Animal feed compositions containing phytase derived from transgenic alfalfa and methods of use thereof

DOEpatents

Austin-Phillips, Sandra; Koegel, Richard G.; Straub, Richard J.; Cook, Mark

1999-01-01

A value-added composition of matter containing plant matter from transgenic alfalfa which expresses exogenous phytase activity is disclosed. The phytase activity is a gene product of an exogenous gene encoding for phytase which has been stably incorporated into the genome of alfalfa plants. The transgenic alfalfa expresses phytase activity in nutritionally-significant amounts, thereby enabling its use in animal feeds to eliminate the need for phosphorous supplementation of livestock, poultry, and fish feed rations.

Animal feed compositions containing phytase derived from transgenic alfalfa and methods of use thereof

DOEpatents

Austin-Phillips, Sandra; Koegel, Richard G.; Straub, Richard J.; Cook, Mark

2001-01-01

A value-added composition of matter containing plant matter from transgenic alfalfa which expresses exogenous phytase activity is disclosed. The phytase activity is a gene product of an exogenous gene encoding for phytase which has been stably incorporated into the genome of alfalfa plants. The transgenic alfalfa expresses phytase activity in nutritionally-significant amounts, thereby enabling its use in animal feeds to eliminate the need for phosphorous supplementation of livestock, poultry, and fish feed rations.

Alfalfa Cellulose Synthase Gene Expression under Abiotic Stress: A Hitchhiker’s Guide to RT-qPCR Normalization

PubMed Central

Guerriero, Gea; Legay, Sylvain; Hausman, Jean-Francois

2014-01-01

Abiotic stress represents a serious threat affecting both plant fitness and productivity. One of the promptest responses that plants trigger following abiotic stress is the differential expression of key genes, which enable to face the adverse conditions. It is accepted and shown that the cell wall senses and broadcasts the stress signal to the interior of the cell, by triggering a cascade of reactions leading to resistance. Therefore the study of wall-related genes is particularly relevant to understand the metabolic remodeling triggered by plants in response to exogenous stresses. Despite the agricultural and economical relevance of alfalfa (Medicago sativa L.), no study, to our knowledge, has addressed specifically the wall-related gene expression changes in response to exogenous stresses in this important crop, by monitoring the dynamics of wall biosynthetic gene expression. We here identify and analyze the expression profiles of nine cellulose synthases, together with other wall-related genes, in stems of alfalfa plants subjected to different abiotic stresses (cold, heat, salt stress) at various time points (e.g. 0, 24, 72 and 96 h). We identify 2 main responses for specific groups of genes, i.e. a salt/heat-induced and a cold/heat-repressed group of genes. Prior to this analysis we identified appropriate reference genes for expression analyses in alfalfa, by evaluating the stability of 10 candidates across different tissues (namely leaves, stems, roots), under the different abiotic stresses and time points chosen. The results obtained confirm an active role played by the cell wall in response to exogenous stimuli and constitute a step forward in delineating the complex pathways regulating the response of plants to abiotic stresses. PMID:25084115

Induction of apoptosis in cells expressing exogenous Hippi, a molecular partner of huntingtin-interacting protein Hip1.

PubMed

Majumder, Pritha; Chattopadhyay, Biswanath; Mazumder, Arindam; Das, Pradeep; Bhattacharyya, Nitai P

2006-05-01

To decipher the pathway of apoptosis induction downstream to caspase-8 activation by exogenous expression of Hippi, an interactor of huntingtin-interacting protein Hip1, we studied apoptosis in HeLa and Neuro2A cells expressing GFP-tagged Hippi. Nuclear fragmentation, caspase-1, caspase-8, caspase-9/caspase-6 and caspase-3 activation were increased significantly in Hippi expressing cells. Cleavage of Bid, release of cytochrome c and apoptosis inducing factor (AIF) from mitochondria were also increased in GFP-Hippi expressing cells. It was observed that caspase-1 and caspase-8 activation was earlier than caspase-3 activation and nuclear fragmentation. Expression of caspase-1, caspase-3 and caspase-7 was increased while anti-apoptotic gene Bcl-2 and mitochondrial genes ND1 and ND4 were reduced in Hippi expressing cells. Besides, the expression SDHA and SDHB, nuclear genes, subunits of mitochondrial complex II were decreased in GFP-Hippi expressing cells. Taken together, we concluded that Hippi expression induced apoptosis by releasing AIF and cytochrome c from mitochondria, activation of caspase-1 and caspase-3, and altering the expression of apoptotic genes and genes involved in mitochondrial complex I and II.

Intestinal alkaline phosphatase and sodium butyrate may be beneficial in attenuating LPS-induced intestinal inflammation.

PubMed

Melo, A D B; Silveira, H; Bortoluzzi, C; Lara, L J; Garbossa, C A P; Preis, G; Costa, L B; Rostagno, M H

2016-10-17

In this study, we evaluated the effect of intestinal alkaline phosphatase (IAP) and sodium butyrate (NaBu) on lipopolysaccharide (LPS)-induced intestinal inflammation. Intestinal alkaline phosphatase and RelA/p65 (NF-κB) gene expressions in porcine jejunum explants were evaluated following exposure to sodium butyrate (NaBu) and essential oil from Brazilian red pepper (EO), alone or in combination with NaBu, as well as exogenous IAP with or without LPS challenge. Five piglets weighing approximately 20 kg each were sacrificed, and their jejunum were extracted. The tissues were segmented into 10 parts, which were exposed to 10 treatments. Gene expressions of IAP and RelA/p65 (NF-κB) in jejunal explants were evaluated via RT-PCR. We found that EO, NaBu, and exogenous IAP were able to up-regulate endogenous IAP and enhance RelA/p65 (NF-κB) gene expression. However, only NaBu and exogenous IAP down-regulated LPS-induced inflammatory response via RelA/p65 (NF-κB). In conclusion, we demonstrated that exogenous IAP and NaBu may be beneficial in attenuating LPS-induced intestinal inflammation.

Transcriptome alteration in Phytophthora infestans in response to phenazine-1-carboxylic acid production by Pseudomonas fluorescens strain LBUM223.

PubMed

Roquigny, Roxane; Novinscak, Amy; Arseneault, Tanya; Joly, David L; Filion, Martin

2018-06-19

Phytophthora infestans is responsible for late blight, one of the most important potato diseases. Phenazine-1-carboxylic acid (PCA)-producing Pseudomonas fluorescens strain LBUM223 isolated in our laboratory shows biocontrol potential against various plant pathogens. To characterize the effect of LBUM223 on the transcriptome of P. infestans, we conducted an in vitro time-course study. Confrontational assay was performed using P. infestans inoculated alone (control) or with LBUM223, its phzC- isogenic mutant (not producing PCA), or exogenically applied PCA. Destructive sampling was performed at 6, 9 and 12 days and the transcriptome of P. infestans was analysed using RNA-Seq. The expression of a subset of differentially expressed genes was validated by RT-qPCR. Both LBUM223 and exogenically applied PCA significantly repressed P. infestans' growth at all times. Compared to the control treatment, transcriptomic analyses showed that the percentages of all P. infestans' genes significantly altered by LBUM223 and exogenically applied PCA increased as time progressed, from 50 to 61% and from to 32 to 46%, respectively. When applying an absolute cut-off value of 3 fold change or more for all three harvesting times, 207 genes were found significantly differentially expressed by PCA, either produced by LBUM223 or exogenically applied. Gene ontology analysis revealed that both treatments altered the expression of key functional genes involved in major functions like phosphorylation mechanisms, transmembrane transport and oxidoreduction activities. Interestingly, even though no host plant tissue was present in the in vitro system, PCA also led to the overexpression of several genes encoding effectors. The mutant only slightly repressed P. infestans' growth and barely altered its transcriptome. Our study suggests that PCA is involved in P. infestans' growth repression and led to important transcriptomic changes by both up- and down-regulating gene expression in P. infestans over time. Different metabolic functions were altered and many effectors were found to be upregulated, suggesting their implication in biocontrol.

Up-regulation of tumor suppressor genes by exogenous dhC16-Cer contributes to its anti-cancer activity in primary effusion lymphoma.

PubMed

Cao, Yueyu; Qiao, Jing; Lin, Zhen; Zabaleta, Jovanny; Dai, Lu; Qin, Zhiqiang

2017-02-28

Primary effusion lymphoma (PEL) is a rare and highly aggressive B-cell malignancy with Kaposi's sarcoma-associated herpesvirus (KSHV) infection, while lack of effective therapies. Our recent data indicated that targeting the sphingolipid metabolism by either sphingosine kinase inhibitor or exogenous ceramide species induces PEL cell apoptosis and suppresses tumor progression in vivo. However, the underlying mechanisms for these exogenous ceramides "killing" PEL cells remain largely unknown. Based on the microarray analysis, we found that exogenous dhC16-Cer treatment affected the expression of many cellular genes with important functions within PEL cells such as regulation of cell cycle, cell survival/proliferation, and apoptosis/anti-apoptosis. Interestingly, we found that a subset of tumor suppressor genes (TSGs) was up-regulated from dhC16-Cer treated PEL cells. One of these elevated TSGs, Thrombospondin-1 (THBS1) was required for dhC16-Cer induced PEL cell cycle arrest. Moreover, dhC16-Cer up-regulation of THBS1 was through the suppression of multiple KSHV microRNAs expression. Our data demonstrate that exogenous ceramides display anti-cancer activities for PEL through regulation of both host and oncogenic virus factors.

Glioma stem cells targeted by oncolytic virus carrying endostatin-angiostatin fusion gene and the expression of its exogenous gene in vitro.

PubMed

Zhu, Guidong; Su, Wei; Jin, Guishan; Xu, Fujian; Hao, Shuyu; Guan, Fangxia; Jia, William; Liu, Fusheng

2011-05-16

The development of the cancer stem cell (CSCs) niche theory has provided a new target for the treatment of gliomas. Gene therapy using oncolytic viral vectors has shown great potential for the therapeutic targeting of CSCs. To explore whether a viral vector carrying an exogenous Endo-Angio fusion gene (VAE) can infect and kill glioma stem cells (GSCs), as well as inhibit their vascular niche in vitro, we have collected surgical specimens of human high-grade glioma (world health organization, WHO Classes III-VI) from which we isolated and cultured GSCs under conditions originally designed for the selective expansion of neural stem cells. Our results demonstrate the following: (1) Four lines of GSCs (isolated from 20 surgical specimens) could grow in suspension, were multipotent, had the ability to self-renew and expressed the neural stem cell markers, CD133 and nestin. (2) VAE could infect GSCs and significantly inhibit their viability. (3) The Endo-Angio fusion gene was expressed in GSCs 48 h after VAE infection and could inhibit the proliferation of human brain microvascular endothelial cells (HBMEC). (4) Residual viable cells lose the ability of self-renewal and adherent differentiation. In conclusion, VAE can significantly inhibit the activity of GSCs in vitro and the expression of exogenous Endo-Angio fusion gene can inhibit HBMEC proliferation. VAE can be used as a novel virus-gene therapy strategy for glioma. Copyright © 2011 Elsevier B.V. All rights reserved.

Effects of exogenous inosine monophosphate on growth performance, flavor compounds, enzyme activity, and gene expression of muscle tissues in chicken.

PubMed

Yan, Junshu; Liu, Peifeng; Xu, Liangmei; Huan, Hailin; Zhou, Weiren; Xu, Xiaoming; Shi, Zhendan

2018-04-01

The goal of this experiment was to examine effects of diets supplemented with exogenous inosine monophosphate (IMP) on the growth performance, flavor compounds, enzyme activity and gene expression of chicken. A total of 1,500 healthy, 1-day-old male 3-yellow chickens were used for a 52-d experimental period. Individuals were randomly divided into 5 groups (group I, II, III, IV, V) with 6 replicates per group, and fed a basal diet supplemented with 0.0, 0.05, 0.1, 0.2, and 0.3% IMP, respectively. There was no significant response to the increasing dietary IMP level in average daily feed intake (ADFI), average daily gain (ADG), and feed:gain ratio (F/G) (P ≥ 0.05). IMP content of the breast and thigh muscle showed an exponential and linear response to the increasing dietary IMP level (P < 0.05), the highest IMP content was obtained when the diet with 0.3% and 0.2% exogenous IMP was fed. There were significant effects of IMP level in diet on free amino acids (FAA) (exponential, linear and quadratic effect, P < 0.05) and delicious amino acids (DAA) (quadratic effect, P < 0.01) content in breast muscle. FAA and DAA content in thigh muscle showed an exponential and linear response (P < 0.05), and quadratic response (P < 0.01) to the increasing dietary IMP level, the highest FAA and DAA content was obtained when the diet with 0.2% exogenous IMP was fed. Dietary IMP supplementation had a quadratic effect on 5΄-NT and the alkaline phosphatase (ALP) enzyme activity in the breast muscle (P < 0.05), and the adenosine triphosphate (ATP) enzyme activity in the thigh muscles increased exponentially and linearly with increasing IMP level in diet (exponential effect, P = 0.061; linear effect, P = 0.059). Cyclohydrolase (ATIC) gene expression in thigh muscle had a quadratic response to the increasing dietary IMP level (P < 0.05), 0.2% exogenous IMP group had the highest (AMPD1) gene expression of the breast muscle and ATIC gene expression of the thigh muscle. These results indicate that dietary IMP did not affect the growth performance of chicken, the diet with 0.2 to 0.3% exogenous IMP is optimal to improve the meat flavor quality in chicken.

Regulation of root hair initiation and expansin gene expression in Arabidopsis

NASA Technical Reports Server (NTRS)

Cho, Hyung-Taeg; Cosgrove, Daniel J.

2002-01-01

The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

Flavonoids modify root growth and modulate expression of SHORT-ROOT and HD-ZIP III.

PubMed

Franco, Danilo Miralha; Silva, Eder Marques; Saldanha, Luiz Leonardo; Adachi, Sérgio Akira; Schley, Thayssa Rabelo; Rodrigues, Tatiane Maria; Dokkedal, Anne Ligia; Nogueira, Fabio Tebaldi Silveira; Rolim de Almeida, Luiz Fernando

2015-09-01

Flavonoids are a class of distinct compounds produced by plant secondary metabolism that inhibit or promote plant development and have a relationship with auxin transport. We showed that, in terms of root development, Copaifera langsdorffii leaf extracts has an inhibitory effect on most flavonoid components compared with the application of exogenous flavonoids (glycosides and aglycones). These compounds alter the pattern of expression of the SHORT-ROOT and HD-ZIP III transcription factor gene family and cause morpho-physiological alterations in sorghum roots. In addition, to examine the flavonoid auxin interaction in stress, we correlated the responses with the effects of exogenous application of auxin and an auxin transport inhibitor. The results show that exogenous flavonoids inhibit primary root growth and increase the development of lateral roots. Exogenous flavonoids also change the pattern of expression of specific genes associated with root tissue differentiation. These findings indicate that flavonoid glycosides can influence the polar transport of auxin, leading to stress responses that depend on auxin. Copyright © 2015 Elsevier GmbH. All rights reserved.

Tissue-specific NETs alter genome organization and regulation even in a heterologous system.

PubMed

de Las Heras, Jose I; Zuleger, Nikolaj; Batrakou, Dzmitry G; Czapiewski, Rafal; Kerr, Alastair R W; Schirmer, Eric C

2017-01-02

Different cell types exhibit distinct patterns of 3D genome organization that correlate with changes in gene expression in tissue and differentiation systems. Several tissue-specific nuclear envelope transmembrane proteins (NETs) have been found to influence the spatial positioning of genes and chromosomes that normally occurs during tissue differentiation. Here we study 3 such NETs: NET29, NET39, and NET47, which are expressed preferentially in fat, muscle and liver, respectively. We found that even when exogenously expressed in a heterologous system they can specify particular genome organization patterns and alter gene expression. Each NET affected largely different subsets of genes. Notably, the liver-specific NET47 upregulated many genes in HT1080 fibroblast cells that are normally upregulated in hepatogenesis, showing that tissue-specific NETs can favor expression patterns associated with the tissue where the NET is normally expressed. Similarly, global profiling of peripheral chromatin after exogenous expression of these NETs using lamin B1 DamID revealed that each NET affected the nuclear positioning of distinct sets of genomic regions with a significant tissue-specific component. Thus NET influences on genome organization can contribute to gene expression changes associated with differentiation even in the absence of other factors and overt cellular differentiation changes.

Up-regulation of tumor suppressor genes by exogenous dhC16-Cer contributes to its anti-cancer activity in primary effusion lymphoma

PubMed Central

Lin, Zhen; Zabaleta, Jovanny; Dai, Lu; Qin, Zhiqiang

2017-01-01

Primary effusion lymphoma (PEL) is a rare and highly aggressive B-cell malignancy with Kaposi's sarcoma-associated herpesvirus (KSHV) infection, while lack of effective therapies. Our recent data indicated that targeting the sphingolipid metabolism by either sphingosine kinase inhibitor or exogenous ceramide species induces PEL cell apoptosis and suppresses tumor progression in vivo. However, the underlying mechanisms for these exogenous ceramides “killing” PEL cells remain largely unknown. Based on the microarray analysis, we found that exogenous dhC16-Cer treatment affected the expression of many cellular genes with important functions within PEL cells such as regulation of cell cycle, cell survival/proliferation, and apoptosis/anti-apoptosis. Interestingly, we found that a subset of tumor suppressor genes (TSGs) was up-regulated from dhC16-Cer treated PEL cells. One of these elevated TSGs, Thrombospondin-1 (THBS1) was required for dhC16-Cer induced PEL cell cycle arrest. Moreover, dhC16-Cer up-regulation of THBS1 was through the suppression of multiple KSHV microRNAs expression. Our data demonstrate that exogenous ceramides display anti-cancer activities for PEL through regulation of both host and oncogenic virus factors. PMID:28146424

Efficient expression of green fluorescent protein (GFP) mediated by a chimeric promoter in Chlamydomonas reinhardtii

NASA Astrophysics Data System (ADS)

Wu, Jinxia; Hu, Zhangli; Wang, Chaogang; Li, Shuangfei; Lei, Anping

2008-08-01

To improve the expression efficiency of exogenous genes in Chlamydomonas reinhardtii, a high efficient expression vector was constructed. Green fluorescent protein (GFP) was expressed in C. reinhardtii under the control of promoters: RBCS2 and HSP70A-RBCS2. Efficiency of transformation and expression were compared between two transgenic algae: RBCS2 mediated strain Tran-I and HSP70A-RBCS2 mediated strain Tran-II. Results show that HSP70A-RBCS2 could improve greatly the transformation efficiency by approximately eightfold of RBCS2, and the expression efficiency of GFP in Tran-II was at least double of that in Tran-I. In addition, a threefold increase of GFP in Tran-II was induced by heat shock at 40°C. All of the results demonstrated that HSP70A-RBCS2 was more efficient than RBCS2 in expressing exogenous gene in C. reinhardtii.

The cytomegalovirus promoter-driven short hairpin RNA constructs mediate effective RNA interference in zebrafish in vivo.

PubMed

Su, Jianguo; Zhu, Zuoyan; Wang, Yaping; Xiong, Feng; Zou, Jun

2008-01-01

The ability to utilize the RNA interference (RNAi) machinery for silencing target-gene expression has created a lot of excitement in the research community. In the present study, we used a cytomegalovirus (CMV) promoter-driven DNA template approach to induce short hairpin RNA (shRNA) triggered RNAi to block exogenous Enhanced Green Fluorescent Protein (EGFP) and endogenous No Tail (NTL) gene expressions. We constructed three plasmids, pCMV-EGFP-CMV-shGFP-SV40, pCMV-EGFP-CMV-shNTL-SV40, and pCMV-EGFP-CMV-shScrambled-SV40, each containing a CMV promoter driving an EGFP reporter cDNA and DNA coding for one shRNA under the control of another CMV promoter. The three shRNA-generating plasmids and pCMV-EGFP control plasmid were introduced into zebrafish embryos by microinjection. Samples were collected at 48 h after injection. Results were evaluated by phenotype observation and real-time fluorescent quantitative reverse-transcription polymerase chain reaction (Q-PCR). The shGFP-generating plasmid significantly inhibited the EGFP expression viewed under fluorescent microscope and reduced by 70.05 +/- 1.26% of exogenous EGFP gene mRNA levels compared with controls by Q-PCR. The shRNA targeting endogenous NTL gene resulted in obvious NTL phenotype of 30 +/- 4% and decreased the level of their corresponding mRNAs up to 54.52 +/- 2.05% compared with nontargeting control shRNA. These data proved the feasibility of the CMV promoter-driven shRNA expression technique to be used to inhibit exogenous and endogenous gene expressions in zebrafish in vivo.

Studies on the expression of an H-2K/human growth hormone fusion gene in giant transgenic mice.

PubMed Central

Morello, D; Moore, G; Salmon, A M; Yaniv, M; Babinet, C

1986-01-01

Transgenic mice carrying the H-2K/human growth hormone (hGH) fusion gene were produced by microinjecting into the pronucleus of fertilized eggs DNA molecules containing 2 kb of the 5' flanking sequences (including promoter) of the class I H-2Kb gene joined to the coding sequences of the hGH gene. Thirteen transgenic mice were obtained which all contained detectable levels of hGH hormone in their blood. Nine grew larger than their control litter-mates. Endogenous H-2Kb and exogenous hGH mRNA levels were analysed by S1 nuclease digestion experiments. hGH transcripts were found in all the tissues examined and the pattern of expression paralleled that of endogenous H-2K gene expression, being high in liver and lymphoid organs and low in muscle and brain. Thus 2 kb of the 5' promoter/regulatory region of the H-2K gene are sufficient to ensure regulated expression of hGH in transgenic mice. This promoter may therefore be of use to target the expression of different exogenous genes in most tissues of transgenic mice and to study the biological role of the corresponding proteins in different cellular environments. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3019667

Self-protection against gliotoxin--a component of the gliotoxin biosynthetic cluster, GliT, completely protects Aspergillus fumigatus against exogenous gliotoxin.

PubMed

Schrettl, Markus; Carberry, Stephen; Kavanagh, Kevin; Haas, Hubertus; Jones, Gary W; O'Brien, Jennifer; Nolan, Aine; Stephens, John; Fenelon, Orla; Doyle, Sean

2010-06-10

Gliotoxin, and other related molecules, are encoded by multi-gene clusters and biosynthesized by fungi using non-ribosomal biosynthetic mechanisms. Almost universally described in terms of its toxicity towards mammalian cells, gliotoxin has come to be considered as a component of the virulence arsenal of Aspergillus fumigatus. Here we show that deletion of a single gene, gliT, in the gliotoxin biosynthetic cluster of two A. fumigatus strains, rendered the organism highly sensitive to exogenous gliotoxin and completely disrupted gliotoxin secretion. Addition of glutathione to both A. fumigatus Delta gliT strains relieved gliotoxin inhibition. Moreover, expression of gliT appears to be independently regulated compared to all other cluster components and is up-regulated by exogenous gliotoxin presence, at both the transcript and protein level. Upon gliotoxin exposure, gliT is also expressed in A. fumigatus Delta gliZ, which cannot express any other genes in the gliotoxin biosynthetic cluster, indicating that gliT is primarily responsible for protecting this strain against exogenous gliotoxin. GliT exhibits a gliotoxin reductase activity up to 9 microM gliotoxin and appears to prevent irreversible depletion of intracellular glutathione stores by reduction of the oxidized form of gliotoxin. Cross-species resistance to exogenous gliotoxin is acquired by A. nidulans and Saccharomyces cerevisiae, respectively, when transformed with gliT. We hypothesise that the primary role of gliotoxin may be as an antioxidant and that in addition to GliT functionality, gliotoxin secretion may be a component of an auto-protective mechanism, deployed by A. fumigatus to protect itself against this potent biomolecule.

Molecular Cloning and Functional Analysis of Three Type D Endogenous Retroviruses of Sheep Reveal a Different Cell Tropism from That of the Highly Related Exogenous Jaagsiekte Sheep Retrovirus

PubMed Central

Palmarini, Massimo; Hallwirth, Claus; York, Denis; Murgia, Claudio; de Oliveira, Tulio; Spencer, Thomas; Fan, Hung

2000-01-01

Integrated into the sheep genome are 15 to 20 copies of type D endogenous loci that are highly related to two exogenous oncogenic viruses, jaagsiekte sheep retrovirus (JSRV) and enzootic nasal tumor virus (ENTV). The exogenous viruses cause infectious neoplasms of the respiratory tract in small ruminants. In this study, we molecularly cloned three intact type D endogenous retroviruses of sheep (enJS56A1, enJS5F16, and enJS59A1; collectively called enJRSVs) and analyzed their genomic structures, their phylogenies with respect to their exogenous counterparts, their capacity to form viral particles, and the expression specificities of their long terminal repeats (LTRs). In addition, the pattern of expression of enJSRVs in vivo was studied by in situ hybridization. All of the three enJSRV proviruses had open reading frames for at least one of the structural genes. In particular, enJS56A1 had open reading frames for all structural genes, but it could not assemble viral particles when highly expressed in human 293T cells. We localized the defect for viral assembly in the first two-thirds of the gag gene by making a series of chimeras between enJS56A1 and the exogenous infectious molecular clone JSRV21. Phylogenetic analysis distinguished five ovine type D retroviruses: enJSRV groups A and B, ENTV, and two exogenous JSRV groups (African versus United Kingdom/North America isolates). Transient transfection assays indicated that the LTRs of the three enJSRVs were not preferentially active in differentiated lung epithelial cells. This suggests that the pulmonary tropic JSRV developed from a type D retrovirus that did not have lung specificity. Consistent with this, in situ hybridization of a panel of normal ovine tissues revealed high expression of enJSRV mRNA in the luminal epithelium and glandular epithelium of the uterus; lower expression was localized in the lamina propria of the gut and in the bronchiolar epithelium of the lungs. PMID:10933716

Wt-p53 action in human leukaemia cell lines corresponding to different stages of differentiation.

PubMed

Rizzo, M G; Zepparoni, A; Cristofanelli, B; Scardigli, R; Crescenzi, M; Blandino, G; Giuliacci, S; Ferrari, S; Soddu, S; Sacchi, A

1998-05-01

Recent studies support the potential application of the wt-p53 gene in cancer therapy. Expression of exogenous wt-p53 suppresses a variety of leukaemia phenotypes by acting on cell survival, proliferation and/or differentiation. As for tumour gene therapy, the final fate of the neoplastic cells is one of the most relevant points. We examined the effects of exogenous wt-p53 gene expression in several leukaemia cell lines to identify p53-responsive leukaemia. The temperature-sensitive p53Val135 mutant or the human wt-p53 cDNA was transduced in leukaemia cell lines representative of different acute leukaemia FAB subtypes, including M1 (KG1), M2 (HL-60), M3 (NB4), M5 (U937) and M6 (HEL 92.1.7), as well as blast crisis of chronic myelogenous leukaemia (BC-CML: K562, BV173) showing diverse differentiation features. By morphological, molecular and biochemical analyses, we have shown that exogenous wt-p53 gene expression induces apoptosis only in cells corresponding to M1, M2 and M3 of the FAB classification and in BC-CML showing morphological and cytochemical features of undifferentiated blast cells. In contrast, it promotes differentiation in the others. Interestingly, cell responsiveness was independent of the vector used and the status of the endogenous p53 gene.

A Novel Tightly Regulated Gene Expression System for the Human Intestinal Symbiont Bacteroides thetaiotaomicron.

PubMed

Horn, Nikki; Carvalho, Ana L; Overweg, Karin; Wegmann, Udo; Carding, Simon R; Stentz, Régis

2016-01-01

There is considerable interest in studying the function of Bacteroides species resident in the human gastrointestinal (GI)-tract and the contribution they make to host health. Reverse genetics and protein expression techniques, such as those developed for well-characterized Escherichia coli cannot be applied to Bacteroides species as they and other members of the Bacteriodetes phylum have unique promoter structures. The availability of useful Bacteroides-specific genetic tools is therefore limited. Here we describe the development of an effective mannan-controlled gene expression system for Bacteroides thetaiotaomicron containing the mannan-inducible promoter-region of an α-1,2-mannosidase gene (BT_3784), a ribosomal binding site designed to modulate expression, a multiple cloning site to facilitate the cloning of genes of interest, and a transcriptional terminator. Using the Lactobacillus pepI as a reporter gene, mannan induction resulted in an increase of reporter activity in a time- and concentration-dependent manner with a wide range of activity. The endogenous BtcepA cephalosporinase gene was used to demonstrate the suitability of this novel expression system, enabling the isolation of a His-tagged version of BtCepA. We have also shown with experiments performed in mice that the system can be induced in vivo in the presence of an exogenous source of mannan. By enabling the controlled expression of endogenous and exogenous genes in B. thetaiotaomicron this novel inducer-dependent expression system will aid in defining the physiological role of individual genes and the functional analyses of their products.

Acute changes in cellular zinc alters zinc uptake rates prior to zinc transporter gene expression in Jurkat cells.

PubMed

Holland, Tai C; Killilea, David W; Shenvi, Swapna V; King, Janet C

2015-12-01

A coordinated network of zinc transporters and binding proteins tightly regulate cellular zinc levels. Canonical responses to zinc availability are thought to be mediated by changes in gene expression of key zinc transporters. We investigated the temporal relationships of actual zinc uptake with patterns of gene expression in membrane-bound zinc transporters in the human immortalized T lymphocyte Jurkat cell line. Cellular zinc levels were elevated or reduced with exogenous zinc sulfate or N,N,N',N-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN), respectively. Excess zinc resulted in a rapid 44 % decrease in the rate of zinc uptake within 10 min. After 120 min, the expression of metallothionein (positive control) increased, as well as the zinc exporter, ZnT1; however, the expression of zinc importers did not change during this time period. Zinc chelation with TPEN resulted in a rapid twofold increase in the rate of zinc uptake within 10 min. After 120 min, the expression of ZnT1 decreased, while again the expression of zinc importers did not change. Overall, zinc transporter gene expression kinetics did not match actual changes in cellular zinc uptake with exogenous zinc or TPEN treatments. This suggests zinc transporter regulation may be the initial response to changes in zinc within Jurkat cells.

Endogenous versus Exogenous Growth Factor Regulation of Articular Chondrocytes

PubMed Central

Shi, Shuiliang; Chan, Albert G.; Mercer, Scott; Eckert, George J.; Trippel, Stephen B.

2014-01-01

Anabolic growth factors that regulate the function of articular chondrocytes are candidates for articular cartilage repair. Such factors may be delivered by pharmacotherapy in the form of exogenous proteins, or by gene therapy as endogenous proteins. It is unknown whether delivery method influences growth factor effectiveness in regulating articular chondrocyte reparative functions. We treated adult bovine articular chondrocytes with exogenous recombinant insulin-like growth factor-I (IGF-I) and transforming growth factor-beta1 (TGF-β1), or with the genes encoding these growth factors for endogenous production. Treatment effects were measured as change in chondrocyte DNA content, glycosaminoglycan production, and aggrecan gene expression. We found that IGF-I stimulated chondrocyte biosynthesis similarly when delivered by either exogenous or endogenous means. In contrast, exogenous TGF-ß1 stimulated these reparative functions, while endogenous TGF-ß1 had little effect. Endogenous TGF-ß1 became more bioactive following activation of the transgene protein product. These data indicate that effective mechanisms of growth factor delivery for articular cartilage repair may differ for different growth factors. In the case of IGF-I, gene therapy or protein therapy appear to be viable options. In contrast, TGF-ß1 gene therapy may be constrained by a limited ability of chondrocytes to convert latent complexes to an active form. PMID:24105960

Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer | Office of Cancer Genomics

Cancer.gov

Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways.

Development of Defective and Persistent Sendai Virus Vector

PubMed Central

Nishimura, Ken; Sano, Masayuki; Ohtaka, Manami; Furuta, Birei; Umemura, Yoko; Nakajima, Yoshiro; Ikehara, Yuzuru; Kobayashi, Toshihiro; Segawa, Hiroaki; Takayasu, Satoko; Sato, Hideyuki; Motomura, Kaori; Uchida, Eriko; Kanayasu-Toyoda, Toshie; Asashima, Makoto; Nakauchi, Hiromitsu; Yamaguchi, Teruhide; Nakanishi, Mahito

2011-01-01

The ectopic expression of transcription factors can reprogram differentiated tissue cells into induced pluripotent stem cells. However, this is a slow and inefficient process, depending on the simultaneous delivery of multiple genes encoding essential reprogramming factors and on their sustained expression in target cells. Moreover, once cell reprogramming is accomplished, these exogenous reprogramming factors should be replaced with their endogenous counterparts for establishing autoregulated pluripotency. Complete and designed removal of the exogenous genes from the reprogrammed cells would be an ideal option for satisfying this latter requisite as well as for minimizing the risk of malignant cell transformation. However, no single gene delivery/expression system has ever been equipped with these contradictory characteristics. Here we report the development of a novel replication-defective and persistent Sendai virus (SeVdp) vector based on a noncytopathic variant virus, which fulfills all of these requirements for cell reprogramming. The SeVdp vector could accommodate up to four exogenous genes, deliver them efficiently into various mammalian cells (including primary tissue cells and human hematopoietic stem cells) and express them stably in the cytoplasm at a prefixed balance. Furthermore, interfering with viral transcription/replication using siRNA could erase the genomic RNA of SeVdp vector from the target cells quickly and thoroughly. A SeVdp vector installed with Oct4/Sox2/Klf4/c-Myc could reprogram mouse primary fibroblasts quite efficiently; ∼1% of the cells were reprogrammed to Nanog-positive induced pluripotent stem cells without chromosomal gene integration. Thus, this SeVdp vector has potential as a tool for advanced cell reprogramming and for stem cell research. PMID:21138846

Abscisic acid regulates pinoresinol-lariciresinol reductase gene expression and secoisolariciresinol accumulation in developing flax (Linum usitatissimum L.) seeds.

PubMed

Renouard, Sullivan; Corbin, Cyrielle; Lopez, Tatiana; Montguillon, Josiane; Gutierrez, Laurent; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe

2012-01-01

Secoisolariciresinol diglucoside (SDG), the main phytoestrogenic lignan of Linum usitatissimum, is accumulated in the seed coat of flax during its development and pinoresinol-lariciresinol reductase (PLR) is a key enzyme in flax for its synthesis. The promoter of LuPLR1, a flax gene encoding a pinoresinol lariciresinol reductase, contains putative regulatory boxes related to transcription activation by abscisic acid (ABA). Gel mobility shift experiments evidenced an interaction of nuclear proteins extracted from immature flax seed coat with a putative cis-acting element involved in ABA response. As ABA regulates a number of physiological events during seed development and maturation we have investigated its involvement in the regulation of this lignan synthesis by different means. ABA and SDG accumulation time courses in the seed as well as LuPLR1 expression were first determined in natural conditions. These results showed that ABA timing and localization of accumulation in the flax seed coat could be correlated with the LuPLR1 gene expression and SDG biosynthesis. Experimental modulations of ABA levels were performed by exogenous application of ABA or fluridone, an inhibitor of ABA synthesis. When submitted to exogenous ABA, immature seeds synthesized 3-times more SDG, whereas synthesis of SDG was reduced in immature seeds treated with fluridone. Similarly, the expression of LuPLR1 gene in the seed coat was up-regulated by exogenous ABA and down-regulated when fluridone was applied. These results demonstrate that SDG biosynthesis in the flax seed coat is positively controlled by ABA through the transcriptional regulation of LuPLR1 gene.

Transcriptome profiling of postharvest strawberry fruit in response to exogenous auxin and abscisic acid.

PubMed

Chen, Jingxin; Mao, Linchun; Lu, Wenjing; Ying, Tiejin; Luo, Zisheng

2016-01-01

Auxin and abscisic acid regulate strawberry fruit ripening and senescence through cross-talk of their signal transduction pathways that further modulate the structural genes related to physico-chemical properties of fruit. The physiological and transcriptomic changes in harvested strawberry fruits in responses to IAA, ABA and their combination were analyzed. Exogenous IAA delayed the ripening process of strawberries after harvest while ABA promoted the postharvest ripening. However, treatment with a combination of IAA and ABA did not slow down nor accelerate the postharvest ripening in the strawberry fruits. At the molecular level, exogenous IAA up regulated the expressions of genes related to IAA signaling, including AUX/IAA, ARF, TOPLESS and genes encoding E3 ubiquitin protein ligase and annexin, and down regulated genes related to pectin depolymerization, cell wall degradation, sucrose and anthocyanin biosyntheses. In contrast, exogenous ABA induced genes related to fruit softening, and genes involved in signaling pathways including SKP1, HSPs, CK2, and SRG1. Comparison of transcriptomes in responses to individual treatments with IAA or ABA or the combination revealed that there were cooperative and antagonistic actions between IAA and ABA in fruit. However, 17% of the differentially expressed unigenes in response to the combination of IAA and ABA were unique and were not found in those unigenes responding to either IAA or ABA alone. The analyses also found that receptor-like kinases and ubiquitin ligases responded to both IAA and ABA, which seemed to play a pivotal role in both hormones' signaling pathways and thus might be the cross-talk points of both hormones.

Exogenous strigolactone interacts with abscisic acid-mediated accumulation of anthocyanins in grapevine berries.

PubMed

Ferrero, Manuela; Pagliarani, Chiara; Novák, Ondrej; Ferrandino, Alessandra; Cardinale, Francesca; Visentin, Ivan; Schubert, Andrea

2018-04-23

Besides signalling to soil organisms, strigolactones (SLs) control above- and below-ground morphology, in particular shoot branching. Furthermore, SLs interact with stress responses, possibly thanks to a crosstalk with the abscisic acid (ABA) signal. In grapevine (Vitis vinifera L.), ABA drives the accumulation of anthocyanins over the ripening season. In this study, we investigated the effects of treatment with a synthetic strigolactone analogue, GR24, on anthocyanin accumulation in grape berries, in the presence or absence of exogenous ABA treatment. Experiments were performed both on severed, incubated berries, and on berries attached to the vine. Furthermore, we analysed the corresponding transcript concentrations of genes involved in anthocyanin biosynthesis, and in ABA biosynthesis, metabolism, and membrane transport. During the experiment time courses, berries showed the expected increase in soluble sugars and anthocyanins. GR24 treatment had no or little effect on anthocyanin accumulation, or on gene expression levels. Exogenous ABA treatment activated soluble sugar and anthocyanin accumulation, and enhanced expression of anthocyanin and ABA biosynthetic genes, and that of genes involved in ABA hydroxylation and membrane transport. Co-treatment of GR24 with ABA delayed anthocyanin accumulation, decreased expression of anthocyanin biosynthetic genes, and negatively affected ABA concentration. GR24 also enhanced the ABA-induced activation of ABA hydroxylase genes, while it down-regulated the ABA-induced activation of ABA transport genes. Our results show that GR24 affects the ABA-induced activation of anthocyanin biosynthesis in this non-climacteric fruit. We discuss possible mechanisms underlying this effect, and the potential role of SLs in ripening of non-ABA-treated berries.

[Construction and Function Verification of a Novel Shuttle Vector Containing a Marker Gene Self-deletion System].

PubMed

Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi

2015-09-01

For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.

Development of a Universal RNA Beacon for Exogenous Gene Detection

PubMed Central

Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen

2015-01-01

Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. PMID:25769653

Development of a universal RNA beacon for exogenous gene detection.

PubMed

Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen; Scarlata, Suzanne

2015-05-01

Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. ©AlphaMed Press.

A Novel Tightly Regulated Gene Expression System for the Human Intestinal Symbiont Bacteroides thetaiotaomicron

PubMed Central

Horn, Nikki; Carvalho, Ana L.; Overweg, Karin; Wegmann, Udo; Carding, Simon R.; Stentz, Régis

2016-01-01

There is considerable interest in studying the function of Bacteroides species resident in the human gastrointestinal (GI)-tract and the contribution they make to host health. Reverse genetics and protein expression techniques, such as those developed for well-characterized Escherichia coli cannot be applied to Bacteroides species as they and other members of the Bacteriodetes phylum have unique promoter structures. The availability of useful Bacteroides-specific genetic tools is therefore limited. Here we describe the development of an effective mannan-controlled gene expression system for Bacteroides thetaiotaomicron containing the mannan-inducible promoter–region of an α-1,2-mannosidase gene (BT_3784), a ribosomal binding site designed to modulate expression, a multiple cloning site to facilitate the cloning of genes of interest, and a transcriptional terminator. Using the Lactobacillus pepI as a reporter gene, mannan induction resulted in an increase of reporter activity in a time- and concentration-dependent manner with a wide range of activity. The endogenous BtcepA cephalosporinase gene was used to demonstrate the suitability of this novel expression system, enabling the isolation of a His-tagged version of BtCepA. We have also shown with experiments performed in mice that the system can be induced in vivo in the presence of an exogenous source of mannan. By enabling the controlled expression of endogenous and exogenous genes in B. thetaiotaomicron this novel inducer-dependent expression system will aid in defining the physiological role of individual genes and the functional analyses of their products. PMID:27468280

Experimental Model to Study the Role of Retinoblastoma Gene Product (pRb) for Determination of Adipocyte Differentiation.

PubMed

Popov, B V; Shilo, P S; Zhidkova, O V; Zaichik, A M; Petrov, N S

2015-06-01

Using stable constitutive expression of retinoblastoma gene product (pRb) in polypotent mesenchymal 10T1/2 cells we obtained stable cell lines hyperexpressing functionally active or inactive mutant pRb. The cells producing active exogenous pRb demonstrated high sensitivity to adipocyte differentiation inductors, whereas production of inactive form of the exogenous protein suppressed adipocyte differentiation. The obtained lines can serve as the experimental model for studying the role of pRb in determination of adipocyte differentiation.

Expression of the human NAD(P)-metabolizing ectoenzyme CD38 compromises systemic acquired resistance in Arabidopsis.

PubMed

Zhang, Xudong; Mou, Zhonglin

2012-09-01

Plant systemic acquired resistance (SAR) is a long-lasting, broad-spectrum immune response that is mounted after primary pathogen infection. Although SAR has been extensively researched, the molecular mechanisms underlying its activation have not been completely understood. We have previously shown that the electron carrier NAD(P) leaks into the plant extracellular compartment upon pathogen attack and that exogenous NAD(P) activates defense gene expression and disease resistance in local treated leaves, suggesting that extracellular NAD(P) [eNAD(P)] might function as a signal molecule activating plant immune responses. To further establish the function of eNAD(P) in plant immunity, we tested the effect of exogenous NAD(P) on resistance gene-mediated hypersensitive response (HR) and SAR. We found that exogenous NAD(P) completely suppresses HR-mediated cell death but does not affect HR-mediated disease resistance. Local application of exogenous NAD(P) is unable to induce SAR in distal tissues, indicating that eNAD(P) is not a sufficient signal for SAR activation. Using transgenic Arabidopsis plants expressing the human NAD(P)-metabolizing ectoenzyme CD38, we demonstrated that altering eNAD(P) concentration or signaling compromises biological induction of SAR. This result suggests that eNAD(P) may play a critical signaling role in activation of SAR.

Effect of delta sleep-inducing peptide on the expression of antioxidant enzyme genes in the brain and blood of rats during physiological aging.

PubMed

Kutilin, D S; Bondarenko, T I; Kornienko, I V; Mikhaleva, I I

2014-09-01

Subcutaneous injections of exogenous delta sleep-inducing peptide in a dose of 100 μg/kg (monthly, 5-day courses) to rats of various age groups (2-24 months) were followed by an increase in the expression of genes for SOD 1 (Sod1) and glutathione peroxidase 1 (Gpx1) in the brain and nucleated blood cells. The expression of these genes was shown to decrease during physiological aging of the body.

Hypoxia Potentiates Anabolic Effects of Exogenous Hyaluronic Acid in Rat Articular Cartilage

PubMed Central

Ichimaru, Shohei; Nakagawa, Shuji; Arai, Yuji; Kishida, Tsunao; Shin-Ya, Masaharu; Honjo, Kuniaki; Tsuchida, Shinji; Inoue, Hiroaki; Fujiwara, Hiroyoshi; Shimomura, Seiji; Mazda, Osam; Kubo, Toshikazu

2016-01-01

Hyaluronic acid (HA) is used clinically to treat osteoarthritis (OA), but its pharmacological effects under hypoxic conditions remain unclear. Articular chondrocytes in patients with OA are exposed to a hypoxic environment. This study investigated whether hypoxia could potentiate the anabolic effects of exogenous HA in rat articular cartilage and whether these mechanisms involved HA receptors. HA under hypoxic conditions significantly enhanced the expression of extracellular matrix genes and proteins in explant culture, as shown by real-time reverse transcription-polymerase chain reaction (RT-PCR), Western blotting, and dimethylmethylene blue (DMMB) assays. Staining with Safranin-O and immunohistochemical staining with antibody to type II collagen were also enhanced in pellet culture. The expression of CD44 was increased by hypoxia and significantly suppressed by transfection with siRNAs targeting hypoxia-inducible factor 1 alpha (siHIF-1α). These findings indicate that hypoxia potentiates the anabolic effects of exogenous HA by a mechanism in which HIF-1α positively regulates the expression of CD44, enhancing the binding affinity for exogenous HA. The anabolic effects of exogenous HA may increase as OA progresses. PMID:27347945

[Cloning and expression analysis of differentially expressed genes in Chinese fir stems treated by different concentrations of exogenous IAA].

PubMed

Yang, Li-Wei; Shi, Ji-Sen

2012-04-01

To reveal the potential genetic mechanisms of indole-3-acetic acid (IAA) that regulate Chinese fir wood formation, cloned the differentially expressed genes via suppress subtractive hybridization (SSH) using the truncated stems treated by 0 and 3 mg IAA/g lanolin as the driver and tester, respectively. A total of 332 unigenes that were involved in cell organization and biosynthesis, developmental processes control, electron transport, stress response, and signal transduction. To further test the results from SSH, we selected those unigenes, whose putative encoding proteins showed significantly homologous with HIRA, PGY1, SMP1, TCT, TRN2, and ARF4, and analyzed their expressed specificity in the wood formative tissues and their response to the secondary developmental changes of vascular cambium stimulated by 0, 1, and 3 mg.IAA/g.lanolin treatment. The results showed that ClHIRA, ClPGY1, and ClARF4, which were specifically expressed in the adaxial zone of stem, were positively response to the activities of cell division and tracheid differentiation stimulated by exogenous IAA treatment. However, ClSMP1, ClTCTP1, and ClTRN2, which were mainly expressed in the abaxial zones of stems, showed negative correlation with the treated levels of exogenous IAA and activities of vascular cambium secondary development at the transcriptional level. This result showed that the differential response of developmental regulatory genes located in different vascular tissues to the level changes of edogenous IAA in stems is likely to be an important molecular mechanism of auxin regulating wood formation.

Genome-Wide Analysis of the RAV Family in Soybean and Functional Identification of GmRAV-03 Involvement in Salt and Drought Stresses and Exogenous ABA Treatment

PubMed Central

Zhao, Shu-Ping; Xu, Zhao-Shi; Zheng, Wei-Jun; Zhao, Wan; Wang, Yan-Xia; Yu, Tai-Fei; Chen, Ming; Zhou, Yong-Bin; Min, Dong-Hong; Ma, You-Zhi; Chai, Shou-Cheng; Zhang, Xiao-Hong

2017-01-01

Transcription factors play vital roles in plant growth and in plant responses to abiotic stresses. The RAV transcription factors contain a B3 DNA binding domain and/or an APETALA2 (AP2) DNA binding domain. Although genome-wide analyses of RAV family genes have been performed in several species, little is known about the family in soybean (Glycine max L.). In this study, a total of 13 RAV genes, named as GmRAVs, were identified in the soybean genome. We predicted and analyzed the amino acid compositions, phylogenetic relationships, and folding states of conserved domain sequences of soybean RAV transcription factors. These soybean RAV transcription factors were phylogenetically clustered into three classes based on their amino acid sequences. Subcellular localization analysis revealed that the soybean RAV proteins were located in the nucleus. The expression patterns of 13 RAV genes were analyzed by quantitative real-time PCR. Under drought stresses, the RAV genes expressed diversely, up- or down-regulated. Following NaCl treatments, all RAV genes were down-regulated excepting GmRAV-03 which was up-regulated. Under abscisic acid (ABA) treatment, the expression of all of the soybean RAV genes increased dramatically. These results suggested that the soybean RAV genes may be involved in diverse signaling pathways and may be responsive to abiotic stresses and exogenous ABA. Further analysis indicated that GmRAV-03 could increase the transgenic lines resistance to high salt and drought and result in the transgenic plants insensitive to exogenous ABA. This present study provides valuable information for understanding the classification and putative functions of the RAV transcription factors in soybean. PMID:28634481

Different Preclimacteric Events in Apple Cultivars with Modified Ripening Physiology

PubMed Central

Singh, Vikram; Weksler, Asya; Friedman, Haya

2017-01-01

“Anna” is an early season apple cultivar exhibiting a fast softening and juiciness loss during storage, in comparison to two mid-late season cultivars “Galaxy” and “GD.” The poor storage capacity of “Anna” was correlated with high lipid oxidation-related autoluminescence, high respiration and ethylene production rates, associated with high expression of MdACO1, 2, 4, 7, and MdACS1. All cultivars at harvest responded to exogenous ethylene by enhancing ethylene production, typical of system-II. The contribution of pre-climacteric events to the poor storage capacity of “Anna” was examined by comparing respiration and ethylene production rates, response to exogenous ethylene, expression of genes responsible for ethylene biosynthesis and response, and developmental regulators in the three cultivars throughout fruit development. In contrast to the “Galaxy” and “GD,” “Anna” showed higher ethylene production and respiration rates during fruit development, and exhibited auto-stimulatory (system II-like) effect in response to exogenous ethylene. The higher ethylene production rate in “Anna” was correlated with higher expression of ethylene biosynthesis genes, MdACS3a MdACO2, 4, and 7 during early fruit development. The expression of negative regulators of ripening (AP2/ERF) and ethylene response pathway, (MdETR1,2 and MdCTR1) was lower in “Anna” in comparison to the other two cultivars throughout development and ripening. Similar pattern of gene expression was found for SQUAMOSA promoter binding protein (SBP)-box genes, including MdCNR and for MdFUL. Taken together, this study provides new understanding on pre-climacteric events in “Anna” that might affect its ripening behavior and physiology following storage. PMID:28928755

The paracrine effect of exogenous growth hormone alleviates dysmorphogenesis caused by tbx5 deficiency in zebrafish (Danio rerio) embryos

PubMed Central

2012-01-01

Background Dysmorphogenesis and multiple organ defects are well known in zebrafish (Danio rerio) embryos with T-box transcription factor 5 (tbx5) deficiencies, mimicking human Holt-Oram syndrome. Methods Using an oligonucleotide-based microarray analysis to study the expression of special genes in tbx5 morphants, we demonstrated that GH and some GH-related genes were markedly downregulated. Zebrafish embryos microinjected with tbx5-morpholino (MO) antisense RNA and mismatched antisense RNA in the 1-cell stage served as controls, while zebrafish embryos co-injected with exogenous growth hormone (GH) concomitant with tbx5-MO comprised the treatment group. Results The attenuating effects of GH in tbx5-MO knockdown embryos were quantified and observed at 24, 30, 48, 72, and 96 h post-fertilization. Though the understanding of mechanisms involving GH in the tbx5 functioning complex is limited, exogenous GH supplied to tbx5 knockdown zebrafish embryos is able to enhance the expression of downstream mediators in the GH and insulin-like growth factor (IGF)-1 pathway, including igf1, ghra, and ghrb, and signal transductors (erk1, akt2), and eventually to correct dysmorphogenesis in various organs including the heart and pectoral fins. Supplementary GH also reduced apoptosis as determined by a TUNEL assay and decreased the expression of apoptosis-related genes and proteins (bcl2 and bad) according to semiquantitative reverse-transcription polymerase chain reaction and immunohistochemical analysis, respectively, as well as improving cell cycle-related genes (p27 and cdk2) and cardiomyogenetic genes (amhc, vmhc, and cmlc2). Conclusions Based on our results, tbx5 knockdown causes a pseudo GH deficiency in zebrafish during early embryonic stages, and supplementation of exogenous GH can partially restore dysmorphogenesis, apoptosis, cell growth inhibition, and abnormal cardiomyogenesis in tbx5 knockdown zebrafish in a paracrine manner. PMID:22776023

Short Exogenous Peptides Regulate Expression of CLE, KNOX1, and GRF Family Genes in Nicotiana tabacum.

PubMed

Fedoreyeva, L I; Dilovarova, T A; Ashapkin, V V; Martirosyan, Yu Ts; Khavinson, V Kh; Kharchenko, P N; Vanyushin, B F

2017-04-01

Exogenous short biologically active peptides epitalon (Ala-Glu-Asp-Gly), bronchogen (Ala-Glu-Asp-Leu), and vilon (Lys-Glu) at concentrations 10 -7 -10 -9  M significantly influence growth, development, and differentiation of tobacco (Nicotiana tabacum) callus cultures. Epitalon and bronchogen, in particular, both increase growth of calluses and stimulate formation and growth of leaves in plant regenerants. Because the regulatory activity of the short peptides appears at low peptide concentrations, their action to some extent is like that of the activity of phytohormones, and it seems to have signaling character and epigenetic nature. The investigated peptides modulate in tobacco cells the expression of genes including genes responsible for tissue formation and cell differentiation. These peptides differently modulate expression of CLE family genes coding for known endogenous regulatory peptides, the KNOX1 genes (transcription factor genes) and GRF (growth regulatory factor) genes coding for respective DNA-binding proteins such as topoisomerases, nucleases, and others. Thus, at the level of transcription, plants have a system of short peptide regulation of formation of long-known peptide regulators of growth and development. The peptides studied here may be related to a new generation of plant growth regulators. They can be used in the experimental botany, plant molecular biology, biotechnology, and practical agronomy.

Differentiation of Odontoblast-Like Cells From Mouse Induced Pluripotent Stem Cells by Pax9 and Bmp4 Transfection.

PubMed

Seki, Daisuke; Takeshita, Nobuo; Oyanagi, Toshihito; Sasaki, Shutaro; Takano, Ikuko; Hasegawa, Masakazu; Takano-Yamamoto, Teruko

2015-09-01

The field of tooth regeneration has progressed in recent years, and human tooth regeneration could become viable in the future. Because induced pluripotent stem (iPS) cells can differentiate into odontogenic cells given appropriate conditions, iPS cells are a potential cell source for tooth regeneration. However, a definitive method to induce iPS cell-derived odontogenic cells has not been established. We describe a novel method of odontoblast differentiation from iPS cells using gene transfection. We generated mouse iPS cell-derived neural crest-like cells (iNCLCs), which exhibited neural crest markers. Next, we differentiated iNCLCs into odontoblast-like cells by transfection of Pax9 and Bmp4 expression plasmids. Exogenous Pax9 upregulated expression of Msx1 and dentin matrix protein 1 (Dmp1) in iNCLCs but not bone morphogenetic protein 4 (Bmp4) or dentin sialophosphoprotein (Dspp). Exogenous Bmp4 upregulated expression of Msx1, Dmp1, and Dspp in iNCLCs, but not Pax9. Moreover, cotransfection of Pax9 and Bmp4 plasmids in iNCLCs revealed a higher expression of Pax9 than when Pax9 plasmid was used alone. In contrast, exogenous Pax9 downregulated Bmp4 overexpression. Cotransfection of Pax9 and Bmp4 synergistically upregulated Dmp1 expression; however, Pax9 overexpression downregulated exogenous Bmp4-induced Dspp expression. Together, these findings suggest that an interaction between exogenous Pax9- and Bmp4-induced signaling modulated Dmp1 and Dspp expression. In conclusion, transfection of Pax9 and Bmp4 expression plasmids in iNCLCs induced gene expression associated with odontoblast differentiation, suggesting that iNCLCs differentiated into odontoblast-like cells. The iPS cell-derived odontoblast-like cells could be a useful cell source for tooth regeneration. It has been reported that induced pluripotent stem (iPS) cells differentiate into odontogenic cells by administration of recombinant growth factors and coculture with odontogenic cells. Therefore, they can be potential cell sources for tooth regeneration. However, these previous methods still have problems, such as usage of other cell types, heterogeneity of differentiated cells, and tumorigenicity. In the present study, a novel method to differentiate iPS cells into odontoblast-like cells without tumorigenicity using gene transfection was established. It is an important advance in the establishment of efficient methods to generate homogeneous functional odontogenic cells derived from iPS cells. ©AlphaMed Press.

Identification and expression analysis of CYS-A1, CYS-C1, NIT4 genes in rice seedlings exposed to cyanide.

PubMed

Yu, Xiao-Zhang; Lin, Yu-Juan; Lu, Chun-Jiao; Zhang, Xue-Hong

2017-09-01

Involvement of genes (CYS-A1, CYS-C1 and NIT4) encoded with cysteine synthase, β-cyanoalanine synthase, nitrilase and cyanide metabolisms are evident in Arabidopsis. In the present study, identifications of CYS-A1, CYS-C1 and NIT4, predictions of conserved motifs, and constructions of phylogenetic relationships, based on their amino acid sequences in rice, were conducted. In order to elucidate the transcriptional responses of these cyanide-degrading genes, two candidate homologues were selected for each gene to test their expression changes upon exposure to exogenous KCN in rice seedlings using RT-PCR. Results showed that all selected candidate homologous genes were differentially expressed at different exposure points in roots and shoots of rice seedlings, suggesting their distinct roles during cyanide assimilation. Both candidate homologues for CYS-A1 constantly exhibited more abundant transcripts in comparison to control. However, only one candidate homologue for CYS-C1 and NIT4 showed a remarkable up-regulation during KCN exposure. Analysis of both tissue and solution cyanide indicated that rice seedlings were quickly able to metabolize exogenous KCN with minor accumulation in plant tissues. In conclusion, significant up-regulation of CYS-A1 suggested that the endogenous pool of cysteine catalyzed by cysteine synthase does not restrict the conversion of exogenous KCN into cyanoalanine through the β-cyanoalanine pathway. However, insufficient responses of the transcription level of NIT4 suggested that NIT enzyme may be a limiting factor for cyanoalanine assimilation by rice seedlings.

Effect of cyclophilin A on gene expression in human pancreatic cancer cells.

PubMed

Li, Min; Wang, Hao; Li, Fei; Fisher, William E; Chen, Changyi; Yao, Qizhi

2005-11-01

We previously found that cyclophilin A (CypA) is overexpressed in human pancreatic cancer cells and stimulates cell proliferation through CD147. In this study, we further investigated the effect of CypA on gene expression of several key molecules that are involved in pancreatic cancer cell proliferation. Human pancreatic cancer cell lines (Panc-1, MIA PaCa-2, and BxPC-3) and human pancreatic ductal epithelial (HPDE) cells were used. The messenger RNA (mRNA) levels of CypA, CypB, CD147, neuropilins (NRPs), vascular endothelial growth factor (VEGF), and VEGF receptors upon the treatment of exogenous recombinant human CypA were determined by real-time reverse-transcription polymerase chain reaction. Exogenous human recombinant CypA reduced the mRNA levels of NRP-1 and VEGF, but not endogenous CypA, CypB, and CD147, in Panc-1, MIA PaCa-2, and BxPC-3 cells. In contrast, HPDE cells showed a decrease of endogenous CypA and CD147 mRNA, but not detectable changes of CypB, NRPs, and VEGF mRNA levels upon exogenous CypA treatment. These data show that exogenous CypA downregulates NRP-1 and VEGF expression in pancreatic cancer cells. This effect is different in normal HPDE cells. Thus, soluble CypA may affect cell growth of pancreatic cancer.

The use of genes for performance enhancement: doping or therapy?

PubMed

Oliveira, R S; Collares, T F; Smith, K R; Collares, T V; Seixas, F K

2011-12-01

Recent biotechnological advances have permitted the manipulation of genetic sequences to treat several diseases in a process called gene therapy. However, the advance of gene therapy has opened the door to the possibility of using genetic manipulation (GM) to enhance athletic performance. In such 'gene doping', exogenous genetic sequences are inserted into a specific tissue, altering cellular gene activity or leading to the expression of a protein product. The exogenous genes most likely to be utilized for gene doping include erythropoietin (EPO), vascular endothelial growth factor (VEGF), insulin-like growth factor type 1 (IGF-1), myostatin antagonists, and endorphin. However, many other genes could also be used, such as those involved in glucose metabolic pathways. Because gene doping would be very difficult to detect, it is inherently very attractive for those involved in sports who are prepared to cheat. Moreover, the field of gene therapy is constantly and rapidly progressing, and this is likely to generate many new possibilities for gene doping. Thus, as part of the general fight against all forms of doping, it will be necessary to develop and continually improve means of detecting exogenous gene sequences (or their products) in athletes. Nevertheless, some bioethicists have argued for a liberal approach to gene doping.

Exogenous Methyl Jasmonate and Salicylic Acid Induce Subspecies-Specific Patterns of Glucosinolate Accumulation and Gene Expression in Brassica oleracea L.

PubMed

Yi, Go-Eun; Robin, Arif Hasan Khan; Yang, Kiwoung; Park, Jong-In; Hwang, Byung Ho; Nou, Ill-Sup

2016-10-24

Glucosinolates have anti-carcinogenic properties. In the recent decades, the genetics of glucosinolate biosynthesis has been widely studied, however, the expression of specific genes involved in glucosinolate biosynthesis under exogenous phytohormone treatment has not been explored at the subspecies level in Brassica oleracea . Such data are vital for strategies aimed at selective exploitation of glucosinolate profiles. This study quantified the expression of 38 glucosinolate biosynthesis-related genes in three B. oleracea subspecies, namely cabbage, broccoli and kale, and catalogued associations between gene expression and increased contents of individual glucosinolates under methyl jasmonate (MeJA) and salicylic acid (SA) treatments. Glucosinolate accumulation and gene expression in response to phytohormone elicitation was subspecies specific. For instance, cabbage leaves showed enhanced accumulation of the aliphatic glucoiberin, progoitrin, sinigrin and indolic neoglucobrassicin under both MeJA and SA treatment. MeJA treatment induced strikingly higher accumulation of glucobrassicin (GBS) in cabbage and kale and of neoglucobrassicin (NGBS) in broccoli compared to controls. Notably higher expression of ST5a (Bol026200), CYP81F1 (Bol028913, Bol028914) and CYP81F4 genes was associated with significantly higher GBS accumulation under MeJA treatment compared to controls in all three subspecies. CYP81F4 genes, trans-activated by MYB34 genes, were expressed at remarkably high levels in all three subspecies under MeJA treatment, which also induced in higher indolic NGBS accumulation in all three subspecies. Remarkably higher expression of MYB28 (Bol036286), ST5b , ST5c , AOP2 , FMOGS-OX5 (Bol031350) and GSL-OH (Bol033373) was associated with much higher contents of aliphatic glucosinolates in kale leaves compared to the other two subspecies. The genes expressed highly could be utilized in strategies to selectively increase glucosinolate compounds in B. oleracea subspecies. These results promote efforts to develop genotypes of B. oleracea and other species with enhanced levels of desired glucosinolates.

Genome-Wide Identification and Expression Profiling Analysis of ZmPIN, ZmPILS, ZmLAX and ZmABCB Auxin Transporter Gene Families in Maize (Zea mays L.) under Various Abiotic Stresses

PubMed Central

Sun, Tao; Zhang, Lei; Yang, Yanjun; Qi, Jianshuang; Yan, Shufeng; Han, Xiaohua; Wang, Huizhong; Shen, Chenjia

2015-01-01

The auxin influx carriers auxin resistant 1/like aux 1 (AUX/LAX), efflux carriers pin-formed (PIN) (together with PIN-like proteins) and efflux/conditional P-glycoprotein (ABCB) are major protein families involved in auxin polar transport. However, how they function in responses to exogenous auxin and abiotic stresses in maize is largely unknown. In this work, the latest updated maize (Zea mays L.) reference genome sequence was used to characterize and analyze the ZmLAX, ZmPIN, ZmPILS and ZmABCB family genes from maize. The results showed that five ZmLAXs, fifteen ZmPINs, nine ZmPILSs and thirty-five ZmABCBs were mapped on all ten maize chromosomes. Highly diversified gene structures, nonconservative transmembrane helices and tissue-specific expression patterns suggested the possibility of function diversification for these genes. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to analyze the expression patterns of ZmLAX, ZmPIN, ZmPILS and ZmABCB genes under exogenous auxin and different environmental stresses. The expression levels of most ZmPIN, ZmPILS, ZmLAX and ZmABCB genes were induced in shoots and were reduced in roots by various abiotic stresses (drought, salt and cold stresses). The opposite expression response patterns indicated the dynamic auxin transport between shoots and roots under abiotic stresses. Analysis of the expression patterns of ZmPIN, ZmPILS, ZmLAX and ZmABCB genes under drought, salt and cold treatment may help us to understand the possible roles of maize auxin transporter genes in responses and tolerance to environmental stresses. PMID:25742625

Phytohormonal Networks Promote Differentiation of Fiber Initials on Pre-Anthesis Cotton Ovules Grown In Vitro and In Planta

PubMed Central

Kim, Hee Jin; Hinchliffe, Doug J.; Triplett, Barbara A.; Chen, Z. Jeffrey; Stelly, David M.; Yeater, Kathleen M.; Moon, Hong S.; Gilbert, Matthew K.; Thyssen, Gregory N.; Turley, Rickie B.; Fang, David D.

2015-01-01

The number of cotton (Gossypium sp.) ovule epidermal cells differentiating into fiber initials is an important factor affecting cotton yield and fiber quality. Despite extensive efforts in determining the molecular mechanisms regulating fiber initial differentiation, only a few genes responsible for fiber initial differentiation have been discovered. To identify putative genes directly involved in the fiber initiation process, we used a cotton ovule culture technique that controls the timing of fiber initial differentiation by exogenous phytohormone application in combination with comparative expression analyses between wild type and three fiberless mutants. The addition of exogenous auxin and gibberellins to pre-anthesis wild type ovules that did not have visible fiber initials increased the expression of genes affecting auxin, ethylene, ABA and jasmonic acid signaling pathways within 1 h after treatment. Most transcripts expressed differentially by the phytohormone treatment in vitro were also differentially expressed in the ovules of wild type and fiberless mutants that were grown in planta. In addition to MYB25-like, a gene that was previously shown to be associated with the differentiation of fiber initials, several other differentially expressed genes, including auxin/indole-3-acetic acid (AUX/IAA) involved in auxin signaling, ACC oxidase involved in ethylene biosynthesis, and abscisic acid (ABA) 8'-hydroxylase an enzyme that controls the rate of ABA catabolism, were co-regulated in the pre-anthesis ovules of both wild type and fiberless mutants. These results support the hypothesis that phytohormonal signaling networks regulate the temporal expression of genes responsible for differentiation of cotton fiber initials in vitro and in planta. PMID:25927364

Phylogeny and expression pattern of starch branching enzyme family genes in cassava (Manihot esculenta Crantz) under diverse environments.

PubMed

Pei, Jinli; Wang, Huijun; Xia, Zhiqiang; Liu, Chen; Chen, Xin; Ma, Pingan; Lu, Cheng; Wang, Wenquan

2015-08-01

Starch branching enzyme (SBE) is one of the key enzymes involved in starch biosynthetic metabolism. In this study, six SBE family genes were identified from the cassava genome. Phylogenetic analysis divided the MeSBE family genes into dicot family A, B, C, and the new group. Tissue-specific analysis showed that MeSBE2.2 was strongly expressed in leaves, stems cortex, and root stele, and MeSBE3 had high expression levels in stem cortex and root stele of plants in the rapid growth stage under field condition, whereas the expression levels of MeSBE2.1, MeSBE4, and MeSBE5 were low except for in stems cortex. The transcriptional activity of MeSBE2.2 and MeSBE3 was higher compared with other members and gradually increased in the storage roots during root growth process, while the other MeSBE members normally remained low expression levels. Expression of MeSBE2.2 could be induced by salt, drought, exogenous abscisic acid, jasmonic acid, and salicylic acid signals, while MeSBE3 had positive response to drought, salt, exogenous abscisic acid, and salicylic acid in leaves but not in storage root, indicating that they might be more important in starch biosynthesis pathway under diverse environments.

Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray

PubMed Central

Carter, Mark G; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH

2005-01-01

The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance. PMID:15998450

Different effects of enhanced and reduced expression of pub gene on the formation of embryoid bodies by cultured embryonic mouse stem cell.

PubMed

Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A

2005-07-01

The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.

Spermine alleviates drought stress in white clover with different resistance by influencing carbohydrate metabolism and dehydrins synthesis.

PubMed

Li, Zhou; Jing, Wen; Peng, Yan; Zhang, Xin Quan; Ma, Xiao; Huang, Lin Kai; Yan, Yan-Hong

2015-01-01

The objective of this research was to analyse whether ameliorating drought stress through exogenously applied spermine (Spm) was related to carbohydrate metabolism, dehydrins accumulation and the transcription of genes encoding dehydrins in two white clovers (drought-susceptible cv. 'Ladino' and drought-resistant cv. 'Haifa') under controlled drying conditions for 10 days. The results show that the application of Spm effectively alleviates negative effects caused by drought stress in both cultivars. Exogenous Spm led to accumulation of more water-soluble carbohydrates (WSC), sucrose, fructose and sorbitol in both cultivars under drought stress, and also significantly elevated glucose content in leaves of drought-resistant cv. 'Haifa', but had no effect on drought-susceptible cv. 'Ladino'. Accordingly, the key enzyme activities of sucrose and sorbitol metabolism changed along with the application of Spm under drought stress. Spm induced a significant increase in sucrose phosphate synthase (SPS) or sorbitol dehydrogenase (SDH) activity, but decrease in sucrose synthetase (SS) activity when two cultivars were subjected to drought. In addition, the improved accumulation of dehydrins induced by exogenous Spm coincided with three genes expression which was responsible for dehydrins synthesis. But Spm-induced transcript level of dehydrin genes increased earlier in cv. 'Ladino' than that in cv. 'Haifa'. Thus, these results suggest that ameliorating drought stress through exogenously applied Spm may be associated with increased carbohydrate accumulation and dehydrins synthesis. There are differences between drought-susceptible and -resistant white clover cultivars related to Spm regulation of WSC metabolism and dehydrins expression.

Polyamine regulates tolerance to water stress in leaves of white clover associated with antioxidant defense and dehydrin genes via involvement in calcium messenger system and hydrogen peroxide signaling

PubMed Central

Li, Zhou; Zhang, Yan; Peng, Dandan; Wang, Xiaojuan; Peng, Yan; He, Xiaoshuang; Zhang, Xinquan; Ma, Xiao; Huang, Linkai; Yan, Yanhong

2015-01-01

Endogenous polyamine (PA) may play a critical role in tolerance to water stress in plants acting as a signaling molecule activator. Water stress caused increases in endogenous PA content in leaves, including putrescine (Put), spermidine (Spd), and spermine (Spm). Exogenous application of Spd could induce the instantaneous H2O2 burst and accumulation of cytosolic free Ca2+, and activate NADPH oxidase and CDPK gene expression in cells. To a great extent, PA biosynthetic inhibitor reduced the water stress-induced H2O2 accumulation, free cytosolic Ca2+ release, antioxidant enzyme activities and genes expression leading to aggravate water stress-induced oxidative damage, while these suppressing effects were alleviated by the addition of exogenous Spd, indicating PA was involved in water stress-induced H2O2 and cytosolic free Ca2+ production as well as stress tolerance. Dehydrin genes (Y2SK, Y2K, and SK2) were showed to be highly responsive to exogenous Spd. PA-induced antioxidant defense and dehydrin genes expression could be blocked by the scavenger of H2O2 and the inhibitors of H2O2 generation or Ca2+ channels blockers, a calmodulin antagonist, as well as the inhibitor of CDPK. These findings suggested that PA regulated tolerance to water stress in white clover associated with antioxidant defenses and dehydrins via involvement in the calcium messenger system and H2O2 signaling pathways. PA-induced H2O2 production required Ca2+ release, while PA-induced Ca2+ release was also essential for H2O2 production, suggesting an interaction between PA-induced H2O2 and Ca2+ signaling. PMID:26528187

Sequence genomic organization and expression of two channel catfish Ictalurus punctatus Ghrelin receptors

USDA-ARS?s Scientific Manuscript database

Two ghrelin receptor (GHS-R) genes were isolated from channel catfish tissue and a bacterial artificial chromosome (BAC) library. The two receptors were characterized by determining tissue distribution, ontogeny of receptor mRNA expression, and effects of exogenous homologous ghrelin administration ...

Gene therapy for human ovarian cancer cells using efficient expression of Fas gene combined with γδT cells.

PubMed

Lin, Jiajing; Zeng, Dingyuan; He, Hongying; Tan, Guangping; Lan, Ying; Jiang, Fuyan; Sheng, Shuting

2017-10-01

Low tissue specificity and efficiency of exogenous gene expression are the two major obstacles in tumor‑targeted gene therapy. The Fas cell surface death receptor (Fas)/Fas ligand pathway is one of the primary pathways responsible for the regulation of cell apoptosis. The aim of the present study was to explore whether the regulation of tumor specific promoters and a two‑step transcriptional amplification system (TSTA) assured efficient, targeted expression of their downstream Fas gene in human ovarian cancer cells, and to assess the killing effect of γδT cells on these cells with high Fas expression. Three shuttle plasmids containing different control elements of the human telomerase reverse transcriptase (hTERT) promoter and/or TSTA were constructed and packaged into adenovirus 5 (Ad5) vectors for the expression of exogenous Fas gene. The human ovarian cancer cell line SKOV3 and a control human embryonic lung fibroblast cell line were transfected with Ad5‑hTERT‑Fas or Ad5‑hTERT‑TSTA‑Fas. Fas mRNA and protein expression were examined by reverse transcription‑quantitative polymerase chain reaction and western blot analysis. γδT lymphocytes were isolated, cultured and mixed at different ratios with SKOV3 cells with Fas expression in order to assess the killing effect of γδT cells. hTERT promoter induced the specific expression of FAS gene in SKOV3 cells, and the TSTA strategy increased FAS expression by 14.2‑fold. The killing effect of γδT cells increased with the expression level of Fas and the effector‑target cell ratio. The killing rate for SKOV3 cells with high FAS expression was 72.5% at an effector‑target cell ratio of 40:1. The regulators of hTERT promoter and TSTA assure the efficient and targeted expression of their downstream Fas gene in SKOV3 cells. The killing effect of γδT cells for ovarian cancer cells with relatively high Fas expression was improved.

Validation of Reference Genes for Robust qRT-PCR Gene Expression Analysis in the Rice Blast Fungus Magnaporthe oryzae.

PubMed

Che Omar, Sarena; Bentley, Michael A; Morieri, Giulia; Preston, Gail M; Gurr, Sarah J

2016-01-01

The rice blast fungus causes significant annual harvest losses. It also serves as a genetically-tractable model to study fungal ingress. Whilst pathogenicity determinants have been unmasked and changes in global gene expression described, we know little about Magnaporthe oryzae cell wall remodelling. Our interests, in wall remodelling genes expressed during infection, vegetative growth and under exogenous wall stress, demand robust choice of reference genes for quantitative Real Time-PCR (qRT-PCR) data normalisation. We describe the expression stability of nine candidate reference genes profiled by qRT-PCR with cDNAs derived during asexual germling development, from sexual stage perithecia and from vegetative mycelium grown under various exogenous stressors. Our Minimum Information for Publication of qRT-PCR Experiments (MIQE) compliant analysis reveals a set of robust reference genes used to track changes in the expression of the cell wall remodelling gene MGG_Crh2 (MGG_00592). We ranked nine candidate reference genes by their expression stability (M) and report the best gene combination needed for reliable gene expression normalisation, when assayed in three tissue groups (Infective, Vegetative, and Global) frequently used in M. oryzae expression studies. We found that MGG_Actin (MGG_03982) and the 40S 27a ribosomal subunit MGG_40s (MGG_02872) proved to be robust reference genes for the Infection group and MGG_40s and MGG_Ef1 (Elongation Factor1-α) for both Vegetative and Global groups. Using the above validated reference genes, M. oryzae MGG_Crh2 expression was found to be significantly (p<0.05) elevated three-fold during vegetative growth as compared with dormant spores and two fold higher under cell wall stress (Congo Red) compared to growth under optimal conditions. We recommend the combinatorial use of two reference genes, belonging to the cytoskeleton and ribosomal synthesis functional groups, MGG_Actin, MGG_40s, MGG_S8 (Ribosomal subunit 40S S8) or MGG_Ef1, which demonstrated low M values across heterogeneous tissues. By contrast, metabolic pathway genes MGG_Fad (FAD binding domain-containing protein) and MGG_Gapdh (Glyceraldehyde-3-phosphate dehydrogenase) performed poorly, due to their lack of expression stability across samples.

A study on the dynamics of the zraP gene expression profile and its application to the construction of zinc adsorption bacteria.

PubMed

Ravikumar, Sambandam; Yoo, Ik-keun; Lee, Sang Yup; Hong, Soon Ho

2011-11-01

Zinc ion plays essential roles in biological chemistry. Bacteria acquire Zn(2+) from the environment, and cellular concentration levels are controlled by zinc homeostasis systems. In comparison with other homeostatic systems, the ZraSR two-component system was found to be more efficient in responding to exogenous zinc concentrations. To understand the dynamic response of the bacterium ZraSR two-component system with respect to exogenous zinc concentrations, the genetic circuit of the ZraSR system was integrated with a reporter protein. This study was helpful in the construction of an E. coli system that can display selective metal binding peptides on the surface of the cell in response to exogenous zinc. The engineered bacterial system for monitoring exogenous zinc was successfully employed to detect levels of zinc as low as 0.001 mM, which directly activates the expression of chimeric ompC(t)--zinc binding peptide gene to remove zinc by adsorbing a maximum of 163.6 μmol of zinc per gram of dry cell weight. These results indicate that the engineered bacterial strain developed in the present study can sense the specific heavy metal and activates a cell surface display system that acts to remove the metal.

Metagenomic and Metatranscriptomic Analyses Reveal the Structure and Dynamics of a Dechlorinating Community Containing Dehalococcoides mccartyi and Corrinoid-Providing Microorganisms under Cobalamin-Limited Conditions

DOE PAGES

Men, Yujie; Yu, Ke; Bælum, Jacob; ...

2017-02-10

The aim of this paper is to obtain a systems-level understanding of the interactions between Dehalococcoides and corrinoid-supplying microorganisms by analyzing community structures and functional compositions, activities, and dynamics in trichloroethene (TCE)-dechlorinating enrichments. Metagenomes and metatranscriptomes of the dechlorinating enrichments with and without exogenous cobalamin were compared. Seven putative draft genomes were binned from the metagenomes. At an early stage (2 days), more transcripts of genes in the Veillonellaceae bin-genome were detected in the metatranscriptome of the enrichment without exogenous cobalamin than in the one with the addition of cobalamin. Among these genes, sporulation-related genes exhibited the highest differential expressionmore » when cobalamin was not added, suggesting a possible release route of corrinoids from corrinoid producers. Other differentially expressed genes include those involved in energy conservation and nutrient transport (including cobalt transport). The most highly expressed corrinoid de novo biosynthesis pathway was also assigned to the Veillonellaceae bin-genome. Targeted quantitative PCR (qPCR) analyses confirmed higher transcript abundances of those corrinoid biosynthesis genes in the enrichment without exogenous cobalamin than in the enrichment with cobalamin. Furthermore, the corrinoid salvaging and modification pathway of Dehalococcoides was upregulated in response to the cobalamin stress. Finally, this study provides important insights into the microbial interactions and roles played by members of dechlorinating communities under cobalamin-limited conditions.« less

Metagenomic and Metatranscriptomic Analyses Reveal the Structure and Dynamics of a Dechlorinating Community Containing Dehalococcoides mccartyi and Corrinoid-Providing Microorganisms under Cobalamin-Limited Conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Men, Yujie; Yu, Ke; Bælum, Jacob

The aim of this paper is to obtain a systems-level understanding of the interactions between Dehalococcoides and corrinoid-supplying microorganisms by analyzing community structures and functional compositions, activities, and dynamics in trichloroethene (TCE)-dechlorinating enrichments. Metagenomes and metatranscriptomes of the dechlorinating enrichments with and without exogenous cobalamin were compared. Seven putative draft genomes were binned from the metagenomes. At an early stage (2 days), more transcripts of genes in the Veillonellaceae bin-genome were detected in the metatranscriptome of the enrichment without exogenous cobalamin than in the one with the addition of cobalamin. Among these genes, sporulation-related genes exhibited the highest differential expressionmore » when cobalamin was not added, suggesting a possible release route of corrinoids from corrinoid producers. Other differentially expressed genes include those involved in energy conservation and nutrient transport (including cobalt transport). The most highly expressed corrinoid de novo biosynthesis pathway was also assigned to the Veillonellaceae bin-genome. Targeted quantitative PCR (qPCR) analyses confirmed higher transcript abundances of those corrinoid biosynthesis genes in the enrichment without exogenous cobalamin than in the enrichment with cobalamin. Furthermore, the corrinoid salvaging and modification pathway of Dehalococcoides was upregulated in response to the cobalamin stress. Finally, this study provides important insights into the microbial interactions and roles played by members of dechlorinating communities under cobalamin-limited conditions.« less

Isolation of ripening-related genes from ethylene/1-MCP treated papaya through RNA-seq.

PubMed

Shen, Yan Hong; Lu, Bing Guo; Feng, Li; Yang, Fei Ying; Geng, Jiao Jiao; Ming, Ray; Chen, Xiao Jing

2017-08-31

Since papaya is a typical climacteric fruit, exogenous ethylene (ETH) applications can induce premature and quicker ripening, while 1-methylcyclopropene (1-MCP) slows down the ripening processes. Differential gene expression in ETH or 1-MCP-treated papaya fruits accounts for the ripening processes. To isolate the key ripening-related genes and better understand fruit ripening mechanisms, transcriptomes of ETH or 1-MCP-treated, and non-treated (Control Group, CG) papaya fruits were sequenced using Illumina Hiseq2500. A total of 18,648 (1-MCP), 19,093 (CG), and 15,321 (ETH) genes were detected, with the genes detected in the ETH-treatment being the least. This suggests that ETH may inhibit the expression of some genes. Based on the differential gene expression (DGE) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, 53 fruit ripening-related genes were selected: 20 cell wall-related genes, 18 chlorophyll and carotenoid metabolism-related genes, four proteinases and their inhibitors, six plant hormone signal transduction pathway genes, four transcription factors, and one senescence-associated gene. Reverse transcription quantitative PCR (RT-qPCR) analyses confirmed the results of RNA-seq and verified that the expression pattern of six genes is consistent with the fruit senescence process. Based on the expression profiling of genes in carbohydrate metabolic process, chlorophyll metabolism pathway, and carotenoid metabolism pathway, the mechanism of pulp softening and coloration of papaya was deduced and discussed. We illustrate that papaya fruit softening is a complex process with significant cell wall hydrolases, such as pectinases, cellulases, and hemicellulases involved in the process. Exogenous ethylene accelerates the coloration of papaya changing from green to yellow. This is likely due to the inhibition of chlorophyll biosynthesis and the α-branch of carotenoid metabolism. Chy-b may play an important role in the yellow color of papaya fruit. Comparing the differential gene expression in ETH/1-MCP-treated papaya using RNA-seq is a sound approach to isolate ripening-related genes. The results of this study can improve our understanding of papaya fruit ripening molecular mechanism and reveal candidate fruit ripening-related genes for further research.

Nitric Oxide Metabolism in Neisseria meningitidis

PubMed Central

Anjum, Muna F.; Stevanin, Tânia M.; Read, Robert C.; Moir, James W. B.

2002-01-01

Neisseria meningitidis, the causative agent of meningococcal disease in humans, is likely to be exposed to nitrosative stress during natural colonization and disease. The genome of N. meningitidis includes the genes aniA and norB, predicted to encode nitrite reductase and nitric oxide (NO) reductase, respectively. These gene products should allow the bacterium to denitrify nitrite to nitrous oxide. We show that N. meningitidis can support growth microaerobically by the denitrification of nitrite via NO and that norB is required for anaerobic growth with nitrite. NorB and, to a lesser extent, the cycP gene product cytochrome c′ are able to counteract toxicity due to exogenously added NO. Expression of these genes by N. meningitidis during colonization and disease may confer protection against exogenous or endogenous nitrosative stress. PMID:12003939

Arabidopsis DREB2C modulates ABA biosynthesis during germination.

PubMed

Je, Jihyun; Chen, Huan; Song, Chieun; Lim, Chae Oh

2014-09-12

Plant dehydration-responsive element binding factors (DREBs) are transcriptional regulators of the APETELA2/Ethylene Responsive element-binding Factor (AP2/ERF) family that control expression of abiotic stress-related genes. We show here that under conditions of mild heat stress, constitutive overexpression seeds of transgenic DREB2C overexpression Arabidopsis exhibit delayed germination and increased abscisic acid (ABA) content compared to untransformed wild-type (WT). Treatment with fluridone, an inhibitor of the ABA biosynthesis abrogated these effects. Expression of an ABA biosynthesis-related gene, 9-cis-epoxycarotenoid dioxygenase 9 (NCED9) was up-regulated in the DREB2C overexpression lines compared to WT. DREB2C was able to trans-activate expression of NCED9 in Arabidopsis leaf protoplasts in vitro. Direct and specific binding of DREB2C to a complete DRE on the NCED9 promoter was observed in electrophoretic mobility shift assays. Exogenous ABA treatment induced DREB2C expression in germinating seeds of WT. Vegetative growth of transgenic DREB2C overexpression lines was more strongly inhibited by exogenous ABA compared to WT. These results suggest that DREB2C is a stress- and ABA-inducible gene that acts as a positive regulator of ABA biosynthesis in germinating seeds through activating NCED9 expression. Copyright © 2014 Elsevier Inc. All rights reserved.

Phosphate Solubilization and Gene Expression of Phosphate-Solubilizing Bacterium Burkholderia multivorans WS-FJ9 under Different Levels of Soluble Phosphate.

PubMed

Zeng, Qingwei; Wu, Xiaoqin; Wang, Jiangchuan; Ding, Xiaolei

2017-04-28

Phosphate-solubilizing bacteria (PSB) have the ability to dissolve insoluble phosphate and enhance soil fertility. However, the growth and mineral phosphate solubilization of PSB could be affected by exogenous soluble phosphate and the mechanism has not been fully understood. In the present study, the growth and mineral phosphate-solubilizing characteristics of PSB strain Burkholderia multivorans WS-FJ9 were investigated at six levels of exogenous soluble phosphate (0, 0.5, 1, 5, 10, and 20 mM). The WS-FJ9 strain showed better growth at high levels of soluble phosphate. The phosphate-solubilizing activity of WS-FJ9 was reduced as the soluble phosphate concentration increased, as well as the production of pyruvic acid. Transcriptome profiling of WS-FJ9 at three levels of exogenous soluble phosphate (0, 5, and 20 mM) identified 446 differentially expressed genes, among which 44 genes were continuously up-regulated when soluble phosphate concentration was increased and 81 genes were continuously down-regulated. Some genes related to cell growth were continuously up-regulated, which would account for the better growth of WS-FJ9 at high levels of soluble phosphate. Genes involved in glucose metabolism, including glycerate kinase, 2-oxoglutarate dehydrogenase, and sugar ABC-type transporter, were continuously down-regulated, which indicates that metabolic channeling of glucose towards the phosphorylative pathway was negatively regulated by soluble phosphate. These findings represent an important first step in understanding the molecular mechanisms of soluble phosphate effects on the growth and mineral phosphate solubilization of PSB.

