were performed with the Infinium HumanMethylation450 BeadChip, at the beginning and end of the 2012 growing season. Bonferroni adjustment was used to identify significant findings (p = 1.03 × 10(-7), based on 485,000 tested methylation sites), although less stringent criteria (i.e., p ≤ 1 × 10(-6)) were used to identify sites of interest. Expression quantitative trait locus (eQTL) databases were used to help identify the most likely functional genes for each associated methylation site. Methylation at 36 CpG sites, located in or near 72 genes, differed between the two groups (p ≤ 1 × 10(-6)). The difference between the two groups was generally due to an increase in methylation in the farmworkers and a slight decrease in methylation in the non-farmworkers. Enrichment was observed in several biological pathways, including those involved in the immune response, as well as growth hormone signaling, role of BRCA1 in DNA damage response, p70S6K signaling, and PI3K signaling in B lymphocytes. We identified considerable changes in DNA methylation at 36 CpG sites over the growing season that differed between farmworkers and non-farmworkers. Dominant pathways included immune-related (HLA) processes, as well as a number of diverse biological systems. Further studies are necessary to determine which exposures or behaviors are responsible for the observed changes, and whether these changes eventually lead to disease-related phenotypes in this population.

  18. Some algebraic clues towards a syntactic view on the Principles of Non-Contradiction and Excluded-Middle

    NASA Astrophysics Data System (ADS)

    Trillas, E.; García-Honrado, I.; Termini, S.

    2014-02-01

    This short paper just considers the possibility of a new view for posing and proving Aristotle's Principles of Non-Contradiction and Excluded-Middle. It is done by means of their refutability, or deducibility, respectively, under Tarski's Consequence Operators.

  19. Impact of neonatal iron deficiency on hippocampal DNA methylation and gene transcription in a porcine biomedical model of cognitive development.

    PubMed

    Schachtschneider, Kyle M; Liu, Yingkai; Rund, Laurie A; Madsen, Ole; Johnson, Rodney W; Groenen, Martien A M; Schook, Lawrence B

    2016-11-03

    Iron deficiency is a common childhood micronutrient deficiency that results in altered hippocampal function and cognitive disorders. However, little is known about the mechanisms through which neonatal iron deficiency results in long lasting alterations in hippocampal gene expression and function. DNA methylation is an epigenetic mark involved in gene regulation and altered by environmental factors. In this study, hippocampal DNA methylation and gene expression were assessed via reduced representation bisulfite sequencing and RNA-seq on samples from a previous study reporting reduced hippocampal-based learning and memory in a porcine biomedical model of neonatal iron deficiency. In total 192 differentially expressed genes (DEGs) were identified between the iron deficient and control groups. GO term and pathway enrichment analysis identified DEGs associated with hypoxia, angiogenesis, increased blood brain barrier (BBB) permeability, and altered neurodevelopment and function. Of particular interest are genes previously implicated in cognitive deficits and behavioral disorders in humans and mice, including HTR2A, HTR2C, PAK3, PRSS12, and NETO1. Altered genome-wide DNA methylation was observed across 0.5 million CpG and 2.4 million non-CpG sites. In total 853 differentially methylated (DM) CpG and 99 DM non-CpG sites were identified between groups. Samples clustered by group when comparing DM non-CpG sites, suggesting high conservation of non-CpG methylation in response to neonatal environment. In total 12 DM sites were associated with 9 DEGs, including genes involved in angiogenesis, neurodevelopment, and neuronal function. Neonatal iron deficiency leads to altered hippocampal DNA methylation and gene regulation involved in hypoxia, angiogenesis, increased BBB permeability, and altered neurodevelopment and function. Together, these results provide new insights into the mechanisms through which neonatal iron deficiency results in long lasting reductions in cognitive development in humans.

  20. Cognitive skills assessment during robot-assisted surgery: separating the wheat from the chaff.

    PubMed

    Guru, Khurshid A; Esfahani, Ehsan T; Raza, Syed J; Bhat, Rohit; Wang, Katy; Hammond, Yana; Wilding, Gregory; Peabody, James O; Chowriappa, Ashirwad J

    2015-01-01

    To investigate the utility of cognitive assessment during robot-assisted surgery (RAS) to define skills in terms of cognitive engagement, mental workload, and mental state; while objectively differentiating between novice and expert surgeons. In all, 10 surgeons with varying operative experience were assigned to beginner (BG), combined competent and proficient (CPG), and expert (EG) groups based on the Dreyfus model. The participants performed tasks for basic, intermediate and advanced skills on the da Vinci Surgical System. Participant performance was assessed using both tool-based and cognitive metrics. Tool-based metrics showed significant differences between the BG vs CPG and the BG vs EG, in basic skills. While performing intermediate skills, there were significant differences only on the instrument-to-instrument collisions between the BG vs CPG (2.0 vs 0.2, P = 0.028), and the BG vs EG (2.0 vs 0.1, P = 0.018). There were no significant differences between the CPG and EG for both basic and intermediate skills. However, using cognitive metrics, there were significant differences between all groups for the basic and intermediate skills. In advanced skills, there were no significant differences between the CPG and the EG except time (1116 vs 599.6 s), using tool-based metrics. However, cognitive metrics revealed significant differences between both groups. Cognitive assessment of surgeons may aid in defining levels of expertise performing complex surgical tasks once competence is achieved. Cognitive assessment may be used as an adjunct to the traditional methods for skill assessment during RAS. © 2014 The Authors. BJU International © 2014 BJU International.

  1. DNA methylation analysis of phenotype specific stratified Indian population.

    PubMed

    Rotti, Harish; Mallya, Sandeep; Kabekkodu, Shama Prasada; Chakrabarty, Sanjiban; Bhale, Sameer; Bharadwaj, Ramachandra; Bhat, Balakrishna K; Dedge, Amrish P; Dhumal, Vikram Ram; Gangadharan, G G; Gopinath, Puthiya M; Govindaraj, Periyasamy; Joshi, Kalpana S; Kondaiah, Paturu; Nair, Sreekumaran; Nair, S N Venugopalan; Nayak, Jayakrishna; Prasanna, B V; Shintre, Pooja; Sule, Mayura; Thangaraj, Kumarasamy; Patwardhan, Bhushan; Valiathan, Marthanda Varma Sankaran; Satyamoorthy, Kapaettu

    2015-05-08

    DNA methylation and its perturbations are an established attribute to a wide spectrum of phenotypic variations and disease conditions. Indian traditional system practices personalized medicine through indigenous concept of distinctly descriptive physiological, psychological and anatomical features known as prakriti. Here we attempted to establish DNA methylation differences in these three prakriti phenotypes. Following structured and objective measurement of 3416 subjects, whole blood DNA of 147 healthy male individuals belonging to defined prakriti (Vata, Pitta and Kapha) between the age group of 20-30years were subjected to methylated DNA immunoprecipitation (MeDIP) and microarray analysis. After data analysis, prakriti specific signatures were validated through bisulfite DNA sequencing. Differentially methylated regions in CpG islands and shores were significantly enriched in promoters/UTRs and gene body regions. Phenotypes characterized by higher metabolism (Pitta prakriti) in individuals showed distinct promoter (34) and gene body methylation (204), followed by Vata prakriti which correlates to motion showed DNA methylation in 52 promoters and 139 CpG islands and finally individuals with structural attributes (Kapha prakriti) with 23 and 19 promoters and CpG islands respectively. Bisulfite DNA sequencing of prakriti specific multiple CpG sites in promoters and 5'-UTR such as; LHX1 (Vata prakriti), SOX11 (Pitta prakriti) and CDH22 (Kapha prakriti) were validated. Kapha prakriti specific CDH22 5'-UTR CpG methylation was also found to be associated with higher body mass index (BMI). Differential DNA methylation signatures in three distinct prakriti phenotypes demonstrate the epigenetic basis of Indian traditional human classification which may have relevance to personalized medicine.

  2. Differential DNA Methylation in Relation to Age and Health Risks of Obesity.

    PubMed

    Mansego, María Luisa; Milagro, Fermín I; Zulet, María Ángeles; Moreno-Aliaga, María J; Martínez, José Alfredo

    2015-07-24

    The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO); defined according to BMI categories as "Low HRO" (overweight and class 1 obesity) versus "High HRO" (class 2 and class 3 obesity). Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA) study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study). In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.

  3. Base Excision Repair of Tandem Modifications in a Methylated CpG Dinucleotide*

    PubMed Central

    Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S.; Beard, William A.; Wilson, Samuel H.

    2014-01-01

    Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3′-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5′-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide. PMID:24695738

  4. Real-time biomimetic Central Pattern Generators in an FPGA for hybrid experiments

    PubMed Central

    Ambroise, Matthieu; Levi, Timothée; Joucla, Sébastien; Yvert, Blaise; Saïghi, Sylvain

    2013-01-01

    This investigation of the leech heartbeat neural network system led to the development of a low resources, real-time, biomimetic digital hardware for use in hybrid experiments. The leech heartbeat neural network is one of the simplest central pattern generators (CPG). In biology, CPG provide the rhythmic bursts of spikes that form the basis for all muscle contraction orders (heartbeat) and locomotion (walking, running, etc.). The leech neural network system was previously investigated and this CPG formalized in the Hodgkin–Huxley neural model (HH), the most complex devised to date. However, the resources required for a neural model are proportional to its complexity. In response to this issue, this article describes a biomimetic implementation of a network of 240 CPGs in an FPGA (Field Programmable Gate Array), using a simple model (Izhikevich) and proposes a new synapse model: activity-dependent depression synapse. The network implementation architecture operates on a single computation core. This digital system works in real-time, requires few resources, and has the same bursting activity behavior as the complex model. The implementation of this CPG was initially validated by comparing it with a simulation of the complex model. Its activity was then matched with pharmacological data from the rat spinal cord activity. This digital system opens the way for future hybrid experiments and represents an important step toward hybridization of biological tissue and artificial neural networks. This CPG network is also likely to be useful for mimicking the locomotion activity of various animals and developing hybrid experiments for neuroprosthesis development. PMID:24319408

  5. Intensive hypermethylation of the CpG island of Ras association domain family 1A in hepatitis B virus-associated hepatocellular carcinomas.

