Sample records for experiments gene expression

  1. FARO server: Meta-analysis of gene expression by matching gene expression signatures to a compendium of public gene expression data.

    PubMed

    Manijak, Mieszko P; Nielsen, Henrik B

    2011-06-11

    Although, systematic analysis of gene annotation is a powerful tool for interpreting gene expression data, it sometimes is blurred by incomplete gene annotation, missing expression response of key genes and secondary gene expression responses. These shortcomings may be partially circumvented by instead matching gene expression signatures to signatures of other experiments. To facilitate this we present the Functional Association Response by Overlap (FARO) server, that match input signatures to a compendium of 242 gene expression signatures, extracted from more than 1700 Arabidopsis microarray experiments. Hereby we present a publicly available tool for robust characterization of Arabidopsis gene expression experiments which can point to similar experimental factors in other experiments. The server is available at http://www.cbs.dtu.dk/services/faro/.

  2. Identification of reference genes for quantitative expression analysis using large-scale RNA-seq data of Arabidopsis thaliana and model crop plants.

    PubMed

    Kudo, Toru; Sasaki, Yohei; Terashima, Shin; Matsuda-Imai, Noriko; Takano, Tomoyuki; Saito, Misa; Kanno, Maasa; Ozaki, Soichi; Suwabe, Keita; Suzuki, Go; Watanabe, Masao; Matsuoka, Makoto; Takayama, Seiji; Yano, Kentaro

    2016-10-13

    In quantitative gene expression analysis, normalization using a reference gene as an internal control is frequently performed for appropriate interpretation of the results. Efforts have been devoted to exploring superior novel reference genes using microarray transcriptomic data and to evaluating commonly used reference genes by targeting analysis. However, because the number of specifically detectable genes is totally dependent on probe design in the microarray analysis, exploration using microarray data may miss some of the best choices for the reference genes. Recently emerging RNA sequencing (RNA-seq) provides an ideal resource for comprehensive exploration of reference genes since this method is capable of detecting all expressed genes, in principle including even unknown genes. We report the results of a comprehensive exploration of reference genes using public RNA-seq data from plants such as Arabidopsis thaliana (Arabidopsis), Glycine max (soybean), Solanum lycopersicum (tomato) and Oryza sativa (rice). To select reference genes suitable for the broadest experimental conditions possible, candidates were surveyed by the following four steps: (1) evaluation of the basal expression level of each gene in each experiment; (2) evaluation of the expression stability of each gene in each experiment; (3) evaluation of the expression stability of each gene across the experiments; and (4) selection of top-ranked genes, after ranking according to the number of experiments in which the gene was expressed stably. Employing this procedure, 13, 10, 12 and 21 top candidates for reference genes were proposed in Arabidopsis, soybean, tomato and rice, respectively. Microarray expression data confirmed that the expression of the proposed reference genes under broad experimental conditions was more stable than that of commonly used reference genes. These novel reference genes will be useful for analyzing gene expression profiles across experiments carried out under various experimental conditions.

  3. MARQ: an online tool to mine GEO for experiments with similar or opposite gene expression signatures.

    PubMed

    Vazquez, Miguel; Nogales-Cadenas, Ruben; Arroyo, Javier; Botías, Pedro; García, Raul; Carazo, Jose M; Tirado, Francisco; Pascual-Montano, Alberto; Carmona-Saez, Pedro

    2010-07-01

    The enormous amount of data available in public gene expression repositories such as Gene Expression Omnibus (GEO) offers an inestimable resource to explore gene expression programs across several organisms and conditions. This information can be used to discover experiments that induce similar or opposite gene expression patterns to a given query, which in turn may lead to the discovery of new relationships among diseases, drugs or pathways, as well as the generation of new hypotheses. In this work, we present MARQ, a web-based application that allows researchers to compare a query set of genes, e.g. a set of over- and under-expressed genes, against a signature database built from GEO datasets for different organisms and platforms. MARQ offers an easy-to-use and integrated environment to mine GEO, in order to identify conditions that induce similar or opposite gene expression patterns to a given experimental condition. MARQ also includes additional functionalities for the exploration of the results, including a meta-analysis pipeline to find genes that are differentially expressed across different experiments. The application is freely available at http://marq.dacya.ucm.es.

  4. An efficient method to identify differentially expressed genes in microarray experiments

    PubMed Central

    Qin, Huaizhen; Feng, Tao; Harding, Scott A.; Tsai, Chung-Jui; Zhang, Shuanglin

    2013-01-01

    Motivation Microarray experiments typically analyze thousands to tens of thousands of genes from small numbers of biological replicates. The fact that genes are normally expressed in functionally relevant patterns suggests that gene-expression data can be stratified and clustered into relatively homogenous groups. Cluster-wise dimensionality reduction should make it feasible to improve screening power while minimizing information loss. Results We propose a powerful and computationally simple method for finding differentially expressed genes in small microarray experiments. The method incorporates a novel stratification-based tight clustering algorithm, principal component analysis and information pooling. Comprehensive simulations show that our method is substantially more powerful than the popular SAM and eBayes approaches. We applied the method to three real microarray datasets: one from a Populus nitrogen stress experiment with 3 biological replicates; and two from public microarray datasets of human cancers with 10 to 40 biological replicates. In all three analyses, our method proved more robust than the popular alternatives for identification of differentially expressed genes. Availability The C++ code to implement the proposed method is available upon request for academic use. PMID:18453554

  5. Promises and challenges of eco-physiological genomics in the field: tests of drought responses in switchgrass

    DOE PAGES

    Lovell, John T.; Shakirov, Eugene V.; Schwartz, Scott; ...

    2016-05-31

    Identifying the physiological and genetic basis of stress tolerance in plants has proven to be critical to understanding adaptation in both agricultural and natural systems. However, many discoveries were initially made in the controlled conditions of greenhouses or laboratories, not in the field. To test the comparability of drought responses across field and greenhouse environments, we undertook three independent experiments using the switchgrass reference genotype Alamo AP13. We analyzed physiological and gene expression variation across four locations, two sampling times, and three years. Relatively similar physiological responses and expression coefficients of variation across experiments masked highly dissimilar gene expression responsesmore » to drought. Critically, a drought experiment utilizing small pots in the greenhouse elicited nearly identical physiological changes as an experiment conducted in the field, but an order of magnitude more differentially expressed genes. However, we were able to define a suite of several hundred genes that were differentially expressed across all experiments. This list was strongly enriched in photosynthesis, water status, and reactive oxygen species responsive genes. The strong across-experiment correlations between physiological plasticity—but not differential gene expression—highlight the complex and diverse genetic mechanisms that can produce phenotypically similar responses to various soil water deficits.« less

  6. Promises and Challenges of Eco-Physiological Genomics in the Field: Tests of Drought Responses in Switchgrass1[OPEN

    PubMed Central

    Schwartz, Scott; Lowry, David B.; Aspinwall, Michael J.; Palacio-Mejia, Juan Diego; Hawkes, Christine V.; Fay, Philip A.

    2016-01-01

    Identifying the physiological and genetic basis of stress tolerance in plants has proven to be critical to understanding adaptation in both agricultural and natural systems. However, many discoveries were initially made in the controlled conditions of greenhouses or laboratories, not in the field. To test the comparability of drought responses across field and greenhouse environments, we undertook three independent experiments using the switchgrass reference genotype Alamo AP13. We analyzed physiological and gene expression variation across four locations, two sampling times, and three years. Relatively similar physiological responses and expression coefficients of variation across experiments masked highly dissimilar gene expression responses to drought. Critically, a drought experiment utilizing small pots in the greenhouse elicited nearly identical physiological changes as an experiment conducted in the field, but an order of magnitude more differentially expressed genes. However, we were able to define a suite of several hundred genes that were differentially expressed across all experiments. This list was strongly enriched in photosynthesis, water status, and reactive oxygen species responsive genes. The strong across-experiment correlations between physiological plasticity—but not differential gene expression—highlight the complex and diverse genetic mechanisms that can produce phenotypically similar responses to various soil water deficits. PMID:27246097

  7. dictyExpress: a Dictyostelium discoideum gene expression database with an explorative data analysis web-based interface.

    PubMed

    Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz

    2009-08-25

    Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms.

  8. dictyExpress: a Dictyostelium discoideum gene expression database with an explorative data analysis web-based interface

    PubMed Central

    Rot, Gregor; Parikh, Anup; Curk, Tomaz; Kuspa, Adam; Shaulsky, Gad; Zupan, Blaz

    2009-01-01

    Background Bioinformatics often leverages on recent advancements in computer science to support biologists in their scientific discovery process. Such efforts include the development of easy-to-use web interfaces to biomedical databases. Recent advancements in interactive web technologies require us to rethink the standard submit-and-wait paradigm, and craft bioinformatics web applications that share analytical and interactive power with their desktop relatives, while retaining simplicity and availability. Results We have developed dictyExpress, a web application that features a graphical, highly interactive explorative interface to our database that consists of more than 1000 Dictyostelium discoideum gene expression experiments. In dictyExpress, the user can select experiments and genes, perform gene clustering, view gene expression profiles across time, view gene co-expression networks, perform analyses of Gene Ontology term enrichment, and simultaneously display expression profiles for a selected gene in various experiments. Most importantly, these tasks are achieved through web applications whose components are seamlessly interlinked and immediately respond to events triggered by the user, thus providing a powerful explorative data analysis environment. Conclusion dictyExpress is a precursor for a new generation of web-based bioinformatics applications with simple but powerful interactive interfaces that resemble that of the modern desktop. While dictyExpress serves mainly the Dictyostelium research community, it is relatively easy to adapt it to other datasets. We propose that the design ideas behind dictyExpress will influence the development of similar applications for other model organisms. PMID:19706156

  9. Gene expression in the liver of rainbow trout, Oncorhynchus mykiss, during the stress response

    USGS Publications Warehouse

    Momoda, T.S.; Schwindt, A.R.; Feist, G.W.; Gerwick, L.; Bayne, C.J.; Schreck, C.B.

    2007-01-01

    To better appreciate the mechanisms underlying the physiology of the stress response, an oligonucleotide microarray and real-time RT-PCR (QRT-PCR) were used to study gene expression in the livers of rainbow trout (Oncorhynchus mykiss). For increased confidence in the discovery of candidate genes responding to stress, we conducted two separate experiments using fish from different year classes. In both experiments, fish exposed to a 3 h stressor were compared to control (unstressed) fish. In the second experiment some additional fish were exposed to only 0.5 h of stress and others were sampled 21 h after experiencing a 3 h stressor. This 21 h post-stress treatment was a means to study gene expression during recovery from stress. The genes we report as differentially expressed are those that responded similarly in both experiments, suggesting that they are robust indicators of stress. Those genes are a major histocompatibility complex class 1 molecule (MHC1), JunB, glucose 6-phosphatase (G6Pase), and nuclear protein 1 (Nupr1). Interestingly, Nupr1 gene expression was still elevated 21 h after stress, which indicates that recovery was incomplete at that time.

  10. GEOGLE: context mining tool for the correlation between gene expression and the phenotypic distinction.

    PubMed

    Yu, Yao; Tu, Kang; Zheng, Siyuan; Li, Yun; Ding, Guohui; Ping, Jie; Hao, Pei; Li, Yixue

    2009-08-25

    In the post-genomic era, the development of high-throughput gene expression detection technology provides huge amounts of experimental data, which challenges the traditional pipelines for data processing and analyzing in scientific researches. In our work, we integrated gene expression information from Gene Expression Omnibus (GEO), biomedical ontology from Medical Subject Headings (MeSH) and signaling pathway knowledge from sigPathway entries to develop a context mining tool for gene expression analysis - GEOGLE. GEOGLE offers a rapid and convenient way for searching relevant experimental datasets, pathways and biological terms according to multiple types of queries: including biomedical vocabularies, GDS IDs, gene IDs, pathway names and signature list. Moreover, GEOGLE summarizes the signature genes from a subset of GDSes and estimates the correlation between gene expression and the phenotypic distinction with an integrated p value. This approach performing global searching of expression data may expand the traditional way of collecting heterogeneous gene expression experiment data. GEOGLE is a novel tool that provides researchers a quantitative way to understand the correlation between gene expression and phenotypic distinction through meta-analysis of gene expression datasets from different experiments, as well as the biological meaning behind. The web site and user guide of GEOGLE are available at: http://omics.biosino.org:14000/kweb/workflow.jsp?id=00020.

  11. Comparative Evaluation of Two Serial Gene Expression Experiments | Division of Cancer Prevention

    Cancer.gov

    Stuart G. Baker, 2014 Introduction This program fits biologically relevant response curves in comparative analysis of the two gene expression experiments involving same genes but under different scenarios and at least 12 responses. The program outputs gene pairs with biologically relevant response curve shapes including flat, linear, sigmoid, hockey stick, impulse and step

  12. Applying Multivariate Adaptive Splines to Identify Genes With Expressions Varying After Diagnosis in Microarray Experiments.

    PubMed

    Duan, Fenghai; Xu, Ye

    2017-01-01

    To analyze a microarray experiment to identify the genes with expressions varying after the diagnosis of breast cancer. A total of 44 928 probe sets in an Affymetrix microarray data publicly available on Gene Expression Omnibus from 249 patients with breast cancer were analyzed by the nonparametric multivariate adaptive splines. Then, the identified genes with turning points were grouped by K-means clustering, and their network relationship was subsequently analyzed by the Ingenuity Pathway Analysis. In total, 1640 probe sets (genes) were reliably identified to have turning points along with the age at diagnosis in their expression profiling, of which 927 expressed lower after turning points and 713 expressed higher after the turning points. K-means clustered them into 3 groups with turning points centering at 54, 62.5, and 72, respectively. The pathway analysis showed that the identified genes were actively involved in various cancer-related functions or networks. In this article, we applied the nonparametric multivariate adaptive splines method to a publicly available gene expression data and successfully identified genes with expressions varying before and after breast cancer diagnosis.

  13. Dynamic gene expression response to altered gravity in human T cells.

    PubMed

    Thiel, Cora S; Hauschild, Swantje; Huge, Andreas; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver

    2017-07-12

    We investigated the dynamics of immediate and initial gene expression response to different gravitational environments in human Jurkat T lymphocytic cells and compared expression profiles to identify potential gravity-regulated genes and adaptation processes. We used the Affymetrix GeneChip® Human Transcriptome Array 2.0 containing 44,699 protein coding genes and 22,829 non-protein coding genes and performed the experiments during a parabolic flight and a suborbital ballistic rocket mission to cross-validate gravity-regulated gene expression through independent research platforms and different sets of control experiments to exclude other factors than alteration of gravity. We found that gene expression in human T cells rapidly responded to altered gravity in the time frame of 20 s and 5 min. The initial response to microgravity involved mostly regulatory RNAs. We identified three gravity-regulated genes which could be cross-validated in both completely independent experiment missions: ATP6V1A/D, a vacuolar H + -ATPase (V-ATPase) responsible for acidification during bone resorption, IGHD3-3/IGHD3-10, diversity genes of the immunoglobulin heavy-chain locus participating in V(D)J recombination, and LINC00837, a long intergenic non-protein coding RNA. Due to the extensive and rapid alteration of gene expression associated with regulatory RNAs, we conclude that human cells are equipped with a robust and efficient adaptation potential when challenged with altered gravitational environments.

  14. Reference genes for measuring mRNA expression.

    PubMed

    Dundas, Jitesh; Ling, Maurice

    2012-12-01

    The aim of this review is to find answers to some of the questions surrounding reference genes and their reliability for quantitative experiments. Reference genes are assumed to be at a constant expression level, over a range of conditions such as temperature. These genes, such as GADPH and beta-actin, are used extensively for gene expression studies using techniques like quantitative PCR. There have been several studies carried out on identifying reference genes. However, a lot of evidence indicates issues to the general suitability of these genes. Recent studies had shown that different factors, including the environment and methods, play an important role in changing the expression levels of the reference genes. Thus, we conclude that there is no reference gene that can deemed suitable for all the experimental conditions. In addition, we believe that every experiment will require the scientific evaluation and selection of the best candidate gene for use as a reference gene to obtain reliable scientific results.