Expression of the Laccase Gene from a White Rot Fungus in Pichia pastoris Can Enhance the Resistance of This Yeast to H2O2-Mediated Oxidative Stress by Stimulating the Glutathione-Based Antioxidative System

PubMed Central

Fan, Fangfang; Zhuo, Rui; Ma, Fuying; Gong, Yangmin; Wan, Xia; Jiang, Mulan

2012-01-01

Laccase is a copper-containing polyphenol oxidase that has great potential in industrial and biotechnological applications. Previous research has suggested that fungal laccase may be involved in the defense against oxidative stress, but there is little direct evidence supporting this hypothesis, and the mechanism by which laccase protects cells from oxidative stress also remains unclear. Here, we report that the expression of the laccase gene from white rot fungus in Pichia pastoris can significantly enhance the resistance of yeast to H2O2-mediated oxidative stress. The expression of laccase in yeast was found to confer a strong ability to scavenge intracellular H2O2 and to protect cells from lipid oxidative damage. The mechanism by which laccase gene expression increases resistance to oxidative stress was then investigated further. We found that laccase gene expression in Pichia pastoris could increase the level of glutathione-based antioxidative activity, including the intracellular glutathione levels and the enzymatic activity of glutathione peroxidase, glutathione reductase, and γ-glutamylcysteine synthetase. The transcription of the laccase gene in Pichia pastoris was found to be enhanced by the oxidative stress caused by exogenous H2O2. The stimulation of laccase gene expression in response to exogenous H2O2 stress further contributed to the transcriptional induction of the genes involved in the glutathione-dependent antioxidative system, including PpYAP1, PpGPX1, PpPMP20, PpGLR1, and PpGSH1. Taken together, these results suggest that the expression of the laccase gene in Pichia pastoris can enhance the resistance of yeast to H2O2-mediated oxidative stress by stimulating the glutathione-based antioxidative system to protect the cell from oxidative damage. PMID:22706050

Proteomic Analysis Reveals the Positive Effect of Exogenous Spermidine in Tomato Seedlings' Response to High-Temperature Stress

PubMed Central

Sang, Qinqin; Shan, Xi; An, Yahong; Shu, Sheng; Sun, Jin; Guo, Shirong

2017-01-01

Polyamines are phytohormones that regulate plant growth and development as well as the response to environmental stresses. To evaluate their functions in high-temperature stress responses, the effects of exogenous spermidine (Spd) were determined in tomato leaves using two-dimensional electrophoresis and MALDI-TOF/TOF MS. A total of 67 differentially expressed proteins were identified in response to high-temperature stress and/or exogenous Spd, which were grouped into different categories according to biological processes. The four largest categories included proteins involved in photosynthesis (27%), cell rescue, and defense (24%), protein synthesis, folding and degradation (22%), and energy and metabolism (13%). Exogenous Spd up-regulated most identified proteins involved in photosynthesis, implying an enhancement in photosynthetic capacity. Meanwhile, physiological analysis showed that Spd could improve net photosynthetic rate and the biomass accumulation. Moreover, an increased high-temperature stress tolerance by exogenous Spd would contribute to the higher expressions of proteins involved in cell rescue and defense, and Spd regulated the antioxidant enzymes activities and related genes expression in tomato seedlings exposed to high temperature. Taken together, these findings provide a better understanding of the Spd-induced high-temperature resistance by proteomic approaches, providing valuable insight into improving the high-temperature stress tolerance in the global warming epoch. PMID:28220137

Proteomic Analysis Reveals the Positive Effect of Exogenous Spermidine in Tomato Seedlings' Response to High-Temperature Stress.

PubMed

Sang, Qinqin; Shan, Xi; An, Yahong; Shu, Sheng; Sun, Jin; Guo, Shirong

2017-01-01

Polyamines are phytohormones that regulate plant growth and development as well as the response to environmental stresses. To evaluate their functions in high-temperature stress responses, the effects of exogenous spermidine (Spd) were determined in tomato leaves using two-dimensional electrophoresis and MALDI-TOF/TOF MS. A total of 67 differentially expressed proteins were identified in response to high-temperature stress and/or exogenous Spd, which were grouped into different categories according to biological processes. The four largest categories included proteins involved in photosynthesis (27%), cell rescue, and defense (24%), protein synthesis, folding and degradation (22%), and energy and metabolism (13%). Exogenous Spd up-regulated most identified proteins involved in photosynthesis, implying an enhancement in photosynthetic capacity. Meanwhile, physiological analysis showed that Spd could improve net photosynthetic rate and the biomass accumulation. Moreover, an increased high-temperature stress tolerance by exogenous Spd would contribute to the higher expressions of proteins involved in cell rescue and defense, and Spd regulated the antioxidant enzymes activities and related genes expression in tomato seedlings exposed to high temperature. Taken together, these findings provide a better understanding of the Spd-induced high-temperature resistance by proteomic approaches, providing valuable insight into improving the high-temperature stress tolerance in the global warming epoch.

Exogenous DKK-3/REIC inhibits Wnt/β-catenin signaling and cell proliferation in human kidney cancer KPK1.

PubMed

Xu, Jiaqi; Sadahira, Takuya; Kinoshita, Rie; Li, Shun-Ai; Huang, Peng; Wada, Koichiro; Araki, Motoo; Ochiai, Kazuhiko; Noguchi, Hirofumi; Sakaguchi, Masakiyo; Nasu, Yasutomo; Watanabe, Masami

2017-11-01

The third member of the Dickkopf family (DKK-3), also known as reduced expression in immortalized cells (REIC), is a tumor suppressor present in a variety of tumor cells. Regarding the regulation of the Wnt/β-catenin signaling pathway, exogenous DKK-1 and DKK-2 are reported to inhibit Wnt signaling by binding the associated effectors. However, whether exogenous DKK-3 inhibits Wnt signaling remains unclear. A recombinant protein of human full-length DKK-3 was used to investigate the exogenous effects of the protein in vitro in KPK1 human renal cell carcinoma cells. It was demonstrated that the expression of phosphorylated (p-)β-catenin (inactive form as the transcriptional factor) was increased in KPK1 cells treated with the exogenous DKK-3 protein. The levels of non-p-β-catenin (activated form of β-catenin) were consistently decreased. It was revealed that the expression of transcription factor (TCF) 1 and c-Myc, the downstream transcription factors of the Wnt/β-catenin signaling pathway, was inhibited following treatment with DKK-3. A cancer cell viability assay confirmed the anti-proliferative effects of exogenous DKK-3 protein, which was consistent with a suppressed Wnt/β-catenin signaling cascade. In addition, as low-density lipoprotein receptor-related protein 6 (LRP6) is a receptor of DKK-1 and DKK-2 and their interaction on the cell surface inhibits Wnt/β-catenin signaling, it was examined whether the exogenous DKK-3 protein affects LRP6-mediated Wnt/β-catenin signaling. The LRP6 gene was silenced and the effects of DKK-3 on the time course of the upregulation of p-β-catenin expression were subsequently analyzed. Notably, LRP6 depletion elevated the base level of p-β-catenin; however, there was no significant effect on its upregulation course or expression pattern. These findings indicate that exogenous DKK-3 upregulates p-β-catenin and inhibits Wnt/β-catenin signaling in an LRP6-independent manner. Therefore, exogenous DKK-3 protein may inhibit the proliferation of KPK1 cells via inactivating Wnt/β-catenin signaling.

Characterization of a wheat (Triticum aestivum L.) expansin gene, TaEXPB23, involved in the abiotic stress response and phytohormone regulation.

PubMed

Han, Yang yang; Li, Ai xiu; Li, Feng; Zhao, Mei rong; Wang, Wei

2012-05-01

Expansins are proteins that are generally accepted to be key regulators of cell wall extension and plant growth. We examined the expression pattern of TaEXPB23, a wheat (Triticum aestivum L.) expansin gene, under exogenous phytohormone and abiotic stress treatments. In addition, we evaluated its function in the tolerance to salt stress and high temperature (HT) by overexpressing it in transgenic tobacco plants. In subcellular localization assays, TaEXPB23 localized to the cell wall. Expression analysis demonstrated that the transcription pattern of TaEXPB23 corresponded to wheat coleoptile growth. Real-time RT-PCR analysis revealed that TaEXPB23 transcript expression was upregulated by exogenous methyl jasmonate (MeJA) and salt stress, but downregulated by exogenous gibberellins (GA₃), ethylene (ET), indole-3-acetic acid (IAA) and α-naphthlcetic acid (NAA). Overexpression of TaEXPB23 in tobacco (tabacum) conferred tolerance to salt stress by enhancing water retention ability (WRA) and decreasing osmotic potential (OP). However, transgenic plants overexpressing TaEXPB23 did not show any improvement in the tolerance to HT stress. These results suggested that TaEXPB23 is regulated by phytohormones and is involved in the regulation of salt stress tolerance. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Cell of Origin: Exploring an Alternative Contributor to Ovarian Cancer

DTIC Science & Technology

2015-12-01

of 60 mice). We previously reported that we conducted simple preliminary studies to assess the potential impact of the retroviral infections on...using primers designed to specifically detect exogenous TP53 gene expression. 12. Simple preliminary studies assessing the potential impact of exogenous...Award was ending and we were delinquent with respect to submission of the Closure report and no longer had access to the funds. Since there was such a

Characterization and expression analysis of a banana gene encoding 1-aminocyclopropane-1-carboxylate oxidase.

PubMed

Huang, P L; Do, Y Y; Huang, F C; Thay, T S; Chang, T W

1997-04-01

A cDNA encoding the banana 1-aminocyclopropane-1-carboxylate (ACC) oxidase has previously been isolated from a cDNA library that was constructed by extracting poly(A)+ RNA from peels of ripening banana. This cDNA, designated as pMAO2, has 1,199 bp and contains an open reading frame of 318 amino acids. In order to identify ripening-related promoters of the banana ACC oxidase gene, pMAO2 was used as a probe to screen a banana genomic library constructed in the lambda EMBL3 vector. The banana ACC oxidase MAO2 gene has four exons and three introns, with all of the boundaries between these introns and exons sharing a consensus dinucleotide sequence of GT-AG. The expression of MAO2 gene in banana begins after the onset of ripening (stage 2) and continuous into later stages of the ripening process. The accumulation of MAO2 mRNA can be induced by 1 microliter/l exogenous ethylene, and it reached steady state level when 100 microliters/l exogenous ethylene was present.

Overexpression of OCT4A ortholog elevates endogenous XIST in porcine parthenogenic blastocysts.

PubMed

Hwang, Jae Yeon; Choi, Kwang-Hwan; Lee, Dong-Kyung; Kim, Seung-Hun; Kim, Eun Bae; Hyun, Sang-Hwan; Lee, Chang-Kyu

2015-01-01

X-chromosome inactivation (XCI) is an epigenetic process that equalizes expression of X-borne genes between male and female eutherians. This process is observed in early eutherian embryo development in a species-specific manner. Until recently, various pluripotent factors have been suggested to regulate the process of XCI by repressing XIST expression, which is the master inducer for XCI. Recent insights into the process and its regulation have been restricted in mouse species despite the evolutionary diversity of the process and molecular mechanism among the species. OCT4A is one of the represented pluripotent factors, the gate-keeper for maintaining pluripotency, and an XIST repressor. Therefore, in here, we examined the relation between OCT4A and X-linked genes in porcine preimplantation embryos. Three X-linked genes, XIST, LOC102165544, and RLIM, were selected in present study because their orthologues have been known to regulate XCI in mice. Expression levels of OCT4A were positively correlated with XIST and LOC102165544 in female blastocysts. Furthermore, overexpression of exogenous human OCT4A in cleaved parthenotes generated blastocysts with increased XIST expression levels. However, increased XIST expression was not observed when exogenous OCT4A was obtained from early blastocysts. These results suggest the possibility that OCT4A would be directly or indirectly involved in XIST expression in earlier stage porcine embryos rather than blastocysts.

Hydrodynamic gene delivery in human skin using a hollow microneedle device.

PubMed

Dul, M; Stefanidou, M; Porta, P; Serve, J; O'Mahony, C; Malissen, B; Henri, S; Levin, Y; Kochba, E; Wong, F S; Dayan, C; Coulman, S A; Birchall, J C

2017-11-10

Microneedle devices have been proposed as a minimally invasive delivery system for the intradermal administration of nucleic acids, both plasmid DNA (pDNA) and siRNA, to treat localised disease or provide vaccination. Different microneedle types and application methods have been investigated in the laboratory, but limited and irreproducible levels of gene expression have proven to be significant challenges to pre-clinical to clinical progression. This study is the first to explore the potential of a hollow microneedle device for the delivery and subsequent expression of pDNA in human skin. The regulatory approved MicronJet600® (MicronJet hereafter) device was used to deliver reporter plasmids (pCMVβ and pEGFP-N1) into viable excised human skin. Exogenous gene expression was subsequently detected at multiple locations that were distant from the injection site but within the confines of the bleb created by the intradermal bolus. The observed levels of gene expression in the tissue are at least comparable to that achieved by the most invasive microneedle application methods e.g. lateral application of a microneedle. Gene expression was predominantly located in the epidermis, although also evident in the papillary dermis. Optical coherence tomography permitted real time visualisation of the sub-surface skin architecture and, unlike a conventional intradermal injection, MicronJet administration of a 50μL bolus appears to create multiple superficial microdisruptions in the papillary dermis and epidermis. These were co-localised with expression of the pCMVβ reporter plasmid. We have therefore shown, for the first time, that a hollow microneedle device can facilitate efficient and reproducible gene expression of exogenous naked pDNA in human skin using volumes that are considered to be standard for intradermal administration, and postulate a hydrodynamic effect as the mechanism of gene delivery. Copyright © 2017 Elsevier B.V. All rights reserved.

Converting cancer genes into killer genes.

PubMed Central

Da Costa, L T; Jen, J; He, T C; Chan, T A; Kinzler, K W; Vogelstein, B

1996-01-01

Over the past decade, it has become clear that tumorigenesis is driven by alterations in genes that control cell growth or cell death. Theoretically, the proteins encoded by these genes provide excellent targets for new therapeutic agents. Here, we describe a gene therapy approach to specifically kill tumor cells expressing such oncoproteins. In outline, the target oncoprotein binds to exogenously introduced gene products, resulting in transcriptional activation of a toxic gene. As an example, we show that this approach can be used to specifically kill cells overexpressing a mutant p53 gene in cell culture. The strategy may be generally applicable to neoplastic diseases in which the underlying patterns of genetic alterations or abnormal gene expression are known. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:8633039

Spermine Alleviates Drought Stress in White Clover with Different Resistance by Influencing Carbohydrate Metabolism and Dehydrins Synthesis

PubMed Central

Li, Zhou; Jing, Wen; Peng, Yan; Zhang, Xin Quan; Ma, Xiao; Huang, Lin Kai; Yan, Yan-hong

2015-01-01

The objective of this research was to analyse whether ameliorating drought stress through exogenously applied spermine (Spm) was related to carbohydrate metabolism, dehydrins accumulation and the transcription of genes encoding dehydrins in two white clovers (drought-susceptible cv. ‘Ladino’ and drought-resistant cv. ‘Haifa’) under controlled drying conditions for 10 days. The results show that the application of Spm effectively alleviates negative effects caused by drought stress in both cultivars. Exogenous Spm led to accumulation of more water-soluble carbohydrates (WSC), sucrose, fructose and sorbitol in both cultivars under drought stress, and also significantly elevated glucose content in leaves of drought-resistant cv. ‘Haifa’, but had no effect on drought-susceptible cv. ‘Ladino’. Accordingly, the key enzyme activities of sucrose and sorbitol metabolism changed along with the application of Spm under drought stress. Spm induced a significant increase in sucrose phosphate synthase (SPS) or sorbitol dehydrogenase (SDH) activity, but decrease in sucrose synthetase (SS) activity when two cultivars were subjected to drought. In addition, the improved accumulation of dehydrins induced by exogenous Spm coincided with three genes expression which was responsible for dehydrins synthesis. But Spm-induced transcript level of dehydrin genes increased earlier in cv. ‘Ladino’ than that in cv. ‘Haifa’. Thus, these results suggest that ameliorating drought stress through exogenously applied Spm may be associated with increased carbohydrate accumulation and dehydrins synthesis. There are differences between drought-susceptible and -resistant white clover cultivars related to Spm regulation of WSC metabolism and dehydrins expression. PMID:25835290

Exogenous regucalcin suppresses the growth of human liver cancer HepG2 cells in vitro.

PubMed

Yamaguchi, Masayoshi; Murata, Tomiyasu

2018-04-05

Regucalcin, which its gene is localized on the X chromosome, plays a pivotal role as a suppressor protein in signal transduction in various types of cells and tissues. Regucalcin gene expression has been demonstrated to be suppressed in various tumor tissues of animal and human subjects, suggesting a potential role of regucalcin in carcinogenesis. Regucalcin, which is produced from the tissues including liver, is found to be present in the serum of human subjects and animals. This study was undertaken to determine the effects of exogenous regucalcin on the proliferation in cloned human hepatoma HepG2 cells in vitro. Proliferation of HepG2 cells was suppressed after culture with addition of regucalcin (0.01 – 10 nM) into culture medium. Exogenous regucalcin did not reveal apoptotic cell death in HepG2 cells in vitro. Suppressive effects of regucalcin on cell proliferation were not enhanced in the presence of various signaling inhibitors including tumor necrosis factor-α (TNF-α), Bay K 8644, PD98059, staurosporine, worthomannin, 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole (DRB) or gemcitabine, which were found to suppress the proliferation. In addition, exogenous regucalcin suppressed the formation of colonies of cultured hepatoma cells in vitro. These findings demonstrated that exogenous regucalcin exhibits a suppressive effect on the growth of human hepatoma HepG2 cells, proposing a strategy with the gene therapy for cancer treatment.

Salicylic acid promotes plant growth and salt-related gene expression in Dianthus superbus L. (Caryophyllaceae) grown under different salt stress conditions.

PubMed

Zheng, Jian; Ma, Xiaohua; Zhang, Xule; Hu, Qingdi; Qian, Renjuan

2018-03-01

Salt stress is a critical factor that affects the growth and development of plants. Salicylic acid (SA) is an important signal molecule that mitigates the negative effects of salt stress on plants. To elucidate salt tolerance in large pink Dianthus superbus L. (Caryophyllaceae) and the regulatory mechanism of exogenous SA on D. superbus under different salt stresses, we conducted a pot experiment to evaluate leaf biomass, leaf anatomy, soluble protein and sugar content, and the relative expression of salt-induced genes in D. superbus under 0.3, 0.6, and 0.9% NaCl conditions with and without 0.5 mM SA. The result showed that exposure of D. superbus to salt stress lead to a decrease in leaf growth, soluble protein and sugar content, and mesophyll thickness, together with an increase in the expression of MYB and P5CS genes. Foliar application of SA effectively increased leaf biomass, soluble protein and sugar content, and upregulated the expression of MYB and P5CS in the D. superbus , which facilitated in the acclimation of D. superbus to moderate salt stress. However, when the plants were grown under severe salt stress (0.9% NaCl), no significant difference in plant physiological responses and relevant gene expression between plants with and without SA was observed. The findings of this study suggest that exogenous SA can effectively counteract the adverse effects of moderate salt stress on D. superbus growth and development.

Homologues of the Arabidopsis thaliana SHI/STY/LRP1 genes control auxin biosynthesis and affect growth and development in the moss Physcomitrella patens.

PubMed

Eklund, D Magnus; Thelander, Mattias; Landberg, Katarina; Ståldal, Veronika; Nilsson, Anders; Johansson, Monika; Valsecchi, Isabel; Pederson, Eric R A; Kowalczyk, Mariusz; Ljung, Karin; Ronne, Hans; Sundberg, Eva

2010-04-01

The plant hormone auxin plays fundamental roles in vascular plants. Although exogenous auxin also stimulates developmental transitions and growth in non-vascular plants, the effects of manipulating endogenous auxin levels have thus far not been reported. Here, we have altered the levels and sites of auxin production and accumulation in the moss Physcomitrella patens by changing the expression level of homologues of the Arabidopsis SHI/STY family proteins, which are positive regulators of auxin biosynthesis genes. Constitutive expression of PpSHI1 resulted in elevated auxin levels, increased and ectopic expression of the auxin response reporter GmGH3pro:GUS, and in an increased caulonema/chloronema ratio, an effect also induced by exogenous auxin application. In addition, we observed premature ageing and necrosis in cells ectopically expressing PpSHI1. Knockout of either of the two PpSHI genes resulted in reduced auxin levels and auxin biosynthesis rates in leafy shoots, reduced internode elongation, delayed ageing, a decreased caulonema/chloronema ratio and an increased number of axillary hairs, which constitute potential auxin biosynthesis sites. Some of the identified auxin functions appear to be analogous in vascular and non-vascular plants. Furthermore, the spatiotemporal expression of the PpSHI genes and GmGH3pro:GUS strongly overlap, suggesting that local auxin biosynthesis is important for the regulation of auxin peak formation in non-vascular plants.

Infrared laser-mediated local gene induction in medaka, zebrafish and Arabidopsis thaliana.

PubMed

Deguchi, Tomonori; Itoh, Mariko; Urawa, Hiroko; Matsumoto, Tomohiro; Nakayama, Sohei; Kawasaki, Takashi; Kitano, Takeshi; Oda, Shoji; Mitani, Hiroshi; Takahashi, Taku; Todo, Takeshi; Sato, Junichi; Okada, Kiyotaka; Hatta, Kohei; Yuba, Shunsuke; Kamei, Yasuhiro

2009-12-01

Heat shock promoters are powerful tools for the precise control of exogenous gene induction in living organisms. In addition to the temporal control of gene expression, the analysis of gene function can also require spatial restriction. Recently, we reported a new method for in vivo, single-cell gene induction using an infrared laser-evoked gene operator (IR-LEGO) system in living nematodes (Caenorhabditis elegans). It was demonstrated that infrared (IR) irradiation could induce gene expression in single cells without incurring cellular damage. Here, we report the application of IR-LEGO to the small fish, medaka (Japanese killifish; Oryzias latipes) and zebrafish (Danio rerio), and a higher plant (Arabidopsis thaliana). Using easily observable reporter genes, we successfully induced gene expression in various tissues in these living organisms. IR-LEGO has the potential to be a useful tool in extensive research fields for cell/tissue marking or targeted gene expression in local tissues of small fish and plants.

Correction of hypophosphatasia (HPP) associated mineralization deficiencies in vitro by phosphate/pyrophosphate modulation in periodontal ligament cells

PubMed Central

Rodrigues, Thaisângela L.; Foster, Brian L.; Silverio, Karina G.; Martins, Luciane; Casati, Marcio Z.; Sallum, Enilson A.; Somerman, Martha J.; Nociti, Francisco H.

2013-01-01

Background Mutations in the Alpl gene in hypophosphatasia (HPP) reduce the function of tissue nonspecific alkaline phosphatase (TNAP), resulting in increased pyrophosphate (PPi) and a severe deficiency in acellular cementum. We hypothesized that exogenous phosphate (Pi) would rescue the in vitro mineralization capacity of periodontal ligament (PDL) cells harvested from HPP-diagnosed subjects, by correcting Pi/PPi ratio and modulating expression of genes involved with Pi/PPi metabolism. Methods Ex vivo and in vitro analyses were employed to identify mechanisms involved in HPP-associated PDL/tooth root deficiencies. Constitutive expression of PPi-associated genes was contrasted in PDL versus pulp tissues obtained from healthy subjects. Primary PDL cell cultures from HPP subjects (monozygotic twin males) were established to assay alkaline phosphatase activity (ALP), in vitro mineralization, and gene expression. Exogenous Pi was provided to correct Pi/PPi ratio. Results PDL tissues obtained from healthy individuals featured higher basal expression of key PPi regulators, genes Alpl, progressive ankylosis protein (Ankh) and ectonucleotide pyrophosphatase/phosphodiesterase 1 (Enpp1), versus paired pulp tissues. A novel Alpl mutation was identified in the twin HPP subjects enrolled in this study. Compared to controls, HPP-PDL cells exhibited significantly reduced ALP and mineralizing capacity, which were rescued by addition of 1mM Pi. Dysregulated expression of PPi regulatory genes Alpl, Ankh, and Enpp1 was also corrected by adding Pi, though other matrix markers evaluated in our study remained down-regulated. Conclusions These findings underscore the importance of controlling Pi/PPi ratio toward development of a functional periodontal apparatus, and support Pi/PPi imbalance as the etiology of HPP-associated cementum defects. PMID:22014174

Differential expression of jasmonate biosynthesis genes in cacao genotypes contrasting for resistance against Moniliophthora perniciosa.

PubMed

Litholdo, Celso G; Leal, Gildemberg A; Albuquerque, Paulo S B; Figueira, Antonio

2015-10-01

The resistance mechanism of cacao against M. perniciosa is likely to be mediated by JA/ET-signaling pathways due to the preferential TcAOS and TcSAM induction in a resistant genotype. The basidiomycete Moniliophthora perniciosa causes a serious disease in cacao (Theobroma cacao L.), and the use of resistant varieties is the only sustainable long-term solution. Cacao resistance against M. perniciosa is characterized by pathogen growth inhibition with reduced colonization and an attenuation of disease symptoms, suggesting a regulation by jasmonate (JA)/ethylene (ET) signaling pathways. The hypothesis that genes involved in JA biosynthesis would be active in the interaction of T. cacao and M. perniciosa was tested here. The cacao JA-related genes were evaluated for their relative quantitative expression in susceptible and resistant genotypes upon the exogenous application of ET, methyl-jasmonate (MJ), and salicylic acid (SA), or after M. perniciosa inoculation. MJ treatment triggered changes in the expression of genes involved in JA biosynthesis, indicating that the mechanism of positive regulation by exogenous MJ application occurs in cacao. However, a higher induction of these genes was observed in the susceptible genotype. Further, a contrast in JA-related transcriptional expression was detected between susceptible and resistant plants under M. perniciosa infection, with the induction of the allene oxide synthase gene (TcAOS), which encodes a key enzyme in the JA biosynthesis pathway in the resistant genotype. Altogether, this work provides additional evidences that the JA-dependent signaling pathway is modulating the defense response against M. perniciosa in a cacao-resistant genotype.

Comparative transcriptional analysis provides new insights into the molecular basis of adventitious rooting recalcitrance in Eucalyptus.

PubMed

de Almeida, Márcia Rodrigues; de Bastiani, Daniela; Gaeta, Marcos Letaif; de Araújo Mariath, Jorge Ernesto; de Costa, Fernanda; Retallick, Jeffrey; Nolan, Lana; Tai, Helen H; Strömvik, Martina V; Fett-Neto, Arthur Germano

2015-10-01

Adventitious rooting (AR) is essential in clonal propagation. Eucalyptus globulus is relevant for the cellulose industry due to its low lignin content. However, several useful clones are recalcitrant to AR, often requiring exogenous auxin, adding cost to clonal garden operations. In contrast, E. grandis is an easy-to-root species widely used in clonal forestry. Aiming at contributing to the elucidation of recalcitrance causes in E. globulus, we conducted a comparative analysis with these two species differing in rooting competence, combining gene expression and anatomical techniques. Recalcitrance in E. globulus is reversed by exposure to exogenous indole-3-acetic acid (IAA), which promotes important gene expression modifications in both species. The endogenous content of IAA was significantly higher in E. grandis than in E. globulus. The cambium zone was identified as an active area during AR, concentrating the first cell divisions. Immunolocalization assay showed auxin accumulation in cambium cells, further indicating the importance of this region for rooting. We then performed a cambium zone-specific gene expression analysis during AR using laser microdissection. The results indicated that the auxin-related genes TOPLESS and IAA12/BODENLOS and the cytokinin-related gene ARR1may act as negative regulators of AR, possibly contributing to the hard-to-root phenotype of E. globulus. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Dynamics of the concentration of IAA and some of its conjugates during the induction of somatic embryogenesis in Coffea canephora

PubMed Central

Ayil-Gutiérrez, Benajmín; Galaz-Ávalos, Rosa María; Peña-Cabrera, Eduardo; Loyola-Vargas, Victor Manuel

2013-01-01

Most of the somatic embryogenesis (SE) process requires the presence, either before or during the embryogenic process, of at least one exogenous auxin. This exogenous auxin induces the presence of endogenous auxins, which appears to be essential for SE induction. We found that during the preincubation period of SE in Coffea canephora, there is an important increase in both free and conjugated indole-3-acetic acid (IAA), as well as indole-3-butyric acid. This increase is accompanied by an increase in the expression of YUCCA (CcYUC), TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS 1 (CcTAA1), and GRETCHEN HAGEN 3 (GH3) genes. On the other hand, most of the IAA compounds decreased during the induction of SE. The results presented in this research suggest that a balance between free IAA and its amide conjugates is necessary to allow the expression of SE-related genes. PMID:24299659

A genomics approach to understanding the role of auxin in apple (Malus x domestica) fruit size control.

PubMed

Devoghalaere, Fanny; Doucen, Thomas; Guitton, Baptiste; Keeling, Jeannette; Payne, Wendy; Ling, Toby John; Ross, John James; Hallett, Ian Charles; Gunaseelan, Kularajathevan; Dayatilake, G A; Diak, Robert; Breen, Ken C; Tustin, D Stuart; Costes, Evelyne; Chagné, David; Schaffer, Robert James; David, Karine Myriam

2012-01-13

Auxin is an important phytohormone for fleshy fruit development, having been shown to be involved in the initial signal for fertilisation, fruit size through the control of cell division and cell expansion, and ripening related events. There is considerable knowledge of auxin-related genes, mostly from work in model species. With the apple genome now available, it is possible to carry out genomics studies on auxin-related genes to identify genes that may play roles in specific stages of apple fruit development. High amounts of auxin in the seed compared with the fruit cortex were observed in 'Royal Gala' apples, with amounts increasing through fruit development. Injection of exogenous auxin into developing apples at the start of cell expansion caused an increase in cell size. An expression analysis screen of auxin-related genes involved in auxin reception, homeostasis, and transcriptional regulation showed complex patterns of expression in each class of gene. Two mapping populations were phenotyped for fruit size over multiple seasons, and multiple quantitative trait loci (QTLs) were observed. One QTL mapped to a region containing an Auxin Response Factor (ARF106). This gene is expressed during cell division and cell expansion stages, consistent with a potential role in the control of fruit size. The application of exogenous auxin to apples increased cell expansion, suggesting that endogenous auxin concentrations are at least one of the limiting factors controlling fruit size. The expression analysis of ARF106 linked to a strong QTL for fruit weight suggests that the auxin signal regulating fruit size could partially be modulated through the function of this gene. One class of gene (GH3) removes free auxin by conjugation to amino acids. The lower expression of these GH3 genes during rapid fruit expansion is consistent with the apple maximising auxin concentrations at this point.

A genomics approach to understanding the role of auxin in apple (Malus x domestica) fruit size control

PubMed Central

2012-01-01

Background Auxin is an important phytohormone for fleshy fruit development, having been shown to be involved in the initial signal for fertilisation, fruit size through the control of cell division and cell expansion, and ripening related events. There is considerable knowledge of auxin-related genes, mostly from work in model species. With the apple genome now available, it is possible to carry out genomics studies on auxin-related genes to identify genes that may play roles in specific stages of apple fruit development. Results High amounts of auxin in the seed compared with the fruit cortex were observed in 'Royal Gala' apples, with amounts increasing through fruit development. Injection of exogenous auxin into developing apples at the start of cell expansion caused an increase in cell size. An expression analysis screen of auxin-related genes involved in auxin reception, homeostasis, and transcriptional regulation showed complex patterns of expression in each class of gene. Two mapping populations were phenotyped for fruit size over multiple seasons, and multiple quantitative trait loci (QTLs) were observed. One QTL mapped to a region containing an Auxin Response Factor (ARF106). This gene is expressed during cell division and cell expansion stages, consistent with a potential role in the control of fruit size. Conclusions The application of exogenous auxin to apples increased cell expansion, suggesting that endogenous auxin concentrations are at least one of the limiting factors controlling fruit size. The expression analysis of ARF106 linked to a strong QTL for fruit weight suggests that the auxin signal regulating fruit size could partially be modulated through the function of this gene. One class of gene (GH3) removes free auxin by conjugation to amino acids. The lower expression of these GH3 genes during rapid fruit expansion is consistent with the apple maximising auxin concentrations at this point. PMID:22243694

FISH-Based Analysis of Clonally Derived CHO Cell Populations Reveals High Probability for Transgene Integration in a Terminal Region of Chromosome 1 (1q13).

PubMed

Li, Shengwei; Gao, Xiaoping; Peng, Rui; Zhang, Sheng; Fu, Wei; Zou, Fangdong

A basic goal in the development of recombinant proteins is the generation of cell lines that express the desired protein stably over many generations. Here, we constructed engineered Chinese hamster ovary cell lines (CHO-S) with a pCHO-hVR1 vector that carried an extracellular domain of a VEGF receptor (VR) fusion gene. Forty-five clones with high hVR1 expression were selected for karyotype analysis. Using fluorescence in situ hybridization (FISH) and G-banding, we found that pCHO-hVR1 was integrated into three chromosomes, including chromosomes 1, Z3 and Z4. Four clones were selected to evaluate their productivity under non-fed, non-optimized shake flask conditions. The results showed that clones 1 and 2 with integration sites on chromosome 1 revealed high levels of hVR1 products (shake flask of approximately 800 mg/L), whereas clones 3 and 4 with integration sites on chromosomes Z3 or Z4 had lower levels of hVR1 products. Furthermore, clones 1 and 2 maintained their productivity stabilities over a continuous period of 80 generations, and clones 3 and 4 showed significant declines in their productivities in the presence of selection pressure. Finally, pCHO-hVR1 localized to the same region at chromosome 1q13, the telomere region of normal chromosome 1. In this study, these results demonstrate that the integration of exogenous hVR1 gene on chromosome 1, band q13, may create a high protein-producing CHO-S cell line, suggesting that chromosome 1q13 may contain a useful target site for the high expression of exogenous protein. This study shows that the integration into the target site of chromosome 1q13 may avoid the problems of random integration that cause gene silencing or also overcome position effects, facilitating exogenous gene expression in CHO-S cells.

Reduction of transforming growth factor-β1 expression in leukemia and its possible role in leukemia development.

PubMed

Wu, Yong; Chen, Ping; Huang, Hui-Fang; Huang, Mei-Juan; Chen, Yuan-Zhong

2012-01-01

The expression of transforming growth factor-β1 (TGF-β1) in leukemic cells and sera from patients with leukemia and its possible role in leukemia development were studied. TGF-β1 levels in culture supernatants from leukemic cells were significantly lower than those from normal bone marrow mononuclear cells. Serum TGF-β1 levels in leukemic patients were significantly lower compared with healthy controls, but returned to normal in patients achieving complete remission, and decreased when patients relapsed. TGF-β1 mRNA expression levels were significantly higher in normal bone marrow mononuclear cells but lower in leukemic cells compared with normal CD34 + cells. After transfection of the TGF-β1 gene to HL-60 cells, cell apoptosis was detected. Moreover, by flow cytometry analysis, cells arrested in G1 phase were 62% for TGF-β1 transfected cells and 44% for controls. Transfection of exogenous TGF-β1 gene inhibited HL60 cells xenograft growth in nude mice, and prolonged survival of tumor-bearing mice compared with the controls. Decreased endogenous TGF-β1 expression in leukemia cells may be involved in leukemia development, Transfection of exogenous TGF-B1 gene to HL60 can inhibit the proliferation of the cells and induce cell apoptosis by down regulating bcl-2, hTERT (human telomerase reverse transcriptase) and c-myc expression.

Recombinant Zymomonas mobilis with improved xylose utilization

DOEpatents

Zhang, Min

2003-05-20

A strain derived from Zymomonas mobilis ATCC31821 or its derivative capable of producing ethanol upon fermentation of a carbohydrate medium containing xylose to provide enhanced xylose utilization and enhanced ethanol process yield, the strain or its derivative comprising exogenous genes encoding xylose isornerase, xylulokinase, transaldolase and transketolase, the genes are fused to at least one promotor recognized by Zymomonas which regulates the expression of at least one of the genes.

Suppression Subtractive Hybridization Analysis of Genes Regulated by Application of Exogenous Abscisic Acid in Pepper Plant (Capsicum annuum L.) Leaves under Chilling Stress.

PubMed

Guo, Wei-Li; Chen, Ru-Gang; Gong, Zhen-Hui; Yin, Yan-Xu; Li, Da-Wei

2013-01-01

Low temperature is one of the major factors limiting pepper (Capsicum annuum L.) production during winter and early spring in non-tropical regions. Application of exogenous abscisic acid (ABA) effectively alleviates the symptoms of chilling injury, such as wilting and formation of necrotic lesions on pepper leaves; however, the underlying molecular mechanism is not understood. The aim of this study was to identify genes that are differentially up- or downregulated in ABA-pretreated hot pepper seedlings incubated at 6°C for 48 h, using a suppression subtractive hybridization (SSH) method. A total of 235 high-quality ESTs were isolated, clustered and assembled into a collection of 73 unigenes including 18 contigs and 55 singletons. A total of 37 unigenes (50.68%) showed similarities to genes with known functions in the non-redundant database; the other 36 unigenes (49.32%) showed low similarities or unknown functions. Gene ontology analysis revealed that the 37 unigenes could be classified into nine functional categories. The expression profiles of 18 selected genes were analyzed using quantitative RT-PCR; the expression levels of 10 of these genes were at least two-fold higher in the ABA-pretreated seedlings under chilling stress than water-pretreated (control) plants under chilling stress. In contrast, the other eight genes were downregulated in ABA-pretreated seedlings under chilling stress, with expression levels that were one-third or less of the levels observed in control seedlings under chilling stress. These results suggest that ABA can positively and negatively regulate genes in pepper plants under chilling stress.

Gibberellin homeostasis and plant height control by EUI and a role for gibberellin in root gravity responses in rice.

PubMed

Zhang, Yingying; Zhu, Yongyou; Peng, Yu; Yan, Dawei; Li, Qun; Wang, Jianjun; Wang, Linyou; He, Zuhua

2008-03-01

The rice Eui (ELONGATED UPPERMOST INTERNODE) gene encodes a cytochrome P450 monooxygenase that deactivates bioactive gibberellins (GAs). In this study, we investigated controlled expression of the Eui gene and its role in plant development. We found that Eui was differentially induced by exogenous GAs and that the Eui promoter had the highest activity in the vascular bundles. The eui mutant was defective in starch granule development in root caps and Eui overexpression enhanced starch granule generation and gravity responses, revealing a role for GA in root starch granule development and gravity responses. Experiments using embryoless half-seeds revealed that RAmy1A and GAmyb were highly upregulated in eui aleurone cells in the absence of exogenous GA. In addition, the GA biosynthesis genes GA3ox1 and GA20ox2 were downregulated and GA2ox1 was upregulated in eui seedlings. These results indicate that EUI is involved in GA homeostasis, not only in the internodes at the heading stage, but also in the seedling stage, roots and seeds. Disturbing GA homeostasis affected the expression of the GA signaling genes GID1 (GIBBERELLIN INSENSITIVE DWARF 1), GID2 and SLR1. Transgenic RNA interference of the Eui gene effectively increased plant height and improved heading performance. By contrast, the ectopic expression of Eui under the promoters of the rice GA biosynthesis genes GA3ox2 and GA20ox2 significantly reduced plant height. These results demonstrate that a slight increase in Eui expression could dramatically change rice morphology, indicating the practical application of the Eui gene in rice molecular breeding for a high yield potential.

Galectin-3 expression in response to LPS, immunomodulatory drugs and exogenously added galectin-3 in monocyte-like THP-1 cells.

PubMed

Dabelic, Sanja; Novak, Ruder; Goreta, Sandra Supraha; Dumic, Jerka

2012-09-01

Galectin-3, a structurally unique beta-galactoside-binding lectin, through the specific protein-protein and protein-carbohydrate interactions participates in numerous biological processes, such as cell proliferation and apoptosis, adhesion and activation. Its expression and secretion by until now an unknown mechanism are modulated by diverse molecules and are dependent on different physiological and pathophysiological conditions. By autocrine and paracrine actions, galectin-3 modulates many immune reactions and affects various immune cells, particularly those of monocyte-macrophage lineage. This is why galectin-3 has recently become an attractive therapeutic target. However, molecular mechanisms of its actions as well as regulatory mechanism of its expression and activation are still largely unknown. In this study, we show that lipopolysaccharide (LPS) provokes upregulation of galectin-3 expression on both gene and protein level in monocyte-like THP-1 cells, which can be inhibited by dexamethasone, but not with non-steroidal anti-inflammatory drugs aspirin and indomethacin. Resting and LPS-challenged monocyte-like THP-1 cells do not have detectable amount of surface-bound galectin-3, but are able to bind exogenously added galectin-3 with the same capacity. Although galectin-3 is generally considered to be a pro-inflammatory molecule, here we show that the exogenously added galectin-3 does not affect interleukin (IL)-1β, IL-6, IL-8, IL-10, IL-12p70 and TNF-α production in resting and LPS-activated monocyte-like THP-1 cells nor influences its own gene expression level in those cells.

5-Aminolevulinic Acid (ALA) Alleviated Salinity Stress in Cucumber Seedlings by Enhancing Chlorophyll Synthesis Pathway.

PubMed

Wu, Yue; Jin, Xin; Liao, Weibiao; Hu, Linli; Dawuda, Mohammed M; Zhao, Xingjie; Tang, Zhongqi; Gong, Tingyu; Yu, Jihua

2018-01-01

5-Aminolevulinic acid (ALA) is a common precursor of tetrapyrroles as well as a crucial growth regulator in higher plants. ALA has been proven to be effective in improving photosynthesis and alleviating the adverse effects of various abiotic stresses in higher plants. However, little is known about the mechanism of ALA in ameliorating the photosynthesis of plant under abiotic stress. In this paper, we studied the effects of exogenous ALA on salinity-induced damages of photosynthesis in cucumber ( Cucumis sativus L.) seedlings. We found that the morphology (plant height, leave area), light utilization capacity of PS II [qL, Y(II)] and gas exchange capacity (Pn, gs, Ci, and Tr) were significantly retarded under NaCl stress, but these parameters were all recovered by the foliar application of 25 mg L -1 ALA. Besides, salinity caused heme accumulation and up-regulation of gene expression of ferrochelatase ( HEMH ) with suppression of other genes involved in chlorophyll synthesis pathway. Exogenously application of ALA under salinity down-regulated the heme content and HEMH expression, but increased the gene expression levels of glutamyl-tRNA reductase ( HEMA1 ), Mg-chelatase ( CHLH ), and protochlorophyllide oxidoreductase ( POR ). Moreover, the contents of intermediates involved in chlorophyll branch were increased by ALA, including protoporphyrin IX (Proto IX), Mg-protoporphyrin IX (Mg-Proto IX, protochlorophyllide (Pchlide), and chlorophyll (Chl a and Chl b ) under salt stress. Ultrastructural observation of mesophyll cell showed that the damages of photosynthetic apparatus under salinity were fixed by ALA. Collectively, the chlorophyll biosynthesis pathway was enhanced by exogenous ALA to improve the tolerance of cucumber under salinity.

The Use of rLH, HMG and hCG in Controlled Ovarian Stimulation for Assisted Reproductive Technologies

DTIC Science & Technology

2012-11-21

express CYP17, the gene encoding for the critical enzyme in the conversion of progesterone and pregnenalone to androgens (3). Conversely, granulosa...2. Potential mechanisms of exogenous LH benefit in ART There are theoretical benefits of the use of exogenous LH for the oocyte and the endometrium...folliculogenesis when administered with FSH (85). rLH has potential advantages over the LH activity in hMG in that there is less risk of protein contamination and

Metagenomic and Metatranscriptomic Analyses Reveal the Structure and Dynamics of a Dechlorinating Community Containing Dehalococcoides mccartyi and Corrinoid-Providing Microorganisms under Cobalamin-Limited Conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Men, Yujie; Yu, Ke; Bælum, Jacob

ABSTRACT The aim of this study is to obtain a systems-level understanding of the interactions betweenDehalococcoidesand corrinoid-supplying microorganisms by analyzing community structures and functional compositions, activities, and dynamics in trichloroethene (TCE)-dechlorinating enrichments. Metagenomes and metatranscriptomes of the dechlorinating enrichments with and without exogenous cobalamin were compared. Seven putative draft genomes were binned from the metagenomes. At an early stage (2 days), more transcripts of genes in theVeillonellaceaebin-genome were detected in the metatranscriptome of the enrichment without exogenous cobalamin than in the one with the addition of cobalamin. Among these genes, sporulation-related genes exhibited the highest differential expression when cobalamin wasmore » not added, suggesting a possible release route of corrinoids from corrinoid producers. Other differentially expressed genes include those involved in energy conservation and nutrient transport (including cobalt transport). The most highly expressed corrinoidde novobiosynthesis pathway was also assigned to theVeillonellaceaebin-genome. Targeted quantitative PCR (qPCR) analyses confirmed higher transcript abundances of those corrinoid biosynthesis genes in the enrichment without exogenous cobalamin than in the enrichment with cobalamin. Furthermore, the corrinoid salvaging and modification pathway ofDehalococcoideswas upregulated in response to the cobalamin stress. This study provides important insights into the microbial interactions and roles played by members of dechlorinating communities under cobalamin-limited conditions. IMPORTANCEThe key chloroethene-dechlorinating bacteriumDehalococcoides mccartyiis a cobalamin auxotroph, thus acquiring corrinoids from other community members. Therefore, it is important to investigate the microbe-microbe interactions betweenDehalococcoidesand the corrinoid-providing microorganisms in a community. This study provides systems-level information, i.e., taxonomic and functional compositions and dynamics of the supportive microorganisms in dechlorinating communities under different cobalamin conditions. The findings shed light on the important roles ofVeillonellaceaespecies in the communities compared to other coexisting community members in producing and providing corrinoids forDehalococcoidesspecies under cobalamin-limited conditions.« less

Metagenomic and Metatranscriptomic Analyses Reveal the Structure and Dynamics of a Dechlorinating Community Containing Dehalococcoides mccartyi and Corrinoid-Providing Microorganisms under Cobalamin-Limited Conditions

PubMed Central

Yu, Ke; Bælum, Jacob; Gao, Ying; Tremblay, Julien; Prestat, Emmanuel; Stenuit, Ben; Tringe, Susannah G.; Jansson, Janet; Zhang, Tong; Alvarez-Cohen, Lisa

2017-01-01

ABSTRACT The aim of this study is to obtain a systems-level understanding of the interactions between Dehalococcoides and corrinoid-supplying microorganisms by analyzing community structures and functional compositions, activities, and dynamics in trichloroethene (TCE)-dechlorinating enrichments. Metagenomes and metatranscriptomes of the dechlorinating enrichments with and without exogenous cobalamin were compared. Seven putative draft genomes were binned from the metagenomes. At an early stage (2 days), more transcripts of genes in the Veillonellaceae bin-genome were detected in the metatranscriptome of the enrichment without exogenous cobalamin than in the one with the addition of cobalamin. Among these genes, sporulation-related genes exhibited the highest differential expression when cobalamin was not added, suggesting a possible release route of corrinoids from corrinoid producers. Other differentially expressed genes include those involved in energy conservation and nutrient transport (including cobalt transport). The most highly expressed corrinoid de novo biosynthesis pathway was also assigned to the Veillonellaceae bin-genome. Targeted quantitative PCR (qPCR) analyses confirmed higher transcript abundances of those corrinoid biosynthesis genes in the enrichment without exogenous cobalamin than in the enrichment with cobalamin. Furthermore, the corrinoid salvaging and modification pathway of Dehalococcoides was upregulated in response to the cobalamin stress. This study provides important insights into the microbial interactions and roles played by members of dechlorinating communities under cobalamin-limited conditions. IMPORTANCE The key chloroethene-dechlorinating bacterium Dehalococcoides mccartyi is a cobalamin auxotroph, thus acquiring corrinoids from other community members. Therefore, it is important to investigate the microbe-microbe interactions between Dehalococcoides and the corrinoid-providing microorganisms in a community. This study provides systems-level information, i.e., taxonomic and functional compositions and dynamics of the supportive microorganisms in dechlorinating communities under different cobalamin conditions. The findings shed light on the important roles of Veillonellaceae species in the communities compared to other coexisting community members in producing and providing corrinoids for Dehalococcoides species under cobalamin-limited conditions. PMID:28188205

Prenyl alcohol production by expression of exogenous isopentenyl diphosphate isomerase and farnesyl diphosphate synthase genes in Escherichia coli.

PubMed

Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu

2009-01-01

Isopentenyl diphosphate isomerase (idi) and farnesyl diphosphate synthase (ispA) genes were overexpressed in Escherichia coli. The resulting transformant showed 6.8-fold higher production of farnesol (389 microg/l). In a similar manner, overexpression of idi and mutated ispA led to high production of geranylgeraniol (128 microg/l).

Parthenolide accumulation and expression of genes related to parthenolide biosynthesis affected by exogenous application of methyl jasmonate and salicylic acid in Tanacetum parthenium.

PubMed

Majdi, Mohammad; Abdollahi, Mohammad Reza; Maroufi, Asad

2015-11-01

Up-regulation of germacrene A synthase and down-regulation of parthenolide hydroxylase genes play key role in parthenolide accumulation of feverfew plants treated with methyl jasmonate and salicylic acid. Parthenolide is an important sesquiterpene lactone due to its anti-migraine and anti-cancer properties. Parthenolide amount was quantified by high-performance liquid chromatography after foliar application of methyl jasmonate (100 µM) or salicylic acid (1.0 mM) on feverfew leaves in time course experiment (3-96 h). Results indicate that exogenous application of methyl jasmonate or salicylic acid activated parthenolide biosynthesis. Parthenolide content reached its highest amount at 24 h after methyl jasmonate or salicylic acid treatments, which were 3.1- and 1.96-fold higher than control plants, respectively. Parthenolide transiently increased due to methyl jasmonate or salicylic acid treatments until 24 h, but did not show significant difference compared with control plants at 48 and 96 h time points in both treatments. Also, the transcript levels of early pathway (upstream) genes of terpene biosynthesis including 3-hydroxy-3-methylglutaryl-coenzyme A reductase, 1-deoxy-D-xylulose-5-phosphate reductoisomerase and hydroxy-2-methyl-2-(E)-butenyl 4-diphosphate reductase and the biosynthetic genes of parthenolide including germacrene A synthase, germacrene A oxidase, costunolide synthase and parthenolide synthase were increased by methyl jasmonate and salicylic acid treatments, but with different intensity. The transcriptional levels of these genes were higher in methyl jasmonate-treated plants than salicylic acid-treated plants. Parthenolide content measurements along with expression pattern analysis of the aforementioned genes and parthenolide hydroxylase as side branch gene of parthenolide suggest that the expression patterns of early pathway genes were not directly consistent with parthenolide accumulation pattern; hence, parthenolide accumulation is probably further modulated by the expression of its biosynthetic genes, especially germacrene A synthase and also its side branch gene, parthenolide hydroxylase.

Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection.

PubMed

Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A

2016-01-15

Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated "CiHHV-6A/B". These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections.

Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection

PubMed Central

Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A.

2016-01-01

Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated “CiHHV-6A/B”. These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections. PMID:26784220

Osteoblasts are target cells for transformation in c-fos transgenic mice

PubMed Central

1993-01-01

We have generated transgenic mice expressing the proto-oncogene c-fos from an H-2Kb class I MHC promoter as a tool to identify and isolate cell populations which are sensitive to altered levels of Fos protein. All homozygous H2-c-fosLTR mice develop osteosarcomas with a short latency period. This phenotype is specific for c-fos as transgenic mice expressing the fos- and jun-related genes, fosB and c-jun, from the same regulatory elements do not develop any pathology despite high expression in bone tissues. The c-fos transgene is not expressed during embryogenesis but is expressed after birth in bone tissues before the onset of tumor formation, specifically in putative preosteoblasts, bone- forming osteoblasts, osteocytes, as well as in osteoblastic cells present within the tumors. Primary and clonal cell lines established from c-fos-induced tumors expressed high levels of exogenous c-fos as well as the bone cell marker genes, type I collagen, alkaline phosphatase, and osteopontin/2ar. In contrast, osteocalcin/BGP expression was either low or absent. All cell lines were tumorigenic in vivo, some of which gave rise to osteosarcomas, expressing exogenous c- fos mRNA, and Fos protein in osteoblastic cells. Detailed analysis of one osteogenic cell line, P1, and several P1-derived clonal cell lines indicated that bone-forming osteoblastic cells were transformed by Fos. The regulation of osteocalcin/BGP and alkaline phosphatase gene expression by 1,25-dihydroxyvitamin D3 was abrogated in P1-derived clonal cells, whereas glucocorticoid responsiveness was unaltered. These results suggest that high levels of Fos perturb the normal growth control of osteoblastic cells and exert specific effects on the expression of the osteoblast phenotype. PMID:8335693

Alleviation of Drought Stress by Hydrogen Sulfide Is Partially Related to the Abscisic Acid Signaling Pathway in Wheat.

PubMed

Ma, Dongyun; Ding, Huina; Wang, Chenyang; Qin, Haixia; Han, Qiaoxia; Hou, Junfeng; Lu, Hongfang; Xie, Yingxin; Guo, Tiancai

2016-01-01

Little information is available describing the effects of exogenous H2S on the ABA pathway in the acquisition of drought tolerance in wheat. In this study, we investigated the physiological parameters, the transcription levels of several genes involved in the abscisic acid (ABA) metabolism pathway, and the ABA and H2S contents in wheat leaves and roots under drought stress in response to exogenous NaHS treatment. The results showed that pretreatment with NaHS significantly increased plant height and the leaf relative water content of seedlings under drought stress. Compared with drought stress treatment alone, H2S application increased antioxidant enzyme activities and reduced MDA and H2O2 contents in both leaves and roots. NaHS pretreatment increased the expression levels of ABA biosynthesis and ABA reactivation genes in leaves; whereas the expression levels of ABA biosynthesis and ABA catabolism genes were up-regulated in roots. These results indicated that ABA participates in drought tolerance induced by exogenous H2S, and that the responses in leaves and roots are different. The transcription levels of genes encoding ABA receptors were up-regulated in response to NaHS pretreatment under drought conditions in both leaves and roots. Correspondingly, the H2S contents in leaves and roots were increased by NaHS pretreatment, while the ABA contents of leaves and roots decreased. This implied that there is complex crosstalk between these two signal molecules, and that the alleviation of drought stress by H2S, at least in part, involves the ABA signaling pathway.

Alleviation of Drought Stress by Hydrogen Sulfide Is Partially Related to the Abscisic Acid Signaling Pathway in Wheat

PubMed Central

Wang, Chenyang; Qin, Haixia; Han, Qiaoxia; Hou, Junfeng; Lu, Hongfang; Xie, Yingxin; Guo, Tiancai

2016-01-01

Little information is available describing the effects of exogenous H2S on the ABA pathway in the acquisition of drought tolerance in wheat. In this study, we investigated the physiological parameters, the transcription levels of several genes involved in the abscisic acid (ABA) metabolism pathway, and the ABA and H2S contents in wheat leaves and roots under drought stress in response to exogenous NaHS treatment. The results showed that pretreatment with NaHS significantly increased plant height and the leaf relative water content of seedlings under drought stress. Compared with drought stress treatment alone, H2S application increased antioxidant enzyme activities and reduced MDA and H2O2 contents in both leaves and roots. NaHS pretreatment increased the expression levels of ABA biosynthesis and ABA reactivation genes in leaves; whereas the expression levels of ABA biosynthesis and ABA catabolism genes were up-regulated in roots. These results indicated that ABA participates in drought tolerance induced by exogenous H2S, and that the responses in leaves and roots are different. The transcription levels of genes encoding ABA receptors were up-regulated in response to NaHS pretreatment under drought conditions in both leaves and roots. Correspondingly, the H2S contents in leaves and roots were increased by NaHS pretreatment, while the ABA contents of leaves and roots decreased. This implied that there is complex crosstalk between these two signal molecules, and that the alleviation of drought stress by H2S, at least in part, involves the ABA signaling pathway. PMID:27649534

Molecular function of microtubule-associated protein 2 for filial imprinting in domestic chicks (Gallus gallus domesticus).

PubMed

Yamaguchi, Shinji; Katagiri, Sachiko; Aoki, Naoya; Iikubo, Eiji; Kitajima, Takaaki; Matsushima, Toshiya; Homma, Koichi J

2011-01-01

RNA interference (RNAi)-mediated gene-silencing can be a tool for elucidating the role of genes in the neural basis of behavioral plasticity. Previously, we reported that exogenous DNA could be successfully delivered into newly-hatched chick brains via electroporation. Here, we used this in vivo gene-transfer technique and showed that transfected microRNA vectors preferentially silence exogenous DNA expression in neuronal cells. Using this system, the up-regulation of microtubule-associated protein 2 (MAP2) accompanying filial imprinting was suppressed in vivo, which impaired the filial imprinting in chicks. In addition, the phosphorylation of MAP2 was found to increase in parallel with filial imprinting, and lithium chloride, an inhibitor of glycogen synthase kinase 3 (GSK3), was found to impair filial imprinting. Our results suggest that the regulation of MAP2 expression and its phosphorylation are required for filial imprinting and may modify microtubule stability, thereby leading to cytoskeletal reorganization during imprinting. This in vivo RNAi-mediated gene-silencing system will facilitate the analysis of gene function in the living chick brain and provides further clues regarding the molecular mechanisms underpinning avian learning. Copyright © 2010 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

Long-Term Efficacy and Safety of Insulin and Glucokinase Gene Therapy for Diabetes: 8-Year Follow-Up in Dogs.

PubMed

Jaén, Maria Luisa; Vilà, Laia; Elias, Ivet; Jimenez, Veronica; Rodó, Jordi; Maggioni, Luca; Ruiz-de Gopegui, Rafael; Garcia, Miguel; Muñoz, Sergio; Callejas, David; Ayuso, Eduard; Ferré, Tura; Grifoll, Iris; Andaluz, Anna; Ruberte, Jesus; Haurigot, Virginia; Bosch, Fatima

2017-09-15

Diabetes is a complex metabolic disease that exposes patients to the deleterious effects of hyperglycemia on various organs. Achievement of normoglycemia with exogenous insulin treatment requires the use of high doses of hormone, which increases the risk of life-threatening hypoglycemic episodes. We developed a gene therapy approach to control diabetic hyperglycemia based on co-expression of the insulin and glucokinase genes in skeletal muscle. Previous studies proved the feasibility of gene delivery to large diabetic animals with adeno-associated viral (AAV) vectors. Here, we report the long-term (∼8 years) follow-up after a single administration of therapeutic vectors to diabetic dogs. Successful, multi-year control of glycemia was achieved without the need of supplementation with exogenous insulin. Metabolic correction was demonstrated through normalization of serum levels of fructosamine, triglycerides, and cholesterol and remarkable improvement in the response to an oral glucose challenge. The persistence of vector genomes and therapeutic transgene expression years after vector delivery was documented in multiple samples from treated muscles, which showed normal morphology. Thus, this study demonstrates the long-term efficacy and safety of insulin and glucokinase gene transfer in large animals and especially the ability of the system to respond to the changes in metabolic needs as animals grow older.

The essential role of endogenous ghrelin in growth hormone expression during zebrafish adenohypophysis development.

PubMed

Li, Xi; He, Jiangyan; Hu, Wei; Yin, Zhan

2009-06-01

Ghrelin, a multifunctional hormone, including potent GH stimulation activity, has been suggested to be important during embryonic development. Expression of ghrelin has been confirmed in the zebrafish pancreas during embryonic stages. Interfering with ghrelin function using two specific antisense morpholino oligonucleotides causes defects during zebrafish embryonic development. In ghrelin morphants the expression of GH was abolished in zebrafish somatotropes, whereas the expression patterns of the other key molecules involved in hypothalamic-pituitary development and distinct pituitary hormones genes remain largely intact at the appropriate time during zebrafish adenohypophysis development. Effective rescue of the ghrelin morphants with exogenous ghrelin mRNA showed that the correct gene had been targeted. Moreover, by analyzing the efficiencies of the ghrelin morphants rescue experiments with various forms of exogenous mutant ghrelin mRNAs, we also demonstrated the essentiality of the form acyl-ghrelin on GH stimulation during zebrafish adenohypophysis development. Our in vivo experiments, for the first time, also provided evidence of the existence of functional obestatin in the C-terminal part of zebrafish proghrelin peptides. Our research here has demonstrated that zebrafish is a unique model for functional studies of endogenous ghrelin, especially during embryonic development.

The potential roles of endogenous retroviruses in autoimmunity.

PubMed

Nakagawa, K; Harrison, L C

1996-08-01

Endogenous retroviruses (ERVs) are estimated to comprise up to 1% of human DNA. While the genome of many ERVs is interrupted by termination codons, deletions or frame shift mutations, some ERVs are transcriptionally active and recent studies reveal protein expression or particle formation by human ERVs. ERVs have been implicated as aetiological agents of autoimmune disease, because of their structural and sequence similarities to exogenous retroviruses associated with immune dysregulation and their tissue-specific or differentiation-dependent expression. In fact, retrovirus-like particles distinct from those of known exogenous retroviruses and immune responses to ERV proteins have been observed in autoimmune disease. Quantitatively or structurally aberrant expression of normally cryptic ERVs, induced by environmental or endogenous factors, could initiate autoimmunity through direct or indirect mechanisms. ERVs may lead to immune dysregulation as insertional mutagens or cis-regulatory elements of cellular genes involved in immune function. ERVs may also encode elements like tax in human T-lymphotrophic virus type I (HTLV-I) or tat in human immunodeficiency virus-I (HIV-I) that are capable of transactivating cellular genes. More directly, human ERV gene products themselves may be immunologically active, by analogy with the superantigen activity in the long terminal repeat (LTR) of mouse mammary tumour viruses (MMTV) and the non-specific immunosuppressive activity in mammalian type C retrovirus env protein. Alternatively, increased expression of an ERV protein, or expression of a novel ERV protein not expressed in the thymus during acquisition of immune tolerance, may lead to its perception as a neoantigen. Paraneoplastic syndromes raise the possibility that novel ERV-encoded epitopes expressed by a tumour elicit immunity to cross-reactive epitopes in normal tissues. Recombination events between different but related ERVs, to whose products the host is immunologically tolerant, may also generate new antigenic determinants. Frequently reported humoral immunity to exogenous retrovirus proteins in autoimmune disease could be elicited by cross-reactive ERV proteins. A review of the evidence implicating ERVs in immune dysfunction leads to the conclusion that direct molecular studies are likely to establish a pathogenic role for ERVs in autoimmune disease.

Regulation of oxidative stress and somatostatin, cholecystokinin, apelin gene expressions by ghrelin in stomach of newborn diabetic rats.

PubMed

Coskun, Zeynep Mine; Sacan, Ozlem; Karatug, Ayse; Turk, Neslihan; Yanardag, Refiye; Bolkent, Sehnaz; Bolkent, Sema

2013-09-01

The aim of the study was to determine whether ghrelin treatment has a protective effect on gene expression and biochemical changes in the stomach of newborn streptozotocin (STZ) induced diabetic rats. In this study, four groups of Wistar rats were used: control, ghrelin control, diabetic and diabetic+ghrelin. The rats were sacrificed after four weeks of treatment for diabetes. The gene expressions of: somatostatin, cholecystokinin, apelin and the altered active caspase-3, active caspase-8, proliferating cell nuclear antigen, were investigated in the pyloric region of the stomach and antioxidant parameters were measured in all the stomach. Although ghrelin treatment to diabetic rats lowered the stomach lipid peroxidation levels, the stomach glutathione levels were increased. Exogenous ghrelin caused an increased activities of stomach catalase, superoxide dismutase, glutathione reductase and glutathione peroxidase in diabetic rats. Numbers of somatostatin, cholecystokinin and proliferating cell nuclear antigen immunoreactive cells decreased in the diabetic+ghrelin group compared to the diabetic group. Apelin mRNA expressions were remarkably less in the diabetic+ghrelin rats than in diabetic rats. The results may indicate that ghrelin treatment has a protective effect to some extent on the diabetic rats. This protection is possibly accomplished through the antioxidant activity of ghrelin observed in type 2 diabetes. Consequently exogenous ghrelin may be a candidate for therapeutic treatment of diabetes. Copyright © 2013 Elsevier GmbH. All rights reserved.

Sodic alkaline stress mitigation by exogenous melatonin in tomato needs nitric oxide as a downstream signal.

PubMed

Liu, Na; Gong, Biao; Jin, Zhiyong; Wang, Xiufeng; Wei, Min; Yang, Fengjuan; Li, Yan; Shi, Qinghua

2015-08-15

The present study was designed to determine the interactive effect of exogenous melatonin and nitric oxide (NO) on sodic alkaline stress mitigation in tomato seedlings. It was observed that exogenous melatonin treatment elevated NO levels in alkaline-stressed tomato roots. However, exogenous NO had little effects on melatonin levels. Importantly, melatonin-induced NO generation was accompanied by increased tolerance to alkaline stress. Chemical scavenging of NO reduced melatonin-induced alkaline stress tolerance and defense genes' expression. However, inhibition of melatonin biosynthesis had a little effect on NO-induced alkaline stress tolerance. These results strongly suggest that NO, acting as a downstream signal, is involved in the melatonin-induced tomato tolerance to alkaline stress. This process creates a new signaling pathway for improving stress tolerance in plant. Copyright © 2015 Elsevier GmbH. All rights reserved.

Suppression Subtractive Hybridization Analysis of Genes Regulated by Application of Exogenous Abscisic Acid in Pepper Plant (Capsicum annuum L.) Leaves under Chilling Stress

PubMed Central

Gong, Zhen-Hui; Yin, Yan-Xu; Li, Da-Wei

2013-01-01

Low temperature is one of the major factors limiting pepper (Capsicum annuum L.) production during winter and early spring in non-tropical regions. Application of exogenous abscisic acid (ABA) effectively alleviates the symptoms of chilling injury, such as wilting and formation of necrotic lesions on pepper leaves; however, the underlying molecular mechanism is not understood. The aim of this study was to identify genes that are differentially up- or downregulated in ABA-pretreated hot pepper seedlings incubated at 6°C for 48 h, using a suppression subtractive hybridization (SSH) method. A total of 235 high-quality ESTs were isolated, clustered and assembled into a collection of 73 unigenes including 18 contigs and 55 singletons. A total of 37 unigenes (50.68%) showed similarities to genes with known functions in the non-redundant database; the other 36 unigenes (49.32%) showed low similarities or unknown functions. Gene ontology analysis revealed that the 37 unigenes could be classified into nine functional categories. The expression profiles of 18 selected genes were analyzed using quantitative RT-PCR; the expression levels of 10 of these genes were at least two-fold higher in the ABA-pretreated seedlings under chilling stress than water-pretreated (control) plants under chilling stress. In contrast, the other eight genes were downregulated in ABA-pretreated seedlings under chilling stress, with expression levels that were one-third or less of the levels observed in control seedlings under chilling stress. These results suggest that ABA can positively and negatively regulate genes in pepper plants under chilling stress. PMID:23825555

Genome-wide identification, phylogeny, and expression analysis of the SWEET gene family in tomato.

PubMed

Feng, Chao-Yang; Han, Jia-Xuan; Han, Xiao-Xue; Jiang, Jing

2015-12-01

The SWEET (Sugars Will Eventually Be Exported Transporters) gene family encodes membrane-embedded sugar transporters containing seven transmembrane helices harboring two MtN3 and saliva domain. SWEETs play important roles in diverse biological processes, including plant growth, development, and response to environmental stimuli. Here, we conducted an exhaustive search of the tomato genome, leading to the identification of 29 SWEET genes. We analyzed the structures, conserved domains, and phylogenetic relationships of these protein-coding genes in detail. We also analyzed the transcript levels of SWEET genes in various tissues, organs, and developmental stages to obtain information about their functions. Furthermore, we investigated the expression patterns of the SWEET genes in response to exogenous sugar and adverse environmental stress (high and low temperatures). Some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Numerous stress-responsive candidate genes were obtained. The results of this study provide insights into the characteristics of the SWEET genes in tomato and may serve as a basis for further functional studies of such genes. Copyright © 2015 Elsevier B.V. All rights reserved.

Ghrelin-Related Peptides Exert Protective Effects in the Cerebral Circulation of Male Mice Through a Nonclassical Ghrelin Receptor(s)

PubMed Central

Ku, Jacqueline M.; Andrews, Zane B.; Barsby, Tom; Reichenbach, Alex; Lemus, Moyra B.; Drummond, Grant R.; Sleeman, Mark W.; Spencer, Sarah J.; Sobey, Christopher G.

2015-01-01

The ghrelin-related peptides, acylated ghrelin, des-acylated ghrelin, and obestatin, are novel gastrointestinal hormones. We firstly investigated whether the ghrelin gene, ghrelin O-acyltransferase, and the ghrelin receptor (GH secretagogue receptor 1a [GHSR1a]) are expressed in mouse cerebral arteries. Secondly, we assessed the cerebrovascular actions of ghrelin-related peptides by examining their effects on vasodilator nitric oxide (NO) and superoxide production. Using RT-PCR, we found the ghrelin gene and ghrelin O-acyltransferase to be expressed at negligible levels in cerebral arteries from male wild-type mice. mRNA expression of GHSR1a was also found to be low in cerebral arteries, and GHSR protein was undetectable in GHSR-enhanced green fluorescent protein mice. We next found that exogenous acylated ghrelin had no effect on the tone of perfused cerebral arteries or superoxide production. By contrast, exogenous des-acylated ghrelin or obestatin elicited powerful vasodilator responses (EC50 < 10 pmol/L) that were abolished by the NO synthase inhibitor Nω-nitro-L-arginine methyl ester. Furthermore, exogenous des-acylated ghrelin suppressed superoxide production in cerebral arteries. Consistent with our GHSR expression data, vasodilator effects of des-acylated ghrelin or obestatin were sustained in the presence of YIL-781 (GHSR1a antagonist) and in arteries from Ghsr-deficient mice. Using ghrelin-deficient (Ghrl−/−) mice, we also found that endogenous production of ghrelin-related peptides regulates NO bioactivity and superoxide levels in the cerebral circulation. Specifically, we show that NO bioactivity was markedly reduced in Ghrl−/− vs wild-type mice, and superoxide levels were elevated. These findings reveal protective actions of exogenous and endogenous ghrelin-related peptides in the cerebral circulation and show the existence of a novel ghrelin receptor(s) in the cerebral endothelium. PMID:25322462

Effect of exogenous progesterone on embryo size and ewe uterine gene expression in an ovine 'dam size' model of maternal constraint.

PubMed

Fermin, Lisanne M; Pain, Sarah J; Morel, Patrick C H; Gedye, Kristene R; Kenyon, Paul R; Blair, Hugh T

2017-11-21

Progesterone (P4), acting via its receptor, regulates uterine function and histotroph production, which are crucial to embryo growth. This study aimed to examine exogenous P4 effects on embryo size and differential endometrial gene expression at Day 19 of gestation using a 'dam size' sheep model of maternal constraint. Purebred Suffolk (S, genotypically large) embryos were transferred into recipient groups of Cheviot (C, genotypically small) or Suffolk ewes that had, or had not, been pre-treated with P4 from Days 0 to 6 of pregnancy. At Day 19S embryos were collected from four experimental groups: P4 pretreated S ewes (SP4; n=5), untreated S ewes (SnP4; n=15), P4 pretreated C ewes (CP4; n=7) and untreated C ewes (CnP4; n=21). Day-19 embryos from CP4 ewes were larger (P<0.05) than those from CnP4 ewes and similar in size (P>0.05) to embryos from SnP4 and SP4 ewes. Expression of mucin 1 (MUC1) and prostaglandin-endoperoxide synthase 2 (PTGS2) was upregulated in uterine horns ipsilateral to the corpus luteum from CP4 ewes. Prostaglandin receptor (PGR), MUC1 and PTGS2 expression was upregulated, whilst cathepsin L (CTSL) and radical S-adenosyl methionine domain-containing 2 (RSAD2) expression was downregulated in the ipsilateral horn of SP4 ewes. This suggests that pretreating ewes with exogenous P4 may alleviate early pregnancy maternal constraint via mechanisms that alter uterine function. However, further research is required to investigate the timing of P4 administration and its impact on conception rates.

Bioluminescence imaging of c-fos gene expression accompanying filial imprinting in the newly hatched chick brain.

PubMed

Yamaguchi, Shinji; Iikubo, Eiji; Hirose, Naoki; Kitajima, Takaaki; Katagiri, Sachiko; Kawamori, Ai; Fujii-Taira, Ikuko; Matsushima, Toshiya; Homma, Koichi J

2010-06-01

Bioluminescence imaging is a powerful tool for examining gene expression in living animals. Previously, we reported that exogenous DNA could be successfully delivered into neurons in the newly hatched chick brain using electroporation. Here, we show the in vivo bioluminescence imaging of c-fos promoter activity and its upregulation, which is associated with filial imprinting. The upregulation of c-fos gene expression correlated with both the strength of the chicks' approach activity to the training object and the acquisition of memory. The present technique should be a powerful tool for analyzing the time changes in neural activity of certain brain areas in real-time during memory formation, using brains of living animals.

[Effects of exogenous spermidine on lipid peroxidation and membrane proton pump activity of cucumber seedling leaves under high temperature stress].

PubMed

Tian, Jing; Guo, Shi-Rong; Sun, Jin; Wang, Li-Ping; Yang, Yan-Juan; Li, Bin

2011-12-01

Taking a relatively heat-resistant cucumber (Cucumis sativus) cultivar 'Jinchun No. 4' as test material, a sand culture experiment was conducted in growth chamber to investigate the effects of foliar spraying spermidine (Spd) on the lipid peroxidation, membrane proton pump activity, and corresponding gene expression of cucumber seedling leaves under high temperature stress. Compared with the control, foliar spraying Spd increased the plant height, stem diameter, dry and fresh mass, and leaf area significantly, and inhibited the increase of leaf relative conductivity, malondialdehyde (MDA) content, and lipoxygenase (LOX) activity effectively. Foliar spraying Spd also helped to the increase of leaf plasma membrane- and tonoplast H(+)-ATPase activity, but no significant difference was observed in the gene expression levels. These results suggested that exogenous Spd could significantly decrease the leaf lipid peroxidation and increase the proton pump activity, and thus, stabilize the leaf membrane structure and function, alleviate the damage induced by high temperature stress, and enhance the heat tolerance of cucumber seedlings.

The relationship between thiamine and two symbioses: Root nodule symbiosis and arbuscular mycorrhiza.

PubMed

Nagae, Miwa; Parniske, Martin; Kawaguchi, Masayoshi; Takeda, Naoya

2016-12-01

Lotus japonicus THIC is expressed in all organs, and the encoded protein catalyzes thiamine biosynthesis. Loss of function produces chlorosis, a typical thiamine-deficiency phenotype, and mortality. To investigate thiamine's role in symbiosis, we focused on THI1, a thiamine-biosynthesis gene expressed in roots, nodules, and seeds. The thi1 mutant had green leaves, but formed small nodules and immature seeds. These phenotypes were rescued by THI1 complementation and by exogenous thiamine. Thus, THI1 is required for nodule enlargement and seed maturation. On the other hand, colonization by arbuscular mycorrhiza (AM) fungus Rhizophagus irregularis was not affected in the thi1 mutant or by exogenous thiamine. However, spores of R. irregularis stored more thiamine than the source (host plants), despite lacking thiamine biosynthesis genes. Therefore, disturbance of the thiamine supply would affect progeny phenotypes such as spore formation and hyphal growth. Further investigation will be required to elucidate thiamine's effect on AM.

In Vivo Gene Therapy of Hemophilia B: Sustained Partial Correction in Factor IX-Deficient Dogs

NASA Astrophysics Data System (ADS)

Kay, Mark A.; Rothenberg, Steven; Landen, Charles N.; Bellinger, Dwight A.; Leland, Frances; Toman, Carol; Finegold, Milton; Thompson, Arthur R.; Read, M. S.; Brinkhous, Kenneth M.; Woo, Savio L. C.

1993-10-01

The liver represents a model organ for gene therapy. A method has been developed for hepatic gene transfer in vivo by the direct infusion of recombinant retroviral vectors into the portal vasculature, which results in the persistent expression of exogenous genes. To determine if these technologies are applicable for the treatment of hemophilia B patients, preclinical efficacy studies were done in a hemophilia B dog model. When the canine factor IX complementary DNA was transduced directly into the hepatocytes of affected dogs in vivo, the animals constitutively expressed low levels of canine factor IX for more than 5 months. Persistent expression of the clotting. factor resulted in reductions of whole blood clotting and partial thromboplastin times of the treated animals. Thus, long-term treatment of hemophilia B patients may be feasible by direct hepatic gene therapy in vivo.

[Proliferation of hepatocytes after delivery of exogenous hepatocyte growth factor gene].

PubMed

Lin, Yong; Xie, Wei fen; Chen, Wei-zhong; Zhang, Xin; Zeng, Xin; Chen, Yue-xiang; Yang, Xiu-jiang; Zhang, Zhong-bing

2003-06-01

To explore the proliferation of primary cultured rats hepatocytes after delivery of exogenous hepatocyte growth factor (HGF) gene which was inserted into the genome of replication-deficient recombinant adenovirus vector. The recombinant adenovirus-AdHGF which could express HGF was generated by homologous recombination. After the HGF gene was delivered into the hepatocytes, the expression of both HGF and c-met/HGF receptor mRNA in the cells was detected by RT-PCR and the level of HGF in the culture supernatant was also assayed by ELISA. On the other hand, cell proliferation was compared between before and after delivery of the HGF gene by MTS assay and the percentages of cell cycles were analyzed by flow cytometry. In addition, the expression of proliferating cell nuclear antigen (PCNA) was determined by immunocytofluorescent stain. 4 x 10(10) efu/ml titer of AdHGF was obtained after recombination, RT-PCR indicated that the expression of HGF mRNA in hepatocytes increased on the third day after infected by the viruses and c-met/HGF receptor mRNA was also up-regulated. The HGF level in the culture supernatant assayed by ELISA was (5,939.0+/-414.39) pg/ml, which was much higher than that in the control (208.1pg/ml+/-37.20pg/ml, F=13.661, P<0.01). In addition, the proliferation of hepatocytes infected with AdHGF increased significantly according to MTS method (F>or=15.158, P<0.01) and more hepatocytes in G0/G1 stages changed into S stage (chi2=41.616, P<0.01), accordingly, PCNA index increased from 6.42+/- 1.88 to 14.56+/-2.85 (F=42.122, P<0.01). show that HGF gene delivered into hepatocytes by AdHGF can be expressed with high efficiency in the cells, which can stimulate hepatocytes proliferation. It may be an effective tool for hepatocyte transplantation by gene modified donor hepatocytes.

Development of a Synthetic Oxytetracycline-Inducible Expression System for Streptomycetes Using de Novo Characterized Genetic Parts.

PubMed

Wang, Weishan; Yang, Tongjian; Li, Yihong; Li, Shanshan; Yin, Shouliang; Styles, Kathryn; Corre, Christophe; Yang, Keqian

2016-07-15

Precise control of gene expression using exogenous factors is of great significance. To develop ideal inducible expression systems for streptomycetes, new genetic parts, oxytetracycline responsive repressor OtrR, operator otrO, and promoter otrBp from Streptomyces rimosus, were selected de novo and characterized in vivo and in vitro. OtrR showed strong affinity to otrO (KD = 1.7 × 10(-10) M) and oxytetracycline induced dissociation of the OtrR/DNA complex in a concentration-dependent manner. On the basis of these genetic parts, a synthetic inducible expression system Potr* was optimized. Induction of Potr* with 0.01-4 μM of oxytetracycline triggered a wide-range expression level of gfp reporter gene in different Streptomyces species. Benchmarking Potr* against the widely used constitutive promoters ermE* and kasOp* revealed greatly enhanced levels of expression when Potr* was fully induced. Finally, Potr* was used as a tool to activate and optimize the expression of the silent jadomycin biosynthetic gene cluster in Streptomyces venezuelae. Altogether, the synthetic Potr* presents a new versatile tool for fine-tuning gene expression in streptomycetes.

Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

1999-12-01

In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.

The Arabidopsis Phytocystatin AtCYS5 Enhances Seed Germination and Seedling Growth under Heat Stress Conditions.

PubMed

Song, Chieun; Kim, Taeyoon; Chung, Woo Sik; Lim, Chae Oh

2017-08-01

Phytocystatins (PhyCYSs) are plant-specific proteinaceous inhibitors that are implicated in protein turnover and stress responses. Here, we characterized a PhyCYS from Arabidopsis thaliana , which was designated AtCYS5. RT-qPCR analysis showed that the expression of AtCYS5 in germinating seeds was induced by heat stress (HS) and exogenous abscisic acid (ABA) treatment. Analysis of the expression of the β -glucuronidase reporter gene under the control of the AtCYS5 promoter showed that AtCYS5 expression during seed germination was induced by HS and ABA. Constitutive overexpression of AtCYS5 driven by the cauliflower mosaic virus 35S promoter led to enhanced HS tolerance in transgenic Arabidopsis , which was characterized by higher fresh weight and root length compared to wild-type (WT) and knockout ( cys5 ) plants grown under HS conditions. The HS tolerance of At-CYS5 -overexpressing transgenic plants was associated with increased insensitivity to exogenous ABA during both seed germination and post-germination compared to WT and cys5 . Although no HS elements were identified in the 5'-flanking region of AtCYS5 , canonical ABA-responsive elements (ABREs) were detected. AtCYS5 was upregulated in ABA-treated protoplasts transiently co-expressing this gene and genes encoding bZIP ABRE-binding factors (ABFs and AREB3). In the absence of ABA, ABF1 and ABF3 directly bound to the ABREs in the AtCYS5 promoter, which activated the transcription of this gene in the presence of ABA. These results suggest that an ABA-dependent pathway plays a positive role in the HS-responsive expression of AtCYS5 during seed germination and post-germination growth.

Photobiological hydrogen production with switchable photosystem-II designer algae

DOEpatents

Lee, James Weifu

2014-02-18

A process for enhanced photobiological H.sub.2 production using transgenic alga. The process includes inducing exogenous genes in a transgenic alga by manipulating selected environmental factors. In one embodiment inducing production of an exogenous gene uncouples H.sub.2 production from existing mechanisms that would downregulate H.sub.2 production in the absence of the exogenous gene. In other embodiments inducing an exogenous gene triggers a cascade of metabolic changes that increase H.sub.2 production. In some embodiments the transgenic alga are rendered non-regenerative by inducing exogenous transgenes for proton channel polypeptides that are targeted to specific algal membranes.

The E1 Protein of Human Papillomavirus Type 16 Is Dispensable for Maintenance Replication of the Viral Genome

PubMed Central

Egawa, Nagayasu; Nakahara, Tomomi; Ohno, Shin-ichi; Narisawa-Saito, Mako; Yugawa, Takashi; Fujita, Masatoshi; Yamato, Kenji; Natori, Yukikazu

2012-01-01

Papillomavirus genomes are thought to be amplified to about 100 copies per cell soon after infection, maintained constant at this level in basal cells, and amplified for viral production upon keratinocyte differentiation. To determine the requirement for E1 in viral DNA replication at different stages, an E1-defective mutant of the human papillomavirus 16 (HPV16) genome featuring a translation termination mutation in the E1 gene was used. The ability of the mutant HPV16 genome to replicate as nuclear episomes was monitored with or without exogenous expression of E1. Unlike the wild-type genome, the E1-defective HPV16 genome became established in human keratinocytes only as episomes in the presence of exogenous E1 expression. Once established, it could replicate with the same efficiency as the wild-type genome, even after the exogenous E1 was removed. However, upon calcium-induced keratinocyte differentiation, once again amplification was dependent on exogenous E1. These results demonstrate that the E1 protein is dispensable for maintenance replication but not for initial and productive replication of HPV16. PMID:22238312

Expression of an Exogenous Growth Hormone Gene by Transplantable Human Epidermal Cells

NASA Astrophysics Data System (ADS)

Morgan, Jeffrey R.; Barrandon, Yann; Green, Howard; Mulligan, Richard C.

1987-09-01

Retrovirus-mediated gene transfer was used to introduce a recombinant human growth hormone gene into cultured human keratinocytes. The transduced keratinocytes secreted biologically active growth hormone into the culture medium. When grafted as an epithelial sheet onto athymic mice, these cultured keratinocytes reconstituted an epidermis that was similar in appearance to that resulting from normal cells, but from which human growth hormone could be extracted. Transduced epidermal cells may prove to be a general vehicle for the delivery of gene products by means of grafting.

Early postnatal virus inoculation into the scala media achieved extensive expression of exogenous green fluorescent protein in the inner ear and preserved auditory brainstem response thresholds.

PubMed

Wang, Yunfeng; Sun, Yu; Chang, Qing; Ahmad, Shoeb; Zhou, Binfei; Kim, Yeunjung; Li, Huawei; Lin, Xi

2013-01-01

Gene transfer into the inner ear is a promising approach for treating sensorineural hearing loss. The special electrochemical environment of the scala media raises a formidable challenge for effective gene delivery at the same time as keeping normal cochlear function intact. The present study aimed to define a suitable strategy for preserving hearing after viral inoculation directly into the scala media performed at various postnatal developmental stages. We assessed transgene expression of green fluorescent protein (GFP) mediated by various types of adeno-associated virus (AAV) and lentivirus (LV) in the mouse cochlea. Auditory brainstem responses were measured 30 days after inoculation to assess effects on hearing. Patterns of GFP expression confirmed extensive exogenous gene expression in various types of cells lining the endolymphatic space. The use of different viral vectors and promoters resulted in specific cellular GFP expression patterns. AAV2/1 with cytomegalovirus promoter apparently gave the best results for GFP expression in the supporting cells. Histological examination showed normal cochlear morphology and no hair cell loss after either AAV or LV injections. We found that hearing thresholds were not significantly changed when the injections were performed in mice younger than postnatal day 5, regardless of the type of virus tested. Viral inoculation and expression in the inner ear for the restoration of hearing must not damage cochlear function. Using normal hearing mice as a model, we have achieved this necessary step, which is required for the treatment of many types of congenital deafness that require early intervention. Copyright © 2013 John Wiley & Sons, Ltd.