    PubMed

    Zhong, Sheng; Yeo, Winnie; Tang, Mandy W; Wong, Nathalie; Lai, Paul B S; Johnson, Phillip J

    2003-08-15

    The human Ras association domain family 1A gene (RASSF1A) is a newly isolated tumor suppressor gene. In this study, we analyzed the methylation status of the promoter region of RASSF1A using bisulfite sequencing and PCR-RFLP in four liver cancer cell lines (Hep3B, HepG(2), SK-HEP-1, and Huh-7) and a cohort of 43 hepatitis B virus-associated hepatocellular carcinoma (HCC) tissues and their corresponding nontumor tissue specimens. The methylation of the CpG islands in the RASSF1A promoter was not detected in 4 samples of normal liver tissue or 10 samples of peripheral blood mononuclear cells from normal subjects. However, the CpG islands were completely methylated, and transcription of the RASSF1A was silenced in the four cell lines. Treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine reactivated the expression of RASSF1A in the Hep3B and HepG2 cells. In 41 of 43 (95%) HCC specimens studied, the promoter region of RASSF1A was intensively methylated at its CpG sites. Although heterogeneous methylation was also detected in 16 of the 23 (70%) corresponding nontumorous tissues analyzed, the level of methylation was significantly lower than in the corresponding tumor tissues. HCC has the highest incidence of promoter methylation of RASSF1A among all malignancies yet reported suggesting that hypermethylation of the CpG island promoter of RASSF1A may play an important pathological role in this tumor.

  6. Preliminary evaluation of cytosine-phosphate-guanine oligodeoxynucleotides bound to gelatine nanoparticles as immunotherapy for canine atopic dermatitis.

    PubMed

    Wagner, I; Geh, K J; Hubert, M; Winter, G; Weber, K; Classen, J; Klinger, C; Mueller, R S

    2017-07-29

    Cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODN) are a promising new immunotherapeutic treatment option for canine atopic dermatitis (AD). The aim of this uncontrolled pilot study was to evaluate clinical and immunological effects of gelatine nanoparticle (GNP)-bound CpG ODN (CpG GNP) on atopic dogs. Eighteen dogs with AD were treated for 8 weeks (group 1, n=8) or 18 weeks (group 2, n=10). Before inclusion and after 2 weeks, 4 weeks, 6 weeks (group 1+2), 8 weeks, 12 weeks and 16 weeks (group 2) 75 µg CpG ODN/dog (bound to 1.5 mg GNP) were injected subcutaneously. Pruritus was evaluated daily by the owner. Lesions were evaluated and serum concentrations and mRNA expressions of interferon-γ, tumour necrosis factor-α, transforming growth factor-β, interleukin (IL) 10 and IL-4 (only mRNA expression) were determined at inclusion and after 8 weeks (group 1+2) and 18 weeks (group 2). Lesions and pruritus improved significantly from baseline to week 8. Mean improvements from baseline to week 18 were 23 per cent and 44 per cent for lesions and pruritus, respectively, an improvement of ≥50 per cent was seen in six out of nine and three out of six dogs, respectively. IL-4 mRNA expression decreased significantly. The results of this study show a clinical improvement of canine AD with CpG GNP comparable to allergen immunotherapy. Controlled studies are needed to confirm these findings. British Veterinary Association.

  7. Multilevel Analysis of Locomotion in Immature Preparations Suggests Innovative Strategies to Reactivate Stepping after Spinal Cord Injury.

    PubMed

    Brumley, Michele R; Guertin, Pierre A; Taccola, Giuliano

    2017-01-01

    Locomotion is one of the most complex motor behaviors. Locomotor patterns change during early life, reflecting development of numerous peripheral and hierarchically organized central structures. Among them, the spinal cord is of particular interest since it houses the central pattern generator (CPG) for locomotion. This main command center is capable of eliciting and coordinating complex series of rhythmic neural signals sent to motoneurons and to corresponding target-muscles for basic locomotor activity. For a long-time, the CPG has been considered a black box. In recent years, complementary insights from in vitro and in vivo animal models have contributed significantly to a better understanding of its constituents, properties and ways to recover locomotion after a spinal cord injury (SCI). This review discusses key findings made by comparing the results of in vitro isolated spinal cord preparations and spinal-transected in vivo models from neonatal animals. Pharmacological, electrical, and sensory stimulation approaches largely used to further understand CPG function may also soon become therapeutic tools for potent CPG reactivation and locomotor movement induction in persons with SCI or developmental neuromuscular disorder. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. A Systematic Review of the Impact of Alcohol Use Disorders on HIV Treatment Outcomes, Adherence to Antiretroviral Therapy and Health Care Utilization *

    PubMed Central

    Azar, Marwan M.; Springer, Sandra A.; Meyer, Jaimie P.; Altice, Frederick L.

    2010-01-01

    Background Alcohol use disorders (AUDs) are highly prevalent and associated with non-adherence to antiretroviral therapy, decreased health care utilization and poor HIV treatment outcomes among HIV-infected individuals. Objectives To systematically review studies assessing the impact of AUDs on: (1) medication adherence, (2) health care utilization and (3) biological treatment outcomes among people living with HIV/AIDS (PLWHA). Data Sources Six electronic databases and Google Scholar were queried for articles published in English, French and Spanish from 1988 to 2010. Selected references from primary articles were also examined. Review Methods Selection criteria included: 1) AUD and adherence (N=20); 2) AUD and health services utilization (N=11); or 3) AUD with CD4 count or HIV-1 RNA treatment outcomes (N=10). Reviews, animal studies, non-peer reviewed documents and ongoing studies with unpublished data were excluded. Studies that did not differentiate HIV+ from HIV- status and those that did not distinguish between drug and alcohol use were also excluded. Data were extracted, appraised and summarized. Data Synthesis and Conclusions Our findings consistently support an association between AUDs and decreased adherence to antiretroviral therapy and poor HIV treatment outcomes among HIV-infected individuals. Their effect on health care utilization, however, was variable. PMID:20705402

  9. Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

    PubMed

    McCluskie, M J; Krieg, A M

    2006-01-01

    The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

  10. In vitro induction of T regulatory cells by a methylated CpG DNA sequence in humans: Potential therapeutic applications in allergic and autoimmune diseases.

    PubMed

    Lawless, Oliver J; Bellanti, Joseph A; Brown, Milton L; Sandberg, Kathryn; Umans, Jason G; Zhou, Li; Chen, Weiqian; Wang, Julie; Wang, Kan; Zheng, Song Guo

    2018-03-01

    Allergic and autoimmune diseases comprise a group of inflammatory disorders caused by aberrant immune responses in which CD25+ Forkhead box P3-positive (FOXP3+) T regulatory (Treg) cells that normally suppress inflammatory events are often poorly functioning. This has stimulated an intensive investigative effort to find ways of increasing Tregs as a method of therapy for these conditions. One such line of investigation includes the study of how ligation of Toll-like receptors (TLRs) by CpG oligonucleotides (ODN) results in an immunostimulatory cascade that leads to induction of T-helper (Th) type 1 and Treg-type immune responses. The present study investigated the mechanisms by which calf thymus mammalian double-stranded DNA (CT-DNA) and a synthetic methylated DNA CpG ODN sequence suppress in vitro lymphoproliferative responses to antigens, mitogens, and alloantigens when measured by [3H]-thymidine incorporation and promote FoxP3 expression in human CD4+ T cells in the presence of transforming growth factor (TGF) beta and interleukin-2 (IL-2). Lymphoproliferative responses of peripheral blood mononuclear cells from four healthy subjects or nine subjects with systemic lupus erythematosus to CT-DNA or phytohemagglutinin (PHA) was measured by tritiated thymidine ([3H]-TdR) incorporation expressed as a stimulation index. Mechanisms of immunosuppressive effects of CT-DNA were evaluated by measurement of the degree of inhibition to lymphoproliferative responses to streptokinase-streptodornase, phytohemagglutinin (PHA), concanavalin A (Con A), pokeweed mitogen (PWM), or alloantigens by a Con A suppressor assay. The effects of CpG methylation on induction of FoxP3 expression in human T cells were measured by comparing inhibitory responses of synthetic methylated and nonmethylated 8-mer CpG ODN sequences by using cell sorting, in vitro stimulation, and suppressor assay. Here, we showed that CT-DNA and a synthetic methylated DNA 8-mer sequence could suppress antigen-, mitogen-, and alloantigen-induced lymphoproliferation in vitro when measured by [3H]-thymidine. The synthetic methylated DNA CpG ODN but not an unmethylated CpG ODN sequence was shown to promote FoxP3 expression in human CD4+ T cells in the presence of TGF beta and IL-2. The induction of FoxP3+ suppressor cells is dose dependent and offers a potential clinical therapeutic application in allergic and autoimmune and inflammatory diseases. The use of this methylated CpG ODN offers a broad clinical application as a novel therapeutic method for Treg induction and, because of its low cost and small size, should facilitate delivery via nasal, respiratory, gastrointestinal routes, and/or by injection, routes of administration important for vaccine delivery to target sites responsible for respiratory, gastrointestinal, and systemic forms of allergic and autoimmune disease.

  11. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs.

    PubMed

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing; Zeng, Ruihong; Wei, Lin

    2017-05-15

    Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8 + lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. Copyright © 2017 American Society for Microbiology.

  12. CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs

    PubMed Central

    Zhang, Lei; Li, Hongyong; Hai, Yan; Yin, Wei; Li, Wenjian; Zheng, Boyang; Du, Xiaomin; Li, Na; Zhang, Zhengzheng; Deng, Yuqing

    2017-01-01

    ABSTRACT Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs. IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD. PMID:28275186

  13. Arabidopsis thaliana telomeres exhibit euchromatic features

    PubMed Central

    Vaquero-Sedas, María I.; Gámez-Arjona, Francisco M.; Vega-Palas, Miguel A.