  15. Gene expression variations during Drosophila metamorphosis in space: The GENE experiment in the Spanish cervantes missions to the ISS

    NASA Astrophysics Data System (ADS)

    Herranz, Raul; Benguria, Alberto; Medina, Javier; Gasset, Gilbert; van Loon, Jack J.; Zaballos, Angel; Marco, Roberto

    2005-08-01

    The ISS expedition 8, a Soyuz Mission, flew to the International Space Station (ISS) to replace the two- member ISS crew during October 2003. During this crew exchanging flight, the Spanish Cervantes Scientific Mission took place. In it some biological experiments were performed among them three proposed by our Team. The third member of the expedition, the Spanish born ESA astronaut Pedro Duque, returned within the Soyuz 7 capsule carrying the experiment containing transport box after almost 11 days in microgravity. In one of the three experiments, the GENE experiment, we intended to determine how microgravity affects the gene expression pattern of Drosophila with one of the current more powerful technologies , a complete Drosophila melanogaster genome microarray (AffymetrixTM, version 1.0). Due to the constrains in the current ISS experiments, we decided to limit our experiment to the organism rebuilding processes that occurs during Drosophila metamorphosis. In addition to the ISS samples, several control experiments have been performed including a 1g Ground control parallel to the ISS flight samples, a Random Position Machine microgravity simulated control and a parallel Hypergravity (10g) experiment. Extracted RNA from the samples was used to test the differences in gene expression during Drosophila development. A preliminary analysis of the results indicates that around five hundred genes change their expression profiles, many of them belonging to particular ontology classification groups.

  16. Early Experiences Can Alter Gene Expression and Affect Long-Term Development. Working Paper #10

    ERIC Educational Resources Information Center

    National Scientific Council on the Developing Child, 2010

    2010-01-01

    New scientific research shows that environmental influences can actually affect whether and how genes are expressed. Thus, the old ideas that genes are "set in stone" or that they alone determine development have been disproven. In fact, scientists have discovered that early experiences can determine how genes are turned on and off and even…

  17. Biological and Clinical Significance of MAD2L1 and BUB1, Genes Frequently Appearing in Expression Signatures for Breast Cancer Prognosis

    PubMed Central

    Wang, Zhanwei; Katsaros, Dionyssios; Shen, Yi; Fu, Yuanyuan; Canuto, Emilie Marion; Benedetto, Chiara; Lu, Lingeng; Chu, Wen-Ming; Risch, Harvey A.; Yu, Herbert

    2015-01-01

    To investigate the biologic relevance and clinical implication of genes involved in multiple gene expression signatures for breast cancer prognosis, we identified 16 published gene expression signatures, and selected two genes, MAD2L1 and BUB1. These genes appeared in 5 signatures and were involved in cell-cycle regulation. We analyzed the expression of these genes in relation to tumor features and disease outcomes. In vitro experiments were also performed in two breast cancer cell lines, MDA-MB-231 and MDA-MB-468, to assess cell proliferation, migration and invasion after knocking down the expression of these genes. High expression of these genes was found to be associated with aggressive tumors and poor disease-free survival of 203 breast cancer patients in our study, and the association with survival was confirmed in an online database consisting of 914 patients. In vitro experiments demonstrated that lowering the expression of these genes by siRNAs reduced tumor cell growth and inhibited cell migration and invasion. Our investigation suggests that MAD2L1 and BUB1 may play important roles in breast cancer progression, and measuring the expression of these genes may assist the prediction of breast cancer prognosis. PMID:26287798

  18. Sexual Experience Modulates Neuronal Activity in Male Japanese Quail

    PubMed Central

    Can, Adem; Domjan, Michael; Delville, Yvon

    2008-01-01

    After an initial increase, repeated exposure to a particular stimulus or familiarity with an event results in lower immediate early gene expression levels in relevant brain structures. We predicted that similar effects would occur in Japanese quail after repeated sexual experience within brain areas involved in sexual behavior, namely, the medial preoptic nucleus (POM), the bed nucleus of stria terminalis (BST), and the nucleus taeniae of the amygdala (TnA), an avian homolog of medial amygdala. High experience subjects copulated with a female once on each of 16 consecutive days, whereas low experience subjects were allowed to copulate either once or twice. Control subjects were never exposed to a female. High experience subjects were faster to initiate sexual interaction, performed more cloacal contacts, and completed each cloacal contact faster than low experience subjects. Low experience subjects showed an increase in egr-1 (ZENK) expression, an immediate early gene product used as marker of neural activation in birds, in the areas of interest. In contrast, in high experience animals, egr-1 expression in the POM, BST and the periaqueductal gray (PAG) was not different than the level of expression in unmated controls. These results show that experience modulates the level of immediate early gene expression in the case of sexual behavior. Our results also indicate that immediate early gene expression in specific brain areas is not necessarily related to behavioral output, but depends on the behavioral history of the subjects. PMID:17826778

  19. Asymmetric latent semantic indexing for gene expression experiments visualization.

    PubMed

    González, Javier; Muñoz, Alberto; Martos, Gabriel

    2016-08-01

    We propose a new method to visualize gene expression experiments inspired by the latent semantic indexing technique originally proposed in the textual analysis context. By using the correspondence word-gene document-experiment, we define an asymmetric similarity measure of association for genes that accounts for potential hierarchies in the data, the key to obtain meaningful gene mappings. We use the polar decomposition to obtain the sources of asymmetry of the similarity matrix, which are later combined with previous knowledge. Genetic classes of genes are identified by means of a mixture model applied in the genes latent space. We describe the steps of the procedure and we show its utility in the Human Cancer dataset.

  20. Analyzing gene expression time-courses based on multi-resolution shape mixture model.

    PubMed

    Li, Ying; He, Ye; Zhang, Yu

    2016-11-01

    Biological processes actually are a dynamic molecular process over time. Time course gene expression experiments provide opportunities to explore patterns of gene expression change over a time and understand the dynamic behavior of gene expression, which is crucial for study on development and progression of biology and disease. Analysis of the gene expression time-course profiles has not been fully exploited so far. It is still a challenge problem. We propose a novel shape-based mixture model clustering method for gene expression time-course profiles to explore the significant gene groups. Based on multi-resolution fractal features and mixture clustering model, we proposed a multi-resolution shape mixture model algorithm. Multi-resolution fractal features is computed by wavelet decomposition, which explore patterns of change over time of gene expression at different resolution. Our proposed multi-resolution shape mixture model algorithm is a probabilistic framework which offers a more natural and robust way of clustering time-course gene expression. We assessed the performance of our proposed algorithm using yeast time-course gene expression profiles compared with several popular clustering methods for gene expression profiles. The grouped genes identified by different methods are evaluated by enrichment analysis of biological pathways and known protein-protein interactions from experiment evidence. The grouped genes identified by our proposed algorithm have more strong biological significance. A novel multi-resolution shape mixture model algorithm based on multi-resolution fractal features is proposed. Our proposed model provides a novel horizons and an alternative tool for visualization and analysis of time-course gene expression profiles. The R and Matlab program is available upon the request. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Quantitative comparison of microarray experiments with published leukemia related gene expression signatures.

    PubMed

    Klein, Hans-Ulrich; Ruckert, Christian; Kohlmann, Alexander; Bullinger, Lars; Thiede, Christian; Haferlach, Torsten; Dugas, Martin

    2009-12-15

    Multiple gene expression signatures derived from microarray experiments have been published in the field of leukemia research. A comparison of these signatures with results from new experiments is useful for verification as well as for interpretation of the results obtained. Currently, the percentage of overlapping genes is frequently used to compare published gene signatures against a signature derived from a new experiment. However, it has been shown that the percentage of overlapping genes is of limited use for comparing two experiments due to the variability of gene signatures caused by different array platforms or assay-specific influencing parameters. Here, we present a robust approach for a systematic and quantitative comparison of published gene expression signatures with an exemplary query dataset. A database storing 138 leukemia-related published gene signatures was designed. Each gene signature was manually annotated with terms according to a leukemia-specific taxonomy. Two analysis steps are implemented to compare a new microarray dataset with the results from previous experiments stored and curated in the database. First, the global test method is applied to assess gene signatures and to constitute a ranking among them. In a subsequent analysis step, the focus is shifted from single gene signatures to chromosomal aberrations or molecular mutations as modeled in the taxonomy. Potentially interesting disease characteristics are detected based on the ranking of gene signatures associated with these aberrations stored in the database. Two example analyses are presented. An implementation of the approach is freely available as web-based application. The presented approach helps researchers to systematically integrate the knowledge derived from numerous microarray experiments into the analysis of a new dataset. By means of example leukemia datasets we demonstrate that this approach detects related experiments as well as related molecular mutations and may help to interpret new microarray data.

  2. RNase One Gene Isolation, Expression, and Affinity Purification Models Research Experimental Progression and Culminates with Guided Inquiry-Based Experiments

    ERIC Educational Resources Information Center

    Bailey, Cheryl P.

    2009-01-01

    This new biochemistry laboratory course moves through a progression of experiments that generates a platform for guided inquiry-based experiments. RNase One gene is isolated from prokaryotic genomic DNA, expressed as a tagged protein, affinity purified, and tested for activity and substrate specificity. Student pairs present detailed explanations…

  3. Technical guide for applications of gene expression profiling in human health risk assessment of environmental chemicals.

    PubMed

    Bourdon-Lacombe, Julie A; Moffat, Ivy D; Deveau, Michelle; Husain, Mainul; Auerbach, Scott; Krewski, Daniel; Thomas, Russell S; Bushel, Pierre R; Williams, Andrew; Yauk, Carole L

    2015-07-01

    Toxicogenomics promises to be an important part of future human health risk assessment of environmental chemicals. The application of gene expression profiles (e.g., for hazard identification, chemical prioritization, chemical grouping, mode of action discovery, and quantitative analysis of response) is growing in the literature, but their use in formal risk assessment by regulatory agencies is relatively infrequent. Although additional validations for specific applications are required, gene expression data can be of immediate use for increasing confidence in chemical evaluations. We believe that a primary reason for the current lack of integration is the limited practical guidance available for risk assessment specialists with limited experience in genomics. The present manuscript provides basic information on gene expression profiling, along with guidance on evaluating the quality of genomic experiments and data, and interpretation of results presented in the form of heat maps, pathway analyses and other common approaches. Moreover, potential ways to integrate information from gene expression experiments into current risk assessment are presented using published studies as examples. The primary objective of this work is to facilitate integration of gene expression data into human health risk assessments of environmental chemicals. Crown Copyright © 2015. Published by Elsevier Inc. All rights reserved.

  4. A novel approach for human whole transcriptome analysis based on absolute gene expression of microarray data.

    PubMed

    Bikel, Shirley; Jacobo-Albavera, Leonor; Sánchez-Muñoz, Fausto; Cornejo-Granados, Fernanda; Canizales-Quinteros, Samuel; Soberón, Xavier; Sotelo-Mundo, Rogerio R; Del Río-Navarro, Blanca E; Mendoza-Vargas, Alfredo; Sánchez, Filiberto; Ochoa-Leyva, Adrian

    2017-01-01

    In spite of the emergence of RNA sequencing (RNA-seq), microarrays remain in widespread use for gene expression analysis in the clinic. There are over 767,000 RNA microarrays from human samples in public repositories, which are an invaluable resource for biomedical research and personalized medicine. The absolute gene expression analysis allows the transcriptome profiling of all expressed genes under a specific biological condition without the need of a reference sample. However, the background fluorescence represents a challenge to determine the absolute gene expression in microarrays. Given that the Y chromosome is absent in female subjects, we used it as a new approach for absolute gene expression analysis in which the fluorescence of the Y chromosome genes of female subjects was used as the background fluorescence for all the probes in the microarray. This fluorescence was used to establish an absolute gene expression threshold, allowing the differentiation between expressed and non-expressed genes in microarrays. We extracted the RNA from 16 children leukocyte samples (nine males and seven females, ages 6-10 years). An Affymetrix Gene Chip Human Gene 1.0 ST Array was carried out for each sample and the fluorescence of 124 genes of the Y chromosome was used to calculate the absolute gene expression threshold. After that, several expressed and non-expressed genes according to our absolute gene expression threshold were compared against the expression obtained using real-time quantitative polymerase chain reaction (RT-qPCR). From the 124 genes of the Y chromosome, three genes (DDX3Y, TXLNG2P and EIF1AY) that displayed significant differences between sexes were used to calculate the absolute gene expression threshold. Using this threshold, we selected 13 expressed and non-expressed genes and confirmed their expression level by RT-qPCR. Then, we selected the top 5% most expressed genes and found that several KEGG pathways were significantly enriched. Interestingly, these pathways were related to the typical functions of leukocytes cells, such as antigen processing and presentation and natural killer cell mediated cytotoxicity. We also applied this method to obtain the absolute gene expression threshold in already published microarray data of liver cells, where the top 5% expressed genes showed an enrichment of typical KEGG pathways for liver cells. Our results suggest that the three selected genes of the Y chromosome can be used to calculate an absolute gene expression threshold, allowing a transcriptome profiling of microarray data without the need of an additional reference experiment. Our approach based on the establishment of a threshold for absolute gene expression analysis will allow a new way to analyze thousands of microarrays from public databases. This allows the study of different human diseases without the need of having additional samples for relative expression experiments.

  5. Repression of mesodermal fate by foxa, a key endoderm regulator of the sea urchin embryo.

    PubMed

    Oliveri, Paola; Walton, Katherine D; Davidson, Eric H; McClay, David R

    2006-11-01

    The foxa gene is an integral component of the endoderm specification subcircuit of the endomesoderm gene regulatory network in the Strongylocentrotus purpuratus embryo. Its transcripts become confined to veg2, then veg1 endodermal territories, and, following gastrulation, throughout the gut. It is also expressed in the stomodeal ectoderm. gatae and otx genes provide input into the pregastrular regulatory system of foxa, and Foxa represses its own transcription, resulting in an oscillatory temporal expression profile. Here, we report three separate essential functions of the foxa gene: it represses mesodermal fate in the veg2 endomesoderm; it is required in postgastrular development for the expression of gut-specific genes; and it is necessary for stomodaeum formation. If its expression is reduced by a morpholino, more endomesoderm cells become pigment and other mesenchymal cell types, less gut is specified, and the larva has no mouth. Experiments in which blastomere transplantation is combined with foxa MASO treatment demonstrate that, in the normal endoderm, a crucial role of Foxa is to repress gcm expression in response to a Notch signal, and hence to repress mesodermal fate. Chimeric recombination experiments in which veg2, veg1 or ectoderm cells contained foxa MASO show which region of foxa expression controls each of the three functions. These experiments show that the foxa gene is a component of three distinct embryonic gene regulatory networks.

  6. Transcriptional profiling identifies differentially expressed genes in developing turkey skeletal muscle

    PubMed Central

    2011-01-01

    Background Skeletal muscle growth and development from embryo to adult consists of a series of carefully regulated changes in gene expression. Understanding these developmental changes in agriculturally important species is essential to the production of high quality meat products. For example, consumer demand for lean, inexpensive meat products has driven the turkey industry to unprecedented production through intensive genetic selection. However, achievements of increased body weight and muscle mass have been countered by an increased incidence of myopathies and meat quality defects. In a previous study, we developed and validated a turkey skeletal muscle-specific microarray as a tool for functional genomics studies. The goals of the current study were to utilize this microarray to elucidate functional pathways of genes responsible for key events in turkey skeletal muscle development and to compare differences in gene expression between two genetic lines of turkeys. To achieve these goals, skeletal muscle samples were collected at three critical stages in muscle development: 18d embryo (hyperplasia), 1d post-hatch (shift from myoblast-mediated growth to satellite cell-modulated growth by hypertrophy), and 16wk (market age) from two genetic lines: a randombred control line (RBC2) maintained without selection pressure, and a line (F) selected from the RBC2 line for increased 16wk body weight. Array hybridizations were performed in two experiments: Experiment 1 directly compared the developmental stages within genetic line, while Experiment 2 directly compared the two lines within each developmental stage. Results A total of 3474 genes were differentially expressed (false discovery rate; FDR < 0.001) by overall effect of development, while 16 genes were differentially expressed (FDR < 0.10) by overall effect of genetic line. Ingenuity Pathways Analysis was used to group annotated genes into networks, functions, and canonical pathways. The expression of 28 genes involved in extracellular matrix regulation, cell death/apoptosis, and calcium signaling/muscle function, as well as genes with miscellaneous function was confirmed by qPCR. Conclusions The current study identified gene pathways and uncovered novel genes important in turkey muscle growth and development. Future experiments will focus further on several of these candidate genes and the expression and mechanism of action of their protein products. PMID:21385442

  7. Automated Discovery of Functional Generality of Human Gene Expression Programs

    PubMed Central

    Gerber, Georg K; Dowell, Robin D; Jaakkola, Tommi S; Gifford, David K

    2007-01-01

    An important research problem in computational biology is the identification of expression programs, sets of co-expressed genes orchestrating normal or pathological processes, and the characterization of the functional breadth of these programs. The use of human expression data compendia for discovery of such programs presents several challenges including cellular inhomogeneity within samples, genetic and environmental variation across samples, uncertainty in the numbers of programs and sample populations, and temporal behavior. We developed GeneProgram, a new unsupervised computational framework based on Hierarchical Dirichlet Processes that addresses each of the above challenges. GeneProgram uses expression data to simultaneously organize tissues into groups and genes into overlapping programs with consistent temporal behavior, to produce maps of expression programs, which are sorted by generality scores that exploit the automatically learned groupings. Using synthetic and real gene expression data, we showed that GeneProgram outperformed several popular expression analysis methods. We applied GeneProgram to a compendium of 62 short time-series gene expression datasets exploring the responses of human cells to infectious agents and immune-modulating molecules. GeneProgram produced a map of 104 expression programs, a substantial number of which were significantly enriched for genes involved in key signaling pathways and/or bound by NF-κB transcription factors in genome-wide experiments. Further, GeneProgram discovered expression programs that appear to implicate surprising signaling pathways or receptor types in the response to infection, including Wnt signaling and neurotransmitter receptors. We believe the discovered map of expression programs involved in the response to infection will be useful for guiding future biological experiments; genes from programs with low generality scores might serve as new drug targets that exhibit minimal “cross-talk,” and genes from high generality programs may maintain common physiological responses that go awry in disease states. Further, our method is multipurpose, and can be applied readily to novel compendia of biological data. PMID:17696603

  8. A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes

    PubMed Central

    Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

    2015-01-01

    In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data. PMID:26201006

  9. A P-Norm Robust Feature Extraction Method for Identifying Differentially Expressed Genes.

    PubMed

    Liu, Jian; Liu, Jin-Xing; Gao, Ying-Lian; Kong, Xiang-Zhen; Wang, Xue-Song; Wang, Dong

    2015-01-01

    In current molecular biology, it becomes more and more important to identify differentially expressed genes closely correlated with a key biological process from gene expression data. In this paper, based on the Schatten p-norm and Lp-norm, a novel p-norm robust feature extraction method is proposed to identify the differentially expressed genes. In our method, the Schatten p-norm is used as the regularization function to obtain a low-rank matrix and the Lp-norm is taken as the error function to improve the robustness to outliers in the gene expression data. The results on simulation data show that our method can obtain higher identification accuracies than the competitive methods. Numerous experiments on real gene expression data sets demonstrate that our method can identify more differentially expressed genes than the others. Moreover, we confirmed that the identified genes are closely correlated with the corresponding gene expression data.