Effects of Per2 overexpression on growth inhibition and metastasis, and on MTA1, nm23-H1 and the autophagy-associated PI3K/PKB signaling pathway in nude mice xenograft models of ovarian cancer

PubMed Central

WANG, ZHAOXIA; LI, LI; WANG, YANG

2016-01-01

The aim of the present study was to evaluate the association between Period2 (Per2) and the occurrence and development of ovarian cancer, in addition to evaluating the effect of this gene on the growth and metastasis of ovarian cancer in nude mice xenograft models. The detection of Per2 by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting methods at various stages of ovarian cancer in tumor tissue samples was conducted. Nude mice xenograft models of ovarian cancer were constructed using an ovarian cancer cell line and, using a gene transfection technique, exogenous infusion of the recombinant gene, Per2, was performed. To assess for the successful and stable expression of Per2 in the tumor tissue, levels of Per2 expression in the nude mice xenograft models were detected by RT-qPCR. During the experimental period, the tumor volumes were measured every three days. Two weeks following treatment cessation, the nude mice were sacrificed and the tumor weight and volume were measured. Furthermore, detection of the changes in expression levels of metastasis-associated gene 1 (MTA-1) and tumor metastasis suppressor gene, non-metastasis protein 23-H1 (nm23-H1), and the expression change of autophagy-associated signal transduction pathway, phosphatidylinositol 3-kinase (PI3K)/protein kinase B (PKB) kinase were analyzed. The findings demonstrated that with ovarian cancer stage development, the expression of Per2 gradually reduced or ceased. In addition, exogenous Per2 was successfully and stably expressed in nude mice tumor tissue samples. Furthermore, in the Per2 overexpression group, MTA-1 protein expression was significantly reduced when compared with the phosphate-buffered saline (PBS) control and empty plasmid groups, while nm23-H1 protein expression was significantly higher when compared with those two groups. The expression levels of PI3K and PKB kinase, which are marker proteins of the autophagy associated signaling pathway PI3K/PKB, were significantly downregulated, when compared with the PBS control and empty plasmid groups (P<0.001). Thus, it was demonstrated that Per2 is closely associated with the development of ovarian cancer, and late-stage ovarian cancer is associated with Per2 mutation or deletion. Per2 overexpression, via exogenous infusion reduced the ovarian cancer growth rate, which was demonstrated by a significant increase in the tumor inhibition rate. In addition, Per2 may inhibit the expression of MTA-1 and promote the expression of nm23-H1 to restrict ovarian tumor growth and metastasis. Finally, it is hypothesized that Per2 affects autophagy by interfering with the PI3K/PKB signaling pathway, causing inhibition of tumor angiogenesis in order to inhibit tumor growth. PMID:27082164

Effects of Per2 overexpression on growth inhibition and metastasis, and on MTA1, nm23-H1 and the autophagy-associated PI3K/PKB signaling pathway in nude mice xenograft models of ovarian cancer.

PubMed

Wang, Zhaoxia; Li, Li; Wang, Yang

2016-06-01

The aim of the present study was to evaluate the association between Period2 (Per2) and the occurrence and development of ovarian cancer, in addition to evaluating the effect of this gene on the growth and metastasis of ovarian cancer in nude mice xenograft models. The detection of Per2 by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and western blotting methods at various stages of ovarian cancer in tumor tissue samples was conducted. Nude mice xenograft models of ovarian cancer were constructed using an ovarian cancer cell line and, using a gene transfection technique, exogenous infusion of the recombinant gene, Per2, was performed. To assess for the successful and stable expression of Per2 in the tumor tissue, levels of Per2 expression in the nude mice xenograft models were detected by RT‑qPCR. During the experimental period, the tumor volumes were measured every three days. Two weeks following treatment cessation, the nude mice were sacrificed and the tumor weight and volume were measured. Furthermore, detection of the changes in expression levels of metastasis‑associated gene 1 (MTA‑1) and tumor metastasis suppressor gene, non‑metastasis protein 23‑H1 (nm23‑H1), and the expression change of autophagy‑associated signal transduction pathway, phosphatidylinositol 3‑kinase (PI3K)/protein kinase B (PKB) kinase were analyzed. The findings demonstrated that with ovarian cancer stage development, the expression of Per2 gradually reduced or ceased. In addition, exogenous Per2 was successfully and stably expressed in nude mice tumor tissue samples. Furthermore, in the Per2 overexpression group, MTA‑1 protein expression was significantly reduced when compared with the phosphate‑buffered saline (PBS) control and empty plasmid groups, while nm23‑H1 protein expression was significantly higher when compared with those two groups. The expression levels of PI3K and PKB kinase, which are marker proteins of the autophagy associated signaling pathway PI3K/PKB, were significantly downregulated, when compared with the PBS control and empty plasmid groups (P<0.001). Thus, it was demonstrated that Per2 is closely associated with the development of ovarian cancer, and late‑stage ovarian cancer is associated with Per2 mutation or deletion. Per2 overexpression, via exogenous infusion reduced the ovarian cancer growth rate, which was demonstrated by a significant increase in the tumor inhibition rate. In addition, Per2 may inhibit the expression of MTA‑1 and promote the expression of nm23‑H1 to restrict ovarian tumor growth and metastasis. Finally, it is hypothesized that Per2 affects autophagy by interfering with the PI3K/PKB signaling pathway, causing inhibition of tumor angiogenesis in order to inhibit tumor growth.

Comparative Proteomic Analysis Reveals the Effects of Exogenous Calcium against Acid Rain Stress in Liquidambar formosana Hance Leaves.

PubMed

Hu, Wen-Jun; Wu, Qian; Liu, Xiang; Shen, Zhi-Jun; Chen, Juan; Liu, Ting-Wu; Chen, Juan; Zhu, Chun-Quan; Wu, Fei-Hua; Chen, Lin; Wei, Jia; Qiu, Xiao-Yun; Shen, Guo-Xin; Zheng, Hai-Lei

2016-01-04

Acid rain (AR) impacts forest health by leaching calcium (Ca) away from soils and plants. Ca is an essential element and participates in various plant physiological responses. In the present study, the protective role of exogenous Ca in alleviating AR stress in Liquidambar formosana Hance at the physiological and proteomic levels was examined. Our results showed that low Ca condition resulted in the chlorophyll content and photosynthesis decreasing significantly in L. formosana leaves; however, these effects could be reversed by high Ca supplementation. Further proteomic analyses successfully identified 81 differentially expressed proteins in AR-treated L. formosana under different Ca levels. In particular, some of the proteins are involved in primary metabolism, photosynthesis, energy production, antioxidant defense, transcription, and translation. Moreover, quantitative real time polymerase chain reaction (qRT-PCR) results indicated that low Ca significantly increased the expression level of the investigated Ca-related genes, which can be reversed by high Ca supplementation under AR stress. Further, Western blotting analysis revealed that exogenous Ca supply reduced AR damage by elevating the expression of proteins involved in the Calvin cycle, reactive oxygen species (ROS) scavenging system. These findings allowed us to better understand how woody plants respond to AR stress at various Ca levels and the protective role of exogenous Ca against AR stress in forest tree species.

Exogenous Application of Citric Acid Ameliorates the Adverse Effect of Heat Stress in Tall Fescue (Lolium arundinaceum)

PubMed Central

Hu, Longxing; Zhang, Zhifei; Xiang, Zuoxiang; Yang, Zhijian

2016-01-01

Citric acid may be involved in plant response to high temperature. The objective of this study was to investigate whether exogenous citric acid could improve heat tolerance in a cool-season turfgrass species, tall fescue (Lolium arundinaceum), and to determine the physiological mechanisms of citric acid effects on heat stress tolerance. The grasses were subjected to four citric acid levels (0, 0.2, 2, and 20 mM) and two temperature levels (25/20 and 35/30 ± 0.5°C, day/night) treatments in growth chambers. Heat stress increased an electrolyte leakage (EL) and malonaldehyde (MDA) content, while reduced plant growth, chlorophyll (Chl) content, photochemical efficiency (Fv/Fm), root activity and antioxidant enzyme activities (superoxide dismutase, SOD; catalase, CAT; peroxidase, POD). External citric acid alleviated the detrimental effects of heat stress on tall fescue, which was evidenced by decreased EL and MDA content, and improved plant growth under stress conditions. Additionally, the reduction in Chl content, Fv/Fm, SOD, POD, CAT and root activity were ameliorated in citric acid treated plants under heat stressed conditions. High temperature induced the expression of heat shock protein (HSP) genes, which exhibited greater expression levels after citric acid treatment under heat stress. These results suggest that exogenous citric acid application may alleviate growth and physiological damage caused by high temperature. In addition, the exogenously applied citric acid might be responsible for maintaining membrane stability, root activity, and activation of antioxidant response and HSP genes which could contribute to the protective roles of citric acid in tall fescue responses to heat stress. PMID:26925085

Identification and characterization of calcium transporter gene family in finger millet in relation to grain calcium content.

PubMed

Singh, Uma M; Metwal, Mamta; Singh, Manoj; Taj, Gohar; Kumar, Anil

2015-07-15

Calcium (Ca) is an essential mineral for proper growth and development of plants as well as animals. In plants including cereals, calcium is deposited in seed during its development which is mediated by specialized Ca transporters. Common cereal seeds contain very low amounts of Ca while the finger millet (Eleusine coracana) contains exceptionally high amounts of Ca in seed. In order to understand the role of Ca transporters in grain Ca accumulation, developing seed transcriptome of two finger millet genotypes (GP-1, low Ca and GP-45 high Ca) differing in seed Ca content was sequenced using Illumina paired-end sequencing technology and members of Ca transporter gene family were identified. Out of 109,218 and 120,130 contigs, 86 and 81 contigs encoding Ca transporters were identified in GP-1 and GP-45, respectively. After removal of redundant sequences, a total of 19 sequences were confirmed as Ca transporter genes, which includes 11 Ca(2+) ATPases, 07 Ca(2+)/cation exchangers and 01 Ca(2+) channel. The differential expressions of all genes were analyzed from transcriptome data and it was observed that 9 and 3 genes were highly expressed in GP-45 and GP-1 genotypes respectively. Validation of transcriptome expression data of selected Ca transporter genes was performed on different stages of developing spikes of both genotypes grown under different concentrations of exogenous Ca. In both genotypes, significant correlation was observed between the expression of these genes, especially EcCaX3, and on the amount of Ca accumulated in seed. The positive correlation of seed mass with the amount of Ca concentration was also observed. The efficient Ca transport property and responsiveness of EcCAX3 towards exogenous Ca could be utilized in future biofortification program. Copyright © 2015 Elsevier B.V. All rights reserved.

[Transformation of Chlamydomonas reinhardtii CW-15 with the hygromycin phosphotransferase gene as a selective marker].

PubMed

Ladygin, V G; Butanaev, A M

2002-09-01

To transform Chlamydomonas reinhardtii Dang. Cells, plasmid pCTVHyg was constructed with the use of the Escherichia coli hygromycin phosphotransferase gene (hpt) controlled by the SV40 early promoter. Cells of the CW-15 mutant strain were transformed by electroporation, with the yield reaching 10(3) hygromycin-resistant (HygR) clones per 10(6) recipient cells. The exogenous DNA integrated in the Ch. reinhardtii nuclear genome showed stable transmission for approximately 350 cell generations, while hygromycin resistance was expressed as an unstable character. Codon usage was compared for the hpt gene and Ch. reinhardtii nuclear genes. The results testified that codon usage bias, which is characteristic of Ch. reinhardtii, is not the major factor affecting foreign gene expression. The advantages of the selective system for studying Ch. reinhardtii transformation with heterologous genes are discussed.

Disruption of cell walls for enhanced lipid recovery

DOEpatents

Knoshaug, Eric P; Donohoe, Bryon S; Gerken, Henri; Laurens, Lieve; Van Wychen, Stefanie Rose

2015-03-24

Presented herein are methods of using cell wall degrading enzymes for recovery of internal lipid bodies from biomass sources such as algae. Also provided are algal cells that express at least one exogenous gene encoding a cell wall degrading enzyme and methods for recovering lipids from the cells.

The Activin A-Peroxisome Proliferator-Activated Receptor Gamma Axis Contributes to the Transcriptome of GM-CSF-Conditioned Human Macrophages.

PubMed

Nieto, Concha; Bragado, Rafael; Municio, Cristina; Sierra-Filardi, Elena; Alonso, Bárbara; Escribese, María M; Domínguez-Andrés, Jorge; Ardavín, Carlos; Castrillo, Antonio; Vega, Miguel A; Puig-Kröger, Amaya; Corbí, Angel L

2018-01-01

GM-CSF promotes the functional maturation of lung alveolar macrophages (A-MØ), whose differentiation is dependent on the peroxisome proliferator-activated receptor gamma (PPARγ) transcription factor. In fact, blockade of GM-CSF-initiated signaling or deletion of the PPARγ-encoding gene PPARG leads to functionally defective A-MØ and the onset of pulmonary alveolar proteinosis. In vitro , macrophages generated in the presence of GM-CSF display potent proinflammatory, immunogenic and tumor growth-limiting activities. Since GM-CSF upregulates PPARγ expression, we hypothesized that PPARγ might contribute to the gene signature and functional profile of human GM-CSF-conditioned macrophages. To verify this hypothesis, PPARγ expression and activity was assessed in human monocyte-derived macrophages generated in the presence of GM-CSF [proinflammatory GM-CSF-conditioned human monocyte-derived macrophages (GM-MØ)] or M-CSF (anti-inflammatory M-MØ), as well as in ex vivo isolated human A-MØ. GM-MØ showed higher PPARγ expression than M-MØ, and the expression of PPARγ in GM-MØ was found to largely depend on activin A. Ligand-induced activation of PPARγ also resulted in distinct transcriptional and functional outcomes in GM-MØ and M-MØ. Moreover, and in the absence of exogenous activating ligands, PPARγ knockdown significantly altered the GM-MØ transcriptome, causing a global upregulation of proinflammatory genes and significantly modulating the expression of genes involved in cell proliferation and migration. Similar effects were observed in ex vivo isolated human A-MØ, where PPARγ silencing led to enhanced expression of genes coding for growth factors and chemokines and downregulation of cell surface pathogen receptors. Therefore, PPARγ shapes the transcriptome of GM-CSF-dependent human macrophages ( in vitro derived GM-MØ and ex vivo isolated A-MØ) in the absence of exogenous activating ligands, and its expression is primarily regulated by activin A. These results suggest that activin A, through enhancement of PPARγ expression, help macrophages to switch from a proinflammatory to an anti-inflammatory polarization state, thus contributing to limit tissue damage and restore homeostasis.

Detection of Differentially Expressed Wound-Healing–Related Glycogenes in Galectin-3–Deficient Mice

PubMed Central

Saravanan, Chandrassegar; Cao, Zhiyi; Head, Steven R.; Panjwani, Noorjahan

2010-01-01

Purpose A prior study showed that exogenous galectin-3 (Gal-3) stimulates re-epithelialization of corneal wounds in wild-type (Gal-3+/+) mice but, surprisingly, not in galectin-3–deficient (Gal-3−/−) mice. In an effort to understand why the injured corneas of Gal-3−/− mice are unresponsive to exogenous Gal-3, the present study was designed to determine whether genes encoding the enzymes that regulate the synthesis of glycan ligands of Gal-3 are differentially expressed in Gal-3−/− corneas compared with the Gal-3+/+ corneas. Methods Glycogene microarray technology was used to identify differentially expressed glycosyltransferases in healing Gal-3+/+ and Gal-3−/− corneas. Results Of ~2000 glycogenes on the array, the expression of 8 was upregulated and that of 14 was downregulated more than 1.3-fold in healing Gal-3−/− corneas. A galactosyltransferase, β3GalT5, which has the ability to synthesize Gal-3 ligands was markedly downregulated in healing Gal-3−/− corneas. The genes for polypeptide galactosaminyltransferases (ppGalNAcT-3 and -7) that are known to initiate O-linked glycosylation and N-aspartyl-β-glucosaminidase, which participates in the removal of N-glycans, were found to be upregulated in healing Gal-3−/− corneas. Microarray data were validated by qRT-PCR. Conclusions Based on the known functions of the differentially expressed glycogenes, it appears that the glycan structures on glycoproteins and glycolipids, synthesized as a result of the differential glycogene expression pattern in healing Gal-3−/− corneas may lead to the downregulation of specific counterreceptors for Gal-3. This may explain, at least in part, why, unlike healing Gal-3+/+ corneas, the healing Gal-3−/− corneas are unresponsive to the stimulatory effect of exogenous Gal-3 on re-epithelialization of corneal wounds. PMID:19643959

Embryo-specific expression of a visual reporter gene as a selection system for citrus transformation

PubMed Central

Zambon, Flavia T.; Erpen, Lígia; Soriano, Leonardo; Grosser, Jude

2018-01-01

The embryo-specific Dc3 gene promoter driving the VvMybA1 anthocyanin regulatory gene was used to develop a visual selection system for the genetic transformation of citrus. Agrobacterium-mediated transformation of cell suspension cultures resulted in the production of purple transgenic somatic embryos that could be easily separated from the green non-transgenic embryos. The somatic embryos produced phenotypically normal plants devoid of any visual purple coloration. These results were also confirmed using protoplast transformation. There was minimal gene expression in unstressed one-year-old transgenic lines. Cold and drought stress did not have any effect on gene expression, while exogenous ABA and NaCl application resulted in a minor change in gene expression in several transgenic lines. When gas exchange was measured in intact leaves, the transgenic lines were similar to controls under the same environment. Our results provide conclusive evidence for the utilization of a plant-derived, embryo-specific visual reporter system for the genetic transformation of citrus. Such a system could aid in the development of an all-plant, consumer-friendly GM citrus tree. PMID:29293649

Vanillylacetone up-regulates anthocyanin accumulation and expression of anthocyanin biosynthetic genes by inducing endogenous abscisic acid in grapevine tissues.

PubMed

Enoki, Shinichi; Hattori, Tomoki; Ishiai, Shiho; Tanaka, Sayumi; Mikami, Masachika; Arita, Kayo; Nagasaka, Shu; Suzuki, Shunji

2017-12-01

We investigated the effect of vanillylacetone (VA) on anthocyanin accumulation with aim of improving grape berry coloration. Spraying Vitis vinifera cv. Muscat Bailey A berries with VA at veraison increased sugar/acid ratio, an indicator of maturation and total anthocyanin accumulation. To elucidate the molecular mechanism underlying the effect of VA on anthocyanin accumulation, in vitro VA treatment of a grapevine cell culture was carried out. Endogenous abscisic acid (ABA) content was higher in the VA-treated cell cultures than in control at 3h after treatment. Consistent with this, the relative expression levels of anthocyanin-synthesis-related genes, including DFR, LDOX, MybA1 and UFGT, in VA-treated cell cultures were much higher than those in control, and high total anthocyanin accumulation was noted in the VA-treated cell cultures as well. These results suggest that VA up-regulates the expression of genes leading to anthocyanin accumulation by inducing endogenous ABA. In addition, VA increased total anthocyanin content in a dose-dependent manner. Although VA treatment in combination with exogenous ABA did not exhibit any synergistic effect, treatment with VA alone showed an equivalent effect to that with exogenous ABA alone on total anthocyanin accumulation. These findings point to the possibility of using VA for improving grape berry coloration. Copyright © 2017 Elsevier GmbH. All rights reserved.

Knockout of exogenous EGFP gene in porcine somatic cells using zinc-finger nucleases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Masahito; Department of Life Sciences, School of Agriculture, Meiji University, 1-1-1 Higashimita, Tama-ku, Kawasaki, Kanagawa 214-8571; Umeyama, Kazuhiro

2010-11-05

Research highlights: {yields} EGFP gene integrated in porcine somatic cells could be knocked out using the ZFN-KO system. {yields} ZFNs induced targeted mutations in porcine primary cultured cells. {yields} Complete absence of EGFP fluorescence was confirmed in ZFN-treated cells. -- Abstract: Zinc-finger nucleases (ZFNs) are expected as a powerful tool for generating gene knockouts in laboratory and domestic animals. Currently, it is unclear whether this technology can be utilized for knocking-out genes in pigs. Here, we investigated whether knockout (KO) events in which ZFNs recognize and cleave a target sequence occur in porcine primary cultured somatic cells that harbor themore » exogenous enhanced green fluorescent protein (EGFP) gene. ZFN-encoding mRNA designed to target the EGFP gene was introduced by electroporation into the cell. Using the Surveyor nuclease assay and flow cytometric analysis, we confirmed ZFN-induced cleavage of the target sequence and the disappearance of EGFP fluorescence expression in ZFN-treated cells. In addition, sequence analysis revealed that ZFN-induced mutations such as base substitution, deletion, or insertion were generated in the ZFN cleavage site of EGFP-expression negative cells that were cloned from ZFN-treated cells, thereby showing it was possible to disrupt (i.e., knock out) the function of the EGFP gene in porcine somatic cells. To our knowledge, this study provides the first evidence that the ZFN-KO system can be applied to pigs. These findings may open a new avenue to the creation of gene KO pigs using ZFN-treated cells and somatic cell nuclear transfer.« less

Abscisic Acid-Dependent and -Independent Expression of the Carrot Late-Embryogenesis-Abundant-Class Gene Dc3 in Transgenic Tobacco Seedlings1

PubMed Central

Siddiqui, Najeeb U.; Chung, Hwa-Jee; Thomas, Terry L.; Drew, Malcolm C.

1998-01-01

We studied the expression of three promoter 5′ deletion constructs (−218, −599, and −1312) of the LEA (late embryogenesis abundant)-class gene Dc3 fused to β-glucuronidase (GUS), where each construct value refers to the number of base pairs upstream of the transcription start site at which the deletion occurred. The Dc3 gene is noted for its induction by abscisic acid (ABA), but its response to other plant hormones and various environmental stresses has not been reported previously for vegetative cells. Fourteen-day-old transgenic tobacco (Nicotiana tabacum L.) seedlings were exposed to dehydration, hypoxia, salinity, exogenous ethylene, or exogenous methyl jasmonate (MeJa). GUS activity was quantified fluorimetrically and expression was observed by histochemical staining of the seedlings. An increase in GUS activity was observed in plants with constructs −599 and −1312 in response to dehydration and salinity within 6 h of stress, and at 12 h in response to hypoxia. No increase in endogenous ABA was found in any of the three lines, even after 72 h of hypoxia. An ABA-independent increase in GUS activity was observed when endogenous ABA biosynthesis was blocked by fluridone and plants were exposed to 5 μL L−1 ethylene in air or 100 μm MeJa. Virtually no expression was observed in construct −218 in response to dehydration, salinity, or MeJa, but there was a moderate response to ethylene and hypoxia. This suggests that the region between −218 and −599 is necessary for ABA (dehydration and salinity)- and MeJa-dependent expression, whereas ethylene-mediated expression does not require this region of the promoter. PMID:9847092

Manipulation of gene expression by infrared laser heat shock and its application to the study of tracheal development in Drosophila.

PubMed

Miao, Guangxia; Hayashi, Shigeo

2015-03-01

Induction of gene expression in a specific cell and a defined time window is desirable to investigate gene function at the cellular level during morphogenesis. To achieve this, we attempted to introduce the infrared laser-evoked gene operator system (IR-LEGO, Kamei et al., 2009) in the Drosophila embryo. In this technique, infrared laser light illumination induces genes to be expressed under the control of heat shock promoters at the single cell level. We applied IR-LEGO to a transgenic fly stock, HS-eGFP, in which the enhanced green fluorescent protein (eGFP) gene is placed under the control of heat shock protein 70 promoter, and showed that eGFP expression can be induced in single cells within 1-2 hr after IR illumination. Furthermore, induction of HS-Branchless transgene encoding the Drosophila fibroblast growth factor (FGF) effectively altered the migration and branching patterns of the tracheal system. Our results indicated that IR-LEGO is a promising choice for the timely control of gene expression in a small group of cells in the Drosophila embryo. By using IR-LEGO, we further demonstrated that the tracheal terminal branching program is sensitive to localized expression of exogenous FGF. © 2014 Wiley Periodicals, Inc.

Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering.

PubMed

Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

2016-01-01

Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.

Molecular Cloning and Characterization of Four Genes Encoding Ethylene Receptors Associated with Pineapple (Ananas comosus L.) Flowering

PubMed Central

Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming

2016-01-01

Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5′ flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1–9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1–4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon. PMID:27252725

Effect of exogenous transforming growth factor β1 (TGF-β1) on early bovine embryo development.

PubMed

Barrera, Antonio D; García, Elina V; Miceli, Dora C

2018-06-08

SummaryDuring preimplantation development, embryos are exposed and have the capacity to respond to different growth factors present in the maternal environment. Among these factors, transforming growth factor β1 (TGF-β1) is a well known modulator of embryonic growth and development. However, its action during the first stages of development, when the embryo transits through the oviduct, has not been yet elucidated. The objective of the present study was to examine the effect of early exposure to exogenous TGF-β1 on embryo development and expression of pluripotency (OCT4, NANOG) and DNA methylation (DNMT1, DNMT3A, DNMT3B) genes in bovine embryos produced in vitro. First, gene expression analysis of TGF-β receptors confirmed a stage-specific expression pattern, showing greater mRNA abundance of TGFBR1 and TGFBR2 from the 2- to the 8-cell stage, before embryonic genome activation. Second, embryo culture for the first 48 h in serum-free CR1aa medium supplemented with 50 or 100 ng/ml recombinant TGF-β1 did not affect the cleavage and blastocyst rate (days 7 and 8). However, RT-qPCR analysis showed a significant increase in the relative abundance of NANOG and DNMT3A in the 8-cell stage embryos and expanded blastocysts (day 8) derived from TGF-β1 treated embryos. These results suggest an early action of exogenous TGF-β1 on the bovine embryo, highlighting the importance to provide a more comprehensive understanding of the role of TGF-β signalling during early embryogenesis.

Thermal Assisted In Vivo Gene Electrotransfer

PubMed Central

Donate, Amy; Bulysheva, Anna; Edelblute, Chelsea; Jung, Derrick; Malik, Mohammad A.; Guo, Siqi; Burcus, Niculina; Schoenbach, Karl; Heller, Richard

2016-01-01

Gene electrotransfer is an effective approach for delivering plasmid DNA to a variety of tissues. Delivery of molecules with electric pulses requires control of the electrical parameters to achieve effective delivery. Since discomfort or tissue damage may occur with high applied voltage, the reduction of the applied voltage while achieving the desired expression may be an important improvement. One possible approach is to combine electrotransfer with exogenously applied heat. Previous work performed in vitro demonstrated that increasing temperature before pulsing can enhance gene expres sion and made it possible to reduce electric fields while maintaining expression levels. In the study reported here, this combination was evaluated in vivo using a novel electrode device designed with an inserted laser for application of heat. The results obtained in this study demonstrated that increased temperature during electrotransfer increased expression or maintained expression with a reduction in applied voltage. With further optimization this approach may provide the basis for both a novel method and a novel instrument that may greatly enhance translation of gene electrotransfer. PMID:27029944

Expression of foreign genes in filamentous cyanobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuritz, T.; Wolk, C.P.

1993-06-01

Several advantages make cyanobacteria attractive hosts for biodegradative genes and possibly for other exogenous genes that have practical uses. The authors have obtained expression in Anabaena sp. strain PCC 7120 and Nostoc ellipsosporum of a dechlorination operon, fcbAB, from Arthrobacter globiformis, and have also developed a simple method for qualitative assessment of dechlorination by microorganisms, such as cyanobacteria, whose metabolism is dependent on the presence of chloride in the medium. Transcription of fcbAB under the control of a variety of promoters was monitored by placing luxAB (encoding luciferase) downstream from fcbAB, and by measuring light emission from luciferase. They believemore » that the system that they have described has value as a means to screen for factors influencing transcription of foreign genes in cyanobacteria.« less

Effects of TGF-β1 and VEGF-A transgenes on the osteogenic potential of bone marrow stromal cells in vitro and in vivo

PubMed Central

Sumner, Dale R; Virdi, Amarjit S

2012-01-01

An exogenous supply of growth factors and bioreplaceable scaffolds may help bone regeneration. The aim of this study was to examine the effects of TGF-β1 and VEGF-A transgenes on the osteogenic potential of bone marrow stromal cells. Rat bone marrow stromal cells were transfected with plasmids encoding mouse TGF-β1 and/or VEGF-A complementary DNAs and cultured for up to 28 days. Furthermore, collagen scaffolds carrying combinations of the plasmids-transfected cells were implanted subcutaneously in rats. The transgenes increased alkaline phosphatase activity, enhanced mineralized nodule formation, and elevated osteogenic gene expressions in vitro. In vivo, messenger RNA expression of osteogenic genes such as BMPs and Runx2 elevated higher by the transgenes. The data indicate that exogenous TGF-β1 and VEGF-A acted synergistically and could induce osteoblastic differentiation of bone marrow stromal cells in both cell culture and an animal model. The results may provide valuable information to optimize protocols for transgene-and-cell-based tissue engineering. PMID:22962632

Part I. Embryonic surgery using femtosecond laser pulses for the delivery of exogenous materials and the analysis of gene expression

NASA Astrophysics Data System (ADS)

Kohli, V.; Elezzabi, A. Y.

2008-02-01

Herein, we demonstrate the application of high-intensity femtosecond (fs) laser pulses for performing laser surgery on the embryonic cells of developing zebrafish (Danio rerio). When fs laser pulses were focused onto individual blastomeres, transient pores were formed exposing the extracellular space to the intracellular environment. Utilizing the transient pores as a pathway for delivery of exogenous material, both chorionated and dechorionated zebrafish embryos were successfully loaded with a fluorescent reporter molecule (fluorescein isothiocyanate (FITC)). Streptavidin-conjugated quantum dots or plasmid DNA (Simian-CMV-EGFP). Both FITC and quantum dots were found to disperse throughout the blastomere cells as the embryo developed. Gene expression was seen in 24 hour post-fertilized embryos, with fluorescence observed in the notochord, floor plates, somites and tails of the larvae. We also determined the survivability of laser-manipulated embryos by rearing zebrafish from early to mid cleavage stage (2-cell to 8/16-cell) to pec-fin stage. Survival rates of 89 and 100 % were found for dechorionated and chorionated embryos, respectively.

Effect of exogenous ATP on the postharvest properties and pectin degradation of mung bean sprouts (Vigna radiata).

PubMed

Chen, Lin; Zhou, Yige; He, Zhenyun; Liu, Qin; Lai, Shaojuan; Yang, Hongshun

2018-06-15

The effects of exogenous ATP on the postharvest quality, browning and softening of mung bean (Vigna radiata) sprouts were evaluated. ATP treatment significantly alleviated the quality loss and browning events during the storage of 3 days. It also reduced the oxidant damage by inducing high activities of peroxidase (9.3-13.9%) and superoxide dismutase (8.8-10.3%) which scavenged the reactive oxygen species (ROS) effectively. Transcriptional results indicated that ATP treatment decreased VrPL1, VrPME and VrPG1 gene expression levels more than 2 folds at some time points. Furthermore, the atomic force microscope (AFM) images revealed that the pectin degradation was notably slowed by ATP treatment and the width and height of pectin backbone were better maintained (47.1% and 45.6% higher than control without ATP treatment). The cooperative effects of ROS scavenging and decreased expressions of pectin-related genes might contribute to the deferred pectin deterioration and firmness loss by ATP treatment. Copyright © 2018 Elsevier Ltd. All rights reserved.

Gene Expression Architecture of Mouse Dorsal and Tail Skin Reveals Functional Differences in Inflammation and Cancer.

PubMed

Quigley, David A; Kandyba, Eve; Huang, Phillips; Halliwill, Kyle D; Sjölund, Jonas; Pelorosso, Facundo; Wong, Christine E; Hirst, Gillian L; Wu, Di; Delrosario, Reyno; Kumar, Atul; Balmain, Allan

2016-07-26

Inherited germline polymorphisms can cause gene expression levels in normal tissues to differ substantially between individuals. We present an analysis of the genetic architecture of normal adult skin from 470 genetically unique mice, demonstrating the effect of germline variants, skin tissue location, and perturbation by exogenous inflammation or tumorigenesis on gene signaling pathways. Gene networks related to specific cell types and signaling pathways, including sonic hedgehog (Shh), Wnt, Lgr family stem cell markers, and keratins, differed at these tissue sites, suggesting mechanisms for the differential susceptibility of dorsal and tail skin to development of skin diseases and tumorigenesis. The Pten tumor suppressor gene network is rewired in premalignant tumors compared to normal tissue, but this response to perturbation is lost during malignant progression. We present a software package for expression quantitative trait loci (eQTL) network analysis and demonstrate how network analysis of whole tissues provides insights into interactions between cell compartments and signaling molecules. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Analysis of expression of the argC and argD genes in the cyanobacterium Anabaena sp. strain PCC 7120.

PubMed Central

Floriano, B; Herrero, A; Flores, E

1994-01-01

A cloned DNA fragment from Anabaena sp. strain PCC 7120 that complements an arginine auxotrophic mutant from the same organism was found to include an open reading frame encoding a 427-residue polypeptide that is homologous to N-acetylornithine aminotransferase from Bacillus subtilis, Escherichia coli, and Saccharomyces cerevisiae. The gene encoding N-acetylornithine aminotransferase in bacteria has been named argD. The expression of Anabaena sp. strain PCC 7120 argD, as well as of argC, was analyzed at the mRNA level. Both genes were transcribed as monocistronic mRNAs, and their expression was not affected by exogenously added arginine. Primer extension analysis identified transcription start points for both genes which were preceded by sequences similar to that of the E. coli RNA polymerase sigma 70 consensus promoter. A second transcription start point for the argD gene that is not preceded by a sigma 70 consensus promoter was detected in dinitrogen-grown cultures. Images PMID:7929012

Molecular phylogenomic study and the role of exogenous spermidine in the metabolic adjustment of endogenous polyamine in two rice cultivars under salt stress.

PubMed

Saha, Jayita; Giri, Kalyan

2017-04-20

Compelling evidences anticipated the well acclamation of involvement of exogenous and endogenous polyamines (PAs) in conferring salt tolerance in plants. Intracellular PA's anabolism and catabolism should have contributed to maintain endogenous PAs homeostasis to induce stress signal networks. In this report, the evolutionary study has been conducted to reveal the phylogenetic relationship of genes encoding enzymes of the anabolic and catabolic pathway of PAs among the five plant lineages including green algae, moss, lycophyte, dicot and monocot along with their respective exon-intron structural patterns. Our results indicated that natural selection pressure had considerable influence on the ancestral PA metabolic pathway coding genes of land plants. PA metabolic genes have undergone gradual evolution by duplication and diversification process leading to subsequent structural modification through exon-intron gain and loss events to acquire specific function under environmental stress conditions. We have illuminated on the potential regulation of both the pathways by investigating the real-time expression analyses of PA metabolic pathway related enzyme coding genes at the transcriptional level in root and shoot tissues of two indica rice varieties, namely IR 36 (salt sensitive) and Nonabokra (salt-tolerant) in response to salinity in presence or absence of exogenous spermidine (Spd) treatment. Additionally, we have performed tissue specific quantification of the intracellular PAs and tried to draw probable connection between the PA metabolic pathway activation and endogenous PAs accumulation. Our results successfully enlighten the fact that how exogenous Spd in presence or absence of salt stress adjust the intracellular PA pathways to equilibrate the cellular PAs that would have been attributed to plant salt tolerance. Copyright © 2017 Elsevier B.V. All rights reserved.

Involvement of a banana MADS-box transcription factor gene in ethylene-induced fruit ripening.

PubMed

Liu, Juhua; Xu, Biyu; Hu, Lifang; Li, Meiying; Su, Wei; Wu, Jing; Yang, Jinghao; Jin, Zhiqiang

2009-01-01

To investigate the regulation of MADS-box genes in banana (Musa acuminata L. AAA group cv. Brazilian) fruit development and postharvest ripening, we isolated from banana fruit a MADS-box gene designated MuMADS1. Amino acid alignment indicated MuMADS1 belongs to the AGAMOUS subfamily, and phylogenetic analysis indicates that this gene is most similar to class D MADS-box genes. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis showed that MuMADS1 is expressed in the stamen and pistil of male and female flowers and in the rhizome, the vegetative reproductive organ of the banana plant. In preharvest banana fruit, MuMADS1 is likely expressed throughout banana fruit development. In postharvest banana ripening, MuMADS1 is associated with ethylene biosynthesis. Expression patterns of MuMADS1 during postharvest ripening as determined by real-time RT-PCR suggest that differential expression of MuMADS1 may not only be induced by ethylene biosynthesis associated with postharvest banana ripening, but also may be induced by exogenous ethylene.

A sensitive synthetic reporter for visualizing cytokinin signaling output in rice.

PubMed

Tao, Jinyuan; Sun, Huwei; Gu, Pengyuan; Liang, Zhihao; Chen, Xinni; Lou, Jiajing; Xu, Guohua; Zhang, Yali

2017-01-01

Cytokinins play many essential roles in plant growth and development, mainly through signal transduction pathways. Although the cytokinin signaling pathway in rice has been clarified, no synthetic reporter for cytokinin signaling output has been reported for rice. The sensitive synthetic reporter two-component signaling sensor ( TCSn ) is used in the model plant Arabidopsis; however, whether the reporter reflects the cytokinin signaling output pattern in rice remains unclear. Early-cytokinin-responsive type-A OsRR-binding element (A/G)GAT(C/T) was more clustered in the 15 type-A OsRRs than in the 13 control genes. Quantitative polymerase chain reaction analysis showed that the relative expression of seven type-A OsRRs in roots and shoots was significantly induced by exogenous cytokinin application, and that of seven OsRRs , mainly in roots, was inhibited by exogenous auxin application. We constructed a transgenic rice plant harboring a beta-glucuronidase (GUS) driven by the synthetic promoter TCSn . TCSn::GUS was expressed in the meristem of germinated rice seed and rice seedlings. Furthermore, TCSn::GUS expression in rice seedlings was induced specifically by exogenous cytokinin application and decreased by exogenous auxin application. Moreover, no obvious reduction in GUS levels was observed after three generations of selfing of transgenic plants, indicating that TCSn::GUS is not subject to transgene silencing. We report here a robust and sensitive synthetic sensor for monitoring the transcriptional output of the cytokinin signaling network in rice.

Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

PubMed

Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika

2013-01-01

Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

GA-DELLA pathway is involved in regulation of nitrogen deficiency-induced anthocyanin accumulation.

PubMed

Zhang, Yongqiang; Liu, Zhongjuan; Liu, Jianping; Lin, Sheng; Wang, Jianfeng; Lin, Wenxiong; Xu, Weifeng

2017-04-01

DELLA proteins positively regulate nitrogen deficiency-induced anthocyanin accumulation through directly interaction with PAP1 to enhance its transcriptional activity on anthocyanin biosynthetic gene expressions. Plants can survive a limiting nitrogen supply by undergoing adaptive responses, including induction of anthocyanin production. However, the detailed mechanism is still unclear. In this study, we found that this process was impaired and enhanced, respectively, by exogenous GA 3 (an active form of GAs) and paclobutrazol (PAC, a specific GA biosynthesis inhibitor) in Arabidopsis seedlings. Consistently, the nitrogen deficiency-induced transcript levels of several key genes involved in anthocyanin biosynthesis, including F3'H, DFR, LDOX, and UF3GT, were decreased and enhanced by exogenous GA 3 and PAC, respectively. Moreover, the nitrogen deficiency-induced anthocyanin accumulation and biosynthesis gene expressions were impaired in the loss-of-function mutant gai-t6/rga-t2/rgl1-1/rgl2-1/rgl3-1 (della) but enhanced in the GA-insensitive mutant gai, suggesting that DELLA proteins, known as repressors of GA signaling, are necessary for fully induction of nitrogen deficiency-driven anthocyanin biosynthesis. Using yeast two-hybrid (Y2H) assay, pull-down assay, and luciferase complementation assay, it was found that RGA, a DELLA of Arabidopsis, could strongly interact with PAP1, a known regulatory transcription factor positively involved in anthocyanin biosynthesis. Furthermore, transient expression assays indicated that RGA and GAI could enhance the transcriptional activities of PAP1 on its downstream genes, including F3'H and DFR. Taken together, this study suggests that DELLAs are necessary regulators for nitrogen deficiency-induced anthocyanin accumulation through interaction with PAP1 and enhancement of PAP1's transcriptional activity on its target genes. GA-DELLA-involved anthocyanin accumulation is important for plant adaptation to nitrogen deficiency.

GCN5 regulates the activation of PI3K/Akt survival pathway in B cells exposed to oxidative stress via controlling gene expressions of Syk and Btk.

PubMed

Kikuchi, Hidehiko; Kuribayashi, Futoshi; Takami, Yasunari; Imajoh-Ohmi, Shinobu; Nakayama, Tatsuo

2011-02-25

Histone acetyltransferase(s) (HATs) are involved in the acetylation of core histones, which is an important event for transcription regulation through alterations in the chromatin structure in eukaryotes. General control non-depressible 5 (GCN5) was first identified as a global coactivator and transcription-related HAT. Here we report that GCN5 regulates the activation of phosphatidylinositol 3-kinase (PI3K)/acutely transforming retrovirus AKT8 in rodent T cell lymphoma (Akt) survival pathway in B cells exposed to oxidative stress via controlling gene expressions of spleen tyrosine kinase (Syk) and Bruton's tyrosine kinase (Btk). The GCN5-deficiency remarkably caused apoptotic cell death by treatment with exogenous hydrogen peroxide (H(2)O(2)) in chicken DT40 cells. In GCN5-deficient DT40 cells, gene expressions of Syk and Btk, which are involved in activation of PI3K/Akt survival pathway in DT40 cells exposed to exogenous H(2)O(2), were remarkably decreased compared with those in wild type DT40 cells. In addition, phosphorylation of Akt in H(2)O(2)-treated GCN5-deficient cells was remarkably suppressed as compared to that of DT40. Chromatin immunoprecipitation assay revealed that GCN5 binds to proximal 5'-upstream regions of Syk and Btk genes in vivo. These results suggest that GCN5 takes part in transcriptional regulations of the Syk and Btk genes, and plays a key role in epigenetic regulation of PI3K/Akt survival pathway in B cells exposed to reactive oxygen species such as H(2)O(2). Copyright © 2011 Elsevier Inc. All rights reserved.

Identification of microRNAs associated with the exogenous spermidine-mediated improvement of high-temperature tolerance in cucumber seedlings (Cucumis sativus L.).

PubMed

Wang, Ying; Guo, Shirong; Wang, Lei; Wang, Liwei; He, Xueying; Shu, Sheng; Sun, Jin; Lu, Na

2018-04-24

High-temperature stress inhibited the growth of cucumber seedlings. Foliar spraying of 1.0 mmol·L - 1 exogenous spermidine (Spd) to the sensitive cucumber cultivar 'Jinchun No. 2' grown at high-temperature (42 °C/32 °C) in an artificial climate box improved the high-temperature tolerance. Although there have been many reports on the response of microRNAs (miRNAs) to high-temperature stress, the mechanism by which exogenous Spd may mitigate the damage of high-temperature stress through miRNA-mediated regulation has not been studied. To elucidate the regulation of miRNAs in response to exogenous Spd-mediated improvement of high-temperature tolerance, four small RNA libraries were constructed from cucumber leaves and sequenced: untreated-control (CW), Spd-treated (CS), high-temperature stress (HW), and Spd-treated and high-temperature stress (HS). As a result, 107 known miRNAs and 79 novel miRNAs were identified. Eight common differentially expressed miRNAs (miR156d-3p, miR170-5p, miR2275-5p, miR394a, miR479b, miR5077, miR5222 and miR6475) were observed in CS/CW, HW/CW, HS/CW and HS/HW comparison pairs, which were the first set of miRNAs that responded to not only high-temperature stress but also exogenous Spd in cucumber seedlings. Five of the eight miRNAs were predicted to target 107 potential genes. Gene function and pathway analyses highlighted the integral role that these miRNAs and target genes probably play in the improvement of the high-temperature tolerance of cucumber seedlings through exogenous Spd application. Our study identified the first set of miRNAs associated with the exogenous Spd-mediated improvement of high-temperature tolerance in cucumber seedlings. The results could help to promote further studies on the complex molecular mechanisms underlying high-temperature tolerance in cucumber and provide a theoretical basis for the high-quality and efficient cultivation of cucumber with high-temperature resistance.

Generation of Knock-in Mouse by Genome Editing.

PubMed

Fujii, Wataru

2017-01-01

Knock-in mice are useful for evaluating endogenous gene expressions and functions in vivo. Instead of the conventional gene-targeting method using embryonic stem cells, an exogenous DNA sequence can be inserted into the target locus in the zygote using genome editing technology. In this chapter, I describe the generation of epitope-tagged mice using engineered endonuclease and single-stranded oligodeoxynucleotide through the mouse zygote as an example of how to generate a knock-in mouse by genome editing.

Improving Microbial Biogasoline Production in Escherichia coli Using Tolerance Engineering

PubMed Central

Foo, Jee Loon; Jensen, Heather M.; Dahl, Robert H.; George, Kevin; Keasling, Jay D.; Lee, Taek Soon; Leong, Susanna

2014-01-01

ABSTRACT Engineering microbial hosts for the production of fungible fuels requires mitigation of limitations posed on the production capacity. One such limitation arises from the inherent toxicity of solvent-like biofuel compounds to production strains, such as Escherichia coli. Here we show the importance of host engineering for the production of short-chain alcohols by studying the overexpression of genes upregulated in response to exogenous isopentenol. Using systems biology data, we selected 40 genes that were upregulated following isopentenol exposure and subsequently overexpressed them in E. coli. Overexpression of several of these candidates improved tolerance to exogenously added isopentenol. Genes conferring isopentenol tolerance phenotypes belonged to diverse functional groups, such as oxidative stress response (soxS, fpr, and nrdH), general stress response (metR, yqhD, and gidB), heat shock-related response (ibpA), and transport (mdlB). To determine if these genes could also improve isopentenol production, we coexpressed the tolerance-enhancing genes individually with an isopentenol production pathway. Our data show that expression of 6 of the 8 candidates improved the production of isopentenol in E. coli, with the methionine biosynthesis regulator MetR improving the titer for isopentenol production by 55%. Additionally, expression of MdlB, an ABC transporter, facilitated a 12% improvement in isopentenol production. To our knowledge, MdlB is the first example of a transporter that can be used to improve production of a short-chain alcohol and provides a valuable new avenue for host engineering in biogasoline production. PMID:25370492

The c-Myb target gene neuromedin U functions as a novel cofactor during the early stages of erythropoiesis

PubMed Central

Gambone, Julia E.; Dusaban, Stephanie S.; Loperena, Roxana; Nakata, Yuji

2011-01-01

The requirement of c-Myb during erythropoiesis spurred an interest in identifying c-Myb target genes that are important for erythroid development. Here, we determined that the neuropeptide neuromedin U (NmU) is a c-Myb target gene. Silencing NmU, c-myb, or NmU's cognate receptor NMUR1 expression in human CD34+ cells impaired burst-forming unit-erythroid (BFU-E) and colony-forming unit-erythroid (CFU-E) formation compared with control. Exogenous addition of NmU peptide to NmU or c-myb siRNA-treated CD34+ cells rescued BFU-E and yielded a greater number of CFU-E than observed with control. No rescue of BFU-E and CFU-E growth was observed when NmU peptide was exogenously added to NMUR1 siRNA-treated cells compared with NMUR1 siRNA-treated cells cultured without NmU peptide. In K562 and CD34+ cells, NmU activated protein kinase C-βII, a factor associated with hematopoietic differentiation-proliferation. CD34+ cells cultured under erythroid-inducing conditions, with NmU peptide and erythropoietin added at day 6, revealed an increase in endogenous NmU and c-myb gene expression at day 8 and a 16% expansion of early erythroblasts at day 10 compared to cultures without NmU peptide. Combined, these data strongly support that the c-Myb target gene NmU functions as a novel cofactor for erythropoiesis and expands early erythroblasts. PMID:21378276

Isoprene production by Escherichia coli through the exogenous mevalonate pathway with reduced formation of fermentation byproducts.

PubMed

Kim, Jung-Hun; Wang, Chonglong; Jang, Hui-Jung; Cha, Myeong-Seok; Park, Ju-Eon; Jo, Seon-Yeong; Choi, Eui-Sung; Kim, Seon-Won

2016-12-23

Isoprene, a volatile C5 hydrocarbon, is an important platform chemical used in the manufacturing of synthetic rubber for tires and various other applications, such as elastomers and adhesives. In this study, Escherichia coli MG1655 harboring Populus trichocarpa isoprene synthase (PtispS) and the exogenous mevalonate (MVA) pathway produced 80 mg/L isoprene. Codon optimization and optimal expression of the ispS gene via adjustment of the RBS strength and inducer concentration increased isoprene production to 199 and 337 mg/L, respectively. To augment expression of MVA pathway genes, the MVA pathway was cloned on a high-copy plasmid (pBR322 origin) with a strong promoter (P trc ), which resulted in an additional increase in isoprene production up to 956 mg/L. To reduce the formation of byproducts derived from acetyl-CoA (an initial substrate of the MVA pathway), nine relevant genes were deleted to generate the E. coli AceCo strain (E. coli MG1655 ΔackA-pta, poxB, ldhA, dld, adhE, pps, and atoDA). The AceCo strain harboring the ispS gene and MVA pathway showed enhanced isoprene production of 1832 mg/L in flask culture with reduced accumulation of byproducts. We achieved a 23-fold increase in isoprene production by codon optimization of PtispS, augmentation of the MVA pathway, and deletion of genes involved in byproduct formation.

Alteration of Transcripts of Stress-Protective Genes and Transcriptional Factors by γ-Aminobutyric Acid (GABA) Associated with Improved Heat and Drought Tolerance in Creeping Bentgrass (Agrostis stolonifera).

PubMed

Li, Zhou; Peng, Yan; Huang, Bingru

2018-05-31

Gamma-aminobutyric acid (GABA) may play a positive role in regulating plant tolerance to drought or heat stress. The objectives of this study were to investigate the physiological effects of GABA on tolerance of creeping bentgrass ( Agrostis stolonifera ) to heat and drought stress and to determine whether enhanced heat and drought tolerance due to GABA treatment was associated with the up-regulation of selected genes and transcriptional factors involved in stress protection. Creeping bentgrass (cultivar "Penncross") plants were treated with 0.5 mM GABA or water (untreated control) as a foliar spray and were subsequently exposed to heat stress (35/30 °C, day/night), drought stress by withholding irrigation, or non-stress conditions in controlled-environment growth chambers. Exogenous application of GABA significantly improved plant tolerance to heat and drought stress, as reflected by increased leaf water content, cell membrane stability, and chlorophyll content. The analysis of gene transcript level revealed that exogenous GABA up-regulated the expression of ABF3 , POD , APX , HSP90 , DHN3 , and MT1 during heat stress and the expression of CDPK26 , MAPK1 , ABF3 , WRKY75 , MYB13 , HSP70 , MT1 , 14-3-3 , and genes ( SOD , CAT , POD , APX , MDHAR , DHAR , and GR ) encoding antioxidant enzymes during drought stress. The up-regulation of the aforementioned stress-protective genes and transcriptional factors could contribute to improved heat and drought tolerance in creeping bentgrass.

Elevated expression of the metabolic regulator receptor-interacting protein 140 results in cardiac hypertrophy and impaired cardiac function.

PubMed

Fritah, Asmaà; Steel, Jennifer H; Nichol, Donna; Parker, Nadeene; Williams, Sharron; Price, Anthony; Strauss, Leena; Ryder, Timothy A; Mobberley, Margaret A; Poutanen, Matti; Parker, Malcolm; White, Roger

2010-06-01

Receptor-interacting protein 140 (RIP140) is a ligand-dependent cofactor for nuclear receptors that regulate networks of genes involved in cellular processes, including metabolism. An important role for RIP140 in metabolic control has been identified in RIP140 null mice, whose phenotypes include derepression of genes involved in energy mobilization or catabolism in adipocytes and a switch to more oxidative fibres in skeletal muscle. We hypothesized that ubiquitous expression of RIP140 would suppress metabolic processes, leading to defects in development or cellular function. The primary effect of exogenous expression of RIP140 mRNA (real-time PCR) and protein (western blotting) in transgenic mice is impaired postnatal heart function. There was rapid onset of cardiac hypertrophy and ventricular fibrosis, detected microscopically, in male RIP140 transgenic mice from 4 weeks of age, resulting in 25% mortality by 5 months. RIP140 exogenous expression in the heart leads to decreased mitochondria state III and state IV membrane potential and oxygen consumption. Quantitative PCR showed more than 50% reduced expression of genes involved in mitochondrial activity and fatty acid metabolism, including mitochondrial transcription factor A, cytochrome oxidase VIIa, cytochrome XII, CD36, medium-chain acyl dehydrogenase, and fatty acid transport protein, many of which are known targets for nuclear receptors, including peroxisome proliferator-activated receptors PPARalpha and PPARdelta and oestrogen-related receptors ERRalpha and ERRgamma. This study demonstrates that RIP140 is an important cofactor in postnatal cardiac function and that inhibition of the action of RIP140 may provide a model system to investigate specific interventions designed to prevent or delay the onset of cardiac disease.

A site-specific genetic modification for induction of pluripotency and subsequent isolation of derived lung alveolar epithelial type II cells.

PubMed

Yan, Qing; Quan, Yuan; Sun, Huanhuan; Peng, Xinmiao; Zou, Zhengyun; Alcorn, Joseph L; Wetsel, Rick A; Wang, Dachun

2014-02-01

Human induced pluripotent stem cells (hiPSCs) have great therapeutic potential in repairing defective lung alveoli. However, genetic abnormalities caused by vector integrations and low efficiency in generating hiPSCs, as well as difficulty in obtaining transplantable hiPSC-derived cell types are still major obstacles. Here we report a novel strategy using a single nonviral site-specific targeting vector with a combination of Tet-On inducible gene expression system, Cre/lox P switching gene expression system, and alveolar epithelial type II cell (ATIIC)-specific Neomycin(R) transgene expression system. With this strategy, a single copy of all of the required transgenes can be specifically knocked into a site immediately downstream of β-2-microglobulin (B2M) gene locus at a high frequency, without causing B2M dysfunction. Thus, the expression of reprogramming factors, Oct4, Sox2, cMyc, and Klf4, can be precisely regulated for efficient reprogramming of somatic cells into random integration-free or genetic mutation-free hiPSCs. The exogenous reprogramming factor transgenes can be subsequently removed after reprogramming by transient expression of Cre recombinase, and the resulting random integration-free and exogenous reprogramming factor-free hiPSCs can be selectively differentiated into a homogenous population of ATIICs. In addition, we show that these hiPSC-derived ATIICs exhibit ultrastructural characteristics and biological functions of normal ATIICs. When transplanted into bleomycin-challenged mice lungs, hiPSC-derived ATIICs efficiently remain and re-epithelialize injured alveoli to restore pulmonary function, preventing lung fibrosis and increasing survival without tumorigenic side effect. This strategy allows for the first time efficient generation of patient-specific ATIICs for possible future clinical applications. © 2013 AlphaMed Press.

A site-specific genetic modification for induction of pluripotency and subsequent isolation of derived lung alveolar epithelial type II cells

PubMed Central

Yan, Qing; Quan, Yuan; Sun, Huanhuan; Peng, Xinmiao; Zou, Zhengyun; Alcorn, Joseph L.; Wetsel, Rick A.; Wang, Dachun

2013-01-01

Human induced pluripotent stem cells (hiPSCs) have great therapeutic potential in repairing defective lung alveoli. However, genetic abnormalities caused by vector-integrations and low efficiency in generating hiPSCs, as well as difficulty in obtaining transplantable hiPSC-derived cell types, are still major obstacles. Here we report a novel strategy using a single non-viral site-specific-targeting vector with a combination of Tet-On inducible gene expression system, Cre/lox P switching gene expression system, and alveolar epithelial type II cell (ATIIC)-specific NeomycinR trangene expression system. With this strategy, a single copy of all of the required transgenes can be specifically knocked into a site immediately downstream of beta-2-microglobulin (B2M) gene locus at a high frequency, without causing B2M dysfunction. Thus, the expression of reprogramming factors, Oct4, Sox2, cMyc and Klf4, can be precisely regulated for efficient reprogramming of somatic cells into random-integration-free or genetic mutation-free hiPSCs. The exogenous reprogramming factor transgenes can be subsequently removed after reprogramming by transient expression of Cre recombinase, and the resulting random-integration-free and exogenous reprogramming-factor-free hiPSCs can be selectively differentiated into a homogenous population of ATIICs. In addition, we show that these hiPSC-derived ATIICs exhibit ultra-structural characteristics and biological functions of normal ATIICs. When transplanted into bleomycin-challenged mice lungs, hiPSC-derived ATIICs efficiently remain and re-epithelialize injured alveoli to restore pulmonary function, preventing lung fibrosis and increasing survival without tumorigenic side effect. This strategy allows for the first time efficient generation of patient-specific ATIICs for possible future clinical applications. PMID:24123810

An auxin responsive CLE gene regulates shoot apical meristem development in Arabidopsis

PubMed Central

Guo, Hongyan; Zhang, Wei; Tian, Hainan; Zheng, Kaijie; Dai, Xuemei; Liu, Shanda; Hu, Qingnan; Wang, Xianling; Liu, Bao; Wang, Shucai

2015-01-01

Plant hormone auxin regulates most, if not all aspects of plant growth and development, including lateral root formation, organ pattering, apical dominance, and tropisms. Peptide hormones are peptides with hormone activities. Some of the functions of peptide hormones in regulating plant growth and development are similar to that of auxin, however, the relationship between auxin and peptide hormones remains largely unknown. Here we report the identification of OsCLE48, a rice (Oryza sativa) CLE (CLAVATA3/ENDOSPERM SURROUNDING REGION) gene, as an auxin response gene, and the functional characterization of OsCLE48 in Arabidopsis and rice. OsCLE48 encodes a CLE peptide hormone that is similar to Arabidopsis CLEs. RT-PCR analysis showed that OsCLE48 was induced by exogenously application of IAA (indole-3-acetic acid), a naturally occurred auxin. Expression of integrated OsCLE48p:GUS reporter gene in transgenic Arabidopsis plants was also induced by exogenously IAA treatment. These results indicate that OsCLE48 is an auxin responsive gene. Histochemical staining showed that GUS activity was detected in all the tissue and organs of the OsCLE48p:GUS transgenic Arabidopsis plants. Expression of OsCLE48 under the control of the 35S promoter in Arabidopsis inhibited shoot apical meristem development. Expression of OsCLE48 under the control of the CLV3 native regulatory elements almost completely complemented clv3-2 mutant phenotypes, suggesting that OsCLE48 is functionally similar to CLV3. On the other hand, expression of OsCLE48 under the control of the 35S promoter in Arabidopsis has little, if any effects on root apical meristem development, and transgenic rice plants overexpressing OsCLE48 are morphologically indistinguishable from wild type plants, suggesting that the functions of some CLE peptides may not be fully conserved in Arabidopsis and rice. Taken together, our results showed that OsCLE48 is an auxin responsive peptide hormone gene, and it regulates shoot apical meristem development when expressed in Arabidopsis. PMID:25983737

Cloning, sequencing, and transgenic expression of Podospora curvicolla and Sordaria macrospora eEF1A genes: relationship between cytosolic translation and longevity in filamentous fungi.

PubMed

Gagny, B; Rossignol, M; Silar, P

1997-12-01

We have cloned and sequenced the gene encoding the translation elongation factor eEF1A from two filamentous fungi, Podospora curvicolla and Sordaria macrospora. These fungi are close relatives of Podospora anserina and also show senescence syndromes. Comparison of the sequences of the deduced proteins with that of P. anserina reveals that the three proteins differ in several positions. Replacement of the P. anserina gene by either of the two exogenous genes does not entail any modification in P. anserina physiology; the longevity of the fungus is not affected. No alteration of in vivo translational accuracy was detected; however, the exogenous proteins nonetheless promoted a modification of the resistance to the aminoglycoside antibiotic paromomycin. These data suggest that optimization of life span between these closely related fungi has likely not been performed during evolution through modifications of eEF1A activity, despite the fact that mutations in this factor can drastically affect longevity. Copyright 1997 Academic Press.

Exogenous short-term silicon application regulates macro-nutrients, endogenous phytohormones, and protein expression in Oryza sativa L.

PubMed

Jang, Soo-Won; Kim, Yoonha; Khan, Abdul Latif; Na, Chae-In; Lee, In-Jung

2018-01-04

Silicon (Si) has been known to regulate plant growth; however, the underlying mechanisms of short-term exogenous Si application on the regulation of calcium (Ca) and nitrogen (N), endogenous phytohormones, and expression of essential proteins have been little understood. Exogenous Si application significantly increased Si content as compared to the control. Among Si treatments, 1.0 mM Si application showed increased phosphorus content as compared to other Si treatments (0.5, 2.0, and 4.0 mM). However, Ca accumulation was significantly reduced (1.8- to 2.0-fold) at the third-leaf stage in the control, whereas all Si treatments exhibited a dose-dependent increase in Ca as determined by radioisotope 45 Ca analysis. Similarly, the radioisotope 15 N for nitrogen localization and uptake showed a varying but reduced response (ranging from 1.03-10.8%) to different Si concentrations as compared to 15 N application alone. Physiologically active endogenous gibberellin (GA 1 ) was also significantly higher with exogenous Si (1.0 mM) as compared to GA 20 and the control plants. A similar response was noted for endogenous jasmonic and salicylic acid synthesis in rice plants with Si application. Proteomic analysis revealed the activation of several essential proteins, such as Fe-S precursor protein, putative thioredoxin, Ser/Thr phosphatase, glucose-6-phosphate isomerase (G6P), and importin alpha-1b (Imp3), with Si application. Among the most-expressed proteins, confirmatory gene expression analysis for G6P and Imp3 showed a similar response to those of the Si treatments. In conclusion, the current results suggest that short-term exogenous Si can significantly regulate rice plant physiology by influencing Ca, N, endogenous phytohormones, and proteins, and that 1.0 mM Si application is more beneficial to plants than higher concentrations.

Uncovering DELLA-Independent Gibberellin Responses by Characterizing New Tomato procera Mutants

PubMed Central

Livne, Sivan; Lor, Vai S.; Nir, Ido; Eliaz, Natanella; Aharoni, Asaph; Olszewski, Neil E.; Eshed, Yuval; Weiss, David

2015-01-01

Gibberellin (GA) regulates plant development primarily by triggering the degradation/deactivation of the DELLA proteins. However, it remains unclear whether all GA responses are regulated by DELLAs. Tomato (Solanum lycopersicum) has a single DELLA gene named PROCERA (PRO), and its recessive pro allele exhibits constitutive GA activity but retains responsiveness to external GA. In the loss-of-function mutant proΔGRAS, all examined GA developmental responses were considerably enhanced relative to pro and a defect in seed desiccation tolerance was uncovered. As pro, but not proΔGRAS, elongation was promoted by GA treatment, pro may retain residual DELLA activity. In agreement with homeostatic feedback regulation of the GA biosynthetic pathway, we found that GA20oxidase1 expression was suppressed in proΔGRAS and was not affected by exogenous GA3. In contrast, expression of GA2oxidase4 was not affected by the elevated GA signaling in proΔGRAS but was strongly induced by exogenous GA3. Since a similar response was found in Arabidopsis thaliana plants with impaired activity of all five DELLA genes, we suggest that homeostatic GA responses are regulated by both DELLA-dependent and -independent pathways. Transcriptome analysis of GA-treated proΔGRAS leaves suggests that 5% of all GA-regulated genes in tomato are DELLA independent. PMID:26036254

[Update views on the theory of phagocytosis].

PubMed

Freĭdlin, I S

2008-01-01

Developer of the phagocytosis theory I.I Mechnikov forecasted the most fruitful directions of its development. Macrophages express on the plasma membranes broad spectrum of receptors, which mediate their interaction with altered organism's own components as well as with exogenous agents, including various microorganisms. Recognition leads to changes of expression of surface molecules, enhancement of phagocytic activity as well as production and secretion of cytokines, presentation functions, signaling and genes expression. This reflected on maintenance of homeostasis, as well as on host defense effectiveness, including mechanisms of innate and adaptive immunity.

Effects of abscisic acid on ethylene biosynthesis and perception in Hibiscus rosa-sinensis L. flower development

PubMed Central

Trivellini, Alice; Ferrante, Antonio; Vernieri, Paolo; Serra, Giovanni

2011-01-01

The effect of the complex relationship between ethylene and abscisic acid (ABA) on flower development and senescence in Hibiscus rosa-sinensis L. was investigated. Ethylene biosynthetic (HrsACS and HrsACO) and receptor (HrsETR and HrsERS) genes were isolated and their expression evaluated in three different floral tissues (petals, style–stigma plus stamens, and ovaries) of detached buds and open flowers. This was achieved through treatment with 0.1 mM 1-aminocyclopropane-1-carboxylic acid (ACC) solution, 500 nl l−1 methylcyclopropene (1-MCP), and 0.1 mM ABA solution. Treatment with ACC and 1-MCP confirmed that flower senescence in hibiscus is ethylene dependent, and treatment with exogenous ABA suggested that ABA may play a role in this process. The 1-MCP impeded petal in-rolling and decreased ABA content in detached open flowers after 9 h. This was preceded by an earlier and sequential increase in ABA content in 1-MCP-treated petals and style–stigma plus stamens between 1 h and 6 h. ACC treatment markedly accelerated flower senescence and increased ethylene production after 6 h and 9 h, particularly in style–stigma plus stamens. Ethylene evolution was positively correlated in these floral tissues with the induction of the gene expression of ethylene biosynthetic and receptor genes. Finally, ABA negatively affected the ethylene biosynthetic pathway and tissue sensitivity in all flower tissues. Transcript abundance of HrsACS, HrsACO, HrsETR, and HrsERS was reduced by exogenous ABA treatment. This research underlines the regulatory effect of ABA on the ethylene biosynthetic and perception machinery at a physiological and molecular level when inhibitors or promoters of senescence are exogenously applied. PMID:21841180

Microarray analysis reveals overlapping and specific transcriptional responses to different plant hormones in rice

PubMed Central

Garg, Rohini; Tyagi, Akhilesh K.; Jain, Mukesh

2012-01-01

Hormones exert pleiotropic effects on plant growth and development throughout the life cycle. Many of these effects are mediated at molecular level via altering gene expression. In this study, we investigated the exogenous effect of plant hormones, including auxin, cytokinin, abscisic acid, ethylene, salicylic acid and jasmonic acid, on the transcription of rice genes at whole genome level using microarray. Our analysis identified a total of 4171 genes involved in several biological processes, whose expression was altered significantly in the presence of different hormones. Further, 28% of these genes exhibited overlapping transcriptional responses in the presence of any two hormones, indicating crosstalk among plant hormones. In addition, we identified genes showing only a particular hormone-specific response, which can be used as hormone-specific markers. The results of this study will facilitate further studies in hormone biology in rice. PMID:22827941

Static magnetic field reduced exogenous oligonucleotide uptake by spermatozoa using magnetic nanoparticle gene delivery system

NASA Astrophysics Data System (ADS)

Katebi, Samira; Esmaeili, Abolghasem; Ghaedi, Kamran

2016-03-01

Spermatozoa could introduce exogenous oligonucleotides of interest to the oocyte. The most important reason of low efficiency of sperm mediated gene transfer (SMGT) is low uptake of exogenous DNA by spermatozoa. The aim of this study was to evaluate the effects of static magnetic field on exogenous oligonucleotide uptake of spermatozoa using magnetofection method. Magnetic nanoparticles (MNPs) associated with the labeled oligonucleotides were used to increase the efficiency of exogenous oligonucleotide uptake by rooster spermatozoa. We used high-field/high-gradient magnet (NdFeB) to enhance and accelerate exogenous DNA sedimentation at the spermatozoa surface. Flow cytometry analysis was performed to measure viability and percentage of exogenous oligonucleotide uptake by sperm. Flow cytometry analysis showed a significant increase in exogenous oligonucleotide uptake by rooster spermatozoa (P<0.001) when spermatozoa were incubated in exogenous oligonucleotide solution and MNPs. However, by applying static magnetic field during magnetofection method, a significant decrease in exogenous oligonucleotide uptake was observed (P<0.05). Findings of this study showed that MNPs were effective to increase exogenous oligonucleotide uptake by rooster spermatozoa; however unlike others studies, static magnetic field, was not only ineffective to enhance exogenous oligonucleotide uptake by rooster spermatozoa but also led to reduction in efficiency of magnetic nanoparticles in gene transfer.

The response of growth and patulin production of postharvest pathogen Penicillium expansum to exogenous potassium phosphite treatment.

PubMed

Lai, Tongfei; Wang, Ying; Fan, Yaya; Zhou, Yingying; Bao, Ying; Zhou, Ting

2017-03-06

In this study, the effects of exogenous potassium phosphite (Phi) on growth and patulin production of postharvest pathogen Penicillium expansum were assessed. The results indicated that P. expansum under 5mmol/L Phi stress presented obvious development retardation, yield reduction of patulin and lower infectivity to apple fruit. Meanwhile, expression analysis of 15 genes related to patulin biosynthesis suggested that Phi mainly affected the early steps of patulin synthetic route at transcriptional level. Furthermore, a global view of proteome and transcriptome alteration of P. expansum spores during 6h of Phi stress was evaluated by iTRAQ (isobaric tags for relative and absolute quantitation) and RNA-seq (RNA sequencing) approaches. A total of 582 differentially expressed proteins (DEPs) and 177 differentially expressed genes (DEGs) were acquired, most of which participated in carbohydrate metabolism, amino acid metabolism, lipid metabolism, genetic information processing and biosynthesis of secondary metabolites. Finally, 39 overlapped candidates were screened out through correlational analysis between iTRAQ and RNA-seq datasets. These findings will afford more precise and directional clues to explore the inhibitory mechanism of Phi on growth and patulin biosynthesis of P. expansum, and be beneficial to develop effective controlling approaches based on Phi. Copyright © 2016 Elsevier B.V. All rights reserved.

The GDNF Target Vsnl1 Marks the Ureteric Tip

PubMed Central

Ola, Roxana; Jakobson, Madis; Kvist, Jouni; Perälä, Nina; Kuure, Satu; Braunewell, Karl-Heinz; Bridgewater, Darren; Rosenblum, Norman D.; Chilov, Dmitri; Immonen, Tiina; Sainio, Kirsi

2011-01-01

Glial cell line-derived neurotrophic factor (GDNF) is indispensable for ureteric budding and branching. If applied exogenously, GDNF promotes ectopic ureteric buds from the Wolffian duct. Although several downstream effectors of GDNF are known, the identification of early response genes is incomplete. Here, microarray screening detected several GDNF-regulated genes in the Wolffian duct, including Visinin like 1 (Vsnl1), which encodes a neuronal calcium-sensor protein. We observed renal Vsnl1 expression exclusively in the ureteric epithelium, but not in Gdnf-null kidneys. In the tissue culture of Gdnf-deficient kidney primordium, exogenous GDNF and alternative bud inducers (FGF7 and follistatin) restored Vsnl1 expression. Hence, Vsnl1 characterizes the tip of the ureteric bud epithelium regardless of the inducer. In the tips, Vsnl1 showed a mosaic expression pattern that was mutually exclusive with β-catenin transcriptional activation. Vsnl1 was downregulated in both β-catenin-stabilized and β-catenin-deficient kidneys. Moreover, in a mouse collecting duct cell line, Vsnl1 compromised β-catenin stability, suggesting a counteracting relationship between Vsnl1 and β-catenin. In summary, Vsnl1 marks ureteric bud tips in embryonic kidneys, and its mosaic pattern demonstrates a heterogeneity of cell types that may be critical for normal ureteric branching. PMID:21289216

Strigolactone regulation of shoot branching in chrysanthemum (Dendranthema grandiflorum)

PubMed Central

Liang, Jianli; Zhao, Liangjun; Challis, Richard; Leyser, Ottoline

2010-01-01

Previous studies of highly branched mutants in pea (rms1–rms5), Arabidopsis thaliana (max1–max4), petunia (dad1–dad3), and rice (d3, d10, htd1/d17, d14, d27) identified strigolactones or their derivates (SLs), as shoot branching inhibitors. This recent discovery offers the possibility of using SLs to regulate branching commercially, for example, in chrysanthemum, an important cut flower crop. To investigate this option, SL physiology and molecular biology were studied in chrysanthemum (Dendranthema grandiflorum), focusing on the CCD8/MAX4/DAD1/RMS1/D10 gene. Our results suggest that, as has been proposed for Arabidopsis, the ability of SLs to inhibit bud activity depends on the presence of a competing auxin source. The chrysanthemum SL biosynthesis gene, CCD8 was cloned, and found to be regulated in a similar, but not identical way to known CCD8s. Expression analyses revealed that DgCCD8 is predominantly expressed in roots and stems, and is up-regulated by exogenous auxin. Exogenous SL can down-regulate DgCCD8 expression, but this effect can be overridden by apical auxin application. This study provides evidence that SLs are promising candidates to alter the shoot branching habit of chrysanthemum. PMID:20478970

Gene Expression in Human Accessory Lacrimal Glands of Wolfring

PubMed Central

Ubels, John L.; Gipson, Ilene K.; Spurr-Michaud, Sandra J.; Tisdale, Ann S.; Van Dyken, Rachel E.; Hatton, Mark P.

2012-01-01

Purpose. The accessory lacrimal glands are assumed to contribute to the production of tear fluid, but little is known about their function. The goal of this study was to conduct an analysis of gene expression by glands of Wolfring that would provide a more complete picture of the function of these glands. Methods. Glands of Wolfring were isolated from frozen sections of human eyelids by laser microdissection. RNA was extracted from the cells and hybridized to gene expression arrays. The expression of several of the major genes was confirmed by immunohistochemistry. Results. Of the 24 most highly expressed genes, 9 were of direct relevance to lacrimal function. These included lysozyme, lactoferrin, tear lipocalin, and lacritin. The glands of Wolfring are enriched in genes related to protein synthesis, targeting, and secretion, and a large number of genes for proteins with antimicrobial activity were detected. Ion channels and transporters, carbonic anhydrase, and aquaporins were abundantly expressed. Genes for control of lacrimal function, including cholinergic, adrenergic, vasoactive intestinal polypeptide, purinergic, androgen, and prolactin receptors were also expressed in gland of Wolfring. Conclusions. The data suggest that the function of glands of Wolfring is similar to that of main lacrimal glands and are consistent with secretion electrolytes, fluid, and protein under nervous and hormonal control. Since these glands secrete directly onto the ocular surface, their location may allow rapid response to exogenous stimuli and makes them readily accessible to topical drugs. PMID:22956620

Degradation of endogenous and exogenous genes of genetically modified rice with Cry1Ab during food processing.

PubMed

Zhang, Wei; Xing, Fuguo; Selvaraj, Jonathan Nimal; Liu, Yang

2014-05-01

In order to assess the degradation of endogenous and exogenous genes during food processing, genetically modified rice with Cry1Ab was used as raw material to produce 4 processed foods: steamed rice, rice noodles, rice crackers, and sweet rice wine. The results showed various processing procedures caused different degrees of degradation of both endogenous and exogenous genes. During the processing of steamed rice and rice noodles, the procedures were so mild that only genes larger than 1500 bp were degraded, and no degradation of NOS terminator and Hpt gene was detected. For rice crackers, frying was the most severe procedure, followed by microwaving, baking, boiling, 1st drying, and 2nd drying. For sweet rice wine, fermentation had more impact on degradation of genes than the other processing procedures. All procedures in this study did not lead to degradation of genes to below 200 bp, except for NOS terminator. In the case of stability of the genes studied during processing of rice crackers and sweet rice wine, SPS gene was the most, followed by the Cry1Ab gene, Hpt gene, Pubi promoter, and NOS terminator. In our study, we gained some information about the degradation of endogenous and exogenous genes during 4 foods processing, compared the different stabilities between endogenous and exogenous genes, and analyzed different effects of procedure on degradation of genes. In addition, the fragments of endogenous and exogenous genes about 200 bp could be detected in final products, except NOS terminator. As a result, we provided some base information about risk assessment of genetically modified (GM) food and appropriate length of fragment to detect GM component in processed foods. © 2014 Institute of Food Technologists®

Exogenous Hydrogen Peroxide Contributes to Heme Oxygenase-1 Delaying Programmed Cell Death in Isolated Aleurone Layers of Rice Subjected to Drought Stress in a cGMP-Dependent Manner

PubMed Central

Wang, Guanghui; Xiao, Yu; Deng, Xiaojiang; Zhang, Heting; Li, Tingge; Chen, Huiping

2018-01-01

Hydrogen peroxide (H2O2) is a reactive oxygen species (ROS) that plays a dual role in plant cells. Here, we discovered that drought (20% polyethylene glycol-6000, PEG)-triggered decreases of HO-1 transcript expression and HO activity. However, exogenous H2O2 contributed toward the increase in HO-1 gene expression and activity of the enzyme under drought stress. Meanwhile, the HO-1 inducer hematin could mimic the effects of the H2O2 scavengers ascorbic acid (AsA) and dimethylthiourea (DMTU) and the H2O2 synthesis inhibitor diphenyleneiodonium (DPI) for scavenging or diminishing drought-induced endogenous H2O2. Conversely, the zinc protoporphyrin IX (ZnPPIX), an HO-1-specific inhibitor, reversed the effects of hematin. We further analyzed the endogenous H2O2 levels and HO-1 transcript expression levels of aleurone layers treated with AsA, DMTU, and DPI in the presence of exogenous H2O2 under drought stress, respectively. The results showed that in aleurone layers subjected to drought stress, when the endogenous H2O2 level was inhibited, the effect of exogenous H2O2 on the induction of HO-1 was enhanced. Furthermore, exogenous H2O2-activated HO-1 effectively enhanced amylase activity. Application of 8-bromoguanosine 3′,5′-cyclic guanosine monophosphate (8-Br-cGMP) (the membrane permeable cGMP analog) promoted the effect of exogenous H2O2-delayed PCD of aleurone layers in response to drought stress. More importantly, HO-1 delayed the programmed cell death (PCD) of aleurone layers by cooperating with nitric oxide (NO), and the delayed effect of NO on PCD was achieved via mediation by cGMP under drought stress. In short, in rice aleurone layers, exogenous H2O2 (as a signaling molecule) triggered HO-1 and delayed PCD via cGMP which possibly induced amylase activity under drought stress. In contrast, as a toxic by-product of cellular metabolism, the drought-generated H2O2 promoted cell death. PMID:29449858

Exogenous Hydrogen Peroxide Contributes to Heme Oxygenase-1 Delaying Programmed Cell Death in Isolated Aleurone Layers of Rice Subjected to Drought Stress in a cGMP-Dependent Manner.

PubMed

Wang, Guanghui; Xiao, Yu; Deng, Xiaojiang; Zhang, Heting; Li, Tingge; Chen, Huiping

2018-01-01

Hydrogen peroxide (H 2 O 2 ) is a reactive oxygen species (ROS) that plays a dual role in plant cells. Here, we discovered that drought (20% polyethylene glycol-6000, PEG)-triggered decreases of HO-1 transcript expression and HO activity. However, exogenous H 2 O 2 contributed toward the increase in HO-1 gene expression and activity of the enzyme under drought stress. Meanwhile, the HO-1 inducer hematin could mimic the effects of the H 2 O 2 scavengers ascorbic acid (AsA) and dimethylthiourea (DMTU) and the H 2 O 2 synthesis inhibitor diphenyleneiodonium (DPI) for scavenging or diminishing drought-induced endogenous H 2 O 2 . Conversely, the zinc protoporphyrin IX (ZnPPIX), an HO-1-specific inhibitor, reversed the effects of hematin. We further analyzed the endogenous H 2 O 2 levels and HO-1 transcript expression levels of aleurone layers treated with AsA, DMTU, and DPI in the presence of exogenous H 2 O 2 under drought stress, respectively. The results showed that in aleurone layers subjected to drought stress, when the endogenous H 2 O 2 level was inhibited, the effect of exogenous H 2 O 2 on the induction of HO-1 was enhanced. Furthermore, exogenous H 2 O 2 -activated HO-1 effectively enhanced amylase activity. Application of 8-bromoguanosine 3',5'-cyclic guanosine monophosphate (8-Br-cGMP) (the membrane permeable cGMP analog) promoted the effect of exogenous H 2 O 2 -delayed PCD of aleurone layers in response to drought stress. More importantly, HO-1 delayed the programmed cell death (PCD) of aleurone layers by cooperating with nitric oxide (NO), and the delayed effect of NO on PCD was achieved via mediation by cGMP under drought stress. In short, in rice aleurone layers, exogenous H 2 O 2 (as a signaling molecule) triggered HO-1 and delayed PCD via cGMP which possibly induced amylase activity under drought stress. In contrast, as a toxic by-product of cellular metabolism, the drought-generated H 2 O 2 promoted cell death.

pLR: a lentiviral backbone series to stable transduction of bicistronic genes and exchange of promoters.

PubMed

Vargas, José Eduardo; Salton, Gabrielle; Sodré de Castro Laino, Andressa; Pires, Tiago Dalberto; Bonamino, Martin; Lenz, Guido; Delgado-Cañedo, Andrés

2012-11-01

Gene transfer based on lentiviral vectors allow the integration of exogenous genes into the genome of a target cell, turning these vectors into one of the most used methods for stable transgene expression in mammalian cells, in vitro and in vivo. Currently, there are no lentivectors that allow the cloning of different genes to be regulated by different promoters. Also, there are none that permit the analysis of the expression through an IRES (internal ribosome entry site)-- reporter gene system. In this work, we have generated a series of lentivectors containing: (1) a malleable structure to allow the cloning of different target genes in a multicloning site (mcs); (2) unique site to exchange promoters, and (3) IRES followed by one of two reporter genes: eGFP or DsRed. The series of the produced vectors were named pLR (for lentivirus and RSV promoter) and were fairly efficient with a strong fluorescence of the reporter genes in direct transfection and viral transduction experiments. This being said, the pLR series have been found to be powerful biotechnological tools for stable gene transfer and expression. Copyright © 2012 Elsevier Inc. All rights reserved.

Mammary gland morphology and gene expression signature of prepubertal male and female rats following exposure to exogenous estradiol

USDA-ARS?s Scientific Manuscript database

In order to properly screen environmental chemicals for potential toxic effects such as increased cancer risk and risk of infertility resulting from actions similar to those of female sex steroids such as estrogens, it is essential to understand the effects of treatment with the most important femal...

Gene expression of Lactobacillus plantarum and the commensal microbiota in the ileum of healthy and early SIV-infected rhesus macaques

PubMed Central

Golomb, Benjamin L.; Hirao, Lauren A.; Dandekar, Satya; Marco, Maria L.

2016-01-01

Chronic HIV infection results in impairment of gut-associated lymphoid tissue leading to systemic immune activation. We previously showed that in early SIV-infected rhesus macaques intestinal dysfunction is initiated with the induction of the IL-1β pathway in the small intestine and reversed by treatment with an exogenous Lactobacillus plantarum strain. Here, we provide evidence that the transcriptomes of L. plantarum and ileal microbiota are not altered shortly after SIV infection. L. plantarum adapts to the small intestine by expressing genes required for tolerating oxidative stress, modifying cell surface composition, and consumption of host glycans. The ileal microbiota of L. plantarum-containing healthy and SIV+ rhesus macaques also transcribed genes for host glycan metabolism as well as for cobalamin biosynthesis. Expression of these pathways by bacteria were proposed but not previously demonstrated in the mammalian small intestine. PMID:27102350

Regulation of galactokinase gene expression in Tetrahymena thermophila. II. Identification of 3,4-dihydroxyphenylalanine as a primary effector of adrenergic control of galactokinase expression.

PubMed

Ness, J C; Morse, D E

1985-08-25

Intracellular concentrations of catecholamines were determined in wild-type and mutant Tetrahymena thermophila, using the highly sensitive techniques of high-performance liquid chromatography and electro-chemical detection. Catecholamines were determined in these cell strains grown under various steady-state conditions, including those which initiate and maintain repression of galactokinase gene expression. Wild-type cells grown in defined minimal medium supplemented with 1% glycerol, exhibiting derepressed galactokinase synthesis, were found to contain considerable quantities of dopa (3,4-dihydroxyphenylalanine) and dopamine, but no detectable levels of either norepinephrine or epinephrine. Analyses of wild-type cells revealed a strong positive correlation between the internal concentration of dopa and expression of the galactokinase gene, both of which are regulated by exogenous carbohydrates, catecholamine agonists, or dibutyryl-cAMP; an analogous relationship between intracellular dopamine concentrations and galactokinase activity was not found. In addition, a correlation between intracellular dopa content and the phenotypic expression of galactokinase in various mutants deficient in the catecholamine biosynthetic pathway or in glucokinase further confirms the role of dopa as a primary effector in the regulation of galactokinase gene expression.

Development of Sendai Virus Vectors and their Potential Applications in Gene Therapy and Regenerative Medicine

PubMed Central

Nakanishi, Mahito; Otsu, Makoto

2012-01-01

Gene delivery/expression vectors have been used as fundamental technologies in gene therapy since the 1980s. These technologies are also being applied in regenerative medicine as tools to reprogram cell genomes to a pluripotent state and to other cell lineages. Rapid progress in these new research areas and expectations for their translation into clinical applications have facilitated the development of more sophisticated gene delivery/expression technologies. Since its isolation in 1953 in Japan, Sendai virus (SeV) has been widely used as a research tool in cell biology and in industry, but the application of SeV as a recombinant viral vector has been investigated only recently. Recombinant SeV vectors have various unique characteristics, such as low pathogenicity, powerful capacity for gene expression and a wide host range. In addition, the cytoplasmic gene expression mediated by this vector is advantageous for applications, in that chromosomal integration of exogenous genes can be undesirable. In this review, we introduce a brief historical background on the development of recombinant SeV vectors and describe their current applications in gene therapy. We also describe the application of SeV vectors in advanced nuclear reprogramming and introduce a defective and persistent SeV vector (SeVdp) optimized for such reprogramming. PMID:22920683

Extent and character of circadian gene expression in Drosophila melanogaster: identification of twenty oscillating mRNAs in the fly head.

PubMed

Van Gelder, R N; Bae, H; Palazzolo, M J; Krasnow, M A

1995-12-01

Although mRNAs expressed with a circadian rhythm have been isolated from many species, the extent and character of circadianly regulated gene expression is unknown for any animal. In Drosophila melanogaster, only the period (per) gene, an essential component of the circadian pacemaker, is known to show rhythmic mRNA expression. Recent work suggests that the encoded Per protein controls its own transcription by an autoregulatory feedback loop. Per might also control the rhythmic expression of other genes to generate circadian behavior and physiology. The goals of this work were to evaluate the extent and character of circadian control of gene expression in Drosophila, and to identify genes dependent on per for circadian expression. A large collection of anonymous, independent cDNA clones was used to screen for transcripts that are rhythmically expressed in the fly head. 20 of the 261 clones tested detected mRNAs with a greater than two-fold daily change in abundance. Three mRNAs were maximally expressed in the morning, whereas 17 mRNAs were most abundant in the evening--when per mRNA is also maximally expressed (but when the flies are inactive). Further analysis of the three 'morning' cDNAs showed that each has a unique dependence on the presence of a light-dark cycle, on timed feeding, and on the function of the per gene for its oscillation. These dependencies were different from those determined for per and for a novel 'evening' gene. Sequence analysis indicated that all but one of the 20 cDNAs identified previously uncloned genes. Diurnal control of gene expression is a significant but limited phenomenon in the fly head, which involves many uncharacterized genes. Diurnal control is mediated by multiple endogenous and exogenous mechanisms, even at the level of individual genes. A subset of circadianly expressed genes are predominantly or exclusively dependent on per for their rhythmic expression. The per gene can therefore influence the expression of genes other than itself, but for many rhythmically expressed genes, per functions in conjunction with external inputs to control their daily expression patterns.