    2011-01-01

    Telomere function is influenced by chromatin structure and organization, which usually involves epigenetic modifications. We describe here the chromatin structure of Arabidopsis thaliana telomeres. Based on the study of six different epigenetic marks we show that Arabidopsis telomeres exhibit euchromatic features. In contrast, subtelomeric regions and telomeric sequences present at interstitial chromosomal loci are heterochromatic. Histone methyltransferases and the chromatin remodeling protein DDM1 control subtelomeric heterochromatin formation. Whereas histone methyltransferases are required for histone H3K92Me and non-CpG DNA methylation, DDM1 directs CpG methylation but not H3K92Me or non-CpG methylation. These results argue that both kinds of proteins participate in different pathways to reinforce subtelomeric heterochromatin formation. PMID:21071395

  14. Computer simulations of neural mechanisms explaining upper and lower limb excitatory neural coupling

    PubMed Central

    2010-01-01

    Background When humans perform rhythmic upper and lower limb locomotor-like movements, there is an excitatory effect of upper limb exertion on lower limb muscle recruitment. To investigate potential neural mechanisms for this behavioral observation, we developed computer simulations modeling interlimb neural pathways among central pattern generators. We hypothesized that enhancement of muscle recruitment from interlimb spinal mechanisms was not sufficient to explain muscle enhancement levels observed in experimental data. Methods We used Matsuoka oscillators for the central pattern generators (CPG) and determined parameters that enhanced amplitudes of rhythmic steady state bursts. Potential mechanisms for output enhancement were excitatory and inhibitory sensory feedback gains, excitatory and inhibitory interlimb coupling gains, and coupling geometry. We first simulated the simplest case, a single CPG, and then expanded the model to have two CPGs and lastly four CPGs. In the two and four CPG models, the lower limb CPGs did not receive supraspinal input such that the only mechanisms available for enhancing output were interlimb coupling gains and sensory feedback gains. Results In a two-CPG model with inhibitory sensory feedback gains, only excitatory gains of ipsilateral flexor-extensor/extensor-flexor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 26%. In a two-CPG model with excitatory sensory feedback gains, excitatory gains of contralateral flexor-flexor/extensor-extensor coupling produced reciprocal upper-lower limb bursts and enhanced output up to 100%. However, within a given excitatory sensory feedback gain, enhancement due to excitatory interlimb gains could only reach levels up to 20%. Interconnecting four CPGs to have ipsilateral flexor-extensor/extensor-flexor coupling, contralateral flexor-flexor/extensor-extensor coupling, and bilateral flexor-extensor/extensor-flexor coupling could enhance motor output up to 32%. Enhancement observed in experimental data exceeded 32%. Enhancement within this symmetrical four-CPG neural architecture was more sensitive to relatively small interlimb coupling gains. Excitatory sensory feedback gains could produce greater output amplitudes, but larger gains were required for entrainment compared to inhibitory sensory feedback gains. Conclusions Based on these simulations, symmetrical interlimb coupling can account for much, but not all of the excitatory neural coupling between upper and lower limbs during rhythmic locomotor-like movements. PMID:21143960

  15. Motor Neurons Tune Premotor Activity in a Vertebrate Central Pattern Generator

    PubMed Central

    2017-01-01

    Central patterns generators (CPGs) are neural circuits that drive rhythmic motor output without sensory feedback. Vertebrate CPGs are generally believed to operate in a top-down manner in which premotor interneurons activate motor neurons that in turn drive muscles. In contrast, the frog (Xenopus laevis) vocal CPG contains a functionally unexplored neuronal projection from the motor nucleus to the premotor nucleus, indicating a recurrent pathway that may contribute to rhythm generation. In this study, we characterized the function of this bottom-up connection. The X. laevis vocal CPG produces a 50–60 Hz “fast trill” song used by males during courtship. We recorded “fictive vocalizations” in the in vitro CPG from the laryngeal nerve while simultaneously recording premotor activity at the population and single-cell level. We show that transecting the motor-to-premotor projection eliminated the characteristic firing rate of premotor neurons. Silencing motor neurons with the intracellular sodium channel blocker QX-314 also disrupted premotor rhythms, as did blockade of nicotinic synapses in the motor nucleus (the putative location of motor neuron-to-interneuron connections). Electrically stimulating the laryngeal nerve elicited primarily IPSPs in premotor neurons that could be blocked by a nicotinic receptor antagonist. Our results indicate that an inhibitory signal, activated by motor neurons, is required for proper CPG function. To our knowledge, these findings represent the first example of a CPG in which precise premotor rhythms are tuned by motor neuron activity. SIGNIFICANCE STATEMENT Central pattern generators (CPGs) are neural circuits that produce rhythmic behaviors. In vertebrates, motor neurons are not commonly known to contribute to CPG function, with the exception of a few spinal circuits where the functional significance of motor neuron feedback is still poorly understood. The frog hindbrain vocal circuit contains a previously unexplored connection from the motor to premotor region. Our results indicate that motor neurons activate this bottom-up connection, and blocking this signal eliminates normal premotor activity. These findings may promote increased awareness of potential involvement of motor neurons in a wider range of CPGs, perhaps clarifying our understanding of network principles underlying motor behaviors in numerous organisms, including humans. PMID:28219984

  16. Randomized, double-blind, placebo-controlled, safety and immunogenicity study of 4 formulations of Anthrax Vaccine Adsorbed plus CPG 7909 (AV7909) in healthy adult volunteers.

    PubMed

    Hopkins, Robert J; Daczkowski, Nancy F; Kaptur, Paulina E; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L; Bernton, Edward

    2013-06-26

    A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax(®) (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18-50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA+0.5mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA+0.25mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA+0.5mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA+0.25mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Critical Points and Traveling Wave in Locomotion: Experimental Evidence and Some Theoretical Considerations.

    PubMed

    Saltiel, Philippe; d'Avella, Andrea; Tresch, Matthew C; Wyler, Kuno; Bizzi, Emilio

    2017-01-01

    The central pattern generator (CPG) architecture for rhythm generation remains partly elusive. We compare cat and frog locomotion results, where the component unrelated to pattern formation appears as a temporal grid, and traveling wave respectively. Frog spinal cord microstimulation with N-methyl-D-Aspartate (NMDA), a CPG activator, produced a limited set of force directions, sometimes tonic, but more often alternating between directions similar to the tonic forces. The tonic forces were topographically organized, and sites evoking rhythms with different force subsets were located close to the constituent tonic force regions. Thus CPGs consist of topographically organized modules. Modularity was also identified as a limited set of muscle synergies whose combinations reconstructed the EMGs. The cat CPG was investigated using proprioceptive inputs during fictive locomotion. Critical points identified both as abrupt transitions in the effect of phasic perturbations, and burst shape transitions, had biomechanical correlates in intact locomotion. During tonic proprioceptive perturbations, discrete shifts between these critical points explained the burst durations changes, and amplitude changes occurred at one of these points. Besides confirming CPG modularity, these results suggest a fixed temporal grid of anchoring points, to shift modules onsets and offsets. Frog locomotion, reconstructed with the NMDA synergies, showed a partially overlapping synergy activation sequence. Using the early synergy output evoked by NMDA at different spinal sites, revealed a rostrocaudal topographic organization, where each synergy is preferentially evoked from a few, albeit overlapping, cord regions. Comparing the locomotor synergy sequence with this topography suggests that a rostrocaudal traveling wave would activate the synergies in the proper sequence for locomotion. This output was reproduced in a two-layer model using this topography and a traveling wave. Together our results suggest two CPG components: modules, i.e., synergies; and temporal patterning, seen as a temporal grid in the cat, and a traveling wave in the frog. Animal and limb navigation have similarities. Research relating grid cells to the theta rhythm and on segmentation during navigation may relate to our temporal grid and traveling wave results. Winfree's mathematical work, combining critical phases and a traveling wave, also appears important. We conclude suggesting tracing, and imaging experiments to investigate our CPG model.

  18. Methylation analysis of plasma cell-free DNA for breast cancer early detection using bisulfite next-generation sequencing.

    PubMed

    Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun

    2016-10-01

    Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.

  19. Activation of the Alternative NFκB Pathway Improves Disease Symptoms in a Model of Sjogren's Syndrome

    PubMed Central

    Gilboa-Geffen, Adi; Wolf, Yochai; Hanin, Geula; Melamed-Book, Naomi; Pick, Marjorie; Bennett, Estelle R.; Greenberg, David S.; Lester, Susan; Rischmueller, Maureen; Soreq, Hermona

    2011-01-01

    The purpose of our study was to understand if Toll-like receptor 9 (TLR9) activation could contribute to the control of inflammation in Sjogren's syndrome. To this end, we manipulated TLR9 signaling in non-obese diabetic (NOD) and TLR9−/− mice using agonistic CpG oligonucleotide aptamers, TLR9 inhibitors, and the in-house oligonucleotide BL-7040. We then measured salivation, inflammatory response markers, and expression of proteins downstream to NF-κB activation pathways. Finally, we labeled proteins of interest in salivary gland biopsies from Sjogren's syndrome patients, compared to Sicca syndrome controls. We show that in NOD mice BL-7040 activates TLR9 to induce an alternative NF-κB activation mode resulting in increased salivation, elevated anti-inflammatory response in salivary glands, and reduced peripheral AChE activity. These effects were more prominent and also suppressible by TLR9 inhibitors in NOD mice, but TLR9−/− mice were resistant to the salivation-promoting effects of CpG oligonucleotides and BL-7040. Last, salivary glands from Sjogren's disease patients showed increased inflammatory and decreased anti-inflammatory biomarkers, in addition to decreased levels of alternative NF-κB pathway proteins. In summary, we have demonstrated that activation of TLR9 by BL-7040 leads to non-canonical activation of NF-κB, promoting salivary functioning and down-regulating inflammation. We propose that BL-7040 could be beneficial in treating Sjogren's syndrome and may be applicable to additional autoimmune syndromes. PMID:22174879

  20. Cardioprotective benefits of adenosine triphosphate-sensitive potassium channel opener diazoxide are lost with administration after the onset of stress in mouse and human myocytes.