  10. Remote sensing of gene expression in Planta: transgenic plants as monitors of exogenous stress perception in extraterrestrial environments

    NASA Technical Reports Server (NTRS)

    Manak, Michael S.; Paul, Anna-Lisa; Sehnke, Paul C.; Ferl, Robert J.

    2002-01-01

    Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the green fluorescent protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and abcissic acid in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system for collecting gene expression data in real time from Transgenic Arabidopsis Gene Expression System (TAGES) biosensor plants during space exploration experiments.

  11. Analysis of host response to bacterial infection using error model based gene expression microarray experiments

    PubMed Central

    Stekel, Dov J.; Sarti, Donatella; Trevino, Victor; Zhang, Lihong; Salmon, Mike; Buckley, Chris D.; Stevens, Mark; Pallen, Mark J.; Penn, Charles; Falciani, Francesco

    2005-01-01

    A key step in the analysis of microarray data is the selection of genes that are differentially expressed. Ideally, such experiments should be properly replicated in order to infer both technical and biological variability, and the data should be subjected to rigorous hypothesis tests to identify the differentially expressed genes. However, in microarray experiments involving the analysis of very large numbers of biological samples, replication is not always practical. Therefore, there is a need for a method to select differentially expressed genes in a rational way from insufficiently replicated data. In this paper, we describe a simple method that uses bootstrapping to generate an error model from a replicated pilot study that can be used to identify differentially expressed genes in subsequent large-scale studies on the same platform, but in which there may be no replicated arrays. The method builds a stratified error model that includes array-to-array variability, feature-to-feature variability and the dependence of error on signal intensity. We apply this model to the characterization of the host response in a model of bacterial infection of human intestinal epithelial cells. We demonstrate the effectiveness of error model based microarray experiments and propose this as a general strategy for a microarray-based screening of large collections of biological samples. PMID:15800204

  12. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    PubMed

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  13. The Use of Whole-Mount "in Situ" Hybridization to Illustrate Gene Expression Regulation

    ERIC Educational Resources Information Center

    Llamusí, Beatriz; Muñoz-Soriano, Verónica; Paricio, Nuria; Artero, Rubén

    2014-01-01

    "In situ" hybridization is a widely used technique for studying gene expression. Here, we describe two experiments addressed to postgraduate genetics students in which the effect of transcription factors on gene expression is analyzed in "Drosophila embryos of different genotypes by whole-mount in situ hybridization. In one of the…

  14. Variation of gene expression in Bacillus subtilis samples of fermentation replicates.

    PubMed

    Zhou, Ying; Yu, Wen-Bang; Ye, Bang-Ce

    2011-06-01

    The application of comprehensive gene expression profiling technologies to compare wild and mutated microorganism samples or to assess molecular differences between various treatments has been widely used. However, little is known about the normal variation of gene expression in microorganisms. In this study, an Agilent customized microarray representing 4,106 genes was used to quantify transcript levels of five-repeated flasks to assess normal variation in Bacillus subtilis gene expression. CV analysis and analysis of variance were employed to investigate the normal variance of genes and the components of variance, respectively. The results showed that above 80% of the total variation was caused by biological variance. For the 12 replicates, 451 of 4,106 genes exhibited variance with CV values over 10%. The functional category enrichment analysis demonstrated that these variable genes were mainly involved in cell type differentiation, cell type localization, cell cycle and DNA processing, and spore or cyst coat. Using power analysis, the minimal biological replicate number for a B. subtilis microarray experiment was determined to be six. The results contribute to the definition of the baseline level of variability in B. subtilis gene expression and emphasize the importance of replicate microarray experiments.

  15. Cell-Type–Specific Transcriptional Profiles of the Dimorphic Pathogen Penicillium marneffei Reflect Distinct Reproductive, Morphological, and Environmental Demands

    PubMed Central

    Pasricha, Shivani; Payne, Michael; Canovas, David; Pase, Luke; Ngaosuwankul, Nathamon; Beard, Sally; Oshlack, Alicia; Smyth, Gordon K.; Chaiyaroj, Sansanee C.; Boyce, Kylie J.; Andrianopoulos, Alex

    2013-01-01

    Penicillium marneffei is an opportunistic human pathogen endemic to Southeast Asia. At 25° P. marneffei grows in a filamentous hyphal form and can undergo asexual development (conidiation) to produce spores (conidia), the infectious agent. At 37° P. marneffei grows in the pathogenic yeast cell form that replicates by fission. Switching between these growth forms, known as dimorphic switching, is dependent on temperature. To understand the process of dimorphic switching and the physiological capacity of the different cell types, two microarray-based profiling experiments covering approximately 42% of the genome were performed. The first experiment compared cells from the hyphal, yeast, and conidiation phases to identify “phase or cell-state–specific” gene expression. The second experiment examined gene expression during the dimorphic switch from one morphological state to another. The data identified a variety of differentially expressed genes that have been organized into metabolic clusters based on predicted function and expression patterns. In particular, C-14 sterol reductase–encoding gene ergM of the ergosterol biosynthesis pathway showed high-level expression throughout yeast morphogenesis compared to hyphal. Deletion of ergM resulted in severe growth defects with increased sensitivity to azole-type antifungal agents but not amphotericin B. The data defined gene classes based on spatio-temporal expression such as those expressed early in the dimorphic switch but not in the terminal cell types and those expressed late. Such classifications have been helpful in linking a given gene of interest to its expression pattern throughout the P. marneffei dimorphic life cycle and its likely role in pathogenicity. PMID:24062530

  16. A novel approach for human whole transcriptome analysis based on absolute gene expression of microarray data

    PubMed Central

    Bikel, Shirley; Jacobo-Albavera, Leonor; Sánchez-Muñoz, Fausto; Cornejo-Granados, Fernanda; Canizales-Quinteros, Samuel; Soberón, Xavier; Sotelo-Mundo, Rogerio R.; del Río-Navarro, Blanca E.; Mendoza-Vargas, Alfredo; Sánchez, Filiberto

    2017-01-01

    Background In spite of the emergence of RNA sequencing (RNA-seq), microarrays remain in widespread use for gene expression analysis in the clinic. There are over 767,000 RNA microarrays from human samples in public repositories, which are an invaluable resource for biomedical research and personalized medicine. The absolute gene expression analysis allows the transcriptome profiling of all expressed genes under a specific biological condition without the need of a reference sample. However, the background fluorescence represents a challenge to determine the absolute gene expression in microarrays. Given that the Y chromosome is absent in female subjects, we used it as a new approach for absolute gene expression analysis in which the fluorescence of the Y chromosome genes of female subjects was used as the background fluorescence for all the probes in the microarray. This fluorescence was used to establish an absolute gene expression threshold, allowing the differentiation between expressed and non-expressed genes in microarrays. Methods We extracted the RNA from 16 children leukocyte samples (nine males and seven females, ages 6–10 years). An Affymetrix Gene Chip Human Gene 1.0 ST Array was carried out for each sample and the fluorescence of 124 genes of the Y chromosome was used to calculate the absolute gene expression threshold. After that, several expressed and non-expressed genes according to our absolute gene expression threshold were compared against the expression obtained using real-time quantitative polymerase chain reaction (RT-qPCR). Results From the 124 genes of the Y chromosome, three genes (DDX3Y, TXLNG2P and EIF1AY) that displayed significant differences between sexes were used to calculate the absolute gene expression threshold. Using this threshold, we selected 13 expressed and non-expressed genes and confirmed their expression level by RT-qPCR. Then, we selected the top 5% most expressed genes and found that several KEGG pathways were significantly enriched. Interestingly, these pathways were related to the typical functions of leukocytes cells, such as antigen processing and presentation and natural killer cell mediated cytotoxicity. We also applied this method to obtain the absolute gene expression threshold in already published microarray data of liver cells, where the top 5% expressed genes showed an enrichment of typical KEGG pathways for liver cells. Our results suggest that the three selected genes of the Y chromosome can be used to calculate an absolute gene expression threshold, allowing a transcriptome profiling of microarray data without the need of an additional reference experiment. Discussion Our approach based on the establishment of a threshold for absolute gene expression analysis will allow a new way to analyze thousands of microarrays from public databases. This allows the study of different human diseases without the need of having additional samples for relative expression experiments. PMID:29230367

  17. CORNAS: coverage-dependent RNA-Seq analysis of gene expression data without biological replicates.

    PubMed

    Low, Joel Z B; Khang, Tsung Fei; Tammi, Martti T

    2017-12-28

    In current statistical methods for calling differentially expressed genes in RNA-Seq experiments, the assumption is that an adjusted observed gene count represents an unknown true gene count. This adjustment usually consists of a normalization step to account for heterogeneous sample library sizes, and then the resulting normalized gene counts are used as input for parametric or non-parametric differential gene expression tests. A distribution of true gene counts, each with a different probability, can result in the same observed gene count. Importantly, sequencing coverage information is currently not explicitly incorporated into any of the statistical models used for RNA-Seq analysis. We developed a fast Bayesian method which uses the sequencing coverage information determined from the concentration of an RNA sample to estimate the posterior distribution of a true gene count. Our method has better or comparable performance compared to NOISeq and GFOLD, according to the results from simulations and experiments with real unreplicated data. We incorporated a previously unused sequencing coverage parameter into a procedure for differential gene expression analysis with RNA-Seq data. Our results suggest that our method can be used to overcome analytical bottlenecks in experiments with limited number of replicates and low sequencing coverage. The method is implemented in CORNAS (Coverage-dependent RNA-Seq), and is available at https://github.com/joel-lzb/CORNAS .

  18. Gene selection with multiple ordering criteria.

    PubMed

    Chen, James J; Tsai, Chen-An; Tzeng, Shengli; Chen, Chun-Houh

    2007-03-05

    A microarray study may select different differentially expressed gene sets because of different selection criteria. For example, the fold-change and p-value are two commonly known criteria to select differentially expressed genes under two experimental conditions. These two selection criteria often result in incompatible selected gene sets. Also, in a two-factor, say, treatment by time experiment, the investigator may be interested in one gene list that responds to both treatment and time effects. We propose three layer ranking algorithms, point-admissible, line-admissible (convex), and Pareto, to provide a preference gene list from multiple gene lists generated by different ranking criteria. Using the public colon data as an example, the layer ranking algorithms are applied to the three univariate ranking criteria, fold-change, p-value, and frequency of selections by the SVM-RFE classifier. A simulation experiment shows that for experiments with small or moderate sample sizes (less than 20 per group) and detecting a 4-fold change or less, the two-dimensional (p-value and fold-change) convex layer ranking selects differentially expressed genes with generally lower FDR and higher power than the standard p-value ranking. Three applications are presented. The first application illustrates a use of the layer rankings to potentially improve predictive accuracy. The second application illustrates an application to a two-factor experiment involving two dose levels and two time points. The layer rankings are applied to selecting differentially expressed genes relating to the dose and time effects. In the third application, the layer rankings are applied to a benchmark data set consisting of three dilution concentrations to provide a ranking system from a long list of differentially expressed genes generated from the three dilution concentrations. The layer ranking algorithms are useful to help investigators in selecting the most promising genes from multiple gene lists generated by different filter, normalization, or analysis methods for various objectives.

  19. Identification of a Novel Reference Gene for Apple Transcriptional Profiling under Postharvest Conditions

    PubMed Central

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference—ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)—along with two novel candidates—HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest. PMID:25774904

  20. Identification of a novel reference gene for apple transcriptional profiling under postharvest conditions.

    PubMed

    Storch, Tatiane Timm; Pegoraro, Camila; Finatto, Taciane; Quecini, Vera; Rombaldi, Cesar Valmor; Girardi, César Luis

    2015-01-01

    Reverse Transcription quantitative PCR (RT-qPCR) is one of the most important techniques for gene expression profiling due to its high sensibility and reproducibility. However, the reliability of the results is highly dependent on data normalization, performed by comparisons between the expression profiles of the genes of interest against those of constitutively expressed, reference genes. Although the technique is widely used in fruit postharvest experiments, the transcription stability of reference genes has not been thoroughly investigated under these experimental conditions. Thus, we have determined the transcriptional profile, under these conditions, of three genes commonly used as reference--ACTIN (MdACT), PROTEIN DISULPHIDE ISOMERASE (MdPDI) and UBIQUITIN-CONJUGATING ENZYME E2 (MdUBC)--along with two novel candidates--HISTONE 1 (MdH1) and NUCLEOSSOME ASSEMBLY 1 PROTEIN (MdNAP1). The expression profile of the genes was investigated throughout five experiments, with three of them encompassing the postharvest period and the other two, consisting of developmental and spatial phases. The transcriptional stability was comparatively investigated using four distinct software packages: BestKeeper, NormFinder, geNorm and DataAssist. Gene ranking results for transcriptional stability were similar for the investigated software packages, with the exception of BestKeeper. The classic reference gene MdUBC ranked among the most stably transcribed in all investigated experimental conditions. Transcript accumulation profiles for the novel reference candidate gene MdH1 were stable throughout the tested conditions, especially in experiments encompassing the postharvest period. Thus, our results present a novel reference gene for postharvest experiments in apple and reinforce the importance of checking the transcription profile of reference genes under the experimental conditions of interest.

  1. Design-Based Learning for Biology: Genetic Engineering Experience Improves Understanding of Gene Expression

    ERIC Educational Resources Information Center

    Ellefson, Michelle R.; Brinker, Rebecca A.; Vernacchio, Vincent J.; Schunn, Christian D.

    2008-01-01

    Gene expression is a difficult topic for students to learn and comprehend, at least partially because it involves various biochemical structures and processes occurring at the microscopic level. Designer Bacteria, a design-based learning (DBL) unit for high-school students, applies principles of DBL to the teaching of gene expression. Throughout…

  2. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    PubMed Central

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  3. Getting the most out of RNA-seq data analysis.