Short-term dopaminergic regulation of GABA release in dopamine deafferented caudate-putamen is not directly associated with glutamic acid decarboxylase gene expression.

PubMed

O'Connor, W T; Lindefors, N; Brené, S; Herrera-Marschitz, M; Persson, H; Ungerstedt, U

1991-07-08

In vivo microdialysis and in situ hybridization were combined to study dopaminergic regulation of gamma-amino butyric acid (GABA) neurons in rat caudate-putamen (CPu). Potassium-stimulated GABA release in CPu was elevated following a dopamine deafferentation. Local perfusion with exogenous dopamine (50 microM) for 3 h via the microdialysis probe attenuated the potassium-stimulated increase in extracellular GABA in CPu. Expression of glutamic acid decarboxylase (GAD) mRNA was also increased in the dopamine deafferented CPu. However, local perfusion with dopamine had no significant attenuating effect on the increased GAD mRNA expression. These findings indicate that dopaminergic regulation of GABA neurons in the dopamine deafferented CPu includes both a short-term effect at the level of GABA release independent of changes in GAD mRNA expression and a long-term modulation at the level of GAD gene expression.

Au nanoinjectors for electrotriggered gene delivery into the cell nucleus.

PubMed

Kang, Mijeong; Kim, Bongsoo

2015-01-01

Intracellular delivery of exogenous materials is an essential technique required for many fundamental biological researches and medical treatments. As our understanding of cell structure and function has been improved and diverse therapeutic agents with a subcellular site of action have been continuously developed, there is a demand to enhance the performance of delivering devices. Ideal intracellular delivery devices should convey various kinds of exogenous materials without deteriorating cell viability regardless of cell type and, furthermore, precisely control the location and the timing of delivery as well as the amount of delivered materials for advanced researches.In this chapter the development of a new intracellular delivery device, a nanoinjector made of a Au (gold) nanowire (a Au nanoinjector) is described in which delivery is triggered by external application of an electric pulse. As a model study, a gene was delivered directly into the nucleus of a neuroblastoma cell, and successful delivery without cell damage was confirmed by the expression of the delivered gene. The insertion of a Au nanoinjector directly into a cell can be generally applied to any kind of cell, and a high degree of surface modification of Au allows attachment of diverse materials such as proteins, small molecules, or nanoparticles as well as genes on Au nanoinjectors. This expands their applicability, and it is expected that they will provide important information on the effects of delivered exogenous materials and consequently contribute to the development of related therapeutic or clinical technologies.

Myostatin downregulates the expression of basic fibroblast growth factor gene in HeLa cells.

PubMed

Liu, H Z; Luo, P; Chen, S H; Shang, J H

2012-01-01

Basic fibroblast growth factor (bFGF or FGF-2), a potent tumorigenic cytokine, improves cells proliferation and angiogenesis in tumor and also plays vital roles in tumor growth, metastasis as well as prognosis. Screening and application of effective cytokines against bFGF tumorigenic activity would be helpful to oncologic therapy. Myostatin, a member of transforming growth factor β superfamily, recently showed an antitumor activity and was reported to induce HeLa cells apoptosis through mitochondrion pathway. The above data raised our assumption that expression level of endogenous bFGF gene may be suppressed by exogenous myostatin in myostatin-treated HeLa cells. To test the hypothesis, myostatin was employed to stimulate HeLa cells and expressional level of endogenous bFGF gene in HeLa cells was detected with real-time RT-PCR and ELISA. Results of the suppressed expression level of bFGF gene in Hela cells implied that myostatin may be regarded as an effective cytokine against bFGF to treat certain cancers (Fig. 3, Ref. 26).

Comparative physiological, metabolomic, and transcriptomic analyses reveal mechanisms of improved abiotic stress resistance in bermudagrass [Cynodon dactylon (L). Pers.] by exogenous melatonin

PubMed Central

Shi, Haitao; Jiang, Chuan; Ye, Tiantian; Tan, Dun-xian; Reiter, Russel J.; Zhang, Heng; Liu, Renyi; Chan, Zhulong

2015-01-01

Melatonin (N-acetyl-5-methoxytryptamine), a well-known animal hormone, is also involved in plant development and abiotic stress responses. In this study, it is shown that exogenous application of melatonin conferred improved salt, drought, and cold stress resistances in bermudagrass. Moreover, exogenous melatonin treatment alleviated reactive oxygen species (ROS) burst and cell damage induced by abiotic stress; this involved activation of several antioxidants. Additionally, melatonin-pre-treated plants exhibited higher concentrations of 54 metabolites, including amino acids, organic acids, sugars, and sugar alcohols, than non-treated plants under abiotic stress conditions. Genome-wide transcriptomic profiling identified 3933 transcripts (2361 up-regulated and 1572 down-regulated) that were differentially expressed in melatonin-treated plants versus controls. Pathway and gene ontology (GO) term enrichment analyses revealed that genes involved in nitrogen metabolism, major carbohydrate metabolism, tricarboxylic acid (TCA)/org transformation, transport, hormone metabolism, metal handling, redox, and secondary metabolism were over-represented after melatonin pre-treatment. Taken together, this study provides the first evidence of the protective roles of exogenous melatonin in the bermudagrass response to abiotic stresses, partially via activation of antioxidants and modulation of metabolic homeostasis. Notably, metabolic and transcriptomic analyses showed that the underlying mechanisms of melatonin could involve major reorientation of photorespiratory and carbohydrate and nitrogen metabolism. PMID:25225478

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

DOE PAGES

Hon, Shuen; Lanahan, Anthony; Tian, Liang; ...

2016-04-22

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hon, Shuen; Lanahan, Anthony; Tian, Liang

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE. To explore the effects of overexpressing wild-type, mutant, and exogenous adhEs, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum. As proof of concept, we used this plasmid to express 12 different adhE genes (bothmore » wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.« less

Development of a plasmid-based expression system in Clostridium thermocellum and its use to screen heterologous expression of bifunctional alcohol dehydrogenases (adhEs).

PubMed

Hon, Shuen; Lanahan, Anthony A; Tian, Liang; Giannone, Richard J; Hettich, Robert L; Olson, Daniel G; Lynd, Lee R

2016-12-01

Clostridium thermocellum is a promising candidate for ethanol production from cellulosic biomass, but requires metabolic engineering to improve ethanol yield. A key gene in the ethanol production pathway is the bifunctional aldehyde and alcohol dehydrogenase, adhE . To explore the effects of overexpressing wild-type, mutant, and exogenous adhE s, we developed a new expression plasmid, pDGO144, that exhibited improved transformation efficiency and better gene expression than its predecessor, pDGO-66. This new expression plasmid will allow for many other metabolic engineering and basic research efforts in C. thermocellum . As proof of concept, we used this plasmid to express 12 different adhE genes (both wild type and mutant) from several organisms. Ethanol production varied between clones immediately after transformation, but tended to converge to a single value after several rounds of serial transfer. The previously described mutant C. thermocellum D494G adhE gave the best ethanol production, which is consistent with previously published results.

Non-viral gene delivery regulated by stiffness of cell adhesion substrates.

PubMed

Kong, Hyun Joon; Liu, Jodi; Riddle, Kathryn; Matsumoto, Takuya; Leach, Kent; Mooney, David J

2005-06-01

Non-viral gene vectors are commonly used for gene therapy owing to safety concerns with viral vectors. However, non-viral vectors are plagued by low levels of gene transfection and cellular expression. Current efforts to improve the efficiency of non-viral gene delivery are focused on manipulations of the delivery vector, whereas the influence of the cellular environment in DNA uptake is often ignored. The mechanical properties (for example, rigidity) of the substrate to which a cell adheres have been found to mediate many aspects of cell function including proliferation, migration and differentiation, and this suggests that the mechanics of the adhesion substrate may regulate a cell's ability to uptake exogeneous signalling molecules. In this report, we present a critical role for the rigidity of the cell adhesion substrate on the level of gene transfer and expression. The mechanism relates to material control over cell proliferation, and was investigated using a fluorescent resonance energy transfer (FRET) technique. This study provides a new material-based control point for non-viral gene therapy.

Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

PubMed

Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

2017-07-01

Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

The phosphotransferase VanU represses expression of four qrr genes antagonizing VanO-mediated quorum-sensing regulation in Vibrio anguillarum

PubMed Central

Weber, Barbara; Lindell, Kristoffer; El Qaidi, Samir; Hjerde, Erik; Willassen, Nils-Peder

2011-01-01

Vibrio anguillarum utilizes quorum sensing to regulate stress responses required for survival in the aquatic environment. Like other Vibrio species, V. anguillarum contains the gene qrr1, which encodes the ancestral quorum regulatory RNA Qrr1, and phosphorelay quorum-sensing systems that modulate the expression of small regulatory RNAs (sRNAs) that destabilize mRNA encoding the transcriptional regulator VanT. In this study, three additional Qrr sRNAs were identified. All four sRNAs were positively regulated by σ54 and the σ54-dependent response regulator VanO, and showed a redundant activity. The Qrr sRNAs, together with the RNA chaperone Hfq, destabilized vanT mRNA and modulated expression of VanT-regulated genes. Unexpectedly, expression of all four qrr genes peaked at high cell density, and exogenously added N-acylhomoserine lactone molecules induced expression of the qrr genes at low cell density. The phosphotransferase VanU, which phosphorylates and activates VanO, repressed expression of the Qrr sRNAs and stabilized vanT mRNA. A model is presented proposing that VanU acts as a branch point, aiding cross-regulation between two independent phosphorelay systems that activate or repress expression of the Qrr sRNAs, giving flexibility and precision in modulating VanT expression and inducing a quorum-sensing response to stresses found in a constantly changing aquatic environment. PMID:21948044

The phosphotransferase VanU represses expression of four qrr genes antagonizing VanO-mediated quorum-sensing regulation in Vibrio anguillarum.

PubMed

Weber, Barbara; Lindell, Kristoffer; El Qaidi, Samir; Hjerde, Erik; Willassen, Nils-Peder; Milton, Debra L

2011-12-01

Vibrio anguillarum utilizes quorum sensing to regulate stress responses required for survival in the aquatic environment. Like other Vibrio species, V. anguillarum contains the gene qrr1, which encodes the ancestral quorum regulatory RNA Qrr1, and phosphorelay quorum-sensing systems that modulate the expression of small regulatory RNAs (sRNAs) that destabilize mRNA encoding the transcriptional regulator VanT. In this study, three additional Qrr sRNAs were identified. All four sRNAs were positively regulated by σ(54) and the σ(54)-dependent response regulator VanO, and showed a redundant activity. The Qrr sRNAs, together with the RNA chaperone Hfq, destabilized vanT mRNA and modulated expression of VanT-regulated genes. Unexpectedly, expression of all four qrr genes peaked at high cell density, and exogenously added N-acylhomoserine lactone molecules induced expression of the qrr genes at low cell density. The phosphotransferase VanU, which phosphorylates and activates VanO, repressed expression of the Qrr sRNAs and stabilized vanT mRNA. A model is presented proposing that VanU acts as a branch point, aiding cross-regulation between two independent phosphorelay systems that activate or repress expression of the Qrr sRNAs, giving flexibility and precision in modulating VanT expression and inducing a quorum-sensing response to stresses found in a constantly changing aquatic environment.

Transcriptome Analysis of the Effects of Shell Removal and Exogenous Gibberellin on Germination of Zanthoxylum Seeds.

PubMed

Sun, Jikang; Wang, Ping; Zhou, Tao; Rong, Jian; Jia, Hao; Liu, Zhiming

2017-08-17

The zanthoxylum seeds are oil-rich and have a very thick, dense and oily shell. In the natural conditions the seeds have a very low germination rate. Prior to treatment with GAs to promote germination, the seeds were usually soaked in sulfuric acid to remove shells easily. A high-throughput sequencing of mRNAs was performed to investigate the effects of the above treatments on the germination of zanthoxylum seeds. Seven libraries were assembled into 100,982 unigenes and 59,509 unigenes were annotated. We focused on the expression profiles of the key genes related to the oil metabolisms and hormone regulations during seed germination. Our data indicated the endogenous ABA of seeds was rich. The effects that the exogenous GAs promoted germination were apparent in the secong day of germination. Especially, for the first time our results indicated the exogenous GAs lowered the aerobic metabolism including the oil metabolisms during imbibition. We inferred that the exogenous GAs had inhibitory effects on the oil metabolisms to avoide oxidative damages to the imbibed seeds, and the seed shell played the role similiar to the exogenous GAs in the initial stage of germination in the natural conditions.

Elevation of secondary metabolites synthesis in Brassica campestris ssp. chinensis L. via exogenous inoculation of Piriformospora indica with appropriate fertilizer

PubMed Central

Khalid, Muhammad; Hassani, Danial; Bilal, Muhammad; Liao, Jianli

2017-01-01

This work evaluated the impact of exogenous soil inoculation of beneficial fungal strain Piriformospora indica on phytochemical changes and the related genes expression of Chinese cabbage (Brassica campestris ssp. chinensis L.) by greenhouse pot experiments. High performance liquid chromatography (HPLC) affirmed that among the different combinations of fungal and organic fertilizer treatments, the phenolic acids and flavonoids were considerably enriched in organic fertilizer and fungi (OP) followed by organic fertilizer, biochar, fungi (OBP) treated plants. The antiradical activity was higher in OP (61.29%) followed by P (60%) and organic fertilizer (OF) (53.84%) inoculated plants which positively correlated with chlorophyll, carotenoids and flavonoids level (P<0.05). Furthermore, results showed that the exogenous application of P. indica significantly (P<0.05) enhanced plant growth, as well as stimulating the activation of chlorophyll, carotenoids and other antioxidant related pathways. The RT-qPCR analysis indicated that key FLS gene triggering the synthesis of kaemferol was up-regulated by the inoculation of P. indica. In conclusion, the results revealed that organic fertilizer and P. indica (OP) is the most appropriate combination for improving phytochemical and antiradical properties in Pakchoi. PMID:28493970

Changes in Global Transcriptional Profiling of Women Following Obesity Surgery Bypass.

PubMed

Pinhel, Marcela Augusta de Souza; Noronha, Natalia Yumi; Nicoletti, Carolina Ferreira; de Oliveira, Bruno Affonso Parente; Cortes-Oliveira, Cristiana; Pinhanelli, Vitor Caressato; Salgado Junior, Wilson; Machry, Ana Julia; da Silva Junior, Wilson Araújo; Souza, Dorotéia Rossi Silva; Marchini, Júlio Sérgio; Nonino, Carla Barbosa

2018-01-01

Differential gene expression in peripheral blood mononuclear cells (PBMCs) after Roux-en-Y gastric bypass (RYGB) is poorly characterized. Markers of these processes may provide a deeper understanding of the mechanisms that underlie these events. The main goal of this study was to identify changes in PBMC gene expression in women with obesity before and 6 months after RYGB-induced weight loss. The ribonucleic acid (RNA) of PBMCs from 13 obese women was analyzed before and 6 months after RYGB; the RNA of PBMCs from nine healthy women served as control. The gene expression levels were determined by microarray analysis. Significant differences in gene expression were validated by real-time quantitative polymerase chain reaction (RT-qPCR). Microarray analysis for comparison of the pre- and postoperative periods showed that 1366 genes were differentially expressed genes (DEGs). The main pathways were related to gene transcription; lipid, energy, and glycide metabolism; inflammatory and immunological response; cell differentiation; oxidative stress regulation; response to endogenous and exogenous stimuli; substrate oxidation; mTOR signaling pathway; interferon signaling; mitogen-activated protein kinases (MAPK), cAMP response element binding protein (CREB1), heat shock factor 1 (HSF1), and sterol regulatory element binding protein 1c (SREBP-1c) gene expression; adipocyte differentiation; and methylation. Six months after bariatric surgery and significant weight loss, many molecular pathways involved in obesity and metabolic diseases change. These findings are an important tool to identify potential targets for therapeutic intervention and clinical practice of nutritional genomics in obesity.

A recombinant rabies virus carrying GFP between N and P affects viral transcription in vitro.

PubMed

Luo, Jun; Zhao, Jing; Tian, Qin; Mo, Weiyu; Wang, Yifei; Chen, Hao; Guo, Xiaofeng

2016-06-01

Several studies have demonstrated the rabies virus to be a perfect potential vaccine vector to insert foreign genes into the target genome. For this study, a green fluorescent protein (GFP) gene was cloned into the rabies virus (RABV) genome between the N and P gene. CT dinucleotide was inserted as intergenic region. The recombinant high egg passage Flury strain (HEP-Flury) of RABV, carrying GFP (rHEP-NP-GFP), was generated in BHK-21 cells using reverse genetics. According to the viral growth kinetics assay, the addition of GFP between N and P gene has little effect on the viral growth compared to the parental strain HEP-Flury. Quantitative real-time PCR (qPCR) indicated that rHEP-NP-GFP showed different viral gene transcription, especially for G gene, compared to HEP-Flury. The same is true for one other recombinant RABV carrying GFP between G and L gene in NA cells. In addition, parent HEP-Flury showed more expression of innate immune-related molecules in NA cells. Compared to HEP-Flury, Western blotting (WB) indicated that insertion of a foreign gene following N gene enhanced the expression of M and G proteins. According to the qPCR and WB, GFP expression levels of rHEP-NP-GFP were significantly higher than rHEP-GFP. This study indicates HEP-Flury as valid vector to express exogenous genes between N and P.

[Advances in molecular mechanisms of adaptive immunity mediated by type I-E CRISPR/Cas system--A review].

PubMed

Sun, Dongchang; Qiu, Juanping

2016-01-04

To better adapt to the environment, prokaryocyte can take up exogenous genes (from bacteriophages, plasmids or genomes of other species) through horizontal gene transfer. Accompanied by the acquisition of exogenous genes, prokaryocyte is challenged by the invasion of 'selfish genes'. Therefore, to protect against the risk of gene transfer, prokaryocyte needs to establish mechanisms for selectively taking up or degrading exogenous DNA. In recent years, researchers discovered an adaptive immunity, which is mediated by the small RNA guided DNA degradation, prevents the invasion of exogenous genes in prokaryocyte. During the immune process, partial DNA fragments are firstly integrated.to the clustered regularly interspaced short palindromic repeats (CRISPR) located within the genome DNA, and then the mature CRISPR RNA transcript and the CRISPR associated proteins (Cas) form a complex CRISPR/Cas for degrading exogenous DNA. In this review, we will first briefly describe the CRISPR/Cas systems and then mainly focus on the recent advances of the function mechanism and the regulation mechanism of the type I-E CRISPR/Cas system in Escherichia coli.

Analysis of the transcriptional responses in inflorescence buds of Jatropha curcas exposed to cytokinin treatment.

PubMed

Chen, Mao-Sheng; Pan, Bang-Zhen; Wang, Gui-Juan; Ni, Jun; Niu, Longjian; Xu, Zeng-Fu

2014-11-30

Jatropha curcas L. is a potential biofuel plant. Application of exogenous cytokinin (6-benzyladenine, BA) on its inflorescence buds can significantly increase the number of female flowers, thereby improving seed yield. To investigate which genes and signal pathways are involved in the response to cytokinin in J. curcas inflorescence buds, we monitored transcriptional activity in inflorescences at 0, 3, 12, 24, and 48 h after BA treatment using a microarray. We detected 5,555 differentially expressed transcripts over the course of the experiment, which could be grouped into 12 distinct temporal expression patterns. We also identified 31 and 131 transcripts in J. curcas whose homologs in model plants function in flowering and phytohormonal signaling pathways, respectively. According to the transcriptional analysis of genes involved in flower development, we hypothesized that BA treatment delays floral organ formation by inhibiting the transcription of the A, B and E classes of floral organ-identity genes, which would allow more time to generate more floral primordia in inflorescence meristems, thereby enhancing inflorescence branching and significantly increasing flower number per inflorescence. BA treatment might also play an important role in maintaining the flowering signals by activating the transcription of GIGANTEA (GI) and inactivating the transcription of CONSTITUTIVE PHOTOMORPHOGENIC 1 (COP1) and TERMINAL FLOWER 1b (TFL1b). In addition, exogenous cytokinin treatment could regulate the expression of genes involved in the metabolism and signaling of other phytohormones, indicating that cytokinin and other phytohormones jointly regulate flower development in J. curcas inflorescence buds. Our study provides a framework to better understand the molecular mechanisms underlying changes in flowering traits in response to cytokinin treatment in J. curcas inflorescence buds. The results provide valuable information related to the mechanisms of cross-talk among multiple phytohormone signaling pathways in woody plants.

Ectopic expression of class 1 KNOX genes induce adventitious shoot regeneration and alter growth and development of tobacco (Nicotiana tabacum L) and European plum (Prunus domestica L).

PubMed

Srinivasan, C; Liu, Zongrang; Scorza, Ralph

2011-04-01

Transgenic plants of tobacco (Nicotiana tabacum L) and European plum (Prunus domestica L) were produced by transforming with the apple class 1 KNOX genes (MdKN1 and MdKN2) or corn KNOX1 gene. Transgenic tobacco plants were regenerated in vitro from transformed leaf discs cultured in a medium lacking cytokinin. Ectopic expression of KNOX genes retarded shoot growth by suppressing elongation of internodes in transgenic tobacco plants. Expression of each of the three KNOX1 genes induced malformation and extensive lobbing in tobacco leaves. In situ regeneration of adventitious shoots was observed from leaves and roots of transgenic tobacco plants expressing each of the three KNOX genes. In vitro culture of leaf explants and internode sections excised from in vitro grown MdKN1 expressing tobacco shoots regenerated adventitious shoots on MS (Murashige and Skoog 1962) basal medium in the absence of exogenous cytokinin. Transgenic plum plants that expressed the MdKN2 or corn KNOX1 gene grew normally but MdKN1 caused a significant reduction in plant height, leaf shape and size and produced malformed curly leaves. A high frequency of adventitious shoot regeneration (96%) was observed in cultures of leaf explants excised from corn KNOX1-expressing transgenic plum shoots. In contrast to KNOX1-expressing tobacco, leaf and internode explants of corn KNOX1-expressing plum required synthetic cytokinin (thidiazuron) in the culture medium to induce adventitious shoot regeneration. The induction of high-frequency regeneration of adventitious shoots in vitro from leaves and stem internodal sections of plum through the ectopic expression of a KNOX1 gene is the first such report for a woody perennial fruit trees.

Insulin-like growth factor-I gene delivery to astrocytes reduces their inflammatory response to lipopolysaccharide

PubMed Central

2011-01-01

Background Insulin-like growth factor-I (IGF-I) exerts neuroprotective actions in the central nervous system that are mediated at least in part by control of activation of astrocytes. In this study we have assessed the efficacy of exogenous IGF-I and IGF-I gene therapy in reducing the inflammatory response of astrocytes from cerebral cortex. Methods An adenoviral vector harboring the rat IGF-I gene and a control adenoviral vector harboring a hybrid gene encoding the herpes simplex virus type 1 thymidine kinase fused to Aequorea victoria enhanced green fluorescent protein were used in this study. Primary astrocytes from mice cerebral cortex were incubated for 24 h or 72 h with vehicle, IGF-I, the IGF-I adenoviral vector, or control vector; and exposed to bacterial lipopolysaccharide to induce an inflammatory response. IGF-I levels were measured by radioimmunoassay. Levels of interleukin 6, tumor necrosis factor-α, interleukin-1β and toll-like receptor 4 mRNA were assessed by quantitative real-time polymerase chain reaction. Levels of IGF-I receptor and IGF binding proteins 2 and 3 were assessed by western blotting. The subcellular distribution of nuclear factor κB (p65) was assessed by immunocytochemistry. Statistical significance was assessed by one way analysis of variance followed by the Bonferroni pot hoc test. Results IGF-I gene therapy increased IGF-I levels without affecting IGF-I receptors or IGF binding proteins. Exogenous IGF-I, and IGF-I gene therapy, decreased expression of toll-like receptor 4 and counteracted the lipopolysaccharide-induced inflammatory response of astrocytes. In addition, IGF-I gene therapy decreased lipopolysaccharide-induced translocation of nuclear factor κB (p65) to the cell nucleus. Conclusion These findings demonstrate efficacy of exogenous IGF-I and of IGF-I gene therapy in reducing the inflammatory response of astrocytes. IGF-I gene therapy may represent a new approach to reduce inflammatory reactions in glial cells. PMID:21371294

Resilience of Penicillium resedanum LK6 and exogenous gibberellin in improving Capsicum annuum growth under abiotic stresses.

PubMed

Khan, Abdul Latif; Waqas, Muhammad; Lee, In-Jung

2015-03-01

Understanding how endophytic fungi mitigate abiotic stresses in plants will be important in a changing global climate. A few endophytes can produce phytohormones, but their ability to induce physiological changes in host plants during extreme environmental conditions are largely unexplored. In the present study, we investigated the ability of Penicillium resedanum LK6 to produce gibberellins and its role in improving the growth of Capsicum annuum L. under salinity, drought, and heat stresses. These effects were compared with exogenous application of gibberellic acid (GA3). Endophyte treatment significantly increased shoot length, biomass, chlorophyll content, and the photosynthesis rate compared with the uninfected control during abiotic stresses. The endophyte and combined endophyte + GA3 treatments significantly ameliorated the negative effects of stresses compared with the control. Stress-responsive endogenous abscisic acid and its encoding genes, such as zeaxanthin epoxidase, 9-cis-epoxycarotenoid dioxygenase 3, and ABA aldehyde oxidase 3, were significantly reduced in endophyte-treated plants under stress. Conversely, salicylic acid and biosynthesis-related gene (isochorismate synthase) had constitutive expressions while pathogenesis related (PR1 and PR5) genes showed attenuated responses during endophyte treatment under abiotic stresses. The present findings suggest that endophytes have effects comparable to those of exogenous GA3; both can significantly increase plant growth and yield under changing environmental conditions by reprogramming the host plant's physiological responses.

Comparative Study on Reagents Involved in Grape Bud Break and Their Effects on Different Metabolites and Related Gene Expression during Winter

PubMed Central

Khalil-Ur-Rehman, Muhammad; Wang, Wu; Xu, Yan-Shuai; Haider, Muhammad S.; Li, Chun-Xia; Tao, Jian-Min

2017-01-01

To elucidate promoting and inhibiting effects of hydrogen cynamide (HC) and abscisic acid (ABA) on quiescence release of grape buds, physiological and molecular approaches were used to explore the mechanisms of quiescence based on metabolic and gene expression analysis. Physiological and molecular mechanisms involved in bud quiescence of grape were studied before and after application of HC, ABA, and ABA-HC. The data showed that ABA inhibited proclamation of quiescence in grape buds and attenuated the influence of HC. Bud quiescence was promoted and regulated by HC and ABA pre-treatment on buds of grape cultivar “Shine Muscat” with 5% HC, 100 μM ABA and combination of ABA-HC (5% HC+100 μM ABA) during quiescence under forcing condition. Exogenous application of ABA elevated superoxide dismutase (SOD), peroxidase (POD) and ascorbate peroxidase (APX) related specific activities, while catalase (CAT) activity was increased during initial period of forcing and then decreased. The concentration of plant growth hormones including gibberellins (GA) and indole acetic acid increased by HC application but decreased the ABA contents under forcing condition. ABA increased the fructose content during quiescence under forcing condition while sucrose and total soluble sugars peaked in HC treated buds as compared to control. Genes related to ABA pathway, protein phosphatase 2C (PP2C family) were down regulated in the buds treated with HC, ABA and ABA-HC as compared to control while two genes related to GA pathway (GID1 family), out of which one gene showed down regulation during initial period of forcing while other gene was up regulated in response to HC and ABA-HC treatments as compared to control. Exogenous ABA application up regulated genes related to antioxidant enzymes as compared to control. The gene probable fructose-bisphosphate aldolase 1, chloroplastic-like, was up regulated in response to ABA treatment as compared to control. Analysis of metabolites and related gene expression pattern would provide a comprehensive view of quiescence after HC, ABA, and ABA-HC treatments in grape buds which may helpful for ultimate improvement in table grape production. PMID:28824676

Toxic responses of Sox2 gene in the regeneration of the earthworm Eisenia foetida exposed to Retnoic acid.

PubMed

Tao, Jing; Rong, Wei; Diao, Xiaoping; Zhou, Hailong

2018-01-01

Exogenous retinoic acid delays and disturbs the regeneration of Eisenia foetida. The stem cell pluripotency factor, Sox2, can play a crucial role in cell reprogramming and dedifferentiation. In this study, we compared the regeneration of Eisenia foetida in different segments after amputation and the effects of retinoic acid on the regeneration of different segments. The results showed that the regeneration speed of the head and tail was slightly faster than the middle part, and retinoic acid disrupted and delayed the regeneration of the earthworm. The qRT-PCR and Western blot analysis showed that the expression of the Sox2 gene and Sox2 protein was highest on the seventh day in different segments (p<0.05). After treatment with retinoic acid, the expression level of the Sox2 gene and Sox2 protein was significantly reduced (p<0.05). The results indicated that the regeneration of earthworms and the formation of blastema are related to the expression of the Sox2 gene and protein. Retinoic acid delays and interferes with the regeneration of the earthworm by affecting the expression levels of the Sox2 gene and protein. Copyright © 2017 Elsevier Inc. All rights reserved.

Pyruvate Formate-Lyase Is Essential for Fumarate-Independent Anaerobic Glycerol Utilization in the Enterococcus faecalis Strain W11

PubMed Central

Ikegami, Yuki

2014-01-01

Although anaerobic glycerol metabolism in Enterococcus faecalis requires exogenous fumarate for NADH oxidation, E. faecalis strain W11 can metabolize glycerol in the absence of oxygen without exogenous fumarate. In this study, metabolic end product analyses and reporter assays probing the expression of enzymes involved in pyruvate metabolism were performed to investigate this fumarate-independent anaerobic metabolism of glycerol in W11. Under aerobic conditions, the metabolic end products of W11 cultured with glycerol were similar to those of W11 cultured with glucose. However, when W11 was cultured anaerobically, most of the glucose was converted to l-lactate, but glycerol was converted to ethanol and formate. During anaerobic culture with glycerol, the expression of the l-lactate dehydrogenase and pyruvate dehydrogenase E1αβ genes in W11 was downregulated, whereas the expression of the pyruvate formate-lyase (Pfl) and aldehyde/alcohol dehydrogenase genes was upregulated. These changes in the expression levels caused the change in the composition of end products. A pflB gene disruptant (Δpfl mutant) of W11 could barely utilize glycerol under anaerobic conditions, but the growth of the Δpfl mutant cultured with either glucose or dihydroxyacetone (DHA) under anaerobic conditions was the same as that of W11. Glucose metabolism and DHA generates one NADH molecule per pyruvate molecule, whereas glycerol metabolism in the dehydrogenation pathway generates two NADH molecules per pyruvate molecule. These findings demonstrate that NADH generated from anaerobic glycerol metabolism in the absence of fumarate is oxidized through the Pfl-ethanol fermentation pathway. Thus, Pfl is essential to avoid the accumulation of excess NADH during fumarate-independent anaerobic glycerol metabolism. PMID:24769696

Abscisic Acid (ABA) Regulation of Arabidopsis SR Protein Gene Expression

PubMed Central

Cruz, Tiago M. D.; Carvalho, Raquel F.; Richardson, Dale N.; Duque, Paula

2014-01-01

Serine/arginine-rich (SR) proteins are major modulators of alternative splicing, a key generator of proteomic diversity and flexible means of regulating gene expression likely to be crucial in plant environmental responses. Indeed, mounting evidence implicates splicing factors in signal transduction of the abscisic acid (ABA) phytohormone, which plays pivotal roles in the response to various abiotic stresses. Using real-time RT-qPCR, we analyzed total steady-state transcript levels of the 18 SR and two SR-like genes from Arabidopsis thaliana in seedlings treated with ABA and in genetic backgrounds with altered expression of the ABA-biosynthesis ABA2 and the ABA-signaling ABI1 and ABI4 genes. We also searched for ABA-responsive cis elements in the upstream regions of the 20 genes. We found that members of the plant-specific SC35-Like (SCL) Arabidopsis SR protein subfamily are distinctively responsive to exogenous ABA, while the expression of seven SR and SR-related genes is affected by alterations in key components of the ABA pathway. Finally, despite pervasiveness of established ABA-responsive promoter elements in Arabidopsis SR and SR-like genes, their expression is likely governed by additional, yet unidentified cis-acting elements. Overall, this study pinpoints SR34, SR34b, SCL30a, SCL28, SCL33, RS40, SR45 and SR45a as promising candidates for involvement in ABA-mediated stress responses. PMID:25268622

Unravelling proximate cues of mass flowering in the tropical forests of South-East Asia from gene expression analyses.

PubMed

Yeoh, Suat Hui; Satake, Akiko; Numata, Shinya; Ichie, Tomoaki; Lee, Soon Leong; Basherudin, Norlia; Muhammad, Norwati; Kondo, Toshiaki; Otani, Tatsuya; Hashim, Mazlan; Tani, Naoki

2017-10-01

Elucidating the physiological mechanisms of the irregular yet concerted flowering rhythm of mass flowering tree species in the tropics requires long-term monitoring of flowering phenology, exogenous and endogenous environmental factors, as well as identifying interactions and dependencies among these factors. To investigate the proximate factors for floral initiation of mast seeding trees in the tropics, we monitored the expression dynamics of two key flowering genes, meteorological conditions and endogenous resources over two flowering events of Shorea curtisii and Shorea leprosula in the Malay Peninsula. Comparisons of expression dynamics of genes studied indicated functional conservation of FLOWERING LOCUS T (FT) and LEAFY (LFY) in Shorea. The genes were highly expressed at least 1 month before anthesis for both species. A mathematical model considering the synergistic effect of cool temperature and drought on activation of the flowering gene was successful in predicting the observed gene expression patterns. Requirement of both cool temperature and drought for floral transition suggested by the model implies that flowering phenologies of these species are sensitive to climate change. Our molecular phenology approach in the tropics sheds light on the conserved role of flowering genes in plants inhabiting different climate zones and can be widely applied to dissect the flowering processes in other plant species. © 2017 John Wiley & Sons Ltd.

Introduction of Exogenous HSV-TK Suicide Gene Increases Safety of Keratinocyte-Derived Induced Pluripotent Stem Cells by Providing Genetic "Emergency Exit" Switch.

PubMed

Sułkowski, Maciej; Konieczny, Paweł; Chlebanowska, Paula; Majka, Marcin

2018-01-09

Since their invention in 2006, induced Pluripotent Stem (iPS) cells remain a great promise for regenerative medicine circumventing the ethical issues linked to Embryonic Stem (ES) cell research. iPS cells can be generated in a patient-specific manner as an unlimited source of various cell types for in vitro drug screening, developmental biology studies and regenerative use. Having the capacity of differentiating into the cells of all three primary germ layers, iPS cells have high potential to form teratoma tumors. This remains their main disadvantage and hazard which, until resolved, prevents utilization of iPS cells in clinic. Here, we present an approach for increasing iPS cells safety by introducing genetic modification-exogenous suicide gene Herpes Simplex Virus Thymidine Kinase ( HSV-TK ). Its expression results in specific vulnerability of genetically modified cells to prodrug-ganciclovir (GCV). We show that HSV-TK expressing cells can be eradicated both in vitro and in vivo with high specificity and efficiency with low doses of GCV. Described strategy increases iPS cells safety for future clinical applications by generating "emergency exit" switch allowing eradication of transplanted cells in case of their malfunction.

Effects of GhWUS from upland cotton (Gossypium hirsutum L.) on somatic embryogenesis and shoot regeneration.

PubMed

Xiao, Yanqing; Chen, Yanli; Ding, Yanpeng; Wu, Jie; Wang, Peng; Yu, Ya; Wei, Xi; Wang, Ye; Zhang, Chaojun; Li, Fuguang; Ge, Xiaoyang

2018-05-01

The WUSCHEL (WUS) gene encodes a plant-specific homeodomain-containing transcriptional regulator, which plays important roles during embryogenesis, as well as in the formation of shoot and flower meristems. Here, we isolated two homologues of Arabidopsis thaliana WUS (AtWUS), GhWUS1a_At and GhWUS1b_At, from upland cotton (Gossypium hirsutum). Domain analysis suggested that the two putative GhWUS proteins contained a highly conserved DNA-binding HOX domain and a WUS-box. Expression profile analysis showed that GhWUSs were predominantly expressed during the embryoid stage. Ectopic expression of GhWUSs in Arabidopsis could induce somatic embryo and shoot formation from seedling root tips. Furthermore, in the absence of exogenous hormone, overexpression of GhWUSs in Arabidopsis could promote shoot regeneration from excised roots, and in the presence of exogenous auxin, excised roots expressing GhWUS could be induced to produce somatic embryo. In addition, expression of the chimeric GhWUS repressor in cotton callus inhibited embryogenic callus formation. Our results show that GhWUS is an important regulator of somatic embryogenesis and shoot regeneration. Copyright © 2018 Elsevier B.V. All rights reserved.

Leaps and lulls in the developmental transcriptome of Dictyostelium discoideum.

PubMed

Rosengarten, Rafael David; Santhanam, Balaji; Fuller, Danny; Katoh-Kurasawa, Mariko; Loomis, William F; Zupan, Blaz; Shaulsky, Gad

2015-04-13

Development of the soil amoeba Dictyostelium discoideum is triggered by starvation. When placed on a solid substrate, the starving solitary amoebae cease growth, communicate via extracellular cAMP, aggregate by tens of thousands and develop into multicellular organisms. Early phases of the developmental program are often studied in cells starved in suspension while cAMP is provided exogenously. Previous studies revealed massive shifts in the transcriptome under both developmental conditions and a close relationship between gene expression and morphogenesis, but were limited by the sampling frequency and the resolution of the methods. Here, we combine the superior depth and specificity of RNA-seq-based analysis of mRNA abundance with high frequency sampling during filter development and cAMP pulsing in suspension. We found that the developmental transcriptome exhibits mostly gradual changes interspersed by a few instances of large shifts. For each time point we treated the entire transcriptome as single phenotype, and were able to characterize development as groups of similar time points separated by gaps. The grouped time points represented gradual changes in mRNA abundance, or molecular phenotype, and the gaps represented times during which many genes are differentially expressed rapidly, and thus the phenotype changes dramatically. Comparing developmental experiments revealed that gene expression in filter developed cells lagged behind those treated with exogenous cAMP in suspension. The high sampling frequency revealed many genes whose regulation is reproducibly more complex than indicated by previous studies. Gene Ontology enrichment analysis suggested that the transition to multicellularity coincided with rapid accumulation of transcripts associated with DNA processes and mitosis. Later development included the up-regulation of organic signaling molecules and co-factor biosynthesis. Our analysis also demonstrated a high level of synchrony among the developing structures throughout development. Our data describe D. discoideum development as a series of coordinated cellular and multicellular activities. Coordination occurred within fields of aggregating cells and among multicellular bodies, such as mounds or migratory slugs that experience both cell-cell contact and various soluble signaling regimes. These time courses, sampled at the highest temporal resolution to date in this system, provide a comprehensive resource for studies of developmental gene expression.

Generation of TALE nickase-mediated gene-targeted cows expressing human serum albumin in mammary glands.

PubMed

Luo, Yan; Wang, Yongsheng; Liu, Jun; Cui, Chenchen; Wu, Yongyan; Lan, Hui; Chen, Qi; Liu, Xu; Quan, Fusheng; Guo, Zekun; Zhang, Yong

2016-02-08

Targeting exogenous genes at milk protein loci via gene-targeting technology is an ideal strategy for producing large quantities of pharmaceutical proteins. Transcription-activator-like effector (TALE) nucleases (TALENs) are an efficient genome-editing tool. However, the off-target effects may lead to unintended gene mutations. In this study, we constructed TALENs and TALE nickases directed against exon 2 of the bovine β-lactoglobulin (BLG) locus. The nickases can induce a site-specific DNA single-strand break, without inducing double-strand break and nonhomologous end joining mediated gene mutation, and lower cell apoptosis rate than TALENs. After co-transfecting the bovine fetal fibroblasts with human serum albumin (HSA) gene-targeting vector and TALE nickase expression vectors, approximately 4.8% (40/835) of the cell clones contained HSA at BLG locus. Unexpectedly, one homozygous gene-targeted cell clone (1/835, 0.1%) was obtained by targeting both alleles of BLG in a single round of transfection. The recombinant protein mimicking the endogenous BLG was highly expressed and correctly folded in the mammary glands of the targeted cows, and the expression level of HSA was significantly increased in the homozygous targeted cows. Results suggested that the combination of TALE nickase-mediated gene targeting and somatic cell nuclear transfer is a feasible and safe approach in producing gene-targeted livestock.

Genome-wide analysis reveals inositol, not choline, as the major effector of Ino2p-Ino4p and unfolded protein response target gene expression in yeast.

PubMed

Jesch, Stephen A; Zhao, Xin; Wells, Martin T; Henry, Susan A

2005-03-11

In the yeast Saccharomyces cerevisiae, the transcription of many genes encoding enzymes of phospholipid biosynthesis are repressed in cells grown in the presence of the phospholipid precursors inositol and choline. A genome-wide approach using cDNA microarray technology was used to profile the changes in the expression of all genes in yeast that respond to the exogenous presence of inositol and choline. We report that the global response to inositol is completely distinct from the effect of choline. Whereas the effect of inositol on gene expression was primarily repressing, the effect of choline on gene expression was activating. Moreover, the combination of inositol and choline increased the number of repressed genes compared with inositol alone and enhanced the repression levels of a subset of genes that responded to inositol. In all, 110 genes were repressed in the presence of inositol and choline. Two distinct sets of genes exhibited differential expression in response to inositol or the combination of inositol and choline in wild-type cells. One set of genes contained the UASINO sequence and were bound by Ino2p and Ino4p. Many of these genes were also negatively regulated by OPI1, suggesting a common regulatory mechanism for Ino2p, Ino4p, and Opi1p. Another nonoverlapping set of genes was coregulated by the unfolded protein response pathway, an ER-localized stress response pathway, but was not dependent on OPI1 and did not show further repression when choline was present together with inositol. These results suggest that inositol is the major effector of target gene expression, whereas choline plays a minor role.

Genome Wide Analysis Reveals Inositol, not Choline, as the Major Effector of Ino2p-Ino4p and Unfolded Protein Response Target Gene Expression in Yeast

PubMed Central

Jesch, Stephen A.; Zhao, Xin; Wells, Martin T.; Henry, Susan A.

2005-01-01

SUMMARY In the yeast Saccharomyces cerevisiae the transcription of many genes encoding enzymes of phospholipid biosynthesis are repressed in cells grown in the presence of the phospholipid precursors inositol and choline. A genome-wide approach using cDNA microarray technology was utilized to profile the changes in the expression of all genes in yeast that respond to the exogenous presence of inositol and choline. We report that the global response to inositol is completely distinct from the effect of choline. Whereas the effect of inositol on gene expression was primarily repressing, the effect of choline on gene expression was activating. Moreover, the combination inositol and choline increased the number of repressed genes compared to inositol alone and enhanced the repression levels of a subset of genes that responded to inositol. In all, 110 genes were repressed in the presence of inositol and choline. Two distinct sets of genes exhibited differential expression in response to inositol or the combination of inositol and choline in wild type cells. One set of genes contained the UASINO sequence and were bound by Ino2p and Ino4p. Many of these genes were also negatively regulated by OPI1, suggesting a common regulatory mechanism for Ino2p, Ino4p, and Opi1p. Another non-overlapping set of genes were coregulated by the unfolded protein response pathway, an ER-localized stress response pathway, but were not dependent on OPI1 and did not show further repression when choline was present together with inositol. These results suggest that inositol is the major effector of target gene expression, while choline plays a minor role. PMID:15611057

Hospicells promote upregulation of the ATP-binding cassette genes by insulin-like growth factor-I via the JAK2/STAT3 signaling pathway in an ovarian cancer cell line.

PubMed

Benabbou, Nadia; Mirshahi, Pezhman; Cadillon, Mélodie; Soria, Jeannette; Therwath, Amu; Mirshahi, Massoud

2013-09-01

Interaction between tumor cells and their micro-environment has a crucial role in the development, progression and drug resistance of cancer. Our objective was to confirm the role of Hospicells, which are stromal cells from the cancer microenvironment, in drug resistance and tumor cell growth. We demonstrated that soluble factors secreted by Hospicells activate several genes and upregulate the JAK/STAT signaling pathway in ovarian cancer cell lines. Hospicells express all insulin-like growth factor (IGF) family as detected by gene array, RT-PCR, protein array and immunocytochemistry. While focusing attention on the microenvironment, we considered the role of IGF-I in proliferation and survival of ovarian cancer cells. Indeed, IGF-I is a major regulator of different stages of cancer development. We studied the effect of exogenously added IGF-I on the regulation of ATP-binding cassette (ABC) genes (MDR1, MRP1, MRP2, MRP3, MRP5 and BCRP) in the ovarian cancer cell line OVCAR3 and validated the results obtained using the IGF-IR antagonist picropodophyllin. IGF-I regulates the expression of ABC genes in OVCAR3 cells via the PI3-kinase, MEK and JAK2/STAT3 signaling pathways. The OVCAR3 cell line when co-cultured with Hospicells showed a marked degree of drug resistance. The drug resistance observed could be amplified with exogenous IGF-I. Addition of IGF-IR inhibitor, however, reduced the degree of resistance in these exposed cells. Cells that were treated with anticancer drugs and then exposed to IGF-I showed an increase in drug resistance and, thereby, an increase in cell survival. This observation indicates that drug resistance of OVCAR3 cells increases when there is synergy between OVCAR3 cells and Hospicells and it is amplified when IGF-I was exogenously added. In conclusion, inhibition of IGF-IR and targeting of the JAK2/STAT3 signaling pathway can be a target for ovarian cancer therapy.

Hospicells promote upregulation of the ATP-binding cassette genes by insulin-like growth factor-I via the JAK2/STAT3 signaling pathway in an ovarian cancer cell line

PubMed Central

BENABBOU, NADIA; MIRSHAHI, PEZHMAN; CADILLON, MÉLODIE; SORIA, JEANNETTE; THERWATH, AMU; MIRSHAHI, MASSOUD

2013-01-01

Interaction between tumor cells and their microenvironment has a crucial role in the development, progression and drug resistance of cancer. Our objective was to confirm the role of Hospicells, which are stromal cells from the cancer microenvironment, in drug resistance and tumor cell growth. We demonstrated that soluble factors secreted by Hospicells activate several genes and upregulate the JAK/STAT signaling pathway in ovarian cancer cell lines. Hospicells express all insulin-like growth factor (IGF) family as detected by gene array, RT-PCR, protein array and immunocytochemistry. While focusing attention on the microenvironment, we considered the role of IGF-I in proliferation and survival of ovarian cancer cells. Indeed, IGF-I is a major regulator of different stages of cancer development. We studied the effect of exogenously added IGF-I on the regulation of ATP-binding cassette (ABC) genes (MDR1, MRP1, MRP2, MRP3, MRP5 and BCRP) in the ovarian cancer cell line OVCAR3 and validated the results obtained using the IGF-IR antagonist picropodophyllin. IGF-I regulates the expression of ABC genes in OVCAR3 cells via the PI3-kinase, MEK and JAK2/STAT3 signaling pathways. The OVCAR3 cell line when co-cultured with Hospicells showed a marked degree of drug resistance. The drug resistance observed could be amplified with exogenous IGF-I. Addition of IGF-IR inhibitor, however, reduced the degree of resistance in these exposed cells. Cells that were treated with anticancer drugs and then exposed to IGF-I showed an increase in drug resistance and, thereby, an increase in cell survival. This observation indicates that drug resistance of OVCAR3 cells increases when there is synergy between OVCAR3 cells and Hospicells and it is amplified when IGF-I was exogenously added. In conclusion, inhibition of IGF-IR and targeting of the JAK2/STAT3 signaling pathway can be a target for ovarian cancer therapy. PMID:23857432

Stocking impacts the expression of candidate genes and physiological condition in introgressed brook charr (Salvelinus fontinalis) populations

PubMed Central

Lamaze, Fabien C; Garant, Dany; Bernatchez, Louis

2013-01-01

Translocation of plants and animal populations between environments is one of the major forms of anthropogenic perturbation experienced by pristine populations, and consequently, human-mediated hybridization by stocking practices between wild and exogenous conspecifics is of increasing concern. In this study, we compared the expression of seven candidate genes involved in multifactorial traits and regulatory pathways for growth as a function of level of introgressive hybridization between wild and domestic brook charr to test the null hypothesis of no effect of introgression on wild fish. Our analyses revealed that the expression of two of the genes tested, cytochrome c oxidase VIIa and the growth hormone receptor isoform I, was positively correlated with the level of introgression. We also observed a positive relationship between the extent of introgression and physiological status quantified by the Fulton's condition index. The expression of other genes was influenced by other variables, including year of sampling (reflecting different thermal conditions), sampling method and lake of origin. This is the first demonstration in nature that introgression from stocked populations has an impact on the expression of genes playing a role in important biological functions that may be related with fitness in wild introgressed populations. PMID:23467764

Effects of exogenous gamma-aminobutyric acid on α-amylase activity in the aleurone of barley seeds.

PubMed

Sheng, Yidi; Xiao, Huiyuan; Guo, Chunli; Wu, Hong; Wang, Xiaojing

2018-03-03

Gamma-aminobutyric acid (GABA), a nonprotein amino acid, often accumulates in plants exposed to certain environmental stimuli. Previous studies indicated that a closed relationship existed between endogenous GABA and seed germination. However, there are few studies on the effect of exogenous GABA on seed germination. The objective of this study was to explore whether exogenous GABA affected α-amylase activity which the activation is an important stage in seed germination. The level of endogenous GABA in barley seeds rose gradually during germination, suggesting that endogenous GABA was involved in germination. We measured starch degradation under application of various concentration GABA and found that GABA promoted seed starch degradation with a dose-responsive effect. The relationship between GABA and α-amylase activity was investigated by treating barley aleurone with exogenous GABA. The result showed that α-amylase activity began to rise after about 24 h and reached a peak at 48 h. Molecular evidence suggested that GABA increased α-amylase gene expression. We explore the possible roles played by GABA in signal transduction. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Intracellular biosynthesis of lipids and cholesterol by Scap and Insig in mesenchymal cells regulates long bone growth and chondrocyte homeostasis.

PubMed

Tsushima, Hidetoshi; Tang, Yuning J; Puviindran, Vijitha; Hsu, Shu-Hsuan Claire; Nadesan, Puviindran; Yu, Chunying; Zhang, Hongyuan; Mirando, Anthony J; Hilton, Matthew J; Alman, Benjamin A

2018-06-13

During enchondral ossification, mesenchymal cells express genes regulating the intracellular biosynthesis of cholesterol and lipids. Here we investigated conditional deletion of Scap or Insig1 and Insig2 (inhibits or activates intracellular biosynthesis respectively). Mesenchymal condensation and chondrogenesis was disrupted in mice lacking Scap in mesenchymal progenitors, while mice lacking the Insig genes in mesenchymal progenitors had short limbs, but normal chondrogenesis. Mice lacking Scap in chondrocytes showed severe dwarfism, with ectopic hypertrophic cells, while deletion of Insig genes in chondrocytes caused a mild dwarfism and shorting of the hypertrophic zone. In-vitro studies showed that intracellular cholesterol in chondrocytes can derive from exogenous and endogenous sources, but that exogenous sources cannot completely overcome the phenotypic effect of Scap deficiency. Genes encoding cholesterol biosynthetic proteins are regulated by Hedgehog (Hh) signaling, and Hh signaling is also regulated by intracellular cholesterol in chondrocytes, suggesting a feedback loop in chondrocyte differentiation. Precise regulation of intracellular biosynthesis is required for chondrocyte homeostasis and long bone growth, and this data supports pharmacologic modulation of cholesterol biosynthesis as a therapy for select cartilage pathologies. © 2018. Published by The Company of Biologists Ltd.

Diurnal Transcriptome and Gene Network Represented through Sparse Modeling in Brachypodium distachyon.

PubMed

Koda, Satoru; Onda, Yoshihiko; Matsui, Hidetoshi; Takahagi, Kotaro; Yamaguchi-Uehara, Yukiko; Shimizu, Minami; Inoue, Komaki; Yoshida, Takuhiro; Sakurai, Tetsuya; Honda, Hiroshi; Eguchi, Shinto; Nishii, Ryuei; Mochida, Keiichi

2017-01-01

We report the comprehensive identification of periodic genes and their network inference, based on a gene co-expression analysis and an Auto-Regressive eXogenous (ARX) model with a group smoothly clipped absolute deviation (SCAD) method using a time-series transcriptome dataset in a model grass, Brachypodium distachyon . To reveal the diurnal changes in the transcriptome in B. distachyon , we performed RNA-seq analysis of its leaves sampled through a diurnal cycle of over 48 h at 4 h intervals using three biological replications, and identified 3,621 periodic genes through our wavelet analysis. The expression data are feasible to infer network sparsity based on ARX models. We found that genes involved in biological processes such as transcriptional regulation, protein degradation, and post-transcriptional modification and photosynthesis are significantly enriched in the periodic genes, suggesting that these processes might be regulated by circadian rhythm in B. distachyon . On the basis of the time-series expression patterns of the periodic genes, we constructed a chronological gene co-expression network and identified putative transcription factors encoding genes that might be involved in the time-specific regulatory transcriptional network. Moreover, we inferred a transcriptional network composed of the periodic genes in B. distachyon , aiming to identify genes associated with other genes through variable selection by grouping time points for each gene. Based on the ARX model with the group SCAD regularization using our time-series expression datasets of the periodic genes, we constructed gene networks and found that the networks represent typical scale-free structure. Our findings demonstrate that the diurnal changes in the transcriptome in B. distachyon leaves have a sparse network structure, demonstrating the spatiotemporal gene regulatory network over the cyclic phase transitions in B. distachyon diurnal growth.

Regulation of zinc homeostasis by inducible NO synthase-derived NO: nuclear metallothionein translocation and intranuclear Zn2+ release.

PubMed

Spahl, Daniela U; Berendji-Grün, Denise; Suschek, Christoph V; Kolb-Bachofen, Victoria; Kröncke, Klaus-D

2003-11-25

Zn2+ is critical for the functional and structural integrity of cells and contributes to a number of important processes including gene expression. It has been shown that NO exogenously applied via NO donors resulting in nitrosative stress leads to cytoplasmic Zn2+ release from the zinc storing protein metallothionein (MT) and probably other proteins that complex Zn2+ via cysteine thiols. We show here that, in cytokine-activated murine aortic endothelial cells, NO derived from the inducible NO synthase (iNOS) induces a transient nuclear release of Zn2+. This nuclear Zn2+ release depends on the presence of MT as shown by the lack of this effect in activated endothelial cells from MT-deficient mice and temporally correlates with nuclear MT translocation. Data also show that NO is an essential but not sufficient signal for MT-mediated Zn2+ trafficking from the cytoplasm into the nucleus. In addition, we found that, endogenously via iNOS, synthesized NO increases the constitutive mRNA expression of both MT-1 and MT-2 genes and that nitrosative stress exogenously applied via an NO donor increases constitutive MT mRNA expression via intracellular Zn2+ release. In conclusion, we here provide evidence for a signaling mechanism based on iNOS-derived NO through the regulation of intracellular Zn2+ trafficking and homeostasis.

Regulation of zinc homeostasis by inducible NO synthase-derived NO: Nuclear metallothionein translocation and intranuclear Zn2+ release

PubMed Central

Spahl, Daniela U.; Berendji-Grün, Denise; Suschek, Christoph V.; Kolb-Bachofen, Victoria; Kröncke, Klaus-D.

2003-01-01

Zn2+ is critical for the functional and structural integrity of cells and contributes to a number of important processes including gene expression. It has been shown that NO exogenously applied via NO donors resulting in nitrosative stress leads to cytoplasmic Zn2+ release from the zinc storing protein metallothionein (MT) and probably other proteins that complex Zn2+ via cysteine thiols. We show here that, in cytokine-activated murine aortic endothelial cells, NO derived from the inducible NO synthase (iNOS) induces a transient nuclear release of Zn2+. This nuclear Zn2+ release depends on the presence of MT as shown by the lack of this effect in activated endothelial cells from MT-deficient mice and temporally correlates with nuclear MT translocation. Data also show that NO is an essential but not sufficient signal for MT-mediated Zn2+ trafficking from the cytoplasm into the nucleus. In addition, we found that, endogenously via iNOS, synthesized NO increases the constitutive mRNA expression of both MT-1 and MT-2 genes and that nitrosative stress exogenously applied via an NO donor increases constitutive MT mRNA expression via intracellular Zn2+ release. In conclusion, we here provide evidence for a signaling mechanism based on iNOS-derived NO through the regulation of intracellular Zn2+ trafficking and homeostasis. PMID:14617770

Exogenous retinoic acid induces digit reduction in opossums (Monodelphis domestica) by disrupting cell death and proliferation, and apical ectodermal ridge and zone of polarizing activity function.

PubMed

Molineaux, Anna C; Maier, Jennifer A; Schecker, Teresa; Sears, Karen E

2015-03-01

Retinoic acid (RA) is a vitamin A derivative. Exposure to exogenous RA generates congenital limb malformations (CLMs) in species from frogs to humans. These CLMs include but are not limited to oligodactyly and long-bone hypoplasia. The processes by which exogenous RA induces CLMs in mammals have been best studied in mouse, but as of yet remain unresolved. We investigated the impact of exogenous RA on the cellular and molecular development of the limbs of a nonrodent model mammal, the opossum Monodelphis domestica. Opossums exposed to exogenous retinoic acid display CLMs including oligodactly, and results are consistent with opossum development being more susceptible to RA-induced disruptions than mouse development. Exposure of developing opossums to exogenous RA leads to an increase in cell death in the limb mesenchyme that is most pronounced in the zone of polarizing activity, and a reduction in cell proliferation throughout the limb mesenchyme. Exogenous RA also disrupts the expression of Shh in the zone of polarizing activity, and Fgf8 in the apical ectodermal ridge, and other genes with roles in the regulation of limb development and cell death. Results are consistent with RA inducing CLMs in opossum limbs by disrupting the functions of the apical ectodermal ridge and zone of polarizing activity, and driving an increase in cell death and reduction of cell proliferation in the mesenchyme of the developing limb. © 2015 Wiley Periodicals, Inc.

Sequencing and Validation of Reference Genes to Analyze Endogenous Gene Expression and Quantify Yellow Dwarf Viruses Using RT-qPCR in Viruliferous Rhopalosiphum padi

PubMed Central

Wu, Keke; Liu, Wenwen; Mar, Thithi; Liu, Yan; Wu, Yunfeng; Wang, Xifeng

2014-01-01

The bird cherry-oat aphid (Rhopalosiphum padi), an important pest of cereal crops, not only directly sucks sap from plants, but also transmits a number of plant viruses, collectively the yellow dwarf viruses (YDVs). For quantifying changes in gene expression in vector aphids, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is a touchstone method, but the selection and validation of housekeeping genes (HKGs) as reference genes to normalize the expression level of endogenous genes of the vector and for exogenous genes of the virus in the aphids is critical to obtaining valid results. Such an assessment has not been done, however, for R. padi and YDVs. Here, we tested three algorithms (GeNorm, NormFinder and BestKeeper) to assess the suitability of candidate reference genes (EF-1α, ACT1, GAPDH, 18S rRNA) in 6 combinations of YDV and vector aphid morph. EF-1α and ACT1 together or in combination with GAPDH or with GAPDH and 18S rRNA could confidently be used to normalize virus titre and expression levels of endogenous genes in winged or wingless R. padi infected with Barley yellow dwarf virus isolates (BYDV)-PAV and BYDV-GAV. The use of only one reference gene, whether the most stably expressed (EF-1α) or the least stably expressed (18S rRNA), was not adequate for obtaining valid relative expression data from the RT-qPCR. Because of discrepancies among values for changes in relative expression obtained using 3 regions of the same gene, different regions of an endogenous aphid gene, including each terminus and the middle, should be analyzed at the same time with RT-qPCR. Our results highlight the necessity of choosing the best reference genes to obtain valid experimental data and provide several HKGs for relative quantification of virus titre in YDV-viruliferous aphids. PMID:24810421

Hemin offers neuroprotection through inducing exogenous neuroglobin in focal cerebral hypoxic-ischemia in rats

PubMed Central

Song, Xue; Xu, Rui; Xie, Fei; Zhu, Haiyuan; Zhu, Ji; Wang, Xin

2014-01-01

Objective: To investigate the inducible effect of hemin on exogenous neuroglobin (Ngb) in focal cerebral hypoxic-ischemia in rats. Methods: 125 healthy SD rats were randomly divided into five groups: sham-operation control group, operation group, hemin treatment group, exogenous Ngb treatment group, and hemin and exogenous Ngb joint treatment group. Twenty-four hours after focal cerebral hypoxic-ischemia, Ngb expression was evaluated by immunocytochemistry, RT-PCR, and western blot analyses, while the brain water content and infarct volume were examined. Results: Immunocytochemistry, RT-PCR, and western blot analyses showed more pronounced Ngb expression in the hemin and exogenous Ngb joint operation group than in the hemin or exogenous Ngb individual treatment groups, thus producing significant differences in brain water content and infarct volume (p < 0.05). Conclusions: Hemin may be beneficial in protecting against focal cerebral hypoxic-ischemia through inducing the expression of exogenous Ngb. PMID:24966924

Comparative physiological, metabolomic, and transcriptomic analyses reveal mechanisms of improved abiotic stress resistance in bermudagrass [Cynodon dactylon (L). Pers.] by exogenous melatonin.

PubMed

Shi, Haitao; Jiang, Chuan; Ye, Tiantian; Tan, Dun-Xian; Reiter, Russel J; Zhang, Heng; Liu, Renyi; Chan, Zhulong

2015-02-01

Melatonin (N-acetyl-5-methoxytryptamine), a well-known animal hormone, is also involved in plant development and abiotic stress responses. In this study, it is shown that exogenous application of melatonin conferred improved salt, drought, and cold stress resistances in bermudagrass. Moreover, exogenous melatonin treatment alleviated reactive oxygen species (ROS) burst and cell damage induced by abiotic stress; this involved activation of several antioxidants. Additionally, melatonin-pre-treated plants exhibited higher concentrations of 54 metabolites, including amino acids, organic acids, sugars, and sugar alcohols, than non-treated plants under abiotic stress conditions. Genome-wide transcriptomic profiling identified 3933 transcripts (2361 up-regulated and 1572 down-regulated) that were differentially expressed in melatonin-treated plants versus controls. Pathway and gene ontology (GO) term enrichment analyses revealed that genes involved in nitrogen metabolism, major carbohydrate metabolism, tricarboxylic acid (TCA)/org transformation, transport, hormone metabolism, metal handling, redox, and secondary metabolism were over-represented after melatonin pre-treatment. Taken together, this study provides the first evidence of the protective roles of exogenous melatonin in the bermudagrass response to abiotic stresses, partially via activation of antioxidants and modulation of metabolic homeostasis. Notably, metabolic and transcriptomic analyses showed that the underlying mechanisms of melatonin could involve major reorientation of photorespiratory and carbohydrate and nitrogen metabolism. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Optimized heterologous transfection of viable adult organotypic brain slices using an enhanced gene gun

PubMed Central

2013-01-01

Background Organotypic brain slices (OTBS) are an excellent experimental compromise between the facility of working with cell cultures and the biological relevance of using animal models where anatomical, morphological, and cellular function of specific brain regions can be maintained. The biological characteristics of OTBS can subsequently be examined under well-defined conditions. They do, however, have a number of limitations; most brain slices are derived from neonatal animals, as it is difficult to properly prepare and maintain adult OTBS. There are ample problems with tissue integrity as OTBS are delicate and frequently become damaged during the preparative stages. Notwithstanding these obstacles, the introduced exogenous proteins into both neuronal cells, and cells imbedded within tissues, have been consistently difficult to achieve. Results Following the ex vivo extraction of adult mouse brains, mounted inside a medium-agarose matrix, we have exploited a precise slicing procedure using a custom built vibroslicer. To transfect these slices we used an improved biolistic transfection method using a custom made low-pressure barrel and novel DNA-coated nanoparticles (40 nm), which are drastically smaller than traditional microparticles. These nanoparticles also minimize tissue damage as seen by a significant reduction in lactate dehydrogenase activity as well as propidium iodide (PI) and dUTP labelling compared to larger traditional gold particles used on these OTBS. Furthermore, following EYFP exogene delivery by gene gun, the 40 nm treated OTBS displayed a significantly larger number of viable NeuN and EYFP positive cells. These OTBS expressed the exogenous proteins for many weeks. Conclusions Our described methodology of producing OTBS, which results in better reproducibility with less tissue damage, permits the exploitation of mature fully formed adult brains for advanced neurobiological studies. The novel 40 nm particles are ideal for the viable biolistic transfection of OTBS by reducing tissue stress while maintaining long term exogene expression. PMID:24354851

Creation of an In vivo cytosensor using engineered mesangial cells. Automatic sensing of glomerular inflammation controls transgene activity.

PubMed

Kitamura, M; Kawachi, H

1997-09-15

Automatic control over exogenous gene expression in response to the activity of disease is a crucial hurdle for gene transfer-based therapies. Towards achieving this goal, we created a "cytosensor" that perceives local inflammatory states and subsequently regulates foreign gene expression. alpha-Smooth muscle actin is known to be expressed in glomerular mesangial cells exclusively in pathologic situations. CArG box element, the crucial regulatory sequence of the alpha-smooth muscle actin promoter, was used as a sensor for glomerular inflammation. Rat mesangial cells were stably transfected with an expression plasmid that introduces a beta-galactosidase gene under the control of CArG box elements. In vitro, the established cells expressed beta-galactosidase exclusively after stimulation with serum. To examine whether the cells are able to automatically control transgene activity in vivo, serum-stimulated or unstimulated cells were transferred into normal rat glomeruli or glomeruli subjected to anti-Thy 1 glomerulonephritis. When stimulated cells were transferred into the normal glomeruli, beta-galactosidase expression was switched off in vivo within 3 d. In contrast, when unstimulated cells were transferred into the nephritic glomeruli, transgene expression was substantially induced. These data indicate the feasibility of using the CArG box element as a molecular sensor for glomerular injury. In the context of advanced forms of gene therapy, this approach provides a novel concept for automatic regulation of local transgene expression where the transgene is required to be activated during inflammation and deactivated when the inflammation has subsided.

Females with reduced fertility have excess androstenedione in follicular fluid, altered theca gene expression and increased VEGFA164b, maternal effect, and microRNA processing mRNA levels in cumulus-oocyte complexes

USDA-ARS?s Scientific Manuscript database

Ovarian dysfunction contributes significantly to female infertility. However, the intrinsic and exogenous factors that result in abnormal ovarian function are poorly defined. Thus, we have established a cow model of fertility to identify mechanisms regulating follicular growth, steroidogenesis and o...

High density growth of T7 expression strains with auto-induction option

DOEpatents

Studier, F. William

2013-03-19

A method for promoting and suppressing auto-induction of transcription of a cloned gene 1 of bacteriophage T7 in cultures of bacterial cells grown batchwise is disclosed. The transcription is under the control of a promoter whose activity can be induced by an exogenous inducer whose ability to induce said promoter is dependent on the metabolic state of said bacterial cells.

Gene therapy of the brain: the trans-vascular approach.

PubMed

Schlachetzki, Felix; Zhang, Yun; Boado, Ruben J; Pardridge, William M

2004-04-27

Many chronic neurologic diseases do not respond to small molecule therapeutics, and have no effective long-term therapy. Gene therapy offers the promise of an effective cure for both genetic and acquired brain disease. However, the limiting problem in brain gene therapy is delivery to brain followed by regulation of the expression of the transgene. Present day gene vectors do not cross the blood-brain barrier (BBB). Consequently, brain gene therapy requires craniotomy and the local injection of a viral gene vector. However, there are few brain disorders that can be effectively treated with local injection. Most applications of gene therapy require global expression in the brain of the exogenous gene, and this can only be achieved with a noninvasive delivery through the BBB--the trans-vascular route to brain. An additional consideration is the potential toxicity of all viral and nonviral approaches, which may either integrate into the host genome and cause insertional mutagenesis or cause inflammation in the brain. Nonviral, noninvasive gene therapy of the brain is now possible with the development of a new approach to targeting therapeutic genes to the brain following an IV administration. This approach utilizes genetically engineered molecular Trojan horses, which ferry the gene across the BBB and into neurons. Global and reversible expression of therapeutic genes in the human brain without surgery and without viral vectors is now possible.

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

The PLUTO plastidial nucleobase transporter also transports the thiamin precursor hydroxymethylpyrimidine

PubMed Central

Beaudoin, Guillaume A.W.; Johnson, Timothy S.; Hanson, Andrew D.

2018-01-01

In plants, the hydroxymethylpyrimidine (HMP) and thiazole precursors of thiamin are synthesized and coupled together to form thiamin in plastids. Mutants unable to form HMP can be rescued by exogenous HMP, implying the presence of HMP transporters in the plasma membrane and plastids. Analysis of bacterial genomes revealed a transporter gene that is chromosomally clustered with thiamin biosynthesis and salvage genes. Its closest Arabidopsis homolog, the plastidic nucleobase transporter (PLUTO), is co-expressed with several thiamin biosynthetic enzymes. Heterologous expression of PLUTO in Escherichia coli or Saccharomyces cerevisiae increased sensitivity to a toxic HMP analog, and disrupting PLUTO in an HMP-requiring Arabidopsis line reduced root growth at low HMP concentrations. These data implicate PLUTO in plastidial transport and salvage of HMP. PMID:29507060

Wheat bHLH-type transcription factor gene TabHLH1 is crucial in mediating osmotic stresses tolerance through modulating largely the ABA-associated pathway.

PubMed

Yang, Tongren; Yao, Sufei; Hao, Lin; Zhao, Yuanyuan; Lu, Wenjing; Xiao, Kai

2016-11-01

Wheat bHLH family gene TabHLH1 is responsive to drought and salt stresses, and it acts as one crucial regulator in mediating tolerance to aforementioned stresses largely through an ABA-associated pathway. Osmotic stresses are adverse factors for plant growth and crop productivity. In this study, we characterized TabHLH1, a gene encoding wheat bHLH-type transcription factor (TF) protein, in mediating plant adaptation to osmotic stresses. TabHLH1 protein contains a conserved basic-helix-loop-helix (bHLH) domain shared by its plant counterparts. Upon PEG-simulated drought stress, salt stress, and exogenous abscisic acid (ABA), the TabHLH1 transcripts in roots and leaves were induced. Under PEG-simulated drought stress and salt stress treatments, the tobacco seedlings with TabHLH1 overexpression exhibited improved growth and osmotic stress-associated traits, showing increased biomass and reduced leaf water loss rate (WLR) relative to wild type (WT). The transgenic lines also possessed promoted stomata closure under drought stress, salt stress, and exogenous ABA and increased proline and soluble sugar contents and reduced hydrogen peroxide (H 2 O 2 ) amount under osmotic stress conditions, indicating that TabHLH1-mediated osmolyte accumulation and cellular ROS homeostasis contributed to the drought stress and salt stress tolerance. NtPYL12 and NtSAPK2;1, the genes encoding ABA receptor and SnRK2 family kinase, respectively, showed up-regulated expression in lines overexpressing TabHLH1 under osmotic stress and exogenous ABA conditions; overexpression of them conferred plants modified stomata movement, leaf WLR, and growth feature under drought and high salinity, suggesting that these ABA-signaling genes are mediated by wheat TabHLH1 gene and involved in regulating plant responses to simulated drought and salt stresses. Our investigation indicates that the TabHLH1 gene plays critical roles in plant tolerance to osmotic stresses largely through an ABA-dependent pathway.

Activation-induced cytidine deaminase (AID) is strongly expressed in the fetal bovine ileal Peyer's patch and spleen and is associated with expansion of the primary antibody repertoire in the absence of exogenous antigens.

PubMed

Liljavirta, J; Ekman, A; Knight, J S; Pernthaner, A; Iivanainen, A; Niku, M

2013-09-01

Due to a limited range of immunoglobulin (Ig) genes, cattle and several other domestic animals rely on postrecombinatorial amplification of the primary repertoire. We report that activation-induced cytidine deaminase (AID) is strongly expressed in the fetal bovine ileal Peyer's patch and spleen but not in fetal bone marrow. The numbers of IGHV (immunoglobulin heavy chain variable) mutations correlate with AID expression. The mutational profile in the fetuses is similar to postnatal and immunized calves, with targeting of complementarity-determining region (CDR) over framework region (FR), preference of replacement over silent mutations in CDRs but not in FRs, and targeting of the AID hotspot motif RGYW/WRCY. Statistical analysis indicates negative selection on FRs and positive selection on CDRs. Our results suggest that AID-mediated somatic hypermutation and selection take place in bovine fetuses, implying a role for AID in the diversification of the primary antibody repertoire in the absence of exogenous antigens.

Tumor suppressor function of Betaig-H3 gene in radiation carcinogenesis

NASA Astrophysics Data System (ADS)

Zhao, Y. L.; Piao, C. Q.; Hei, T. K.

Interaction between cell and extracellular matrix (ECM) plays a crucial role in tumor invasiveness and metastasis. Using an immortalized human bronchial epithelial (BEP2D) cell model, we showed previously that expression of a list of genes including Betaig-h3 (induced by transforming growth factor-β) DCC (deleted in colorectal cancer), p21 cip1, c-fos , Heat shock protein (HSP27) and cytokeratin 14 were differentially expressed in several independently generated, radiation-induced tumor cell lines (TL1-TL5) relative to parental BEP2D cells. Our previous data further demonstrated that loss of tumor suppressor gene(s) as a likely mechanism of radiation carcinogenesis. In the present study, we chose Betaig-h3 and DCC that were downregulated in tumorigenic cells for further study. Restored expression of Betaig-h3 gene, not DCC gene, by transfecting cDNA into tumor cells resulted in a significant reduction in tumor growth. While integrin receptor α5β1 was overexpressed in tumor cells, its expression was corrected to the level found in control BEP2D cells after Betaig-h3 transfection. These data suggest that Betaig-h3 gene is involved in tumor progression by regulating integrin α5β1 receptor. Furthermore, exogenous TGF-β1 induced expression of Betaig-h3 gene and inhibited the growth of both control and tumorigenic BEP2D cells. Therefore, downregulation of Betaig-h3 gene may results from the decreased expression of upstream mediators such as TGF-β. The findings provide strong evidence that the Betaig-h3 gene has tumor suppressor function in radiation-induced tumorigenic human bronchial epithelial cells and suggest a potential target for interventional therapy.

Phylogenetic analysis of IDD gene family and characterization of its expression in response to flower induction in Malus.

PubMed

Fan, Sheng; Zhang, Dong; Xing, Libo; Qi, Siyan; Du, Lisha; Wu, Haiqin; Shao, Hongxia; Li, Youmei; Ma, Juanjuan; Han, Mingyu

2017-08-01

Although INDETERMINATE DOMAIN (IDD) genes encoding specific plant transcription factors have important roles in plant growth and development, little is known about apple IDD (MdIDD) genes and their potential functions in the flower induction. In this study, we identified 20 putative IDD genes in apple and named them according to their chromosomal locations. All identified MdIDD genes shared a conserved IDD domain. A phylogenetic analysis separated MdIDDs and other plant IDD genes into four groups. Bioinformatic analysis of chemical characteristics, gene structure, and prediction of protein-protein interactions demonstrated the functional and structural diversity of MdIDD genes. To further uncover their potential functions, we performed analysis of tandem, synteny, and gene duplications, which indicated several paired homologs of IDD genes between apple and Arabidopsis. Additionally, genome duplications also promoted the expansion and evolution of the MdIDD genes. Quantitative real-time PCR revealed that all the MdIDD genes showed distinct expression levels in five different tissues (stems, leaves, buds, flowers, and fruits). Furthermore, the expression levels of candidate MdIDD genes were also investigated in response to various circumstances, including GA treatment (decreased the flowering rate), sugar treatment (increased the flowering rate), alternate-bearing conditions, and two varieties with different-flowering intensities. Parts of them were affected by exogenous treatments and showed different expression patterns. Additionally, changes in response to alternate-bearing and different-flowering varieties of apple trees indicated that they were also responsive to flower induction. Taken together, our comprehensive analysis provided valuable information for further analysis of IDD genes aiming at flower induction.

Recent advances in the development of new transgenic animal technology.

PubMed

Miao, Xiangyang

2013-03-01

Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

A snapshot of gene therapy in Latin America.

PubMed

Linden, Rafael; Matte, Ursula

2014-03-01

Gene therapy attempts the insertion and expression of exogenous genetic material in cells for therapeutic purposes. Conceived in the 1960s, gene therapy reached its first clinical trial at the end of the 1980s and by December 2013 around 600 genuine open clinical trials of gene therapy were registered at NIH Clinical Trials Database. Here, we summarize the current efforts towards the development of gene therapy in Latin America. Our survey shows that the number of scientists involved in the development of gene therapy and DNA vaccines in Latin America is still very low. Higher levels of investment in this technology are necessary to boost the advancement of innovation and intellectual property in this field in a way that would ease both the social and financial burden of various medical conditions in Latin America.

Comparative analysis of temporal gene expression patterns in the developing ovary of the embryonic chicken

PubMed Central

YU, Minli; XU, Yali; YU, Defu; YU, Debing; DU, Wenxing

2015-01-01

Many genes participate in the process of ovarian germ cell development, while the combined action mechanisms of these molecular regulators still need clarification. The present study was focused on determination of differentially expressed genes and gene functions at four critical time points in chicken ovarian development. Comparative transcriptional profiling of ovaries from embryonic day 5.5 (E5.5), E12.5, E15.5 and E18.5 was performed using an Affymetrix GeneChip chicken genome microarray. Differential expression patterns for genes specifically depleted and enriched in each stage were identified. The results showed that most of the up- and downregulated genes were involved in the metabolism of retinoic acid (RA) and synthesis of hormones. Among them, a higher number of up- and downregulated genes in the E15.5 ovary were identified as being involved in steroid biosynthesis and retinol metabolism, respectively. To validate gene changes, expressions of twelve candidate genes related to germ cell development were examined by real-time PCR and found to be consistent with the of GeneChip data. Moreover, the immunostaining results suggested that ovarian development during different stages was regulated by different genes. Furthermore, a Raldh2 knockdown chicken model was produced to investigate the fundamental role of Raldh2 in meiosis initiation. It was found that meiosis occurred abnormally in Raldh2 knockdown ovaries, but the inhibitory effect on meiosis was reversed by the addition of exogenous RA. This study offers insights into the profile of gene expression and mechanisms regulating ovarian development, especially the notable role of Raldh2 in meiosis initiation in the chicken. PMID:25736178

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

Structure and Function of the Macrolide Biosensor Protein, MphR(A), with and without Erythromycin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Jianting; Sagar, Vatsala; Smolinsky, Adam

2009-09-02

The regulatory protein MphR(A) has recently seen extensive use in synthetic biological applications, such as metabolite sensing and exogenous control of gene expression. This protein negatively regulates the expression of a macrolide 2{prime}-phosphotransferase I resistance gene (mphA) via binding to a 35-bp DNA operator upstream of the start codon and is de-repressed by the presence of erythromycin. Here, we present the refined crystal structure of the MphR(A) protein free of erythromycin and that of the MphR(A) protein with bound erythromycin at 2.00- and 1.76-{angstrom} resolutions, respectively. We also studied the DNA binding properties of the protein and identified mutants ofmore » MphR(A) that are defective in gene repression and ligand binding in a cell-based reporter assay. The combination of these two structures illustrates the molecular basis of erythromycin-induced gene expression and provides a framework for additional applied uses of this protein in the isolation and engineered biosynthesis of polyketide natural products.« less

The effects of exogenous cortisol on myostatin transcription in rainbow trout, Oncorhynchus mykiss

PubMed Central

Galt, Nicholas J.; Froehlich, Jacob Michael; Remily, Ethan A.; Romero, Sinibaldo R.; Biga, Peggy R.

2014-01-01

Glucocorticoids (GCs) strongly regulate myostatin transcript levels in mammals via glucocorticoid response elements (GREs) in the myostatin promoter, and bioinformatics methods suggest that this regulatory mechanism is conserved among many vertebrates. However, the multiple myostatin genes found in some fishes may be an exception. In rainbow trout (Oncorhynchus mykiss), two genome duplication events have produced three putatively functional myostatin genes, myostatin-1a, -1b and -2a, which are ubiquitously and differentially expressed. In addition, in silico promoter analyses of the rainbow trout myostatin promoters have failed to identify putative GREs, suggesting a divergence in myostatin function. Therefore, we hypothesized that myostatin mRNA expression is not regulated by glucocorticoids in rainbow trout. In this study, both juvenile rainbow trout and primary trout myoblasts were treated with cortisol to examine the relationship between this glucocorticoid and myostatin mRNA expression. Results suggest that exogenous cortisol does not regulate myostatin-1a and -1b expression in vivo, as myostatin mRNA levels were not significantly affected by cortisol treatment in either red or white muscle tissue. In red muscle, myostatin-2a levels were significantly elevated in the cortisol treatment group relative to the control, but not the vehicle control, at both 12 h and 24 h post-injection. As such, it is unclear if cortisol was acting alone or in combination with the vehicle. Cortisol increased myostatin-1b expression in a dose-dependent manner in vitro. Further work is needed to determine if this response is the direct result of cortisol acting on the myostatin-1b promoter or through an alternative mechanism. These results suggest that regulation of myostatin by cortisol may not be as highly conserved as previously thought and support previous work that describes potential functional divergence of the multiple myostatin genes in fishes. PMID:24875565

Improving the Immunogenicity of the Mycobacterium bovis BCG Vaccine by Non-Genetic Bacterial Surface Decoration Using the Avidin-Biotin System.

PubMed

Liao, Ting-Yu Angela; Lau, Alice; Joseph, Sunil; Hytönen, Vesa; Hmama, Zakaria

2015-01-01

Current strategies to improve the current BCG vaccine attempt to over-express genes encoding specific M. tuberculosis (Mtb) antigens and/or regulators of antigen presentation function, which indeed have the potential to reshape BCG in many ways. However, these approaches often face serious difficulties, in particular the efficiency and stability of gene expression via nucleic acid complementation and safety concerns associated with the introduction of exogenous DNA. As an alternative, we developed a novel non-genetic approach for rapid and efficient display of exogenous proteins on bacterial cell surface. The technology involves expression of proteins of interest in fusion with a mutant version of monomeric avidin that has the feature of reversible binding to biotin. Fusion proteins are then used to decorate the surface of biotinylated BCG. Surface coating of BCG with recombinant proteins was highly reproducible and stable. It also resisted to the freeze-drying shock routinely used in manufacturing conventional BCG. Modifications of BCG surface did not affect its growth in culture media neither its survival within the host cell. Macrophages phagocytized coated BCG bacteria, which efficiently delivered their surface cargo of avidin fusion proteins to MHC class I and class II antigen presentation compartments. Thereafter, chimeric proteins corresponding to a surrogate antigen derived from ovalbumin and the Mtb specific ESAT6 antigen were generated and tested for immunogenicity in vaccinated mice. We found that BCG displaying ovalbumin antigen induces an immune response with a magnitude similar to that induced by BCG genetically expressing the same surrogate antigen. We also found that BCG decorated with Mtb specific antigen ESAT6 successfully induces the expansion of specific T cell responses. This novel technology, therefore, represents a practical and effective alternative to DNA-based gene expression for upgrading the current BCG vaccine.

Genetically encoded reporters for hyperpolarized xenon magnetic resonance imaging

NASA Astrophysics Data System (ADS)

Shapiro, Mikhail G.; Ramirez, R. Matthew; Sperling, Lindsay J.; Sun, George; Sun, Jinny; Pines, Alexander; Schaffer, David V.; Bajaj, Vikram S.

2014-07-01

Magnetic resonance imaging (MRI) enables high-resolution non-invasive observation of the anatomy and function of intact organisms. However, previous MRI reporters of key biological processes tied to gene expression have been limited by the inherently low molecular sensitivity of conventional 1H MRI. This limitation could be overcome through the use of hyperpolarized nuclei, such as in the noble gas xenon, but previous reporters acting on such nuclei have been synthetic. Here, we introduce the first genetically encoded reporters for hyperpolarized 129Xe MRI. These expressible reporters are based on gas vesicles (GVs), gas-binding protein nanostructures expressed by certain buoyant microorganisms. We show that GVs are capable of chemical exchange saturation transfer interactions with xenon, which enables chemically amplified GV detection at picomolar concentrations (a 100- to 10,000-fold improvement over comparable constructs for 1H MRI). We demonstrate the use of GVs as heterologously expressed indicators of gene expression and chemically targeted exogenous labels in MRI experiments performed on living cells.

Autoimmunity and glomerulonephritis in mice with targeted deletion of the serum amyloid P component gene: SAP deficiency or strain combination?