    PubMed

    Janjua, M Burhan; Makepeace, Carol M; Anastacio, Melissa M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

    2014-10-01

    Adenosine triphosphate-sensitive (KATP) potassium channel opener diazoxide (DZX) maintains myocyte volume and contractility during stress via an unknown mechanism when administered at the onset of stress. This study was performed to investigate the cardioprotective potential of DZX when added after the onset of the stresses of hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress. Isolated mouse ventricular and human atrial myocytes were exposed to control Tyrode's solution (TYR) for 10 to 20 minutes, test solution for 30 minutes (hypothermic hyperkalemic cardioplegia [CPG], CPG + 100uM diazoxide [CPG+DZX], metabolic inhibition [MI], MI+DZX, mild hypo-osmotic stress [0.9T], or 0.9T + DZX), with DZX added after 10 or 20 minutes of stress, followed by 20 minutes of re-exposure to TYR (±DZX). Myocyte volume (human + mouse) and contractility (mouse) were compared. Mouse and human myocytes demonstrated significant swelling during exposure to CPG, MI, and hypo-osmotic stress that was not prevented by DZX when administered either at 10 or 20 minutes after the onset of stress. Contractility after the stress of CPG in mouse myocytes significantly declined when DZX was administered 20 minutes after the onset of stress (p < 0.05 vs TYR). Contractility after hypo-osmotic stress in mouse myocytes was not altered by the addition of DZX. To maintain myocyte volume homeostasis and contractility during stress (hyperkalemic cardioplegia, metabolic inhibition, and hypo-osmotic stress), KATP channel opener diazoxide requires administration at the onset of stress in this isolated myocyte model. These data have potential implications for any future clinical application of diazoxide. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

  1. Bisphenol A-associated epigenomic changes in prepubescent girls: a cross-sectional study in Gharbiah, Egypt

    PubMed Central

    2013-01-01

    Background There is now compelling evidence that epigenetic modifications link adult disease susceptibility to environmental exposures during specific life stages, including pre-pubertal development. Animal studies indicate that bisphenol A (BPA), the monomer used in epoxy resins and polycarbonate plastics, may impact health through epigenetic mechanisms, and epidemiological data associate BPA levels with metabolic disorders, behavior changes, and reproductive effects. Thus, we conducted an environmental epidemiology study of BPA exposure and CpG methylation in pre-adolescent girls from Gharbiah, Egypt hypothesizing that methylation profiles exhibit exposure-dependent trends. Methods Urinary concentrations of total (free plus conjugated) species of BPA in spot samples were quantified for 60 girls aged 10 to 13. Genome-wide CpG methylation was concurrently measured in bisulfite-converted saliva DNA using the Infinium HumanMethylation27 BeadChip (N = 46). CpG sites from four candidate genes were validated via quantitative bisulfite pyrosequencing. Results CpG methylation varied widely among girls, and higher urinary BPA concentrations were generally associated with less genomic methylation. Based on pathway analyses, genes exhibiting reduced methylation with increasing urinary BPA were involved in immune function, transport activity, metabolism, and caspase activity. In particular, hypomethylation of CpG targets on chromosome X was associated with higher urinary BPA. Using the Comparative Toxicogenomics Database, we identified a number of candidate genes in our sample that previously have been associated with BPA-related expression change. Conclusions These data indicate that BPA may affect human health through specific epigenomic modification of genes in relevant pathways. Thus, epigenetic epidemiology holds promise for the identification of biomarkers from previous exposures and the development of epigenetic-based diagnostic strategies. PMID:23590724

  2. Superior diastolic function with KATP channel opener diazoxide in a novel mouse Langendorff model.

    PubMed

    Makepeace, Carol M; Suarez-Pierre, Alejandro; Kanter, Evelyn M; Schuessler, Richard B; Nichols, Colin G; Lawton, Jennifer S

    2018-07-01

    Adenosine triphosphate-sensitive potassium (K ATP ) channel openers have been found to be cardioprotective in multiple animal models via an unknown mechanism. Mouse models allow genetic manipulation of K ATP channel components for the investigation of this mechanism. Mouse Langendorff models using 30 min of global ischemia are known to induce measurable myocardial infarction and injury. Prolongation of global ischemia in a mouse Langendorff model could allow the determination of the mechanisms involved in K ATP channel opener cardioprotection. Mouse hearts (C57BL/6) underwent baseline perfusion with Krebs-Henseleit buffer (30 min), assessment of function using a left ventricular balloon, delivery of test solution, and prolonged global ischemia (90 min). Hearts underwent reperfusion (30 min) and functional assessment. Coronary flow was measured using an inline probe. Test solutions included were as follows: hyperkalemic cardioplegia alone (CPG, n = 11) or with diazoxide (CPG + DZX, n = 12). Although the CPG + DZX group had greater percent recovery of developed pressure and coronary flow, this was not statistically significant. Following a mean of 74 min (CPG) and 77 min (CPG + DZX), an additional increase in end-diastolic pressure was noted (plateau), which was significantly higher in the CPG group. Similarly, the end-diastolic pressure (at reperfusion and at the end of experiment) was significantly higher in the CPG group. Prolongation of global ischemia demonstrated added benefit when DZX was added to traditional hyperkalemic CPG. This model will allow the investigation of DZX mechanism of cardioprotection following manipulation of targeted K ATP channel components. This model will also allow translation to prolonged ischemic episodes associated with cardiac surgery. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. A phenolic glycoside from Flacourtia indica induces heme mediated oxidative stress in Plasmodium falciparum and attenuates malaria pathogenesis in mice.

    PubMed

    Singh, Shiv Vardan; Manhas, Ashan; Singh, Suriya P; Mishra, Sonali; Tiwari, Nimisha; Kumar, Parmanand; Shanker, Karuna; Srivastava, Kumkum; Sashidhara, Koneni V; Pal, Anirban

    2017-07-01

    Flacourtia indica is especially popular among the various communities of many African countries where it is being used traditionally for the treatment of malaria. In our previous report, we have identified some phenolic glycosides from the aerial parts of F. indica as promising antiplasmodial agents under in vitro conditions. Antimalarial bioprospection of F. indica derived phenolic glycoside in Swiss mice (in vivo) with special emphasis on its mode of action. Chloroquine sensitive strain of Plasmodium falciparum was routinely cultured and used for the in vitro studies. The in vivo antimalarial potential of phenolic glycoside was evaluated against P. berghei in Swiss mice through an array of parameters viz., hematological, biochemical, chemo-suppression and mean survival time. 2-(6-benzoyl-β-d-glucopyranosyloxy)-7-(1α, 2α, 6α-trihydroxy-3-oxocyclohex-4-enoyl)-5-hydroxybenzyl alcohol (CPG), a phenolic glycoside isolated from the aerial parts of F. indica was found to exhibit promising antiplasmodial activity by arresting the P. falciparum growth at the trophozoite stage. Spectroscopic investigations reveal that CPG possesses a strong binding affinity with free heme moieties. In addition, these interactions lead to the inhibition of heme polymerization in malaria parasite, augmenting oxidative stress, and delaying the rapid growth of parasite. Under in-vivo condition, CPG exhibited significant antimalarial activity against P. berghei at 50 and 75mg/kg body weight through chemo-suppression of parasitemia and ameliorating the parasite induced inflammatory and oxidative (hepatic) imbalance in the experimental mice. CPG was found to be a potential antimalarial constituent of F. indica with an explored mechanism of action, which also offers the editing choices for developing CPG based antimalarial chemotypes. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Interactions between Dorsal and Ventral Root Stimulation on the Generation of Locomotor-Like Activity in the Neonatal Mouse Spinal Cord

    PubMed Central

    2016-01-01

    Abstract We investigated whether dorsal (DR) and ventral root (VR) stimulus trains engage common postsynaptic components to activate the central pattern generator (CPG) for locomotion in the neonatal mouse spinal cord. VR stimulation did not activate the first order interneurons mediating the activation of the locomotor CPG by sacrocaudal afferent stimulation. Simultaneous stimulation of adjacent dorsal or ventral root pairs, subthreshold for evoking locomotor-like activity, did not summate to activate the CPG. This suggests that locomotor-like activity is triggered when a critical class of efferent or afferent axons is stimulated and does not depend on the number of stimulated axons or activated postsynaptic neurons. DR- and VR-evoked episodes exhibited differences in the coupling between VR pairs. In DR-evoked episodes, the coupling between the ipsilateral and contralateral flexor/extensor roots was similar and stronger than the bilateral extensor roots. In VR-evoked episodes, ipsilateral flexor/extensor coupling was stronger than both the contralateral flexor/extensor and the bilateral extensor coupling. For both types of stimulation, the coupling was greatest between the bilateral L1/L2 flexor-dominated roots. This indicates that the recruitment and/or the firing pattern of motoneurons differed in DR and VR-evoked episodes. However, the DR and VR trains do not appear to activate distinct CPGs because trains of DR and VR stimuli at frequencies too low to evoke locomotor-like activity did so when they were interleaved. These results indicate that the excitatory actions of VR stimulation converge onto the CPG through an unknown pathway that is not captured by current models of the locomotor CPG. PMID:27419215

  5. Adherence to Clinical Practice Guidelines during Dementia Work-Up in a Real-World Setting: A Study from the Registry of Dementias of Girona.

    PubMed

    Turró-Garriga, Oriol; Calvó-Perxas, Laia; Vilalta-Franch, Joan; Hernández-Ferrándiz, Marta; Flaqué, Margarita; Linares, Marta; Cullell, Marta; Gich, Jordi; Casas, Isabel; Perkal, Héctor; Garre-Olmo, Josep

    2017-01-01

    There are several position statements and clinical practice guidelines (CPG) for diagnosing dementia. Our aims were to evaluate the adherence to CPG among specialists in the 7 memory clinics included in the Registry of Dementias of Girona (ReDeGi), and to compare the results between 2007-2011 and 2012-2015. We also determined the time and number of visits required to achieve a diagnosis, the supplementary tests ordered, and the drugs prescribed according to dementia subtypes. Medical charts of a stratified random sample of 475 ReDeGi cases were reviewed. Basic dementia work-up was evaluated using as a reference evidence-based CPG. An Index of Adherence (AI) was calculated using the following items in the medical chart: cognitive symptomatology; functional disability evaluation; physical examination; neurological examination; psychiatric examination; brief cognitive examination; activities of daily living performance examination; blood test; structural neuroimaging (CT-scan or MRI). The mean AI to CPG among specialists was of 8.2 points, and it improved from 7.9 points in 2007-2011 to 8.5 points in 2012-2015 (Cohen's d = 0.46). A lower adherence was detected in the most severe cases. A dementia diagnosis required 3.5 visits, regardless of the subtype of dementia, although milder cases required more time, more visits, and more supplementary tests than severe cases. The adherence to CPG in the catchment area of the ReDeGi is high, and an epidemiological surveillance system such as the ReDeGi may help in improving it. Dementia guidelines should establish procedures adapted to clinical practice, with simplified recommendations for most severe cases.