    PubMed

    Khang, Tsung Fei; Lau, Ching Yee

    2015-01-01

    Background. A common research goal in transcriptome projects is to find genes that are differentially expressed in different phenotype classes. Biologists might wish to validate such gene candidates experimentally, or use them for downstream systems biology analysis. Producing a coherent differential gene expression analysis from RNA-seq count data requires an understanding of how numerous sources of variation such as the replicate size, the hypothesized biological effect size, and the specific method for making differential expression calls interact. We believe an explicit demonstration of such interactions in real RNA-seq data sets is of practical interest to biologists. Results. Using two large public RNA-seq data sets-one representing strong, and another mild, biological effect size-we simulated different replicate size scenarios, and tested the performance of several commonly-used methods for calling differentially expressed genes in each of them. We found that, when biological effect size was mild, RNA-seq experiments should focus on experimental validation of differentially expressed gene candidates. Importantly, at least triplicates must be used, and the differentially expressed genes should be called using methods with high positive predictive value (PPV), such as NOISeq or GFOLD. In contrast, when biological effect size was strong, differentially expressed genes mined from unreplicated experiments using NOISeq, ASC and GFOLD had between 30 to 50% mean PPV, an increase of more than 30-fold compared to the cases of mild biological effect size. Among methods with good PPV performance, having triplicates or more substantially improved mean PPV to over 90% for GFOLD, 60% for DESeq2, 50% for NOISeq, and 30% for edgeR. At a replicate size of six, we found DESeq2 and edgeR to be reasonable methods for calling differentially expressed genes at systems level analysis, as their PPV and sensitivity trade-off were superior to the other methods'. Conclusion. When biological effect size is weak, systems level investigation is not possible using RNAseq data, and no meaningful result can be obtained in unreplicated experiments. Nonetheless, NOISeq or GFOLD may yield limited numbers of gene candidates with good validation potential, when triplicates or more are available. When biological effect size is strong, NOISeq and GFOLD are effective tools for detecting differentially expressed genes in unreplicated RNA-seq experiments for qPCR validation. When triplicates or more are available, GFOLD is a sharp tool for identifying high confidence differentially expressed genes for targeted qPCR validation; for downstream systems level analysis, combined results from DESeq2 and edgeR are useful.

  4. DSSTox chemical-index files for exposure-related experiments in ArrayExpress and Gene Expression Omnibus: enabling toxico-chemogenomics data linkages

    EPA Science Inventory

    The Distributed Structure-Searchable Toxicity (DSSTox) ARYEXP and GEOGSE files are newly published, structure-annotated files of the chemical-associated and chemical exposure-related summary experimental content contained in the ArrayExpress Repository and Gene Expression Omnibus...

  5. Light represses transcription of asparagine synthetase genes in photosynthetic and nonphotosynthetic organs of plants.

    PubMed Central

    Tsai, F Y; Coruzzi, G

    1991-01-01

    Asparagine synthetase (AS) mRNA in Pisum sativum accumulates preferentially in plants grown in the dark. Nuclear run-on experiments demonstrate that expression of both the AS1 and AS2 genes is negatively regulated by light at the level of transcription. A decrease in the transcriptional rate of the AS1 gene can be detected as early as 20 min after exposure to light. Time course experiments reveal that the levels of AS mRNA fluctuate dramatically during a "normal" light/dark cycle. This is due to a direct effect of light and not to changes associated with circadian rhythm. A novel finding is that the light-repressed expression of the AS1 gene is as dramatic in nonphotosynthetic organs such as roots as it is in leaves. Experiments demonstrate that the small amount of light which passes through the soil is sufficient to repress AS1 expression in roots, indicating that light has a direct effect on AS1 gene expression in roots. The negative regulation of AS gene expression by light was shown to be a general phenomenon in plants which also occurs in nonlegumes such as Nicotiana plumbaginifolia and Nicotiana tabacum. Thus, the AS genes can serve as a model with which to dissect the molecular basis for light-regulated transcriptional repression in plants. Images PMID:1681424

  6. Biophysical Constraints Arising from Compositional Context in Synthetic Gene Networks.

    PubMed

    Yeung, Enoch; Dy, Aaron J; Martin, Kyle B; Ng, Andrew H; Del Vecchio, Domitilla; Beck, James L; Collins, James J; Murray, Richard M

    2017-07-26

    Synthetic gene expression is highly sensitive to intragenic compositional context (promoter structure, spacing regions between promoter and coding sequences, and ribosome binding sites). However, much less is known about the effects of intergenic compositional context (spatial arrangement and orientation of entire genes on DNA) on expression levels in synthetic gene networks. We compare expression of induced genes arranged in convergent, divergent, or tandem orientations. Induction of convergent genes yielded up to 400% higher expression, greater ultrasensitivity, and dynamic range than divergent- or tandem-oriented genes. Orientation affects gene expression whether one or both genes are induced. We postulate that transcriptional interference in divergent and tandem genes, mediated by supercoiling, can explain differences in expression and validate this hypothesis through modeling and in vitro supercoiling relaxation experiments. Treatment with gyrase abrogated intergenic context effects, bringing expression levels within 30% of each other. We rebuilt the toggle switch with convergent genes, taking advantage of supercoiling effects to improve threshold detection and switch stability. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Adaptive Mutations in RNA Polymerase and the Transcriptional Terminator Rho Have Similar Effects on Escherichia coli Gene Expression.

    PubMed

    González-González, Andrea; Hug, Shaun M; Rodríguez-Verdugo, Alejandra; Patel, Jagdish Suresh; Gaut, Brandon S

    2017-11-01

    Modifications to transcriptional regulators play a major role in adaptation. Here, we compared the effects of multiple beneficial mutations within and between Escherichia coli rpoB, the gene encoding the RNA polymerase β subunit, and rho, which encodes a transcriptional terminator. These two genes have harbored adaptive mutations in numerous E. coli evolution experiments but particularly in our previous large-scale thermal stress experiment, where the two genes characterized alternative adaptive pathways. To compare the effects of beneficial mutations, we engineered four advantageous mutations into each of the two genes and measured their effects on fitness, growth, gene expression and transcriptional termination at 42.2 °C. Among the eight mutations, two rho mutations had no detectable effect on relative fitness, suggesting they were beneficial only in the context of epistatic interactions. The remaining six mutations had an average relative fitness benefit of ∼20%. The rpoB mutations affected the expression of ∼1,700 genes; rho mutations affected the expression of fewer genes but most (83%) were a subset of those altered by rpoB mutants. Across the eight mutants, relative fitness correlated with the degree to which a mutation restored gene expression back to the unstressed, 37.0 °C state. The beneficial mutations in the two genes did not have identical effects on fitness, growth or gene expression, but they caused parallel phenotypic effects on gene expression and genome-wide transcriptional termination. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Sex-Biased Gene Expression and Sexual Conflict throughout Development

    PubMed Central

    Ingleby, Fiona C.; Flis, Ilona; Morrow, Edward H.

    2015-01-01

    Sex-biased gene expression is likely to account for most sexually dimorphic traits because males and females share much of their genome. When fitness optima differ between sexes for a shared trait, sexual dimorphism can allow each sex to express their optimum trait phenotype, and in this way, the evolution of sex-biased gene expression is one mechanism that could help to resolve intralocus sexual conflict. Genome-wide patterns of sex-biased gene expression have been identified in a number of studies, which we review here. However, very little is known about how sex-biased gene expression relates to sex-specific fitness and about how sex-biased gene expression and conflict vary throughout development or across different genotypes, populations, and environments. We discuss the importance of these neglected areas of research and use data from a small-scale experiment on sex-specific expression of genes throughout development to highlight potentially interesting avenues for future research. PMID:25376837

  9. Investigation of mRNA quadruplex formation in Escherichia coli.

    PubMed

    Wieland, Markus; Hartig, Jörg S

    2009-01-01

    The protocol presented here allows for the investigation of the formation of unusual nucleic acid structures in the 5'-untranslated region (UTR) of bacteria by correlating gene expression levels to the in vitro stability of the respective structure. In particular, we describe the introduction of G-quadruplex forming sequences close to the ribosome-binding site (RBS) on the mRNA of a reporter gene and the subsequent read-out of the expression levels. Insertion of a stable secondary structure results in the cloaking of RBS and eventually reduced gene expression levels. The structures and stability of the introduced sequences are further characterized by circular dichroism (CD) spectroscopy and thermal melting experiments. The extent of inhibition is then correlated to the stability of the respective quadruplex structure, allowing judgement of whether factors other than thermodynamic stability affect the formation of a given quadruplex sequence in vivo. Measuring gene expression levels takes 2 d including cloning; CD experiments take 5 hours per experiment.

  10. Gene structure and expression characteristic of a novel odorant receptor gene cluster in the parasitoid wasp Microplitis mediator (Hymenoptera: Braconidae).

    PubMed

    Wang, S-N; Shan, S; Zheng, Y; Peng, Y; Lu, Z-Y; Yang, Y-Q; Li, R-J; Zhang, Y-J; Guo, Y-Y

    2017-08-01

    Odorant receptors (ORs) expressed in the antennae of parasitoid wasps are responsible for detection of various lipophilic airborne molecules. In the present study, 107 novel OR genes were identified from Microplitis mediator antennal transcriptome data. Phylogenetic analysis of the set of OR genes from M. mediator and Microplitis demolitor revealed that M. mediator OR (MmedOR) genes can be classified into different subfamilies, and the majority of MmedORs in each subfamily shared high sequence identities and clear orthologous relationships to M. demolitor ORs. Within a subfamily, six MmedOR genes, MmedOR98, 124, 125, 126, 131 and 155, shared a similar gene structure and were tightly linked in the genome. To evaluate whether the clustered MmedOR genes share common regulatory features, the transcription profile and expression characteristics of the six closely related OR genes were investigated in M. mediator. Rapid amplification of cDNA ends-PCR experiments revealed that the OR genes within the cluster were transcribed as single mRNAs, and a bicistronic mRNA for two adjacent genes (MmedOR124 and MmedOR98) was also detected in female antennae by reverse transcription PCR. In situ hybridization experiments indicated that each OR gene within the cluster was expressed in a different number of cells. Moreover, there was no co-expression of the two highly related OR genes, MmedOR124 and MmedOR98, which appeared to be individually expressed in a distinct population of neurons. Overall, there were distinct expression profiles of closely related MmedOR genes from the same cluster in M. mediator. These data provide a basic understanding of the olfactory coding in parasitoid wasps. © 2017 The Royal Entomological Society.

  11. Fully moderated T-statistic for small sample size gene expression arrays.

    PubMed

    Yu, Lianbo; Gulati, Parul; Fernandez, Soledad; Pennell, Michael; Kirschner, Lawrence; Jarjoura, David

    2011-09-15

    Gene expression microarray experiments with few replications lead to great variability in estimates of gene variances. Several Bayesian methods have been developed to reduce this variability and to increase power. Thus far, moderated t methods assumed a constant coefficient of variation (CV) for the gene variances. We provide evidence against this assumption, and extend the method by allowing the CV to vary with gene expression. Our CV varying method, which we refer to as the fully moderated t-statistic, was compared to three other methods (ordinary t, and two moderated t predecessors). A simulation study and a familiar spike-in data set were used to assess the performance of the testing methods. The results showed that our CV varying method had higher power than the other three methods, identified a greater number of true positives in spike-in data, fit simulated data under varying assumptions very well, and in a real data set better identified higher expressing genes that were consistent with functional pathways associated with the experiments.

  12. Online Analytical Processing (OLAP): A Fast and Effective Data Mining Tool for Gene Expression Databases

    PubMed Central

    2005-01-01

    Gene expression databases contain a wealth of information, but current data mining tools are limited in their speed and effectiveness in extracting meaningful biological knowledge from them. Online analytical processing (OLAP) can be used as a supplement to cluster analysis for fast and effective data mining of gene expression databases. We used Analysis Services 2000, a product that ships with SQLServer2000, to construct an OLAP cube that was used to mine a time series experiment designed to identify genes associated with resistance of soybean to the soybean cyst nematode, a devastating pest of soybean. The data for these experiments is stored in the soybean genomics and microarray database (SGMD). A number of candidate resistance genes and pathways were found. Compared to traditional cluster analysis of gene expression data, OLAP was more effective and faster in finding biologically meaningful information. OLAP is available from a number of vendors and can work with any relational database management system through OLE DB. PMID:16046824

  13. Turning publicly available gene expression data into discoveries using gene set context analysis.

    PubMed

    Ji, Zhicheng; Vokes, Steven A; Dang, Chi V; Ji, Hongkai

    2016-01-08

    Gene Set Context Analysis (GSCA) is an open source software package to help researchers use massive amounts of publicly available gene expression data (PED) to make discoveries. Users can interactively visualize and explore gene and gene set activities in 25,000+ consistently normalized human and mouse gene expression samples representing diverse biological contexts (e.g. different cells, tissues and disease types, etc.). By providing one or multiple genes or gene sets as input and specifying a gene set activity pattern of interest, users can query the expression compendium to systematically identify biological contexts associated with the specified gene set activity pattern. In this way, researchers with new gene sets from their own experiments may discover previously unknown contexts of gene set functions and hence increase the value of their experiments. GSCA has a graphical user interface (GUI). The GUI makes the analysis convenient and customizable. Analysis results can be conveniently exported as publication quality figures and tables. GSCA is available at https://github.com/zji90/GSCA. This software significantly lowers the bar for biomedical investigators to use PED in their daily research for generating and screening hypotheses, which was previously difficult because of the complexity, heterogeneity and size of the data. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Comparative analysis of gene expression profiles of hip articular cartilage between non-traumatic necrosis and osteoarthritis.

    PubMed

    Wang, Wenyu; Liu, Yang; Hao, Jingcan; Zheng, Shuyu; Wen, Yan; Xiao, Xiao; He, Awen; Fan, Qianrui; Zhang, Feng; Liu, Ruiyu

    2016-10-10

    Hip cartilage destruction is consistently observed in the non-traumatic osteonecrosis of femoral head (NOFH) and accelerates its bone necrosis. The molecular mechanism underlying the cartilage damage of NOFH remains elusive. In this study, we conducted a systematically comparative study of gene expression profiles between NOFH and osteoarthritis (OA). Hip articular cartilage specimens were collected from 12 NOFH patients and 12 controls with traumatic femoral neck fracture for microarray (n=4) and quantitative real-time PCR validation experiments (n=8). Gene expression profiling of articular cartilage was performed using Agilent Human 4×44K Microarray chip. The accuracy of microarray experiment was further validated by qRT-PCR. Gene expression results of OA hip cartilage were derived from previously published study. Significance Analysis of Microarrays (SAM) software was applied for identifying differently expressed genes. Gene ontology (GO) and pathway enrichment analysis were conducted by Gene Set Enrichment Analysis software and DAVID tool, respectively. Totally, 27 differently expressed genes were identified for NOFH. Comparing the gene expression profiles of NOFH cartilage and OA cartilage detected 8 common differently expressed genes, including COL5A1, OGN, ANGPTL4, CRIP1, NFIL3, METRNL, ID2 and STEAP1. GO comparative analysis identified 10 common significant GO terms, mainly implicated in apoptosis and development process. Pathway comparative analysis observed that ECM-receptor interaction pathway and focal adhesion pathway were enriched in the differently expressed genes of both NOFH and hip OA. In conclusion, we identified a set of differently expressed genes, GO and pathways for NOFH articular destruction, some of which were also involved in the hip OA. Our study results may help to reveal the pathogenetic similarities and differences of cartilage damage of NOFH and hip OA. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. [Effect of cisplatin on the expression of Pokemon gene: experiment with different human lung cancer cells].

    PubMed

    Zhao, Zhi-Hong; Wang, Sheng-Fa; Yu, Liang; Wang, Ju; Cong, De-Gang; Chang, Hao; Wang, Xue-Feng; Zhang, Tie-Wa; Zhang, Jian; Fu, Kai; Jiang, Jiu-Yang

    2008-04-29

    To investigate the correlation between Pokemon gene and cisplatin mechanism. Human lung adenocarcinoma cells of the lines A549 and AGZY83-a, human lung squamous carcinoma cells of the line HE-99, and human giant cell lung cancer cells of the line 95D were cultured and cisplatin was added into the medium. Other lung cancer cells of the above mentioned lines were cultured in the medium without cisplatin and were used as control groups. RT-PCR and Western blotting were used to detect the mRNA and protein expression of Pokemon. Pokemon mRNA and protein were expressed highly in all the 4 cell lines. The Pokemon gene expression did not changed significantly after cisplatin treatment groups. There were not significant differences in the mRNA and protein expression of Pokemon among the 4 experiment groups and the control groups (all P > 0.05). Cisplatin has no effect on the Pokemon gene expression of the human lung cancer cells.