PubMed Central

Gillmore, Julian D; Hutchinson, Winston L; Herbert, Jeff; Bybee, Alison; Mitchell, Daniel A; Hasserjian, Robert P; Yamamura, Ken-Ichi; Suzuki, Misao; Sabin, Caroline A; Pepys, Mark B

2004-01-01

Human serum amyloid P component (SAP) binds avidly to DNA, chromatin and apoptotic cells in vitro and in vivo. 129\\Sv × C57BL\\6 mice with targeted deletion of the SAP gene spontaneously develop antinuclear autoantibodies and immune complex glomerulonephritis. SAP-deficient animals, created by backcrossing the 129\\Sv SAP gene deletion into pure line C57BL\\6 mice and studied here for the first time, also spontaneously developed broad spectrum antinuclear autoimmunity and proliferative immune complex glomerulonephritis but without proteinuria, renal failure, or increased morbidity or mortality. Mice hemizygous for the SAP gene deletion had an intermediate autoimmune phenotype. Injected apoptotic cells and isolated chromatin were more immunogenic in SAP–\\– mice than in wild-type mice. In contrast, SAP-deficient pure line 129\\Sv mice did not produce significant autoantibodies either spontaneously or when immunized with extrinsic chromatin or apoptotic cells, indicating that loss of tolerance is markedly strain dependent. However, SAP deficiency in C57BL\\6 mice only marginally affected plasma clearance of exogenous chromatin and had no effect on distribution of exogenous nucleosomes between the liver and kidneys, which were the only tissue sites of catabolism. Furthermore, transgenic expression of human SAP in the C57BL\\6 SAP knockout mice did not abrogate the autoimmune phenotype. This may reflect the different binding affinities of mouse and human SAP for nuclear autoantigens and\\or the heterologous nature of transgenic human SAP in the mouse. Alternatively, the autoimmunity may be independent of SAP deficiency and caused by expression of 129\\Sv chromosome 1 genes in the C57BL\\6 background. PMID:15147569

Combinations of Macrolide Resistance Determinants in Field Isolates of Mannheimia haemolytica and Pasteurella multocida▿

PubMed Central

Desmolaize, Benoit; Rose, Simon; Wilhelm, Cornelia; Warrass, Ralf; Douthwaite, Stephen

2011-01-01

Respiratory tract infections in cattle are commonly associated with the bacterial pathogens Mannheimia haemolytica and Pasteurella multocida. These infections can generally be successfully treated in the field with one of several groups of antibiotics, including macrolides. A few recent isolates of these species exhibit resistance to veterinary macrolides with phenotypes that fall into three distinct classes. The first class has type I macrolide, lincosamide, and streptogramin B antibiotic resistance and, consistent with this, the 23S rRNA nucleotide A2058 is monomethylated by the enzyme product of the erm(42) gene. The second class shows no lincosamide resistance and lacks erm(42) and concomitant 23S rRNA methylation. Sequencing of the genome of a representative strain from this class, P. multocida 3361, revealed macrolide efflux and phosphotransferase genes [respectively termed msr(E) and mph(E)] that are arranged in tandem and presumably expressed from the same promoter. The third class exhibits the most marked drug phenotype, with high resistance to all of the macrolides tested, and possesses all three resistance determinants. The combinations of erm(42), msr(E), and mph(E) are chromosomally encoded and intermingled with other exogenous genes, many of which appear to have been transferred from other members of the Pasteurellaceae. The presence of some of the exogenous genes explains recent reports of resistance to additional drug classes. We have expressed recombinant versions of the erm(42), msr(E), and mph(E) genes within an isogenic Escherichia coli background to assess their individually contributions to resistance. Our findings indicate what types of compounds might have driven the selection for these resistance determinants. PMID:21709086

Transformation of miniature potted rose (Rosa hybrida cv. Linda) with P( SAG12 )-ipt gene delays leaf senescence and enhances resistance to exogenous ethylene.

PubMed

Zakizadeh, Hedayat; Lütken, Henrik; Sriskandarajah, Sridevy; Serek, Margrethe; Müller, Renate

2013-02-01

KEY MESSAGE : The P ( SAG12 ) -ipt gene was transferred to miniature rose, as the first woody species, resulting in increased ethylene resistance due to specific up-regulation of the ipt gene under senescence promoting conditions. Transgenic plants of Rosa hybrida 'Linda' were obtained via transformation with Agrobacterium tumefaciens strain harboring the binary vector pSG529(+) containing the P( SAG12 )-ipt construct. A. tumefaciens strains AGL1, GV3850 and LBA4404 (containing P(35S)-INTGUS gene) were used for transformation of embryogenic callus, but transgenic shoots were obtained only when AGL1 was applied. The highest transformation frequency was 10 % and it was achieved when half MS medium was used for the dilution of overnight culture of Agrobacterium. Southern blot confirmed integration of 1-6 copies of the nptII gene into the rose genome in the tested lines. Four transgenic lines were obtained which were morphologically true-to-type and indistinguishable from Wt shoots while they were in in vitro cultures. Adventitious root induction was more difficult in transgenic shoots compared to the Wt shoots, however, one of the transgenic lines (line 6) was rooted and subsequently analyzed phenotypically. The ipt expression levels were determined in this line after exposure to exogenous ethylene (3.5 μl l(-1)) and/or darkness. Darkness resulted in twofold up-regulation of ipt expression, whereas darkness combined with ethylene caused eightfold up-regulation in line 6 compared to Wt plants. The transgenic line had significantly higher content of chlorophyll at the end of the treatment period compared to Wt plants.

Single administration of recombinant IL-6 restores the gene expression of lipogenic enzymes in liver of fasting IL-6-deficient mice.

PubMed

Gavito, A L; Cabello, R; Suarez, J; Serrano, A; Pavón, F J; Vida, M; Romero, M; Pardo, V; Bautista, D; Arrabal, S; Decara, J; Cuesta, A L; Valverde, A M; Rodríguez de Fonseca, F; Baixeras, E

2016-03-01

Lipogenesis is intimately controlled by hormones and cytokines as well as nutritional conditions. IL-6 participates in the regulation of fatty acid metabolism in the liver. We investigated the role of IL-6 in mediating fasting/re-feeding changes in the expression of hepatic lipogenic enzymes. Gene and protein expression of lipogenic enzymes were examined in livers of wild-type (WT) and IL-6-deficient (IL-6(-/-) ) mice during fasting and re-feeding conditions. Effects of exogenous IL-6 administration on gene expression of these enzymes were evaluated in vivo. The involvement of STAT3 in mediating these IL-6 responses was investigated by using siRNA in human HepG2 cells. During feeding, the up-regulation in the hepatic expression of lipogenic genes presented similar time kinetics in WT and IL-6(-/-) mice. During fasting, expression of lipogenic genes decreased gradually over time in both strains, although the initial drop was more marked in IL-6(-/-) mice. Protein levels of hepatic lipogenic enzymes were lower in IL-6(-/-) than in WT mice at the end of the fasting period. In WT, circulating IL-6 levels paralleled gene expression of hepatic lipogenic enzymes. IL-6 administration in vivo and in vitro showed that IL-6-mediated signalling was associated with the up-regulation of hepatic lipogenic enzyme genes. Moreover, silencing STAT3 in HepG2 cells attenuated IL-6 mediated up-regulation of lipogenic gene transcription levels. IL-6 sustains levels of hepatic lipogenic enzymes during fasting through activation of STAT3. Our findings indicate that clinical use of STAT3-associated signalling cytokines, particularly against steatosis, should be undertaken with caution. © 2016 The British Pharmacological Society.

Development of a calcium phosphate co-precipitate/poly(lactide-co-glycolide) DNA delivery system: release kinetics and cellular transfection studies.

PubMed

Kofron, Michelle D; Laurencin, Cato T

2004-06-01

One of the most common non-viral methods for the introduction of foreign deoxyribonucleic acid (DNA) into cultured cells is calcium phosphate co-precipitate transfection. This technique involves the encapsulation of DNA within a calcium phosphate co-precipitate, particulate addition to in vitro cell culture, endocytosis of the co-precipitate, and exogenous DNA expression by the transfected cell. In this study, we fabricated a novel non-viral gene transfer system by adsorbing DNA, encapsulated in calcium phosphate (DNA/Ca-P) co-precipitates, to biodegradable two- and three-dimensional poly(lactide-co-glycolide) matrices (2D-DNA/Ca-P/PLAGA, 3D-DNA/Ca-P/PLAGA). Co-precipitate release studies demonstrated an initial burst release over the first 48 h. By day 7, approximately 96% of the initially adsorbed DNA/Ca-P co-precipitate had been released. This was followed by low levels of co-precipitate release for 42 days. Polymerase chain reaction was used to demonstrate the ability of the released DNA containing co-precipitates to transfect SaOS-2 cells cultured in vitro on the 3D-DNA/Ca-P/PLAGA matrix and maintenance of the structural integrity of the exogenous DNA. In summary, a promising system for the incorporation and controlled delivery of exogenous genes encapsulated within a calcium phosphate co-precipitate from biodegradable polymeric matrices has been developed and may have applicability to the delivery of therapeutic genes and the transfection of other cell types.

Exogenous auxin represses soybean seed germination through decreasing the gibberellin/abscisic acid (GA/ABA) ratio.

PubMed

Shuai, Haiwei; Meng, Yongjie; Luo, Xiaofeng; Chen, Feng; Zhou, Wenguan; Dai, Yujia; Qi, Ying; Du, Junbo; Yang, Feng; Liu, Jiang; Yang, Wenyu; Shu, Kai

2017-10-03

Auxin is an important phytohormone which mediates diverse development processes in plants. Published research has demonstrated that auxin induces seed dormancy. However, the precise mechanisms underlying the effect of auxin on seed germination need further investigation, especially the relationship between auxins and both abscisic acid (ABA) and gibberellins (GAs), the latter two phytohormones being the key regulators of seed germination. Here we report that exogenous auxin treatment represses soybean seed germination by enhancing ABA biosynthesis, while impairing GA biogenesis, and finally decreasing GA 1 /ABA and GA 4 /ABA ratios. Microscope observation showed that auxin treatment delayed rupture of the soybean seed coat and radicle protrusion. qPCR assay revealed that transcription of the genes involved in ABA biosynthetic pathway was up-regulated by application of auxin, while expression of genes involved in GA biosynthetic pathway was down-regulated. Accordingly, further phytohormone quantification shows that auxin significantly increased ABA content, whereas the active GA 1 and GA 4 levels were decreased, resulting insignificant decreases in the ratiosGA 1 /ABA and GA 4 /ABA.Consistent with this, ABA biosynthesis inhibitor fluridone reversed the delayed-germination phenotype associated with auxin treatment, while paclobutrazol, a GA biosynthesis inhibitor, inhibited soybean seed germination. Altogether, exogenous auxin represses soybean seed germination by mediating ABA and GA biosynthesis.

Novel Bioengineered Cassava Expressing an Archaeal Starch Degradation System and a Bacterial ADP-Glucose Pyrophosphorylase for Starch Self-Digestibility and Yield Increase

PubMed Central

Ligaba-Osena, Ayalew; Jones, Jenna; Donkor, Emmanuel; Chandrayan, Sanjeev; Pole, Farris; Wu, Chang-Hao; Vieille, Claire; Adams, Michael W. W.; Hankoua, Bertrand B.

2018-01-01

To address national and global low-carbon fuel targets, there is great interest in alternative plant species such as cassava (Manihot esculenta), which are high-yielding, resilient, and are easily converted to fuels using the existing technology. In this study the genes encoding hyperthermophilic archaeal starch-hydrolyzing enzymes, α-amylase and amylopullulanase from Pyrococcus furiosus and glucoamylase from Sulfolobus solfataricus, together with the gene encoding a modified ADP-glucose pyrophosphorylase (glgC) from Escherichia coli, were simultaneously expressed in cassava roots to enhance starch accumulation and its subsequent hydrolysis to sugar. A total of 13 multigene expressing transgenic lines were generated and characterized phenotypically and genotypically. Gene expression analysis using quantitative RT-PCR showed that the microbial genes are expressed in the transgenic roots. Multigene-expressing transgenic lines produced up to 60% more storage root yield than the non-transgenic control, likely due to glgC expression. Total protein extracted from the transgenic roots showed up to 10-fold higher starch-degrading activity in vitro than the protein extracted from the non-transgenic control. Interestingly, transgenic tubers released threefold more glucose than the non-transgenic control when incubated at 85°C for 21-h without exogenous application of thermostable enzymes, suggesting that the archaeal enzymes produced in planta maintain their activity and thermostability. PMID:29541080

Novel Bioengineered Cassava Expressing an Archaeal Starch Degradation System and a Bacterial ADP-Glucose Pyrophosphorylase for Starch Self-Digestibility and Yield Increase.

PubMed

Ligaba-Osena, Ayalew; Jones, Jenna; Donkor, Emmanuel; Chandrayan, Sanjeev; Pole, Farris; Wu, Chang-Hao; Vieille, Claire; Adams, Michael W W; Hankoua, Bertrand B

2018-01-01

To address national and global low-carbon fuel targets, there is great interest in alternative plant species such as cassava ( Manihot esculenta ), which are high-yielding, resilient, and are easily converted to fuels using the existing technology. In this study the genes encoding hyperthermophilic archaeal starch-hydrolyzing enzymes, α-amylase and amylopullulanase from Pyrococcus furiosus and glucoamylase from Sulfolobus solfataricus , together with the gene encoding a modified ADP-glucose pyrophosphorylase ( glgC ) from Escherichia coli , were simultaneously expressed in cassava roots to enhance starch accumulation and its subsequent hydrolysis to sugar. A total of 13 multigene expressing transgenic lines were generated and characterized phenotypically and genotypically. Gene expression analysis using quantitative RT-PCR showed that the microbial genes are expressed in the transgenic roots. Multigene-expressing transgenic lines produced up to 60% more storage root yield than the non-transgenic control, likely due to glgC expression. Total protein extracted from the transgenic roots showed up to 10-fold higher starch-degrading activity in vitro than the protein extracted from the non-transgenic control. Interestingly, transgenic tubers released threefold more glucose than the non-transgenic control when incubated at 85°C for 21-h without exogenous application of thermostable enzymes, suggesting that the archaeal enzymes produced in planta maintain their activity and thermostability.

Transfection of isolated rainbow trout, Oncorhynchus mykiss, granulosa cells through chemical transfection and electroporation at 12°C.

PubMed

Marivin, E; Mourot, B; Loyer, P; Rime, H; Bobe, J; Fostier, A

2015-09-15

Over-expression or inhibition of gene expression can be efficiently used to analyse the functions and/or regulation of target genes. Modulation of gene expression can be achieved through transfection of exogenous nucleic acids into target cells. Such techniques require the development of specific protocols to transfect cell cultures with nucleic acids. The aim of this study was to develop a method of transfection suitable for rainbow trout granulosa cells in primary culture. After the isolation of rainbow trout granulosa cells, chemical transfection of cells with a fluorescent morpholino oligonucleotide (MO) was tested using FuGENE HD at 12 °C. Electroporation was also employed to transfect these cells with either a plasmid or MO. Transfection was more efficient using electroporation (with the following settings: 1200 V/40 ms/1p) than chemical transfection, but electroporation by itself was deleterious, resulting in a decrease of the steroidogenic capacity of the cells, measured via estradiol production from its androgenic substrate. The disturbance of cell biology induced by the transfection method per se should be taken into account in data interpretation when investigating the effects of under- or over-expression of candidate genes. Copyright © 2015 Elsevier Inc. All rights reserved.

Site-specific recombination in the chicken genome using Flipase recombinase-mediated cassette exchange.

PubMed

Lee, Hong Jo; Lee, Hyung Chul; Kim, Young Min; Hwang, Young Sun; Park, Young Hyun; Park, Tae Sub; Han, Jae Yong

2016-02-01

Targeted genome recombination has been applied in diverse research fields and has a wide range of possible applications. In particular, the discovery of specific loci in the genome that support robust and ubiquitous expression of integrated genes and the development of genome-editing technology have facilitated rapid advances in various scientific areas. In this study, we produced transgenic (TG) chickens that can induce recombinase-mediated gene cassette exchange (RMCE), one of the site-specific recombination technologies, and confirmed RMCE in TG chicken-derived cells. As a result, we established TG chicken lines that have, Flipase (Flp) recognition target (FRT) pairs in the chicken genome, mediated by piggyBac transposition. The transgene integration patterns were diverse in each TG chicken line, and the integration diversity resulted in diverse levels of expression of exogenous genes in each tissue of the TG chickens. In addition, the replaced gene cassette was expressed successfully and maintained by RMCE in the FRT predominant loci of TG chicken-derived cells. These results indicate that targeted genome recombination technology with RMCE could be adaptable to TG chicken models and that the technology would be applicable to specific gene regulation by cis-element insertion and customized expression of functional proteins at predicted levels without epigenetic influence. © FASEB.

Tools for neuroanatomy and neurogenetics in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pfeiffer, Barret D.; Jenett, Arnim; Hammonds, Ann S.

2008-08-11

We demonstrate the feasibility of generating thousands of transgenic Drosophila melanogaster lines in which the expression of an exogenous gene is reproducibly directed to distinct small subsets of cells in the adult brain. We expect the expression patterns produced by the collection of 5,000 lines that we are currently generating to encompass all neurons in the brain in a variety of intersecting patterns. Overlapping 3-kb DNA fragments from the flanking noncoding and intronic regions of genes thought to have patterned expression in the adult brain were inserted into a defined genomic location by site-specific recombination. These fragments were then assayedmore » for their ability to function as transcriptional enhancers in conjunction with a synthetic core promoter designed to work with a wide variety of enhancer types. An analysis of 44 fragments from four genes found that >80% drive expression patterns in the brain; the observed patterns were, on average, comprised of <100 cells. Our results suggest that the D. melanogaster genome contains >50,000 enhancers and that multiple enhancers drive distinct subsets of expression of a gene in each tissue and developmental stage. We expect that these lines will be valuable tools for neuroanatomy as well as for the elucidation of neuronal circuits and information flow in the fly brain.« less

The Alleviation of Heat Damage to Photosystem II and Enzymatic Antioxidants by Exogenous Spermidine in Tall Fescue.

PubMed

Zhang, Liang; Hu, Tao; Amombo, Erick; Wang, Guangyang; Xie, Yan; Fu, Jinmin

2017-01-01

Tall fescue ( Festuca arundinacea Schreb) is a typical cool-season grass that is widely used in turf and pasture. However, high temperature as an abiotic stress seriously affects its utilization. The objective of this study was to explore the effect of spermidine (Spd) on heat stress response of tall fescue. The samples were exposed to 22°C (normal condition) or 44°C (heat stress) for 4 h. The results showed that exogenous Spd partially improved the quality of tall fescue leaves under normal temperature conditions. Nevertheless, after heat stress treatment, exogenous Spd significantly decreased the electrolyte leakage of tall fescue leaves. Spd also profoundly reduced the H 2 O 2 and O 2 ⋅- content and increased antioxidant enzymes activities. In addition, PAs can also regulate antioxidant enzymes activities including SOD, POD, and APX which could help to scavenge ROS. Moreover, application of Spd could also remarkably increase the chlorophyll content and had a positive effect on the chlorophyll α fluorescence transients under high temperature. The Spd reagent enhanced the performance of photosystem II (PSII) as observed by the JIP-test. Under heat stress, the Spd profoundly improved the partial potentials at the steps of energy bifurcations (PI ABS and PI total ) and the quantum yields and efficiencies (φP 0 , δR 0 , φR 0 , and γRC). Exogenous Spd could also reduce the specific energy fluxes per Q A - reducing PSII reaction center (RC) (TP 0 /RC and ET 0 /RC). Additionally, exogenous Spd improved the expression level of psbA and psbB , which encoded the proteins of PSII core reaction center complex. We infer that PAs can stabilize the structure of nucleic acids and protect RNA from the degradation of ribonuclease. In brief, our study indicates that exogenous Spd enhances the heat tolerance of tall fescue by maintaining cell membrane stability, increasing antioxidant enzymes activities, improving PSII, and relevant gene expression.

Developmental and Wound-, Cold-, Desiccation-, Ultraviolet-B-Stress-Induced Modulations in the Expression of the Petunia Zinc Finger Transcription Factor Gene ZPT2-21

PubMed Central

van der Krol, Alexander R.; van Poecke, Remco M.P.; Vorst, Oscar F.J.; Voogt, Charlotte; van Leeuwen, Wessel; Borst-Vrensen, Tanja W.M.; Takatsuji, Hiroshi; van der Plas, Linus H.W.

1999-01-01

The ZPT2-2 gene belongs to the EPF gene family in petunia (Petunia hybrida), which encodes proteins with TFIIIA-type zinc-finger DNA-binding motifs. To elucidate a possible function for ZPT2-2, we analyzed its pattern of expression in relation to different developmental and physiological stress signals. The activity of the ZPT2-2 promoter was analyzed using a firefly luciferase (LUC) reporter gene, allowing for continuous measurements of transgene activity in planta. We show that ZPT2-2::LUC is active in all plant tissues, but is strongly modulated in cotyledons upon germination, in leaves in response to desiccation, cold treatment, wounding, or ultraviolet-B light, and in petal tissue in response to pollination of the stigma. Analysis of mRNA levels indicated that the modulations in ZPT2-2::LUC expression reflect modulations in endogenous ZPT2-2 gene expression. The change in ZPT2-2::LUC activity by cold treatment, wounding, desiccation, and ultraviolet-B light suggest that the phytohormones ethylene and jasmonic acid are involved in regulating the expression of ZPT2-2. Although up-regulation of expression of ZPT2-2 can be blocked by inhibitors of ethylene perception, expression in plants is not induced by exogenously applied ethylene. The application of jasmonic acid does result in an up-regulation of gene activity and, thus, ZPT2-2 may play a role in the realization of the jasmonic acid hormonal responses in petunia. PMID:10594102

Enhanced green fluorescent protein (egfp) gene expression in Tetraselmis subcordiformis chloroplast with endogenous regulators.

PubMed

Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song

2016-05-01

On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.

Expression of CAR in SW480 and HepG2 cells during G1 is associated with cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osabe, Makoto; Sugatani, Junko; Global COE Program, School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka

Constitutive androstane receptor (CAR) is a transcription factor to regulate the expression of several genes related to drug-metabolism. Here, we demonstrate that CAR protein accumulates during G1 in human SW480 and HepG2 cells. After the G1/S phase transition, CAR protein levels decreased, and CAR was hardly detected in cells by the late M phase. CAR expression in both cell lines was suppressed by RNA interference-mediated suppression of CDK4. Depletion of CAR by RNA interference in both cells and by hepatocyte growth factor treatment in HepG2 cells resulted in decreased MDM2 expression that led to p21 upregulation and repression of HepG2more » cell growth. Thus, our results demonstrate that CAR expression is an early G1 event regulated by CDK4 that contributes to MDM2 expression; these findings suggest that CAR may influence the expression of genes involved in not only the metabolism of endogenous and exogenous substances but also in the cell proliferation.« less

The PIN gene family in cotton (Gossypium hirsutum): genome-wide identification and gene expression analyses during root development and abiotic stress responses.

PubMed

He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui

2017-07-03

Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.

The Expression of Three Opsin Genes from the Compound Eye of Helicoverpa armigera (Lepidoptera: Noctuidae) Is Regulated by a Circadian Clock, Light Conditions and Nutritional Status

PubMed Central

Yan, Shuo; Zhu, Jialin; Zhu, Weilong; Zhang, Xinfang; Li, Zhen; Liu, Xiaoxia; Zhang, Qingwen

2014-01-01

Visual genes may become inactive in species that inhabit poor light environments, and the function and regulation of opsin components in nocturnal moths are interesting topics. In this study, we cloned the ultraviolet (UV), blue (BL) and long-wavelength-sensitive (LW) opsin genes from the compound eye of the cotton bollworm and then measured their mRNA levels using quantitative real-time PCR. The mRNA levels fluctuated over a daily cycle, which might be an adaptation of a nocturnal lifestyle, and were dependent on a circadian clock. Cycling of opsin mRNA levels was disturbed by constant light or constant darkness, and the UV opsin gene was up-regulated after light exposure. Furthermore, the opsin genes tended to be down-regulated upon starvation. Thus, this study illustrates that opsin gene expression is determined by multiple endogenous and exogenous factors and is adapted to the need for nocturnal vision, suggesting that color vision may play an important role in the sensory ecology of nocturnal moths. PMID:25353953

Methods and materials for the production of L-lactic acid in yeast

DOEpatents

Hause, Ben [Jordan, MN; Rajgarhia, Vineet [Minnetonka, MN; Suominen, Pirkko [Maple Grove, MN

2009-05-19

Recombinant yeast are provided having, in one aspect, multiple exogenous LDH genes integrated into the genome, while leaving native PDC genes intact. In a second aspect, recombinant yeast are provided having an exogenous LDH gene integrated into its genome at the locus of a native PDC gene, with deletion of the native PDC gene. The recombinant yeast are useful in fermentation process for producing lactic acid.

Proteomic Response and Quality Maintenance in Postharvest Fruit of Strawberry (Fragaria × ananassa) to Exogenous Cytokinin.

PubMed

Li, Li; Li, Dongdong; Luo, Zisheng; Huang, Xinhong; Li, Xihong

2016-06-01

The limitations in current understanding of the molecular mechanisms underlying fruit response to the application of plant growth regulators have increasingly become major challenges in improvement of crop quality. This study aimed to evaluate the response of strawberry to the preharvest application of exogenous cytokinin known as forchlorfenuron (CPPU). Postharvest internal and physiological quality attributes were characterized following storage under different conditions. Hierarchical clustering analysis via a label-free proteomic quantitative approach identified a total of 124 proteins in strawberries across all treatments. The expression profiles of both proteins and genes spanned the ranged role of cytokinin involved in primary and secondary metabolism, stress response, and so on. Eighty-eight proteins and fifty-six proteins were significantly regulated immediately at harvest and after storage, respectively. In general, the glycolysis in strawberry was only regulated by CPPU before storage; in addition to the accelerated photosynthesis and acid metabolism, CPPU application maintained higher capacity of resistance in strawberry to stress stimuli after storage, in comparison to control. Nevertheless, the volatile biosynthesis in strawberry has been suppressed by exogenous CPPU. Novel cytokinin response proteins and processes were identified in addition to the main transcriptomic expression to gain insights into the phytohormone control of fruit postharvest quality.

The effects of exogenous cortisol on myostatin transcription in rainbow trout, Oncorhynchus mykiss.

PubMed

Galt, Nicholas J; Froehlich, Jacob Michael; Remily, Ethan A; Romero, Sinibaldo R; Biga, Peggy R

2014-09-01

Glucocorticoids (GCs) strongly regulate myostatin expression in mammals via glucocorticoid response elements (GREs), and bioinformatics methods suggest that this regulatory mechanism is conserved among many vertebrates. However, the multiple myostatin genes found in some fishes may be an exception. In silico promoter analyses of the three putative rainbow trout (Oncorhynchus mykiss) myostatin promoters have failed to identify putative GREs, suggesting a divergence in myostatin function. Therefore, we hypothesized that myostatin mRNA expression is not regulated by glucocorticoids in rainbow trout. In this study, both juvenile rainbow trout and primary trout myoblasts were treated with cortisol to examine the effects on myostatin mRNA expression. Results suggest that exogenous cortisol does not regulate myostatin-1a and -1b expression in vivo, as myostatin mRNA levels were not significantly affected by cortisol treatment in either red or white muscle tissue. In red muscle, myostatin-2a levels were significantly elevated in the cortisol treatment group relative to the control, but not the vehicle control, at both 12 h and 24 h post-injection. As such, it is unclear if cortisol was acting alone or in combination with the vehicle. Cortisol increased myostatin-1b expression in a dose-dependent manner in vitro. Further work is needed to determine if this response is the direct result of cortisol acting on the myostatin-1b promoter or through an alternative mechanism. These results suggest that regulation of myostatin by cortisol may not be as highly conserved as previously thought and support previous work that describes potential functional divergence of the multiple myostatin genes in fishes. Copyright © 2014 Elsevier Inc. All rights reserved.

Transgenic mice: an irreplaceable tool for the study of mammalian development and biology.

PubMed

Babinet, C

2000-11-01

Stable integration into the mouse genome of exogenous genetic information, i.e., the creation of transgenic mice, has become a privileged way of analyzing gene function in normal development and pathology. Both gene addition and gene replacement may be performed. This has allowed, in particular, the creation of mice in which precise mutations are introduced into a given gene. Furthermore, in recent years, strategies that induce the expression of a mutation in a given type of cell and/or at a given time in development have been developed. Thus, the transgenic methodology affords a unique and irreplaceable tool for the study of mammalian development and biology and for the creation of animal models for human genetic diseases.

Sensitive periods for 17β-estradiol exposure during immune system development in sea bass head kidney.

PubMed

Seemann, Frauke; Knigge, Thomas; Duflot, Aurélie; Marie, Sabine; Olivier, Stéphanie; Minier, Christophe; Monsinjon, Tiphaine

2016-06-01

An increasing body of evidence suggests that sex steroids play an important role in the development and regulation of vertebrate immune defense. Therefore, compounds with estrogenic activity may influence the immune system via receptor-mediated pathways. The presence of estrogen receptors in immune cells and organs during the early stages of development may indicate that female steroid hormones are involved in the maturation of the fish immune system. This is of particular importance, as some marine fish are probably exposed to sources of exogenous estrogens while they reside in their estuarine nursery grounds. In this study, the influence of 17β-estradiol (E2) on estrogen receptor and cytokine gene expression was assessed in juvenile sea bass (Dicentrarchus labrax) together with characterization of the head kidney leukocyte populations and corresponding phagocytic activity during organ regionalization from 98 to 239 dph. E2 exposure, beginning at 90 dph resulted in indirect and delayed modifications of interleukin 1β and estrogen receptor α gene expression, which may affect B-lymphocyte proliferation in the sea bass head kidney. The E2 treatment of 120 dph fish led to an increase in estrogen receptor β2 and a decrease in transforming growth factor β1 gene expression, which coincided with decreased phagocytic activity of head kidney lymphocytes and monocytes/macrophages. Additionally, these changes were observed during developmental periods described as critical phases for B-lymphocyte development in mammals. Consequently, exogenous estrogens have the potential to modify the innate immune response in juvenile sea bass and to exert detrimental effects on head kidney development. Copyright © 2015 John Wiley & Sons, Ltd. Copyright © 2015 John Wiley & Sons, Ltd.

Indications for distinct pathogenic mechanisms of asbestos and silica through gene expression profiling of the response of lung epithelial cells

PubMed Central

Perkins, Timothy N.; Peeters, Paul M.; Shukla, Arti; Arijs, Ingrid; Dragon, Julie; Wouters, Emiel F.M.; Reynaert, Niki L.; Mossman, Brooke T.

2015-01-01

Occupational and environmental exposures to airborne asbestos and silica are associated with the development of lung fibrosis in the forms of asbestosis and silicosis, respectively. However, both diseases display distinct pathologic presentations, likely associated with differences in gene expression induced by different mineral structures, composition and bio-persistent properties. We hypothesized that effects of mineral exposure in the airway epithelium may dictate deviating molecular events that may explain the different pathologies of asbestosis versus silicosis. Using robust gene expression-profiling in conjunction with in-depth pathway analysis, we assessed early (24 h) alterations in gene expression associated with crocidolite asbestos or cristobalite silica exposures in primary human bronchial epithelial cells (NHBEs). Observations were confirmed in an immortalized line (BEAS-2B) by QRT-PCR and protein assays. Utilization of overall gene expression, unsupervised hierarchical cluster analysis and integrated pathway analysis revealed gene alterations that were common to both minerals or unique to either mineral. Our findings reveal that both minerals had potent effects on genes governing cell adhesion/migration, inflammation, and cellular stress, key features of fibrosis. Asbestos exposure was most specifically associated with aberrant cell proliferation and carcinogenesis, whereas silica exposure was highly associated with additional inflammatory responses, as well as pattern recognition, and fibrogenesis. These findings illustrate the use of gene-profiling as a means to determine early molecular events that may dictate pathological processes induced by exogenous cellular insults. In addition, it is a useful approach for predicting the pathogenicity of potentially harmful materials. PMID:25351596

Role for the banana AGAMOUS-like gene MaMADS7 in regulation of fruit ripening and quality.

PubMed

Liu, Juhua; Liu, Lin; Li, Yujia; Jia, Caihong; Zhang, Jianbin; Miao, Hongxia; Hu, Wei; Wang, Zhuo; Xu, Biyu; Jin, Zhiqiang

2015-11-01

MADS-box transcription factors play important roles in organ development. In plants, most studies on MADS-box genes have mainly focused on flower development and only a few concerned fruit development and ripening. A new MADS-box gene named MaMADS7 was isolated from banana fruit by rapid amplification of cDNA ends (RACE) based on a MADS-box fragment obtained from a banana suppression subtractive hybridization (SSH) cDNA library. MaMADS7 is an AGAMOUS-like MADS-box gene that is preferentially expressed in the ovaries and fruits and in tobacco its protein product localizes to the nucleus. This study found that MaMADS7 expression can be induced by exogenous ethylene. Ectopic expression of MaMADS7 in tomato resulted in broad ripening phenotypes. The expression levels of seven ripening and quality-related genes, ACO1, ACS2, E4, E8, PG, CNR and PSY1 in MaMADS7 transgenic tomato fruits were greatly increased while the expression of the AG-like MADS-box gene TAGL1 was suppressed. Compared with the control, the contents of β-carotene, lycopene, ascorbic acid and organic acid in transformed tomato fruits were increased, while the contents of glucose and fructose were slightly decreased. MaMADS7 interacted with banana 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase gene 1 (MaACO1) and tomato phytoene synthase gene (LePSY1) promoters. Our results indicated that MaMADS7 plays an important role in initiating endogenous ethylene biosynthesis and fruit ripening. © 2015 Scandinavian Plant Physiology Society.

Involvement of polyamine oxidase in abscisic acid-induced cytosolic antioxidant defense in leaves of maize.

PubMed

Xue, Beibei; Zhang, Aying; Jiang, Mingyi

2009-03-01

Using pharmacological and biochemical approaches, the role of maize polyamine oxidase (MPAO) in abscisic acid (ABA)-induced antioxidant defense in leaves of maize (Zea mays L.) plants was investigated. Exogenous ABA treatment enhanced the expression of the MPAO gene and the activities of apoplastic MPAO. Pretreatment with two different inhibitors for apoplastic MPAO partly reduced hydrogen peroxide (H2O2) accumulation induced by ABA and blocked the ABA-induced expression of the antioxidant genes superoxide dismutase 4 and cytosolic ascorbate peroxidase and the activities of the cytosolic antioxidant enzymes. Treatment with spermidine, the optimum substrate of MPAO, also induced the expression and the activities of the antioxidant enzymes, and the upregulation of the antioxidant enzymes was prevented by two inhibitors of MPAO and two scavengers of H2O2. These results suggest that MPAO contributes to ABA-induced cytosolic antioxidant defense through H2O2, a Spd catabolic product.

Up-regulation of cyclooxygenase-2 by product-prostaglandin E2

NASA Technical Reports Server (NTRS)

Tjandrawinata, R. R.; Hughes-Fulford, M.

1997-01-01

The development of prostate cancer has been linked to high level of dietary fat intake. Our laboratory investigates the connection between cancer cell growth and fatty acid products. Studying human prostatic carcinoma PC-3 cells, we found that prostaglandin E2 (PGE2) increased cell growth and up-regulated the gene expression of its own synthesizing enzyme, cyclooxygenase-2 (COX-2). PGE2 increased COX-2 mRNA expression dose-dependently with the highest levels of stimulation seen at the 3-hour period following PGE2 addition. The NSAID flurbiprofen (5 microM), in the presence of exogenous PGE2, inhibited the up-regulation of COX-2 mRNA and cell growth. These data suggest that the levels of local intracellular PGE2 play a major role in the growth of prostate cancer cells through an activation of COX-2 gene expression.

Transient overexpression of exogenous APOBEC3A causes C-to-U RNA editing of thousands of genes.

PubMed

Sharma, Shraddha; Patnaik, Santosh K; Kemer, Zeynep; Baysal, Bora E

2017-05-04

APOBEC3A cytidine deaminase induces site-specific C-to-U RNA editing of hundreds of genes in monocytes exposed to hypoxia and/or interferons and in pro-inflammatory macrophages. To examine the impact of APOBEC3A overexpression, we transiently expressed APOBEC3A in HEK293T cell line and performed RNA sequencing. APOBEC3A overexpression induces C-to-U editing at more than 4,200 sites in transcripts of 3,078 genes resulting in protein recoding of 1,110 genes. We validate recoding RNA editing of genes associated with breast cancer, hematologic neoplasms, amyotrophic lateral sclerosis, Alzheimer disease and primary pulmonary hypertension. These results highlight the fundamental impact of APOBEC3A overexpression on human transcriptome by widespread RNA editing.

Dominant genetics using a yeast genomic library under the control of a strong inducible promoter.

PubMed

Ramer, S W; Elledge, S J; Davis, R W

1992-12-01

In Saccharomyces cerevisiae, numerous genes have been identified by selection from high-copy-number libraries based on "multicopy suppression" or other phenotypic consequences of overexpression. Although fruitful, this approach suffers from two major drawbacks. First, high copy number alone may not permit high-level expression of tightly regulated genes. Conversely, other genes expressed in proportion to dosage cannot be identified if their products are toxic at elevated levels. This work reports construction of a genomic DNA expression library for S. cerevisiae that circumvents both limitations by fusing randomly sheared genomic DNA to the strong, inducible yeast GAL1 promoter, which can be regulated by carbon source. The library obtained contains 5 x 10(7) independent recombinants, representing a breakpoint at every base in the yeast genome. This library was used to examine aberrant gene expression in S. cerevisiae. A screen for dominant activators of yeast mating response identified eight genes that activate the pathway in the absence of exogenous mating pheromone, including one previously unidentified gene. One activator was a truncated STE11 gene lacking approximately 1000 base pairs of amino-terminal coding sequence. In two different clones, the same GAL1 promoter-proximal ATG is in-frame with the coding sequence of STE11, suggesting that internal initiation of translation there results in production of a biologically active, truncated STE11 protein. Thus this library allows isolation based on dominant phenotypes of genes that might have been difficult or impossible to isolate from high-copy-number libraries.

Interactions between Bmp-4 and Msx-1 act to restrict gene expression to odontogenic mesenchyme.

PubMed

Tucker, A S; Al Khamis, A; Sharpe, P T

1998-08-01

Tooth development is regulated by a reciprocal series of epithelial-mesenchymal interactions. Bmp4 has been identified as a candidate signalling molecule in these interactions, initially as an epithelial signal and then later at the bud stage as a mesenchymal signal (Vainio et al. [1993] Cell 75:45-58). A target gene for Bmp4 signalling is the homeobox gene Msx-1, identified by the ability of recombinant Bmp4 protein to induce expression in mesenchyme. There is, however, no evidence that Bmp4 is the endogenous inducer of Msx-1 expression. Msx-1 and Bmp-4 show dynamic, interactive patterns of expression in oral epithelium and ectomesenchyme during the early stages of tooth development. In this study, we compare the temporal and spatial expression of these two genes to determine whether the changing expression patterns of these genes are consistent with interactions between the two molecules. We show that changes in Bmp-4 expression precede changes in Msx-1 expression. At embryonic day (E)10.5-E11.0, expression patterns are consistent with BMP4 from the epithelium, inducing or maintaining Msx-1 in underlying mesenchyme. At E11.5, Bmp-4 expression shifts from epithelium to mesenchyme and is rapidly followed by localised up-regulation of Msx-1 expression at the sites of Bmp-4 expression. Using cultured explants of developing mandibles, we confirm that exogenous BMP4 is capable of replacing the endogenous source in epithelium and inducing Msx-1 gene expression in mesenchyme. By using noggin, a BMP inhibitor, we show that endogenous Msx-1 expression can be inhibited at E10.5 and E11.5, providing the first evidence that endogenous Bmp-4 from the epithelium is responsible for regulating the early spatial expression of Msx-1. We also show that the mesenchymal shift in Bmp-4 is responsible for up-regulating Msx-1 specifically at the sites of future tooth formation. Thus, we establish that a reciprocal series of interactions act to restrict expression of both genes to future sites of tooth formation, creating a positive feedback loop that maintains expression of both genes in tooth mesenchymal cells.

Ethylene Mediates Alkaline-Induced Rice Growth Inhibition by Negatively Regulating Plasma Membrane H+-ATPase Activity in Roots

PubMed Central

Chen, Haifei; Zhang, Quan; Cai, Hongmei; Xu, Fangsen

2017-01-01

pH is an important factor regulating plant growth. Here, we found that rice was better adapted to low pH than alkaline conditions, as its growth was severely inhibited at high pH, with shorter root length and an extreme biomass reduction. Under alkaline stress, the expression of genes for ethylene biosynthesis enzymes in rice roots was strongly induced by high pH and exogenous ethylene precursor ACC and ethylene overproduction in etol1-1 mutant aggravated the alkaline stress-mediated inhibition of rice growth, especially for the root elongation with decreased cell length in root apical regions. Conversely, the ethylene perception antagonist silver (Ag+) and ein2-1 mutants could partly alleviate the alkaline-induced root elongation inhibition. The H+-ATPase activity was extremely inhibited by alkaline stress and exogenous ACC. However, the H+-ATPase-mediated rhizosphere acidification was enhanced by exogenous Ag+, while H+ efflux on the root surface was extremely inhibited by exogenous ACC, suggesting that ethylene negatively regulated H+-ATPase activity under high-pH stress. Our results demonstrate that H+-ATPase is involved in ethylene-mediated inhibition of rice growth under alkaline stress. PMID:29114258

An Acidic PATHOGENESIS-RELATED1 Gene of Oryza grandiglumis is Involved in Disease Resistance Response Against Bacterial Infection

PubMed Central

Shin, Sang Hyun; Pak, Jung-Hun; Kim, Mi Jin; Kim, Hye Jeong; Oh, Ju Sung; Choi, Hong Kyu; Jung, Ho Won; Chung, Young Soo

2014-01-01

Wild rice, Oryza grandiglumis shows hyper-resistance response to pathogen infection. In order to identify genes necessary for defense response in plants, we have carried out a subtractive hybridization coupled with a cDNA macroarray. An acidic PATHOGENESIS-RELATED1 (PR1) gene of the wild rice is highly identical to the acidic PR1 genes of different plant species. The OgPR1a cDNA has an apparent single open reading frame with a predicted molecular mass 40,621 Da and an isoelectic point of 5.14. Both in silico analysis and a transient expression assay in onion epidermal cells revealed that the OgPR1a protein could be localized in intercellular space in plants. The OgPR1a mRNA was strongly transcribed by the exogenous treatment with ethylene and jasmonic acid as well as protein phosphatase inhibitors. Additionally, ectopic expression of the OgPR1a conferred disease resistance on Arabidopsis to the bacterial and fungal infections. PMID:25289005

Ethylene and cold participate in the regulation of LeCBF1 gene expression in postharvest tomato fruits.

PubMed

Zhao, Danying; Shen, Lin; Fan, Bei; Yu, Mengmeng; Zheng, Yang; Lv, Shengnan; Sheng, Jiping

2009-10-20

C-repeat/dehydration-responsive element binding factor (CBF) is a transcription factor regulating cold response in plants, of which little is known in fruits. We showed a double-peak expression pattern of Lycopersicon esculentum putative transcriptional activator CBF1 (LeCBF1) in mature green fruit. The peaks appeared at 2 and 16 h after subjection to cold storage (2 degrees C). The second peak was coincident with, and thus caused by a peak in endogenous ethylene production. We showed that LeCBF1 expression was regulated by exogenous ethylene and 1-methylcyclopropene, and was not expressed without cold induction. LeCBF1 expression was different in the five maturation stages of fruits, but expression peaked at 2 h at all stages.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyata, Maiko; Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065; Ichihara, Masatoshi

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas frommore » melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.« less

Determining the Extremes of the Cellular NAD(H) Level by Using an Escherichia coli NAD+-Auxotrophic Mutant ▿

PubMed Central

Zhou, Yongjin; Wang, Lei; Yang, Fan; Lin, Xinping; Zhang, Sufang; Zhao, Zongbao K.

2011-01-01

NAD (NAD+) and its reduced form (NADH) are omnipresent cofactors in biological systems. However, it is difficult to determine the extremes of the cellular NAD(H) level in live cells because the NAD+ level is tightly controlled by a biosynthesis regulation mechanism. Here, we developed a strategy to determine the extreme NAD(H) levels in Escherichia coli cells that were genetically engineered to be NAD+ auxotrophic. First, we expressed the ntt4 gene encoding the NAD(H) transporter in the E. coli mutant YJE001, which had a deletion of the nadC gene responsible for NAD+ de novo biosynthesis, and we showed NTT4 conferred on the mutant strain better growth in the presence of exogenous NAD+. We then constructed the NAD+-auxotrophic mutant YJE003 by disrupting the essential gene nadE, which is responsible for the last step of NAD+ biosynthesis in cells harboring the ntt4 gene. The minimal NAD+ level was determined in M9 medium in proliferating YJE003 cells that were preloaded with NAD+, while the maximal NAD(H) level was determined by exposing the cells to high concentrations of exogenous NAD(H). Compared with supplementation of NADH, cells grew faster and had a higher intracellular NAD(H) level when NAD+ was fed. The intracellular NAD(H) level increased with the increase of exogenous NAD+ concentration, until it reached a plateau. Thus, a minimal NAD(H) level of 0.039 mM and a maximum of 8.49 mM were determined, which were 0.044× and 9.6× those of wild-type cells, respectively. Finally, the potential application of this strategy in biotechnology is briefly discussed. PMID:21742902

Genistein and bisphenol A exposure cause estrogen receptor 1 to bind thousands of sites in a cell type-specific manner

PubMed Central

Gertz, Jason; Reddy, Timothy E.; Varley, Katherine E.; Garabedian, Michael J.; Myers, Richard M.

2012-01-01

Endogenous estrogens that are synthesized in the body impact gene regulation by activating estrogen receptors in diverse cell types. Exogenous compounds that have estrogenic properties can also be found circulating in the blood in both children and adults. The genome-wide impact of these environmental estrogens on gene regulation is unclear. To obtain an integrated view of gene regulation in response to environmental and endogenous estrogens on a genome-wide scale, we performed ChIP-seq to identify estrogen receptor 1 (ESR1; previously estrogen receptor α) binding sites, and RNA-seq in endometrial cancer cells exposed to bisphenol A (BPA; found in plastics), genistein (GEN; found in soybean), or 17β-estradiol (E2; an endogenous estrogen). GEN and BPA treatment induces thousands of ESR1 binding sites and >50 gene expression changes, representing a subset of E2-induced gene regulation changes. Genes affected by E2 were highly enriched for ribosome-associated proteins; however, GEN and BPA failed to regulate most ribosome-associated proteins and instead enriched for transporters of carboxylic acids. Treatment-dependent changes in gene expression were associated with treatment-dependent ESR1 binding sites, with the exception that many genes up-regulated by E2 harbored a BPA-induced ESR1 binding site but failed to show any expression change after BPA treatment. GEN and BPA exhibited a similar relationship to E2 in the breast cancer line T-47D, where cell type specificity played a much larger role than treatment specificity. Overall, both environmental estrogens clearly regulate gene expression through ESR1 on a genome-wide scale, although with lower potency resulting in less ESR1 binding sites and less gene expression changes compared to the endogenous estrogen, E2. PMID:23019147

Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

PubMed

Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

2016-10-28

Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

The PLUTO plastidial nucleobase transporter also transports the thiamin precursor hydroxymethylpyrimidine.

PubMed

Beaudoin, Guillaume A W; Johnson, Timothy S; Hanson, Andrew D

2018-04-27

In plants, the hydroxymethylpyrimidine (HMP) and thiazole precursors of thiamin are synthesized and coupled together to form thiamin in plastids. Mutants unable to form HMP can be rescued by exogenous HMP, implying the presence of HMP transporters in the plasma membrane and plastids. Analysis of bacterial genomes revealed a transporter gene that is chromosomally clustered with thiamin biosynthesis and salvage genes. Its closest Arabidopsis homolog, the plastidic nucleobase transporter (PLUTO), is co-expressed with several thiamin biosynthetic enzymes. Heterologous expression of PLUTO in Escherichia coli or Saccharomyces cerevisiae increased sensitivity to a toxic HMP analog, and disrupting PLUTO in an HMP-requiring Arabidopsis line reduced root growth at low HMP concentrations. These data implicate PLUTO in plastidial transport and salvage of HMP. © 2018 The Author(s).

Discovery of Cationic Polymers for Non-viral Gene Delivery using Combinatorial Approaches

PubMed Central

Barua, Sutapa; Ramos, James; Potta, Thrimoorthy; Taylor, David; Huang, Huang-Chiao; Montanez, Gabriela; Rege, Kaushal

2015-01-01

Gene therapy is an attractive treatment option for diseases of genetic origin, including several cancers and cardiovascular diseases. While viruses are effective vectors for delivering exogenous genes to cells, concerns related to insertional mutagenesis, immunogenicity, lack of tropism, decay and high production costs necessitate the discovery of non-viral methods. Significant efforts have been focused on cationic polymers as non-viral alternatives for gene delivery. Recent studies have employed combinatorial syntheses and parallel screening methods for enhancing the efficacy of gene delivery, biocompatibility of the delivery vehicle, and overcoming cellular level barriers as they relate to polymer-mediated transgene uptake, transport, transcription, and expression. This review summarizes and discusses recent advances in combinatorial syntheses and parallel screening of cationic polymer libraries for the discovery of efficient and safe gene delivery systems. PMID:21843141

A snapshot of gene therapy in Latin America

PubMed Central

Linden, Rafael; Matte, Ursula

2014-01-01

Gene therapy attempts the insertion and expression of exogenous genetic material in cells for therapeutic purposes. Conceived in the 1960s, gene therapy reached its first clinical trial at the end of the 1980s and by December 2013 around 600 genuine open clinical trials of gene therapy were registered at NIH Clinical Trials Database. Here, we summarize the current efforts towards the development of gene therapy in Latin America. Our survey shows that the number of scientists involved in the development of gene therapy and DNA vaccines in Latin America is still very low. Higher levels of investment in this technology are necessary to boost the advancement of innovation and intellectual property in this field in a way that would ease both the social and financial burden of various medical conditions in Latin America. PMID:24764763

CrMAPK3 regulates the expression of iron-deficiency-responsive genes in Chlamydomonas reinhardtii.

PubMed

Fei, Xiaowen; Yu, Junmei; Li, Yajun; Deng, Xiaodong

2017-05-16

Under iron-deficient conditions, Chlamydomonas exhibits high affinity for iron absorption. Nevertheless, the response, transmission, and regulation of downstream gene expression in algae cells have not to be investigated. Considering that the MAPK pathway is essential for abiotic stress responses, we determined whether this pathway is involved in iron deficiency signal transduction in Chlamydomonas. Arabidopsis MAPK gene sequences were used as entry data to search for homologous genes in Chlamydomonas reinhardtii genome database to investigate the functions of mitogen-activated protein kinase (MAPK) gene family in C. reinhardtii under iron-free conditions. Results revealed 16 C. reinhardtii MAPK genes labeled CrMAPK2-CrMAPK17 with TXY conserved domains and low homology to MAPK in yeast, Arabidopsis, and humans. The expression levels of these genes were then analyzed through qRT-PCR and exposure to high salt (150 mM NaCl), low nitrogen, or iron-free conditions. The expression levels of these genes were also subjected to adverse stress conditions. The mRNA levels of CrMAPK2, CrMAPK3, CrMAPK4, CrMAPK5, CrMAPK6, CrMAPK8, CrMAPK9, and CrMAPK11 were remarkably upregulated under iron-deficient stress. The increase in CrMAPK3 expression was 43-fold greater than that in the control. An RNA interference vector was constructed and transformed into C. reinhardtii 2A38, an algal strain with an exogenous FOX1:ARS chimeric gene, to silence CrMAPK3. After this gene was silenced, the mRNA levels and ARS activities of FOX1:ARS chimeric gene and endogenous CrFOX1 were decreased. The mRNA levels of iron-responsive genes, such as CrNRAMP2, CrATX1, CrFTR1, and CrFEA1, were also remarkably reduced. CrMAPK3 regulates the expression of iron-deficiency-responsive genes in C. reinhardtii.

Transcriptional Regulation of Aerobic Metabolism in Pichia pastoris Fermentation

PubMed Central

Zhang, Biao; Li, Baizhi; Chen, Dai; Zong, Jie; Sun, Fei; Qu, Huixin; Liang, Chongyang

2016-01-01

In this study, we investigated the classical fermentation process in Pichia pastoris based on transcriptomics. We utilized methanol in pichia yeast cell as the focus of our study, based on two key steps: limiting carbon source replacement (from glycerol to methonal) and fermentative production of exogenous proteins. In the former, the core differential genes in co-expression net point to initiation of aerobic metabolism and generation of peroxisome. The transmission electron microscope (TEM) results showed that yeast gradually adapted methanol induction to increased cell volume, and decreased density, via large number of peroxisomes. In the fermentative production of exogenous proteins, the Gene Ontology (GO) mapping results show that PAS_chr2-1_0582 played a vital role in regulating aerobic metabolic drift. In order to confirm the above results, we disrupted PAS_chr2-1_0582 by homologous recombination. Alcohol consumption was equivalent to one fifth of the normal control, and fewer peroxisomes were observed in Δ0582 strain following methanol induction. In this study we determined the important core genes and GO terms regulating aerobic metabolic drift in Pichia, as well as developing new perspectives for the continued development within this field. PMID:27537181

Microarray profiling of human white adipose tissue after exogenous leptin injection.

PubMed

Taleb, S; Van Haaften, R; Henegar, C; Hukshorn, C; Cancello, R; Pelloux, V; Hanczar, B; Viguerie, N; Langin, D; Evelo, C; Zucker, J; Clément, K; Saris, W H M

2006-03-01

Leptin is a secreted adipocyte hormone that plays a key role in the regulation of body weight homeostasis. The leptin effect on human white adipose tissue (WAT) is still debated. The aim of this study was to assess whether the administration of polyethylene glycol-leptin (PEG-OB) in a single supraphysiological dose has transcriptional effects on genes of WAT and to identify its target genes and functional pathways in WAT. Blood samples and WAT biopsies were obtained from 10 healthy nonobese men before treatment and 72 h after the PEG-OB injection, leading to an approximate 809-fold increase in circulating leptin. The WAT gene expression profile before and after the PEG-OB injection was compared using pangenomic microarrays. Functional gene annotations based on the gene ontology of the PEG-OB regulated genes were performed using both an 'in house' automated procedure and GenMAPP (Gene Microarray Pathway Profiler), designed for viewing and analyzing gene expression data in the context of biological pathways. Statistical analysis of microarray data revealed that PEG-OB had a major down-regulated effect on WAT gene expression, as we obtained 1,822 and 100 down- and up-regulated genes, respectively. Microarray data were validated using reverse transcription quantitative PCR. Functional gene annotations of PEG-OB regulated genes revealed that the functional class related to immunity and inflammation was among the most mobilized PEG-OB pathway in WAT. These genes are mainly expressed in the cell of the stroma vascular fraction in comparison with adipocytes. Our observations support the hypothesis that leptin could act on WAT, particularly on genes related to inflammation and immunity, which may suggest a novel leptin target pathway in human WAT.

Transcription factor AtTCP14 regulates embryonic growth potential during seed germination in Arabidopsis thaliana.

PubMed

Tatematsu, Kiyoshi; Nakabayashi, Kazumi; Kamiya, Yuji; Nambara, Eiji

2008-01-01

To understand the molecular mechanisms underlying regulation of seed germination, we searched enriched cis elements in the upstream regions of Arabidopsis genes whose transcript levels increased during seed germination. Using available published microarray data, we found that two cis elements, Up1 or Up2, which regulate outgrowth of Arabidopsis axillary shoots, were significantly over-represented. Classification of Up1- and Up2-containing genes by gene ontology revealed that protein synthesis-related genes, especially ribosomal protein genes, were highly over-represented. Expression analysis using a reporter gene driven by a synthetic promoter regulated by these elements showed that the Up1 is necessary and sufficient for germination-associated gene induction, whereas Up2 acts as an enhancer of Up1. Up1-mediated gene expression was suppressed by treatments that blocked germination. Up1 is almost identical to the site II motif, which is the predicted target of TCP transcription factors. Of 24 AtTCP genes, AtTCP14, which showed the highest transcript level just prior to germination, was functionally characterized to test its involvement in the regulation of seed germination. Transposon-tagged lines for AtTCP14 showed delayed germination. In addition, germination of attcp14 mutants exhibited hypersensitivity to exogenously applied abscisic acid and paclobutrazol, an inhibitor of gibberellin biosynthesis. AtTCP14 was predominantly expressed in the vascular tissues of the embryo, and affected gene expression in radicles in a non-cell-autonomous manner. Taken together, these results indicate that AtTCP14 regulates the activation of embryonic growth potential in Arabidopsis seeds.

A transcriptional approach to unravel the connection between phospholipases A₂ and D and ABA signal in citrus under water stress.

PubMed

Romero, Paco; Lafuente, M Teresa; Alférez, Fernando

2014-07-01

The effect of water stress on the interplay between phospholipases (PL) A2 and D and ABA signalling was investigated in fruit and leaves from the sweet orange Navelate and its fruit-specific ABA-deficient mutant Pinalate by studying simultaneously expression of 5 PLD and 3 PLA2-encoding genes. In general, expression levels of PLD-encoding genes were higher at harvest in the flavedo (coloured outer part of the peel) from Pinalate. Moreover, a higher and transient increase in expression of CsPLDα, CsPLDβ, CsPLDδ and CsPLDζ was observed in the mutant as compared to Navelate fruit under water stress, which may reflect a mechanism of acclimation to water stress influenced by ABA deficiency. An early induction in CsPLDγ gene expression, when increase in peel damage during fruit storage was most evident, suggested a role for this gene in membrane degradation processes during water stress. Exogenous ABA on mutant fruit modified the expression of all PLD genes and reduced the expression of CsPLDα and CsPLDβ by 1 week to levels similar to those of Navelate, suggesting a repressor role of ABA on these genes. In general, CssPLA2α and β transcript levels were lower in flavedo from Pinalate than from Navelate fruit during the first 3 weeks of storage, suggesting that expression of these genes also depends at least partially on ABA levels. Patterns of expression of PLD and PLA2-encoding genes were very similar in Navelate and Pinalate leaves, which have similar ABA levels, when comparing both RH conditions. Results comparison with other from previous works in the same experimental systems helped to decipher the effect of the stress severity on the differential response of some of these genes under dehydration conditions and pointed out the interplay between PLA2 and PLD families and their connection with ABA signalling in citrus. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Expression, function and regulation of mouse cytochrome P450 enzymes: comparison with human P450 enzymes.

PubMed

Hrycay, E G; Bandiera, S M

2009-12-01

The present review focuses on the expression, function and regulation of mouse cytochrome P450 (Cyp) enzymes. Information compiled for mouse Cyp enzymes is compared with data collected for human CYP enzymes. To date, approximately 40 pairs of orthologous mouse-human CYP genes have been identified that encode enzymes performing similar metabolic functions. Recent knowledge concerning the tissue expression of mouse Cyp enzymes from families 1 to 51 is summarized. The catalytic activities of microsomal, mitochondrial and recombinant mouse Cyp enzymes are discussed and their involvement in the metabolism of exogenous and endogenous compounds is highlighted. The role of nuclear receptors, such as the aryl hydrocarbon receptor, constitutive androstane receptor and pregnane X receptor, in regulating the expression of mouse Cyp enzymes is examined. Targeted disruption of selected Cyp genes has generated numerous Cyp null mouse lines used to decipher the role of Cyp enzymes in metabolic, toxicological and biological processes. In conclusion, the laboratory mouse is an indispensable model for exploring human CYP-mediated activities.

Nerve growth factor regulates galanin and neuropeptide Y expression in primary cultured superior cervical ganglion neurons.

PubMed

Liu, Huaxiang; Liu, Zhen; Xu, Xiaobo; Yang, Xiangdong; Wang, Huaijing; Li, Zhengzhong

2010-03-01

Both galanin and neuropeptide Y (NPY) are expressed in superior cervical ganglion (SCG) neurons. Following nerve transection or axotomy galanin is strongly upregulated and NPY is downregulated in SCG neurons because target-derived nerve growth factor (NGF) content decreased. It is not known whether or to what extent NGF affects both galanin and NPY expression in primary cultured SCG neurons. In the present study we examine whether exogenous NGF affects expression of neuropeptides for galanin and NPY in primary cultured SCG neurons. In addition, we explore whether mRNAs for galanin and NPY are affected by administration of exogenous NGF in SCG cultures. The significance of expression of galanin and NPY and their mRNAs was revealed by performing experiments without and with administration of exogenous NGF. Galanin and its mRNA expression was attenuated by administration of exogenous NGF in SCG cultures. The enhancement of NPY and its mRNA expression by administration of exogenous NGF in SCG cultures was dose-dependent. The physiological or pathophysiological mechanisms of the alterations of galanin and NPY expression affected by NGF in primary cultured SCG neurons are still unknown. The present data provide basic knowledge about the expression of galanin and NPY in primary cultured SCG neurons of rats, which may further improve our understanding of the functional significance of galanin and NPY expression affected by NGF.

Disruption of transforming growth factor-beta signaling by curcumin induces gene expression of peroxisome proliferator-activated receptor-gamma in rat hepatic stellate cells.

PubMed

Zheng, Shizhong; Chen, Anping

2007-01-01

Activation of hepatic stellate cells (HSC), the major effectors of hepatic fibrogenesis, is coupled with sequential alterations in gene expression, including an increase in receptors for transforming growth factor-beta (TGF-beta) and a dramatic reduction in the peroxisome proliferator-activated receptor-gamma (PPAR-gamma). The relationship between them remains obscure. We previously demonstrated that curcumin induced gene expression of PPAR-gamma in activated HSC, leading to reducing cell proliferation, inducing apoptosis and suppressing expression of extracellular matrix genes. The underlying molecular mechanisms are largely unknown. We recently observed that stimulation of PPAR-gamma activation suppressed gene expression of TGF-beta receptors in activated HSC, leading to the interruption of TGF-beta signaling. This observation supported our assumption of an antagonistic relationship between PPAR-gamma activation and TGF-beta signaling in HSC. In this study, we further hypothesize that TGF-beta signaling might negatively regulate gene expression of PPAR-gamma in activated HSC. The present report demonstrates that exogenous TGF-beta1 inhibits gene expression of PPAR-gamma in activated HSC, which is eliminated by the pretreatment with curcumin likely by interrupting TGF-beta signaling. Transfection assays further indicate that blocking TGF-beta signaling by dominant negative type II TGF-beta receptor increases the promoter activity of PPAR-gamma gene. Promoter deletion assays, site-directed mutageneses, and gel shift assays localize two Smad binding elements (SBEs) in the PPAR-gamma gene promoter, acting as curcumin response elements and negatively regulating the promoter activity in passaged HSC. The Smad3/4 protein complex specifically binds to the SBEs. Overexpression of Smad4 dose dependently eliminates the inhibitory effects of curcumin on the PPAR-gamma gene promoter and TGF-beta signaling. Taken together, these results demonstrate that the interruption of TGF-beta signaling by curcumin induces gene expression of PPAR-gamma in activated HSC in vitro. Our studies provide novel insights into the molecular mechanisms of curcumin in the induction of PPAR-gamma gene expression and in the inhibition of HSC activation.

Adrenomedullin Regulates IL-1β Gene Expression in F4/80+ Macrophages during Synovial Inflammation

PubMed Central

Takano, Shotaro; Miyagi, Masayuki; Inoue, Gen; Aikawa, Jun; Iwabuchi, Kazuya; Takaso, Masashi

2017-01-01

Adrenomedullin (AM) plays an important role in the regulation of inflammatory processes; however, the role and expression of AM in synovial inflammation have not been determined. To investigate the expression and role of AM in inflamed synovial tissue (ST), the gene expression profiles of AM in the ST, including synovial macrophages and fibroblasts, of a murine patellar surgical dislocation model were characterized. In addition, the effects of interleukin- (IL-) 1β and AM in cultured synovial cells were also examined. CD11c+ macrophages were found to be elevated in ST of the surgically dislocated patella. Higher gene expression of CD11c, IL-1β, AM, receptor activity-modifying proteins 2 (RAMP2), and 3 (RAMP3) was also observed in ST obtained from the dislocated side. AM expression was also significantly increased in synovial fibroblasts and macrophages in response to IL-1β treatment. Synovial macrophages also highly expressed RAMP3 compared to fibroblasts and this expression was further stimulated by exogenously added IL-1β. Further, the treatment of the F4/80-positive cell fraction obtained from ST with AM inhibited IL-1β expression. Taken together, these findings demonstrated that AM was produced by synovial fibroblasts and macrophages in inflamed ST and that increased levels of AM may exert anti-inflammatory effects on synovial macrophages. PMID:28299347

Exogenous fibroblast growth factor 9 attenuates cartilage degradation and aggravates osteophyte formation in post-traumatic osteoarthritis.

PubMed

Zhou, S; Wang, Z; Tang, J; Li, W; Huang, J; Xu, W; Luo, F; Xu, M; Wang, J; Wen, X; Chen, L; Chen, H; Su, N; Shen, Y; Du, X; Xie, Y; Chen, L

2016-12-01

The aim of the present study is to investigate the effects of exogenous fibroblast growth factor (FGF)9 on the progression of post-traumatic osteoarthritis (OA). The expression of FGF9 in articular cartilage with OA is detected by immunohistochemistry (IHC). The effects of intra-articular exogenous FGF9 injection on post-traumatic OA induced by the destabilization of the medial meniscus (DMM) surgery are evaluated. Cartilage changes and osteophyte formation in knee joints are investigated by histological analysis. Changes in subchondral bone are evaluated by microcomputed tomography (micro-CT). The effect of exogenous FGF9 on an interleukin-1β (IL-1β)-induced ex vivo OA model of human articular cartilage tissues is also evaluated. FGF9 expression was down-regulated in articular chondrocytes of OA but ectopically induced at sites of osteophyte formation. Intra-articular injection of exogenous FGF9 attenuated articular cartilage degradation in mice after DMM surgery. Exogenous FGF9 suppressed collagen X and MMP13 expressions in OA cartilage, while promoted collagen II expression. Similar results were observed in IL-1β-induced ex vivo OA model. Intra-articular injection of FGF9 had no significant effect on the subchondral bone of knee joints after DMM surgery, but aggravated osteophyte formation. The expressions of SOX9 and collagen II, and cell proliferation were up-regulated at sites of initial osteophyte formation in mice with exogenous FGF9 treatment. Intra-articular injection of exogenous FGF9 delays articular cartilage degradation in post-traumatic OA, while aggravates osteophyte formation. Copyright © 2016. Published by Elsevier Ltd.

Three 1-Aminocyclopropane-1-Carboxylate Synthase Genes Regulated by Primary and Secondary Pollination Signals in Orchid Flowers1

PubMed Central

Bui, Anhthu Q.; Neill, Sharman D. O'

1998-01-01

The temporal and spatial expression patterns of three 1-aminocyclopropane-1-carboxylate (ACC) synthase genes were investigated in pollinated orchid (Phalaenopsis spp.) flowers. Pollination signals initiate a cascade of development events in multiple floral organs, including the induction of ethylene biosynthesis, which coordinates several postpollination developmental responses. The initiation and propagation of ethylene biosynthesis is regulated by the coordinated expression of three distinct ACC synthase genes in orchid flowers. One ACC synthase gene (Phal-ACS1) is regulated by ethylene and participates in amplification and interorgan transmission of the pollination signal, as we have previously described in a related orchid genus. Two additional ACC synthase genes (Phal-ACS2 and Phal-ACS3) are expressed primarily in the stigma and ovary of pollinated orchid flowers. Phal-ACS2 mRNA accumulated in the stigma within 1 h after pollination, whereas Phal-ACS1 mRNA was not detected until 6 h after pollination. Similar to the expression of Phal-ACS2, the Phal-ACS3 gene was expressed within 2 h after pollination in the ovary. Exogenous application of auxin, but not ACC, mimicked pollination by stimulating a rapid increase in ACC synthase activity in the stigma and ovary and inducing Phal-ACS2 and Phal-ACS3 mRNA accumulation in the stigma and ovary, respectively. These results provide the basis for an expanded model of interorgan regulation of three ACC synthase genes that respond to both primary (Phal-ACS2 and Phal-ACS3) and secondary (Phal-ACS1) pollination signals. PMID:9449850

Whole-Genome Microarray and Gene Deletion Studies Reveal Regulation of the Polyhydroxyalkanoate Production Cycle by the Stringent Response in Ralstonia eutropha H16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brigham, CJ; Speth, DR; Rha, C

Poly(3-hydroxybutyrate) (PHB) production and mobilization in Ralstonia eutropha are well studied, but in only a few instances has PHB production been explored in relation to other cellular processes. We examined the global gene expression of wild-type R. eutropha throughout the PHB cycle: growth on fructose, PHB production using fructose following ammonium depletion, and PHB utilization in the absence of exogenous carbon after ammonium was resupplied. Our results confirm or lend support to previously reported results regarding the expression of PHB-related genes and enzymes. Additionally, genes for many different cellular processes, such as DNA replication, cell division, and translation, are selectivelymore » repressed during PHB production. In contrast, the expression levels of genes under the control of the alternative sigma factor sigma(54) increase sharply during PHB production and are repressed again during PHB utilization. Global gene regulation during PHB production is strongly reminiscent of the gene expression pattern observed during the stringent response in other species. Furthermore, a ppGpp synthase deletion mutant did not show an accumulation of PHB, and the chemical induction of the stringent response with DL-norvaline caused an increased accumulation of PHB in the presence of ammonium. These results indicate that the stringent response is required for PHB accumulation in R. eutropha, helping to elucidate a thus-far-unknown physiological basis for this process.« less

Decreased expression of interferon-induced protein 2 (IFIT2) by Wnt/β-catenin signaling confers anti-apoptotic properties to colorectal cancer cells

PubMed Central

Ohsugi, Tomoyuki; Yamaguchi, Kiyoshi; Zhu, Chi; Ikenoue, Tsuneo; Furukawa, Yoichi

2017-01-01

Impaired Wnt signaling pathway plays a crucial role in the development of colorectal cancer through activation of the β-catenin/TCF7L2 complex. Although genes up-regulated by Wnt/β-catenin signaling have been intensively studied, the roles of down-regulated genes are poorly understood. In this study, we explored a global gene expression of colorectal cancer cells transfected with β-catenin siRNAs or a dominant negative form of TCF7L2 (dnTCF7L2), and identified a set of genes down-regulated by Wnt/β-catenin signaling. Among the genes, we focused here on IFIT2, a gene encoding interferon-induced protein with tetratricopeptide repeats. A reporter assay using plasmids containing a 5’-flanking region of the gene showed that the reporter activity was enhanced by either transduction of β-catenin siRNA or dnTCF7L2, suggesting that the region is involved in the transcriptional regulation as a downstream of the β-catenin/TCF7L2 complex. Consistent with this result, expression of IFIT2 was significantly lower in colorectal cancer tissues than that in normal tissues. Exogenous IFIT2 expression decreased cell proliferation and increased apoptosis of colorectal cancer cells. These data suggested that the down-regulation of IFIT2 by Wnt/β-catenin signaling may play a vital role in human colorectal carcinogenesis through the suppression of apoptosis. PMID:29245969

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kasid, A.; Morecki, S.; Aebersold, P.

Tumor-infiltrating lymphocytes (TILs) are cells generated from tumor suspensions cultured in interleukin 2 that can mediate cancer regression when adoptively transferred into mice or humans. Since TILs proliferate rapidly in vitro, recirculate, and preferentially localize at the tumor site in vivo, they provide an attractive model for delivery of exogenous genetic material into man. To determine whether efficient gene transfer into TILs is feasible. The authors transduced human TILs with the bacterial gene for neomycin-resistance (Neo{sup R}) using the retroviral vector N2. The transduced TIL populations were stable and polyclonal with respect to the intact Neo{sup R} gene integration andmore » expressed high levels of neomycin phosphotransferase activity. The Neo{sup R} gene insertion did not alter the in vitro growth pattern and interleukin 2 dependence of the transduced TILs. Analyses of T-cell receptor gene rearrangement for {beta}- and {gamma}-chain genes revealed the oligoclonal nature of the TIL populations with no major change in the DNA rearrangement patterns or the levels of mRNA expression of the {beta} and {gamma} chains following transduction and selection of TILs in the neomycin analog G418. Human TILs expressed mRNA for tumor necrosis factors ({alpha} and {beta}) and interleukin 2 receptor P55. This pattern of cytokine-mRNA expression was not significantly altered following the transduction of TILs. The studies demonstrate the feasibility of TILs as suitable cellular vehicles for the introduction of therapeutic genes into patients receiving autologous TILs.« less

Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes.

PubMed

Majumder, P; Choudhury, A; Banerjee, M; Lahiri, A; Bhattacharyya, N P

2007-08-01

To investigate the mechanism of increased expression of caspase-1 caused by exogenous Hippi, observed earlier in HeLa and Neuro2A cells, in this work we identified a specific motif AAAGACATG (- 101 to - 93) at the caspase-1 gene upstream sequence where HIPPI could bind. Various mutations in this specific sequence compromised the interaction, showing the specificity of the interactions. In the luciferase reporter assay, when the reporter gene was driven by caspase-1 gene upstream sequences (- 151 to - 92) with the mutation G to T at position - 98, luciferase activity was decreased significantly in green fluorescent protein-Hippi-expressing HeLa cells in comparison to that obtained with the wild-type caspase-1 gene 60 bp upstream sequence, indicating the biological significance of such binding. It was observed that the C-terminal 'pseudo' death effector domain of HIPPI interacted with the 60 bp (- 151 to - 92) upstream sequence of the caspase-1 gene containing the motif. We further observed that expression of caspase-8 and caspase-10 was increased in green fluorescent protein-Hippi-expressing HeLa cells. In addition, HIPPI interacted in vitro with putative promoter sequences of these genes, containing a similar motif. In summary, we identified a novel function of HIPPI; it binds to specific upstream sequences of the caspase-1, caspase-8 and caspase-10 genes and alters the expression of the genes. This result showed the motif-specific interaction of HIPPI with DNA, and indicates that it could act as transcription regulator.

Identification and expression analysis of cytokinin metabolic genes IPTs, CYP735A and CKXs in the biofuel plant Jatropha curcas.

PubMed

Cai, Li; Zhang, Lu; Fu, Qiantang; Xu, Zeng-Fu

2018-01-01

The seed oil of Jatropha curcas is considered a potential bioenergy source that could replace fossil fuels. However, the seed yield of Jatropha is low and has yet to be improved. We previously reported that exogenous cytokinin treatment increased the seed yield of Jatropha . Cytokinin levels are directly regulated by isopentenyl transferase (IPT), cytochrome P450 monooxygenase, family 735, subfamily A (CYP735A), and cytokinin oxidase/dehydrogenase (CKX). In this study, we cloned six IPT genes, one JcCYP735A gene, and seven JcCKX genes. The expression patterns of these 14 genes in various organs were determined using real-time quantitative PCR. JcIPT1 was primarily expressed in roots and seeds, JcIPT2 was expressed in roots, apical meristems, and mature leaves, JcIPT3 was expressed in stems and mature leaves, JcIPT5 was expressed in roots and mature leaves, JcIPT6 was expressed in seeds at 10 days after pollination, and JcIPT9 was expressed in mature leaves. JcCYP735A was mainly expressed in roots, flower buds, and seeds. The seven JcCKX genes also showed different expression patterns in different organs of Jatropha . In addition, CK levels were detected in flower buds and seeds at different stages of development. The concentration of N 6 -(Δ 2 -isopentenyl)-adenine (iP), iP-riboside, and trans -zeatin (tZ) increased with flower development, and the concentration of iP decreased with seed development, while that of tZ increased. We further analyzed the function of JcCYP735A using the CRISPR-Cas9 system, and found that the concentrations of tZ and tZ-riboside decreased significantly in the Jccyp735a mutants, which showed severely retarded growth. These findings will be helpful for further studies of the functions of cytokinin metabolic genes and understanding the roles of cytokinins in Jatropha growth and development.

Identification and expression analysis of cytokinin metabolic genes IPTs, CYP735A and CKXs in the biofuel plant Jatropha curcas

PubMed Central

Cai, Li; Zhang, Lu

2018-01-01

The seed oil of Jatropha curcas is considered a potential bioenergy source that could replace fossil fuels. However, the seed yield of Jatropha is low and has yet to be improved. We previously reported that exogenous cytokinin treatment increased the seed yield of Jatropha. Cytokinin levels are directly regulated by isopentenyl transferase (IPT), cytochrome P450 monooxygenase, family 735, subfamily A (CYP735A), and cytokinin oxidase/dehydrogenase (CKX). In this study, we cloned six IPT genes, one JcCYP735A gene, and seven JcCKX genes. The expression patterns of these 14 genes in various organs were determined using real-time quantitative PCR. JcIPT1 was primarily expressed in roots and seeds, JcIPT2 was expressed in roots, apical meristems, and mature leaves, JcIPT3 was expressed in stems and mature leaves, JcIPT5 was expressed in roots and mature leaves, JcIPT6 was expressed in seeds at 10 days after pollination, and JcIPT9 was expressed in mature leaves. JcCYP735A was mainly expressed in roots, flower buds, and seeds. The seven JcCKX genes also showed different expression patterns in different organs of Jatropha. In addition, CK levels were detected in flower buds and seeds at different stages of development. The concentration of N6-(Δ2-isopentenyl)-adenine (iP), iP-riboside, and trans-zeatin (tZ) increased with flower development, and the concentration of iP decreased with seed development, while that of tZ increased. We further analyzed the function of JcCYP735A using the CRISPR-Cas9 system, and found that the concentrations of tZ and tZ-riboside decreased significantly in the Jccyp735a mutants, which showed severely retarded growth. These findings will be helpful for further studies of the functions of cytokinin metabolic genes and understanding the roles of cytokinins in Jatropha growth and development. PMID:29785355

Metabolic Mechanism for l-Leucine-Induced Metabolome To Eliminate Streptococcus iniae.

PubMed

Du, Chao-Chao; Yang, Man-Jun; Li, Min-Yi; Yang, Jun; Peng, Bo; Li, Hui; Peng, Xuan-Xian

2017-05-05

Crucial metabolites that modulate hosts' metabolome to eliminate bacterial pathogens have been documented, but the metabolic mechanisms are largely unknown. The present study explores the metabolic mechanism for l-leucine-induced metabolome to eliminate Streptococcus iniae in tilapia. GC-MS-based metabolomics was used to investigate the tilapia liver metabolic profile in the presence of exogenous l-leucine. Thirty-seven metabolites of differential abundance were determined, and 11 metabolic pathways were enriched. Pattern recognition analysis identified serine and proline as crucial metabolites, which are the two metabolites identified in survived tilapias during S. iniae infection, suggesting that the two metabolites play crucial roles in l-leucine-induced elimination of the pathogen by the host. Exogenous l-serine reduces the mortality of tilapias infected by S. iniae, providing a robust proof supporting the conclusion. Furthermore, exogenous l-serine elevates expression of genes IL-1β and IL-8 in tilapia spleen, but not TNFα, CXCR4 and Mx, suggesting that the metabolite promotes a phagocytosis role of macrophages, which is consistent with the finding that l-leucine promotes macrophages to kill both Gram-positive and Gram-negative bacterial pathogens. Therefore, the ability of phagocytosis enhanced by exogenous l-leucine is partly attributed to elevation of l-serine. These results demonstrate a metabolic mechanism by which exogenous l-leucine modulates tilapias' metabolome to enhance innate immunity and eliminate pathogens.

A Heme-responsive Regulator Controls Synthesis of Staphyloferrin B in Staphylococcus aureus*♦

PubMed Central

Laakso, Holly A.; Marolda, Cristina L.; Pinter, Tyler B.; Stillman, Martin J.; Heinrichs, David E.

2016-01-01

Staphylococcus aureus possesses a multitude of mechanisms by which it can obtain iron during growth under iron starvation conditions. It expresses an effective heme acquisition system (the iron-regulated surface determinant system), it produces two carboxylate-type siderophores staphyloferrin A and staphyloferrin B (SB), and it expresses transporters for many other siderophores that it does not synthesize. The ferric uptake regulator protein regulates expression of genes encoding all of these systems. Mechanisms of fine-tuning expression of iron-regulated genes, beyond simple iron regulation via ferric uptake regulator, have not been uncovered in this organism. Here, we identify the ninth gene of the sbn operon, sbnI, as encoding a ParB/Spo0J-like protein that is required for expression of genes in the sbn operon from sbnD onward. Expression of sbnD–I is drastically decreased in an sbnI mutant, and the mutant does not synthesize detectable SB during early phases of growth. Thus, SB-mediated iron acquisition is impaired in an sbnI mutant strain. We show that the protein forms dimers and tetramers in solution and binds to DNA within the sbnC coding region. Moreover, we show that SbnI binds heme and that heme-bound SbnI does not bind DNA. Finally, we show that providing exogenous heme to S. aureus growing in an iron-free medium results in delayed synthesis of SB. This is the first study in S. aureus that identifies a DNA-binding regulatory protein that senses heme to control gene expression for siderophore synthesis. PMID:26534960

Cyclic strain is a weak inducer of prostacyclin synthase expression in bovine aortic endothelial cells

NASA Technical Reports Server (NTRS)

Segurola, R. J. Jr; Oluwole, B.; Mills, I.; Yokoyama, C.; Tanabe, T.; Kito, H.; Nakajima, N.; Sumpio, B. E.

1997-01-01

Recent studies indicate that hemodynamic forces such as cyclic strain and shear stress can increase prostacyclin (PGI2) secretion by endothelial cells (EC) but the effect of these forces on prostacyclin synthase (PGIS) gene expression remains unclear and is the focus of this study. Bovine aortic EC were seeded onto type I collagen coated flexible membranes and grown to confluence. The membranes and attached EC were subjected to 10% average strain at 60 cpm (0.5 sec deformation alternating with 0.5 sec relaxation) for up to 5 days. PGIS gene expression was determined by Northern blot analysis and protein level by Western blot analysis. The effect of cyclic strain on the PGIS promoter was determined by the transfection of a 1-kb human PGIS gene promoter construct coupled to a luciferase reporter gene into EC, followed by determination of luciferase activity. PGIS gene expression increased 1.7-fold in EC subjected to cyclic strain for 24 hr. Likewise, EC transfected with a pGL3B-PGIS (-1070/-10) construct showed an approximate 1.3-fold elevation in luciferase activity in EC subjected to cyclic strain for 3, 4, 8, and 12 hr. The weak stimulation of PGIS gene expression by cyclic strain was reflected in an inability to detect alterations in PGIS protein levels in EC subjected to cyclic strain for as long as 5 days. These data suggest that strain-induced stimulation of PGIS gene expression plays only a minor role in the ability of cyclic strain to stimulate PGI2 release in EC. These findings coupled with our earlier demonstration of a requisite addition of exogenous arachidonate in order to observe strain-induced PGI2 release, implicates a mechanism that more likely involves strain-induced stimulation of PGIS activity.

Histological staining methods preparatory to laser capture microdissection significantly affect the integrity of the cellular RNA.

PubMed

Wang, Hongyang; Owens, James D; Shih, Joanna H; Li, Ming-Chung; Bonner, Robert F; Mushinski, J Frederic

2006-04-27

Gene expression profiling by microarray analysis of cells enriched by laser capture microdissection (LCM) faces several technical challenges. Frozen sections yield higher quality RNA than paraffin-imbedded sections, but even with frozen sections, the staining methods used for histological identification of cells of interest could still damage the mRNA in the cells. To study the contribution of staining methods to degradation of results from gene expression profiling of LCM samples, we subjected pellets of the mouse plasma cell tumor cell line TEPC 1165 to direct RNA extraction and to parallel frozen sectioning for LCM and subsequent RNA extraction. We used microarray hybridization analysis to compare gene expression profiles of RNA from cell pellets with gene expression profiles of RNA from frozen sections that had been stained with hematoxylin and eosin (H&E), Nissl Stain (NS), and for immunofluorescence (IF) as well as with the plasma cell-revealing methyl green pyronin (MGP) stain. All RNAs were amplified with two rounds of T7-based in vitro transcription and analyzed by two-color expression analysis on 10-K cDNA microarrays. The MGP-stained samples showed the least introduction of mRNA loss, followed by H&E and immunofluorescence. Nissl staining was significantly more detrimental to gene expression profiles, presumably owing to an aqueous step in which RNA may have been damaged by endogenous or exogenous RNAases. RNA damage can occur during the staining steps preparatory to laser capture microdissection, with the consequence of loss of representation of certain genes in microarray hybridization analysis. Inclusion of RNAase inhibitor in aqueous staining solutions appears to be important in protecting RNA from loss of gene transcripts.

Histological staining methods preparatory to laser capture microdissection significantly affect the integrity of the cellular RNA

PubMed Central

Wang, Hongyang; Owens, James D; Shih, Joanna H; Li, Ming-Chung; Bonner, Robert F; Mushinski, J Frederic

2006-01-01

Background Gene expression profiling by microarray analysis of cells enriched by laser capture microdissection (LCM) faces several technical challenges. Frozen sections yield higher quality RNA than paraffin-imbedded sections, but even with frozen sections, the staining methods used for histological identification of cells of interest could still damage the mRNA in the cells. To study the contribution of staining methods to degradation of results from gene expression profiling of LCM samples, we subjected pellets of the mouse plasma cell tumor cell line TEPC 1165 to direct RNA extraction and to parallel frozen sectioning for LCM and subsequent RNA extraction. We used microarray hybridization analysis to compare gene expression profiles of RNA from cell pellets with gene expression profiles of RNA from frozen sections that had been stained with hematoxylin and eosin (H&E), Nissl Stain (NS), and for immunofluorescence (IF) as well as with the plasma cell-revealing methyl green pyronin (MGP) stain. All RNAs were amplified with two rounds of T7-based in vitro transcription and analyzed by two-color expression analysis on 10-K cDNA microarrays. Results The MGP-stained samples showed the least introduction of mRNA loss, followed by H&E and immunofluorescence. Nissl staining was significantly more detrimental to gene expression profiles, presumably owing to an aqueous step in which RNA may have been damaged by endogenous or exogenous RNAases. Conclusion RNA damage can occur during the staining steps preparatory to laser capture microdissection, with the consequence of loss of representation of certain genes in microarray hybridization analysis. Inclusion of RNAase inhibitor in aqueous staining solutions appears to be important in protecting RNA from loss of gene transcripts. PMID:16643667

Arabidopsis thaliana responses to mechanical stimulation do not require ETR1 or EIN2

NASA Technical Reports Server (NTRS)

Johnson, K. A.; Sistrunk, M. L.; Polisensky, D. H.; Braam, J.; McIntire, L. V. (Principal Investigator)

1998-01-01

Plants exposed to repetitive touch or wind are generally shorter and stockier than sheltered plants. These mechanostimulus-induced developmental changes are termed thigmomorphogenesis and may confer resistance to subsequent stresses. An early response of Arabidopsis thaliana to touch or wind is the up-regulation of TCH (touch) gene expression. The signal transduction pathway that leads to mechanostimulus responses is not well defined. A role for ethylene has been proposed based on the observation that mechanostimulation of plants leads to ethylene evolution and exogenous ethylene leads to thigmomorphogenetic-like changes. To determine whether ethylene has a role in plant responses to mechanostimulation, we assessed the ability of two ethylene-insensitive mutants, etr1-3 and ein2-1, to undergo thigmomorphogenesis and TCH gene up-regulation of expression. The ethylene-insensitive mutants responded to wind similarly to the wild type, with a delay in flowering, decrease in inflorescence elongation rate, shorter mature primary inflorescences, more rosette paraclades, and appropriate TCH gene expression changes. Also, wild-type and mutant Arabidopsis responded to vibrational stimulation, with an increase in hypocotyl elongation and up-regulation of TCH gene expression. We conclude that the ETR1 and EIN2 protein functions are not required for the developmental and molecular responses to mechanical stimulation.

[Subtractive gene cloning and gene-disruption for elucidation of pseudohyphal formation in Candida tropicalis].