  6. Genome-wide methylation analysis identifies differentially methylated CpG loci associated with severe obesity in childhood.

    PubMed

    Huang, R C; Garratt, E S; Pan, H; Wu, Y; Davis, E A; Barton, S J; Burdge, G C; Godfrey, K M; Holbrook, J D; Lillycrop, K A

    2015-01-01

    Childhood obesity is a major public health issue. Here we investigated whether differential DNA methylation was associated with childhood obesity. We studied DNA methylation profiles in whole blood from 78 obese children (mean BMI Z-score: 2.6) and 71 age- and sex-matched controls (mean BMI Z-score: 0.1). DNA samples from obese and control groups were pooled and analyzed using the Infinium HumanMethylation450 BeadChip array. Comparison of the methylation profiles between obese and control subjects revealed 129 differentially methylated CpG (DMCpG) loci associated with 80 unique genes that had a greater than 10% difference in methylation (P-value < 0.05). The top pathways enriched among the DMCpGs included developmental processes, immune system regulation, regulation of cell signaling, and small GTPase-mediated signal transduction. The associations between the methylation of selected DMCpGs with childhood obesity were validated using sodium bisulfite pyrosequencing across loci within the FYN, PIWIL4, and TAOK3 genes in individual subjects. Three CpG loci within FYN were hypermethylated in obese individuals (all P < 0.01), while obesity was associated with lower methylation of CpG loci within PIWIL4 (P = 0.003) and TAOK3 (P = 0.001). After building logistic regression models, we determined that a 1% increase in methylation in TAOK3, multiplicatively decreased the odds of being obese by 0.91 (95% CI: 0.86 - 0.97), and an increase of 1% methylation in FYN CpG3, multiplicatively increased the odds of being obese by 1.03 (95% CI: 0.99 - 1.07). In conclusion, these findings provide evidence that childhood obesity is associated with specific DNA methylation changes in whole blood, which may have utility as biomarkers of obesity risk.

  7. Correlation of CpG Island Methylation of the Cytochrome P450 2E1/2D6 Genes with Liver Injury Induced by Anti-Tuberculosis Drugs: A Nested Case-Control Study.

    PubMed

    Zhang, Jinling; Zhu, Xuebin; Li, Yuhong; Zhu, Lingyan; Li, Shiming; Zheng, Guoying; Ren, Qi; Xiao, Yonghong; Feng, Fumin

    2016-08-01

    This study investigated the role of CpG island methylation of the CYP2E1 and CYP2D6 genes in liver injury induced by anti-TB drugs from an epigenetic perspective in a Chinese cohort. A 1:1 matched nested case-control study design was applied. Pulmonary tuberculosis (TB) patients, who underwent standard anti-TB therapy and developed liver injury were defined as cases, while those who did not develop liver injury were defined as control. The two groups were matched in terms of sex, treatment regimen, and age. In 114 pairs of cases, CpG island methylation levels of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of anti-TB drug-induced liver injury (ADLI), with odds ratio (OR) values of 2.429 and 3.500, respectively (p < 0.01). Moreover, through multivariate logistic regression analysis, CpG island methylation of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA were found to be significantly correlated with the occurrence of ADLI, with adjusted OR values of 4.390 (95% confidence interval (CI): 1.982-9.724) and 9.193 (95% CI: 3.624-25.888), respectively (p < 0.001). These results suggest that aberrantly elevated methylation of CpG islands of the CYP2E1 and CYP2D6 genes in plasma cell-free DNA may increase the risk of ADLI in Chinese TB patients.

  8. Methylomics of gene expression in human monocytes

    PubMed Central

    Liu, Yongmei; Ding, Jingzhong; Reynolds, Lindsay M.; Lohman, Kurt; Register, Thomas C.; De La Fuente, Alberto; Howard, Timothy D.; Hawkins, Greg A.; Cui, Wei; Morris, Jessica; Smith, Shelly G.; Barr, R. Graham; Kaufman, Joel D.; Burke, Gregory L.; Post, Wendy; Shea, Steven; Mccall, Charles E.; Siscovick, David; Jacobs, David R.; Tracy, Russell P.; Herrington, David M.; Hoeschele, Ina

    2013-01-01

    DNA methylation is one of several epigenetic mechanisms that contribute to the regulation of gene expression; however, the extent to which methylation of CpG dinucleotides correlates with gene expression at the genome-wide level is still largely unknown. Using purified primary monocytes from subjects in a large community-based cohort (n = 1264), we characterized methylation (>485 000 CpG sites) and mRNA expression (>48K transcripts) and carried out genome-wide association analyses of 8370 expression phenotypes. We identified 11 203 potential cis-acting CpG loci whose degree of methylation was associated with gene expression (eMS) at a false discovery rate threshold of 0.001. Most of the associations were consistent in effect size and direction of effect across sex and three ethnicities. Contrary to expectation, these eMS were not predominately enriched in promoter regions, or CpG islands, but rather in the 3′ UTR, gene bodies, CpG shores or ‘offshore’ sites, and both positive and negative correlations between methylation and expression were observed across all locations. eMS were enriched for regions predicted to be regulatory by ENCODE (Encyclopedia of DNA Elements) data in multiple cell types, particularly enhancers. One of the strongest association signals detected (P < 2.2 × 10−308) was a methylation probe (cg17005068) in the promoter/enhancer region of the glutathione S-transferase theta 1 gene (GSTT1, encoding the detoxification enzyme) with GSTT1 mRNA expression. Our study provides a detailed description of the epigenetic architecture in human monocytes and its relationship to gene expression. These data may help prioritize interrogation of biologically relevant methylation loci and provide new insights into the epigenetic basis of human health and diseases. PMID:23900078

  9. Gold nanoparticle–M2e conjugate coformulated with CpG induces protective immunity against influenza A virus

    PubMed Central

    Tao, Wenqian; Ziemer, Katherine S; Gill, Harvinder S

    2014-01-01

    Aim: This study aimed to develop a novel influenza A vaccine by conjugating the highly conserved extracellular region of the matrix 2 protein (M2e) of influenza A virus to gold nanoparticles (AuNPs) and to test the vaccine in a mouse influenza challenge model. Materials & methods: Citrate-reduced AuNPs (diameter: 12 nm) were synthesized, and characterized by transmission electron microscopy and dynamic light scattering. M2e was conjugated to AuNPs through thiol–gold interactions to form M2e–AuNP conjugates. Particle stability was confirmed by UV–visible spectra, and M2e conjugation was further characterized by x-ray photoelectron spectroscopy. Mice were immunized with M2e–AuNPs with or without CpG (cytosine-guanine rich oligonucleotide) as an adjuvant with appropriate control groups. Sera was collected and M2e-specific immunoglobulin (IgG) was measured, and immunized mice were challenged with PR8-H1N1 influenza virus. Results: M2e-capped AuNPs could be lyophilized and stably resuspended in water. Intranasal vaccination of mice with M2e–AuNP conjugates induced M2e-specific IgG serum antibodies, which significantly increased upon addition of soluble CpG as adjuvant. Upon challenge with lethal PR8, mice vaccinated with M2e-AuNP conjugates were only partially protected, while mice that received soluble CpG as adjuvant in addition to M2e–AuNP were fully protected. Conclusion: Overall, this study demonstrates the potential of using the M2e–AuNP conjugates with CpG as an adjuvant as a platform for developing an influenza A vaccine. PMID:23829488

  10. In vitro effects of CpG oligodeoxynucleotides delivered by gelatin nanoparticles on canine peripheral blood mononuclear cells of atopic and healthy dogs - a pilot study.

    PubMed

    Prélaud, Ana Rostaher; Fuchs, Sebastian; Weber, Karin; Winter, Gerhard; Coester, Conrad; Mueller, Ralf S

    2013-10-01

    Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides offer a novel promising immunotherapeutic approach for atopic dermatitis (AD) both in humans and animals. Gelatin nanoparticles (GNP) enhance and prolong CpG-associated immunomodulatory effects and minimize adverse effects both in vitro and in vivo. Information about the effects of this combination in dogs is lacking. The aim of this study was to evaluate immunological effects of CpG coupled to GNP on canine peripheral blood mononuclear cells (PBMCs) in vitro. Eight dogs with AD, diagnosed by standard criteria and with a concurrent immediate hypersensitivity to house dust mites were included. Control samples were taken from eight healthy, age-matched control dogs without history or evidence of cutaneous or systemic illness. Peripheral blood mononuclear cells of healthy and allergic dogs were incubated with CpG-GNP and the uptake of CpG-GNP was demonstrated using confocal laser scanning microscopy. Cell culture supernatant concentrations of interferon gamma (IFN-γ), interleukin (IL)-4, IL-6 and IL-10 were measured by Canine Cytokine Milliplex. No significant changes in IFN-γ and IL-4 were found when comparing PBMCs incubated with CpG and CpG-GNP with the negative controls in atopic and healthy dogs. Interleukin-6 was not detected in any of the groups. However, a statistically significant increase in IL-10 concentration was found after 24 h stimulation with CpG-GNP compared with CpG alone both in atopic and healthy dogs. As IL-10 is considered an immunosuppressive cytokine playing a key role in peripheral tolerance; the reported CpG-GNP formulation could be a new approach in allergy treatment. © 2013 ESVD and ACVD.