  16. A plasmid-based Escherichia coli gene expression system with cell-to-cell variation below the extrinsic noise limit

    PubMed Central

    2017-01-01

    Experiments in synthetic biology and microbiology can benefit from protein expression systems with low cell-to-cell variability (noise) and expression levels precisely tunable across a useful dynamic range. Despite advances in understanding the molecular biology of microbial gene regulation, many experiments employ protein-expression systems exhibiting high noise and nearly all-or-none responses to induction. I present an expression system that incorporates elements known to reduce gene expression noise: negative autoregulation and bicistronic transcription. I show by stochastic simulation that while negative autoregulation can produce a more gradual response to induction, bicistronic expression of a repressor and gene of interest can be necessary to reduce noise below the extrinsic limit. I synthesized a plasmid-based system incorporating these principles and studied its properties in Escherichia coli cells, using flow cytometry and fluorescence microscopy to characterize induction dose-response, induction/repression kinetics and gene expression noise. By varying ribosome binding site strengths, expression levels from 55–10,740 molecules/cell were achieved with noise below the extrinsic limit. Individual strains are inducible across a dynamic range greater than 20-fold. Experimental comparison of different regulatory networks confirmed that bicistronic autoregulation reduces noise, and revealed unexpectedly high noise for a conventional expression system with a constitutively expressed transcriptional repressor. I suggest a hybrid, low-noise expression system to increase the dynamic range. PMID:29084263

  17. Problem-Based Test: The Effect of Fibroblast Growth Factor on Gene Expression

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2011-01-01

    This paper shows the results of an experiment in which the effects of fibroblast growth factor (FGF), actinomycin D (Act D; an inhibitor of transcription), and cycloheximide (CHX; an inhibitor of translation) were studied on the expression of two genes: a gene called "Fnk" and the gene coding for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).…

  18. Parabolic flight induces changes in gene expression patterns in Arabidopsis thaliana.

    PubMed

    Paul, Anna-Lisa; Manak, Michael S; Mayfield, John D; Reyes, Matthew F; Gurley, William B; Ferl, Robert J

    2011-10-01

    Our primary objective was to evaluate gene expression changes in Arabidopsis thaliana in response to parabolic flight as part of a comprehensive approach to the molecular biology of spaceflight-related adaptations. In addition, we wished to establish parabolic flight as a tractable operations platform for molecular biology studies. In a succession of experiments on NASA's KC-135 and C-9 parabolic aircraft, Arabidopsis plants were presented with replicated exposure to parabolic flight. Transcriptome profiling revealed that parabolic flight caused changes in gene expression patterns that stood the statistical tests of replication on three different flight days. The earliest response, after 20 parabolas, was characterized by a prominence of genes associated with signal transduction. After 40 parabolas, this prominence was largely replaced by genes associated with biotic and abiotic stimuli and stress. Among these responses, three metabolic processes stand out in particular: the induction of auxin metabolism and signaling, the differential expression of genes associated with calcium-mediated signaling, and the repression of genes associated with disease resistance and cell wall biochemistry. Many, but not all, of these responses are known to be involved in gravity sensing in plants. Changes in auxin-related gene expression were also recorded by reporter genes tuned to auxin signal pathways. These data demonstrate that the parabolic flight environment is appropriate for molecular biology research involving the transition to microgravity, in that with replication, proper controls, and analyses, gene expression changes can be observed in the time frames of typical parabolic flight experiments.

  19. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks

    PubMed Central

    Trapnell, Cole; Roberts, Adam; Goff, Loyal; Pertea, Geo; Kim, Daehwan; Kelley, David R; Pimentel, Harold; Salzberg, Steven L; Rinn, John L; Pachter, Lior

    2012-01-01

    Recent advances in high-throughput cDNA sequencing (RNA-seq) can reveal new genes and splice variants and quantify expression genome-wide in a single assay. The volume and complexity of data from RNA-seq experiments necessitate scalable, fast and mathematically principled analysis software. TopHat and Cufflinks are free, open-source software tools for gene discovery and comprehensive expression analysis of high-throughput mRNA sequencing (RNA-seq) data. Together, they allow biologists to identify new genes and new splice variants of known ones, as well as compare gene and transcript expression under two or more conditions. This protocol describes in detail how to use TopHat and Cufflinks to perform such analyses. It also covers several accessory tools and utilities that aid in managing data, including CummeRbund, a tool for visualizing RNA-seq analysis results. Although the procedure assumes basic informatics skills, these tools assume little to no background with RNA-seq analysis and are meant for novices and experts alike. The protocol begins with raw sequencing reads and produces a transcriptome assembly, lists of differentially expressed and regulated genes and transcripts, and publication-quality visualizations of analysis results. The protocol's execution time depends on the volume of transcriptome sequencing data and available computing resources but takes less than 1 d of computer time for typical experiments and ~1 h of hands-on time. PMID:22383036

  20. Systems analysis of transcriptome data provides new hypotheses about Arabidopsis root response to nitrate treatments

    PubMed Central

    Canales, Javier; Moyano, Tomás C.; Villarroel, Eva; Gutiérrez, Rodrigo A.

    2014-01-01

    Nitrogen (N) is an essential macronutrient for plant growth and development. Plants adapt to changes in N availability partly by changes in global gene expression. We integrated publicly available root microarray data under contrasting nitrate conditions to identify new genes and functions important for adaptive nitrate responses in Arabidopsis thaliana roots. Overall, more than 2000 genes exhibited changes in expression in response to nitrate treatments in Arabidopsis thaliana root organs. Global regulation of gene expression by nitrate depends largely on the experimental context. However, despite significant differences from experiment to experiment in the identity of regulated genes, there is a robust nitrate response of specific biological functions. Integrative gene network analysis uncovered relationships between nitrate-responsive genes and 11 highly co-expressed gene clusters (modules). Four of these gene network modules have robust nitrate responsive functions such as transport, signaling, and metabolism. Network analysis hypothesized G2-like transcription factors are key regulatory factors controlling transport and signaling functions. Our meta-analysis highlights the role of biological processes not studied before in the context of the nitrate response such as root hair development and provides testable hypothesis to advance our understanding of nitrate responses in plants. PMID:24570678

  1. Expressing foreign genes in the pistil: a comparison of S-RNase constructs in different Nicotiana backgrounds.

    PubMed

    Murfett, J; McClure, B A

    1998-06-01

    Transgenic plant experiments have great potential for extending our understanding of the role of specific genes in controlling pollination. Often, the intent of such experiments is to over-express a gene and test for effects on pollination. We have examined the efficiency of six different S-RNase constructs in Nicotiana species and hybrids. Each construct contained the coding region, intron, and downstream sequences from the Nicotiana alata S(A2)-RNase gene. Among the six expression constructs, two utilized the cauliflower mosaic virus (CaMV) 35S promoter with duplicated enhancer, and four utilized promoters from genes expressed primarily in pistils. The latter included promoters from the tomato Chi2;1 and 9612 genes, a promoter from the N. alata S(A2)-RNase gene, and a promoter from the Brassica SLG-13 gene. Some or all of the constructs were tested in N. tabacum, N. plumbaginifolia, N. plumbaginifolia x SI N. alata S(C10)S(c10) hybrids, N. langsdorffii, and N. langsdorffii x SC N. alata hybrids. Stylar specific RNase activities and S(A2)-RNase transcript levels were determined in transformed plants. Constructs including the tomato Chi2;1 gene promoter or the Brassica SLG-13 promoter provided the highest levels of S(A2)-RNase expression. Transgene expression patterns were tightly regulated, the highest level of expression was observed in post-anthesis styles. Expression levels of the S(A2)-RNase transgenes was dependent on the genetic background of the host. Higher levels of S(A2)-RNase expression were observed in N. plumbaginifolia x SC N. alata hybrids than in N. plumbaginifolia.

  2. Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans

    PubMed Central

    Ow, Maria C.; Nichitean, Alexandra M.; Dorus, Steve; Hall, Sarah E.

    2018-01-01

    Environmental stress during early development in animals can have profound effects on adult phenotypes via programmed changes in gene expression. Using the nematode C. elegans, we demonstrated previously that adults retain a cellular memory of their developmental experience that is manifested by differences in gene expression and life history traits; however, the sophistication of this system in response to different environmental stresses, and how it dictates phenotypic plasticity in adults that contribute to increased fitness in response to distinct environmental challenges, was unknown. Using transcriptional profiling, we show here that C. elegans adults indeed retain distinct cellular memories of different environmental conditions. We identified approximately 500 genes in adults that entered dauer due to starvation that exhibit significant opposite (“seesaw”) transcriptional phenotypes compared to adults that entered dauer due to crowding, and are distinct from animals that bypassed dauer. Moreover, we show that two-thirds of the genes in the genome experience a 2-fold or greater seesaw trend in gene expression, and based upon the direction of change, are enriched in large, tightly linked regions on different chromosomes. Importantly, these transcriptional programs correspond to significant changes in brood size depending on the experienced stress. In addition, we demonstrate that while the observed seesaw gene expression changes occur in both somatic and germline tissue, only starvation-induced changes require a functional GLP-4 protein necessary for germline development, and both programs require the Argonaute CSR-1. Thus, our results suggest that signaling between the soma and the germ line can generate phenotypic plasticity as a result of early environmental experience, and likely contribute to increased fitness in adverse conditions and the evolution of the C. elegans genome. PMID:29447162

  3. Concerted Changes in Gene Expression and Cell Physiology of the Cyanobacterium Synechocystis sp. Strain PCC 6803 during Transitions between Nitrogen and Light-Limited Growth1[W][OA

    PubMed Central

    Aguirre von Wobeser, Eneas; Ibelings, Bas W.; Bok, Jasper; Krasikov, Vladimir; Huisman, Jef; Matthijs, Hans C.P.

    2011-01-01

    Physiological adaptation and genome-wide expression profiles of the cyanobacterium Synechocystis sp. strain PCC 6803 in response to gradual transitions between nitrogen-limited and light-limited growth conditions were measured in continuous cultures. Transitions induced changes in pigment composition, light absorption coefficient, photosynthetic electron transport, and specific growth rate. Physiological changes were accompanied by reproducible changes in the expression of several hundred open reading frames, genes with functions in photosynthesis and respiration, carbon and nitrogen assimilation, protein synthesis, phosphorus metabolism, and overall regulation of cell function and proliferation. Cluster analysis of the nearly 1,600 regulated open reading frames identified eight clusters, each showing a different temporal response during the transitions. Two large clusters mirrored each other. One cluster included genes involved in photosynthesis, which were up-regulated during light-limited growth but down-regulated during nitrogen-limited growth. Conversely, genes in the other cluster were down-regulated during light-limited growth but up-regulated during nitrogen-limited growth; this cluster included several genes involved in nitrogen uptake and assimilation. These results demonstrate complementary regulation of gene expression for two major metabolic activities of cyanobacteria. Comparison with batch-culture experiments revealed interesting differences in gene expression between batch and continuous culture and illustrates that continuous-culture experiments can pick up subtle changes in cell physiology and gene expression. PMID:21205618

  4. Differential expression profiles and pathways of genes in sugarcane leaf at elongation stage in response to drought stress

    PubMed Central

    Li, Changning; Nong, Qian; Solanki, Manoj Kumar; Liang, Qiang; Xie, Jinlan; Liu, Xiaoyan; Li, Yijie; Wang, Weizan; Yang, Litao; Li, Yangrui

    2016-01-01

    Water stress causes considerable yield losses in sugarcane. To investigate differentially expressed genes under water stress, a pot experiment was performed with the sugarcane variety GT21 at three water-deficit levels (mild, moderate, and severe) during the elongation stage and gene expression was analyzed using microarray technology. Physiological parameters of sugarcane showed significant alterations in response to drought stress. Based on the expression profile of 15,593 sugarcane genes, 1,501 (9.6%) genes were differentially expressed under different water-level treatments; 821 genes were upregulated and 680 genes were downregulated. A gene similarity analysis showed that approximately 62.6% of the differentially expressed genes shared homology with functional proteins. In a Gene Ontology (GO) analysis, 901 differentially expressed genes were assigned to 36 GO categories. Moreover, 325 differentially expressed genes were classified into 101 pathway categories involved in various processes, such as the biosynthesis of secondary metabolites, ribosomes, carbon metabolism, etc. In addition, some unannotated genes were detected; these may provide a basis for studies of water-deficit tolerance. The reliability of the observed expression patterns was confirmed by RT-PCR. The results of this study may help identify useful genes for improving drought tolerance in sugarcane. PMID:27170459

  5. Efficient production by sperm-mediated gene transfer of human decay accelerating factor (hDAF) transgenic pigs for xenotransplantation

    PubMed Central

    Lavitrano, Marialuisa; Bacci, Maria Laura; Forni, Monica; Lazzereschi, Davide; Di Stefano, Carla; Fioretti, Daniela; Giancotti, Paola; Marfé, Gabriella; Pucci, Loredana; Renzi, Luigina; Wang, Hongjun; Stoppacciaro, Antonella; Stassi, Giorgio; Sargiacomo, Massimo; Sinibaldi, Paola; Turchi, Valeria; Giovannoni, Roberto; Della Casa, Giacinto; Seren, Eraldo; Rossi, Giancarlo

    2002-01-01

    A large number of hDAF transgenic pigs to be used for xenotransplantation research were generated by using sperm-mediated gene transfer (SMGT). The efficiency of transgenesis obtained with SMGT was much greater than with any other method. In the experiments reported, up to 80% of pigs had the transgene integrated into the genome. Most of the pigs carrying the hDAF gene transcribed it in a stable manner (64%). The great majority of pigs that transcribed the gene expressed the protein (83%). The hDAF gene was transmitted to progeny. Expression was stable and found in caveolae as it is in human cells. The expressed gene was functional based on in vitro experiments performed on peripheral blood mononuclear cells. These results show that our SMGT approach to transgenesis provides an efficient procedure for studies involving large animal models. PMID:12393815

  6. [DNA microarray reveals changes in gene expression of endothelial cells under shear stress].

    PubMed

    Cheng, Min; Zhang, Wensheng; Chen, Huaiqing; Wu, Wenchao; Huang, Hua

    2004-04-01

    cDNA microarray technology is used as a powerful tool for rapid, comprehensive, and quantitative analysis of gene profiles of cultured human umbilical vein endothelial cells(HUVECs) in the normal static group and the shear stressed (4.20 dyne/cm2, 2 h) group. The total RNA from normal static cultured HUVECs was labeled by Cy3-dCTP, and total RNA of HUVECs from the paired shear stressed experiment was labeled by Cy5-dCTP. The expression ratios reported are the average from the two separate experiments. After bioinformatics analysis, we identified a total of 108 genes (approximately 0.026%) revealing differential expression. Of these 53 genes expressions were up-regulated, the most enhanced ones being human homolog of yeast IPP isomerase, human low density lipoprotein receptor gene, Squalene epoxidase gene, 7-dehydrocholesterol reductase, and 55 were down-regulated, the most decreased ones being heat shock 70 kD protein 1, TCB gene encoding cytosolic thyroid hormone-binding protein in HUVECs exposed to low shear stress. These results indicate that the cDNA microarray technique is effective in screening the differentially expressed genes in endothelial cells induced by various experimental conditions and the data may serve as stimuli to further researches.

  7. BATS: a Bayesian user-friendly software for analyzing time series microarray experiments.

    PubMed

    Angelini, Claudia; Cutillo, Luisa; De Canditiis, Daniela; Mutarelli, Margherita; Pensky, Marianna

    2008-10-06

    Gene expression levels in a given cell can be influenced by different factors, namely pharmacological or medical treatments. The response to a given stimulus is usually different for different genes and may depend on time. One of the goals of modern molecular biology is the high-throughput identification of genes associated with a particular treatment or a biological process of interest. From methodological and computational point of view, analyzing high-dimensional time course microarray data requires very specific set of tools which are usually not included in standard software packages. Recently, the authors of this paper developed a fully Bayesian approach which allows one to identify differentially expressed genes in a 'one-sample' time-course microarray experiment, to rank them and to estimate their expression profiles. The method is based on explicit expressions for calculations and, hence, very computationally efficient. The software package BATS (Bayesian Analysis of Time Series) presented here implements the methodology described above. It allows an user to automatically identify and rank differentially expressed genes and to estimate their expression profiles when at least 5-6 time points are available. The package has a user-friendly interface. BATS successfully manages various technical difficulties which arise in time-course microarray experiments, such as a small number of observations, non-uniform sampling intervals and replicated or missing data. BATS is a free user-friendly software for the analysis of both simulated and real microarray time course experiments. The software, the user manual and a brief illustrative example are freely available online at the BATS website: http://www.na.iac.cnr.it/bats.

  8. Microarray-based gene expression profiling to elucidate effectiveness of fermented Codonopsis lanceolata in mice.

    PubMed

    Choi, Woon Yong; Kim, Ji Seon; Park, Sung Jin; Ma, Choong Je; Lee, Hyeon Yong

    2014-04-08

    In this study, the effect of Codonopsis lanceolata fermented by lactic acid on controlling gene expression levels related to obesity was observed in an oligonucleotide chip microarray. Among 8170 genes, 393 genes were up regulated and 760 genes were down regulated in feeding the fermented C. lanceolata (FCL). Another 374 genes were up regulated and 527 genes down regulated without feeding the sample. The genes were not affected by the FCL sample. It was interesting that among those genes, Chytochrome P450, Dmbt1, LOC76487, and thyroid hormones, etc., were mostly up or down regulated. These genes are more related to lipid synthesis. We could conclude that the FCL possibly controlled the gene expression levels related to lipid synthesis, which resulted in reducing obesity. However, more detailed protein expression experiments should be carried out.