PubMed

Suzuki, Takahito

2003-01-01

The dimorphic transition from yeast to pseudohyphae in the petroleum-assimilating yeast Candida tropicalis occurs following the addition of ethanol to glucose semi-defined medium. Subtractive gene cloning was performed on the cDNA from the yeast-growing control culture and on that from the ethanol-supplemented one (the ethanol culture). A homologue of Schizosaccharomyces pombe nmt1+ or Saccharomyces cerevisiae THI5 was isolated from the cDNA fraction as a preferentially expressed gene for the ethanol culture. This homologue was tentatively called Ctnmt1+, since exogenous thiamine repressed its expression in C. tropicalis growth media. The ethanol culture showed a biphasic pattern of growth phases and the expression of Ctnmt1+ occurred at the first growth phase. The supplementation of thiamine to the ethanol culture at the first phase was followed by repression of Ctnmt1+ expression and also delay of pseudohyphal growth: filamentous growth was inhibited and chains of yeast cells were formed. A Ctnmt1+ disruptant of this organism did not show thiamine auxotrophy and produced pseudohyphal filaments even in the control culture. The supplementation of oxythiamine, an analog of thiamine, to the control culture was followed by the appearance of pseudohyphal filaments, indicating the participation of thiamine during the process of pseudohyphal growth in this organism.

Oncogenic collaboration of the cyclin D1 (PRAD1, bcl-1) gene with a mutated p53 and an activated ras oncogene in neoplastic transformation.

PubMed

Uchimaru, K; Endo, K; Fujinuma, H; Zukerberg, L; Arnold, A; Motokura, T

1996-05-01

Cyclin D1 is one of the key regulators in G1 progression in the cell cycle and is also a candidate oncogene (termed PRAD1 or bcl-1) in several types of human tumors. We report a collaboration of the cyclin D1 gene with ras and a mutated form of p53 (p53-mt) in neoplastic transformation. Transfection of cyclin D1 alone or in combination with ras or with p53-mt was not sufficient for focus formation of rat embryonic fibroblasts. However, focus formation induced by co-transfection of ras and p53-mt was enhanced in the presence of the cyclin D1-expression plasmid. Co-transfection of ras- and p53-mt-transformants with the cyclin D1-expression plasmid resulted in reduced serum dependency in vitro. Furthermore, the transformants expressing exogenous cyclin D1 grew faster than those without the cyclin D1 plasmid when injected into nude mice. These observations strengthen the significance of cyclin D1 overexpression through gene rearrangement or gene amplification observed in human tumors as a step in multistep oncogenesis; deregulated expression of cyclin D1 may reduce the requirement for growth factors and may stimulate in vivo growth.

[Construction and identification of recombinant human platelet-derived growth factor-B adenoviral vector and transfection into periodontal ligament stem cells].

PubMed

Shang, Shu-huan; Zhang, Yu-feng; Shi, Bin; Cheng, Xiang-rong

2008-10-01

To construct a recombinant human platelet-derived growth factor-B (PDGF-B) adenoviral vector and to transfect it into human periodontal ligament stem cells (PDLSC). The recombinant plasmid pAd-PDGF-B was constructed by homologous recombination and confirmed by restriction endonucleases digestion. Recombinant adenovirus was packaged in HEK293 cells. PDLSC were transfected with recombinant adenovirus and PDGF-B expression was confirmed. Expression of collagen type I gene was determined by quantitative analysis of the products of RT-PCR. The cell proliferation was determined with MTT colorimetric assay. The recombinant plasmid pAd-PDGF-B was confirmed by restriction endonucleases digestion. EGFP expression was observed on the third day after transfecting, and the expression of PDGF-B was detected. Immunohistochemical methods revealed that PDGF-B was expressed in PDLSC. Levels of expression of collagen type I gene were increased significantly by transfer of the exogenous PDGF-B gene to PDLSC. At the same time, findings indicated that Ad-PDGF-B stimulated PDLSC proliferation. MTT assay indicated the absorbance of PDLSC by stimulating with Ad-PDGF-B was (0.68 +/- 0.02), P < 0.01. Using the AdEasy system, the human PDGF-B recombinant adenovirus can be rapidly obtained. These results indicate that recombinant adenoviruses encoding PDGF-B transgenes could modulate proliferative activity of PDLSC, enhance the high expression of collagen type I and lay the foundation for periodontal tissue regeneration and dental implant gene therapy.

Gene transcript profiles of the TIA biosynthetic pathway in response to ethylene and copper reveal their interactive role in modulating TIA biosynthesis in Catharanthus roseus.

PubMed

Pan, Ya-Jie; Liu, Jia; Guo, Xiao-Rui; Zu, Yuan-Gang; Tang, Zhong-Hua

2015-05-01

Research on transcriptional regulation of terpenoid indole alkaloid (TIA) biosynthesis of the medicinal plant, Catharanthus roseus, has largely been focused on gene function and not clustering analysis of multiple genes at the transcript level. Here, more than ten key genes encoding key enzyme of alkaloid synthesis in TIA biosynthetic pathways were chosen to investigate the integrative responses to exogenous elicitor ethylene and copper (Cu) at both transcriptional and metabolic levels. The ethylene-induced gene transcripts in leaves and roots, respectively, were subjected to principal component analysis (PCA) and the results showed the overall expression of TIA pathway genes indicated as the Q value followed a standard normal distribution after ethylene treatments. Peak gene expression was at 15-30 μM of ethephon, and the pre-mature leaf had a higher Q value than the immature or mature leaf and root. Treatment with elicitor Cu found that Cu up-regulated overall TIA gene expression more in roots than in leaves. The combined effects of Cu and ethephon on TIA gene expression were stronger than their separate effects. It has been documented that TIA gene expression is tightly regulated by the transcriptional factor (TF) ethylene responsive factor (ERF) and mitogen-activated protein kinase (MAPK) cascade. The loading plot combination with correlation analysis for the genes of C. roseus showed that expression of the MPK gene correlated with strictosidine synthase (STR) and strictosidine b-D-glucosidase(SGD). In addition, ERF expression correlated with expression of secologanin synthase (SLS) and tryptophan decarboxylase (TDC), specifically in roots, whereas MPK and myelocytomatosis oncogene (MYC) correlated with STR and SGD genes. In conclusion, the ERF regulates the upstream pathway genes in response to heavy metal Cu mainly in C. roseus roots, while the MPK mainly participates in regulating the STR gene in response to ethylene in pre-mature leaf. Interestingly, the change in TIA accumulation does not correlate with expression of the associated genes. Our previous research found significant accumulation of vinblastine in response to high concentration of ethylene and Cu suggesting the involvement of posttranscriptional and posttranslational mechanisms in a spatial and temporal manner. In this study, meta-analysis reveals ERF and MPK form a positive feedback loop connecting two pathways actively involved in response of TIA pathway genes to ethylene and copper in C. roseus.

Characterization of Gonadal Transcriptomes from Nile Tilapia (Oreochromis niloticus) Reveals Differentially Expressed Genes

PubMed Central

Sun, Yunlv; Yang, Shijie; Li, Minghui; Zeng, Sheng; Huang, Baofeng; Wang, Deshou

2013-01-01

Four pairs of XX and XY gonads from Nile tilapia were sequenced at four developmental stages, 5, 30, 90, and 180 days after hatching (dah) using Illumina HiseqTM technology. This produced 28 Gb sequences, which were mapped to 21,334 genes. Of these, 259 genes were found to be specifically expressed in XY gonads, and 69 were found to be specific to XX gonads. Totally, 187 XX- and 1,358 XY-enhanced genes were identified, and 2,978 genes were found to be co-expressed in XX and XY gonads. Almost all steroidogenic enzymes, including cyp19a1a, were up-regulated in XX gonads at 5 dah; but in XY gonads these enzymes, including cyp11b2, were significantly up-regulated at 90 dah, indicating that, at a time critical to sex determination, the XX fish produced estrogen and the XY fish did not produce androgens. The most pronounced expression of steroidogenic enzyme genes was observed at 30 and 90 dah for XX and XY gonads, corresponding to the initiation of germ cell meiosis in the female and male gonads, respectively. Both estrogen and androgen receptors were found to be expressed in XX gonads, but only estrogen receptors were expressed in XY gonads at 5 dah. This could explain why exogenous steroid treatment induced XX and XY sex reversal. The XX-enhanced expression of cyp19a1a and cyp19a1b at all stages suggests an important role for estrogen in female sex determination and maintenance of phenotypic sex. This work is the largest collection of gonadal transcriptome data in tilapia and lays the foundation for future studies into the molecular mechanisms of sex determination and maintenance of phenotypic sex in non-model teleosts. PMID:23658843

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

The human estrogen receptor can regulate exogenous but not endogenous vitellogenin gene promoters in a Xenopus cell line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seiler-Tuyns, A.; Merillat, A.M.; Haefliger, D.N.

Transfection of a human estrogen receptor cDNA expression vector (HEO) into cultured Xenopus kidney cells confers estrogen responsiveness to the recipient cells as demonstrated by the hormone dependent expression of co-transfected Xenopus vitellogenin-CAT chimeric genes. The estrogen stimulation of these vit-CAT genes is dependent upon the presence of the vitellogenin estrogen responsive element (ERE) in their 5{prime} flanking region. Thus, functional human estrogen receptor (hER) can be synthesized in heterologous lower vertebrate cells and can act as a trans-acting regulatory factor that is necessary, together with estradiol, for the induction of the vit-CAT constructs in these cells. In addition, vitellogeninmore » minigenes co-transfected with the HEO expression vector also respond to hormonal stimulation. Their induction is not higher than that of the vit-CAT chimeric genes. It suggests that in the Xenopus kidney cell line B 3.2, the structural parts of the vitellogenin minigenes do not play a role in the induction process. Furthermore, no stabilizing effect of estrogen on vitellogenin mRNA is observed in these cells.« less

Isolation and characterization of a novel wheat cysteine-rich receptor-like kinase gene induced by Rhizoctonia cerealis

NASA Astrophysics Data System (ADS)

Yang, Kun; Rong, Wei; Qi, Lin; Li, Jiarui; Wei, Xuening; Zhang, Zengyan

2013-10-01

Cysteine-rich receptor kinases (CRKs) belong to the receptor-like kinase family. Little is known about CRK genes in wheat. We isolated a wheat CRK gene TaCRK1 from Rhizoctonia cerealis-resistant wheat CI12633 based on a differentially expressed sequence identified by RNA-Sequencing (RNA-Seq) analysis. TaCRK1 was more highly expressed in CI12633 than in susceptible Wenmai 6. Transcription of TaCRK1 in wheat was induced in CI12633 after R. cerealis infection and exogenous abscisic acid (ABA) treatment. The deduced TaCRK1 protein contained a signal peptide, two DUF26 domains, a transmembrane domain, and a serine/threonine protein kinase domain. Transient expression of a green fluorescence protein fused with TaCRK1 in wheat and onion indicated that TaCRK1 may localize to plasma membranes. Characterization of TaCRK1 silencing induced by virus-mediated method in CI12633 showed that the downregulation of TaCRK1 transcript did not obviously impair resistance to R. cerealis. This study paves the way to further CRK research in wheat.

Bmp2 Deletion Causes an Amelogenesis Imperfecta Phenotype Via Regulating Enamel Gene Expression

PubMed Central

GUO, FENG; FENG, JUNSHENG; WANG, FENG; LI, WENTONG; GAO, QINGPING; CHEN, ZHUO; SHOFF, LISA; DONLY, KEVIN J.; GLUHAK-HEINRICH, JELICA; CHUN, YONG HEE PATRICIA; HARRIS, STEPHEN E.; MACDOUGALL, MARY; CHEN, SHUO

2015-01-01

Although Bmp2 is essential for tooth formation, the role of Bmp2 during enamel formation remains unknown in vivo. In this study, the role of Bmp2 in regulation of enamel formation was investigated by the Bmp2 conditional knock out (Bmp2 cKO) mice. Teeth of Bmp2 cKO mice displayed severe and profound phenotypes with asymmetric and misshaped incisors as well as abrasion of incisors and molars. Scanning electron microscopy analysis showed that the enamel layer was hypoplastic and enamel lacked a typical prismatic pattern. Teeth from null mice were much more brittle as tested by shear and compressive moduli. Expression of enamel matrix protein genes, amelogenin, enamelin, and enamel-processing proteases, Mmp-20 and Klk4 was reduced in the Bmp2 cKO teeth as reflected in a reduced enamel formation. Exogenous Bmp2 up-regulated those gene expressions in mouse enamel organ epithelial cells. This result for the first time indicates Bmp2 signaling is essential for proper enamel development and mineralization in vivo. PMID:25545831

Bmp2 deletion causes an amelogenesis imperfecta phenotype via regulating enamel gene expression.

PubMed

Guo, Feng; Feng, Junsheng; Wang, Feng; Li, Wentong; Gao, Qingping; Chen, Zhuo; Shoff, Lisa; Donly, Kevin J; Gluhak-Heinrich, Jelica; Chun, Yong Hee Patricia; Harris, Stephen E; MacDougall, Mary; Chen, Shuo

2015-08-01

Although Bmp2 is essential for tooth formation, the role of Bmp2 during enamel formation remains unknown in vivo. In this study, the role of Bmp2 in regulation of enamel formation was investigated by the Bmp2 conditional knock out (Bmp2 cKO) mice. Teeth of Bmp2 cKO mice displayed severe and profound phenotypes with asymmetric and misshaped incisors as well as abrasion of incisors and molars. Scanning electron microscopy analysis showed that the enamel layer was hypoplastic and enamel lacked a typical prismatic pattern. Teeth from null mice were much more brittle as tested by shear and compressive moduli. Expression of enamel matrix protein genes, amelogenin, enamelin, and enamel-processing proteases, Mmp-20 and Klk4 was reduced in the Bmp2 cKO teeth as reflected in a reduced enamel formation. Exogenous Bmp2 up-regulated those gene expressions in mouse enamel organ epithelial cells. This result for the first time indicates Bmp2 signaling is essential for proper enamel development and mineralization in vivo. © 2015 Wiley Periodicals, Inc.

The Novel Wheat Transcription Factor TaNAC47 Enhances Multiple Abiotic Stress Tolerances in Transgenic Plants

PubMed Central

Zhang, Lina; Zhang, Lichao; Xia, Chuan; Zhao, Guangyao; Jia, Jizeng; Kong, Xiuying

2016-01-01

NAC transcription factors play diverse roles in plant development and responses to abiotic stresses. However, the biological roles of NAC family members in wheat are not well understood. Here, we reported the isolation and functional characterization of a novel wheat TaNAC47 gene. TaNAC47 encoded protein, localizing in the nucleus, is able to bind to the ABRE cis-element and transactivate transcription in yeast, suggesting that it likely functions as a transcriptional activator. We also showed that TaNAC47 is differentially expressed in different tissues, and its expression was induced by the stress treatments of salt, cold, polyethylene glycol and exogenous abscisic acid. Furthermore, overexpression of TaNAC47 in Arabidopsis resulted in ABA hypersensitivity and enhancing tolerance of transgenic plants to drought, salt, and freezing stresses. Strikingly, overexpression of TaNAC47 was found to activate the expression of downstream genes and change several physiological indices that may enable transgenic plants to overcome unfavorable environments. Taken together, these results uncovered an important role of wheat TaNAC47 gene in response to ABA and abiotic stresses. PMID:26834757

The Novel Wheat Transcription Factor TaNAC47 Enhances Multiple Abiotic Stress Tolerances in Transgenic Plants.

PubMed

Zhang, Lina; Zhang, Lichao; Xia, Chuan; Zhao, Guangyao; Jia, Jizeng; Kong, Xiuying

2015-01-01

NAC transcription factors play diverse roles in plant development and responses to abiotic stresses. However, the biological roles of NAC family members in wheat are not well understood. Here, we reported the isolation and functional characterization of a novel wheat TaNAC47 gene. TaNAC47 encoded protein, localizing in the nucleus, is able to bind to the ABRE cis-element and transactivate transcription in yeast, suggesting that it likely functions as a transcriptional activator. We also showed that TaNAC47 is differentially expressed in different tissues, and its expression was induced by the stress treatments of salt, cold, polyethylene glycol and exogenous abscisic acid. Furthermore, overexpression of TaNAC47 in Arabidopsis resulted in ABA hypersensitivity and enhancing tolerance of transgenic plants to drought, salt, and freezing stresses. Strikingly, overexpression of TaNAC47 was found to activate the expression of downstream genes and change several physiological indices that may enable transgenic plants to overcome unfavorable environments. Taken together, these results uncovered an important role of wheat TaNAC47 gene in response to ABA and abiotic stresses.

Amino Acids Regulate Transgene Expression in MDCK Cells

PubMed Central

Torrente, Marta; Guetg, Adriano; Sass, Jörn Oliver; Arps, Lisa; Ruckstuhl, Lisa; Camargo, Simone M. R.; Verrey, François

2014-01-01

Gene expression and cell growth rely on the intracellular concentration of amino acids, which in metazoans depends on extracellular amino acid availability and transmembrane transport. To investigate the impact of extracellular amino acid concentrations on the expression of a concentrative amino acid transporter, we overexpressed the main kidney proximal tubule luminal neutral amino acid transporter B0AT1-collectrin (SLC6A19-TMEM27) in MDCK cell epithelia. Exogenously expressed proteins co-localized at the luminal membrane and mediated neutral amino acid uptake. However, the transgenes were lost over few cell culture passages. In contrast, the expression of a control transgene remained stable. To test whether this loss was due to inappropriately high amino acid uptake, freshly transduced MDCK cell lines were cultivated either with physiological amounts of amino acids or with the high concentration found in standard cell culture media. Expression of exogenous transporters was unaffected by physiological amino acid concentration in the media. Interestingly, mycoplasma infection resulted in a significant increase in transgene expression and correlated with the rapid metabolism of L-arginine. However, L-arginine metabolites were shown to play no role in transgene expression. In contrast, activation of the GCN2 pathway revealed by an increase in eIF2α phosphorylation may trigger transgene derepression. Taken together, high extracellular amino acid concentration provided by cell culture media appears to inhibit the constitutive expression of concentrative amino acid transporters whereas L-arginine depletion by mycoplasma induces the expression of transgenes possibly via stimulation of the GCN2 pathway. PMID:24797296

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

Silencing and transcriptional properties of the imprinted Airn ncRNA are independent of the endogenous promoter

PubMed Central

Stricker, Stefan H; Steenpass, Laura; Pauler, Florian M; Santoro, Federica; Latos, Paulina A; Huang, Ru; Koerner, Martha V; Sloane, Mathew A; Warczok, Katarzyna E; Barlow, Denise P

2008-01-01

The Airn macro ncRNA is the master regulator of imprinted expression in the Igf2r imprinted gene cluster where it silences three flanking genes in cis. Airn transcription shows unusual features normally viewed as promoter specific, such as impaired post-transcriptional processing and a macro size. The Airn transcript is 108 kb long, predominantly unspliced and nuclear localized, with only a minority being variably spliced and exported. Here, we show by deletion of the Airn ncRNA promoter and replacement with a constitutive strong or weak promoter that splicing suppression and termination, as well as silencing activity, are maintained by strong Airn expression from an exogenous promoter. This indicates that all functional regions are located within the Airn transcript. DNA methylation of the maternal imprint control element (ICE) restricts Airn expression to the paternal allele and we also show that a strong active promoter is required to maintain the unmethylated state of the paternal ICE. Thus, Airn expression not only induces silencing of flanking mRNA genes but also protects the paternal copy of the ICE from de novo methylation. PMID:19008856

Characterization of the Carbohydrate Binding Module 18 gene family in the amphibian pathogen Batrachochytrium dendrobatidis.

PubMed

Liu, Peng; Stajich, Jason E

2015-04-01

Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis responsible for worldwide decline in amphibian populations. Previous analysis of the Bd genome revealed a unique expansion of the carbohydrate-binding module family 18 (CBM18) predicted to be a sub-class of chitin recognition domains. CBM expansions have been linked to the evolution of pathogenicity in a variety of fungal species by protecting the fungus from the host. Based on phylogenetic analysis and presence of additional protein domains, the gene family can be classified into 3 classes: Tyrosinase-, Deacetylase-, and Lectin-like. Examination of the mRNA expression levels from sporangia and zoospores of nine of the cbm18 genes found that the Lectin-like genes had the highest expression while the Tyrosinase-like genes showed little expression, especially in zoospores. Heterologous expression of GFP-tagged copies of four CBM18 genes in Saccharomyces cerevisiae demonstrated that two copies containing secretion signal peptides are trafficked to the cell boundary. The Lectin-like genes cbm18-ll1 and cbm18-ll2 co-localized with the chitinous cell boundaries visualized by staining with calcofluor white. In vitro assays of the full length and single domain copies from CBM18-LL1 demonstrated chitin binding and no binding to cellulose or xylan. Expressed CBM18 domain proteins were demonstrated to protect the fungus, Trichoderma reeseii, in vitro against hydrolysis from exogenously added chitinase, likely by binding and limiting exposure of fungal chitin. These results demonstrate that cbm18 genes can play a role in fungal defense and expansion of their copy number may be an important pathogenicity factor of this emerging infectious disease of amphibians. Copyright © 2015 Elsevier Inc. All rights reserved.

Ectoine and 5-hydroxyectoine accumulation in the halophile Virgibacillus halodenitrificans PDB-F2 in response to salt stress.

PubMed

Tao, Ping; Li, Hui; Yu, Yunjiang; Gu, Jidong; Liu, Yongdi

2016-08-01

The moderately halophilic bacterium Virgibacillus halodenitrificans PDB-F2 copes with salinity by synthesizing or taking up compatible solutes. The main compatible solutes in this strain were ectoine and hydroxyectoine, as determined by (1)H nuclear magnetic resonance spectroscopy ((1)H-NMR). A high-performance liquid chromatography (HPLC) analysis showed that ectoine was the major solute that was synthesized in response to elevated salinity, while hydroxyectoine was a minor solute. However, the hydroxyectoine/ectoine ratio increased from 0.04 at 3 % NaCl to 0.45 at 15 % NaCl in the late exponential growth phase. A cluster of ectoine biosynthesis genes was identified, including three genes in the order of ectA, ectB, and ectC. The hydroxyectoine biosynthesis gene ectD was not part of the ectABC gene cluster. Reverse transcription-quantitative polymerase chain reactions (RT-qPCR) showed that the expression of the ect genes was salinity dependent. The expression of ectABC reached a maximum at 12 % NaCl, while ectD expression increased up to 15 % NaCl. Ectoine and hydroxyectoine production was growth phase dependent. The hydroxyectoine/ectoine ratio increased from 0.018 in the early exponential phase to 0.11 in the stationary phase at 5 % NaCl. Hydroxyectoine biosynthesis started much later than ectoine biosynthesis after osmotic shock, and the temporal expression of the ect genes differed under these conditions, with the ectABC genes being expressed first, followed by ectD gene. Increased culture salinity triggered ectoine or hydroxyectoine uptake when they were added to the medium. Hydroxyectoine was accumulated preferentially when both ectoine and hydroxyectoine were provided exogenously.

A novel expression vector for the secretion of abaecin in Bacillus subtilis.

PubMed

Li, Li; Mu, Lan; Wang, Xiaojuan; Yu, Jingfeng; Hu, Ruiping; Li, Zhen

This study aimed to describe a Bacillus subtilis expression system based on genetically modified B. subtilis. Abaecin, an antimicrobial peptide obtained from Apis mellifera, can enhance the effect of pore-forming peptides from other species on the inhibition of bacterial growth. For the exogenous expression, the abaecin gene was fused with a tobacco etch virus protease cleavage site, a promoter Pglv, and a mature beta-glucanase signal peptide. Also, a B. subtilis expression system was constructed. The recombinant abaecin gene was expressed and purified as a recombinant protein in the culture supernatant. The purified abaecin did not inhibit the growth of Escherichia coli strain K88. Cecropin A and hymenoptaecin exhibited potent bactericidal activities at concentrations of 1 and 1.5μM. Combinatorial assays revealed that cecropin A and hymenoptaecin had sublethal concentrations of 0.3 and 0.5μM. This potentiating functional interaction represents a promising therapeutic strategy. It provides an opportunity to address the rising threat of multidrug-resistant pathogens that are recalcitrant to conventional antibiotics. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Rev-erb beta regulates the Srebp-1c promoter and mRNA expression in skeletal muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramakrishnan, Sathiya N.; Lau, Patrick; Crowther, Lisa M.

2009-10-30

The nuclear hormone receptor, Rev-erb beta operates as a transcriptional silencer. We previously demonstrated that exogenous expression of Rev-erb{beta}{Delta}E in skeletal muscle cells increased Srebp-1c mRNA expression. We validated these in vitro observations by injection of an expression vector driving Rev-erb{beta}{Delta}E expression into mouse tibialis muscle that resulted in increased Srebp-1c mRNA expression. Paradoxically, Rev-erb{beta} siRNA expression in skeletal muscle cells repressed Srebp-1c expression, and indicated that Rev-erb{beta} expression was necessary for Srebp-1c expression. ChIP analysis demonstrated that Rev-erb{beta} was recruited to the Srebp-1c promoter. Moreover, Rev-erb{beta} trans-activated the Srebp-1c promoter, in contrast, Rev-erb{beta} efficiently repressed the Rev-erb{alpha} promoter, amore » previously characterized target gene. Finally, treatment with the Rev-erb agonist (hemin) (i) increased the trans-activation of the Srebp-1c promoter by Rev-erb{beta}; and (ii) increased Rev-erb{beta} and Srebp-1c mRNA expression. These data suggest that Rev-erb{beta} has the potential to activate gene expression, and is a positive regulator of Srebp-1c, a regulator of lipogenesis.« less

Regulation of polyamine metabolism and biosynthetic gene expression during olive mature-fruit abscission.

PubMed

Gil-Amado, Jose A; Gomez-Jimenez, Maria C

2012-06-01

Exogenous ethylene and some inhibitors of polyamine biosynthesis can induce mature-fruit abscission in olive, which could be associated with decreased nitric oxide production as a signaling molecule. Whether H₂O₂ also plays a signaling role in mature-fruit abscission is unknown. The possible involvement of H₂O₂ and polyamine in ethylene-induced mature-fruit abscission was examined in the abscission zone and adjacent cells of two olive cultivars. Endogenous H₂O₂ showed an increase in the abscission zone during mature-fruit abscission, suggesting that accumulated H₂O₂ may participate in abscission signaling. On the other hand, we followed the expression of two genes involved in the polyamine biosynthesis pathway during mature-fruit abscission and in response to ethylene or inhibitors of ethylene and polyamine. OeSAMDC1 and OeSPDS1 were expressed differentially within and between the abscission zones of the two cultivars. OeSAMDC1 showed slightly lower expression in association with mature-fruit abscission. Furthermore, our data show that exogenous ethylene or inhibitors of polyamine encourage the free putrescine pool and decrease the soluble-conjugated spermidine, spermine, homospermidine, and cadaverine in the olive abscission zone, while ethylene inhibition by CoCl₂ increases these soluble conjugates, but does not affect free putrescine. Although the impact of these treatments on polyamine metabolism depends on the cultivar, the results confirm that the mature-fruit abscission may be accompanied by an inhibition of S-adenosyl methionine decarboxylase activity, and the promotion of putrescine synthesis in olive abscission zone, suggesting that endogenous putrescine may play a complementary role to ethylene in the normal course of mature-fruit abscission.

Beneficial role of spermidine in chlorophyll metabolism and D1 protein content in tomato seedlings under salinity-alkalinity stress.

PubMed

Hu, Lipan; Xiang, Lixia; Li, Shuting; Zou, Zhirong; Hu, Xiao-Hui

2016-04-01

Polyamines are important in protecting plants against various environmental stresses, including protection against photodamage to the photosynthetic apparatus. The molecular mechanism of this latter effect is not completely understood. Here, we have investigated the effects of salinity-alkalinity stress and spermidine (Spd) on tomato seedlings at both physiological and transcriptional levels. Salinity-alkalinity stress decreased leaf area, net photosynthetic rate, maximum net photosynthetic rate, light saturation point, apparent quantum efficiency, total chlorophyll, chlorophyll a and chlorophyll a:chlorophyll b relative to the control. The amount of D1 protein, an important component of photosystem II, was reduced compared with the control, as was the expression of psbA, which codes for D1. Expression of the chlorophyll biosynthesis gene porphobilinogen deaminase (PBGD) was reduced following salinity-alkalinity stress, whereas the expression of Chlase, which codes for chlorophyllase, was increased. These negative physiological effects of salinity-alkalinity stress were alleviated by exogenous Spd. Expression of PBGD and psbA were enhanced, whereas the expression of Chlase was reduced, when exogenous Spd was included in the stress treatment compared with when it was not. The protective effect of Spd on chlorophyll and D1 protein content during stress may maintain the photosynthetic apparatus, permitting continued photosynthesis and growth of tomato seedlings (Solanum lycopersicum cv. Jinpengchaoguan) under salinity-alkalinity stress. © 2015 Scandinavian Plant Physiology Society.

Plant insects and mites uptake double-stranded RNA upon its exogenous application on tomato leaves.

PubMed

Gogoi, Anupam; Sarmah, Nomi; Kaldis, Athanasios; Perdikis, Dionysios; Voloudakis, Andreas

2017-12-01

Exogenously applied double-stranded RNA (dsRNA) molecules onto tomato leaves, moved rapidly from local to systemic leaves and were uptaken by agricultural pests namely aphids, whiteflies and mites. Four small interfering RNAs, deriving from the applied dsRNA, were molecularly detected in plants, aphids and mites but not in whiteflies. Double-stranded RNA (dsRNA) acts as the elicitor molecule of the RNA silencing (RNA interference, RNAi), the endogenous and evolutionary conserved surveillance system present in all eukaryotes. DsRNAs and their subsequent degradation products, namely the small interfering RNAs (siRNAs), act in a sequence-specific manner to control gene expression. Exogenous application of dsRNAs onto plants elicits resistance against plant viruses. In the present work, exogenously applied dsRNA molecules, derived from Zucchini yellow mosaic virus (ZYMV) HC-Pro region, onto tomato plants were detected in aphids (Myzus persicae), whiteflies (Trialeurodes vaporariorum) and mites (Tetranychus urticae) that were fed on treated as well as systemic tomato leaves. Furthermore, four siRNAs, deriving from the dsRNA applied, were detected in tomato and the agricultural pests fed on treated tomato plants. More specifically, dsRNA was detected in agricultural pests at 3 and 10 dpt (days post treatment) in dsRNA-treated leaves and at 14 dpt in systemic leaves. In addition, using stem-loop RT-PCR, siRNAs were detected in agricultural pests at 3 and 10 dpt in aphids and mites. Surprisingly, in whiteflies carrying the applied dsRNA, siRNAs were not molecularly detected. Our results showed that, upon exogenous application of dsRNAs molecules, these moved rapidly within tomato and were uptaken by agricultural pests fed on treated tomato. As a result, this non-transgenic method has the potential to control important crop pests via RNA silencing of vital genes of the respective pests.

Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish.

PubMed

Kawahara, Atsuo; Hisano, Yu; Ota, Satoshi; Taimatsu, Kiyohito

2016-05-13

The zebrafish (Danio rerio) is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs) at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

Heterologous expression of the immunomodulatory protein gene from Ganoderma sinense in the basidiomycete Coprinopsis cinerea.

PubMed

Han, F; Liu, Y; Guo, L Q; Zeng, X L; Liu, Z M; Lin, J F

2010-11-01

FIP-gsi, a fungal immunomodulatory protein found in Ganoderma sinense, has antitumour, anti-allergy and immunomodulatory activities and is regulated by the fip-gsi gene. In this study, we aimed to express the fip-gsi gene from G. sinense in Coprinopsis cinerea to increase yield of FIPs-gsi. A fungal expression vector pBfip-gsi containing the gpd promoter from Agaricus bisporus and the fip-gsi gene from the G. sinense was constructed and transformed into C. cinerea. PCR and Southern blotting analysis verified the successful integration of the exogenous gene fip-gsi into the genome of C. cinerea. RT-PCR and Northern blotting analysis confirmed that the fip-gsi gene was transcribed in C. cinerea. The yield of the FIP-gsi protein reached 314mg kg(-1) fresh mycelia. The molecular weight of the FIP-gsi was 13kDa, and the FIP-gsi was capable of hemagglutinating mouse red blood cells, but no such activity was observed towards human red blood cells in vitro. The fip-gsi from G. sinense has been successfully translated in C. cinerea, and the yield of bioactive FIP-gsi protein was high. This is the first report using the C. cinerea for the heterologous expression of FIP-gsi protein and it might supply a basis for large-scale production of the protein. © 2010 The Authors. Journal of Applied Microbiology © 2010 The Society for Applied Microbiology.

Double agents and secret agents: the emerging fields of exogenous chemical exchange saturation transfer and T2-exchange magnetic resonance imaging contrast agents for molecular imaging.

PubMed

Daryaei, Iman; Pagel, Mark D

2015-01-01

Two relatively new types of exogenous magnetic resonance imaging contrast agents may provide greater impact for molecular imaging by providing greater specificity for detecting molecular imaging biomarkers. Exogenous chemical exchange saturation transfer (CEST) agents rely on the selective saturation of the magnetization of a proton on an agent, followed by chemical exchange of a proton from the agent to water. The selective detection of a biomarker-responsive CEST signal and an unresponsive CEST signal, followed by the ratiometric comparison of these signals, can improve biomarker specificity. We refer to this improvement as a "double-agent" approach to molecular imaging. Exogenous T 2 -exchange agents also rely on chemical exchange of protons between the agent and water, especially with an intermediate rate that lies between the slow exchange rates of CEST agents and the fast exchange rates of traditional T 1 and T 2 agents. Because of this intermediate exchange rate, these agents have been relatively unknown and have acted as "secret agents" in the contrast agent research field. This review exposes these secret agents and describes the merits of double agents through examples of exogenous agents that detect enzyme activity, nucleic acids and gene expression, metabolites, ions, redox state, temperature, and pH. Future directions are also provided for improving both types of contrast agents for improved molecular imaging and clinical translation. Therefore, this review provides an overview of two new types of exogenous contrast agents that are becoming useful tools within the armamentarium of molecular imaging.

Double agents and secret agents: the emerging fields of exogenous chemical exchange saturation transfer and T2-exchange magnetic resonance imaging contrast agents for molecular imaging

PubMed Central

Daryaei, Iman; Pagel, Mark D

2016-01-01

Two relatively new types of exogenous magnetic resonance imaging contrast agents may provide greater impact for molecular imaging by providing greater specificity for detecting molecular imaging biomarkers. Exogenous chemical exchange saturation transfer (CEST) agents rely on the selective saturation of the magnetization of a proton on an agent, followed by chemical exchange of a proton from the agent to water. The selective detection of a biomarker-responsive CEST signal and an unresponsive CEST signal, followed by the ratiometric comparison of these signals, can improve biomarker specificity. We refer to this improvement as a “double-agent” approach to molecular imaging. Exogenous T2-exchange agents also rely on chemical exchange of protons between the agent and water, especially with an intermediate rate that lies between the slow exchange rates of CEST agents and the fast exchange rates of traditional T1 and T2 agents. Because of this intermediate exchange rate, these agents have been relatively unknown and have acted as “secret agents” in the contrast agent research field. This review exposes these secret agents and describes the merits of double agents through examples of exogenous agents that detect enzyme activity, nucleic acids and gene expression, metabolites, ions, redox state, temperature, and pH. Future directions are also provided for improving both types of contrast agents for improved molecular imaging and clinical translation. Therefore, this review provides an overview of two new types of exogenous contrast agents that are becoming useful tools within the armamentarium of molecular imaging. PMID:27747191

Antimicrobial Peptides from Fish

PubMed Central

Masso-Silva, Jorge A.; Diamond, Gill

2014-01-01

Antimicrobial peptides (AMPs) are found widely distributed through Nature, and participate in the innate host defense of each species. Fish are a great source of these peptides, as they express all of the major classes of AMPs, including defensins, cathelicidins, hepcidins, histone-derived peptides, and a fish-specific class of the cecropin family, called piscidins. As with other species, the fish peptides exhibit broad-spectrum antimicrobial activity, killing both fish and human pathogens. They are also immunomodulatory, and their genes are highly responsive to microbes and innate immuno-stimulatory molecules. Recent research has demonstrated that some of the unique properties of fish peptides, including their ability to act even in very high salt concentrations, make them good potential targets for development as therapeutic antimicrobials. Further, the stimulation of their gene expression by exogenous factors could be useful in preventing pathogenic microbes in aquaculture. PMID:24594555

The murine homeobox gene Msx-3 shows highly restricted expression in the developing neural tube.

PubMed

Shimeld, S M; McKay, I J; Sharpe, P T

1996-04-01

The mouse homeobox-genes Msx-1 and Msx-2 are expressed in several areas of the developing embryo, including the neural tube, neural crest, facial processes and limb buds. Here we report the characterisation of a third mouse Msx gene, which we designate Msx-3. The embryonic expression of Msx-3 was found to differ from that of Msx-1 and -2 in that it was confined to the dorsal neural tube. In embryos with 5-8 somites a segmental pattern of expression was observed in the hindbrain, with rhombomeres 3 and 5 lacking Msx-3 while other rhombomeres expressed Msx-3. This pattern was transient, however, such that in embryos with 18 or more somites expression was continuous throughout the dorsal hindbrain and anterior dorsal spinal cord. Differentiation of dorsal cell types in the neural tube can be induced by addition of members of the Tgf-beta family. Additionally, Msx-1 and -2 have been shown to be activated by addition of the Tgf-beta family member Bmp-4. To determine if Bmp-4 could activate Msx-3, we incubated embryonic hindbrain explants with exogenous Bmp-4. The dorsal expression of Msx-3 was seen to expand into more ventral regions of the neurectoderm in Bmp-4-treated cultures, implying that Bmp-4 may be able to mimic an in vivo signal that induces Msx-3.

Identification of endogenous inducers of the mal regulon in Escherichia coli.

PubMed Central

Ehrmann, M; Boos, W

1987-01-01

The expression of the maltose regulon in Escherichia coli is induced when maltose or maltodextrins are present in the growth medium. Mutations in malK, which codes for a component of the transport system, result in the elevated expression of the remaining mal genes. Uninduced expression in the wild type, as well as elevated expression in malK mutants, is strongly repressed at high osmolarity. In the absence of malQ-encoded amylomaltase, expression remains high at high osmolarity. We found that uninduced expression in the wild type and elevated expression in malK mutants were paralleled by the appearance of two types of endogenous carbohydrates. One, produced primarily at high osmolarity, was identified as comprising maltodextrins that are derived from glycogen or glycogen-synthesizing enzymes. The other, produced primarily at low osmolarity, consisted of an oligosaccharide that was not derived from glycogen. We isolated a mutant that no longer synthesized this oligosaccharide. The gene carrying this mutation, termed malI, was mapped at min 36 on the E. coli linkage map. A Tn10 insertion in malI also resulted in the loss of constitutivity at low osmolarity and delayed the induction of the maltose regulon by exogenous inducers. Images PMID:3038842

Establishment of a genetic transformation system for the marine pennate diatom Fistulifera sp. strain JPCC DA0580--a high triglyceride producer.

PubMed

Muto, Masaki; Fukuda, Yorikane; Nemoto, Michiko; Yoshino, Tomoko; Matsunaga, Tadashi; Tanaka, Tsuyoshi

2013-02-01

A genetic transformation system for the marine pennate diatom, Fistulifera sp. JPCC DA0580, was established using microparticle bombardment methods. Strain JPCC DA0580 has been recently identified as the highest triglyceride (60 % w/w) producer from a culture collection of 1,393 strains of marine microalgae, and it is expected to be a feasible source of biodiesel fuel. The transformation conditions for strain JPCC DA0580 were optimised using the green fluorescent protein gene (gfp) and the gene encoding neomycin phosphotransferase II (nptII). The most efficient rate of transformation was attained when tungsten particles (0.6 μm in diameter) were used for microparticle bombardment. The effect of endogenous and exogenous promoters on the expression of nptII was examined. Endogenous promoters were more efficient for obtaining transformants compared with exogenous promoters. Southern hybridisation analysis suggested that nptII integrated into the nuclear genome. This genetic manipulation technique should allow us to understand the mechanisms of high triglyceride accumulation in this strain, thereby contributing to improving BDF production.

AfAP2-1, An Age-Dependent Gene of Aechmea fasciata, Responds to Exogenous Ethylene Treatment

PubMed Central

Lei, Ming; Li, Zhi-Ying; Wang, Jia-Bin; Fu, Yun-Liu; Ao, Meng-Fei; Xu, Li

2016-01-01

The Bromeliaceae family is one of the most morphologically diverse families with a pantropical distribution. To schedule an appropriate flowering time for bromeliads, ethylene is commonly used to initiate flower development in adult plants. However, the mechanism by which ethylene induces flowering in adult bromeliads remains unknown. Here, we identified an APETALA2 (AP2)-like gene, AfAP2-1, in Aechmea fasciata. AfAP2-1 contains two AP2 domains and is a nuclear-localized protein. It functions as a transcriptional activator, and the activation domain is located in the C-terminal region. The expression level of AfAP2-1 is higher in juvenile plants than in adult plants, and the AfAP2-1 transcript level was rapidly and transiently reduced in plants treated with exogenous ethylene. Overexpression of AfAP2-1 in Arabidopsis thaliana results in an extremely delayed flowering phenotype. These results suggested that AfAP2-1 responds to ethylene and is a putative age-dependent flowering regulator in A. fasciata. PMID:26927090

Abscisic acid alleviates iron deficiency by promoting root iron reutilization and transport from root to shoot in Arabidopsis.

PubMed

Lei, Gui Jie; Zhu, Xiao Fang; Wang, Zhi Wei; Dong, Fang; Dong, Ning Yu; Zheng, Shao Jian

2014-04-01

Abscisic acid (ABA) has been demonstrated to be involved in iron (Fe) homeostasis, but the underlying mechanism is largely unknown. Here, we found that Fe deficiency induced ABA accumulation rapidly (within 6 h) in the roots of Arabidopsis. Exogenous ABA at 0.5 μM decreased the amount of root apoplastic Fe bound to pectin and hemicellulose, and increased the shoot Fe content significantly, thus alleviating Fe deficiency-induced chlorosis. Exogenous ABA promoted the secretion of phenolics to release apoplastic Fe and up-regulated the expression of AtNRAMP3 to enhance reutilization of Fe stored in the vacuoles, leading to a higher level of soluble Fe and lower ferric-chelate reductase (FCR) activity in roots. Treatment with ABA also led to increased Fe concentrations in the xylem sap, partially because of the up-regulation of AtFRD3, AtYSL2 and AtNAS1, genes related to long-distance transport of Fe. Exogenous ABA could not alleviate the chlorosis of abi5 mutant resulting from the significantly low expression of AtYSL2 and low transport of Fe from root to shoot. Taken together, our data support the conclusion that ABA is involved in the reutilization and transport of Fe from root to shoot under Fe deficiency conditions in Arabidopsis. © 2013 John Wiley & Sons Ltd.

Ganglioside GM2 mediates migration of tumor cells by interacting with integrin and modulating the downstream signaling pathway.

PubMed

Kundu, Manjari; Mahata, Barun; Banerjee, Avisek; Chakraborty, Sohini; Debnath, Shibjyoti; Ray, Sougata Sinha; Ghosh, Zhumur; Biswas, Kaushik

2016-07-01

The definitive role of ganglioside GM2 in mediating tumor-induced growth and progression is still unknown. Here we report a novel role of ganglioside GM2 in mediating tumor cell migration and uncovered its mechanism. Data shows differential expression levels of GM2-synthase as well as GM2 in different human cancer cells. siRNA mediated knockdown of GM2-synthase in CCF52, A549 and SK-RC-26B cells resulted in significant inhibition of tumor cell migration as well as invasion in vitro without affecting cellular proliferation. Over-expression of GM2-synthase in low-GM2 expressing SK-RC-45 cells resulted in a consequent increase in migration thus confirming the potential role GM2 and its downstream partners play in tumor cell migration and motility. Further, treatment of SK-RC-45 cells with exogenous GM2 resulted in a dramatic increase in migratory and invasive capacity with no change in proliferative capacity, thereby confirming the role of GM2 in tumorigenesis specifically by mediating tumor migration and invasion. Gene expression profiling of GM2-synthase silenced cells revealed altered expression of several genes involved in cell migration primarily those controlling the integrin mediated signaling. GM2-synthase knockdown resulted in decreased phosphorylation of FAK, Src as well as Erk, while over-expression and/or exogenous GM2 treatment caused increased FAK and Erk phosphorylation respectively. Again, GM2 mediated invasion and Erk phosphorylation is blocked in integrin knockdown SK-RC-45 cells, thus confirming that GM2 mediated migration and phosphorylation of Erk is integrin dependent. Finally, confocal microscopy suggested co-localization while co-immunoprecipitation and surface plasmon resonance (SPR) confirmed direct interaction of membrane bound ganglioside, GM2 with the integrin receptor. Copyright © 2016 Elsevier B.V. All rights reserved.

JPRS Report, Science & Technology, Japan, Government and Private Sector Joint R&D Projects

DTIC Science & Technology

1988-08-16

is that if this system uses exogenous genes represented by the DNA that codes for hepatitis B surface antigen, polyvaccines can be produced easily...that can express in large quantities molecular clones of genetic products is awaited. Vectors using cells of higher mammals including man have been...functions of IVM and MMD using cultured spinal nerve cells with a great advantage that the same sample can be used for both electrophysiological and

Exogenous Melatonin Improves Plant Iron Deficiency Tolerance via Increased Accumulation of Polyamine-Mediated Nitric Oxide.

PubMed

Zhou, Cheng; Liu, Zhi; Zhu, Lin; Ma, Zhongyou; Wang, Jianfei; Zhu, Jian

2016-10-25

Melatonin has recently been demonstrated to play important roles in the regulation of plant growth, development, and abiotic and biotic stress responses. However, the possible involvement of melatonin in Fe deficiency responses and the underlying mechanisms remained elusive in Arabidopsis thaliana . In this study, Fe deficiency quickly induced melatonin synthesis in Arabidopsis plants. Exogenous melatonin significantly increased the soluble Fe content of shoots and roots, and decreased the levels of root cell wall Fe bound to pectin and hemicellulose, thus alleviating Fe deficiency-induced chlorosis. Intriguingly, melatonin treatments induced a significant increase of nitric oxide (NO) accumulation in roots of Fe-deficient plants, but not in those of polyamine-deficient ( adc2-1 and d-arginine-treated) plants. Moreover, the melatonin-alleviated leaf chlorosis was blocked in the polyamine- and NO-deficient ( nia1nia2noa1 and c-PTIO-treated) plants, and the melatonin-induced Fe remobilization was largely inhibited. In addition, the expression of some Fe acquisition-related genes, including FIT1 , FRO2 , and IRT1 were significantly up-regulated by melatonin treatments, whereas the enhanced expression of these genes was obviously suppressed in the polyamine- and NO-deficient plants. Collectively, our results provide evidence to support the view that melatonin can increase the tolerance of plants to Fe deficiency in a process dependent on the polyamine-induced NO production under Fe-deficient conditions.

Acyl-homoserine lactone-based quorum sensing and quorum quenching hold promise to determine the performance of biological wastewater treatments: An overview.

PubMed

Huang, Jinhui; Shi, Yahui; Zeng, Guangming; Gu, Yanling; Chen, Guiqiu; Shi, Lixiu; Hu, Yi; Tang, Bi; Zhou, Jianxin

2016-08-01

Quorum sensing (QS) is a communication process between cells, in which bacteria secrete and sense the specific chemicals, and regulate gene expression in response to population density. Quorum quenching (QQ) blocks QS system, and inhibits gene expression mediating bacterial behaviors. Given the extensive research of acyl-homoserine lactone (AHL) signals, existences and effects of AHL-based QS and QQ in biological wastewater treatments are being subject to high concern. This review summarizes AHL structure, synthesis mode, degradation mechanisms, analytical methods, environmental factors, AHL-based QS and QQ mechanisms. The existences and roles of AHL-based QS and QQ in biomembrane processes, activated sludge processes and membrane bioreactors are summarized and discussed, and corresponding exogenous regulation strategy by selective enhancement of AHL-based QS or QQ coexisting in biological wastewater treatments is suggested. Such strategies including the addition of AHL signals, AHL-producing bacteria as well as quorum quenching enzyme or bacteria can effectively improve wastewater treatment performance without killing or limiting bacterial survival and growth. This review will present the theoretical and practical cognition for bacterial AHL-based QS and QQ, suggest the feasibility of exogenous regulation strategies in biological wastewater treatments, and provide useful information to scientists and engineers who work in this field. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genome-wide identification and analysis of the aldehyde dehydrogenase (ALDH) gene superfamily in apple (Malus × domestica Borkh.).

PubMed

Li, Xiaoqin; Guo, Rongrong; Li, Jun; Singer, Stacy D; Zhang, Yucheng; Yin, Xiangjing; Zheng, Yi; Fan, Chonghui; Wang, Xiping

2013-10-01

Aldehyde dehydrogenases (ALDHs) represent a protein superfamily encoding NAD(P)(+)-dependent enzymes that oxidize a wide range of endogenous and exogenous aliphatic and aromatic aldehydes. In plants, they are involved in many biological processes and play a role in the response to environmental stress. In this study, a total of 39 ALDH genes from ten families were identified in the apple (Malus × domestica Borkh.) genome. Synteny analysis of the apple ALDH (MdALDH) genes indicated that segmental and tandem duplications, as well as whole genome duplications, have likely contributed to the expansion and evolution of these gene families in apple. Moreover, synteny analysis between apple and Arabidopsis demonstrated that several MdALDH genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes appeared before the divergence of lineages that led to apple and Arabidopsis. In addition, phylogenetic analysis, as well as comparisons of exon-intron and protein structures, provided further insight into both their evolutionary relationships and their putative functions. Tissue-specific expression analysis of the MdALDH genes demonstrated diverse spatiotemporal expression patterns, while their expression profiles under abiotic stress and various hormone treatments indicated that many MdALDH genes were responsive to high salinity and drought, as well as different plant hormones. This genome-wide identification, as well as characterization of evolutionary relationships and expression profiles, of the apple MdALDH genes will not only be useful for the further analysis of ALDH genes and their roles in stress response, but may also aid in the future improvement of apple stress tolerance. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Increased Interleukin-32 Levels in Obesity Promote Adipose Tissue Inflammation and Extracellular Matrix Remodeling: Effect of Weight Loss.

PubMed

Catalán, Victoria; Gómez-Ambrosi, Javier; Rodríguez, Amaia; Ramírez, Beatriz; Valentí, Víctor; Moncada, Rafael; Landecho, Manuel F; Silva, Camilo; Salvador, Javier; Frühbeck, Gema

2016-12-01

Interleukin (IL)-32 is a recently described cytokine involved in the regulation of inflammation. We aimed to explore whether IL-32 could function as an inflammatory and angiogenic factor in human obesity and obesity-associated type 2 diabetes. Samples obtained from 90 subjects were used in the study. Obese patients exhibited higher expression levels of IL-32 in visceral adipose tissue (AT) as well as in subcutaneous AT and peripheral blood mononuclear cells. IL32 was mainly expressed by stromovascular fraction cells, and its expression was significantly enhanced by inflammatory stimuli and hypoxia, whereas no changes were found after the incubation with anti-inflammatory cytokines. The addition of exogenous IL-32 induced the expression of inflammation and extracellular matrix-related genes in human adipocyte cultures, and IL32-silenced adipocytes showed a downregulation of inflammatory genes. Furthermore, adipocyte-conditioned media obtained from obese patients increased IL32 gene expression in human monocyte cultures, whereas the adipocyte-conditioned media from lean volunteers had no effect on IL32 mRNA levels. These findings provide evidence, for the first time, about the inflammatory and remodeling properties of IL-32 in AT, implicating this cytokine in obesity-associated comorbidities. © 2016 by the American Diabetes Association.

Morphine and galectin-1 modulate HIV-1 infection of human monocytes-derived macrophages

PubMed Central

Reynolds, Jessica L.; Law, Wing Cheung; Mahajan, Supriya D.; Aalinkeel, Ravikumar; Nair, Bindukumar; Sykes, Donald E.; Mammen, Manoj J.; Yong, Ken-Tye; Hui, Rui; Prasad, Paras N.; Schwartz, Stanley A.

2012-01-01

Morphine is a widely abused, addictive drug that modulates immune function. Macrophages are a primary reservoir of HIV-1; therefore, they not only play a role in the development of this disease but also impact the overall course of disease progression. Galectin-1 is a member of a family of β-galactoside-binding lectins that are soluble adhesion molecules and that mediate direct cell-pathogen interactions during HIV-1 viral adhesion. Since the drug abuse epidemic and the HIV-1 epidemic are closely interrelated we propose that increased expression of galectin-1 induced by morphine may modulate HIV-1 infection of human monocytes-derived macrophages (MDM). Here, we show that galectin-1 gene and protein expression are potentiated by incubation with morphine. Confirming previous studies, morphine alone or galectin-1 alone enhance HIV-1 infection of MDM. Concomitant incubation with exogenous galectin-1 and morphine potentiated HIV-1 infection of MDM. We utilized a nanotechnology approach that uses gold nanorod-galectin-1 siRNA complexes (nanoplexes) to inhibit gene expression for galectin-1. We found that nanoplexes silenced gene expression for galectin-1 and the nanoplexes reversed the effects of morphine on galectin-1 expression. Furthermore, the effects of morphine on HIV-1 infection were reduced in the presence of the nanoplex. PMID:22430735

Single administration of recombinant IL‐6 restores the gene expression of lipogenic enzymes in liver of fasting IL‐6‐deficient mice

PubMed Central

Gavito, AL; Cabello, R; Suarez, J; Serrano, A; Pavón, F J; Vida, M; Romero, M; Pardo, V; Bautista, D; Arrabal, S; Decara, J; Cuesta, AL; Valverde, A M; Rodríguez de Fonseca, F

2016-01-01

Background and Purpose Lipogenesis is intimately controlled by hormones and cytokines as well as nutritional conditions. IL‐6 participates in the regulation of fatty acid metabolism in the liver. We investigated the role of IL‐6 in mediating fasting/re‐feeding changes in the expression of hepatic lipogenic enzymes. Experimental Approach Gene and protein expression of lipogenic enzymes were examined in livers of wild‐type (WT) and IL‐6‐deficient (IL‐6−/−) mice during fasting and re‐feeding conditions. Effects of exogenous IL‐6 administration on gene expression of these enzymes were evaluated in vivo. The involvement of STAT3 in mediating these IL‐6 responses was investigated by using siRNA in human HepG2 cells. Key Results During feeding, the up‐regulation in the hepatic expression of lipogenic genes presented similar time kinetics in WT and IL‐6−/− mice. During fasting, expression of lipogenic genes decreased gradually over time in both strains, although the initial drop was more marked in IL‐6−/− mice. Protein levels of hepatic lipogenic enzymes were lower in IL‐6−/− than in WT mice at the end of the fasting period. In WT, circulating IL‐6 levels paralleled gene expression of hepatic lipogenic enzymes. IL‐6 administration in vivo and in vitro showed that IL‐6‐mediated signalling was associated with the up‐regulation of hepatic lipogenic enzyme genes. Moreover, silencing STAT3 in HepG2 cells attenuated IL‐6 mediated up‐regulation of lipogenic gene transcription levels. Conclusions and Implications IL‐6 sustains levels of hepatic lipogenic enzymes during fasting through activation of STAT3. Our findings indicate that clinical use of STAT3‐associated signalling cytokines, particularly against steatosis, should be undertaken with caution. PMID:26750868

MiR-210 disturbs mitotic progression through regulating a group of mitosis-related genes

PubMed Central

He, Jie; Wu, Jiangbin; Xu, Naihan; Xie, Weidong; Li, Mengnan; Li, Jianna; Jiang, Yuyang; Yang, Burton B.; Zhang, Yaou

2013-01-01

MiR-210 is up-regulated in multiple cancer types but its function is disputable and further investigation is necessary. Using a bioinformatics approach, we identified the putative target genes of miR-210 in hypoxia-induced CNE cells from genome-wide scale. Two functional gene groups related to cell cycle and RNA processing were recognized as the major targets of miR-210. Here, we investigated the molecular mechanism and biological consequence of miR-210 in cell cycle regulation, particularly mitosis. Hypoxia-induced up-regulation of miR-210 was highly correlated with the down-regulation of a group of mitosis-related genes, including Plk1, Cdc25B, Cyclin F, Bub1B and Fam83D. MiR-210 suppressed the expression of these genes by directly targeting their 3′-UTRs. Over-expression of exogenous miR-210 disturbed mitotic progression and caused aberrant mitosis. Furthermore, miR-210 mimic with pharmacological doses reduced tumor formation in a mouse metastatic tumor model. Taken together, these results implicate that miR-210 disturbs mitosis through targeting multi-genes involved in mitotic progression, which may contribute to its inhibitory role on tumor formation. PMID:23125370

MiR-210 disturbs mitotic progression through regulating a group of mitosis-related genes.

PubMed

He, Jie; Wu, Jiangbin; Xu, Naihan; Xie, Weidong; Li, Mengnan; Li, Jianna; Jiang, Yuyang; Yang, Burton B; Zhang, Yaou

2013-01-07

MiR-210 is up-regulated in multiple cancer types but its function is disputable and further investigation is necessary. Using a bioinformatics approach, we identified the putative target genes of miR-210 in hypoxia-induced CNE cells from genome-wide scale. Two functional gene groups related to cell cycle and RNA processing were recognized as the major targets of miR-210. Here, we investigated the molecular mechanism and biological consequence of miR-210 in cell cycle regulation, particularly mitosis. Hypoxia-induced up-regulation of miR-210 was highly correlated with the down-regulation of a group of mitosis-related genes, including Plk1, Cdc25B, Cyclin F, Bub1B and Fam83D. MiR-210 suppressed the expression of these genes by directly targeting their 3'-UTRs. Over-expression of exogenous miR-210 disturbed mitotic progression and caused aberrant mitosis. Furthermore, miR-210 mimic with pharmacological doses reduced tumor formation in a mouse metastatic tumor model. Taken together, these results implicate that miR-210 disturbs mitosis through targeting multi-genes involved in mitotic progression, which may contribute to its inhibitory role on tumor formation.

MADS-Box Genes and Gibberellins Regulate Bolting in Lettuce (Lactuca sativa L.)

PubMed Central

Han, Yingyan; Chen, Zijing; Lv, Shanshan; Ning, Kang; Ji, Xueliang; Liu, Xueying; Wang, Qian; Liu, Renyi; Fan, Shuangxi; Zhang, Xiaolan

2016-01-01

Bolting in lettuce is promoted by high temperature and bolting resistance is of great economic importance for lettuce production. But how bolting is regulated at the molecular level remains elusive. Here, a bolting resistant line S24 and a bolting sensitive line S39 were selected for morphological, physiological, transcriptomic and proteomic comparisons. A total of 12204 genes were differentially expressed in S39 vs. S24. Line S39 was featured with larger leaves, higher levels of chlorophyll, soluble sugar, anthocyanin and auxin, consistent with its up-regulation of genes implicated in photosynthesis, oxidation-reduction and auxin actions. Proteomic analysis identified 30 differentially accumulated proteins in lines S39 and S24 upon heat treatment, and 19 out of the 30 genes showed differential expression in the RNA-Seq data. Exogenous gibberellins (GA) treatment promoted bolting in both S39 and S24, while 12 flowering promoting MADS-box genes were specifically induced in line S39, suggesting that although GA regulates bolting in lettuce, it may be the MADS-box genes, not GA, that plays a major role in differing the bolting resistance between these two lettuce lines. PMID:28018414

Hox cluster polarity in early transcriptional availability: a high order regulatory level of clustered Hox genes in the mouse.

PubMed

Roelen, Bernard A J; de Graaff, Wim; Forlani, Sylvie; Deschamps, Jacqueline

2002-11-01

The molecular mechanism underlying the 3' to 5' polarity of induction of mouse Hox genes is still elusive. While relief from a cluster-encompassing repression was shown to lead to all Hoxd genes being expressed like the 3'most of them, Hoxd1 (Kondo and Duboule, 1999), the molecular basis of initial activation of this 3'most gene, is not understood yet. We show that, already before primitive streak formation, prior to initial expression of the first Hox gene, a dramatic transcriptional stimulation of the 3'most genes, Hoxb1 and Hoxb2, is observed upon a short pulse of exogenous retinoic acid (RA), whereas it is not in the case for more 5', cluster-internal, RA-responsive Hoxb genes. In contrast, the RA-responding Hoxb1lacZ transgene that faithfully mimics the endogenous gene (Marshall et al., 1994) did not exhibit the sensitivity of Hoxb1 to precocious activation. We conclude that polarity in initial activation of Hoxb genes reflects a greater availability of 3'Hox genes for transcription, suggesting a pre-existing (susceptibility to) opening of the chromatin structure at the 3' extremity of the cluster. We discuss the data in the context of prevailing models involving differential chromatin opening in the directionality of clustered Hox gene transcription, and regarding the importance of the cluster context for correct timing of initial Hox gene expression.Interestingly, Cdx1 manifested the same early transcriptional availability as Hoxb1. Copyright 2002 Elsevier Science Ireland Ltd.

Fasting-induced G0/G1 switch gene 2 and FGF21 expression in the liver are under regulation of adipose tissue derived fatty acids

PubMed Central

Jaeger, Doris; Schoiswohl, Gabriele; Hofer, Peter; Schreiber, Renate; Schweiger, Martina; Eichmann, Thomas O.; Pollak, Nina M.; Poecher, Nadja; Grabner, Gernot F.; Zierler, Kathrin A.; Eder, Sandra; Kolb, Dagmar; Radner, Franz P.W.; Preiss-Landl, Karina; Lass, Achim; Zechner, Rudolf; Kershaw, Erin E.; Haemmerle, Guenter

2015-01-01

Background & Aims Adipose tissue (AT)-derived fatty acids (FAs) are utilized for hepatic triacylglycerol (TG) generation upon fasting. However, their potential impact as signaling molecules is not established. Herein we examined the role of exogenous AT-derived FAs in the regulation of hepatic gene expression by investigating mice with a defect in AT-derived FA supply to the liver. Methods Plasma FA levels, tissue TG hydrolytic activities and lipid content were determined in mice lacking the lipase co-activator comparative gene identification-58 (CGI-58) selectively in AT (CGI-58-ATko) applying standard protocols. Hepatic expression of lipases, FA oxidative genes, transcription factors, ER stress markers, hormones and cytokines were determined by qRT-PCR, Western blotting and ELISA. Results Impaired AT-derived FA supply upon fasting of CGI-58-ATko mice causes a marked defect in liver PPARα-signaling and nuclear CREBH translocation. This severely reduced the expression of respective target genes such as the ATGL inhibitor G0/G1 switch gene-2 (G0S2) and the endocrine metabolic regulator FGF21. These changes could be reversed by lipid administration and raising plasma FA levels. Impaired AT-lipolysis failed to induce hepatic G0S2 expression in fasted CGI-58-ATko mice leading to enhanced ATGL-mediated TG-breakdown strongly reducing hepatic TG deposition. On high fat diet, impaired AT-lipolysis counteracts hepatic TG accumulation and liver stress linked to improved systemic insulin sensitivity. Conclusions AT-derived FAs are a critical regulator of hepatic fasting gene expression required for the induction of G0S2-expression in the liver to control hepatic TG-breakdown. Interfering with AT-lipolysis or hepatic G0S2 expression represents an effective strategy for the treatment of hepatic steatosis. PMID:25733154

Building a Genetic Manipulation Tool Box for Orchid Biology: Identification of Constitutive Promoters and Application of CRISPR/Cas9 in the Orchid, Dendrobium officinale

PubMed Central

Kui, Ling; Chen, Haitao; Zhang, Weixiong; He, Simei; Xiong, Zijun; Zhang, Yesheng; Yan, Liang; Zhong, Chaofang; He, Fengmei; Chen, Junwen; Zeng, Peng; Zhang, Guanghui; Yang, Shengchao; Dong, Yang; Wang, Wen; Cai, Jing

2017-01-01

Orchidaceae is the second largest family of flowering plants, which is highly valued for its ornamental purposes and medicinal uses. Dendrobium officinale is a special orchid species that can grow without seed vernalization. Because the whole-genome sequence of D. officinale is publicly available, this species is poised to become a convenient research model for the evolutionary, developmental, and genetic studies of Orchidaceae. Despite these advantages, the methods of genetic manipulation are poorly developed in D. officinale. In this study, based on the previously developed Agrobacterium-mediated gene transformation system, we identified several highly efficient promoters for exogenous gene expression and successfully applied the CRISPR/Cas9 system for editing endogenous genes in the genome of D. officinale. These two basic techniques contribute to the genetic manipulation toolbox of Orchidaceae. The pCambia-1301-35SN vector containing the CaMV 35S promoter and the β-glucuronidase (GUS) and Superfolder green fluorescence protein (SG) as reporter genes were introduced into the plant tissues by the Agrobacterium-mediated transformation system. Fluorescence emission from the transformed plants confirmed the successful transcription and translation of SG genes into functional proteins. We compared the GUS activity under different promoters including four commonly used promoters (MtHP, CVMV, MMV and PCISV) with CaMV 35S promoter and found that MMV, CVMV, and PCISV were as effective as the 35S promoter. Furthermore, we applied the CRISPR/Cas9-mediated genome editing system successfully in D. officinale. By selecting five target genes (C3H, C4H, 4CL, CCR, and IRX) in the lignocellulose biosynthesis pathway, we showed that, for a given target, this system can generate edits (insertions, deletions, or substitutions) at a rate of 10 to 100%. These results showed that our two genetic manipulation tools can efficiently express exogenous genes and edit endogenous genes in D. officinale. These efficient research tools will not only help create novel D. officinale varieties, but will also facilitate the molecular genetic investigation of orchid biology. PMID:28127299

Building a Genetic Manipulation Tool Box for Orchid Biology: Identification of Constitutive Promoters and Application of CRISPR/Cas9 in the Orchid, Dendrobium officinale.

PubMed

Kui, Ling; Chen, Haitao; Zhang, Weixiong; He, Simei; Xiong, Zijun; Zhang, Yesheng; Yan, Liang; Zhong, Chaofang; He, Fengmei; Chen, Junwen; Zeng, Peng; Zhang, Guanghui; Yang, Shengchao; Dong, Yang; Wang, Wen; Cai, Jing

2016-01-01

Orchidaceae is the second largest family of flowering plants, which is highly valued for its ornamental purposes and medicinal uses. Dendrobium officinale is a special orchid species that can grow without seed vernalization. Because the whole-genome sequence of D. officinale is publicly available, this species is poised to become a convenient research model for the evolutionary, developmental, and genetic studies of Orchidaceae. Despite these advantages, the methods of genetic manipulation are poorly developed in D. officinale . In this study, based on the previously developed Agrobacterium -mediated gene transformation system, we identified several highly efficient promoters for exogenous gene expression and successfully applied the CRISPR/Cas9 system for editing endogenous genes in the genome of D. officinale . These two basic techniques contribute to the genetic manipulation toolbox of Orchidaceae. The pCambia-1301-35SN vector containing the CaMV 35S promoter and the β-glucuronidase ( GUS ) and Superfolder green fluorescence protein (SG) as reporter genes were introduced into the plant tissues by the Agrobacterium -mediated transformation system. Fluorescence emission from the transformed plants confirmed the successful transcription and translation of SG genes into functional proteins. We compared the GUS activity under different promoters including four commonly used promoters (MtHP, CVMV, MMV and PCISV) with CaMV 35S promoter and found that MMV, CVMV, and PCISV were as effective as the 35S promoter. Furthermore, we applied the CRISPR/Cas9-mediated genome editing system successfully in D. officinale . By selecting five target genes ( C3H, C4H, 4CL, CCR, and IRX ) in the lignocellulose biosynthesis pathway, we showed that, for a given target, this system can generate edits (insertions, deletions, or substitutions) at a rate of 10 to 100%. These results showed that our two genetic manipulation tools can efficiently express exogenous genes and edit endogenous genes in D. officinale . These efficient research tools will not only help create novel D. officinale varieties, but will also facilitate the molecular genetic investigation of orchid biology.

Genome-wide analysis, expression profile of heat shock factor gene family (CaHsfs) and characterisation of CaHsfA2 in pepper (Capsicum annuum L.).

PubMed

Guo, Meng; Lu, Jin-Ping; Zhai, Yu-Fei; Chai, Wei-Guo; Gong, Zhen-Hui; Lu, Ming-Hui

2015-06-19

Heat shock factors (Hsfs) play crucial roles in plant developmental and defence processes. The production and quality of pepper (Capsicum annuum L.), an economically important vegetable crop, are severely reduced by adverse environmental stress conditions, such as heat, salt and osmotic stress. Although the pepper genome has been fully sequenced, the characterization of the Hsf gene family under abiotic stress conditions remains incomplete. A total of 25 CaHsf members were identified in the pepper genome by bioinformatics analysis and PCR assays. They were grouped into three classes, CaHsfA, B and C, based on highly conserved Hsf domains, were distributed over 11 of 12 chromosomes, with none found on chromosome 11, and all of them, except CaHsfA5, formed a protein-protein interaction network. According to the RNA-seq data of pepper cultivar CM334, most CaHsf members were expressed in at least one tissue among root, stem, leaf, pericarp and placenta. Quantitative real-time PCR assays showed that all of the CaHsfs responded to heat stress (40 °C for 2 h), except CaHsfC1 in thermotolerant line R9 leaves, and that the expression patterns were different from those in thermosensitive line B6. Many CaHsfs were also regulated by salt and osmotic stresses, as well as exogenous Ca(2+), putrescine, abscisic acid and methyl jasmonate. Additionally, CaHsfA2 was located in the nucleus and had transcriptional activity, consistent with the typical features of Hsfs. Time-course expression profiling of CaHsfA2 in response to heat stress revealed differences in its expression level and pattern between the pepper thermosensitive line B6 and thermotolerant line R9. Twenty-five Hsf genes were identified in the pepper genome and most of them responded to heat, salt, osmotic stress, and exogenous substances, which provided potential clues for further analyses of CaHsfs functions in various kinds of abiotic stresses and of corresponding signal transduction pathways in pepper.

Early activation of quorum sensing in Pseudomonas aeruginosa reveals the architecture of a complex regulon.

PubMed

Schuster, Martin; Greenberg, E Peter

2007-08-22

Quorum-sensing regulation of gene expression in Pseudomonas aeruginosa is complex. Two interconnected acyl-homoserine lactone (acyl-HSL) signal-receptor pairs, 3-oxo-dodecanoyl-HSL-LasR and butanoyl-HSL-RhlR, regulate more than 300 genes. The induction of most of the genes is delayed during growth of P. aeruginosa in complex medium, cannot be advanced by addition of exogenous signal, and requires additional regulatory components. Many of these late genes can be induced by addition of signals early by using specific media conditions. While several factors super-regulate the quorum receptors, others may co-regulate target promoters or may affect expression posttranscriptionally. To better understand the contributions of super-regulation and co-regulation to quorum-sensing gene expression, and to better understand the general structure of the quorum sensing network, we ectopically expressed the two receptors (in the presence of their cognate signals) and another component that affects quorum sensing, the stationary phase sigma factor RpoS, early in growth. We determined the effect on target gene expression by microarray and real-time PCR analysis. Our results show that many target genes (e.g. lasB and hcnABC) are directly responsive to receptor protein levels. Most genes (e.g. lasA, lecA, and phnAB), however, are not significantly affected, although at least some of these genes are directly regulated by quorum sensing. The majority of promoters advanced by RhlR appeared to be regulated directly, which allowed us to build a RhlR consensus sequence. The direct responsiveness of many quorum sensing target genes to receptor protein levels early in growth confirms the role of super-regulation in quorum sensing gene expression. The observation that the induction of most target genes is not affected by signal or receptor protein levels indicates that either target promoters are co-regulated by other transcription factors, or that expression is controlled posttranscriptionally. This architecture permits the integration of multiple signaling pathways resulting in quorum responses that require a "quorum" but are otherwise highly adaptable and receptive to environmental conditions.

Ginger and turmeric expressed sequence tags identify signature genes for rhizome identity and development and the biosynthesis of curcuminoids, gingerols and terpenoids

PubMed Central

2013-01-01

Background Ginger (Zingiber officinale) and turmeric (Curcuma longa) accumulate important pharmacologically active metabolites at high levels in their rhizomes. Despite their importance, relatively little is known regarding gene expression in the rhizomes of ginger and turmeric. Results In order to identify rhizome-enriched genes and genes encoding specialized metabolism enzymes and pathway regulators, we evaluated an assembled collection of expressed sequence tags (ESTs) from eight different ginger and turmeric tissues. Comparisons to publicly available sorghum rhizome ESTs revealed a total of 777 gene transcripts expressed in ginger/turmeric and sorghum rhizomes but apparently absent from other tissues. The list of rhizome-specific transcripts was enriched for genes associated with regulation of tissue growth, development, and transcription. In particular, transcripts for ethylene response factors and AUX/IAA proteins appeared to accumulate in patterns mirroring results from previous studies regarding rhizome growth responses to exogenous applications of auxin and ethylene. Thus, these genes may play important roles in defining rhizome growth and development. Additional associations were made for ginger and turmeric rhizome-enriched MADS box transcription factors, their putative rhizome-enriched homologs in sorghum, and rhizomatous QTLs in rice. Additionally, analysis of both primary and specialized metabolism genes indicates that ginger and turmeric rhizomes are primarily devoted to the utilization of leaf supplied sucrose for the production and/or storage of specialized metabolites associated with the phenylpropanoid pathway and putative type III polyketide synthase gene products. This finding reinforces earlier hypotheses predicting roles of this enzyme class in the production of curcuminoids and gingerols. Conclusion A significant set of genes were found to be exclusively or preferentially expressed in the rhizome of ginger and turmeric. Specific transcription factors and other regulatory genes were found that were common to the two species and that are excellent candidates for involvement in rhizome growth, differentiation and development. Large classes of enzymes involved in specialized metabolism were also found to have apparent tissue-specific expression, suggesting that gene expression itself may play an important role in regulating metabolite production in these plants. PMID:23410187

Activin A prevents neuron-like PC12 cell apoptosis after oxygen-glucose deprivation☆

PubMed Central

Xu, Guihua; He, Jinting; Guo, Hongliang; Mei, Chunli; Wang, Jiaoqi; Li, Zhongshu; Chen, Han; Mang, Jing; Yang, Hong; Xu, Zhongxin

2013-01-01

In this study, PC12 cells were induced to differentiate into neuron-like cells using nerve growth factor, and were subjected to oxygen-glucose deprivation. Cells were treated with 0, 10, 20, 30, 50, 100 ng/mL exogenous Activin A. The 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl tetrazolium bromide assay and Hoechst 33324 staining showed that the survival percentage of PC12 cells significantly decreased and the rate of apoptosis significantly increased after oxygen-glucose deprivation. Exogenous Activin A significantly increased the survival percentage of PC12 cells in a dose-dependent manner. Reverse transcription-PCR results revealed a significant increase in Activin receptor IIA, Smad3 and Smad4 mRNA levels, which are key sites in the Activin A/Smads signaling pathway, in neuron-like cells subjected to oxygen-glucose deprivation, while mRNA expression of the apoptosis-regulation gene caspase-3 decreased. Our experimental findings indicate that exogenous Activin A plays an anti-apoptotic role and protects neurons by means of activating the Activin A/Smads signaling pathway. PMID:25206395

Successful transient expression of Cas9 and single guide RNA genes in Chlamydomonas reinhardtii.

PubMed

Jiang, Wenzhi; Brueggeman, Andrew J; Horken, Kempton M; Plucinak, Thomas M; Weeks, Donald P

2014-11-01

The clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system has become a powerful and precise tool for targeted gene modification (e.g., gene knockout and gene replacement) in numerous eukaryotic organisms. Initial attempts to apply this technology to a model, the single-cell alga, Chlamydomonas reinhardtii, failed to yield cells containing edited genes. To determine if the Cas9 and single guide RNA (sgRNA) genes were functional in C. reinhardtii, we tested the ability of a codon-optimized Cas9 gene along with one of four different sgRNAs to cause targeted gene disruption during a 24-h period immediately following transformation. All three exogenously supplied gene targets as well as the endogenous FKB12 (rapamycin sensitivity) gene of C. reinhardtii displayed distinct Cas9/sgRNA-mediated target site modifications as determined by DNA sequencing of cloned PCR amplicons of the target site region. Success in transient expression of Cas9 and sgRNA genes contrasted with the recovery of only a single rapamycin-resistant colony bearing an appropriately modified FKB12 target site in 16 independent transformation experiments involving >10(9) cells. Failure to recover transformants with intact or expressed Cas9 genes following transformation with the Cas9 gene alone (or even with a gene encoding a Cas9 lacking nuclease activity) provided strong suggestive evidence for Cas9 toxicity when Cas9 is produced constitutively in C. reinhardtii. The present results provide compelling evidence that Cas9 and sgRNA genes function properly in C. reinhardtii to cause targeted gene modifications and point to the need for a focus on development of methods to properly stem Cas9 production and/or activity following gene editing. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Exogenous abscisic acid increases antioxidant enzymes and related gene expression in pepper (Capsicum annuum) leaves subjected to chilling stress.

PubMed

Guo, W L; Chen, R G; Gong, Z H; Yin, Y X; Ahmed, S S; He, Y M

2012-11-28

To elucidate how physiological and biochemical mechanisms of chilling stress are regulated by abscisic acid (ABA) pretreatment, pepper variety (cv. 'P70') seedlings were pretreated with 0.57 mM ABA for 72 h and then subjected to chilling stress at 10°/6°C (day/night). Chilling stress caused severe necrotic lesions on the leaves and increased malondialdehyde and H(2)O(2) levels. Activities of monodehydroascorbate reductase (DHAR), dehydroascorbate reductase, glutathione reductase, guaiacol peroxidase, ascorbate peroxidase, ascorbate, and glutathione increased due to chilling stress during the 72 h, while superoxide dismutase and catalase activities decreased during 24 h, suggesting that chilling stress activates the AsA-GSH cycle under catalase deactivation in pepper leaves. ABA pretreatment induced significant increases in the above-mentioned enzyme activities and progressive decreases in ascorbate and glutathione levels. On the other hand, ABA-pretreated seedlings under chilling stress increased superoxide dismutase and guaiacol peroxidase activities and lowered concentrations of other antioxidants compared with untreated chilling-stressed plants. These seedlings showed concomitant decreases in foliage damage symptoms, and levels of malondialdehyde and H(2)O(2). Induction of Mn-SOD and POD was observed in chilling-stressed plants treated with ABA. The expression of DHAR1 and DHAR2 was altered by chilling stress, but it was higher in the presence than in the absence of ABA at 24 h. Overall, the results indicate that exogenous application of ABA increases tolerance of plants to chilling-induced oxidative damage, mainly by enhancing superoxide dismutase and guaiacol peroxidase activities and related gene expression.

MiR-224 expression increases radiation sensitivity of glioblastoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Upraity, Shailendra; Kazi, Sadaf; Padul, Vijay

Highlights: • MiR-224 expression in established glioblastoma cell lines and sporadic tumor tissues is low. • Exogenous miR-224 expression was found to increase radiation sensitivity of glioblastoma cells. • MiR-224 expression brought about 55–60% reduction in API5 expression levels. • Transfection with API5 siRNA increased radiation sensitivity of glioblastoma cells. • Low miR-224 and high API5 expression correlated with worse survival of GBM patients. - Abstract: Glioblastoma (GBM) is the most common and highly aggressive primary malignant brain tumor. The intrinsic resistance of this brain tumor limits the efficacy of administered treatment like radiation therapy. In the present study, effectmore » of miR-224 expression on growth characteristics of established GBM cell lines was analyzed. MiR-224 expression in the cell lines as well as in primary GBM tumor tissues was found to be low. Exogenous transient expression of miR-224 using either synthetic mimics or stable inducible expression using doxycycline inducible lentiviral vector carrying miR-224 gene, was found to bring about 30–55% reduction in clonogenic potential of U87 MG cells. MiR-224 expression reduced clonogenic potential of U87 MG cells by 85–90% on irradiation at a dose of 6 Gy, a dose that brought about 50% reduction in clonogenic potential in the absence of miR-224 expression. MiR-224 expression in glioblastoma cells resulted in 55–65% reduction in the expression levels of API5 gene, a known target of miR-224. Further, siRNA mediated down-regulation of API5 was also found to have radiation sensitizing effect on glioblastoma cell lines. Analysis of the Cancer Genome Atlas data showed lower miR-224 expression levels in male GBM patients to correlate with poorer survival. Higher expression levels of miR-224 target API5 also showed significant correlation with poorer survival of GBM patients. Up-regulation of miR-224 or down-regulation of its target API5 in combination with radiation therapy, therefore appear as promising options for the treatment of glioblastoma, which is refractory to the existing treatment strategies.« less

Resistance to BmNPV via Overexpression of an Exogenous Gene Controlled by an Inducible Promoter and Enhancer in Transgenic Silkworm, Bombyx mori

PubMed Central

Jiang, Liang; Cheng, Tingcai; Zhao, Ping; Yang, Qiong; Wang, Genhong; Jin, Shengkai; Lin, Ping; Xiao, Yang; Xia, Qingyou

2012-01-01

The hycu-ep32 gene of Hyphantria cunea NPV can inhibit Bombyx mori nucleopolyhedrovirus (BmNPV) multiplication in co-infected cells, but it is not known whether the overexpression of the hycu-ep32 gene has an antiviral effect in the silkworm, Bombyx mori. Thus, we constructed four transgenic vectors, which were under the control of the 39 K promoter of BmNPV (39 KP), Bombyx mori A4 promoter (A4P), hr3 enhancer of BmNPV combined with 39 KP, and hr3 combined with A4P. Transgenic lines were created via embryo microinjection using practical diapause silkworm. qPCR revealed that the expression level of hycu-ep32 could be induced effectively after BmNPV infection in transgenic lines where hycu-ep32 was controlled by hr3 combined with 39 KP (i.e., HEKG). After oral inoculation of BmNPV with 3 × 105 occlusion bodies per third instar, the mortality with HEKG-B was approximately 30% lower compared with the non-transgenic line. The economic characteristics of the transgenic lines remained unchanged. These results suggest that overexpression of an exogenous antiviral gene controlled by an inducible promoter and enhancer is a feasible method for breeding silkworms with a high antiviral capacity. PMID:22870254

Involvement of auxin and a homeodomain-leucine zipper I gene in rhizoid development of the moss Physcomitrella patens.

PubMed

Sakakibara, Keiko; Nishiyama, Tomoaki; Sumikawa, Naomi; Kofuji, Rumiko; Murata, Takashi; Hasebe, Mitsuyasu

2003-10-01

Differentiation of epidermal cells is important for plants because they are in direct contact with the environment. Rhizoids are multicellular filaments that develop from the epidermis in a wide range of plants, including pteridophytes, bryophytes, and green algae; they have similar functions to root hairs in vascular plants in that they support the plant body and are involved in water and nutrient absorption. In this study, we examined mechanisms underlying rhizoid development in the moss, Physcomitrella patens, which is the only land plant in which high-frequency gene targeting is possible. We found that rhizoid development can be split into two processes: determination and differentiation. Two types of rhizoids with distinct developmental patterns (basal and mid-stem rhizoids) were recognized. The development of basal rhizoids from epidermal cells was induced by exogenous auxin, while that of mid-stem rhizoids required an unknown factor in addition to exogenous auxin. Once an epidermal cell had acquired a rhizoid initial cell fate, expression of the homeodomain-leucine zipper I gene Pphb7 was induced. Analysis of Pphb7 disruptant lines showed that Pphb7 affects the induction of pigmentation and the increase in the number and size of chloroplasts, but not the position or number of rhizoids. This is the first report on the involvement of a homeodomain-leucine zipper I gene in epidermal cell differentiation.

Identification and expression analysis of four 14-3-3 genes during fruit ripening in banana (Musa acuminata L. AAA group, cv. Brazilian).

PubMed

Li, Mei-Ying; Xu, Bi-Yu; Liu, Ju-Hua; Yang, Xiao-Liang; Zhang, Jian-Bin; Jia, Cai-Hong; Ren, Li-Cheng; Jin, Zhi-Qiang

2012-02-01

To investigate the regulation of 14-3-3 proteins in banana (Musa acuminata L. AAA group, cv. Brazilian) fruit postharvest ripening, four cDNAs encoding 14-3-3 proteins were isolated from banana and designated as Ma-14-3-3a, Ma-14-3-3c, Ma-14-3-3e, and Ma-14-3-3i, respectively. Amino acid sequence alignment showed that the four 14-3-3 proteins shared a highly conserved core structure and variable C-terminal as well as N-terminal regions with 14-3-3 proteins from other plant species. Phylogenetic analysis revealed that the four 14-3-3 genes belong to the non-ε groups. They were differentially and specifically expressed in various tissues. Real-time RT-PCR analysis indicated that these four genes function differentially during banana fruit postharvest ripening. Three genes, Ma-14-3-3a, Ma-14-3-3c, and Ma-14-3-3e, were significantly induced by exogenous ethylene treatment. However, gene function differed in naturally ripened fruits. Ethylene could induce Ma-14-3-3c expression during postharvest ripening, but expression patterns of Ma-14-3-3a and Ma-14-3-3e suggest that these two genes appear to be involved in regulating ethylene biosynthesis during fruit ripening. No obvious relationship emerged between Ma-14-3-3i expression in naturally ripened and 1-MCP (1-methylcyclopropene)-treated fruit groups during fruit ripening. These results indicate that the 14-3-3 proteins might be involved in various regulatory processes of banana fruit ripening. Further studies will mainly focus on revealing the detailed biological mechanisms of these four 14-3-3 genes in regulating banana fruit postharvest ripening.

Hydrogen peroxide-regulated genes in the Medicago truncatula-Sinorhizobium meliloti symbiosis.

PubMed

Andrio, Emilie; Marino, Daniel; Marmeys, Anthony; de Segonzac, Marion Dunoyer; Damiani, Isabelle; Genre, Andrea; Huguet, Stéphanie; Frendo, Pierre; Puppo, Alain; Pauly, Nicolas

2013-04-01

Reactive oxygen species (ROS), particularly hydrogen peroxide (H(2)O(2)), play an important role in signalling in various cellular processes. The involvement of H(2)O(2) in the Medicago truncatula-Sinorhizobium meliloti symbiotic interaction raises questions about its effect on gene expression. A transcriptome analysis was performed on inoculated roots of M. truncatula in which ROS production was inhibited with diphenylene iodonium (DPI). In total, 301 genes potentially regulated by ROS content were identified 2 d after inoculation. These genes included MtSpk1, which encodes a putative protein kinase and is induced by exogenous H(2)O(2) treatment. MtSpk1 gene expression was also induced by nodulation factor treatment. MtSpk1 transcription was observed in infected root hair cells, nodule primordia and the infection zone of mature nodules. Analysis with a fluorescent protein probe specific for H(2)O(2) showed that MtSpk1 expression and H(2)O(2) were similarly distributed in the nodule infection zone. Finally, the establishment of symbiosis was impaired by MtSpk1 downregulation with an artificial micro-RNA. Several genes regulated by H(2)O(2) during the establishment of rhizobial symbiosis were identified. The involvement of MtSpk1 in the establishment of the symbiosis is proposed. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

PpHB22, a member of HD-Zip proteins, activates PpDAM1 to regulate bud dormancy transition in 'Suli' pear (Pyrus pyrifolia White Pear Group).