  11. DNA methylation signatures of chronic low-grade inflammation are associated with complex diseases.

    PubMed

    Ligthart, Symen; Marzi, Carola; Aslibekyan, Stella; Mendelson, Michael M; Conneely, Karen N; Tanaka, Toshiko; Colicino, Elena; Waite, Lindsay L; Joehanes, Roby; Guan, Weihua; Brody, Jennifer A; Elks, Cathy; Marioni, Riccardo; Jhun, Min A; Agha, Golareh; Bressler, Jan; Ward-Caviness, Cavin K; Chen, Brian H; Huan, Tianxiao; Bakulski, Kelly; Salfati, Elias L; Fiorito, Giovanni; Wahl, Simone; Schramm, Katharina; Sha, Jin; Hernandez, Dena G; Just, Allan C; Smith, Jennifer A; Sotoodehnia, Nona; Pilling, Luke C; Pankow, James S; Tsao, Phil S; Liu, Chunyu; Zhao, Wei; Guarrera, Simonetta; Michopoulos, Vasiliki J; Smith, Alicia K; Peters, Marjolein J; Melzer, David; Vokonas, Pantel; Fornage, Myriam; Prokisch, Holger; Bis, Joshua C; Chu, Audrey Y; Herder, Christian; Grallert, Harald; Yao, Chen; Shah, Sonia; McRae, Allan F; Lin, Honghuang; Horvath, Steve; Fallin, Daniele; Hofman, Albert; Wareham, Nicholas J; Wiggins, Kerri L; Feinberg, Andrew P; Starr, John M; Visscher, Peter M; Murabito, Joanne M; Kardia, Sharon L R; Absher, Devin M; Binder, Elisabeth B; Singleton, Andrew B; Bandinelli, Stefania; Peters, Annette; Waldenberger, Melanie; Matullo, Giuseppe; Schwartz, Joel D; Demerath, Ellen W; Uitterlinden, André G; van Meurs, Joyce B J; Franco, Oscar H; Chen, Yii-Der Ida; Levy, Daniel; Turner, Stephen T; Deary, Ian J; Ressler, Kerry J; Dupuis, Josée; Ferrucci, Luigi; Ong, Ken K; Assimes, Themistocles L; Boerwinkle, Eric; Koenig, Wolfgang; Arnett, Donna K; Baccarelli, Andrea A; Benjamin, Emelia J; Dehghan, Abbas

    2016-12-12

    Chronic low-grade inflammation reflects a subclinical immune response implicated in the pathogenesis of complex diseases. Identifying genetic loci where DNA methylation is associated with chronic low-grade inflammation may reveal novel pathways or therapeutic targets for inflammation. We performed a meta-analysis of epigenome-wide association studies (EWAS) of serum C-reactive protein (CRP), which is a sensitive marker of low-grade inflammation, in a large European population (n = 8863) and trans-ethnic replication in African Americans (n = 4111). We found differential methylation at 218 CpG sites to be associated with CRP (P < 1.15 × 10 -7 ) in the discovery panel of European ancestry and replicated (P < 2.29 × 10 -4 ) 58 CpG sites (45 unique loci) among African Americans. To further characterize the molecular and clinical relevance of the findings, we examined the association with gene expression, genetic sequence variants, and clinical outcomes. DNA methylation at nine (16%) CpG sites was associated with whole blood gene expression in cis (P < 8.47 × 10 -5 ), ten (17%) CpG sites were associated with a nearby genetic variant (P < 2.50 × 10 -3 ), and 51 (88%) were also associated with at least one related cardiometabolic entity (P < 9.58 × 10 -5 ). An additive weighted score of replicated CpG sites accounted for up to 6% inter-individual variation (R2) of age-adjusted and sex-adjusted CRP, independent of known CRP-related genetic variants. We have completed an EWAS of chronic low-grade inflammation and identified many novel genetic loci underlying inflammation that may serve as targets for the development of novel therapeutic interventions for inflammation.

  12. Adherence to Clinical Practice Guidelines (CPG) management of dengue infection in adults (revised 2nd edition)

    PubMed Central

    Suli, Zailiza; Singh Gill, Balvinder; Rudra Deva, Shanti; Abdullah Sani, Ana Fizalinda; Romli, Erni Zurina; Mohamed Ghazali, Izzuna Mudla; Mohd. Yusof, Mohd. Aminuddin; Ahmad Lutfi, Nafisah; Shuib, Shahril Effendi; Mohd Darus, Noormah; Bakri, Rugayah

    2017-01-01

    The Malaysian Dengue Clinical Practice Guidelines (CPG) have been developed to provide evidence-based guidance in the management of dengue infections. The use of these guidelines is essential to ensure its recommendations are being practiced. However, the adherence to the guidelines for management of dengue (revised 2nd edition) by healthcare providers still remains unknown. Therefore, the aim of this study was to evaluate the proportion among healthcare providers that adhere to this Dengue CPG. A retrospective cohort study of dengue cases registered from 1 January 2014 to 1 June 2015 was conducted in public hospitals and health clinics in Selangor, Putrajaya and Kuala Lumpur. Adherence to the CPG recommendations were recorded by reviewing patients’ case notes. Overall proportion of adherence in clinical components of the recommendation were (7.1 to 100.0% versus 7.7 to 73.8%) in history taking, (6.7 to 100.0% versus 12.3 to 60.0%) in physical examinations, (18.4 to 100.0% versus 23.1 to 83.2%) in assessment of warning signs, (0.6 to 100.0% versus 12.3 to 87.7%) in assessment of haemodynamic status, (60.0 to 100.0% versus 27.7 to 40.0%) in diagnosis, (46.6 to 80.0% versus 52.3%) in case notifications, (73.2 to 100.0% versus 89.2 to 96.9%) in performing specific laboratory investigations and (7.9 to 100.0% versus 21.5%) in monitoring, for outpatient versus inpatient, respectively. Adherence trends were demonstrated to be higher in hospital settings compared to outpatient settings. Adherence to this Dengue CPG varies widely with overall good clinical outcomes observed. PMID:29095822

  13. Possible Mediation by Methylation in Acute Inflammation Following Personal Exposure to Fine Particulate Air Pollution

    PubMed Central

    Wang, Cuicui; Chen, Renjie; Shi, Min; Cai, Jing; Shi, Jingjin; Yang, Changyuan; Li, Huichu; Lin, Zhijing; Meng, Xia; Liu, Cong; Niu, Yue; Xia, Yongjie; Zhao, Zhuohui; Kan, Haidong; Weinberg, Clarice R

    2018-01-01

    Abstract Air pollution may increase cardiovascular and respiratory risk through inflammatory pathways, but evidence for acute effects has been weak and indirect. Between December 2014 and July 2015, we enrolled 36 healthy, nonsmoking college students for a panel study in Shanghai, China, a city with highly variable levels of air pollution. We measured personal exposure to particulate matter with an aerodynamic diameter less than or equal to 2.5 μm (PM2.5) continuously for 72 hours preceding each of 4 clinical visits that included phlebotomy. We measured 4 inflammation proteins and DNA methylation at nearby regulatory cytosine-phosphate-guanine (CpG) loci. We applied linear mixed-effect models to examine associations over various lag times. When results suggested mediation, we evaluated methylation as mediator. Increased PM2.5 concentration was positively associated with all 4 inflammation proteins and negatively associated with DNA methylation at regulatory loci for tumor necrosis factor alpha (TNF-α) and soluble intercellular adhesion molecule-1. A 10-μg/m3 increase in average PM2.5 during the 24 hours preceding blood draw corresponded to a 4.4% increase in TNF-α and a statistically significant decrease in methylation at one of the two studied candidate CpG loci for TNF-α. Epigenetics may play an important role in mediating effects of PM2.5 on inflammatory pathways. PMID:29020142

  14. Stochastic epigenetic mutations (DNA methylation) increase exponentially in human aging and correlate with X chromosome inactivation skewing in females.

    PubMed

    Gentilini, Davide; Garagnani, Paolo; Pisoni, Serena; Bacalini, Maria Giulia; Calzari, Luciano; Mari, Daniela; Vitale, Giovanni; Franceschi, Claudio; Di Blasio, Anna Maria

    2015-08-01

    In this study we applied a new analytical strategy to investigate the relations between stochastic epigenetic mutations (SEMs) and aging. We analysed methylation levels through the Infinium HumanMethylation27 and HumanMethylation450 BeadChips in a population of 178 subjects ranging from 3 to 106 years. For each CpG probe, epimutated subjects were identified as the extreme outliers with methylation level exceeding three times interquartile ranges the first quartile (Q1-(3 x IQR)) or the third quartile (Q3+(3 x IQR)). We demonstrated that the number of SEMs was low in childhood and increased exponentially during aging. Using the HUMARA method, skewing of X chromosome inactivation (XCI) was evaluated in heterozygotes women. Multivariate analysis indicated a significant correlation between log(SEMs) and degree of XCI skewing after adjustment for age (β = 0.41; confidence interval: 0.14, 0.68; p-value = 0.0053). The PATH analysis tested the complete model containing the variables: skewing of XCI, age, log(SEMs) and overall CpG methylation. After adjusting for the number of epimutations we failed to confirm the well reported correlation between skewing of XCI and aging. This evidence might suggest that the known correlation between XCI skewing and aging could not be a direct association but mediated by the number of SEMs.

  15. H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells

    PubMed Central

    Fernández, Agustín F.; Bayón, Gustavo F.; Urdinguio, Rocío G.; Toraño, Estela G.; García, María G.; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M.; Riancho, José A.; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A.

    2015-01-01

    In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type–independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. PMID:25271306

  16. DNA methylation profiling identifies global methylation differences and markers of adrenocortical tumors.

    PubMed

    Rechache, Nesrin S; Wang, Yonghong; Stevenson, Holly S; Killian, J Keith; Edelman, Daniel C; Merino, Maria; Zhang, Lisa; Nilubol, Naris; Stratakis, Constantine A; Meltzer, Paul S; Kebebew, Electron

    2012-06-01

    It is not known whether there are any DNA methylation alterations in adrenocortical tumors. The objective of the study was to determine the methylation profile of normal adrenal cortex and benign and malignant adrenocortical tumors. Genome-wide methylation status of CpG regions were determined in normal (n = 19), benign (n = 48), primary malignant (n = 8), and metastatic malignant (n = 12) adrenocortical tissue samples. An integrated analysis of genome-wide methylation and mRNA expression in benign vs. malignant adrenocortical tissue samples was also performed. Methylation profiling revealed the following: 1) that methylation patterns were distinctly different and could distinguish normal, benign, primary malignant, and metastatic tissue samples; 2) that malignant samples have global hypomethylation; and 3) that the methylation of CpG regions are different in benign adrenocortical tumors by functional status. Normal compared with benign samples had the least amount of methylation differences, whereas normal compared with primary and metastatic adrenocortical carcinoma samples had the greatest variability in methylation (adjusted P ≤ 0.01). Of 215 down-regulated genes (≥2-fold, adjusted P ≤ 0.05) in malignant primary adrenocortical tumor samples, 52 of these genes were also hypermethylated. Malignant adrenocortical tumors are globally hypomethylated as compared with normal and benign tumors. Methylation profile differences may accurately distinguish between primary benign and malignant adrenocortical tumors. Several differentially methylated sites are associated with genes known to be dysregulated in malignant adrenocortical tumors.