  9. Developmental and Environmental Regulation of Aquaporin Gene Expression across Populus Species: Divergence or Redundancy?

    PubMed Central

    Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

    2013-01-01

    Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy could be suspected. PMID:23393587

  10. Developmental and environmental regulation of Aquaporin gene expression across Populus species: divergence or redundancy?

    PubMed

    Cohen, David; Bogeat-Triboulot, Marie-Béatrice; Vialet-Chabrand, Silvère; Merret, Rémy; Courty, Pierre-Emmanuel; Moretti, Sébastien; Bizet, François; Guilliot, Agnès; Hummel, Irène

    2013-01-01

    Aquaporins (AQPs) are membrane channels belonging to the major intrinsic proteins family and are known for their ability to facilitate water movement. While in Populus trichocarpa, AQP proteins form a large family encompassing fifty-five genes, most of the experimental work focused on a few genes or subfamilies. The current work was undertaken to develop a comprehensive picture of the whole AQP gene family in Populus species by delineating gene expression domain and distinguishing responsiveness to developmental and environmental cues. Since duplication events amplified the poplar AQP family, we addressed the question of expression redundancy between gene duplicates. On these purposes, we carried a meta-analysis of all publicly available Affymetrix experiments. Our in-silico strategy controlled for previously identified biases in cross-species transcriptomics, a necessary step for any comparative transcriptomics based on multispecies design chips. Three poplar AQPs were not supported by any expression data, even in a large collection of situations (abiotic and biotic constraints, temporal oscillations and mutants). The expression of 11 AQPs was never or poorly regulated whatever the wideness of their expression domain and their expression level. Our work highlighted that PtTIP1;4 was the most responsive gene of the AQP family. A high functional divergence between gene duplicates was detected across species and in response to tested cues, except for the root-expressed PtTIP2;3/PtTIP2;4 pair exhibiting 80% convergent responses. Our meta-analysis assessed key features of aquaporin expression which had remained hidden in single experiments, such as expression wideness, response specificity and genotype and environment interactions. By consolidating expression profiles using independent experimental series, we showed that the large expansion of AQP family in poplar was accompanied with a strong divergence of gene expression, even if some cases of functional redundancy could be suspected.

  11. Discovering causal signaling pathways through gene-expression patterns

    PubMed Central

    Parikh, Jignesh R.; Klinger, Bertram; Xia, Yu; Marto, Jarrod A.; Blüthgen, Nils

    2010-01-01

    High-throughput gene-expression studies result in lists of differentially expressed genes. Most current meta-analyses of these gene lists include searching for significant membership of the translated proteins in various signaling pathways. However, such membership enrichment algorithms do not provide insight into which pathways caused the genes to be differentially expressed in the first place. Here, we present an intuitive approach for discovering upstream signaling pathways responsible for regulating these differentially expressed genes. We identify consistently regulated signature genes specific for signal transduction pathways from a panel of single-pathway perturbation experiments. An algorithm that detects overrepresentation of these signature genes in a gene group of interest is used to infer the signaling pathway responsible for regulation. We expose our novel resource and algorithm through a web server called SPEED: Signaling Pathway Enrichment using Experimental Data sets. SPEED can be freely accessed at http://speed.sys-bio.net/. PMID:20494976

  12. Gene Expression Browser: Large-Scale and Cross-Experiment Microarray Data Management, Search & Visualization

    USDA-ARS?s Scientific Manuscript database

    The amount of microarray gene expression data in public repositories has been increasing exponentially for the last couple of decades. High-throughput microarray data integration and analysis has become a critical step in exploring the large amount of expression data for biological discovery. Howeve...

  13. Global gene expression analysis of the heat shock response in the phytopathogen Xylella fastidiosa.

    PubMed

    Koide, Tie; Vêncio, Ricardo Z N; Gomes, Suely L

    2006-08-01

    Xylella fastidiosa is a phytopathogenic bacterium that is responsible for diseases in many economically important crops. Although different strains have been studied, little is known about X. fastidiosa stress responses. One of the better characterized stress responses in bacteria is the heat shock response, which induces the expression of specific genes to prevent protein misfolding and aggregation and to promote degradation of the irreversibly denatured polypeptides. To investigate X. fastidiosa genes involved in the heat shock response, we performed a whole-genome microarray analysis in a time course experiment. Globally, 261 genes were induced (9.7%) and 222 genes were repressed (8.3%). The expression profiles of the differentially expressed genes were grouped, and their expression patterns were validated by quantitative reverse transcription-PCR experiments. We determined the transcription start sites of six heat shock-inducible genes and analyzed their promoter regions, which allowed us to propose a putative consensus for sigma(32) promoters in Xylella and to suggest additional genes as putative members of this regulon. Besides the induction of classical heat shock protein genes, we observed the up-regulation of virulence-associated genes such as vapD and of genes for hemagglutinins, hemolysin, and xylan-degrading enzymes, which may indicate the importance of heat stress to bacterial pathogenesis. In addition, we observed the repression of genes related to fimbriae, aerobic respiration, and protein biosynthesis and the induction of genes related to the extracytoplasmic stress response and some phage-related genes, revealing the complex network of genes that work together in response to heat shock.

  14. Heterogeneous expression pattern of tandem duplicated sHsps genes during fruit ripening in two tomato species

    NASA Astrophysics Data System (ADS)

    Arce, DP; Krsticevic, FJ; Ezpeleta, J.; Ponce, SD; Pratta, GR; Tapia, E.

    2016-04-01

    The small heat shock proteins (sHSPs) have been found to play a critical role in physiological stress conditions in protecting proteins from irreversible aggregation. To characterize the gene expression profile of four sHsps with a tandem gene structure arrangement in the domesticated Solanum lycopersicum (Heinz 1706) genome and its wild close relative Solanum pimpinellifolium (LA1589), differential gene expression analysis using RNA-Seq was conducted in three ripening stages in both cultivars fruits. Gene promoter analysis was performed to explain the heterogeneous pattern of gene expression found for these tandem duplicated sHsps. In silico analysis results contribute to refocus wet experiment analysis in tomato sHsp family proteins.

  15. Estimation of gene induction enables a relevance-based ranking of gene sets.

    PubMed

    Bartholomé, Kilian; Kreutz, Clemens; Timmer, Jens

    2009-07-01

    In order to handle and interpret the vast amounts of data produced by microarray experiments, the analysis of sets of genes with a common biological functionality has been shown to be advantageous compared to single gene analyses. Some statistical methods have been proposed to analyse the differential gene expression of gene sets in microarray experiments. However, most of these methods either require threshhold values to be chosen for the analysis, or they need some reference set for the determination of significance. We present a method that estimates the number of differentially expressed genes in a gene set without requiring a threshold value for significance of genes. The method is self-contained (i.e., it does not require a reference set for comparison). In contrast to other methods which are focused on significance, our approach emphasizes the relevance of the regulation of gene sets. The presented method measures the degree of regulation of a gene set and is a useful tool to compare the induction of different gene sets and place the results of microarray experiments into the biological context. An R-package is available.

  16. Validating internal controls for quantitative plant gene expression studies.

    PubMed

    Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H

    2004-08-18

    Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments.

  17. Examination of the genetic basis for sexual dimorphism in the Aedes aegypti (dengue vector mosquito) pupal brain

    PubMed Central

    2014-01-01

    Background Most animal species exhibit sexually dimorphic behaviors, many of which are linked to reproduction. A number of these behaviors, including blood feeding in female mosquitoes, contribute to the global spread of vector-borne illnesses. However, knowledge concerning the genetic basis of sexually dimorphic traits is limited in any organism, including mosquitoes, especially with respect to differences in the developing nervous system. Methods Custom microarrays were used to examine global differences in female vs. male gene expression in the developing pupal head of the dengue vector mosquito, Aedes aegypti. The spatial expression patterns of a subset of differentially expressed transcripts were examined in the developing female vs. male pupal brain through in situ hybridization experiments. Small interfering RNA (siRNA)-mediated knockdown studies were used to assess the putative role of Doublesex, a terminal component of the sex determination pathway, in the regulation of sex-specific gene expression observed in the developing pupal brain. Results Transcripts (2,527), many of which were linked to proteolysis, the proteasome, metabolism, catabolic, and biosynthetic processes, ion transport, cell growth, and proliferation, were found to be differentially expressed in A. aegypti female vs. male pupal heads. Analysis of the spatial expression patterns for a subset of dimorphically expressed genes in the pupal brain validated the data set and also facilitated the identification of brain regions with dimorphic gene expression. In many cases, dimorphic gene expression localized to the optic lobe. Sex-specific differences in gene expression were also detected in the antennal lobe and mushroom body. siRNA-mediated gene targeting experiments demonstrated that Doublesex, a transcription factor with consensus binding sites located adjacent to many dimorphically expressed transcripts that function in neural development, is required for regulation of sex-specific gene expression in the developing A. aegypti brain. Conclusions These studies revealed sex-specific gene expression profiles in the developing A. aegypti pupal head and identified Doublesex as a key regulator of sexually dimorphic gene expression during mosquito neural development. PMID:25729562

  18. Mining microarray data at NCBI's Gene Expression Omnibus (GEO)*.

    PubMed

    Barrett, Tanya; Edgar, Ron

    2006-01-01

    The Gene Expression Omnibus (GEO) at the National Center for Biotechnology Information (NCBI) has emerged as the leading fully public repository for gene expression data. This chapter describes how to use Web-based interfaces, applications, and graphics to effectively explore, visualize, and interpret the hundreds of microarray studies and millions of gene expression patterns stored in GEO. Data can be examined from both experiment-centric and gene-centric perspectives using user-friendly tools that do not require specialized expertise in microarray analysis or time-consuming download of massive data sets. The GEO database is publicly accessible through the World Wide Web at http://www.ncbi.nlm.nih.gov/geo.

  19. Transcriptome-wide selection of a reliable set of reference genes for gene expression studies in potato cyst nematodes (Globodera spp.).

    PubMed

    Sabeh, Michael; Duceppe, Marc-Olivier; St-Arnaud, Marc; Mimee, Benjamin

    2018-01-01

    Relative gene expression analyses by qRT-PCR (quantitative reverse transcription PCR) require an internal control to normalize the expression data of genes of interest and eliminate the unwanted variation introduced by sample preparation. A perfect reference gene should have a constant expression level under all the experimental conditions. However, the same few housekeeping genes selected from the literature or successfully used in previous unrelated experiments are often routinely used in new conditions without proper validation of their stability across treatments. The advent of RNA-Seq and the availability of public datasets for numerous organisms are opening the way to finding better reference genes for expression studies. Globodera rostochiensis is a plant-parasitic nematode that is particularly yield-limiting for potato. The aim of our study was to identify a reliable set of reference genes to study G. rostochiensis gene expression. Gene expression levels from an RNA-Seq database were used to identify putative reference genes and were validated with qRT-PCR analysis. Three genes, GR, PMP-3, and aaRS, were found to be very stable within the experimental conditions of this study and are proposed as reference genes for future work.

  20. Non-Gaussian Distributions Affect Identification of Expression Patterns, Functional Annotation, and Prospective Classification in Human Cancer Genomes

    PubMed Central

    Marko, Nicholas F.; Weil, Robert J.

    2012-01-01

    Introduction Gene expression data is often assumed to be normally-distributed, but this assumption has not been tested rigorously. We investigate the distribution of expression data in human cancer genomes and study the implications of deviations from the normal distribution for translational molecular oncology research. Methods We conducted a central moments analysis of five cancer genomes and performed empiric distribution fitting to examine the true distribution of expression data both on the complete-experiment and on the individual-gene levels. We used a variety of parametric and nonparametric methods to test the effects of deviations from normality on gene calling, functional annotation, and prospective molecular classification using a sixth cancer genome. Results Central moments analyses reveal statistically-significant deviations from normality in all of the analyzed cancer genomes. We observe as much as 37% variability in gene calling, 39% variability in functional annotation, and 30% variability in prospective, molecular tumor subclassification associated with this effect. Conclusions Cancer gene expression profiles are not normally-distributed, either on the complete-experiment or on the individual-gene level. Instead, they exhibit complex, heavy-tailed distributions characterized by statistically-significant skewness and kurtosis. The non-Gaussian distribution of this data affects identification of differentially-expressed genes, functional annotation, and prospective molecular classification. These effects may be reduced in some circumstances, although not completely eliminated, by using nonparametric analytics. This analysis highlights two unreliable assumptions of translational cancer gene expression analysis: that “small” departures from normality in the expression data distributions are analytically-insignificant and that “robust” gene-calling algorithms can fully compensate for these effects. PMID:23118863

  1. Gene Expression Noise, Fitness Landscapes, and Evolution

    NASA Astrophysics Data System (ADS)

    Charlebois, Daniel

    The stochastic (or noisy) process of gene expression can have fitness consequences for living organisms. For example, gene expression noise facilitates the development of drug resistance by increasing the time scale at which beneficial phenotypic states can be maintained. The present work investigates the relationship between gene expression noise and the fitness landscape. By incorporating the costs and benefits of gene expression, we track how the fluctuation magnitude and timescale of expression noise evolve in simulations of cell populations under stress. We find that properties of expression noise evolve to maximize fitness on the fitness landscape, and that low levels of expression noise emerge when the fitness benefits of gene expression exceed the fitness costs (and that high levels of noise emerge when the costs of expression exceed the benefits). The findings from our theoretical/computational work offer new hypotheses on the development of drug resistance, some of which are now being investigated in evolution experiments in our laboratory using well-characterized synthetic gene regulatory networks in budding yeast. Nserc Postdoctoral Fellowship (Grant No. PDF-453977-2014).

  2. From reads to genes to pathways: differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline.

    PubMed

    Chen, Yunshun; Lun, Aaron T L; Smyth, Gordon K

    2016-01-01

    In recent years, RNA sequencing (RNA-seq) has become a very widely used technology for profiling gene expression. One of the most common aims of RNA-seq profiling is to identify genes or molecular pathways that are differentially expressed (DE) between two or more biological conditions. This article demonstrates a computational workflow for the detection of DE genes and pathways from RNA-seq data by providing a complete analysis of an RNA-seq experiment profiling epithelial cell subsets in the mouse mammary gland. The workflow uses R software packages from the open-source Bioconductor project and covers all steps of the analysis pipeline, including alignment of read sequences, data exploration, differential expression analysis, visualization and pathway analysis. Read alignment and count quantification is conducted using the Rsubread package and the statistical analyses are performed using the edgeR package. The differential expression analysis uses the quasi-likelihood functionality of edgeR.

  3. An Efficient Method for Generation of Knockout Human Embryonic Stem Cells Using CRISPR/Cas9 System.

    PubMed

    Bohaciakova, Dasa; Renzova, Tereza; Fedorova, Veronika; Barak, Martin; Kunova Bosakova, Michaela; Hampl, Ales; Cajanek, Lukas

    2017-11-01

    Human embryonic stem cells (hESCs) represent a promising tool to study functions of genes during development, to model diseases, and to even develop therapies when combined with gene editing techniques such as CRISPR/CRISPR-associated protein-9 nuclease (Cas9) system. However, the process of disruption of gene expression by generation of null alleles is often inefficient and tedious. To circumvent these limitations, we developed a simple and efficient protocol to permanently downregulate expression of a gene of interest in hESCs using CRISPR/Cas9. We selected p53 for our proof of concept experiments. The methodology is based on series of hESC transfection, which leads to efficient downregulation of p53 expression even in polyclonal population (p53 Low cells), here proven by a loss of regulation of the expression of p53 target gene, microRNA miR-34a. We demonstrate that our approach achieves over 80% efficiency in generating hESC clonal sublines that do not express p53 protein. Importantly, we document by a set of functional experiments that such genetically modified hESCs do retain typical stem cells characteristics. In summary, we provide a simple and robust protocol to efficiently target expression of gene of interest in hESCs that can be useful for laboratories aiming to employ gene editing in their hESC applications/protocols.

  4. Microgravity and Immunity: Changes in Lymphocyte Gene Expression

    NASA Technical Reports Server (NTRS)

    Risin, D.; Pellis, N. R.; Ward, N. E.; Risin, S. A.