PubMed

Yang, Qinsong; Niu, Qingfeng; Li, Jianzhao; Zheng, Xiaoyan; Ma, Yunjing; Bai, Songling; Teng, Yuanwen

2018-06-01

Homeodomain-leucine zipper (HD-Zip) proteins, which form one of the largest and most diverse families, regulate many biological processes in plants, including differentiation, flowering, vascular development, and stress signaling. Abscisic acid (ABA) has been proved to be one of the key regulators of bud dormancy and to influence several HD-Zip genes expression. However, the role of HD-Zip genes in regulating bud dormancy remains unclear. We identified 47 pear (P. pyrifolia White Pear Group) HD-Zip genes, which were classified into four subfamilies (HD-Zip I-IV). We further revealed that gene expression levels of some HD-Zip members were closely related to ABA concentrations in flower buds during dormancy transition. Exogenous ABA treatment confirmed that PpHB22 and several other HD-Zip genes responded to ABA. Yeast one-hybrid and dual luciferase assay results combining subcellular localization showed that PpHB22 was present in nucleus and directly induced PpDAM1 (dormancy associated MADS-box 1) expression. Thus, PpHB22 is a negative regulator of plant growth associated with the ABA response pathway and functions upstream of PpDAM1. These findings enrich our understanding of the function of HD-Zip genes related to the bud dormancy transition. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Up-regulating the abscisic acid inactivation gene ZmABA8ox1b contributes to seed germination heterosis by promoting cell expansion.

PubMed

Li, Yangyang; Wang, Cheng; Liu, Xinye; Song, Jian; Li, Hongjian; Sui, Zhipeng; Zhang, Ming; Fang, Shuang; Chu, Jinfang; Xin, Mingming; Xie, Chaojie; Zhang, Yirong; Sun, Qixin; Ni, Zhongfu

2016-04-01

Heterosis has been widely used in agriculture, but the underlying molecular principles are still largely unknown. During seed germination, we observed that maize (Zea mays) hybrid B73/Mo17 was less sensitive than its parental inbred lines to exogenous abscisic acid (ABA), and endogenous ABA content in hybrid embryos decreased more rapidly than in the parental inbred lines. ZmABA8ox1b, an ABA inactivation gene, was consistently more highly up-regulated in hybrid B73/Mo17 than in its parental inbred lines at early stages of seed germination. Moreover, ectopic expression of ZmABA8ox1b obviously promoted seed germination in Arabidopsis Remarkably, microscopic observation revealed that cell expansion played a major role in the ABA-mediated maize seed germination heterosis, which could be attributed to the altered expression of cell wall-related genes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Reprogramming cell fate with a genome-scale library of artificial transcription factors.

PubMed

Eguchi, Asuka; Wleklinski, Matthew J; Spurgat, Mackenzie C; Heiderscheit, Evan A; Kropornicka, Anna S; Vu, Catherine K; Bhimsaria, Devesh; Swanson, Scott A; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J; Slukvin, Igor; Thomson, James A; Dutton, James R; Ansari, Aseem Z

2016-12-20

Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices.

Exogenous isoprene modulates gene expression in unstressed Arabidopsis thaliana plants.

PubMed

Harvey, Christopher M; Sharkey, Thomas D

2016-06-01

Isoprene is a well-studied volatile hemiterpene that protects plants from abiotic stress through mechanisms that are not fully understood. The antioxidant and membrane stabilizing potential of isoprene are the two most commonly invoked mechanisms. However, isoprene also affects phenylpropanoid metabolism, suggesting an additional role as a signalling molecule. In this study, microarray-based gene expression profiling reveals transcriptional reprogramming of Arabidopsis thaliana plants fumigated for 24 h with a physiologically relevant concentration of isoprene. Functional enrichment analysis of fumigated plants revealed enhanced heat- and light-stress-responsive processes in response to isoprene. Isoprene induced a network enriched in ERF and WRKY transcription factors, which may play a role in stress tolerance. The isoprene-induced up-regulation of phenylpropanoid biosynthetic genes was specifically confirmed using quantitative reverse transcription polymerase chain reaction. These results support a role for isoprene as a signalling molecule, in addition to its possible roles as an antioxidant and membrane thermoprotectant. © 2015 John Wiley & Sons Ltd.

Reprogramming cell fate with a genome-scale library of artificial transcription factors

PubMed Central

Eguchi, Asuka; Wleklinski, Matthew J.; Spurgat, Mackenzie C.; Heiderscheit, Evan A.; Kropornicka, Anna S.; Vu, Catherine K.; Bhimsaria, Devesh; Swanson, Scott A.; Stewart, Ron; Ramanathan, Parameswaran; Kamp, Timothy J.; Slukvin, Igor; Thomson, James A.; Dutton, James R.; Ansari, Aseem Z.

2016-01-01

Artificial transcription factors (ATFs) are precision-tailored molecules designed to bind DNA and regulate transcription in a preprogrammed manner. Libraries of ATFs enable the high-throughput screening of gene networks that trigger cell fate decisions or phenotypic changes. We developed a genome-scale library of ATFs that display an engineered interaction domain (ID) to enable cooperative assembly and synergistic gene expression at targeted sites. We used this ATF library to screen for key regulators of the pluripotency network and discovered three combinations of ATFs capable of inducing pluripotency without exogenous expression of Oct4 (POU domain, class 5, TF 1). Cognate site identification, global transcriptional profiling, and identification of ATF binding sites reveal that the ATFs do not directly target Oct4; instead, they target distinct nodes that converge to stimulate the endogenous pluripotency network. This forward genetic approach enables cell type conversions without a priori knowledge of potential key regulators and reveals unanticipated gene network dynamics that drive cell fate choices. PMID:27930301

Wnt Signaling Cross-Talks with JH Signaling by Suppressing Met and gce Expression

PubMed Central

Abdou, Mohamed; Peng, Cheng; Huang, Jianhua; Zyaan, Ola; Wang, Sheng; Li, Sheng; Wang, Jian

2011-01-01

Juvenile hormone (JH) plays key roles in controlling insect growth and metamorphosis. However, relatively little is known about the JH signaling pathways. Until recent years, increasing evidence has suggested that JH modulates the action of 20-hydroxyecdysone (20E) by regulating expression of broad (br), a 20E early response gene, through Met/Gce and Kr-h1. To identify other genes involved in JH signaling, we designed a novel Drosophila genetic screen to isolate mutations that derepress JH-mediated br suppression at early larval stages. We found that mutations in three Wnt signaling negative regulators in Drosophila, Axin (Axn), supernumerary limbs (slmb), and naked cuticle (nkd), caused precocious br expression, which could not be blocked by exogenous JHA. A similar phenotype was observed when armadillo (arm), the mediator of Wnt signaling, was overexpressed. qRT-PCR revealed that Met, gce and Kr-h1expression was suppressed in the Axn, slmb and nkd mutants as well as in arm gain-of-function larvae. Furthermore, ectopic expression of gce restored Kr-h1 expression but not Met expression in the arm gain-of-function larvae. Taken together, we conclude that Wnt signaling cross-talks with JH signaling by suppressing transcription of Met and gce, genes that encode for putative JH receptors. The reduced JH activity further induces down-regulation of Kr-h1expression and eventually derepresses br expression in the Drosophila early larval stages. PMID:22087234

Polysaccharide Peptide-Induced Virus Resistance Depends on Ca2+ Influx by Increasing the Salicylic Acid Content and Upregulating the Leucine-Rich Repeat Gene in Arabidopsis thaliana.

PubMed

Zhao, Lei; Chen, Yujia; Yang, Wen; Zhang, Yuanle; Chen, Wenbao; Feng, Chaohong; Wang, Qaochun; Wu, Yunfeng

2018-05-01

Plant viral diseases cause severe economic losses in agricultural production. The development of biosource-derived antiviral agents provides an alternative strategy to efficiently control plant viral diseases. We previously reported that the exogenous application of polysaccharide peptide (PSP) exerts significant inhibitive effects on Tobacco mosaic virus infection in Nicotiana tabacum. In this study, we studied in additional detail the mechanism by which PSP can induce virus resistance in Arabidopsis thaliana. We found that PSP significantly induced Ca 2+ influx and increased the accumulation of hydrogen peroxide and salicylic acid (SA) in the A. thaliana cells. A gene with a toll interleukin 1 receptor-nucleotide binding site-leucine-rich repeat domain (LRR) was obtained by RNA sequencing in combination with the screening of the gene-deletion mutants of A. thaliana. The LRR gene was deleted, and the inductive response of A. thaliana to PSP was significantly attenuated after mutation. After the heterologous overexpression of the LRR gene in N. benthamiana, the SA content and PR1 gene expression in N. benthamiana were significantly increased. Through analyses of the LRR gene expression and the ability of A. thaliana to resist Cucumber mosaic virus following the treatments of PSP and PSP + ethyleneglycol-bis (beta-aminoethylether)-N,N'-tetraacetic acid, it was shown that PSP enhanced the virus resistance of A. thaliana by inducing Ca 2+ influx and subsequently improving expression of the LRR gene, which further increased the SA content.

Vacuolar H+-ATPase Is Expressed in Response to Gibberellin during Tomato Seed Germination1

PubMed Central

Cooley, Michael B.; Yang, Hong; Dahal, Peetambar; Mella, R. Alejandra; Downie, A. Bruce; Haigh, Anthony M.; Bradford, Kent J.

1999-01-01

Completion of germination (radicle emergence) by gibberellin (GA)-deficient (gib-1) mutant tomato (Lycopersicon esculentum Mill.) seeds is dependent upon exogenous GA, because weakening of the endosperm tissue enclosing the radicle tip requires GA. To investigate genes that may be involved in endosperm weakening or embryo growth, differential cDNA display was used to identify mRNAs differentially expressed in gib-1 seeds imbibed in the presence or absence of GA4+7. Among these was a GA-responsive mRNA encoding the 16-kD hydrophobic subunit c of the V0 membrane sector of vacuolar H+-translocating ATPases (V-ATPase), which we termed LVA-P1. LVA-P1 mRNA expression in gib-1 seeds was dependent on GA and was particularly abundant in the micropylar region prior to radicle emergence. Both GA dependence and tissue localization of LVA-P1 mRNA expression were confirmed directly in individual gib-1 seeds using tissue printing. LVA-P1 mRNA was also expressed in wild-type seeds during development and germination, independent of exogenous GA. Specific antisera detected protein subunits A and B of the cytoplasmic V1 sector of the V-ATPase holoenzyme complex in gib-1 seeds only in the presence of GA, and expression was localized to the micropylar region. The results suggest that V-ATPase plays a role in GA-regulated germination of tomato seeds. PMID:10594121

Cartilage fragments from osteoarthritic knee promote chondrogenesis of mesenchymal stem cells without exogenous growth factor induction.

PubMed

Chen, Chia-Chun; Liao, Cheng-Hao; Wang, Yao-Horng; Hsu, Yuan-Ming; Huang, Shih-Horng; Chang, Chih-Hung; Fang, Hsu-Wei

2012-03-01

Extracellular matrix (ECM) is thought to participate significantly in guiding the differentiation process of mesenchymal stem cells (MSCs). In this study, we hypothesized that cartilage fragments from osteoarthritic knee could promote chondrogenesis of MSCs. Nonworn parts of cartilage tissues were obtained during total knee arthroplasty (TKA) surgery. Cartilage fragments and MSCs were wrapped into fibrin glue; and the constructs were implanted subcutaneously into nude mice. Histological analysis showed neocartilage-like structure with positive Alcian blue staining in the cartilage fragment-fibrin-MSC constructs. However, constructs with only MSCs in fibrin showed condensed appearance like MSCs in the pellet culture. Gene expression of type II collagen in the constructs with 60 mg cartilage fragments were significantly elevated after 4 weeks of implantation. Conversely, the constructs without cartilage fragments failed to express type II collagen, which indicated MSCs did not differentiate into a chondrogenic lineage. In conclusion, we demonstrated the effect of cartilage fragments from osteoarthritic knee in promoting chondrogenic differentiation of MSCs. This may be a favorable strategy for MSC chondrogenesis without exogenous growth factor induction. Copyright © 2011 Orthopaedic Research Society.

Rice ABI5-Like1 Regulates Abscisic Acid and Auxin Responses by Affecting the Expression of ABRE-Containing Genes1[W][OA

PubMed Central

Yang, Xi; Yang, Ya-Nan; Xue, Liang-Jiao; Zou, Mei-Juan; Liu, Jian-Ying; Chen, Fan; Xue, Hong-Wei

2011-01-01

Abscisic acid (ABA) regulates plant development and is crucial for plant responses to biotic and abiotic stresses. Studies have identified the key components of ABA signaling in Arabidopsis (Arabidopsis thaliana), some of which regulate ABA responses by the transcriptional regulation of downstream genes. Here, we report the functional identification of rice (Oryza sativa) ABI5-Like1 (ABL1), which is a basic region/leucine zipper motif transcription factor. ABL1 is expressed in various tissues and is induced by the hormones ABA and indole-3-acetic acid and stress conditions including salinity, drought, and osmotic pressure. The ABL1 deficiency mutant, abl1, shows suppressed ABA responses, and ABL1 expression in the Arabidopsis abi5 mutant rescued the ABA sensitivity. The ABL1 protein is localized to the nucleus and can directly bind ABA-responsive elements (ABREs; G-box) in vitro. A gene expression analysis by DNA chip hybridization confirms that a large proportion of down-regulated genes of abl1 are involved in stress responses, consistent with the transcriptional activating effects of ABL1. Further studies indicate that ABL1 regulates the plant stress responses by regulating a series of ABRE-containing WRKY family genes. In addition, the abl1 mutant is hypersensitive to exogenous indole-3-acetic acid, and some ABRE-containing genes related to auxin metabolism or signaling are altered under ABL1 deficiency, suggesting that ABL1 modulates ABA and auxin responses by directly regulating the ABRE-containing genes. PMID:21546455

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

Selection of yeast Saccharomyces cerevisiae promoters available for xylose cultivation and fermentation.

PubMed

Nambu-Nishida, Yumiko; Sakihama, Yuri; Ishii, Jun; Hasunuma, Tomohisa; Kondo, Akihiko

2018-01-01

To efficiently utilize xylose, a major sugar component of hemicelluloses, in Saccharomyces cerevisiae requires the proper expression of varied exogenous and endogenous genes. To expand the repertoire of promoters in engineered xylose-utilizing yeast strains, we selected promoters in S. cerevisiae during cultivation and fermentation using xylose as a carbon source. To select candidate promoters that function in the presence of xylose, we performed comprehensive gene expression analyses using xylose-utilizing yeast strains both during xylose and glucose fermentation. Based on microarray data, we chose 29 genes that showed strong, moderate, and weak expression in xylose rather than glucose fermentation. The activities of these promoters in a xylose-utilizing yeast strain were measured by lacZ reporter gene assays over time during aerobic cultivation and microaerobic fermentation, both in xylose and glucose media. In xylose media, P TDH3 , P FBA1 , and P TDH1 were favorable for high expression, and P SED1 , P HXT7 , P PDC1 , P TEF1 , P TPI1 , and P PGK1 were acceptable for medium-high expression in aerobic cultivation, and moderate expression in microaerobic fermentation. P TEF2 allowed moderate expression in aerobic culture and weak expression in microaerobic fermentation, although it showed medium-high expression in glucose media. P ZWF1 and P SOL4 allowed moderate expression in aerobic cultivation, while showing weak but clear expression in microaerobic fermentation. P ALD3 and P TKL2 showed moderate promoter activity in aerobic cultivation, but showed almost no activity in microaerobic fermentation. The knowledge of promoter activities in xylose cultivation obtained in this study will permit the control of gene expression in engineered xylose-utilizing yeast strains that are used for hemicellulose fermentation. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Optoporation of impermeable molecules and genes for visualization and activation of cells

NASA Astrophysics Data System (ADS)

Dhakal, Kamal; Batbyal, Subrata; Kim, Young-Tae; Mohanty, Samarendra

2015-03-01

Visualization, activation, and detection of the cell(s) and their electrical activity require delivery of exogenous impermeable molecules and targeted expression of genes encoding labeling proteins, ion-channels and voltage indicators. While genes can be delivered by viral vector to cells, delivery of other impermeable molecules into the cytoplasm of targeted cells requires microinjection by mechanical needle or microelectrodes, which pose significant challenge to the viability of the cells. Further, it will be useful to localize the expression of the targeted molecules not only in specific cell types, but to specific cells in restricted spatial regions. Here, we report use of focused near-infrared (NIR) femtosecond laser beam to transiently perforate targeted cell membrane to insert genes encoding blue light activatable channelrhodopsin-2 (ChR2) and red-shifted opsin (ReachR). Optoporation of nanomolar concentrations of rhodamine phalloidin (an impermeable dye molecule for staining filamentous actin) into targeted living mammalian cells (both HEK and primary cortical neurons) is also achieved allowing imaging of dynamics and intact morphology of cellular structures without requiring fixation.

Effect of exogenous abscisic acid on morphology, growth and nutrient uptake of rice (Oryza sativa) roots under simulated acid rain stress.

PubMed

Liu, Hongyue; Ren, Xiaoqian; Zhu, Jiuzheng; Wu, Xi; Liang, Chanjuan

2018-05-31

Application of proper ABA can improve acid tolerance of rice roots by balancing endogenous hormones and promoting nutrient uptake. Abscisic acid (ABA) has an important signaling role in enhancing plant tolerance to environmental stress. To alleviate the inhibition on plant growth and productivity caused by acid rain, it is crucial to clarify the regulating mechanism of ABA on adaptation of plants to acid rain. Here, we studied the effects of exogenously applied ABA on nutrients uptake of rice roots under simulated acid rain (SAR) stress from physiological, biochemical and molecular aspects. Compared to the single SAR treatment (pH 4.5 or 3.5), exogenous 10 μM ABA alleviated the SAR-induced inhibition of root growth by balancing endogenous hormones (abscisic acid, indole-3-acetic acid, gibberellic acid and zeatin), promoting nutrient uptake (nitrate, P, K and Mg) in rice roots, and increasing the activity of the plasma membrane H + -ATPase by up-regulating expression levels of genes (OSA2, OSA4, OSA9 and OSA10). However, exogenous 100 μM ABA exacerbated the SAR-caused inhibition of root growth by disrupting the balance of endogenous hormones, and inhibiting nutrient uptake (nitrate, P, K, Ca and Mg) through decreasing the activity of the plasma membrane H + -ATPase. These results indicate that proper concentration of exogenous ABA could enhance tolerance of rice roots to SAR stress by promoting nutrients uptake and balancing endogenous hormones.

Retrovirally mediated correction of bone marrow-derived mesenchymal stem cells from patients with mucopolysaccharidosis type I.

PubMed

Baxter, Melissa A; Wynn, Robert F; Deakin, Jonathan A; Bellantuono, Ilaria; Edington, Kirsten G; Cooper, Alan; Besley, Guy T N; Church, Heather J; Wraith, J Ed; Carr, Trevor F; Fairbairn, Leslie J

2002-03-01

We have investigated the utility of bone marrow-derived mesenchymal stem cells (MSCs) as targets for gene therapy of the autosomal recessive disorder mucopolysaccharidosis type IH (MPS-IH, Hurler syndrome). Cultures of MSCs were initially exposed to a green fluorescent protein-expressing retrovirus. Green fluorescent protein-positive cells maintained their proliferative and differentiation capacity. Next we used a vector encoding alpha-L-iduronidase (IDUA), the enzyme that is defective in MPS-IH. Following transduction, MPS-IH MSCs expressed high levels of IDUA and secreted supernormal levels of this enzyme into the extracellular medium. Exogenous IDUA expression led to a normalization of glycosaminoglycan storage in MPS-IH cells, as evidenced by a dramatic decrease in the amount of (35)SO(4) sequestered within the heparan sulfate and dermatan sulfate compartments of these cells. Finally, gene-modified MSCs were able to cross-correct the enzyme defect in untransduced MPS-IH fibroblasts via protein transfer.

Chitinases in Pneumocystis carinii pneumonia

PubMed Central

Villegas, Leah R.; Kottom, Theodore J.

2014-01-01

Pneumocystis pneumonia remains an important complication of immune suppression. The cell wall of Pneumocystis has been demonstrated to potently stimulate host inflammatory responses, with most studies focusing on β-glucan components of the Pneumocystis cell wall. In the current study, we have elaborated the potential role of chitins and chitinases in Pneumocystis pneumonia. We demonstrated differential host mammalian chitinase expression during Pneumocystis pneumonia. We further characterized a chitin synthase gene in Pneumocystis carinii termed Pcchs5, a gene with considerable homolog to the fungal chitin biosynthesis protein Chs5. We also observed the impact of chitinase digestion on Pneumocystis-induced host inflammatory responses by measuring TNFα release and mammalian chitinase expression by cultured lung epithelial and macrophage cells stimulated with Pneumocystis cell wall isolates in the presence and absence of exogenous chitinase digestion. These findings provide evidence supporting a chitin biosynthetic pathway in Pneumocystis organisms and that chitinases modulate inflammatory responses in lung cells. We further demonstrate lung expression of chitinase molecules during Pneumocystis pneumonia. PMID:22535444

[Breeding of transgenic mice expressing human tau isoform with P301L mutation and identification of homozygous transgenic mice].

PubMed

Wang, Yan-yan; Chen, Ru-zhui; Zhu, Xiao-nani; Liu, Jing; Li, Zhi-hui; Liu, Xiu-juan; Li, Zhi-hui; Na, Xin; Liang, Shan-shan; Qiu, Guo-guang; Zhang, Wei; Wang, Hai; Wang, Xue-lan

2012-05-01

To establish homozygous transgenic mouse strain expressing human tau isoform with P301L mutation. Five transgenic mice expressing human tau isoform with P301L mutation were obtained by microinjection into male nuclei. Homozygote and hemizygote were identified by PCR and real-time fluorescent quantitative PCR. Ninety five homozygous transgenic mice were selected, and the results indicated that homozygous transgenic mice were superior to hemizygote in simulating the changes of biological characteristics. Exogenous gene tau is able to stably transmit to next generation and the combination of SYBR Green real-time fluorescent quantitative PCR with the traditional mating is a fast, reliable and economical way to screen homozygous and hemizygous transgenic mice.

Coenzyme Q supplementation or over-expression of the yeast Coq8 putative kinase stabilizes multi-subunit Coq polypeptide complexes in yeast coq null mutants.

PubMed

He, Cuiwen H; Xie, Letian X; Allan, Christopher M; Tran, Uyenphuong C; Clarke, Catherine F

2014-04-04

Coenzyme Q biosynthesis in yeast requires a multi-subunit Coq polypeptide complex. Deletion of any one of the COQ genes leads to respiratory deficiency and decreased levels of the Coq4, Coq6, Coq7, and Coq9 polypeptides, suggesting that their association in a high molecular mass complex is required for stability. Over-expression of the putative Coq8 kinase in certain coq null mutants restores steady-state levels of the sensitive Coq polypeptides and promotes the synthesis of late-stage Q-intermediates. Here we show that over-expression of Coq8 in yeast coq null mutants profoundly affects the association of several of the Coq polypeptides in high molecular mass complexes, as assayed by separation of digitonin extracts of mitochondria by two-dimensional blue-native/SDS PAGE. The Coq4 polypeptide persists at high molecular mass with over-expression of Coq8 in coq3, coq5, coq6, coq7, coq9, and coq10 mutants, indicating that Coq4 is a central organizer of the Coq complex. Supplementation with exogenous Q6 increased the steady-state levels of Coq4, Coq7, and Coq9, and several other mitochondrial polypeptides in select coq null mutants, and also promoted the formation of late-stage Q-intermediates. Q supplementation may stabilize this complex by interacting with one or more of the Coq polypeptides. The stabilizing effects of exogenously added Q6 or over-expression of Coq8 depend on Coq1 and Coq2 production of a polyisoprenyl intermediate. Based on the observed interdependence of the Coq polypeptides, the effect of exogenous Q6, and the requirement for an endogenously produced polyisoprenyl intermediate, we propose a new model for the Q-biosynthetic complex, termed the CoQ-synthome. Copyright © 2014 Elsevier B.V. All rights reserved.

Coenzyme Q supplementation or over-expression of the yeast Coq8 putative kinase stabilizes multi-subunit Coq polypeptide complexes in yeast coq null mutants*

PubMed Central

He, Cuiwen H.; Xie, Letian X.; Allan, Christopher M.; Tran, UyenPhuong C.; Clarke, Catherine F.

2014-01-01

Coenzyme Q biosynthesis in yeast requires a multi-subunit Coq polypeptide complex. Deletion of any one of the COQ genes leads to respiratory deficiency and decreased levels of the Coq4, Coq6, Coq7, and Coq9 polypeptides, suggesting that their association in a high molecular mass complex is required for stability. Over-expression of the putative Coq8 kinase in certain coq null mutants restores steady-state levels of the sensitive Coq polypeptides and promotes the synthesis of late-stage Q-intermediates. Here we show that over-expression of Coq8 in yeast coq null mutants profoundly affects the association of several of the Coq polypeptides in high molecular mass complexes, as assayed by separation of digitonin extracts of mitochondria by two-dimensional blue-native/SDS PAGE. The Coq4 polypeptide persists at high molecular mass with over-expression of Coq8 in coq3, coq5, coq6, coq7, coq9, and coq10 mutants, indicating that Coq4 is a central organizer of the Coq complex. Supplementation with exogenous Q6 increased the steady-state levels of Coq4, Coq7, Coq9, and several other mitochondrial polypeptides in select coq null mutants, and also promoted the formation of late-stage Q-intermediates. Q supplementation may stabilize this complex by interacting with one or more of the Coq polypeptides. The stabilizing effects of exogenously added Q6 or over-expression of Coq8 depend on Coq1 and Coq2 production of a polyisoprenyl intermediate. Based on the observed interdependence of the Coq polypeptides, the effect of exogenous Q6, and the requirement for an endogenously produced polyisoprenyl intermediate, we propose a new model for the Q-biosynthetic complex, termed the CoQ-synthome. PMID:24406904

Alternatives to vitamin B 1 uptake revealed with discovery of riboswitches in multiple marine eukaryotic lineages

DOE PAGES

McRose, Darcy; Guo, Jian; Monier, Adam; ...

2014-08-29

Here, vitamin B 1 (thiamine pyrophosphate, TPP) is essential to all life but scarce in ocean surface waters. In many bacteria and a few eukaryotic groups thiamine biosynthesis genes are controlled by metabolite-sensing mRNA-based gene regulators known as riboswitches. Using available genome sequences and transcriptomes generated from ecologically important marine phytoplankton, we identified 31 new eukaryotic riboswitches. These were found in alveolate, cryptophyte, haptophyte and rhizarian phytoplankton as well as taxa from two lineages previously known to have riboswitches (green algae and stramenopiles). The predicted secondary structures bear hallmarks of TPP-sensing riboswitches. Surprisingly, most of the identified riboswitches are affiliatedmore » with genes of unknown function, rather than characterized thiamine biosynthesis genes. Using qPCR and growth experiments involving two prasinophyte algae, we show that expression of these genes increases significantly under vitamin B 1-deplete conditions relative to controls. Pathway analyses show that several algae harboring the uncharacterized genes lack one or more enzymes in the known TPP biosynthesis pathway. We demonstrate that one such alga, the major primary producer Emiliania huxleyi, grows on 4-amino-5-hydroxymethyl-2-methylpyrimidine (a thiamine precursor moiety) alone, although long thought dependent on exogenous sources of thiamine. Thus, overall, we have identified riboswitches in major eukaryotic lineages not known to undergo this form of gene regulation. In these phytoplankton groups, riboswitches are often affiliated with widespread thiamine-responsive genes with as yet uncertain roles in TPP pathways. Further, taxa with ‘incomplete’ TPP biosynthesis pathways do not necessarily require exogenous vitamin B 1, making vitamin control of phytoplankton blooms more complex than the current paradigm suggests.« less

Alternatives to vitamin B 1 uptake revealed with discovery of riboswitches in multiple marine eukaryotic lineages

DOE Office of Scientific and Technical Information (OSTI.GOV)

McRose, Darcy; Guo, Jian; Monier, Adam

Here, vitamin B 1 (thiamine pyrophosphate, TPP) is essential to all life but scarce in ocean surface waters. In many bacteria and a few eukaryotic groups thiamine biosynthesis genes are controlled by metabolite-sensing mRNA-based gene regulators known as riboswitches. Using available genome sequences and transcriptomes generated from ecologically important marine phytoplankton, we identified 31 new eukaryotic riboswitches. These were found in alveolate, cryptophyte, haptophyte and rhizarian phytoplankton as well as taxa from two lineages previously known to have riboswitches (green algae and stramenopiles). The predicted secondary structures bear hallmarks of TPP-sensing riboswitches. Surprisingly, most of the identified riboswitches are affiliatedmore » with genes of unknown function, rather than characterized thiamine biosynthesis genes. Using qPCR and growth experiments involving two prasinophyte algae, we show that expression of these genes increases significantly under vitamin B 1-deplete conditions relative to controls. Pathway analyses show that several algae harboring the uncharacterized genes lack one or more enzymes in the known TPP biosynthesis pathway. We demonstrate that one such alga, the major primary producer Emiliania huxleyi, grows on 4-amino-5-hydroxymethyl-2-methylpyrimidine (a thiamine precursor moiety) alone, although long thought dependent on exogenous sources of thiamine. Thus, overall, we have identified riboswitches in major eukaryotic lineages not known to undergo this form of gene regulation. In these phytoplankton groups, riboswitches are often affiliated with widespread thiamine-responsive genes with as yet uncertain roles in TPP pathways. Further, taxa with ‘incomplete’ TPP biosynthesis pathways do not necessarily require exogenous vitamin B 1, making vitamin control of phytoplankton blooms more complex than the current paradigm suggests.« less

Cloning and characterization of the metE gene encoding S-adenosylmethionine synthetase from Bacillus subtilis.

PubMed Central

Yocum, R R; Perkins, J B; Howitt, C L; Pero, J

1996-01-01

The metE gene, encoding S-adenosylmethionine synthetase (EC 2.5.1.6) from Bacillus subtilis, was cloned in two steps by normal and inverse PCR. The DNA sequence of the metE gene contains an open reading frame which encodes a 400-amino-acid sequence that is homologous to other known S-adenosylmethionine synthetases. The cloned gene complements the metE1 mutation and integrates at or near the chromosomal site of metE1. Expression of S-adenosylmethionine synthetase is reduced by only a factor of about 2 by exogenous methioinine. Overproduction of S-adenosylmethionine synthetase from a strong constitutive promoter leads to methionine auxotrophy in B. subtilis, suggesting that S-adenosylmethionine is a corepressor of methionine biosynthesis in B. subtilis, as others have already shown for Escherichia coli. PMID:8755891

Cloning and characterization of the metE gene encoding S-adenosylmethionine synthetase from Bacillus subtilis.

PubMed

Yocum, R R; Perkins, J B; Howitt, C L; Pero, J

1996-08-01

The metE gene, encoding S-adenosylmethionine synthetase (EC 2.5.1.6) from Bacillus subtilis, was cloned in two steps by normal and inverse PCR. The DNA sequence of the metE gene contains an open reading frame which encodes a 400-amino-acid sequence that is homologous to other known S-adenosylmethionine synthetases. The cloned gene complements the metE1 mutation and integrates at or near the chromosomal site of metE1. Expression of S-adenosylmethionine synthetase is reduced by only a factor of about 2 by exogenous methioinine. Overproduction of S-adenosylmethionine synthetase from a strong constitutive promoter leads to methionine auxotrophy in B. subtilis, suggesting that S-adenosylmethionine is a corepressor of methionine biosynthesis in B. subtilis, as others have already shown for Escherichia coli.

Postprandial antioxidant gene expression is modified by Mediterranean diet supplemented with coenzyme Q(10) in elderly men and women.

PubMed

Yubero-Serrano, Elena M; Gonzalez-Guardia, Lorena; Rangel-Zuñiga, Oriol; Delgado-Casado, Nieves; Delgado-Lista, Javier; Perez-Martinez, Pablo; Garcia-Rios, Antonio; Caballero, Javier; Marin, Carmen; Gutierrez-Mariscal, Francisco M; Tinahones, Francisco J; Villalba, Jose M; Tunez, Isaac; Perez-Jimenez, Francisco; Lopez-Miranda, Jose

2013-02-01

Postprandial oxidative stress is characterized by an increased susceptibility of the organism towards oxidative damage after consumption of a meal rich in lipids and/or carbohydrates. We have investigated whether the quality of dietary fat alters postprandial gene expression and protein levels involved in oxidative stress and whether the supplementation with coenzyme Q(10) (CoQ) improves this situation in an elderly population. Twenty participants were randomized to receive three isocaloric diets each for 4 weeks: Mediterranean diet supplemented with CoQ (Med + CoQ diet), Mediterranean diet (Med diet), saturated fatty acid-rich diet (SFA diet). After 12-h fast, volunteers consumed a breakfast with a fat composition similar to that consumed in each of the diets. Nrf2, p22(phox) and p47(phox), superoxide dismutase 1 and 2 (SOD1 and SOD2), glutathione peroxidase 1 (GPx1), thiorredoxin reductase (TrxR) gene expression and Kelch-like ECH associating protein 1 (Keap-1) and citoplasmic and nuclear Nrf2 protein levels were determined. Med and Med + CoQ diets induced lower Nrf2, p22(phox), p47(phox), SOD1, SOD2 and TrxR gene expression and higher cytoplasmic Nrf2 and Keap-1 protein levels compared to the SFA diet. Moreover, Med + CoQ diet produced lower postprandial Nrf2 gene expression and lower nuclear Nrf2 protein levels compared to the other diets and lower GPx1 gene expression than the SFA diet. Our results support the antioxidant effect of a Med diet and that exogenous CoQ supplementation has a protective effects against free radical overgeneration through the lowering of postprandial oxidative stress modifying the postprandial antioxidant protein levels and reducing the postprandial expression of antioxidant genes in peripheral blood mononuclear cells.

Identification and expression analysis of ERF transcription factor genes in petunia during flower senescence and in response to hormone treatments.

PubMed

Liu, Juanxu; Li, Jingyu; Wang, Huinan; Fu, Zhaodi; Liu, Juan; Yu, Yixun

2011-01-01

Ethylene-responsive element-binding factor (ERF) genes constitute one of the largest transcription factor gene families in plants. In Arabidopsis and rice, only a few ERF genes have been characterized so far. Flower senescence is associated with increased ethylene production in many flowers. However, the characterization of ERF genes in flower senescence has not been reported. In this study, 13 ERF cDNAs were cloned from petunia. Based on the sequence characterization, these PhERFs could be classified into four of the 12 known ERF families. Their predicted amino acid sequences exhibited similarities to ERFs from other plant species. Expression analyses of PhERF mRNAs were performed in corollas and gynoecia of petunia flower. The 13 PhERF genes displayed differential expression patterns and levels during natural flower senescence. Exogenous ethylene accelerates the transcription of the various PhERF genes, and silver thiosulphate (STS) decreased the transcription of several PhERF genes in corollas and gynoecia. PhERF genes of group VII showed a strong association with the rise in ethylene production in both petals and gynoecia, and might be associated particularly with flower senescence in petunia. The effect of sugar, methyl jasmonate, and the plant hormones abscisic acid, salicylic acid, and 6-benzyladenine in regulating the different PhERF transcripts was investigated. Functional nuclear localization signal analyses of two PhERF proteins (PhERF2 and PhERF3) were carried out using fluorescence microscopy. These results supported a role for petunia PhERF genes in transcriptional regulation of petunia flower senescence processes.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Effect of early addition of bone morphogenetic protein 5 (BMP5) to embryo culture medium on in vitro development and expression of developmentally important genes in bovine preimplantation embryos.

PubMed

García, Elina V; Miceli, Dora C; Rizo, Gabriela; Valdecantos, Pablo A; Barrera, Antonio D

2015-09-01

Previous studies have reported that bone morphogenetic protein 5 (BMP5) is differentially expressed in the isthmus of bovine oviducts and it is present in the oviductal fluid. However, the specific action of this factor is unknown. To evaluate whether BMP5 exerts some effect during early bovine embryo development, gene expression of BMP5, BMP receptors, and the effect of exogenous BMP5 on in vitro development and expression of developmentally important genes were assessed. In experiment 1, pools of embryos at two-cell, four-cell, eight-cell, and blastocyst stages, derived from in vitro fertilization, were collected for analysis of BMP5 and BMP receptors (BMPR1A, BMPR1B, and BMPR2) messenger RNA (mRNA) expression. On the basis of previous results, in experiment 2, presumptive zygotes were cultured for the first 48 hours after insemination in CR1aa medium assaying three different treatments: (1) control (CR1aa); (2) vehicle control (CR1aa + 0.04 mM HCl), and (3) BMP5 treatment (CR1aa + 100 ng/mL of BMP5). The cleavage rate was evaluated 48 hours after insemination (Day 2), and then, embryos were transferred to CR1aa + 10% fetal bovine serum. The blastocyst rate was determined on Day 7. In experiment 3, pools of embryos at two-cell, four-cell, eight-cell, and blastocyst stages, derived from control and BMP5-treated groups, were collected for analysis of ID2 (BMP target gene), OCT4, NANOG, and SOX2 (pluripotency genes) mRNA expression. BMP5 transcripts were not detectable in any of the embryonic stages examined, whereas the relative mRNA abundance of the three BMP receptors analyzed was greater in early embryo development stages before maternal-embryonic transition, raising the possibility of a direct effect of exogenous BMPs on the embryo during the first developmental period. Although early addition of 100 ng/mL of BMP5 to the embryo culture medium had no effect on the cleavage rate, a significantly higher proportion of cleaved embryos developed to the blastocyst stage in the BMP5 group. Moreover, reverse transcription quantitative real-time polymerase chain reaction analysis showed a significant increase in the relative abundance of SOX2 in two-cell stage embryos, ID2 and OCT4 in eight-cell stage embryos, and NANOG and OCT4 in blastocysts derived from BMP5-treated embryos. In conclusion, our results report that early addition of BMP5 to the embryo culture medium had a positive effect on the blastocyst rate and affected the relative expression of BMP target and pluripotency genes, suggesting that BMP5 could play an important role in the preimplantation development of bovine embryos. Copyright © 2015 Elsevier Inc. All rights reserved.

GLUT3 gene expression is critical for embryonic growth, brain development and survival.

PubMed

Carayannopoulos, Mary O; Xiong, Fuxia; Jensen, Penny; Rios-Galdamez, Yesenia; Huang, Haigen; Lin, Shuo; Devaskar, Sherin U

2014-04-01

Glucose is the primary energy source for eukaryotic cells and the predominant substrate for the brain. GLUT3 is essential for trans-placental glucose transport and highly expressed in the mammalian brain. To further elucidate the role of GLUT3 in embryonic development, we utilized the vertebrate whole animal model system of Danio rerio as a tractable system for defining the cellular and molecular mechanisms altered by impaired glucose transport and metabolism related to perturbed expression of GLUT3. The comparable orthologue of human GLUT3 was identified and the expression of this gene abrogated during early embryonic development. In a dose-dependent manner embryonic brain development was disrupted resulting in a phenotype of aberrant brain organogenesis, associated with embryonic growth restriction and increased cellular apoptosis. Rescue of the morphant phenotype was achieved by providing exogenous GLUT3 mRNA. We conclude that GLUT3 is critically important for brain organogenesis and embryonic growth. Disruption of GLUT3 is responsible for the phenotypic spectrum of embryonic growth restriction to demise and neural apoptosis with microcephaly. Copyright © 2014 Elsevier Inc. All rights reserved.

MOF Acetylates the Histone Demethylase LSD1 to Suppress Epithelial-to-Mesenchymal Transition.

PubMed

Luo, Huacheng; Shenoy, Anitha K; Li, Xuehui; Jin, Yue; Jin, Lihua; Cai, Qingsong; Tang, Ming; Liu, Yang; Chen, Hao; Reisman, David; Wu, Lizi; Seto, Edward; Qiu, Yi; Dou, Yali; Casero, Robert A; Lu, Jianrong

2016-06-21

The histone demethylase LSD1 facilitates epithelial-to-mesenchymal transition (EMT) and tumor progression by repressing epithelial marker expression. However, little is known about how its function may be modulated. Here, we report that LSD1 is acetylated in epithelial but not mesenchymal cells. Acetylation of LSD1 reduces its association with nucleosomes, thus increasing histone H3K4 methylation at its target genes and activating transcription. The MOF acetyltransferase interacts with LSD1 and is responsible for its acetylation. MOF is preferentially expressed in epithelial cells and is downregulated by EMT-inducing signals. Expression of exogenous MOF impedes LSD1 binding to epithelial gene promoters and histone demethylation, thereby suppressing EMT and tumor invasion. Conversely, MOF depletion enhances EMT and tumor metastasis. In human cancer, high MOF expression correlates with epithelial markers and a favorable prognosis. These findings provide insight into the regulation of LSD1 and EMT and identify MOF as a critical suppressor of EMT and tumor progression. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

GLUT3 Gene Expression is Critical for Embryonic Growth, Brain Development and Survival

PubMed Central

Carayannopoulos, Mary O.; Xiong, Fuxia; Jensen, Penny; Rios-Galdamez, Yesenia; Huang, Haigen; Lin, Shuo; Devaskar, Sherin U.

2015-01-01

Glucose is the primary energy source for eukaryotic cells and the predominant substrate for the brain. GLUT3 is essential for trans-placental glucose transport and highly expressed in the mammalian brain. To further elucidate the role of GLUT3 in embryonic development, we utilized the vertebrate whole animal model system of Danio rerio as a tractable system for defining the cellular and molecular mechanisms altered by impaired glucose transport and metabolism related to perturbed expression of GLUT3. The comparable orthologue of human GLUT3 was identified and the expression of this gene abrogated during early embryonic development. In a dose-dependent manner embryonic brain development was disrupted resulting in a phenotype of aberrant brain organogenesis, associated with embryonic growth restriction and increased cellular apoptosis. Rescue of the morphant phenotype was achieved by providing exogenous GLUT3 mRNA. We conclude that GLUT3 is critically important for brain organogenesis and embryonic growth. Disruption of GLUT3 is responsible for the phenotypic spectrum of embryonic growth restriction to demise and neural apoptosis with microcephaly. PMID:24529979

The novel ethylene-responsive factor CsERF025 affects the development of fruit bending in cucumber.

PubMed

Wang, Chunhua; Xin, Ming; Zhou, Xiuyan; Liu, Chunhong; Li, Shengnan; Liu, Dong; Xu, Yuan; Qin, Zhiwei

2017-11-01

Overexpression of CsERF025 induces fruit bending by promoting the production of ethylene. Cucumber fruit bending critically affects cucumber quality, but the mechanism that causes fruit bending remains unclear. To better understand this mechanism, we performed transcriptome analyses on tissues from the convex (C1) and concave (C2) sides of bending and straight (S) fruit at 2 days post anthesis (DPA). We identified a total of 281 differentially expressed genes (DEGs) from both the convex and concave sides of bent fruit that showed significantly different expression profiles relative to straight fruits. Of these 281 DEGs, 196 were up-regulated (C1/S_C2/S) and 85 were down-regulated (C1/S_C2/S). Among the 196 up-regulated DEGs, the transcriptional levels of genes related to ethylene biosynthesis and signaling pathways were significantly higher in bending fruit compared with straight fruit. CsERF025 showed the largest difference in expression between bending and straight fruit. CsERF025 is an AP2/ERF gene encoding a protein that localizes to the nucleus. Overexpression of this gene increased the bending rate of cucumber fruits and increased the angle of bending. CsERF025 increased both the expression of ethylene biosynthesis-related genes and the production of ethylene. The application of exogenous 1-aminocyclopropane-l-carboxylic acid (ACC) to straight fruits from control plants promoted fruit bending. Thus, CsERF025 enhances the production of ethylene and thereby promotes fruit bending in cucumber.

The metabolic trinity, glucose-glycogen-lactate, links astrocytes and neurons in brain energetics, signaling, memory, and gene expression.

PubMed

Dienel, Gerald A

2017-01-10

Glucose, glycogen, and lactate are traditionally identified with brain energetics, ATP turnover, and pathophysiology. However, recent studies extend their roles to include involvement in astrocytic signaling, memory consolidation, and gene expression. Emerging roles for these brain fuels and a readily-diffusible by-product are linked to differential fluxes in glycolytic and oxidative pathways, astrocytic glycogen dynamics, redox shifts, neuron-astrocyte interactions, and regulation of astrocytic activities by noradrenaline released from the locus coeruleus. Disproportionate utilization of carbohydrate compared with oxygen during brain activation is influenced by catecholamines, but its physiological basis is not understood and its magnitude may be affected by technical aspects of metabolite assays. Memory consolidation and gene expression are impaired by glycogenolysis blockade, and prevention of these deficits by injection of abnormally-high concentrations of lactate was interpreted as a requirement for astrocyte-to-neuron lactate shuttling in memory and gene expression. However, lactate transport was not measured and evidence for presumed shuttling is not compelling. In fact, high levels of lactate used to preserve memory consolidation and induce gene expression are sufficient to shut down neuronal firing via the HCAR1 receptor. In contrast, low lactate levels activate a receptor in locus coeruleus that stimulates noradrenaline release that may activate astrocytes throughout brain. Physiological relevance of exogenous concentrations of lactate used to mimic and evaluate metabolic, molecular, and behavioral effects of lactate requires close correspondence with the normal lactate levels, the biochemical and cellular sources and sinks, and specificity of lactate delivery to target cells. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

PubMed

de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

2010-09-20

Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression profile obtained using the genes suggested by the algorithms, H2B and TUA were considered as the most suitable reference genes for expression studies in E. globulus adventitious rooting. UBI and 18S were unsuitable for use as controls in qPCR related to this process. These findings will enable more accurate and reliable normalization of qPCR results for gene expression studies in this economically important woody plant, particularly related to rooting and clonal propagation.

Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill

PubMed Central

2010-01-01

Background Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. Results By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs indentified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Conclusion Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression profile obtained using the genes suggested by the algorithms, H2B and TUA were considered as the most suitable reference genes for expression studies in E. globulus adventitious rooting. UBI and 18S were unsuitable for use as controls in qPCR related to this process. These findings will enable more accurate and reliable normalization of qPCR results for gene expression studies in this economically important woody plant, particularly related to rooting and clonal propagation. PMID:20854682

BAC mediated transgenic Large White boars with FSHα/β genes from Chinese Erhualian pigs.

PubMed

Xu, Pan; Li, Qiuyan; Jiang, Kai; Yang, Qiang; Bi, Mingjun; Jiang, Chao; Wang, Xiaopeng; Wang, Chengbin; Li, Longyun; Qiao, Chuanmin; Gong, Huanfa; Xing, Yuyun; Ren, Jun

2016-10-01

Follicle-stimulating hormone (FSH) is a critical hormone regulating reproduction in mammals. Transgenic mice show that overexpression of FSH can improve female fecundity. Using a bacterial artificial chromosome (BAC) system and somatic cell nuclear transfer, we herein generated 67 Large White transgenic (TG) boars harboring FSHα/β genes from Chinese Erhualian pigs, the most prolific breed in the world. We selected two F0 TG boars for further breeding and conducted molecular characterization and biosafety assessment for F1 boars. We showed that 8-9 copies of exogenous FSHα and 5-6 copies of exogenous FSHβ were integrated into the genome of transgenic pigs. The inheritance of exogenous genes conforms to the Mendel's law of segregation. TG boars had higher levels of serum FSH, FSHα mRNA in multiple tissues, FSHβ protein in pituitary and more germ cells per seminiferous tubule compared with their wild-type half sibs without any reproductive defects. Analysis of growth curve, hematological and biochemical parameters and histopathology illustrated that TG boars grew healthily and normally. By applying 16S rRNA gene sequencing, we demonstrated that exogenous genes had no impact on the bacterial community structures of pig guts. Moreover, foreign gene drift did not occur as verified by horizontal gene transfer. Our findings indicate that overexpression of FSH could improve spermatogenesis ability of boars. This work provides insight into the effect of FSHα/β genes on male reproductive performance on pigs by a BAC-mediated transgenic approach.

Concepts in Gene Therapy for Cartilage Repair

PubMed Central

Steinert, Andre F.; Nöth, Ulrich; Tuan, Rocky S.

2009-01-01

Summary Once articular cartilage is injured, it has a very limited capacity for self-repair. Although current surgical therapeutic procedures to cartilage repair are clinically useful, they cannot restore a normal articular surface. Current research offers a growing number of bioactive reagents, including proteins and nucleic acids, that may be used to augment different aspects of the repair process. As these agents are difficult to administer effectively, gene transfer approaches are being developed to provide their sustained synthesis at sites of repair. To augment regeneration of articular cartilage, therapeutic genes can be delivered to the synovium, or directly to the cartilage lesion. Gene delivery to the cells of the synovial lining is generally considered more suitable for chondroprotective approaches, based on the expression of anti-inflammatory mediators. Gene transfer targeted to cartilage defects can be achieved by either direct vector administration to cells located at or surrounding the defects, or by transplantation of genetically modified chondrogenic cells into the defect. Several studies have shown that exogenous cDNAs encoding growth factors can be delivered locally to sites of cartilage damage, where they are expressed at therapeutically relevant levels. Furthermore, data is beginning to emerge indicating, that efficient delivery and expression of these genes is capable of influencing a repair response toward the synthesis of a more hyaline cartilage repair tissue in vivo. This review presents the current status of gene therapy for cartilage healing and highlights some of the remaining challenges. PMID:18313477

Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis

NASA Technical Reports Server (NTRS)

Brandstatter, I.; Kieber, J. J.; Evans, M. L. (Principal Investigator)

1998-01-01

Cytokinins are central regulators of plant growth and development, but little is known about their mode of action. By using differential display, we identified a gene, IBC6 (for induced by cytokinin), from etiolated Arabidopsis seedlings, that is induced rapidly by cytokinin. The steady state level of IBC6 mRNA was elevated within 10 min by the exogenous application of cytokinin, and this induction did not require de novo protein synthesis. IBC6 was not induced by other plant hormones or by light. A second Arabidopsis gene with a sequence highly similar to IBC6 was identified. This IBC7 gene also was induced by cytokinin, although with somewhat slower kinetics and to a lesser extent. The pattern of expression of the two genes was similar, with higher expression in leaves, rachises, and flowers and lower transcript levels in roots and siliques. Sequence analysis revealed that IBC6 and IBC7 are similar to the receiver domain of bacterial two-component response regulators. This homology, coupled with previously published work on the CKI1 histidine kinase homolog, suggests that these proteins may play a role in early cytokinin signaling.

Identification of potential biophysical and molecular signalling mechanisms underlying hyaluronic acid enhancement of cartilage formation

PubMed Central

Responte, Donald J.; Natoli, Roman M.; Athanasiou, Kyriacos A.

2012-01-01

This study determined the effects of exogenous hyaluronic acid (HA) on the biomechanical and biochemical properties of self-assembled bovine chondrocytes, and investigated biophysical and genetic mechanisms underlying these effects. The effects of HA commencement time, concentration, application duration and molecular weight were examined using histology, biomechanics and biochemistry. Additionally, the effects of HA application on sulphated glycosaminoglycan (GAG) retention were assessed. To investigate the influence of HA on gene expression, microarray analysis was conducted. HA treatment of developing neocartilage increased compressive stiffness onefold and increased sulphated GAG content by 35 per cent. These effects were dependent on HA molecular weight, concentration and application commencement time. Additionally, applying HA increased sulphated GAG retention within self-assembled neotissue. HA administration also upregulated 503 genes, including multiple genes associated with TGF-β1 signalling. Increased sulphated GAG retention indicated that HA could enhance compressive stiffness by increasing the osmotic pressure that negatively charged GAGs create. The gene expression data demonstrate that HA treatment differentially regulates genes related to TGF-β1 signalling, revealing a potential mechanism for altering matrix composition. These results illustrate the potential use of HA to improve cartilage regeneration efforts and better understand cartilage development. PMID:22809846

Identification of bottlenecks in Escherichia coli engineered for the production of CoQ(10).

PubMed

Cluis, Corinne P; Ekins, Andrew; Narcross, Lauren; Jiang, Heng; Gold, Nicholas D; Burja, Adam M; Martin, Vincent J J

2011-11-01

In this work, Escherichia coli was engineered to produce a medically valuable cofactor, coenzyme Q(10) (CoQ(10)), by removing the endogenous octaprenyl diphosphate synthase gene and functionally replacing it with a decaprenyl diphosphate synthase gene from Sphingomonas baekryungensis. In addition, by over-expressing genes coding for rate-limiting enzymes of the aromatic pathway, biosynthesis of the CoQ(10) precursor para-hydroxybenzoate (PHB) was increased. The production of isoprenoid precursors of CoQ(10) was also improved by the heterologous expression of a synthetic mevalonate operon, which permits the conversion of exogenously supplied mevalonate to farnesyl diphosphate. The over-expression of these precursors in the CoQ(10)-producing E. coli strain resulted in an increase in CoQ(10) content, as well as in the accumulation of an intermediate of the ubiquinone pathway, decaprenylphenol (10P-Ph). In addition, the over-expression of a PHB decaprenyl transferase (UbiA) encoded by a gene from Erythrobacter sp. NAP1 was introduced to direct the flux of DPP and PHB towards the ubiquinone pathway. This further increased CoQ(10) content in engineered E. coli, but decreased the accumulation of 10P-Ph. Finally, we report that the combined over-production of isoprenoid precursors and over-expression of UbiA results in the decaprenylation of para-aminobenzoate, a biosynthetic precursor of folate, which is structurally similar to PHB. Copyright © 2011 Elsevier Inc. All rights reserved.

Identification, expression and tissue distribution of a renalase homologue from mouse.

PubMed

Wang, Jian; Qi, Shaoling; Cheng, Wei; Li, Li; Wang, Fu; Li, Ying-Zi; Zhang, Shu-Ping

2008-12-01

FAD (flavin adenine dinucleotide)-dependent monoamine oxidases play very important roles in many biological processes. A novel monoamine oxidase, named renalase, has been identified in human kidney recently and is found to be markedly reduced in patients with end-stage renal disease (ESRD). Here, we reported the identification of a renalase homologue from mouse, termed mMAO-C (mouse monoamine oxidase-C) after the monoamine oxidase-A and -B (MAO-A and -B). This gene locates on the mouse chromosome 19C1 and its coding region spans 7 exons. The deuced amino acid sequences were predicted to contain a typical secretive signal peptide and a conserved amine oxidase domain. Phylogenetic analysis and multiple sequences alignment indicated that mMAO-C-like sequences exist in all examined species and share significant similarities. This gene has been submitted to the NCBI GenBank database (Accession number: DQ788834). With expression vectors generated from the cloned mMAO-C gene, exogenous protein was effectively expressed in both prokaryotic and eukaryotic cells. Recombinant mMAO-C protein was secreted out of human cell lines, indicating the biological function of its signal peptide. Moreover, tissue expression pattern analysis revealed that mMAO-C gene is predominantly expressed in the mouse kidney and testicle, which implies that kidney and testicle are the main sources of renalase secretion. Shortly, this study provides an insight into understanding the physiological and biological functions of mMAO-C and its homologues in endocrine.

Selecting antagonistic antibodies that control differentiation through inducible expression in embryonic stem cells

PubMed Central

Melidoni, Anna N.; Dyson, Michael R.; Wormald, Sam; McCafferty, John

2013-01-01

Antibodies that modulate receptor function have great untapped potential in the control of stem cell differentiation. In contrast to many natural ligands, antibodies are stable, exquisitely specific, and are unaffected by the regulatory mechanisms that act on natural ligands. Here we describe an innovative system for identifying such antibodies by introducing and expressing antibody gene populations in ES cells. Following induced antibody expression and secretion, changes in differentiation outcomes of individual antibody-expressing ES clones are monitored using lineage-specific gene expression to identify clones that encode and express signal-modifying antibodies. This in-cell expression and reporting system was exemplified by generating blocking antibodies to FGF4 and its receptor FGFR1β, identified through delayed onset of ES cell differentiation. Functionality of the selected antibodies was confirmed by addition of exogenous antibodies to three different ES reporter cell lines, where retained expression of pluripotency markers Oct4, Nanog, and Rex1 was observed. This work demonstrates the potential for discovery and utility of functional antibodies in stem cell differentiation. This work is also unique in constituting an example of ES cells carrying an inducible antibody that causes a functional protein “knock-down” and allows temporal control of stable signaling components at the protein level. PMID:24082130

Differential expression of fatty acid transporters and fatty acid synthesis-related genes in crop tissues of male and female pigeons (Columba livia domestica) during incubation and chick rearing.

PubMed

Xie, Peng; Wang, Xue-Ping; Bu, Zhu; Zou, Xiao-Ting

2017-10-01

1. The growth performance of squabs reared solely by male or female parent pigeons was measured, and the changes of lipid content of crop milk and the expression profiles of genes potentially involved in lipid accumulation by crop tissues of parent pigeons were evaluated during incubation and chick rearing. 2. Squabs increased in body weight during 25 d of rearing, whereas both male and female pigeons lost weight after finishing rearing chicks, and the weight loss of male pigeons was significantly greater than that of female parent pigeons. Lipid content of crop milk from both parent pigeons gradually decreased to the crude fat level in the formulated diet after 10 d (R10) of chick rearing. 3. The gene expression of fatty acid translocase (FAT/CD36), fatty acid-binding protein 5 (EFABP) and acyl-CoA-binding protein (ACBP) in male pigeon crop tissue were the greatest at 17 d (I17) of incubation. In female pigeons, FAT/CD36 expression was the highest at I14, and both EFABP and ACBP expression peaked at I14 and R7. The expression of acetyl-CoA carboxylase and fatty acid synthase in male pigeons reached the maximum level at R1, while they peaked at I14 and I17, respectively in female pigeons. The gene expression of peroxisome proliferators-activated receptor-gamma (PPARγ) was the greatest at I17 in the male, while it was at I14 in the female. However, no regular changing pattern was found in PPARα gene expression in male pigeons. 4. These results indicated that male and female pigeons may make different contributions in rearing squabs. The gene expression study suggested that fatty acids used in lipid biosynthesis of crop milk probably originated from both exogenous supply and de novo synthesis. The sex of the parent pigeon affected the lipid content of crop milk and the expression profiles of genes involved in fatty acid transportation and lipogenesis.

Remission of Diabetes by Insulin Gene Therapy Using a Hepatocyte-specific and Glucose-responsive Synthetic Promoter

PubMed Central

Han, Jaeseok; McLane, Brienne; Kim, Eung-Hwi; Yoon, Ji-Won; Jun, Hee-Sook

2011-01-01

Efficient production of insulin in response to changes in glucose levels has been a major issue for insulin gene therapy to treat diabetes. To express target genes in response to glucose specifically in hepatocytes, we generated a synthetic promoter library containing hepatocyte nuclear factor-1, CAAT/enhancer-binding protein (C/EBP) response element, and glucose-response element. Combinations of these three cis-elements in 3-, 6-, or 9-element configurations were screened for transcriptional activity and then glucose responsiveness in vitro. The most effective promoter (SP23137) was selected for further study. Intravenous administration of a recombinant adenovirus expressing furin-cleavable rat insulin under control of the SP23137 promoter into streptozotocin (STZ)-induced diabetic mice resulted in normoglycemia, which was maintained for >30 days. Glucose tolerance tests showed that treated mice produced insulin in response to glucose and cleared exogenous glucose from the blood in a manner similar to nondiabetic control mice, although the clearance was somewhat delayed. Insulin expression was seen specifically in the liver and not in other organs. These observations indicate the potential of this synthetic, artificial promoter to regulate glucose-responsive insulin production and remit hyperglycemia, thus providing a new method of liver-directed insulin gene therapy for type 1 diabetes. PMID:21119621

Remission of diabetes by insulin gene therapy using a hepatocyte-specific and glucose-responsive synthetic promoter.

PubMed

Han, Jaeseok; McLane, Brienne; Kim, Eung-Hwi; Yoon, Ji-Won; Jun, Hee-Sook

2011-03-01

Efficient production of insulin in response to changes in glucose levels has been a major issue for insulin gene therapy to treat diabetes. To express target genes in response to glucose specifically in hepatocytes, we generated a synthetic promoter library containing hepatocyte nuclear factor-1, CAAT/enhancer-binding protein (C/EBP) response element, and glucose-response element. Combinations of these three cis-elements in 3-, 6-, or 9-element configurations were screened for transcriptional activity and then glucose responsiveness in vitro. The most effective promoter (SP23137) was selected for further study. Intravenous administration of a recombinant adenovirus expressing furin-cleavable rat insulin under control of the SP23137 promoter into streptozotocin (STZ)-induced diabetic mice resulted in normoglycemia, which was maintained for >30 days. Glucose tolerance tests showed that treated mice produced insulin in response to glucose and cleared exogenous glucose from the blood in a manner similar to nondiabetic control mice, although the clearance was somewhat delayed. Insulin expression was seen specifically in the liver and not in other organs. These observations indicate the potential of this synthetic, artificial promoter to regulate glucose-responsive insulin production and remit hyperglycemia, thus providing a new method of liver-directed insulin gene therapy for type 1 diabetes.

Expression of the 1-SST and 1-FFT genes and consequent fructan accumulation in Agave tequilana and A. inaequidens is differentially induced by diverse (a)biotic-stress related elicitors.

PubMed

Suárez-González, Edgar Martín; López, Mercedes G; Délano-Frier, John P; Gómez-Leyva, Juan Florencio

2014-02-15

The expression of genes coding for sucrose:sucrose 1-fructosyltransferase (1-SST; EC 2.4.1.99) and fructan:fructan 1-fructosyltransferase (1-FFT; EC 2.4.1.100), both fructan biosynthesizing enzymes, characterization by TLC and HPAEC-PAD, as well as the quantification of the fructo-oligosaccharides (FOS) accumulating in response to the exogenous application of sucrose, kinetin (cytokinin) or other plant hormones associated with (a)biotic stress responses were determined in two Agave species grown in vitro, domesticated Agave tequilana var. azul and wild A. inaequidens. It was found that elicitors such as salicylic acid (SA), and jasmonic acid methyl ester (MeJA) had the strongest effect on fructo-oligosaccharide (FOS) accumulation. The exogenous application of 1mM SA induced a 36-fold accumulation of FOS of various degrees of polymerization (DP) in stems of A. tequilana. Other treatments, such as 50mM abscisic acid (ABA), 8% Sucrose (Suc), and 1.0 mg L(-1) kinetin (KIN) also led to a significant accumulation of low and high DP FOS in this species. Conversely, treatment with 200 μM MeJA, which was toxic to A. tequilana, induced an 85-fold accumulation of FOS in the stems of A. inaequidens. Significant FOS accumulation in this species also occurred in response to treatments with 1mM SA, 8% Suc, and 10% polyethylene glycol (PEG). Maximum yields of 13.6 and 8.9 mg FOS per g FW were obtained in stems of A. tequilana and A. inaequidens, respectively. FOS accumulation in the above treatments was tightly associated with increased expression levels of either the 1-FFT or the 1-SST gene in tissues of both Agave species. Copyright © 2013 Elsevier GmbH. All rights reserved.

A Novel Dwarfism with Gonadal Dysfunction Due to Loss-of-Function Allele of the Collagen Receptor Gene, Ddr2, in the Mouse

PubMed Central

Kano, Kiyoshi; Marín de Evsikova, C.; Young, James; Wnek, Christopher; Maddatu, Terry P.; Nishina, Patsy M.; Naggert, Jürgen K.

2008-01-01

Smallie (slie), a spontaneous, autosomal-recessive mutation causes dwarfing and infertility in mice. The purpose of this study was to determine and characterize the underlying molecular genetic basis for its phenotype. The slie locus was mapped to chromosome 1, and fine-structure mapping narrowed the slie allele within 2 Mb between genetic markers D1Mit36 and Mpz. To pinpoint the underlying mutation quantitative real-time PCR was used to measure the relative expression levels for the genes residing within this region. Expression of one gene, Ddr2, which encodes discoidin domain receptor 2 (DDR2), was absent in slie homozygote mice. Genomic sequencing analysis detected a 150-kb deletion that extended into the Ddr2 gene transcript. Detailed phenotype analysis revealed that gonadal dysregulation underlies infertility in slie mice because all females were anovulatory and most adult males lacked spermatogenesis. The pituitary gland of prepubertal slie mice was smaller than in wild-type mice. The basal levels and gene expression for pituitary and hypothalamic hormones, and gene expression for hypothalamic-releasing hormones, were not significantly different between slie and wild-type mice. Circulating levels of IGF-1 did not differ in slie mice despite lower Igf-1 mRNA expression in the liver. After exogenous gonadotropin administration, the levels of secreted steroid hormones in both male and female adult slie mice were blunted compared to adult wild-type, but was similar to prepubertal wild-type mice. Taken together, our results indicate that the absence of DDR2 leads to growth retardation and gonadal dysfunction due to peripheral defects in hormonal-responsive pathways in slie mice. PMID:18483174

Ectopic expression of UGT84A2 delayed flowering by indole-3-butyric acid-mediated transcriptional repression of ARF6 and ARF8 genes in Arabidopsis.

PubMed

Zhang, Gui-Zhi; Jin, Shang-Hui; Li, Pan; Jiang, Xiao-Yi; Li, Yan-Jie; Hou, Bing-Kai

2017-12-01

Ectopic expression of auxin glycosyltransferase UGT84A2 in Arabidopsis can delay flowering through increased indole-3-butyric acid and suppressed transcription of ARF6, ARF8 and flowering-related genes FT, SOC1, AP1 and LFY. Auxins are critical regulators for plant growth and developmental processes. Auxin homeostasis is thus an important issue for plant biology. Here, we identified an indole-3-butyric acid (IBA)-specific glycosyltransferase, UGT84A2, and characterized its role in Arabidopsis flowering development. UGT84A2 could catalyze the glycosylation of IBA, but not indole-3-acetic acid (IAA). UGT84A2 transcription expression was clearly induced by IBA. When ectopically expressing in Arabidopsis, UGT84A2 caused obvious delay in flowering. Correspondingly, the increase of IBA level, the down-regulation of AUXIN RESPONSE FACTOR 6 (ARF6) and ARF8, and the down-regulation of flowering-related genes such as FLOWERING LOCUS T (FT), SUPPRESSOR OF OVEREXPRESSION OF CO1(SOC1), APETALA1 (AP1), and LEAFY(LFY) were observed in transgenic plants. When exogenously applying IBA to wild-type plants, the late flowering phenotype, the down-regulation of ARF6, ARF8 and flowering-related genes recurred. We examined the arf6arf8 double mutants and found that the expression of flowering-related genes was also substantially decreased in these mutants. Together, our results suggest that glycosyltransferase UGT84A2 may be involved in flowering regulation through indole-3-butyric acid-mediated transcriptional repression of ARF6, ARF8 and downstream flowering pathway genes.

In vivo gene expression profiling of the entomopathogenic fungus Beauveria bassiana elucidates its infection stratagems in Anopheles mosquito.

PubMed

Lai, Yiling; Chen, Huan; Wei, Ge; Wang, Guandong; Li, Fang; Wang, Sibao

2017-08-01

The use of entomopathogenic fungi to control mosquitoes is a promising tool for reducing vector-borne disease transmission. To better understand infection stratagems of insect pathogenic fungi, we analyzed the global gene expression profiling of Beauveria bassiana at 36, 60, 84 and 108 h after topical infection of Anopheles stephensi adult mosquitoes using RNA sequencing (RNA-Seq). A total of 5,354 differentially expressed genes (DEGs) are identified over the course of fungal infection. When the fungus grows on the mosquito cuticle, up-regulated DEGs include adhesion-related genes involved in cuticle attachment, Pth11-like GPCRs hypothesized to be involved in host recognition, and extracellular enzymes involved in the degradation and penetration of the mosquito cuticle. Once in the mosquito hemocoel, the fungus evades mosquito immune system probably through up-regulating expression of β-1,3-glucan degrading enzymes and chitin synthesis enzymes for remodeling of cell walls. Moreover, six previous unknown SSCP (small secreted cysteine-rich proteins) are significantly up-regulated, which may serve as "effectors" to suppress host defense responses. B. bassiana also induces large amounts of antioxidant genes to mitigate host-generated exogenous oxidative stress. At late stage of infection, B. bassiana activates a broad spectrum of genes including nutrient degrading enzymes, some transporters and metabolism pathway components, to exploit mosquito tissues and hemolymph as a nutrient source for hyphal growth. These findings establish an important framework of knowledge for further comprehensive elucidation of fungal pathogenesis and molecular mechanism of Beauveria-mosquito interactions.

De novo characterization of Larix gmelinii (Rupr.) Rupr. transcriptome and analysis of its gene expression induced by jasmonates.

PubMed

Men, Lina; Yan, Shanchun; Liu, Guanjun

2013-08-13

Larix gmelinii is a dominant tree species in China's boreal forests and plays an important role in the coniferous ecosystem. It is also one of the most economically important tree species in the Chinese timber industry due to excellent water resistance and anti-corrosion of its wood products. Unfortunately, in Northeast China, L. gmelinii often suffers from serious attacks by diseases and insects. The application of exogenous volatile semiochemicals may induce and enhance its resistance against insect or disease attacks; however, little is known regarding the genes and molecular mechanisms related to induced resistance. We performed de novo sequencing and assembly of the L. gmelinii transcriptome using a short read sequencing technology (Illumina). Chemical defenses of L. gmelinii seedlings were induced with jasmonic acid (JA) or methyl jasmonate (MeJA) for 6 hours. Transcriptomes were compared between seedlings induced by JA, MeJA and untreated controls using a tag-based digital gene expression profiling system. In a single run, 25,977,782 short reads were produced and 51,157 unigenes were obtained with a mean length of 517 nt. We sequenced 3 digital gene expression libraries and generated between 3.5 and 5.9 million raw tags, and obtained 52,040 reliable reference genes after removing redundancy. The expression of disease/insect-resistance genes (e.g., phenylalanine ammonialyase, coumarate 3-hydroxylase, lipoxygenase, allene oxide synthase and allene oxide cyclase) was up-regulated. The expression profiles of some abundant genes under different elicitor treatment were studied by using real-time qRT-PCR.The results showed that the expression levels of disease/insect-resistance genes in the seedling samples induced by JA and MeJA were higher than those in the control group. The seedlings induced with MeJA elicited the strongest increases in disease/insect-resistance genes. Both JA and MeJA induced seedlings of L. gmelinii showed significantly increased expression of disease/insect-resistance genes. MeJA seemed to have a stronger induction effect than JA on expression of disease/insect-resistance related genes. This study provides sequence resources for L. gmelinii research and will help us to better understand the functions of disease/insect-resistance genes and the molecular mechanisms of secondary metabolisms in L. gmelinii.

Emodin Inhibits Migration and Invasion of Human Endometrial Stromal Cells by Facilitating the Mesenchymal-Epithelial Transition Through Targeting ILK.

PubMed

Zheng, Qiaomei; Xu, Ying; Lu, Jingjing; Zhao, Jing; Wei, Xuan; Liu, Peishu

2016-11-01

To determine whether emodin facilitates the mesenchymal-epithelial transition (MET) of endometrial stromal cells (ESCs) as well as to explore the mechanism through which emodin favored the MET of ESCs. Cell viability was tested by methyl thiazolyl tetrazolium assay. Cell migration and invasion abilities were detected by transwell assays. Levels of integrin-linked kinase (ILK) and epithelial-mesenchymal transition (EMT)-related proteins were detected by Western blot. Upregulated ILK and increased abilities of migration and invasion were confirmed in the eutopic and ectopic ESCs (EuSCs and EcSCs), especially in the EcSCs. After treated with emodin, the expression of ILK was statistically downregulated in EcSCs, resulting in the MET and decreased migration and invasion abilities of EcSCs. Additionally, silencing of the ILK gene in EcSCs also achieved the above-mentioned effects, which were strengthened by emodin. Furthermore, exogenous expression of ILK in control ESCs (CSCs) resulted in the EMT and increased abilities of migration and invasion of CSCs, which can be abrogated by emodin. Besides, exogenous expression of ILK also abrogated the effects of emodin on CSCs. Emodin inhibits the migration and invasion abilities of human ESCs by facilitating the MET through targeting ILK. © The Author(s) 2016.

Transgenic Studies on the Involvement of Cytokinin and Gibberellin in Male Development

PubMed Central

Huang, Shihshieh; Cerny, R. Eric; Qi, Youlin; Bhat, Deepti; Aydt, Carrie M.; Hanson, Doris D.; Malloy, Kathleen P.; Ness, Linda A.

2003-01-01

Numerous plant hormones interact during plant growth and development. Elucidating the role of these various hormones on particular tissue types or developmental stages has been difficult with exogenous applications or constitutive expression studies. Therefore, we used tissue-specific promoters expressing CKX1 and gai, genes involved in oxidative cytokinin degradation and gibberellin (GA) signal transduction, respectively, to study the roles of cytokinin and GA in male organ development. Accumulation of CKX1 in reproductive tissues of transgenic maize (Zea mays) resulted in male-sterile plants. The male development of these plants was restored by applications of kinetin and thidiazuron. Similarly, expression of gai specifically in anthers and pollen of tobacco (Nicotiana tabacum) and Arabidopsis resulted in the abortion of these respective tissues. The gai-induced male-sterile phenotype exhibited by the transgenic plants was reversible by exogenous applications of kinetin. Our results provide molecular evidence of the involvement of cytokinin and GA in male development and support the hypothesis that the male development is controlled in concert by multiple hormones. These studies also suggest a potential method for generating maintainable male sterility in plants by using existing agrochemicals that would reduce the expense of seed production for existing hybrid crops and provide a method to produce hybrid varieties of traditionally non-hybrid crops. PMID:12644677

HDAC inhibitors TSA and sodium butyrate enhanced the human IL-5 expression by altering histone acetylation status at its promoter region.

PubMed

Han, Songyan; Lu, Jun; Zhang, Yu; Cheng, Cao; Li, Lin; Han, Liping; Huang, Baiqu

2007-02-15

The expression of IL-5 correlated tightly with the maturation and differentiation of eosinophils, and is considered as a cytokine responsible for allergic inflammation. We report here that inhibition of HDAC activity by Trichostatin A (TSA) and sodium butyrate (NaBu), the two specific HDAC inhibitors, resulted in the elevation of both endogenous and exogenous activity of IL-5 promoter. We demonstrated that both the mRNA expression and protein production of IL-5 were stimulated by TSA and NaBu treatments. ChIP assays showed that treatments of TSA and NaBu caused hyperacetylation of histones H3 and H4 on IL-5 promoter in Jurkat cells, which consequently promoted the exogenous luciferase activity driven by this promoter. Moreover, site-directed mutagenesis studies showed that the binding sites for transcription factors NFAT, GATA3 and YY1 on IL-5 promoter were critical for the effects of TSA and NaBu, suggesting that the transcriptional activation of IL-5 gene by these inhibitors was achieved by affecting HDAC function on IL-5 promoter via transcription factors. These data will contribute to elucidating the unique mechanism of IL-5 transcriptional control and to the therapy of allergic disorders related to IL-5.

Enhancement of bioelectricity generation via heterologous expression of IrrE in Pseudomonas aeruginosa-inoculated MFCs.

PubMed

Luo, Jianmei; Wang, Tingting; Li, Xiao; Yang, Yanan; Zhou, Minghua; Li, Ming; Yan, Zhongli

2018-05-30

Low electricity power output (EPT) is still the main bottleneck limited the industrial application of microbial fuel cells (MFCs). Herein, EPT enhancement by introducing an exogenous global regulator IrrE derived from Deinococcus radiodurans into electrochemically active bacteria (EAB) was explored using Pseudomonas aeruginosa PAO1 as a model strain, achieving a power density 71% higher than that of the control strain. Moreover, IrrE-expressing strain exhibited a remarkable increase in the total amount of electron shuttles (majorly phenazines compounds) and a little decrease in internal resistance, which should underlie the enhancement in extracellular electron transfer (EET) efficiency and EPT. Strikingly, IrrE significantly affected substrate utilization profiling, improved cell growth characterization and cell tolerance to various stresses. Further quantitative RT-PCR analysis revealed that IrrE led to many differentially expressed genes, which were responsible for phenazines core biosynthesis, biofilm formation, QS systems, transcriptional regulation, glucose metabolism and general stress response. The results substantiated that targeting cellular regulatory network by the introduction of exogenous global regulators could be a facile and promising approach for the enhancement of bioelectricity generation and cell multiple phenotypes, and thus would be of great potential application in the practical MFCs. Copyright © 2018 Elsevier B.V. All rights reserved.

Transcriptome Wide Identification and Validation of Calcium Sensor Gene Family in the Developing Spikes of Finger Millet Genotypes for Elucidating Its Role in Grain Calcium Accumulation

PubMed Central

Singh, Uma M.; Chandra, Muktesh; Shankhdhar, Shailesh C.; Kumar, Anil

2014-01-01

Background In finger millet, calcium is one of the important and abundant mineral elements. The molecular mechanisms involved in calcium accumulation in plants remains poorly understood. Transcriptome sequencing of genetically diverse genotypes of finger millet differing in grain calcium content will help in understanding the trait. Principal Finding In this study, the transcriptome sequencing of spike tissues of two genotypes of finger millet differing in their grain calcium content, were performed for the first time. Out of 109,218 contigs, 78 contigs in case of GP-1 (Low Ca genotype) and out of 120,130 contigs 76 contigs in case of GP-45 (High Ca genotype), were identified as calcium sensor genes. Through in silico analysis all 82 unique calcium sensor genes were classified into eight calcium sensor gene family viz., CaM & CaMLs, CBLs, CIPKs, CRKs, PEPRKs, CDPKs, CaMKs and CCaMK. Out of 82 genes, 12 were found diverse from the rice orthologs. The differential expression analysis on the basis of FPKM value resulted in 24 genes highly expressed in GP-45 and 11 genes highly expressed in GP-1. Ten of the 35 differentially expressed genes could be assigned to three documented pathways involved mainly in stress responses. Furthermore, validation of selected calcium sensor responder genes was also performed by qPCR, in developing spikes of both genotypes grown on different concentration of exogenous calcium. Conclusion Through de novo transcriptome data assembly and analysis, we reported the comprehensive identification and functional characterization of calcium sensor gene family. The calcium sensor gene family identified and characterized in this study will facilitate in understanding the molecular basis of calcium accumulation and development of calcium biofortified crops. Moreover, this study also supported that identification and characterization of gene family through Illumina paired-end sequencing is a potential tool for generating the genomic information of gene family in non-model species. PMID:25157851

Transcriptome wide identification and validation of calcium sensor gene family in the developing spikes of finger millet genotypes for elucidating its role in grain calcium accumulation.

PubMed

Singh, Uma M; Chandra, Muktesh; Shankhdhar, Shailesh C; Kumar, Anil

2014-01-01

In finger millet, calcium is one of the important and abundant mineral elements. The molecular mechanisms involved in calcium accumulation in plants remains poorly understood. Transcriptome sequencing of genetically diverse genotypes of finger millet differing in grain calcium content will help in understanding the trait. In this study, the transcriptome sequencing of spike tissues of two genotypes of finger millet differing in their grain calcium content, were performed for the first time. Out of 109,218 contigs, 78 contigs in case of GP-1 (Low Ca genotype) and out of 120,130 contigs 76 contigs in case of GP-45 (High Ca genotype), were identified as calcium sensor genes. Through in silico analysis all 82 unique calcium sensor genes were classified into eight calcium sensor gene family viz., CaM & CaMLs, CBLs, CIPKs, CRKs, PEPRKs, CDPKs, CaMKs and CCaMK. Out of 82 genes, 12 were found diverse from the rice orthologs. The differential expression analysis on the basis of FPKM value resulted in 24 genes highly expressed in GP-45 and 11 genes highly expressed in GP-1. Ten of the 35 differentially expressed genes could be assigned to three documented pathways involved mainly in stress responses. Furthermore, validation of selected calcium sensor responder genes was also performed by qPCR, in developing spikes of both genotypes grown on different concentration of exogenous calcium. Through de novo transcriptome data assembly and analysis, we reported the comprehensive identification and functional characterization of calcium sensor gene family. The calcium sensor gene family identified and characterized in this study will facilitate in understanding the molecular basis of calcium accumulation and development of calcium biofortified crops. Moreover, this study also supported that identification and characterization of gene family through Illumina paired-end sequencing is a potential tool for generating the genomic information of gene family in non-model species.

miR396 affects mycorrhization and root meristem activity in the legume Medicago truncatula.

PubMed

Bazin, Jérémie; Khan, Ghazanfar Abbas; Combier, Jean-Philippe; Bustos-Sanmamed, Pilar; Debernardi, Juan Manuel; Rodriguez, Ramiro; Sorin, Céline; Palatnik, Javier; Hartmann, Caroline; Crespi, Martin; Lelandais-Brière, Christine

2013-06-01

The root system is crucial for acquisition of resources from the soil. In legumes, the efficiency of mineral and water uptake by the roots may be reinforced due to establishment of symbiotic relationships with mycorrhizal fungi and interactions with soil rhizobia. Here, we investigated the role of miR396 in regulating the architecture of the root system and in symbiotic interactions in the model legume Medicago truncatula. Analyses with promoter-GUS fusions suggested that the mtr-miR396a and miR396b genes are highly expressed in root tips, preferentially in the transition zone, and display distinct expression profiles during lateral root and nodule development. Transgenic roots of composite plants that over-express the miR396b precursor showed lower expression of six growth-regulating factor genes (MtGRF) and two bHLH79-like target genes, as well as reduced growth and mycorrhizal associations. miR396 inactivation by mimicry caused contrasting tendencies, with increased target expression, higher root biomass and more efficient colonization by arbuscular mycorrhizal fungi. In contrast to MtbHLH79, repression of three GRF targets by RNA interference severely impaired root growth. Early activation of mtr-miR396b, concomitant with post-transcriptional repression of MtGRF5 expression, was also observed in response to exogenous brassinosteroids. Growth limitation in miR396 over-expressing roots correlated with a reduction in cell-cycle gene expression and the number of dividing cells in the root apical meristem. These results link the miR396 network to the regulation of root growth and mycorrhizal associations in plants. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

The cotton transcription factor TCP14 functions in auxin-mediated epidermal cell differentiation and elongation.

PubMed

Wang, Miao-Ying; Zhao, Pi-Ming; Cheng, Huan-Qing; Han, Li-Bo; Wu, Xiao-Min; Gao, Peng; Wang, Hai-Yun; Yang, Chun-Lin; Zhong, Nai-Qin; Zuo, Jian-Ru; Xia, Gui-Xian

2013-07-01

Plant-specific TEOSINTE-BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors play crucial roles in development, but their functional mechanisms remain largely unknown. Here, we characterized the cellular functions of the class I TCP transcription factor GhTCP14 from upland cotton (Gossypium hirsutum). GhTCP14 is expressed predominantly in fiber cells, especially at the initiation and elongation stages of development, and its expression increased in response to exogenous auxin. Induced heterologous overexpression of GhTCP14 in Arabidopsis (Arabidopsis thaliana) enhanced initiation and elongation of trichomes and root hairs. In addition, root gravitropism was severely affected, similar to mutant of the auxin efflux carrier PIN-FORMED2 (PIN2) gene. Examination of auxin distribution in GhTCP14-expressing Arabidopsis by observation of auxin-responsive reporters revealed substantial alterations in auxin distribution in sepal trichomes and root cortical regions. Consistent with these changes, expression of the auxin uptake carrier AUXIN1 (AUX1) was up-regulated and PIN2 expression was down-regulated in the GhTCP14-expressing plants. The association of GhTCP14 with auxin responses was also evidenced by the enhanced expression of auxin response gene IAA3, a gene in the AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) family. Electrophoretic mobility shift assays showed that GhTCP14 bound the promoters of PIN2, IAA3, and AUX1, and transactivation assays indicated that GhTCP14 had transcription activation activity. Taken together, these results demonstrate that GhTCP14 is a dual-function transcription factor able to positively or negatively regulate expression of auxin response and transporter genes, thus potentially acting as a crucial regulator in auxin-mediated differentiation and elongation of cotton fiber cells.

The Cotton Transcription Factor TCP14 Functions in Auxin-Mediated Epidermal Cell Differentiation and Elongation1[C][W

PubMed Central

Wang, Miao-Ying; Zhao, Pi-Ming; Cheng, Huan-Qing; Han, Li-Bo; Wu, Xiao-Min; Gao, Peng; Wang, Hai-Yun; Yang, Chun-Lin; Zhong, Nai-Qin; Zuo, Jian-Ru; Xia, Gui-Xian

2013-01-01

Plant-specific TEOSINTE-BRANCHED1/CYCLOIDEA/PCF (TCP) transcription factors play crucial roles in development, but their functional mechanisms remain largely unknown. Here, we characterized the cellular functions of the class I TCP transcription factor GhTCP14 from upland cotton (Gossypium hirsutum). GhTCP14 is expressed predominantly in fiber cells, especially at the initiation and elongation stages of development, and its expression increased in response to exogenous auxin. Induced heterologous overexpression of GhTCP14 in Arabidopsis (Arabidopsis thaliana) enhanced initiation and elongation of trichomes and root hairs. In addition, root gravitropism was severely affected, similar to mutant of the auxin efflux carrier PIN-FORMED2 (PIN2) gene. Examination of auxin distribution in GhTCP14-expressing Arabidopsis by observation of auxin-responsive reporters revealed substantial alterations in auxin distribution in sepal trichomes and root cortical regions. Consistent with these changes, expression of the auxin uptake carrier AUXIN1 (AUX1) was up-regulated and PIN2 expression was down-regulated in the GhTCP14-expressing plants. The association of GhTCP14 with auxin responses was also evidenced by the enhanced expression of auxin response gene IAA3, a gene in the AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) family. Electrophoretic mobility shift assays showed that GhTCP14 bound the promoters of PIN2, IAA3, and AUX1, and transactivation assays indicated that GhTCP14 had transcription activation activity. Taken together, these results demonstrate that GhTCP14 is a dual-function transcription factor able to positively or negatively regulate expression of auxin response and transporter genes, thus potentially acting as a crucial regulator in auxin-mediated differentiation and elongation of cotton fiber cells. PMID:23715527

Epigenetic Inactivation of GALR1 in Head and Neck Cancer

PubMed Central

Misawa, Kiyoshi; Ueda, Yo; Kanazawa, Takeharu; Misawa, Yuki; Jang, Ilwhan; Brenner, John Chadwick; Ogawa, Tetsuya; Takebayashi, Satoru; Grenman, Reidar A.; Herman, James G.; Mineta, Hiroyuki; Carey, Thomas E.