  17. Laboratory measurement of the anticoagulant activity of the non-vitamin K oral anticoagulants.

    PubMed

    Cuker, Adam; Siegal, Deborah M; Crowther, Mark A; Garcia, David A

    2014-09-16

    Non-vitamin K oral anticoagulants (NOACs) do not require routine laboratory monitoring. However, laboratory measurement may be desirable in special situations and populations. This study's objective was to systematically review and summarize current evidence regarding laboratory measurement of the anticoagulant activity of dabigatran, rivaroxaban, and apixaban. We searched PubMed and Web of Science for studies that reported a relationship between drug levels of dabigatran, rivaroxaban, and apixaban and coagulation assay results. Study quality was evaluated using QUADAS-2 (Quality Assessment of Diagnostic Accuracy Studies 2). We identified 17 eligible studies for dabigatran, 15 for rivaroxaban, and 4 for apixaban. For dabigatran, a normal thrombin time excludes clinically relevant drug concentrations. The activated partial thromboplastin time (APTT) and prothrombin time (PT) are less sensitive and may be normal at trough drug levels. The dilute thrombin time (R(2) = 0.92 to 0.99) and ecarin-based assays (R(2) = 0.92 to 1.00) show excellent linearity across on-therapy drug concentrations and may be used for drug quantification. For rivaroxaban and apixaban, anti-Xa activity is linear (R(2) = 0.89 to 1.00) over a wide range of drug levels and may be used for drug quantification. Undetectable anti-Xa activity likely excludes clinically relevant drug concentrations. The PT is less sensitive (especially for apixaban); a normal PT may not exclude clinically relevant levels. The APTT demonstrates insufficient sensitivity and linearity for quantification. Dabigatran, rivaroxaban, and apixaban exhibit variable effects on coagulation assays. Understanding these effects facilitates interpretation of test results in NOAC-treated patients. More information on the relationship between drug levels and clinical outcomes is needed. Copyright © 2014 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  18. [The German program for disease management guidelines: evaluation by use of quality indicators].

    PubMed

    Kopp, Ina B; Geraedts, Max; Jäckel, Wilfried H; Altenhofen, Lutz; Thomeczek, Christian; Ollenschläger, Günter

    2007-08-15

    The Program for National Disease Management Guidelines (German DM-CPG Program) in Germany aims at the implementation of best-practice recommendations for prevention, acute care, rehabilitation and chronic care in the setting of disease management programs and integrated health-care systems. Like other guidelines, DM-CPG need to be assessed regarding their influence on structures, processes and outcomes of care. However, quality assessment in integrated health-care systems is challenging. On the one hand, a multitude of potential domains for measurement, actors and perspectives need to be considered. On the other hand, measures need to be identified that assess the function of the diagnostic and therapeutic chain in terms of cooperation and coordination of care. The article reviews methods and use of quality indicators in the context of the German DM-CPG Program.

  19. Profiling DNA methylome landscapes of mammalian cells with single-cell reduced-representation bisulfite sequencing.

    PubMed

    Guo, Hongshan; Zhu, Ping; Guo, Fan; Li, Xianlong; Wu, Xinglong; Fan, Xiaoying; Wen, Lu; Tang, Fuchou

    2015-05-01

    The heterogeneity of DNA methylation within a population of cells necessitates DNA methylome profiling at single-cell resolution. Recently, we developed a single-cell reduced-representation bisulfite sequencing (scRRBS) technique in which we modified the original RRBS method by integrating all the experimental steps before PCR amplification into a single-tube reaction. These modifications enable scRRBS to provide digitized methylation information on ∼1 million CpG sites within an individual diploid mouse or human cell at single-base resolution. Compared with the single-cell bisulfite sequencing (scBS) technique, scRRBS covers fewer CpG sites, but it provides better coverage for CpG islands (CGIs), which are likely to be the most informative elements for DNA methylation. The entire procedure takes ∼3 weeks, and it requires strong molecular biology skills.

  20. Time to administration of epinephrine and outcome after in-hospital cardiac arrest with non-shockable rhythms: retrospective analysis of large in-hospital data registry

    PubMed Central

    Salciccioli, Justin D; Howell, Michael D; Cocchi, Michael N; Giberson, Brandon; Berg, Katherine; Gautam, Shiva; Callaway, Clifton

    2014-01-01

    Objective To determine if earlier administration of epinephrine (adrenaline) in patients with non-shockable cardiac arrest rhythms is associated with increased return of spontaneous circulation, survival, and neurologically intact survival. Design Post hoc analysis of prospectively collected data in a large multicenter registry of in-hospital cardiac arrests (Get With The Guidelines-Resuscitation). Setting We utilized the Get With The Guidelines-Resuscitation database (formerly National Registry of Cardiopulmonary Resuscitation, NRCPR). The database is sponsored by the American Heart Association (AHA) and contains prospective data from 570 American hospitals collected from 1 January 2000 to 19 November 2009. Participants 119 978 adults from 570 hospitals who had a cardiac arrest in hospital with asystole (55%) or pulseless electrical activity (45%) as the initial rhythm. Of these, 83 490 arrests were excluded because they took place in the emergency department, intensive care unit, or surgical or other specialty unit, 10 775 patients were excluded because of missing or incomplete data, 524 patients were excluded because they had a repeat cardiac arrest, and 85 patients were excluded as they received vasopressin before the first dose of epinephrine. The main study population therefore comprised 25 095 patients. The mean age was 72, and 57% were men. Main outcome measures The primary outcome was survival to hospital discharge. Secondary outcomes included sustained return of spontaneous circulation, 24 hour survival, and survival with favorable neurologic status at hospital discharge. Results 25 095 adults had in-hospital cardiac arrest with non-shockable rhythms. Median time to administration of the first dose of epinephrine was 3 minutes (interquartile range 1-5 minutes). There was a stepwise decrease in survival with increasing interval of time to epinephrine (analyzed by three minute intervals): adjusted odds ratio 1.0 for 1-3 minutes (reference group); 0.91 (95% confidence interval 0.82 to 1.00; P=0.055) for 4-6 minutes; 0.74 (0.63 to 0.88; P<0.001) for 7-9 minutes; and 0.63 (0.52 to 0.76; P<0.001) for >9 minutes. A similar stepwise effect was observed across all outcome variables. Conclusions In patients with non-shockable cardiac arrest in hospital, earlier administration of epinephrine is associated with a higher probability of return of spontaneous circulation, survival in hospital, and neurologically intact survival. PMID:24846323

  1. NGO Provision of Basic Education: Alternative or Complementary Service Delivery to Support Access to the Excluded?

    ERIC Educational Resources Information Center

    Rose, Pauline

    2009-01-01

    This paper focuses on approaches by non-government organisations (NGOs) to reach primary school-aged children excluded from access to the conventional state education system. It highlights recent shifts in international literature and agency priorities from the portrayal of NGO provision as a (non-formal) "alternative" to (formal) state…

  2. 20 CFR 404.1037 - Work on or in connection with a non-American vessel or aircraft.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Employment, Wages, Self-Employment, and Self-Employment Income Work Excluded from Employment § 404.1037 Work on or in connection with a non-American...(b)(3)) or American aircraft (as defined in § 404.1004(b)(2)), your work is excluded from employment...

  3. 20 CFR 404.1037 - Work on or in connection with a non-American vessel or aircraft.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Employment, Wages, Self-Employment, and Self-Employment Income Work Excluded from Employment § 404.1037 Work on or in connection with a non-American...(b)(3)) or American aircraft (as defined in § 404.1004(b)(2)), your work is excluded from employment...

  4. 20 CFR 404.1037 - Work on or in connection with a non-American vessel or aircraft.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Employment, Wages, Self-Employment, and Self-Employment Income Work Excluded from Employment § 404.1037 Work on or in connection with a non-American...(b)(3)) or American aircraft (as defined in § 404.1004(b)(2)), your work is excluded from employment...

  5. 20 CFR 404.1037 - Work on or in connection with a non-American vessel or aircraft.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Employment, Wages, Self-Employment, and Self-Employment Income Work Excluded from Employment § 404.1037 Work on or in connection with a non-American...(b)(3)) or American aircraft (as defined in § 404.1004(b)(2)), your work is excluded from employment...

  6. 20 CFR 404.1037 - Work on or in connection with a non-American vessel or aircraft.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Employment, Wages, Self-Employment, and Self-Employment Income Work Excluded from Employment § 404.1037 Work on or in connection with a non-American...(b)(3)) or American aircraft (as defined in § 404.1004(b)(2)), your work is excluded from employment...

  7. To Enforce or Not to Enforce? The Use of Collaborative Interfaces to Promote Social Skills in Children with High Functioning Autism Spectrum Disorder

    ERIC Educational Resources Information Center

    Ben-Sasson, Ayelet; Lamash, Liron; Gal, Eynat

    2013-01-01

    The goal of this study was to examine whether a technological touch activated Collaborative Puzzle Game (CPG) increased positive social behaviors in children with high functioning autism spectrum disorder (HFASD). The CPG involved construction of a virtual puzzle by selecting and dragging pieces into the solution area on a touch screen table. The…

  8. South African Guidelines Excellence (SAGE): Adopt, adapt, or contextualise?

    PubMed

    Dizon, J M; Grimmer, K; Louw, Q; Kredo, T; Young, T; Machingaidze, S

    2016-12-01

    Clinical practice guideline (CPG) activities must be planned carefully for efficient use of available resources and evidence-based implementation. De novo development of CPGs may sometimes 'recreate the wheel' and delay implementation. Three innovative alternatives to de novo CPG development (adopt, contextualise or adapt) are outlined, which have greater potential than de novo development to best use the limited available resources, personnel and time in settings such as South Africa.