    2006-01-01

    Earlier studies had shown that modeled and true microgravity (MG) cause multiple direct effects on human lymphocytes. MG inhibits lymphocyte locomotion, suppresses polyclonal and antigen-specific activation, affects signal transduction mechanisms, as well as activation-induced apoptosis. In this study we assessed changes in gene expression associated with lymphocyte exposure to microgravity in an attempt to identify microgravity-sensitive genes (MGSG) in general and specifically those genes that might be responsible for the functional and structural changes observed earlier. Two sets of experiments targeting different goals were conducted. In the first set, T-lymphocytes from normal donors were activated with antiCD3 and IL2 and then cultured in 1g (static) and modeled MG (MMG) conditions (Rotating Wall Vessel bioreactor) for 24 hours. This setting allowed searching for MGSG by comparison of gene expression patterns in zero and 1 g gravity. In the second set - activated T-cells after culturing for 24 hours in 1g and MMG were exposed three hours before harvesting to a secondary activation stimulus (PHA) thus triggering the apoptotic pathway. Total RNA was extracted using the RNeasy isolation kit (Qiagen, Valencia, CA). Affymetrix Gene Chips (U133A), allowing testing for 18,400 human genes, were used for microarray analysis. In the first set of experiments MMG exposure resulted in altered expression of 89 genes, 10 of them were up-regulated and 79 down-regulated. In the second set, changes in expression were revealed in 85 genes, 20 were up-regulated and 65 were down-regulated. The analysis revealed that significant numbers of MGS genes are associated with signal transduction and apoptotic pathways. Interestingly, the majority of genes that responded by up- or down-regulation in the alternative sets of experiments were not the same, possibly reflecting different functional states of the examined T-lymphocyte populations. The responder genes (MGSG) might play an essential role in adaptation to MG and/or be responsible for pathologic changes encountered in Space and thus represent potential targets for molecular-based countermeasures

  5. LINCS Canvas Browser: interactive web app to query, browse and interrogate LINCS L1000 gene expression signatures.

    PubMed

    Duan, Qiaonan; Flynn, Corey; Niepel, Mario; Hafner, Marc; Muhlich, Jeremy L; Fernandez, Nicolas F; Rouillard, Andrew D; Tan, Christopher M; Chen, Edward Y; Golub, Todd R; Sorger, Peter K; Subramanian, Aravind; Ma'ayan, Avi

    2014-07-01

    For the Library of Integrated Network-based Cellular Signatures (LINCS) project many gene expression signatures using the L1000 technology have been produced. The L1000 technology is a cost-effective method to profile gene expression in large scale. LINCS Canvas Browser (LCB) is an interactive HTML5 web-based software application that facilitates querying, browsing and interrogating many of the currently available LINCS L1000 data. LCB implements two compacted layered canvases, one to visualize clustered L1000 expression data, and the other to display enrichment analysis results using 30 different gene set libraries. Clicking on an experimental condition highlights gene-sets enriched for the differentially expressed genes from the selected experiment. A search interface allows users to input gene lists and query them against over 100 000 conditions to find the top matching experiments. The tool integrates many resources for an unprecedented potential for new discoveries in systems biology and systems pharmacology. The LCB application is available at http://www.maayanlab.net/LINCS/LCB. Customized versions will be made part of the http://lincscloud.org and http://lincs.hms.harvard.edu websites. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Cloning and expression analysis of innate immune genes from red sea bream to assess different susceptibility to megalocytivirus infection.

    PubMed

    Jin, J W; Kim, Y C; Hong, S; Kim, M S; Jeong, J B; Jeong, H D

    2017-04-01

    As suggested by the Office International des Epizooties (OIE), fishes belonging to the genus Oplegnathus are more sensitive to megalocytivirus infection than other fish species including red sea bream (Pagrus major). To assess the roles of the innate immune response to these different susceptibilities, we cloned the genes encoding inflammatory factors including IL-8 and COX-2, and the antiviral factor like Mx from red sea bream for the first time and performed phylogenetic and structural analysis. Analysed expression levels of IL-1β, IL-8 and COX-2 and the antiviral factor like Mx genes performed with in vivo challenge experiment showed no difference in inflammatory gene expression or respiratory burst activity between red sea bream and rock bream (Oplegnathus fasciatus). However, the Mx gene expression levels in red sea bream were markedly higher than those in rock bream, suggesting the importance of type I interferon (IFN)-induced proteins, particularly Mx, during megalocytivirus infection, rather than inflammation-related genes. The in vitro challenge experiments using embryonic primary cultures derived from both fish species showed no difference in cytopathic effects (CPE), viral replication profiles, and inflammatory and Mx gene expression pattern between the two fish species. © 2016 John Wiley & Sons Ltd.

  7. Suboptimal evolutionary novel environments promote singular altered gravity responses of transcriptome during Drosophila metamorphosis

    PubMed Central

    2013-01-01

    Background Previous experiments have shown that the reduced gravity aboard the International Space Station (ISS) causes important alterations in Drosophila gene expression. These changes were shown to be intimately linked to environmental space-flight related constraints. Results Here, we use an array of different techniques for ground-based simulation of microgravity effects to assess the effect of suboptimal environmental conditions on the gene expression of Drosophila in reduced gravity. A global and integrative analysis, using “gene expression dynamics inspector” (GEDI) self-organizing maps, reveals different degrees in the responses of the transcriptome when using different environmental conditions or microgravity/hypergravity simulation devices. Although the genes that are affected are different in each simulation technique, we find that the same gene ontology groups, including at least one large multigene family related with behavior, stress response or organogenesis, are over represented in each case. Conclusions These results suggest that the transcriptome as a whole can be finely tuned to gravity force. In optimum environmental conditions, the alteration of gravity has only mild effects on gene expression but when environmental conditions are far from optimal, the gene expression must be tuned greatly and effects become more robust, probably linked to the lack of experience of organisms exposed to evolutionary novel environments such as a gravitational free one. PMID:23806134

  8. Differentiating disease subtypes by using pathway patterns constructed from gene expressions and protein networks.

    PubMed

    Hung, Fei-Hung; Chiu, Hung-Wen

    2015-01-01

    Gene expression profiles differ in different diseases. Even if diseases are at the same stage, such diseases exhibit different gene expressions, not to mention the different subtypes at a single lesion site. Distinguishing different disease subtypes at a single lesion site is difficult. In early cases, subtypes were initially distinguished by doctors. Subsequently, further differences were found through pathological experiments. For example, a brain tumor can be classified according to its origin, its cell-type origin, or the tumor site. Because of the advancements in bioinformatics and the techniques for accumulating gene expressions, researchers can use gene expression data to classify disease subtypes. Because the operation of a biopathway is closely related to the disease mechanism, the application of gene expression profiles for clustering disease subtypes is insufficient. In this study, we collected gene expression data of healthy and four myelodysplastic syndrome subtypes and applied a method that integrated protein-protein interaction and gene expression data to identify different patterns of disease subtypes. We hope it is efficient for the classification of disease subtypes in adventure.

  9. Importing MAGE-ML format microarray data into BioConductor.

    PubMed

    Durinck, Steffen; Allemeersch, Joke; Carey, Vincent J; Moreau, Yves; De Moor, Bart

    2004-12-12

    The microarray gene expression markup language (MAGE-ML) is a widely used XML (eXtensible Markup Language) standard for describing and exchanging information about microarray experiments. It can describe microarray designs, microarray experiment designs, gene expression data and data analysis results. We describe RMAGEML, a new Bioconductor package that provides a link between cDNA microarray data stored in MAGE-ML format and the Bioconductor framework for preprocessing, visualization and analysis of microarray experiments. http://www.bioconductor.org. Open Source.

  10. Detrimental effect of expression of Bt endotoxin Cry1Ac on in vitro regeneration, in vivo growth and development of tobacco and cotton transgenics.

    PubMed

    Rawat, Preeti; Singh, Amarjeet Kumar; Ray, Krishna; Chaudhary, Bhupendra; Kumar, Sanjeev; Gautam, Taru; Kanoria, Shaveta; Kaur, Gurpreet; Kumar, Paritosh; Pental, Deepak; Burma, Pradeep Kumar

    2011-06-01

    High levels of expression of the cry1Ac gene from Bacillus thuringiensis cannot be routinely achieved in transgenic plants despite modifications made in the gene to improve its expression. This has been attributed to the instability of the transcript in a few reports. In the present study, based on the genetic transformation of cotton and tobacco, we show that the expression of the Cry1Ac endotoxin has detrimental effects on both the in vitro and in vivo growth and development of transgenic plants. A number of experiments on developing transgenics in cotton with different versions of cry1Ac gene showed that the majority of the plants did not express any Cry1Ac protein. Based on Southern blot analysis, it was also observed that a substantial number of lines did not contain the cry1Ac gene cassette although they contained the marker gene nptII. More significantly, all the lines that showed appreciable levels of expression were found to be phenotypically abnormal. Experiments on transformation of tobacco with different constructs expressing the cry1Ac gene showed that in vitro regeneration was inhibited by the encoded protein. Further, out of a total of 145 independent events generated with the different cry1Ac gene constructs in tobacco, only 21 showed expression of the Cry1Ac protein, confirming observations made in cotton that regenerants that express high levels of the Cry1Ac protein are selected against during regeneration of transformed events. This problem was circumvented by targeting the Cry1Ac protein to the chloroplast, which also significantly improved the expression of the protein.

  11. Regulatory effect of acetyl-l-carnitine on expression of lenticular antioxidant and apoptotic genes in selenite-induced cataract.

    PubMed

    Elanchezhian, R; Sakthivel, M; Geraldine, P; Thomas, P A

    2010-03-30

    Differential expression of apoptotic genes has been demonstrated in selenite-induced cataract. Acetyl-l-carnitine (ALCAR) has been shown to prevent selenite cataractogenesis by maintaining lenticular antioxidant enzyme and redox system components at near normal levels and also by inhibiting lenticular calpain activity. The aim of the present experiment was to investigate the possibility that ALCAR also prevents selenite-induced cataractogenesis by regulating the expression of antioxidant (catalase) and apoptotic [caspase-3, early growth response protein-1 (EGR-1) and cytochrome c oxidase subunit I (COX-I)] genes. The experiment was conducted on 9-day-old Wistar rat pups, which were divided into normal, cataract-untreated and cataract-treated groups. Putative changes in gene expression in whole lenses removed from the rats were determined by measuring mRNA transcript levels of the four genes by RT-PCR analysis, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as an internal control. The expression of lenticular caspase-3 and EGR-1 genes appeared to be upregulated, as inferred by detecting increased mRNA transcript levels, while that of COX-I and catalase genes appeared to be downregulated (lowered mRNA transcript levels) in the lenses of cataract-untreated rats. However, in rats treated with ALCAR, the lenticular mRNA transcript levels were maintained at near normal (control) levels. These results suggest that ALCAR may prevent selenite-induced cataractogenesis by preventing abnormal expression of lenticular genes governing apoptosis.

  12. ExpTreeDB: web-based query and visualization of manually annotated gene expression profiling experiments of human and mouse from GEO.

    PubMed

    Ni, Ming; Ye, Fuqiang; Zhu, Juanjuan; Li, Zongwei; Yang, Shuai; Yang, Bite; Han, Lu; Wu, Yongge; Chen, Ying; Li, Fei; Wang, Shengqi; Bo, Xiaochen

    2014-12-01

    Numerous public microarray datasets are valuable resources for the scientific communities. Several online tools have made great steps to use these data by querying related datasets with users' own gene signatures or expression profiles. However, dataset annotation and result exhibition still need to be improved. ExpTreeDB is a database that allows for queries on human and mouse microarray experiments from Gene Expression Omnibus with gene signatures or profiles. Compared with similar applications, ExpTreeDB pays more attention to dataset annotations and result visualization. We introduced a multiple-level annotation system to depict and organize original experiments. For example, a tamoxifen-treated cell line experiment is hierarchically annotated as 'agent→drug→estrogen receptor antagonist→tamoxifen'. Consequently, retrieved results are exhibited by an interactive tree-structured graphics, which provide an overview for related experiments and might enlighten users on key items of interest. The database is freely available at http://biotech.bmi.ac.cn/ExpTreeDB. Web site is implemented in Perl, PHP, R, MySQL and Apache. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. ERK signaling pathway regulates sleep duration through activity-induced gene expression during wakefulness.

    PubMed

    Mikhail, Cyril; Vaucher, Angélique; Jimenez, Sonia; Tafti, Mehdi

    2017-01-24

    Wakefulness is accompanied by experience-dependent synaptic plasticity and an increase in activity-regulated gene transcription. Wake-induced genes are certainly markers of neuronal activity and may also directly regulate the duration of and need for sleep. We stimulated murine cortical cultures with the neuromodulatory signals that are known to control wakefulness in the brain and found that norepinephrine alone or a mixture of these neuromodulators induced activity-regulated gene transcription. Pharmacological inhibition of the various signaling pathways involved in the regulation of gene expression indicated that the extracellular signal-regulated kinase (ERK) pathway is the principal one mediating the effects of waking neuromodulators on gene expression. In mice, ERK phosphorylation in the cortex increased and decreased with wakefulness and sleep. Whole-body or cortical neuron-specific deletion of Erk1 or Erk2 significantly increased the duration of wakefulness in mice, and pharmacological inhibition of ERK phosphorylation decreased sleep duration and increased the duration of wakefulness bouts. Thus, this signaling pathway, which is highly conserved from Drosophila to mammals, is a key pathway that links waking experience-induced neuronal gene expression to sleep duration and quality. Copyright © 2017, American Association for the Advancement of Science.

  14. EXP-PAC: providing comparative analysis and storage of next generation gene expression data.

    PubMed

    Church, Philip C; Goscinski, Andrzej; Lefèvre, Christophe

    2012-07-01

    Microarrays and more recently RNA sequencing has led to an increase in available gene expression data. How to manage and store this data is becoming a key issue. In response we have developed EXP-PAC, a web based software package for storage, management and analysis of gene expression and sequence data. Unique to this package is SQL based querying of gene expression data sets, distributed normalization of raw gene expression data and analysis of gene expression data across experiments and species. This package has been populated with lactation data in the international milk genomic consortium web portal (http://milkgenomics.org/). Source code is also available which can be hosted on a Windows, Linux or Mac APACHE server connected to a private or public network (http://mamsap.it.deakin.edu.au/~pcc/Release/EXP_PAC.html). Copyright © 2012 Elsevier Inc. All rights reserved.

  15. iPcc: a novel feature extraction method for accurate disease class discovery and prediction

    PubMed Central

    Ren, Xianwen; Wang, Yong; Zhang, Xiang-Sun; Jin, Qi

    2013-01-01

    Gene expression profiling has gradually become a routine procedure for disease diagnosis and classification. In the past decade, many computational methods have been proposed, resulting in great improvements on various levels, including feature selection and algorithms for classification and clustering. In this study, we present iPcc, a novel method from the feature extraction perspective to further propel gene expression profiling technologies from bench to bedside. We define ‘correlation feature space’ for samples based on the gene expression profiles by iterative employment of Pearson’s correlation coefficient. Numerical experiments on both simulated and real gene expression data sets demonstrate that iPcc can greatly highlight the latent patterns underlying noisy gene expression data and thus greatly improve the robustness and accuracy of the algorithms currently available for disease diagnosis and classification based on gene expression profiles. PMID:23761440

  16. Validating internal controls for quantitative plant gene expression studies

    PubMed Central

    Brunner, Amy M; Yakovlev, Igor A; Strauss, Steven H

    2004-01-01

    Background Real-time reverse transcription PCR (RT-PCR) has greatly improved the ease and sensitivity of quantitative gene expression studies. However, accurate measurement of gene expression with this method relies on the choice of a valid reference for data normalization. Studies rarely verify that gene expression levels for reference genes are adequately consistent among the samples used, nor compare alternative genes to assess which are most reliable for the experimental conditions analyzed. Results Using real-time RT-PCR to study the expression of 10 poplar (genus Populus) housekeeping genes, we demonstrate a simple method for determining the degree of stability of gene expression over a set of experimental conditions. Based on a traditional method for analyzing the stability of varieties in plant breeding, it defines measures of gene expression stability from analysis of variance (ANOVA) and linear regression. We found that the potential internal control genes differed widely in their expression stability over the different tissues, developmental stages and environmental conditions studied. Conclusion Our results support that quantitative comparisons of candidate reference genes are an important part of real-time RT-PCR studies that seek to precisely evaluate variation in gene expression. The method we demonstrated facilitates statistical and graphical evaluation of gene expression stability. Selection of the best reference gene for a given set of experimental conditions should enable detection of biologically significant changes in gene expression that are too small to be revealed by less precise methods, or when highly variable reference genes are unknowingly used in real-time RT-PCR experiments. PMID:15317655

  17. Increase in expression of brain serotonin transporter and monoamine oxidase a genes induced by repeated experience of social defeats in male mice.