2011-01-01

Purpose One copy of the GALR1 locus on 18q is often deleted and expression is absent in some head and neck squamous cell carcinoma (HNSCC) cell lines. To determine if LOH and hypermethylation might silence the GALR1 gene, promoter methylation status and gene expression were assessed in a large panel of HNSCC cell lines and tumors. Experimental Design Promoter methylation of GALR1 in 72 cell lines and 100 primary tumor samples was analyzed using methylation-specific PCR (MSP). GALR1 expression and methylation status were analyzed further by real-time PCR and bisulfite sequencing analysis. Results The GALR1 promoter was fully or partially methylated in 38 of 72 HNSCC cell lines (52.7%) but not in the majority 18/20 (90.0%) of non-malignant lines. GALR1 methylation was also found in 38/100 (38%) primary tumor specimens. Methylation correlated with decreased GALR1 expression. In tumors methylation was significantly correlated with increased tumor size (P=0.0036), lymph-node status (P=0.0414), tumor stage (P=0.0037), cyclin D1 expression (P=0.0420), and p16 methylation (P=0.0494) and survival (P=0.045). Bisulfite sequencing of 36 CpG sites upstream of the transcription start site revealed that CpG methylation within transcription factor binding sites correlated with complete suppression of GALR1 mRNA. Treatment with TSA and 5-azacytidine restored GALR1 expression. In UM-SCC-23 cells that have total silencing of GALR1, exogenous GALR1 expression and stimulation with galanin suppressed cell proliferation. Conclusions Frequent promoter hypermethylation, gene silencing, association with prognosis, and growth suppression after re-expression support the hypothesis that GALR1 is a tumor suppressor gene in HNSCC. PMID:19047085

Exogenous plant hormones and cyclotide expression in Viola uliginosa (Violaceae).

PubMed

Slazak, Blazej; Jacobsson, Erik; Kuta, Elżbieta; Göransson, Ulf

2015-09-01

Plants from Violaceae produce cyclotides, peptides characterized by a circular peptide backbone and a cystine knot. This signature motif gives stability that can harness a wide spectrum of biological activities, with implications in plant defense and with applications in medicine and biotechnology. In the current work, cyclotide expressing in vitro cultures were established from Viola uliginosa. These cultures are useful models for studying biosynthesis of cyclotides and can also be used in their production. The cyclotide expression pattern is shown to be dependent on exogenous plant growth regulators, both on peptide and gene expression levels. The highest yields of cyclotides were obtained on media containing only a cytokinin and were correlated with storage material accumulation. Exposure to auxins decreased cyclotide production and caused shifting of the biosynthesis pattern to root specific cyclotides. The response to stimuli in terms of cyclotide expression pattern appears to be developmental, and related to polar auxin transportation and the auxin/cytokinin ratio regulating tissue differentiation. By the use of whole transcriptome shotgun sequencing (WTSS) and peptidomics, 20 cyclotide sequences from V. uliginosa (including 12 new) and 12 complete precursor proteins could be identified. The most abundant cyclotides were cycloviolacin O3 (CyO3), CyO8 and CyO13. A suspension culture was obtained that grew exponentially with a doubling time of approximately 3 days. After ten days of growth, the culture provided a yield of more than 4 mg CyO13 per gram dry mass. Copyright © 2015 Elsevier Ltd. All rights reserved.

The Pseudomonas aeruginosa Magnesium Transporter MgtE Inhibits Transcription of the Type III Secretion System▿ †

PubMed Central

Anderson, Gregory G.; Yahr, Timothy L.; Lovewell, Rustin R.; O'Toole, George A.

2010-01-01

Pseudomonas aeruginosa is an opportunistic pathogen that causes life-long pneumonia in individuals with cystic fibrosis (CF). These long-term infections are maintained by bacterial biofilm formation in the CF lung. We have recently developed a model of P. aeruginosa biofilm formation on cultured CF airway epithelial cells. Using this model, we discovered that mutation of a putative magnesium transporter gene, called mgtE, led to increased cytotoxicity of P. aeruginosa toward epithelial cells. This altered toxicity appeared to be dependent upon expression of the type III secretion system (T3SS). In this study, we found that mutation of mgtE results in increased T3SS gene transcription. Through epistasis analyses, we discovered that MgtE influences the ExsE-ExsC-ExsD-ExsA gene regulatory system of T3SS by either directly or indirectly inhibiting ExsA activity. While variations in calcium levels modulate T3SS gene expression in P. aeruginosa, we found that addition of exogenous magnesium did not inhibit T3SS activity. Furthermore, mgtE variants that were defective for magnesium transport could still complement the cytotoxicity effect. Thus, the magnesium transport function of MgtE does not fully explain the regulatory effects of MgtE on cytotoxicity. Overall, our results indicate that MgtE modulates expression of T3SS genes. PMID:20028803

The Pseudomonas aeruginosa magnesium transporter MgtE inhibits transcription of the type III secretion system.

PubMed

Anderson, Gregory G; Yahr, Timothy L; Lovewell, Rustin R; O'Toole, George A

2010-03-01

Pseudomonas aeruginosa is an opportunistic pathogen that causes life-long pneumonia in individuals with cystic fibrosis (CF). These long-term infections are maintained by bacterial biofilm formation in the CF lung. We have recently developed a model of P. aeruginosa biofilm formation on cultured CF airway epithelial cells. Using this model, we discovered that mutation of a putative magnesium transporter gene, called mgtE, led to increased cytotoxicity of P. aeruginosa toward epithelial cells. This altered toxicity appeared to be dependent upon expression of the type III secretion system (T3SS). In this study, we found that mutation of mgtE results in increased T3SS gene transcription. Through epistasis analyses, we discovered that MgtE influences the ExsE-ExsC-ExsD-ExsA gene regulatory system of T3SS by either directly or indirectly inhibiting ExsA activity. While variations in calcium levels modulate T3SS gene expression in P. aeruginosa, we found that addition of exogenous magnesium did not inhibit T3SS activity. Furthermore, mgtE variants that were defective for magnesium transport could still complement the cytotoxicity effect. Thus, the magnesium transport function of MgtE does not fully explain the regulatory effects of MgtE on cytotoxicity. Overall, our results indicate that MgtE modulates expression of T3SS genes.

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

PubMed

Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

2017-06-01

Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Abscisic acid-dependent multisite phosphorylation regulates the activity of a transcription activator AREB1.

PubMed

Furihata, Takashi; Maruyama, Kyonoshin; Fujita, Yasunari; Umezawa, Taishi; Yoshida, Riichiro; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

2006-02-07

bZIP-type transcription factors AREBs/ABFs bind an abscisic acid (ABA)-responsive cis-acting element named ABRE and transactivate downstream gene expression in Arabidopsis. Because AREB1 overexpression could not induce downstream gene expression, activation of AREB1 requires ABA-dependent posttranscriptional modification. We confirmed that ABA activated 42-kDa kinase activity, which, in turn, phosphorylated Ser/Thr residues of R-X-X-S/T sites in the conserved regions of AREB1. Amino acid substitutions of R-X-X-S/T sites to Ala suppressed transactivation activity, and multiple substitution of these sites resulted in almost complete suppression of transactivation activity in transient assays. In contrast, substitution of the Ser/Thr residues to Asp resulted in high transactivation activity without exogenous ABA application. A phosphorylated, transcriptionally active form was achieved by substitution of Ser/Thr in all conserved R-X-X-S/T sites to Asp. Transgenic plants overexpressing the phosphorylated active form of AREB1 expressed many ABA-inducible genes, such as RD29B, without ABA treatment. These results indicate that the ABA-dependent multisite phosphorylation of AREB1 regulates its own activation in plants.

TTLL12 Inhibits the Activation of Cellular Antiviral Signaling through Interaction with VISA/MAVS.

PubMed

Ju, Lin-Gao; Zhu, Yuan; Lei, Pin-Ji; Yan, Dong; Zhu, Kun; Wang, Xiang; Li, Qing-Lan; Li, Xue-Jing; Chen, Jian-Wen; Li, Lian-Yun; Wu, Min

2017-02-01

Upon virus infection, host cells use retinoic-acid-inducible geneI I (RIG-I)-like receptors to recognize viral RNA and activate type I IFN expression. To investigate the role of protein methylation in the antiviral signaling pathway, we screened all the SET domain-containing proteins and identified TTLL12 as a negative regulator of RIG-I signaling. TTLL12 contains SET and TTL domains, which are predicted to have lysine methyltransferase and tubulin tyrosine ligase activities, respectively. Exogenous expression of TTLL12 represses IFN-β expression induced by Sendai virus. TTLL12 deficiency by RNA interference and CRISPR-gRNA techniques increases the induced IFN-β expression and inhibits virus replication in the cell. The global gene expression profiling indicated that TTLL12 specifically inhibits the expression of the downstream genes of innate immunity pathways. Cell fractionation and fluorescent staining indicated that TTLL12 is localized in the cytosol. The mutagenesis study suggested that TTLL12's ability to repress the RIG-I pathway is probably not dependent on protein modifications. Instead, TTLL12 directly interacts with virus-induced signaling adaptor (VISA), TBK1, and IKKε, and inhibits the interactions of VISA with other signaling molecules. Taken together, our findings demonstrate TTLL12 as a negative regulator of RNA-virus-induced type I IFN expression by inhibiting the interaction of VISA with other proteins. Copyright © 2017 by The American Association of Immunologists, Inc.

A plant EPF-type zinc-finger protein, CaPIF1, involved in defence against pathogens.

PubMed

Oh, Sang-Keun; Park, Jeong Mee; Joung, Young Hee; Lee, Sanghyeob; Chung, Eunsook; Kim, Soo-Yong; Yu, Seung Hun; Choi, Doil

2005-05-01

SUMMARY To understand better the defence responses of plants to pathogen attack, we challenged hot pepper plants with bacterial pathogens and identified transcription factor-encoding genes whose expression patterns were altered during the subsequent hypersensitive response. One of these genes, CaPIF1 (Capsicum annuum Pathogen-Induced Factor 1), was characterized further. This gene encodes a plant-specific EPF-type protein that contains two Cys(2)/His(2) zinc fingers. CaPIF1 expression was rapidly and specifically induced when pepper plants were challenged with bacterial pathogens to which they are resistant. In contrast, challenge with a pathogen to which the plants are susceptible only generated weak CaPIF1 expression. CaPIF1 expression was also strongly induced in pepper leaves by the exogenous application of ethephon, an ethylene-releasing compound, and salicylic acid, whereas methyl jasmonate had only moderate effects. CaPIF1 localized to the nuclei of onion epidermis when expressed as a CaPIF1-smGFP fusion protein. Transgenic tobacco plants over-expressing CaPIF1 driven by the CaMV 35S promoter showed increased resistance to challenge with a tobacco-specific pathogen or non-host bacterial pathogens. These plants also showed constitutive up-regulation of multiple defence-related genes. Moreover, virus-induced silencing of the CaPIF1 orthologue in Nicotiana benthamiana enhanced susceptibility to the same host or non-host bacterial pathogens. These observations provide evidence that an EPF-type Cys(2)/His(2) zinc-finger protein plays a crucial role in the activation of the pathogen defence response in plants.

Genomewide Analysis of Aryl Hydrocarbon Receptor Binding Targets Reveals an Extensive Array of Gene Clusters that Control Morphogenetic and Developmental Programs

PubMed Central

Sartor, Maureen A.; Schnekenburger, Michael; Marlowe, Jennifer L.; Reichard, John F.; Wang, Ying; Fan, Yunxia; Ma, Ci; Karyala, Saikumar; Halbleib, Danielle; Liu, Xiangdong; Medvedovic, Mario; Puga, Alvaro

2009-01-01

Background The vertebrate aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor that regulates cellular responses to environmental polycyclic and halogenated compounds. The naive receptor is believed to reside in an inactive cytosolic complex that translocates to the nucleus and induces transcription of xenobiotic detoxification genes after activation by ligand. Objectives We conducted an integrative genomewide analysis of AHR gene targets in mouse hepatoma cells and determined whether AHR regulatory functions may take place in the absence of an exogenous ligand. Methods The network of AHR-binding targets in the mouse genome was mapped through a multipronged approach involving chromatin immunoprecipitation/chip and global gene expression signatures. The findings were integrated into a prior functional knowledge base from Gene Ontology, interaction networks, Kyoto Encyclopedia of Genes and Genomes pathways, sequence motif analysis, and literature molecular concepts. Results We found the naive receptor in unstimulated cells bound to an extensive array of gene clusters with functions in regulation of gene expression, differentiation, and pattern specification, connecting multiple morphogenetic and developmental programs. Activation by the ligand displaced the receptor from some of these targets toward sites in the promoters of xenobiotic metabolism genes. Conclusions The vertebrate AHR appears to possess unsuspected regulatory functions that may be potential targets of environmental injury. PMID:19654925

Genetic and functional studies of the intervertebral disc: a novel murine intervertebral disc model.

PubMed

Pelle, Dominic W; Peacock, Jacqueline D; Schmidt, Courtney L; Kampfschulte, Kevin; Scholten, Donald J; Russo, Scott S; Easton, Kenneth J; Steensma, Matthew R

2014-01-01

Intervertebral disc (IVD) homeostasis is mediated through a combination of micro-environmental and biomechanical factors, all of which are subject to genetic influences. The aim of this study is to develop and characterize a genetically tractable, ex vivo organ culture model that can be used to further elucidate mechanisms of intervertebral disc disease. Specifically, we demonstrate that IVD disc explants (1) maintain their native phenotype in prolonged culture, (2) are responsive to exogenous stimuli, and (3) that relevant homeostatic regulatory mechanisms can be modulated through ex-vivo genetic recombination. We present a novel technique for isolation of murine IVD explants with demonstration of explant viability (CMFDA/propidium iodide staining), disc anatomy (H&E), maintenance of extracellular matrix (ECM) (Alcian Blue staining), and native expression profile (qRT-PCR) as well as ex vivo genetic recombination (mT/mG reporter mice; AdCre) following 14 days of culture in DMEM media containing 10% fetal bovine serum, 1% L-glutamine, and 1% penicillin/streptomycin. IVD explants maintained their micro-anatomic integrity, ECM proteoglycan content, viability, and gene expression profile consistent with a homeostatic drive in culture. Treatment of genetically engineered explants with cre-expressing adenovirus efficaciously induced ex vivo genetic recombination in a variety of genetically engineered mouse models. Exogenous administration of IL-1ß and TGF-ß3 resulted in predicted catabolic and anabolic responses, respectively. Genetic recombination of TGFBR1fl/fl explants resulted in constitutively active TGF-ß signaling that matched that of exogenously administered TGF-ß3. Our results illustrate the utility of the murine intervertebral disc explant to investigate mechanisms of intervertebral disc degeneration.

Genetic and Functional Studies of the Intervertebral Disc: A Novel Murine Intervertebral Disc Model

PubMed Central

Pelle, Dominic W.; Peacock, Jacqueline D.; Schmidt, Courtney L.; Kampfschulte, Kevin; Scholten, Donald J.; Russo, Scott S.; Easton, Kenneth J.; Steensma, Matthew R.

2014-01-01

Intervertebral disc (IVD) homeostasis is mediated through a combination of micro-environmental and biomechanical factors, all of which are subject to genetic influences. The aim of this study is to develop and characterize a genetically tractable, ex vivo organ culture model that can be used to further elucidate mechanisms of intervertebral disc disease. Specifically, we demonstrate that IVD disc explants (1) maintain their native phenotype in prolonged culture, (2) are responsive to exogenous stimuli, and (3) that relevant homeostatic regulatory mechanisms can be modulated through ex-vivo genetic recombination. We present a novel technique for isolation of murine IVD explants with demonstration of explant viability (CMFDA/propidium iodide staining), disc anatomy (H&E), maintenance of extracellular matrix (ECM) (Alcian Blue staining), and native expression profile (qRT-PCR) as well as ex vivo genetic recombination (mT/mG reporter mice; AdCre) following 14 days of culture in DMEM media containing 10% fetal bovine serum, 1% L-glutamine, and 1% penicillin/streptomycin. IVD explants maintained their micro-anatomic integrity, ECM proteoglycan content, viability, and gene expression profile consistent with a homeostatic drive in culture. Treatment of genetically engineered explants with cre-expressing adenovirus efficaciously induced ex vivo genetic recombination in a variety of genetically engineered mouse models. Exogenous administration of IL-1ß and TGF-ß3 resulted in predicted catabolic and anabolic responses, respectively. Genetic recombination of TGFBR1fl/fl explants resulted in constitutively active TGF-ß signaling that matched that of exogenously administered TGF-ß3. Our results illustrate the utility of the murine intervertebral disc explant to investigate mechanisms of intervertebral disc degeneration. PMID:25474689

Effects of supplemental dietary arginine on the exogenous advanced glycosylation end product-induced interleukin-23/interleukin-17 immune response in rats.

PubMed

Yeh, Chiu-Li; Hu, Ya-Mei; Liu, Jun-Jen; Chen, Wei-Jao; Yeh, Sung-Ling

2012-10-01

Arginine (Arg) is known to possess numerous useful physiological properties and immunomodulatory effects. Th17 cells are a unique T-helper cell lineage. Regulation of Th17 cells plays a significant role in the pathogenesis of inflammatory disorders. This study investigated the effect of Arg on the exogenous advanced glycosylation end product (AGE)-induced Th17-mediated immune response. Rats were randomly divided into three groups. The control BSA (CB) group was fed a common diet and given a tail vein injection of non-glycated bovine serum albumin (BSA). The control AGE (CA) group was fed the common diet and injected with 2 mg AGE-BSA. Arg-AGE (AA) group was fed the Arg-supplemented diet and injected with 2 mg AGE-BSA. The experimental diets were identical in energy and nutrient distributions except for the amino acid content. Arg provided 2% of the total energy. Tail vein injections and diets were given daily. After 10 d, all rats were sacrificed, and blood samples were collected for further analysis. The AA group had the highest inducible nitric oxide (NO) synthase expression and plasma NO levels. The percentage of Foxp3 T-regulatory cells in the AA group was lower than those of the CA and CB groups. Transforming growth factor-β1, interleukin (IL)-6, and IL-17A gene expression was higher in the AGE-administered groups. The AA group had higher TGF-β1 and IL-17A expression than did the CA group. These results suggest that in a condition of exogenous AGE administration, supplemental dietary Arg resulted in a more pronounced IL-23/IL-17 immune response, possibly by increasing NO secretion. Copyright © 2012 Elsevier Inc. All rights reserved.

Conditional sterility in plants

DOEpatents

Meagher, Richard B.; McKinney, Elizabeth; Kim, Tehryung

2010-02-23

The present disclosure provides methods, recombinant DNA molecules, recombinant host cells containing the DNA molecules, and transgenic plant cells, plant tissue and plants which contain and express at least one antisense or interference RNA specific for a thiamine biosynthetic coding sequence or a thiamine binding protein or a thiamine-degrading protein, wherein the RNA or thiamine binding protein is expressed under the regulatory control of a transcription regulatory sequence which directs expression in male and/or female reproductive tissue. These transgenic plants are conditionally sterile; i.e., they are fertile only in the presence of exogenous thiamine. Such plants are especially appropriate for use in the seed industry or in the environment, for example, for use in revegetation of contaminated soils or phytoremediation, especially when those transgenic plants also contain and express one or more chimeric genes which confer resistance to contaminants.

Insulin-like growth factor-1 (IGF-1) promotes myoblast proliferation and skeletal muscle growth of embryonic chickens via the PI3K/Akt signalling pathway.

PubMed

Yu, Minli; Wang, Huan; Xu, Yali; Yu, Debing; Li, Dongfeng; Liu, Xiuhong; Du, Wenxing

2015-08-01

During embryonic development, IGF-1 fulfils crucial roles in skeletal myogenesis. However, the involvement of IGF-1-induced myoblast proliferation in muscle growth is still unclear. In the present study, we have characterised the role of IGF-1 in myoblast proliferation both in vitro and in vivo and have revealed novel details of how exogenous IGF-1 influences myogenic genes in chicken embryos. The results show that IGF-1 significantly induces the proliferation of cultured myoblasts in a dose-dependent manner. Additionally, the IGF-1 treatment significantly promoted myoblasts entering a new cell cycle and increasing the mRNA expression levels of cell cycle-dependent genes. However, these effects were inhibited by the PI3K inhibitor LY294002 and the Akt inhibitor KP372-1. These data indicated that the pro-proliferative effect of IGF-1 was mediated in response to the PI3K/Akt signalling pathway. Moreover, we also showed that exogenous IGF-1 stimulated myoblast proliferation in vivo. IGF-1 administration obviously promoted the incorporation of BrdU and remarkably increased the number of PAX7-positive cells in the skeletal muscle of chicken embryos. Administration of IGF-1 also significantly induced the upregulation of myogenic factors gene, the enhancement of c-Myc and the inhibition of myostatin (Mstn) expression. These findings demonstrate that IGF-1 has strong activity as a promoter of myoblast expansion and muscle fiber formation during early myogenesis. Therefore, this study offers insight into the mechanisms responsible for IGF-1-mediated stimulation of embryonic skeletal muscle development, which could have important implications for the improvement of chicken meat production. © 2015 International Federation for Cell Biology.

Magnetogenetics: Remote Control of Cellular Signaling with Magnetic Fields

NASA Astrophysics Data System (ADS)

Sauer, Jeremy P.

Means for temporally regulating gene expression and cellular activity are invaluable for elucidating the underlying physiological processes and have therapeutic implications. Here we report the development of a system for remote regulation of gene expression by low frequency radiowaves (RF) or by a static magnetic field. We accomplished this by first adding iron oxide nanoparticles - either exogenously or as genetically encoded ferritin/ferric oxyhydroxide particle. These particles have been designed with affinity to the plasma membrane ion channel Transient Receptor Potential Vanilloid 1 (TRPV1) by a conjugated antibody. Application of a magnetic field stimulates the particle to gate the ion channel and this, in turn, initiates calcium-dependent transgene expression. We first demonstrated in vitro that TRPV1 can be actuated to cause calcium flux into the cell by directly applying a localized magnetic field. In mice expressing these genetically encoded components, application of external magnetic field caused remote stimulation of insulin transgene expression and significantly lowered blood glucose. In addition, we are investigating mechanisms by which iron oxide nanoparticles can absorb RF, and transduce this energy to cause channel opening. This robust, repeatable method for remote cellular regulation in vivo may ultimately have applications in basic science, as well as in technology and therapeutics.

Establishment of embryonic neuroepithelial cell lines exhibiting an epiplastic expression pattern of region specific markers.

PubMed

Nardelli, Jeannette; Catala, Martin; Charnay, Patrick

2003-09-15

Neuroepithelial b2T cells were derived from the hindbrain and the spinal cord of mouse transgenic embryos, which expressed SV40 T antigen under the control of a Hoxb2 enhancer. Strikingly, b2T cell lines of either origin exhibit a very similar gene expression pattern, including markers of the hindbrain and the spinal cord, such as Hox genes, but not of more anterior cephalic regions. In addition, the broad expression pattern of b2T cells, probably linked to culture conditions, appeared to be appropriately modulated when the cells were reimplanted at different longitudinal levels into chick host embryos, suggesting that these cells are responsive to exogenous signalling mechanisms. Further support for these allegations was obtained by culturing b2T cells in defined medium and by assessing the expression of Krox20, an odd-numbered rhombomere marker, which appeared to be modulated by a complex interplay between FGF, retinoic acid (RA), and noggin. With respect to these as yet unique properties, b2T cells constitute an original alternative tool to in vivo models for the analysis of molecular pathways involved in the patterning of the neural tube. Copyright 2003 Wiley-Liss, Inc.

Nitric Oxide Inhibits Al-Induced Programmed Cell Death in Root Tips of Peanut (Arachis hypogaea L.) by Affecting Physiological Properties of Antioxidants Systems and Cell Wall

PubMed Central

Pan, Chun-Liu; Yao, Shao-Chang; Xiong, Wei-Jiao; Luo, Shu-Zhen; Wang, Ya-Lun; Wang, Ai-Qin; Xiao, Dong; Zhan, Jie; He, Long-Fei

2017-01-01

It has been reported that nitric oxide (NO) is a negative regulator of aluminum (Al)-induced programmed cell death (PCD) in peanut root tips. However, the inhibiting mechanism of NO on Al-induced PCD is unclear. In order to investigate the mechanism by which NO inhibits Al-induced PCD, the effects of co-treatment Al with the exogenous NO donor or the NO-specific scavenger on peanut root tips, the physiological properties of antioxidants systems and cell wall (CW) in root tip cells of NO inhibiting Al-induced PCD were studied with two peanut cultivars. The results showed that Al exposure induced endogenous NO accumulation, and endogenous NO burst increased antioxidant enzyme activity in response to Al stress. The addition of NO donor sodium nitroprusside (SNP) relieved Al-induced root elongation inhibition, cell death and Al adsorption in CW, as well as oxidative damage and ROS accumulation. Furthermore, co-treatment with the exogenous NO donor decreased MDA content, LOX activity and pectin methylesterase (PME) activity, increased xyloglucan endotransglucosylase (XET) activity and relative expression of the xyloglucan endotransglucosylase/hydrolase (XTH-32) gene. Taken together, exogenous NO alleviated Al-induced PCD by inhibiting Al adsorption in CW, enhancing antioxidant defense and reducing peroxidation of membrane lipids, alleviating the inhibition of Al on root elongation by maintaining the extensibility of CW, decreasing PME activity, and increasing XET activity and relative XTH-32 expression of CW. PMID:29311970

Nitric Oxide Inhibits Al-Induced Programmed Cell Death in Root Tips of Peanut (Arachis hypogaea L.) by Affecting Physiological Properties of Antioxidants Systems and Cell Wall.

PubMed

Pan, Chun-Liu; Yao, Shao-Chang; Xiong, Wei-Jiao; Luo, Shu-Zhen; Wang, Ya-Lun; Wang, Ai-Qin; Xiao, Dong; Zhan, Jie; He, Long-Fei

2017-01-01

It has been reported that nitric oxide (NO) is a negative regulator of aluminum (Al)-induced programmed cell death (PCD) in peanut root tips. However, the inhibiting mechanism of NO on Al-induced PCD is unclear. In order to investigate the mechanism by which NO inhibits Al-induced PCD, the effects of co-treatment Al with the exogenous NO donor or the NO-specific scavenger on peanut root tips, the physiological properties of antioxidants systems and cell wall (CW) in root tip cells of NO inhibiting Al-induced PCD were studied with two peanut cultivars. The results showed that Al exposure induced endogenous NO accumulation, and endogenous NO burst increased antioxidant enzyme activity in response to Al stress. The addition of NO donor sodium nitroprusside (SNP) relieved Al-induced root elongation inhibition, cell death and Al adsorption in CW, as well as oxidative damage and ROS accumulation. Furthermore, co-treatment with the exogenous NO donor decreased MDA content, LOX activity and pectin methylesterase (PME) activity, increased xyloglucan endotransglucosylase (XET) activity and relative expression of the xyloglucan endotransglucosylase/hydrolase ( XTH-32 ) gene. Taken together, exogenous NO alleviated Al-induced PCD by inhibiting Al adsorption in CW, enhancing antioxidant defense and reducing peroxidation of membrane lipids, alleviating the inhibition of Al on root elongation by maintaining the extensibility of CW, decreasing PME activity, and increasing XET activity and relative XTH-32 expression of CW.

Transcriptional regulation of IGF-I expression in skeletal muscle

NASA Technical Reports Server (NTRS)

McCall, G. E.; Allen, D. L.; Haddad, F.; Baldwin, K. M.

2003-01-01

The present study investigated the role of transcription in the regulation of insulin-like growth factor (IGF)-I expression in skeletal muscle. RT-PCR was used to determine endogenous expression of IGF-I pre-mRNA and mRNA in control (Con) and functionally overloaded (FO) rat plantaris. The transcriptional activities of five different-length IGF-I promoter fragments controlling transcription of a firefly luciferase (FLuc) reporter gene were tested in vitro by transfection of myoblasts or in vivo during FO by direct gene transfer into the plantaris. Increased endogenous IGF-I gene transcription during 7 days of plantaris FO was evidenced by an approximately 140-160% increase (P < 0.0001) in IGF-I pre-mRNA (a transcriptional marker). IGF-I mRNA expression also increased by approximately 90% (P < 0.0001), and it was correlated (R = 0.93; P < 0.0001) with the pre-mRNA increases. The three longest IGF-I exon 1 promoters induced reporter gene expression in proliferating C2C12 and L6E9 myoblasts. In differentiated L6E9 myotubes, promoter activity increased approximately two- to threefold over myoblasts. Overexpression of calcineurin and MyoD increased the activity of the -852/+192 promoter in C2C12 myotubes by approximately 5- and approximately 18-fold, respectively. However, FO did not induce these exogenous promoter fragments. Nevertheless, the present findings are consistent with the hypothesis that the IGF-I gene is transcriptionally regulated during muscle hypertrophy in vivo as evidenced by the induction of the endogenous IGF-I pre-mRNA during plantaris FO. The exon 1 promoter region of the IGF-I gene is sufficient to direct inducible expression in vitro; however, an in vivo response to FO may require elements outside the -852/+346 region of the exon 1 IGF-I promoter or features inherent to the endogenous IGF-I gene.

High copy and stable expression of the xylanase XynHB in Saccharomyces cerevisiae by rDNA-mediated integration.

PubMed

Fang, Cheng; Wang, Qinhong; Selvaraj, Jonathan Nimal; Zhou, Yuling; Ma, Lixin; Zhang, Guimin; Ma, Yanhe

2017-08-18

Xylanase is a widely-used additive in baking industry for enhancing dough and bread quality. Several xylanases used in baking industry were expressed in different systems, but their expression in antibiotic free vector system is highly essential and safe. In the present study, an alternative rDNA-mediated technology was developed to increase the copy number of target gene by integrating it into Saccharomyces cerevisiae genome. A xylanase-encoding gene xynHB from Bacillus sp. was cloned into pHBM367H and integrated into S. cerevisiae genome through rDNA-mediated recombination. Exogenous XynHB expressed by recombinant S. cerevisiae strain A13 exhibited higher degradation activity towards xylan than other transformants. The real-time PCR analysis on A13 genome revealed the presence of 13.64 copies of xynHB gene. Though no antibiotics have been used, the genetic stability and the xylanase activity of xynHB remained stable up to 1,011 generations of cultivation. S. cerevisiae strain A13 expressing xylanase reduced the required kneading time and increased the height and diameter of the dough size, which would be safe and effective in baking industry as no antibiotics-resistance risk. The new effective rDNA-mediated technology without using antibiotics here provides a way to clone other food related industrial enzymes for applications.

BMP4 Cooperates with Retinoic Acid to Induce the Expression of Differentiation Markers in Cultured Mouse Spermatogonia

PubMed Central

Feng, Yanmin; Feng, Xue; Wang, Xiuxia; Gan, Haiyun; Wang, Lixian; Lin, Xiwen

2016-01-01

Spermatogenesis is sustained by the proliferation and differentiation of spermatogonial stem cells (SSCs). However, the molecules controlling these processes remain largely unknown. Here, we developed a simplified high concentration serum-containing system for the culture of mouse SSCs. Analysis of SSCs markers and transplantation results revealed that the cultured spermatogonia retained stem cell characteristics after long-term in vitro propagation. Using this culture system, the expression and function of bone morphogenetic protein 4 (BMP4) were explored. Immunostaining showed that BMP4 was predominantly expressed in germ cells and that its level increased as spermatogenesis progresses. BMP4 receptors BMPR1A and BMPRII were present in spermatogonia, spermatocytes, and round spermatids. Moreover, despite the mRNAs of these two genes being present in mouse Sertoli cells, only BMPRII was detected by using Western blotting assays. While exogenous BMP4 by itself did not induce the expression of Stra8 and c-Kit, two marker genes of differentiating spermatogonia, a significant cooperative effect of BMP4 and retinoic acid (RA) was observed. Moreover, pretreatment of cultured spermatogonia with the BMP4 antagonist Noggin could inhibit RA-induced expression of these two marker genes. In conclusion, BMP4 may exert autocrine effects and act cooperatively with RA to induce the differentiation of spermatogonia in vivo. PMID:27795714

Molecular cloning, expression analysis, and potential food intake attenuation effect of peptide YY in grass carp (Ctenopharyngodon idellus).

PubMed

Chen, Yong; Shen, Yubang; Pandit, Narayan Prasad; Fu, Jianjun; Li, Da; Li, Jiale

2013-06-15

The peptide YY (PYY) is a 36 amino acid peptide involved in the food intake control in vertebrates. We have cloned and characterized a PYY gene from grass carp Ctenopharyngodon idellus. The full-length cDNA encodes a precursor protein of grass carp PYY (gcPYY) that consists of a putative 28-amino acid signal peptide, a 36-amino acid mature peptide, an amidation-proteolytic site, and a 30-amino acid carboxy-terminal extension. The gcPYY gene is comprised of 4 exons interspaced by 3 introns as seen in PYYs from other species. Amino acid alignment and gene structure comparison indicate that the structure of PYY is well preserved throughout vertebrate phylogeny. The tissue distribution and postprandial changes in gcPYY mRNA expression were evaluated by real-time PCR, which showed that the gcPYY is expressed abundantly in the central nervous system, with significantly increased expression following a single meal. During embryogenesis, the presence of gcPYY mRNA was detected in early developing embryos, and high expression levels were observed when most larvae completed their switch from endogenous nourishment to exogenous feeding. Reduced food intake by juveniles during a single meal after giving perpheral injection of gcPYY1-36 suggests a potentially important role of PYY in the food intake attenuation in grass carp. Copyright © 2013 Elsevier Inc. All rights reserved.

Morphological diversity of the avian foot is related with the pattern of msx gene expression in the developing autopod.

PubMed

Gañan, Y; Macias, D; Basco, R D; Merino, R; Hurle, J M

1998-04-01

The formation of the digits in amniota embryos is accompanied by apoptotic cell death of the interdigital mesoderm triggered through BMP signaling. Differences in the intensity of this apoptotic process account for the establishment of the different morphological types of feet observed in amniota (i.e., free-digits, webbed digits, lobulated digits). The molecular basis accounting for the differential pattern of interdigital cell death remains uncertain since the reduction of cell death in species with webbed digits is not accompanied by a parallel reduction in the pattern of expression of bmp genes in the interdigital regions. In this study we show that the duck interdigital web mesoderm exhibits an attenuated response to both BMP-induced apoptosis and TGFbeta-induced chondrogenesis in comparison with species with free digits. The attenuated response to these signals is accompanied by a reduced pattern of expression of msx-1 and msx-2 genes. Local application of FGF in the duck interdigit expands the domain of msx-2 expression but not the domain of msx-1 expression. This change in the expression of msx-2 is followed by a parallel increase in spontaneous and exogenous BMP-induced interdigital cell death, while the chondrogenic response to TGFbetas is unchanged. The regression of AER, as deduced by the pattern of extinction of fgf-8 expression, takes place in a similar fashion in the chick and duck regardless of the differences in interdigital cell death and msx gene expression. Implantation of BMP-beads in the distal limb mesoderm induces AER regression in both the chick and duck. This finding suggests an additional role for BMPs in the physiological regression of the AER. It is proposed that the formation of webbed vs free-digit feet in amniota results from a premature differentiation of the interdigital mesoderm into connective tissue caused by a reduced expression of msx genes in the developing autopod. Copyright 1998 Academic Press.

[Detection of the exogenous gene copy number of the transgenic tomato anti-caries vaccine].

PubMed

Bai, Guo-hui; Liu, Jian-guo; Tian, Yuan; Chen, Zhu; Bai, Peng-yuan; Han, Qi; Gu, Yu; Guan, Xiao-yan; Wang, Hai-hui

2013-12-01

To detect the exogenous gene copy number of the transgenic tomato anti-caries vaccine by using the SYBR Green real-time PCR. Recombinant plasmid pEAC10 and pEPC10 were used as standard to detect genome samples of exogenous gene pacA-ctxB and pacP-ctxB by SYBR green fluorescent quantitation, then the average value was calculated as gene copy number. The copy number of the transgenic tomato carrying pacA-ctxB was 1.3 and the pacP-ctxB was 3.2. The transgenic tomato plants which have high stability are low-copy transgenic plants. Supported by National Natural Science Foundation of China (30160086, 81260164), Science and Technical Fund of Guizhou Province (LKZ[2011]41), Project of Technology Innovation Team in Guizhou Province, Leading Academic Discipline Construction Project in Guizhou Province and Excellent Scientific Research Team Cultivation Project in Zunyi Medical College ([2012]12).

Melatonin enhances thermotolerance by promoting cellular protein protection in tomato plants.

PubMed

Xu, Wen; Cai, Shu-Yu; Zhang, Yun; Wang, Yu; Ahammed, Golam Jalal; Xia, Xiao-Jian; Shi, Kai; Zhou, Yan-Hong; Yu, Jing-Quan; Reiter, Russel J; Zhou, Jie

2016-11-01

Melatonin is a pleiotropic signaling molecule that provides physiological protection against diverse environmental stresses in plants. Nonetheless, the mechanisms for melatonin-mediated thermotolerance remain largely unknown. Here, we report that endogenous melatonin levels increased with a rise in ambient temperature and that peaked at 40°C. Foliar pretreatment with an optimal dose of melatonin (10 μmol/L) or the overexpression of N-acetylserotonin methyltransferase (ASMT) gene effectively ameliorated heat-induced photoinhibition and electrolyte leakage in tomato plants. Both exogenous melatonin treatment and endogenous melatonin manipulation by overexpression of ASMT decreased the levels of insoluble and ubiquitinated proteins, but enhanced the expression of heat-shock proteins (HSPs) to refold denatured and unfolded proteins under heat stress. Meanwhile, melatonin also induced expression of several ATG genes and formation of autophagosomes to degrade aggregated proteins under the same stress. Proteomic profile analyses revealed that protein aggregates for a large number of biological processes accumulated in wild-type plants. However, exogenous melatonin treatment or overexpression of ASMT reduced the accumulation of aggregated proteins. Aggregation responsive proteins such as HSP70 and Rubisco activase were preferentially accumulated and ubiquitinated in wild-type plants under heat stress, while melatonin mitigated heat stress-induced accumulation and ubiquitination of aggregated proteins. These results suggest that melatonin promotes cellular protein protection through induction of HSPs and autophagy to refold or degrade denatured proteins under heat stress in tomato plants. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The AP2/ERF Transcription Factor DRNL Modulates Gynoecium Development and Affects Its Response to Cytokinin.

PubMed

Durán-Medina, Yolanda; Serwatowska, Joanna; Reyes-Olalde, J Irepan; de Folter, Stefan; Marsch-Martínez, Nayelli

2017-01-01

The gynoecium is the female reproductive system in flowering plants. It is a complex structure formed by different tissues, some that are essential for reproduction and others that facilitate the fertilization process and nurture and protect the developing seeds. The coordinated development of these different tissues during the formation of the gynoecium is important for reproductive success. Both hormones and genetic regulators guide the development of the different tissues. Auxin and cytokinin in particular have been found to play important roles in this process. On the other hand, the AP2/ERF2 transcription factor BOL/DRNL/ESR2/SOB is expressed at very early stages of aerial organ formation and has been proposed to be a marker for organ founder cells. In this work, we found that this gene is also expressed at later stages during gynoecium development, particularly at the lateral regions (the region related to the valves of the ovary). The loss of DRNL function affects gynoecium development. Some of the mutant phenotypes present similarities to those observed in plants treated with exogenous cytokinins, and AHP6 has been previously proposed to be a target of DRNL. Therefore, we explored the response of drnl-2 developing gynoecia to cytokinins, and found that the loss of DRNL function affects the response of the gynoecium to exogenously applied cytokinins in a developmental-stage-dependent manner. In summary, this gene participates during gynoecium development, possibly through the dynamic modulation of cytokinin homeostasis and response.

The AP2/ERF Transcription Factor DRNL Modulates Gynoecium Development and Affects Its Response to Cytokinin

PubMed Central

Durán-Medina, Yolanda; Serwatowska, Joanna; Reyes-Olalde, J. Irepan; de Folter, Stefan; Marsch-Martínez, Nayelli

2017-01-01

The gynoecium is the female reproductive system in flowering plants. It is a complex structure formed by different tissues, some that are essential for reproduction and others that facilitate the fertilization process and nurture and protect the developing seeds. The coordinated development of these different tissues during the formation of the gynoecium is important for reproductive success. Both hormones and genetic regulators guide the development of the different tissues. Auxin and cytokinin in particular have been found to play important roles in this process. On the other hand, the AP2/ERF2 transcription factor BOL/DRNL/ESR2/SOB is expressed at very early stages of aerial organ formation and has been proposed to be a marker for organ founder cells. In this work, we found that this gene is also expressed at later stages during gynoecium development, particularly at the lateral regions (the region related to the valves of the ovary). The loss of DRNL function affects gynoecium development. Some of the mutant phenotypes present similarities to those observed in plants treated with exogenous cytokinins, and AHP6 has been previously proposed to be a target of DRNL. Therefore, we explored the response of drnl-2 developing gynoecia to cytokinins, and found that the loss of DRNL function affects the response of the gynoecium to exogenously applied cytokinins in a developmental-stage-dependent manner. In summary, this gene participates during gynoecium development, possibly through the dynamic modulation of cytokinin homeostasis and response. PMID:29123539

Application of glycerol as a foliar spray activates the defence response and enhances disease resistance of Theobroma cacao.

PubMed

Zhang, Yufan; Smith, Philip; Maximova, Siela N; Guiltinan, Mark J

2015-01-01

Previous work has implicated glycerol-3-phosphate (G3P) as a mobile inducer of systemic immunity in plants. We tested the hypothesis that the exogenous application of glycerol as a foliar spray might enhance the disease resistance of Theobroma cacao through the modulation of endogenous G3P levels. We found that exogenous application of glycerol to cacao leaves over a period of 4 days increased the endogenous level of G3P and decreased the level of oleic acid (18:1). Reactive oxygen species (ROS) were produced (a marker of defence activation) and the expression of many pathogenesis-related genes was induced. Notably, the effects of glycerol application on G3P and 18:1 fatty acid content, and gene expression levels, in cacao leaves were dosage dependent. A 100 mm glycerol spray application was sufficient to stimulate the defence response without causing any observable damage, and resulted in a significantly decreased lesion formation by the cacao pathogen Phytophthora capsici; however, a 500 mm glycerol treatment led to chlorosis and cell death. The effects of glycerol treatment on the level of 18:1 and ROS were constrained to the locally treated leaves without affecting distal tissues. The mechanism of the glycerol-mediated defence response in cacao and its potential use as part of a sustainable farming system are discussed. © 2014 BSPP AND JOHN WILEY & SONS LTD.

Viral nanoparticle-encapsidated enzyme and restructured DNA for cell delivery and gene expression

PubMed Central

Liu, Jinny L.; Dixit, Aparna Banerjee; Robertson, Kelly L.; Qiao, Eric; Black, Lindsay W.

2014-01-01

Packaging specific exogenous active proteins and DNAs together within a single viral-nanocontainer is challenging. The bacteriophage T4 capsid (100 × 70 nm) is well suited for this purpose, because it can hold a single long DNA or multiple short pieces of DNA up to 170 kb packed together with more than 1,000 protein molecules. Any linear DNA can be packaged in vitro into purified procapsids. The capsid-targeting sequence (CTS) directs virtually any protein into the procapsid. Procapsids are assembled with specific CTS-directed exogenous proteins that are encapsidated before the DNA. The capsid also can display on its surface high-affinity eukaryotic cell-binding peptides or proteins that are in fusion with small outer capsid and head outer capsid surface-decoration proteins that can be added in vivo or in vitro. In this study, we demonstrate that the site-specific recombinase cyclic recombination (Cre) targeted into the procapsid is enzymatically active within the procapsid and recircularizes linear plasmid DNA containing two terminal loxP recognition sites when packaged in vitro. mCherry expression driven by a cytomegalovirus promoter in the capsid containing Cre-circularized DNA is enhanced over linear DNA, as shown in recipient eukaryotic cells. The efficient and specific packaging into capsids and the unpackaging of both DNA and protein with release of the enzymatically altered protein–DNA complexes from the nanoparticles into cells have potential in numerous downstream drug and gene therapeutic applications. PMID:25161284

Effect of proline on biochemical and molecular mechanisms in lettuce (Lactuca sativa L.) exposed to UV-B radiation.

PubMed

Aksakal, Ozkan; Tabay, Dilruba; Esringu, Aslıhan; Icoglu Aksakal, Feyza; Esim, Nevzat

2017-02-15

The purpose of the present study was to evaluate the role of proline (Pro) in relieving UV-B radiation-induced oxidative stress in lettuce. Lettuce seedlings were exposed to 3.3 W m -2 UV-B radiation for 12 h after pre-treatment sprayed with 20 mM Pro. The data for malondialdehyde (MDA), hydrogen peroxide (H 2 O 2 ), endogenous Pro level, the activities of antioxidant enzymes [superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), and peroxidase (POD)], total phenolic concentration, antioxidant capacity, expression of phenylalanine ammonia lyase (PAL), γ-tocopherol methyltransferase (γ-TMT) and proline dehydrogenase (ProDH) genes, phytohormone levels such as abscisic acid (ABA), gibberellic acid (GA), indole acetic acid (IAA) and salicylic acid (SA), soluble sugars and organic acids were recorded. It was found that Pro alleviated the oxidative damage in the seedlings of lettuce as demonstrated by lower lipid peroxidation and H 2 O 2 content, increasing the endogenous Pro level, the activity of antioxidant enzymes, total phenolic concentration and the antioxidant capacity. Additionally, it was revealed that exogenous application of Pro enhanced the levels of GA, IAA, the concentrations of soluble sugars and organic acids and expressions of PAL, γ-TMT and ProDH genes as compared to the control. The results obtained in this study suggest that pre-treatment with exogenous Pro provides important contributions to the increase in the UV-B tolerance of lettuce by regulating the biochemical mechanisms of UV-B response.

Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen.

PubMed

Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N; Chen, Fajun

2017-11-07

Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO 2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO 2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2, 1 and 2 N). It is elucidated that the increased levels of global atmospheric CO 2 concentration will trigger up-regulation of Bt toxin expression in transgenic rice, especially with appropriate increase of N fertilizer supply, while, to some extent, the exogenous Bt-transgene expression is reduced at sub-N levels (1/4 and 1/2N), even though the total protein of plant tissues is reduced and the plant growth is restricted. The unpredictable and stochastic occurrence of transgene silencing and epigenetic alternations remains unresolved for most transgenic plants. It is expected that N fertilization supply may promote the expression of transgenic Bt toxin in transgenic Bt rice, particularly under elevated CO 2 .

Molecular regulation of sex change induced by methyltestosterone -feeding and methyltestosterone -feeding withdrawal in the protogynous orange-spotted grouper.

PubMed

Wang, Qing; Liu, Yun; Peng, Cheng; Wang, Xiang; Xiao, Ling; Wang, Dengdong; Chen, Jiaxing; Zhang, Haifa; Zhao, Huihong; Li, Shuisheng; Zhang, Yong; Lin, Haoran

2017-08-01

The sex identity of fish can be easily manipulated by exogenous hormones. Treatment with 17-methyltestosterone (MT) has been widely used to induce a male fate, but the molecular and cellular processes underlying sex changes induced by MT treatments and the withdrawal of MT are not well studied. In this study, we systematically investigated gonadal histology, gene expression profiles, sex steroid hormone levels, and cellular changes during sex changes induced by MT-feeding and MT-feeding withdrawal in the protogynous orange-spotted grouper, Epinephelus coioides. Based on gonadal histology, we demonstrated that MT-feeding-induced sex reversal can be divided into early and late phases: in the early phase, male and female germ cells coexist, and MT-feeding withdrawal leads to a female fate; in the late phase, only male germ cells are observed, and MT-feeding withdrawal does not reverse the process, leading to a male fate. In both the early and late phases, cytochrome P450 family19 subfamily A member 1 (cyp19a1a) gene expression increased in response to MT-feeding withdrawal. Finally, by tracing doublesex- and Mab-3-related transcription factor 1 (dmrt1)-expressing cells, we found that gonia-like cells in the germinal epithelium might be the major germ cell sources for developing testes during sex reversal. Collectively, our findings provide insights into the molecular and cellular mechanisms underlying sex changes induced by exogenous hormones. © The Authors 2017. Published by Oxford University Press on behalf of Society for the Study of Reproduction. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Electrical Stimuli Are Anti-Apoptotic in Skeletal Muscle via Extracellular ATP. Alteration of This Signal in Mdx Mice Is a Likely Cause of Dystrophy

PubMed Central

Valladares, Denisse; Almarza, Gonzalo; Contreras, Ariel; Pavez, Mario; Buvinic, Sonja; Jaimovich, Enrique; Casas, Mariana

2013-01-01

ATP signaling has been shown to regulate gene expression in skeletal muscle and to be altered in models of muscular dystrophy. We have previously shown that in normal muscle fibers, ATP released through Pannexin1 (Panx1) channels after electrical stimulation plays a role in activating some signaling pathways related to gene expression. We searched for a possible role of ATP signaling in the dystrophy phenotype. We used muscle fibers from flexor digitorum brevis isolated from normal and mdx mice. We demonstrated that low frequency electrical stimulation has an anti-apoptotic effect in normal muscle fibers repressing the expression of Bax, Bim and PUMA. Addition of exogenous ATP to the medium has a similar effect. In dystrophic fibers, the basal levels of extracellular ATP were higher compared to normal fibers, but unlike control fibers, they do not present any ATP release after low frequency electrical stimulation, suggesting an uncoupling between electrical stimulation and ATP release in this condition. Elevated levels of Panx1 and decreased levels of Cav1.1 (dihydropyridine receptors) were found in triads fractions prepared from mdx muscles. Moreover, decreased immunoprecipitation of Cav1.1 and Panx1, suggest uncoupling of the signaling machinery. Importantly, in dystrophic fibers, exogenous ATP was pro-apoptotic, inducing the transcription of Bax, Bim and PUMA and increasing the levels of activated Bax and cytosolic cytochrome c. These evidence points to an involvement of the ATP pathway in the activation of mechanisms related with cell death in muscular dystrophy, opening new perspectives towards possible targets for pharmacological therapies. PMID:24282497

Electrical stimuli are anti-apoptotic in skeletal muscle via extracellular ATP. Alteration of this signal in Mdx mice is a likely cause of dystrophy.

PubMed

Valladares, Denisse; Almarza, Gonzalo; Contreras, Ariel; Pavez, Mario; Buvinic, Sonja; Jaimovich, Enrique; Casas, Mariana

2013-01-01

ATP signaling has been shown to regulate gene expression in skeletal muscle and to be altered in models of muscular dystrophy. We have previously shown that in normal muscle fibers, ATP released through Pannexin1 (Panx1) channels after electrical stimulation plays a role in activating some signaling pathways related to gene expression. We searched for a possible role of ATP signaling in the dystrophy phenotype. We used muscle fibers from flexor digitorum brevis isolated from normal and mdx mice. We demonstrated that low frequency electrical stimulation has an anti-apoptotic effect in normal muscle fibers repressing the expression of Bax, Bim and PUMA. Addition of exogenous ATP to the medium has a similar effect. In dystrophic fibers, the basal levels of extracellular ATP were higher compared to normal fibers, but unlike control fibers, they do not present any ATP release after low frequency electrical stimulation, suggesting an uncoupling between electrical stimulation and ATP release in this condition. Elevated levels of Panx1 and decreased levels of Cav1.1 (dihydropyridine receptors) were found in triads fractions prepared from mdx muscles. Moreover, decreased immunoprecipitation of Cav1.1 and Panx1, suggest uncoupling of the signaling machinery. Importantly, in dystrophic fibers, exogenous ATP was pro-apoptotic, inducing the transcription of Bax, Bim and PUMA and increasing the levels of activated Bax and cytosolic cytochrome c. These evidence points to an involvement of the ATP pathway in the activation of mechanisms related with cell death in muscular dystrophy, opening new perspectives towards possible targets for pharmacological therapies.

ATP Released by Electrical Stimuli Elicits Calcium Transients and Gene Expression in Skeletal Muscle*

PubMed Central

Buvinic, Sonja; Almarza, Gonzalo; Bustamante, Mario; Casas, Mariana; López, Javiera; Riquelme, Manuel; Sáez, Juan Carlos; Huidobro-Toro, Juan Pablo; Jaimovich, Enrique

2009-01-01

ATP released from cells is known to activate plasma membrane P2X (ionotropic) or P2Y (metabotropic) receptors. In skeletal muscle cells, depolarizing stimuli induce both a fast calcium signal associated with contraction and a slow signal that regulates gene expression. Here we show that nucleotides released to the extracellular medium by electrical stimulation are partly involved in the fast component and are largely responsible for the slow signals. In rat skeletal myotubes, a tetanic stimulus (45 Hz, 400 1-ms pulses) rapidly increased extracellular levels of ATP, ADP, and AMP after 15 s to 3 min. Exogenous ATP induced an increase in intracellular free Ca2+ concentration, with an EC50 value of 7.8 ± 3.1 μm. Exogenous ADP, UTP, and UDP also promoted calcium transients. Both fast and slow calcium signals evoked by tetanic stimulation were inhibited by either 100 μm suramin or 2 units/ml apyrase. Apyrase also reduced fast and slow calcium signals evoked by tetanus (45 Hz, 400 0.3-ms pulses) in isolated mouse adult skeletal fibers. A likely candidate for the ATP release pathway is the pannexin-1 hemichannel; its blockers inhibited both calcium transients and ATP release. The dihydropyridine receptor co-precipitated with both the P2Y2 receptor and pannexin-1. As reported previously for electrical stimulation, 500 μm ATP significantly increased mRNA expression for both c-fos and interleukin 6. Our results suggest that nucleotides released during skeletal muscle activity through pannexin-1 hemichannels act through P2X and P2Y receptors to modulate both Ca2+ homeostasis and muscle physiology. PMID:19822518

Microarray analysis identifies keratin loci as sensitive biomarkers for thyroid hormone disruption in the salamander Ambystoma mexicanum.

PubMed

Page, Robert B; Monaghan, James R; Samuels, Amy K; Smith, Jeramiah J; Beachy, Christopher K; Voss, S Randal

2007-02-01

Ambystomatid salamanders offer several advantages for endocrine disruption research, including genomic and bioinformatics resources, an accessible laboratory model (Ambystoma mexicanum), and natural lineages that are broadly distributed among North American habitats. We used microarray analysis to measure the relative abundance of transcripts isolated from A. mexicanum epidermis (skin) after exogenous application of thyroid hormone (TH). Only one gene had a >2-fold change in transcript abundance after 2 days of TH treatment. However, hundreds of genes showed significantly different transcript levels at days 12 and 28 in comparison to day 0. A list of 123 TH-responsive genes was identified using statistical, BLAST, and fold level criteria. Cluster analysis identified two groups of genes with similar transcription patterns: up-regulated versus down-regulated. Most notably, several keratins exhibited dramatic (1000 fold) increases or decreases in transcript abundance. Keratin gene expression changes coincided with morphological remodeling of epithelial tissues. This suggests that keratin loci can be developed as sensitive biomarkers to assay temporal disruptions of larval-to-adult gene expression programs. Our study has identified the first collection of loci that are regulated during TH-induced metamorphosis in a salamander, thus setting the stage for future investigations of TH disruption in the Mexican axolotl and other salamanders of the genus Ambystoma.

Elucidating Cannabinoid Biology in Zebrafish (Danio rerio)

PubMed Central

Krug, Randall G.; Clark, Karl J.

2015-01-01

The number of annual cannabinoid users exceeds 100,000,000 globally and an estimated 9 % of these individuals will suffer from dependency. Although exogenous cannabinoids, like those contained in marijuana, are known to exert their effects by disrupting the endocannabinoid system, a dearth of knowledge exists about the potential toxicological consequences on public health. Conversely, the endocannabinoid system represents a promising therapeutic target for a plethora of disorders because it functions to endogenously regulate a vast repertoire of physiological functions. Accordingly, the rapidly expanding field of cannabinoid biology has sought to leverage model organisms in order to provide both toxicological and therapeutic insights about altered endocannabinoid signaling. The primary goal of this manuscript is to review the existing field of cannabinoid research in the genetically tractable zebrafish model—focusing on the cannabinoid receptor genes, cnr1 and cnr2, and the genes that produce enzymes for synthesis and degradation of the cognate ligands anandamide and 2-arachidonylglycerol. Consideration is also given to research that has studied the effects of exposure to exogenous phytocannabinoids and synthetic cannabinoids that are known to interact with cannabinoid receptors. These results are considered in the context of either endocannabinoid gene expression or endocannabinoid gene function, and are integrated with findings from rodent studies. This provides the framework for a discussion of how zebrafish may be leveraged in the future to provide novel toxicological and therapeutic insights in the field of cannabinoid biology, which has become increasingly significant given recent trends in cannabis legislation. PMID:26192460

In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.

PubMed

Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L

2009-10-01

To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the evaluation of radiolabeled hypoxia tracers.

GA3 and other signal regulators (MeJA and IAA) improve xanthumin biosynthesis in different manners in Xanthium strumarium L.

PubMed

Li, Changfu; Chen, Fangfang; Zhang, Yansheng

2014-08-25

Xanthanolides from Xanthium strumarium L. exhibit various pharmacological activities and these compounds are mainly produced in the glandular trichomes of aerial plant parts. The regulation of xanthanolide biosynthesis has never been reported in the literature. In this study, the effects of phytohormonal stimulation on xanthumin (a xanthanolide compound) biosynthesis, glandular trichomes and germacrene A synthase (GAS) gene expression in X. strumarium L. young leaves were investigated. The exogenous applications of methyl jasmonate (MeJA), indole-3-acetic acid (IAA), and gibberrellin A3 (GA3) at appropriate concentrations were all found to improve xanthumin biosynthesis, but in different ways. It was suggested that a higher gland density stimulated by MeJA (400 µM) or IAA (200 µM) treatment caused at least in part an improvement in xanthumin production, whereas GA3 (10 µM) led to an improvement by up-regulating xanthumin biosynthetic genes within gland cells, not by forming more glandular trichomes. Compared to the plants before the flowering stage, plants that had initiated flowering showed enhanced xanthumin biosynthesis, but no higher gland density, an effect was similar to that caused by exogenous GA3 treatment.

Enhanced expression of the urokinase-type plasminogen activator gene and reduced colony formation in soft agar by ectopic expression of PU.1 in HT1080 human fibrosarcoma cells.

PubMed Central

Kondoh, N.; Yamada, T.; Kihara-Negishi, F.; Yamamoto, M.; Oikawa, T.

1998-01-01

To investigate the cell biological function of PU.1, a member of the Ets family of transcription factors, a vector capable of expressing the protein was transfected into HT1080 human fibrosarcoma cells. Exogenous expression of PU.1 in HT1080 cells reduced colony-forming efficiency but stimulated cell migration in soft agar, although it did not affect cell growth in adherent culture. Expression of the urokinase-type plasminogen activator (uPA) mRNA, which is known to be correlated with cell migration and invasion, was enhanced in PU.1 transfectants compared with mock transfectants. Run-on analysis demonstrated that uPA transcription was unaffected by PU.1, suggesting that this enhancement mainly occurs at a post-transcriptional level. On the other hand, treatment of HT1080 cells with the synthetic glucocorticoid dexamethasone (DEX; 10(-7) M) significantly reduced uPA gene expression at a transcriptional level. Furthermore, DEX inhibited cell migration in soft agar without affecting cell growth. These negative effects of DEX on uPA expression and cell migration were alleviated by the expression of PU.1 in HT1080 cells, whereas expression of the N-ras oncogene, which is responsible for maintenance of the transformed phenotypes in HT1080 cells, was unaffected by PU.1 expression or DEX treatment in the cells. Our results suggest that expression of PU.1 can stimulate uPA gene expression at the post-transcriptional level, which may subsequently lead to activation of cell motility and/or reduced cell-cell adhesion, but reduces anchorage-independent growth of HT1080 cells. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:9743289

Enhanced Host-Parasite Resistance Based on Down-Regulation of Phelipanche aegyptiaca Target Genes Is Likely by Mobile Small RNA

PubMed Central

Dubey, Neeraj K.; Eizenberg, Hanan; Leibman, Diana; Wolf, Dalia; Edelstein, Menahem; Abu-Nassar, Jackline; Marzouk, Sally; Gal-On, Amit; Aly, Radi

2017-01-01

RNA silencing refers to diverse mechanisms that control gene expression at transcriptional and post-transcriptional levels which can also be used in parasitic pathogens of plants that Broomrapes (Orobanche/Phelipanche spp.) are holoparasitic plants that subsist on the roots of a variety of agricultural crops and cause severe negative effects on the yield and yield quality of those crops. Effective methods for controlling parasitic weeds are scarce, with only a few known cases of genetic resistance. In the current study, we suggest an improved strategy for the control of parasitic weeds based on trans-specific gene-silencing of three parasite genes at once. We used two strategies to express dsRNA containing selected sequences of three Phelipanche aegyptiaca genes PaACS, PaM6PR, and PaPrx1 (pma): transient expression using Tobacco rattle virus (TRV:pma) as a virus-induced gene-silencing vector and stable expression in transgenic tomato Solanum lycopersicum (Mill.) plants harboring a hairpin construct (pBINPLUS35:pma). siRNA-mediated transgene-silencing (20–24 nt) was detected in the host plants. Our results demonstrate that the quantities of PaACS and PaM6PR transcripts from P. aegyptiaca tubercles grown on transgenic tomato or on TRV-infected Nicotiana benthamiana plants were significantly reduced. However, only partial reductions in the quantity of PaPrx1 transcripts were observed in the parasite tubercles grown on tomato and on N. benthamiana plants. Concomitant with the suppression of the target genes, there were significant decreases in the number and weight of the parasite tubercles that grew on the host plants, in both the transient and the stable experimental systems. The results of the work carried out using both strategies point to the movement of mobile exogenous siRNA from the host to the parasite, leading to the impaired expression of essential parasite target genes. PMID:28955363

Expression of tropodithietic acid biosynthesis is controlled by a novel autoinducer.

PubMed

Geng, Haifeng; Belas, Robert

2010-09-01

The interactions between marine prokaryotic and eukaryotic microorganisms are crucial to many biological and biogeochemical processes in the oceans. Often the interactions are mutualistic, as in the symbiosis between phytoplankton, e.g., the dinoflagellate Pfiesteria piscicida and Silicibacter sp. TM1040, a member of the Roseobacter taxonomic lineage. It is hypothesized that an important component of this symbiosis is bacterial production of tropodithietic acid (TDA), a biologically active tropolone compound whose synthesis requires the expression of tdaABCDEF (tdaA-F), as well as six additional genes (cysI, malY, paaIJK, and tdaH). The factors controlling tda gene expression are not known, although growth in laboratory standing liquid cultures drastically increases TDA levels. In this report, we measured the transcription of tda genes to gain a greater understanding of the factors controlling their expression. While the expression of tdaAB was constitutive, tdaCDE and tdaF mRNA increased significantly (3.7- and 17.4-fold, respectively) when cells were grown in standing liquid broth compared to their levels with shaking liquid culturing. No transcription of tdaC was detected when a tdaCp::lacZ transcriptional fusion was placed in 11 of the 12 Tda(-) mutant backgrounds, with cysI being the sole exception. The expression of tdaC could be restored to 9 of the remaining 11 Tda(-) mutants-tdaA and tdaH failed to respond-by placing wild-type (Tda(+)) strains in close proximity or by supplying exogenous TDA to the mutant, suggesting that TDA induces tda gene expression. These results indicate that TDA acts as an autoinducer of its own synthesis and suggest that roseobacters may use TDA as a quorum signal.

Expression of Tropodithietic Acid Biosynthesis Is Controlled by a Novel Autoinducer▿ †

PubMed Central

Geng, Haifeng; Belas, Robert

2010-01-01

The interactions between marine prokaryotic and eukaryotic microorganisms are crucial to many biological and biogeochemical processes in the oceans. Often the interactions are mutualistic, as in the symbiosis between phytoplankton, e.g., the dinoflagellate Pfiesteria piscicida and Silicibacter sp. TM1040, a member of the Roseobacter taxonomic lineage. It is hypothesized that an important component of this symbiosis is bacterial production of tropodithietic acid (TDA), a biologically active tropolone compound whose synthesis requires the expression of tdaABCDEF (tdaA-F), as well as six additional genes (cysI, malY, paaIJK, and tdaH). The factors controlling tda gene expression are not known, although growth in laboratory standing liquid cultures drastically increases TDA levels. In this report, we measured the transcription of tda genes to gain a greater understanding of the factors controlling their expression. While the expression of tdaAB was constitutive, tdaCDE and tdaF mRNA increased significantly (3.7- and 17.4-fold, respectively) when cells were grown in standing liquid broth compared to their levels with shaking liquid culturing. No transcription of tdaC was detected when a tdaCp::lacZ transcriptional fusion was placed in 11 of the 12 Tda− mutant backgrounds, with cysI being the sole exception. The expression of tdaC could be restored to 9 of the remaining 11 Tda− mutants—tdaA and tdaH failed to respond—by placing wild-type (Tda+) strains in close proximity or by supplying exogenous TDA to the mutant, suggesting that TDA induces tda gene expression. These results indicate that TDA acts as an autoinducer of its own synthesis and suggest that roseobacters may use TDA as a quorum signal. PMID:20601479

Stimulation of neurotrophic factors and inhibition of proinflammatory cytokines by exogenous application of triiodothyronine in the rat model of ischemic stroke.

PubMed

Sabbaghziarani, Fatemeh; Mortezaee, Keywan; Akbari, Mohammad; Kashani, Iraj Ragerdi; Soleimani, Mansooreh; Hassanzadeh, Gholamreza; Zendedel, Adib

2017-01-01

There is a positive relation between decreases of triiodothyronine (T3) amounts and severity of stroke. The aim of this study was to evaluate the effect of exogenous T3 application on levels of neurogenesis markers in the subventricular zone. Cerebral ischemia was induced by middle cerebral artery occlusion in male Wistar rats. There were 4 experimental groups: sham, ischemic, vehicle, and treatment. Rats were injected with T3 (25 μg/kg, IV injection) at 24 hours after ischemia. Animals were sacrificed at day 7 after ischemia. There were high levels of brain-derived neurotrophic factor, nestin, and Sox2 expressions in gene and protein levels in the T3 treatment group (P ≤ .05 vs ischemic group). Treatment group showed high levels of sera T3 and thyroxine (T4) but low levels of thyrotropin (TSH), tumor necrosis factor-α, and interleukin-6 (P ≤ .05 vs ischemic group) at day 4 after ischemia induction. Findings of this study revealed the effectiveness of exogenous T3 application in the improvement of neurogenesis possibly via regulation of proinflammatory cytokines. Copyright © 2017 John Wiley & Sons, Ltd.

A specific glycerol kinase induces rapid cold hardening of the diamondback moth, Plutella xylostella.

PubMed

Park, Youngjin; Kim, Yonggyun

2014-08-01

Insects in temperate zones survive low temperatures by migrating or tolerating the cold. The diamondback moth, Plutella xylostella, is a serious insect pest on cabbage and other cruciferous crops worldwide. We showed that P. xylostella became cold-tolerant by expressing rapid cold hardiness (RCH) in response to a brief exposure to moderately low temperature (4°C) for 7h along with glycerol accumulation in hemolymph. Glycerol played a crucial role in the cold-hardening process because exogenously supplying glycerol significantly increased the cold tolerance of P. xylostella larvae without cold acclimation. To determine the genetic factor(s) responsible for RCH and the increase of glycerol, four glycerol kinases (GKs), and glycerol-3-phosphate dehydrogenase (PxGPDH) were predicted from the whole P. xylostella genome and analyzed for their function associated with glycerol biosynthesis. All predicted genes were expressed, but differed in their expression during different developmental stages and in different tissues. Expression of the predicted genes was individually suppressed by RNA interference (RNAi) using double-stranded RNAs specific to target genes. RNAi of PxGPDH expression significantly suppressed RCH and glycerol accumulation. Only PxGK1 among the four GKs was responsible for RCH and glycerol accumulation. Furthermore, PxGK1 expression was significantly enhanced during RCH. These results indicate that a specific GK, the terminal enzyme to produce glycerol, is specifically inducible during RCH to accumulate the main cryoprotectant. Copyright © 2014 Elsevier Ltd. All rights reserved.

Pyruvate kinase isoform expression alters nucleotide synthesis to impact cell proliferation

PubMed Central

Lunt, Sophia Y.; Muralidhar, Vinayak; Hosios, Aaron M.; Israelsen, William J.; Gui, Dan Y.; Newhouse, Lauren; Ogrodzinski, Martin; Hecht, Vivian; Xu, Kali; Acevedo, Paula N. Marín; Hollern, Daniel P.; Bellinger, Gary; Dayton, Talya L.; Christen, Stefan; Elia, Ilaria; Dinh, Anh T.; Stephanopoulos, Gregory; Manalis, Scott R.; Yaffe, Michael B.; Andrechek, Eran R.; Fendt, Sarah-Maria; Heiden, Matthew G. Vander

2014-01-01

SUMMARY Metabolic regulation influences cell proliferation. The influence of pyruvate kinase isoforms on tumor cells has been extensively studied, but whether PKM2 is required for normal cell proliferation is unknown. We examine how PKM2-deletion affects proliferation and metabolism in non-transformed, non-immortalized PKM2-expressing primary cells. We find that deletion of PKM2 in primary cells results in PKM1 expression and proliferation arrest. PKM1 expression, rather than PKM2 loss, is responsible for this effect, and proliferation arrest cannot be explained by cell differentiation, senescence, death, changes in gene expression, or prevention of cell growth. Instead, PKM1 expression impairs nucleotide production and the ability to synthesize DNA and progress through the cell cycle. Nucleotide biosynthesis is limiting, as proliferation arrest is characterized by severe thymidine depletion, and supplying exogenous thymine rescues both nucleotide levels and cell proliferation. Thus, PKM1 expression promotes a metabolic state that is unable to support DNA synthesis. PMID:25482511

Exogenous IFN-beta regulates the RANKL-c-Fos-IFN-beta signaling pathway in the collagen antibody-induced arthritis model.

PubMed

Zhao, Rong; Chen, Ni-Nan; Zhou, Xiao-Wei; Miao, Ping; Hu, Chao-Ying; Qian, Liu; Yu, Qi-Wen; Zhang, Ji-Ying; Nie, Hong; Chen, Xue-hua; Li, Pu; Xu, Rong; Xiao, Lian-Bo; Zhang, Xin; Liu, Jian-Ren; Zhang, Dong-Qing

2014-12-10

Although a variety of drugs have been used to treat the symptoms of rheumatoid arthritis (RA), none of them are able to cure the disease. Interferon β (IFN-β) has pleiotropic effects on RA, but whether it can be used to treat RA remains globally controversial. Thus, in this study we tested the effects of IFN-β on RA patients and on collagen antibody-induced arthritis (CAIA) model mice. The cytokine and auto-antibody expression profiles in the serum and synovial fluid (SF) from RA patients were assessed using enzyme-linked immunosorbent assay (ELISA) and compared with the results from osteoarthritis (OA) patients. Exogenous IFN-β was administered to RA patients and CAIA model mice, and the therapeutic effects were evaluated. Endogenous IFN-β expression in the joint bones of CAIA model mice was evaluated by quantitative real-time PCR (qRT-PCR). The effects of exogenous IFN-β on CAIA model mice were assessed using a clinical scoring system, hematoxylin eosin and safranin-O with fast green counterstain histology, molybdenum target X-ray, and tartrate-resistant acid phosphatase (TRAP) staining. The RANKL-RANK signaling pathway was analyzed using qRT-PCR. The RAW 264.7 cell line was differentiated into osteoclasts with RANKL stimulation and then treated with exogenous IFN-β. The expression of inflammatory cytokines (IFN-γ, IL-17, MMP-3, and RANKL) and auto-antibodies (CII antibodies, RF-IgM, and anti-CCP/GPI) were significantly higher in RA compared with OA patients. After IFN-β intervention, some clinical symptoms in RA patients were partially alleviated, and the expression of IFN-γ, IL-17, MMP-3, and OPG) returned to normal levels. In the CAIA model, the expression of endogenous IFN-β in the joint bones was decreased. After IFN-β administration, the arthritis scores were decreased; synovial inflammation, cartilage, and bone destruction were clearly attenuated; and the expression of c-Fos and NFATc1 were reduced, while RANKL and TRAF6 expression was unchanged. In addition, exogenous IFN-β directly inhibited RANKL-induced osteoclastogenesis. Exogenous IFN-β administration immunomodulates CAIA, may reduce joint inflammation and, perhaps more importantly, bone destruction by inhibiting the RANKL-c-Fos signaling pathway. Exogenous IFN-β intervention should be selectively used on RA patients because it may only be useful for RA patients with low endogenous IFN-β expression.

OsLOL1, a C2C2-type zinc finger protein, interacts with OsbZIP58 to promote seed germination through the modulation of gibberellin biosynthesis in Oryza sativa.

PubMed

Wu, Jiahe; Zhu, Chuanfeng; Pang, Jinhuan; Zhang, Xiangrong; Yang, Chunlin; Xia, Guixian; Tian, Yingchuan; He, Chaozu

2014-12-01

Seed germination is a key developmental process in the plant life cycle that is influenced by various environmental cues and phytohormones through gene expression and a series of metabolism pathways. In the present study, we investigated a C2C2-type finger protein, OsLOL1, which promotes gibberellin (GA) biosynthesis and affects seed germination in Oryza sativa (rice). We used OsLOL1 antisense and sense transgenic lines to explore OsLOL1 functions. Seed germination timing in antisense plants was restored to wild type when exogenous GA3 was applied. The reduced expression of the GA biosynthesis gene OsKO2 and the accumulation of ent-kaurene were observed during germination in antisense plants. Based on yeast two-hybrid and firefly luciferase complementation analyses, OsLOL1 interacted with the basic leucine zipper protein OsbZIP58. The results from electrophoretic mobility shift and dual-luciferase reporter assays showed that OsbZIP58 binds the G-box cis-element of the OsKO2 promoter and activates LUC reporter gene expression, and that interaction between OsLOL1 and OsbZIP58 activates OsKO2 gene expression. In addition, OsLOL1 decreased SOD1 gene expression and accelerated programmed cell death (PCD) in the aleurone layer of rice grains. These findings demonstrate that the interaction between OsLOL1 and OsbZIP58 influences GA biosynthesis through the activation of OsKO2 via OsbZIP58, thereby stimulating aleurone PCD and seed germination. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Exogenous application of rutin and gallic acid regulate antioxidants and alleviate reactive oxygen generation in Oryza sativa L.

PubMed

Singh, Akanksha; Gupta, Rupali; Pandey, Rakesh

2017-04-01

The effect of rutin and gallic acid on growth, phytochemical and defense gene activation of rice ( Oryza sativa L.) was investigated. The seeds of rice were primed with different concentrations of rutin and gallic acid (10-60 µg mL -1 ) to explicate the effect on germination on water agar plates. Further, to study the effect of most effective concentrations of gallic acid (60 µg mL -1 ) and rutin (50 µg mL -1 ), greenhouse pot experiment was set up to determine the changes in growth, antioxidant and defense parameters. The results revealed more pronounced effect of gallic acid on total chlorophyll and carotenoids as well as on total flavonoid content and free radical scavenging activities. Gene expression analysis of OsWRKY71, PAL, CHS and LOX genes involved in strengthening the plant defense further validated the results obtained from the biochemical analysis. Microscopic analysis also confirmed reduction in total reactive oxygen species, free radicals like H 2 O 2 and O 2 - by exogenous application of gallic acid and rutin. The data obtained thus suggest that both gallic acid and rutin can affect the growth and physiology of rice plants and therefore can be used to develop effective plant growth promoters and as substitute of biofertilizers for maximizing their use in field conditions.

Arabidopsis PIZZA has the capacity to acylate brassinosteroids.

PubMed

Schneider, Katja; Breuer, Christian; Kawamura, Ayako; Jikumaru, Yusuke; Hanada, Atsushi; Fujioka, Shozo; Ichikawa, Takanari; Kondou, Youichi; Matsui, Minami; Kamiya, Yuji; Yamaguchi, Shinjiro; Sugimoto, Keiko

2012-01-01

Brassinosteroids (BRs) affect a wide range of developmental processes in plants and compromised production or signalling of BRs causes severe growth defects. To identify new regulators of plant organ growth, we searched the Arabidopsis FOX (Full-length cDNA Over-eXpressor gene) collection for mutants with altered organ size and isolated two overexpression lines that display typical BR deficient dwarf phenotypes. The phenotype of these lines, caused by an overexpression of a putative acyltransferase gene PIZZA (PIZ), was partly rescued by supplying exogenous brassinolide (BL) and castasterone (CS), indicating that endogenous BR levels are rate-limiting for the growth of PIZ overexpression lines. Our transcript analysis further showed that PIZ overexpression leads to an elevated expression of genes involved in BR biosynthesis and a reduced expression of BR inactivating hydroxylases, a transcriptional response typical to low BR levels. Taking the advantage of relatively high endogenous BR accumulation in a mild bri1-301 background, we found that overexpression of PIZ results in moderately reduced levels of BL and CS and a strong reduction of typhasterol (TY) and 6-deoxocastasterone (6-deoxoCS), suggesting a role of PIZ in BR metabolism. We tested a set of potential substrates in vitro for heterologously expressed PIZ and confirmed its acyltransferase activity with BL, CS and TY. The PIZ gene is expressed in various tissues but as reported for other genes involved in BR metabolism, the loss-of-function mutants did not display obvious growth phenotypes under standard growth conditions. Together, our data suggest that PIZ can modify BRs by acylation and that these properties might help modulating endogenous BR levels in Arabidopsis.

NHR-49/HNF4 integrates regulation of fatty acid metabolism with a protective transcriptional response to oxidative stress and fasting.

PubMed

Goh, Grace Y S; Winter, Johnathan J; Bhanshali, Forum; Doering, Kelsie R S; Lai, Regina; Lee, Kayoung; Veal, Elizabeth A; Taubert, Stefan

2018-06-01

Endogenous and exogenous stresses elicit transcriptional responses that limit damage and promote cell/organismal survival. Like its mammalian counterparts, hepatocyte nuclear factor 4 (HNF4) and peroxisome proliferator-activated receptor α (PPARα), Caenorhabditis elegans NHR-49 is a well-established regulator of lipid metabolism. Here, we reveal that NHR-49 is essential to activate a transcriptional response common to organic peroxide and fasting, which includes the pro-longevity gene fmo-2/flavin-containing monooxygenase. These NHR-49-dependent, stress-responsive genes are also upregulated in long-lived glp-1/notch receptor mutants, with two of them making critical contributions to the oxidative stress resistance of wild-type and long-lived glp-1 mutants worms. Similar to its role in lipid metabolism, NHR-49 requires the mediator subunit mdt-15 to promote stress-induced gene expression. However, NHR-49 acts independently from the transcription factor hlh-30/TFEB that also promotes fmo-2 expression. We show that activation of the p38 MAPK, PMK-1, which is important for adaptation to a variety of stresses, is also important for peroxide-induced expression of a subset of NHR-49-dependent genes that includes fmo-2. However, organic peroxide increases NHR-49 protein levels, by a posttranscriptional mechanism that does not require PMK-1 activation. Together, these findings establish a new role for the HNF4/PPARα-related NHR-49 as a stress-activated regulator of cytoprotective gene expression. © 2018 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Gene expression and metabolite profiling of gibberellin biosynthesis during induction of somatic embryogenesis in Medicago truncatula Gaertn

PubMed Central

Igielski, Rafał

2017-01-01

Gibberellins (GAs) are involved in the regulation of numerous developmental processes in plants including zygotic embryogenesis, but their biosynthesis and role during somatic embryogenesis (SE) is mostly unknown. In this study we show that during three week- long induction phase, when cells of leaf explants from non-embryogenic genotype (M9) and embryogenic variant (M9-10a) were forming the callus, all the bioactive gibberellins from non-13-hydroxylation (GA4, GA7) and 13-hydroxylation (GA1, GA5, GA3, GA6) pathways were present, but the contents of only a few of them differed between the tested lines. The GA53 and GA19 substrates synthesized by the 13-hydroxylation pathway accumulated specifically in the M9-10a line after the first week of induction; subsequently, among the bioactive gibberellins detected, only the content of GA3 increased and appeared to be connected with acquisition of embryogenic competence. We fully annotated 20 Medicago truncatula orthologous genes coding the enzymes which catalyze all the known reactions of gibberellin biosynthesis. Our results indicate that, within all the genes tested, expression of only three: MtCPS, MtGA3ox1 and MtGA3ox2, was specific to embryogenic explants and reflected the changes observed in GA53, GA19 and GA3 contents. Moreover, by analyzing expression of MtBBM, SE marker gene, we confirmed the inhibitory effect of manipulation in GAs metabolism, applying exogenous GA3, which not only impaired the production of somatic embryos, but also significantly decreased expression of this gene. PMID:28750086

Necessity of OxyR for the hydrogen peroxide stress response and full virulence in Ralstonia solanacearum.

PubMed

Flores-Cruz, Zomary; Allen, Caitilyn

2011-09-01

The plant pathogen Ralstonia solanacearum, which causes bacterial wilt disease, is exposed to reactive oxygen species (ROS) during tomato infection and expresses diverse oxidative stress response (OSR) genes during midstage disease on tomato. The R. solanacearum genome predicts that the bacterium produces multiple and redundant ROS-scavenging enzymes but only one known oxidative stress response regulator, OxyR. An R. solanacearum oxyR mutant had no detectable catalase activity, did not grow in the presence of 250 μM hydrogen peroxide, and grew poorly in the oxidative environment of solid rich media. This phenotype was rescued by the addition of exogenous catalase, suggesting that oxyR is essential for the hydrogen peroxide stress response. Unexpectedly, the oxyR mutant strain grew better than the wild type in the presence of the superoxide generator paraquat. Gene expression studies indicated that katE, kaG, ahpC1, grxC, and oxyR itself were each differentially expressed in the oxyR mutant background and in response to hydrogen peroxide, suggesting that oxyR is necessary for hydrogen peroxide-inducible gene expression. Additional OSR genes were differentially regulated in response to hydrogen peroxide alone. The virulence of the oxyR mutant strain was significantly reduced in both tomato and tobacco host plants, demonstrating that R. solanacearum is exposed to inhibitory concentrations of ROS in planta and that OxyR-mediated responses to ROS during plant pathogenesis are important for R. solanacearum host adaptation and virulence.

JcDREB2, a Physic Nut AP2/ERF Gene, Alters Plant Growth and Salinity Stress Responses in Transgenic Rice.

PubMed

Tang, Yuehui; Liu, Kun; Zhang, Ju; Li, Xiaoli; Xu, Kedong; Zhang, Yi; Qi, Jing; Yu, Deshui; Wang, Jian; Li, Chengwei

2017-01-01

Transcription factors of the AP2/ERF family play important roles in plant growth, development, and responses to biotic and abiotic stresses. In this study, a physic nut AP2/ERF gene, JcDREB2 , was functionally characterized. Real-time PCR analysis revealed that JcDREB2 was expressed mainly in the leaf and could be induced by abscisic acid but suppressed by gibberellin (GA) and salt. Transient expression of a JcDREB2-YFP fusion protein in Arabidopsis protoplasts cells suggested that JcDREB2 is localized in the nucleus. Rice plants overexpressing JcDREB2 exhibited dwarf and GA-deficient phenotypes with shorter shoots and roots than those of wild-type plants. The dwarfism phenotype could be rescued by the application of exogenous GA 3 . The expression levels of GA biosynthetic genes including OsGA20ox1 , OsGA20ox2 , OsGA20ox4 , OsGA3ox2, OsCPS1 , OsKO2 , and OsKAO were significantly reduced in plants overexpressing JcDREB2 . Overexpression of JcDREB2 in rice increased sensitivity to salt stress. Increases in the expression levels of several salt-tolerance-related genes in response to salt stress were impaired in JcDREB2 -overexpressing plants. These results demonstrated not only that JcDREB2 influences GA metabolism, but also that it can participate in the regulation of the salt stress response in rice.

Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds

PubMed Central

Chen, Zhenliang; Liao, Rongrong; Zhang, Xiangzhe; Wang, Qishan; Pan, Yuchun

2014-01-01

Copper is required for structural and catalytic properties of a variety of enzymes participating in many vital biological processes for growth and development. Feeds provide most of the copper as an essential micronutrient consumed by animals, but inorganic copper could not be utilized effectively. In the present study, we aimed to develop transgenic mouse models to test if copper utilization will be increased by providing the animals with an exogenous gene for generation of copper chelatin in saliva. Considering that the S. cerevisiae CUP1 gene encodes a Cys-rich protein that can bind copper as specifically as copper chelatin in yeast, we therefore constructed a transgene plasmid containing the CUP1 gene regulated for specific expression in the salivary glands by a promoter of gene coding pig parotid secretory protein. Transgenic CUP1 was highly expressed in the parotid and submandibular salivary glands and secreted in saliva as a 9-kDa copper-chelating protein. Expression of salivary copper-chelating proteins reduced fecal copper contents by 21.61% and increased body-weight by 12.97%, suggesting that chelating proteins improve the utilization and absorbed efficacy of copper. No negative effects on the health of the transgenic mice were found by blood biochemistry and histology analysis. These results demonstrate that the introduction of the salivary CUP1 transgene into animals offers a possible approach to increase the utilization efficiency of copper and decrease the fecal copper contents. PMID:25265503

The Role of Ethylene and Cold Temperature in the Regulation of the Apple POLYGALACTURONASE1 Gene and Fruit Softening1[W][OA

PubMed Central

Tacken, Emma; Ireland, Hilary; Gunaseelan, Kularajathevan; Karunairetnam, Sakuntala; Wang, Daisy; Schultz, Keith; Bowen, Judith; Atkinson, Ross G.; Johnston, Jason W.; Putterill, Jo; Hellens, Roger P.; Schaffer, Robert J.

2010-01-01

Fruit softening in apple (Malus × domestica) is associated with an increase in the ripening hormone ethylene. Here, we show that in cv Royal Gala apples that have the ethylene biosynthetic gene ACC OXIDASE1 suppressed, a cold treatment preconditions the apples to soften independently of added ethylene. When a cold treatment is followed by an ethylene treatment, a more rapid softening occurs than in apples that have not had a cold treatment. Apple fruit softening has been associated with the increase in the expression of cell wall hydrolase genes. One such gene, POLYGALACTURONASE1 (PG1), increases in expression both with ethylene and following a cold treatment. Transcriptional regulation of PG1 through the ethylene pathway is likely to be through an ETHYLENE-INSENSITIVE3-like transcription factor, which increases in expression during apple fruit development and transactivates the PG1 promoter in transient assays in the presence of ethylene. A cold-related gene that resembles a COLD BINDING FACTOR (CBF) class of gene also transactivates the PG1 promoter. The transactivation by the CBF-like gene is greatly enhanced by the addition of exogenous ethylene. These observations give a possible molecular mechanism for the cold- and ethylene-regulated control of fruit softening and suggest that either these two pathways act independently and synergistically with each other or cold enhances the ethylene response such that background levels of ethylene in the ethylene-suppressed apples is sufficient to induce fruit softening in apples. PMID:20237022