  9. Integrative Cardiac Health Project, Windber Research Institute

    DTIC Science & Technology

    2014-07-01

    laparoscopically placed adjustable gastric banding (LAGB) baseline (5) and one year (5), control baseline (5) and one year (5). OD260/280 ratios...coverage and detection of 3-4 million CpG sites . All samples had a bisulfite conversion rate of >98.25%; number of CpG (methylated) sites per sample...methylation) and hyper-methylated (increasing methylation) sites in the three groups were identified. For LAGB patients, a heat map based on

  10. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer

    PubMed Central

    Savio, Andrea J.; Bapat, Bharati

    2017-01-01

    ABSTRACT The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located. PMID:28304185

  11. Modulation of transcription factor binding and epigenetic regulation of the MLH1 CpG island and shore by polymorphism rs1800734 in colorectal cancer.

    PubMed

    Savio, Andrea J; Bapat, Bharati

    2017-06-03

    The MLH1 promoter polymorphism rs1800734 is associated with MLH1 CpG island hypermethylation and expression loss in colorectal cancer (CRC). Conversely, variant rs1800734 is associated with MLH1 shore, but not island, hypomethylation in peripheral blood mononuclear cell DNA. To explore these distinct patterns, MLH1 CpG island and shore methylation was assessed in CRC cell lines stratified by rs1800734 genotype. Cell lines containing the variant A allele demonstrated MLH1 shore hypomethylation compared to wild type (GG). There was significant enrichment of transcription factor AP4 at the MLH1 promoter in GG and GA cell lines, but not the AA cell line, by chromatin immunoprecipitation studies. Preferential binding to the G allele was confirmed by sequencing in the GA cell line. The enhancer-associated histone modification H3K4me1 was enriched at the MLH1 shore; however, H3K27ac was not, indicating the shore is an inactive enhancer. These results demonstrate the role of variant rs1800734 in altering transcription factor binding as well as epigenetics at regions beyond the MLH1 CpG island in which it is located.

  12. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration.

    PubMed

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn't affect Egf mRNA expression during the re-organization phase.

  13. Applying the RE-AIM Framework to Evaluate the Dissemination and Implementation of Clinical Practice Guidelines for Sexually Transmitted Infections.

    PubMed

    Jeong, Heon-Jae; Jo, Heui-Sug; Oh, Moo-Kyung; Oh, Hyung-Won

    2015-07-01

    Clinical practice guidelines (CPG) are one of the most effective ways to translate evidence of medical improvement into everyday practice. This study evaluated the dissemination and implementation of the Sexually Transmitted Infections-Korean Guidelines (STIKG) by applying the reach, effectiveness, adoption, implementation and maintenance (RE-AIM) framework. A survey questionnaire was administered to clinicians via the internet. Among the 332 respondents, 190 (57.2%) stated that they were aware of STIKG and 107 (33.2%) implemented STIKG in their practice. The odds that a physician was exposed to STIKG (dissemination) were 2.61 times greater among physicians with previous training or education for any CPG than those who did not. Clinicians who indicated that STIKG were easy to understand were 4.88 times more likely to implement STIKG in their practice than those who found them not so easy. When a clinician's workplace had a supporting system for CPG use, the odds of implementation was 3.76 times higher. Perceived level of effectiveness of STIKG did not significantly influence their implementation. The findings of this study suggest that, ultimately, knowing how to engage clinicians in CPG implementation is as important as how to disseminate such guidelines; moreover, easy-to-use guidelines and institutional support are key factors.

  14. Toward robust phase-locking in Melibe swim central pattern generator models

    NASA Astrophysics Data System (ADS)

    Jalil, Sajiya; Allen, Dane; Youker, Joseph; Shilnikov, Andrey

    2013-12-01

    Small groups of interneurons, abbreviated by CPG for central pattern generators, are arranged into neural networks to generate a variety of core bursting rhythms with specific phase-locked states, on distinct time scales, which govern vital motor behaviors in invertebrates such as chewing and swimming. These movements in lower level animals mimic motions of organs in higher animals due to evolutionarily conserved mechanisms. Hence, various neurological diseases can be linked to abnormal movement of body parts that are regulated by a malfunctioning CPG. In this paper, we, being inspired by recent experimental studies of neuronal activity patterns recorded from a swimming motion CPG of the sea slug Melibe leonina, examine a mathematical model of a 4-cell network that can plausibly and stably underlie the observed bursting rhythm. We develop a dynamical systems framework for explaining the existence and robustness of phase-locked states in activity patterns produced by the modeled CPGs. The proposed tools can be used for identifying core components for other CPG networks with reliable bursting outcomes and specific phase relationships between the interneurons. Our findings can be employed for identifying or implementing the conditions for normal and pathological functioning of basic CPGs of animals and artificially intelligent prosthetics that can regulate various movements.

  15. Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

    PubMed Central

    Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

    2016-01-01

    Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

  16. Developing Guidelines on the Assessment and Treatment of Delirium in Older Adults at the End of Life

    PubMed Central

    Brajtman, Susan; Wright, David; Hogan, David B.; Allard, Pierre; Bruto, Venera; Burne, Deborah; Gage, Laura; Gagnon, Pierre R.; Sadowski, Cheryl A.; Helsdingen, Sherri; Wilson, Kimberley

    2011-01-01

    Background and Purpose Delirium at the end of life is common and can have serious consequences on an older person’s quality of life and death. In spite of the importance of detecting, diagnosing, and managing delirium at the end of life, comprehensive clinical practice guidelines (CPG) are lacking. Our objective was to develop CPG for the assessment and treatment of delirium that would be applicable to seniors receiving end-of-life care in diverse settings. Methods Using as a starting point the 2006 Canadian Coalition for Seniors’ Mental Health CPG on the assessment and treatment of delirium, a team of palliative care researchers and clinicians partnered with members of the original guideline development group to adapt the guidelines for an end-of-life care context. This process was supported by an extensive literature review. The final guidelines were reviewed by external experts. Results Comprehensive CPG on the assessment and treatment of delirium in older adults at the end of life were developed and can be downloaded from http://www.ccsmh.ca. Conclusions Further research is needed on the implementation and evaluation of these adapted delirium guidelines for older patients receiving end-of-life care in various palliative care settings. PMID:23251311

  17. Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

    PubMed

    Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

    1999-01-19

    In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

  18. Prognostic implication of the CpG island methylator phenotype in colorectal cancers depends on tumour location

    PubMed Central

    Bae, J M; Kim, J H; Cho, N-Y; Kim, T-Y; Kang, G H

    2013-01-01

    Background: Colorectal cancer (CRC) is usually categorised as proximal or distal CRC. Recently, many researchers have tried to determine the molecular heterogeneity of CRCs along bowel subsites. However, the differential effects of the CpG island methylator phenotype (CIMP) and microsatellite instability (MSI) on the clinical outcome according to tumour location are not well-known. Methods: We analysed clinicopathologic and molecular characteristics, including CIMP, MSI, KRAS and BRAF mutations, in 734 CRCs according to bowel subsites. And the prognostic value of CIMP and MSI was analysed according to tumour location. Results: We found a linear increase of female predominance, T, N category, stage, differentiation, absence of luminal necrosis, tumour -infiltrating lymphocytes, Crohn's-like lymphoid reaction, serration and mucin production from the rectum to caecum. CpG island methylator phenotype -high and MSI-high gradually increased from the rectum to caecum. CpG island methylator phenotype is a poor prognostic factor of overall survival (hazard ratio (HR): 4.13, 95% confidence interval (CI): 1.27–13.46) and disease-free survival (HR: 2.90, 95% CI: 1.04–8.08) in rectal cancers. Conclusion: Clinicopathologic and molecular profiles of CRCs gradually change along bowel subsites, and the prognostic implication of CIMP is different according to tumour location. PMID:23900220

  19. CpG island methylator phenotype (CIMP) in cancer: causes and implications.

    PubMed

    Teodoridis, Jens M; Hardie, Catriona; Brown, Robert

    2008-09-18

    Strong evidence exists for a subgroup of tumours, from a variety of tissue types, exhibiting concordant tumour specific DNA methylation: the "CpG island methylator phenotype" (CIMP). Occurrence of CIMP is associated with a range of genetic and environmental factors, although the molecular causes are not well-understood. Both increased expression and aberrant targeting of DNA methyltransferases (DNMTs) could contribute to the occurrence of CIMP. One under-explored area is the possibility that DNA damage may induce or select for CIMP during carcinogenesis or treatment of tumours with chemotherapy. DNA damaging agents can induce DNA damage at guanine rich regions throughout the genome, including CpG islands. This DNA damage can result in stalled DNA synthesis, which will lead to localised increased DNMT1 concentration and therefore potentially increased DNA methylation at these sites. Chemotherapy can select for cells which have increased tolerance to DNA damage due to increased lesion bypass, in some cases by mechanisms which involve inactivation of genes by CpG island methylation. CIMP has been associated with worse patient prognosis, probably due to increased epigenetic plasticity. Therefore, further clinical testing of the diagnostic and prognostic value of the current CIMP markers, as well as increasing our understanding of the molecular causes underlying CIMP are required.

  20. Resource utilization in lung cancer diagnostic procedures: Current use and budget consequences.

    PubMed

    Brinkhof, Sander; Groen, Harry J M; Siesling, Sabine S; IJzerman, Maarten J

    2017-01-01

    The main objective of this study is to determine the current use of lung cancer diagnostic procedures in two large hospitals in the Netherlands, to explore deviations in guideline adherence between the hospitals, and to estimate the budget impact of the diagnostic work-up as well as the over- and underutilization. A state transition model for the diagnostic pathway for lung cancer patients was developed using existing clinical practice guidelines (CPG) combined with a systematic literature. In addition to the CPGs depicting current practice, diagnostic utilization was gathered in two large hospitals representing an academic tertiary care hospital and a large regional teaching hospital for patients, who were selected from the Netherlands cancer registry. The total population consisted of 376 patients with lung cancer. Not in all cases the guideline was followed, for instance in the usage of MR brain with stage III lung cancer patients (n = 70). The state-transition model predicts an average budget impact for the diagnostic pathway per patient estimated of € 2496 in the academic tertiary care hospital and € 2191 in the large regional teaching hospital. The adherence to the CPG's differed between hospitals, which questions the adherence to CPG's in general. Adherence to CPG's could lead to less costs in the diagnostic pathway for lung cancer patients.

Top