    PubMed

    Filipenko, M L; Beilina, A G; Alekseyenko, O V; Dolgov, V V; Kudryavtseva, N N

    2002-04-01

    Serotonin transporter and monoamine oxidase (MAO) A are involved in the inactivation of serotonin. The former is responsible for serotonin re-uptake from the synapse, whereas the latter catalyzes serotonin deamination in presynaptic terminals. Expression of serotonin transporter and MAO A genes was investigated in raphe nuclei of midbrain of CBA/Lac male mice with repeated experience of social victories or defeats in 10 daily aggressive confrontations. The amount of cDNA of these genes was evaluated using multiplex RT-PCR. Two independent experiments revealed that the defeated mice were characterized by significantly higher levels of serotonin transporter and MAO A mRNAs than the control and aggressive animals. Increased expression of MAO A and serotonin transporter genes is suggested to reflect the accelerated serotonin degradation in response to activation of the serotonergic system functioning induced by social stress. Significant positive correlation between MAO A and serotonin transporter mRNA levels suggests common pathways of regulation of transcriptional activity of these genes.

  18. Designing microarray and RNA-Seq experiments for greater systems biology discovery in modern plant genomics.

    PubMed

    Yang, Chuanping; Wei, Hairong

    2015-02-01

    Microarray and RNA-seq experiments have become an important part of modern genomics and systems biology. Obtaining meaningful biological data from these experiments is an arduous task that demands close attention to many details. Negligence at any step can lead to gene expression data containing inadequate or composite information that is recalcitrant for pattern extraction. Therefore, it is imperative to carefully consider experimental design before launching a time-consuming and costly experiment. Contemporarily, most genomics experiments have two objectives: (1) to generate two or more groups of comparable data for identifying differentially expressed genes, gene families, biological processes, or metabolic pathways under experimental conditions; (2) to build local gene regulatory networks and identify hierarchically important regulators governing biological processes and pathways of interest. Since the first objective aims to identify the active molecular identities and the second provides a basis for understanding the underlying molecular mechanisms through inferring causality relationships mediated by treatment, an optimal experiment is to produce biologically relevant and extractable data to meet both objectives without substantially increasing the cost. This review discusses the major issues that researchers commonly face when embarking on microarray or RNA-seq experiments and summarizes important aspects of experimental design, which aim to help researchers deliberate how to generate gene expression profiles with low background noise but with more interaction to facilitate novel biological discoveries in modern plant genomics. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  19. Mining Microarray Data at NCBI’s Gene Expression Omnibus (GEO)*

    PubMed Central

    Barrett, Tanya; Edgar, Ron

    2006-01-01

    Summary The Gene Expression Omnibus (GEO) at the National Center for Biotechnology Information (NCBI) has emerged as the leading fully public repository for gene expression data. This chapter describes how to use Web-based interfaces, applications, and graphics to effectively explore, visualize, and interpret the hundreds of microarray studies and millions of gene expression patterns stored in GEO. Data can be examined from both experiment-centric and gene-centric perspectives using user-friendly tools that do not require specialized expertise in microarray analysis or time-consuming download of massive data sets. The GEO database is publicly accessible through the World Wide Web at http://www.ncbi.nlm.nih.gov/geo. PMID:16888359

  20. ARG1 Functions in the Physiological Adaptation of Undifferentiated Plant Cells to Spaceflight

    NASA Astrophysics Data System (ADS)

    Zupanska, Agata K.; Schultz, Eric R.; Yao, JiQiang; Sng, Natasha J.; Zhou, Mingqi; Callaham, Jordan B.; Ferl, Robert J.; Paul, Anna-Lisa

    2017-11-01

    Scientific access to spaceflight and especially the International Space Station has revealed that physiological adaptation to spaceflight is accompanied or enabled by changes in gene expression that significantly alter the transcriptome of cells in spaceflight. A wide range of experiments have shown that plant physiological adaptation to spaceflight involves gene expression changes that alter cell wall and other metabolisms. However, while transcriptome profiling aptly illuminates changes in gene expression that accompany spaceflight adaptation, mutation analysis is required to illuminate key elements required for that adaptation. Here we report how transcriptome profiling was used to gain insight into the spaceflight adaptation role of Altered response to gravity 1 (Arg1), a gene known to affect gravity responses in plants on Earth. The study compared expression profiles of cultured lines of Arabidopsis thaliana derived from wild-type (WT) cultivar Col-0 to profiles from a knock-out line deficient in the gene encoding ARG1 (ARG1 KO), both on the ground and in space. The cell lines were launched on SpaceX CRS-2 as part of the Cellular Expression Logic (CEL) experiment of the BRIC-17 spaceflight mission. The cultured cell lines were grown within 60 mm Petri plates in Petri Dish Fixation Units (PDFUs) that were housed within the Biological Research In Canisters (BRIC) hardware. Spaceflight samples were fixed on orbit. Differentially expressed genes were identified between the two environments (spaceflight and comparable ground controls) and the two genotypes (WT and ARG1 KO). Each genotype engaged unique genes during physiological adaptation to the spaceflight environment, with little overlap. Most of the genes altered in expression in spaceflight in WT cells were found to be Arg1-dependent, suggesting a major role for that gene in the physiological adaptation of undifferentiated cells to spaceflight.

  1. Associating quantitative behavioral traits with gene expression in the brain: searching for diamonds in the hay.

    PubMed

    Reiner-Benaim, Anat; Yekutieli, Daniel; Letwin, Noah E; Elmer, Gregory I; Lee, Norman H; Kafkafi, Neri; Benjamini, Yoav

    2007-09-01

    Gene expression and phenotypic functionality can best be associated when they are measured quantitatively within the same experiment. The analysis of such a complex experiment is presented, searching for associations between measures of exploratory behavior in mice and gene expression in brain regions. The analysis of such experiments raises several methodological problems. First and foremost, the size of the pool of potential discoveries being screened is enormous yet only few biologically relevant findings are expected, making the problem of multiple testing especially severe. We present solutions based on screening by testing related hypotheses, then testing the hypotheses of interest. In one variant the subset is selected directly, in the other one a tree of hypotheses is tested hierarchical; both variants control the False Discovery Rate (FDR). Other problems in such experiments are in the fact that the level of data aggregation may be different for the quantitative traits (one per animal) and gene expression measurements (pooled across animals); in that the association may not be linear; and in the resolution of interest only few replications exist. We offer solutions to these problems as well. The hierarchical FDR testing strategies presented here can serve beyond the structure of our motivating example study to any complex microarray study. Supplementary data are available at Bioinformatics online.

  2. Bacillus subtilis 168 Contains Two Differentially Regulated Genes Encoding l-Asparaginase

    PubMed Central

    Fisher, Susan H.; Wray, Lewis V.

    2002-01-01

    Expression of the two Bacillus subtilis genes encoding l-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional l-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second l-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression. PMID:11914346

  3. Bacillus subtilis 168 contains two differentially regulated genes encoding L-asparaginase.

    PubMed

    Fisher, Susan H; Wray, Lewis V

    2002-04-01

    Expression of the two Bacillus subtilis genes encoding L-asparaginase is controlled by independent regulatory factors. The ansZ gene (formerly yccC) was shown by mutational analysis to encode a functional L-asparaginase, the expression of which is activated during nitrogen-limited growth by the TnrA transcription factor. Gel mobility shift and DNase I footprinting experiments indicate that TnrA regulates ansZ expression by binding to a DNA site located upstream of the ansZ promoter. The expression of the ansA gene, which encodes the second L-asparaginase, was found to be induced by asparagine. The ansA repressor, AnsR, was shown to negatively regulate its own expression.

  4. Sexually dimorphic expression of the genes encoding ribosomal proteins L17 and L37 in the song control nuclei of juvenile zebra finches

    PubMed Central

    Tang, Yu Ping; Wade, Juli

    2010-01-01

    Studies evaluating the role of steroid hormones in sexual differentiation of the zebra finch song system have produced complicated and at times paradoxical results, and indicate that additional factors may be critical. Therefore, in a previous study we initiated a screen for differential gene expression in the telencephalon of developing male and female zebra finches. The use of cDNA microarrays and real-time quantitative PCR revealed increased expression of the genes encoding ribosomal proteins L17 and L37 (RPL17 and RPL37) in the male forebrain as a whole. Preliminary in situ hybridization data then indicated enhanced expression of both these genes in song control regions. Two experiments in the present study quantified the mRNA expression. The first utilized 25-day-old male and female zebra finches. The second compared a separate set of juveniles to adults of both sexes to both re-confirm enhanced expression in juvenile males and to determine whether it is limited to developing animals. In Experiment 1, males exhibited increased expression of both RPL17 and RPL37 compared to females in Area X, the robust nucleus of the arcopallium (RA), and the ventral ventricular zone (VVZ), which may provide neurons to Area X. Experiment 2 replicated the sexually dimorphic expression of these genes at post-hatching day 25, and documented that the sex differences are eliminated or greatly reduced in adults. The results are consistent with the idea that these ribosomal proteins may influence sexual differentiation of Area X and RA, potentially regulating the genesis and/or survival of neurons. PMID:16938280

  5. Sexually dimorphic expression of the genes encoding ribosomal proteins L17 and L37 in the song control nuclei of juvenile zebra finches.

    PubMed

    Tang, Yu Ping; Wade, Juli

    2006-12-18

    Studies evaluating the role of steroid hormones in sexual differentiation of the zebra finch song system have produced complicated and at times paradoxical results, and indicate that additional factors may be critical. Therefore, in a previous study we initiated a screen for differential gene expression in the telencephalon of developing male and female zebra finches. The use of cDNA microarrays and real-time quantitative PCR revealed increased expression of the genes encoding ribosomal proteins L17 and L37 (RPL17 and RPL37) in the male forebrain as a whole. Preliminary in situ hybridization data then indicated enhanced expression of both these genes in song control regions. Two experiments in the present study quantified the mRNA expression. The first utilized 25-day-old male and female zebra finches. The second compared a separate set of juveniles to adults of both sexes to both re-confirm enhanced expression in juvenile males and to determine whether it is limited to developing animals. In Experiment 1, males exhibited increased expression of both RPL17 and RPL37 compared to females in Area X, the robust nucleus of the arcopallium (RA), and the ventral ventricular zone (VVZ), which may provide neurons to Area X. Experiment 2 replicated the sexually dimorphic expression of these genes at post-hatching day 25, and documented that the sex differences are eliminated or greatly reduced in adults. The results are consistent with the idea that these ribosomal proteins may influence sexual differentiation of Area X and RA, potentially regulating the genesis and/or survival of neurons.

  6. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  7. Characterization of basal gene expression trends over a diurnal cycle in Xiphophorus maculatus skin, brain and liver.

    PubMed

    Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald

    2018-06-01

    Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Targeting gene expression selectively in cancer cells by using the progression-elevated gene-3 promoter.

    PubMed

    Su, Zhao-Zhong; Sarkar, Devanand; Emdad, Luni; Duigou, Gregory J; Young, Charles S H; Ware, Joy; Randolph, Aaron; Valerie, Kristoffer; Fisher, Paul B

    2005-01-25

    One impediment to effective cancer-specific gene therapy is the rarity of regulatory sequences targeting gene expression selectively in tumor cells. Although many tissue-specific promoters are recognized, few cancer-selective gene promoters are available. Progression-elevated gene-3 (PEG-3) is a rodent gene identified by subtraction hybridization that displays elevated expression as a function of transformation by diversely acting oncogenes, DNA damage, and cancer cell progression. The promoter of PEG-3, PEG-Prom, displays robust expression in a broad spectrum of human cancer cell lines with marginal expression in normal cellular counterparts. Whereas GFP expression, when under the control of a CMV promoter, is detected in both normal and cancer cells, when GFP is expressed under the control of the PEG-Prom, cancer-selective expression is evident. Mutational analysis identifies the AP-1 and PEA-3 transcription factors as primary mediators of selective, cancer-specific expression of the PEG-Prom. Synthesis of apoptosis-inducing genes, under the control of the CMV promoter, inhibits the growth of both normal and cancer cells, whereas PEG-Prom-mediated expression of these genes kills only cancer cells and spares normal cells. The efficacy of the PEG-Prom as part of a cancer gene therapeutic regimen is further documented by in vivo experiments in which PEG-Prom-controlled expression of an apoptosis-inducing gene completely inhibited prostate cancer xenograft growth in nude mice. These compelling observations indicate that the PEG-Prom, with its cancer-specific expression, provides a means of selectively delivering genes to cancer cells, thereby providing a crucial component in developing effective cancer gene therapies.

  9. Detection of changes in gene regulatory patterns, elicited by perturbations of the Hsp90 molecular chaperone complex, by visualizing multiple experiments with an animation

    PubMed Central

    2011-01-01

    Background To make sense out of gene expression profiles, such analyses must be pushed beyond the mere listing of affected genes. For example, if a group of genes persistently display similar changes in expression levels under particular experimental conditions, and the proteins encoded by these genes interact and function in the same cellular compartments, this could be taken as very strong indicators for co-regulated protein complexes. One of the key requirements is having appropriate tools to detect such regulatory patterns. Results We have analyzed the global adaptations in gene expression patterns in the budding yeast when the Hsp90 molecular chaperone complex is perturbed either pharmacologically or genetically. We integrated these results with publicly accessible expression, protein-protein interaction and intracellular localization data. But most importantly, all experimental conditions were simultaneously and dynamically visualized with an animation. This critically facilitated the detection of patterns of gene expression changes that suggested underlying regulatory networks that a standard analysis by pairwise comparison and clustering could not have revealed. Conclusions The results of the animation-assisted detection of changes in gene regulatory patterns make predictions about the potential roles of Hsp90 and its co-chaperone p23 in regulating whole sets of genes. The simultaneous dynamic visualization of microarray experiments, represented in networks built by integrating one's own experimental with publicly accessible data, represents a powerful discovery tool that allows the generation of new interpretations and hypotheses. PMID:21672238

  10. Low heat-shock thresholds in wild Antarctic inter-tidal limpets (Nacella concinna).

    PubMed

    Clark, Melody S; Geissler, Paul; Waller, Catherine; Fraser, Keiron P P; Barnes, David K A; Peck, Lloyd S

    2008-01-01

    Heat shock proteins (HSPs) are a family of genes classically used to measure levels of organism stress. We have previously identified two HSP70 genes (HSP70A and HSP70B) in sub-tidal populations of the Antarctic limpet (Nacella concinna). These genes are up-regulated in response to increased seawater temperatures of 15 degrees C or more during acute heat shock experiments, temperatures that have very little basis when considering the current Antarctic ecology of these animals. Therefore, the question was posed as to whether these animals could express HSP70 genes when subjected to more complex environmental conditions, such as those that occur in the inter-tidal. Inter-tidal limpets were collected on three occasions in different weather conditions at South Cove, Rothera Point, over a complete tidal cycle, and the expression levels of the HSP70 genes were measured. Both genes showed relative up-regulation of gene expression over the period of the tidal cycle. The average foot temperature of these animals was 3.3 degrees C, far below that of the acute heat shock experiments. These experiments demonstrate that the temperature and expression levels of HSP production in wild animals cannot be accurately extrapolated from experimentally induced treatments, especially when considering the complexity of stressors in the natural environment. However, experimental manipulation can provide molecular markers for identifying stress in Antarctic molluscs, provided it is accompanied by environmental validation, as demonstrated here.

  11. Effects of simulated microgravity on gene expression and biological phenotypes of a single generation Caenorhabditis elegans cultured on 2 different media

    NASA Astrophysics Data System (ADS)

    Tee, Ling Fei; Neoh, Hui-min; Then, Sue Mian; Murad, Nor Azian; Asillam, Mohd Fairos; Hashim, Mohd Helmy; Nathan, Sheila; Jamal, Rahman

    2017-11-01

    Studies of multigenerational Caenorhabditis elegans exposed to long-term spaceflight have revealed expression changes of genes involved in longevity, DNA repair, and locomotion. However, results from spaceflight experiments are difficult to reproduce as space missions are costly and opportunities are rather limited for researchers. In addition, multigenerational cultures of C. elegans used in previous studies contribute to mixture of gene expression profiles from both larvae and adult worms, which were recently reported to be different. Usage of different culture media during microgravity simulation experiments might also give rise to differences in the gene expression and biological phenotypes of the worms. In this study, we investigated the effects of simulated microgravity on the gene expression and biological phenotype profiles of a single generation of C. elegans worms cultured on 2 different culture media. A desktop Random Positioning Machine (RPM) was used to simulate microgravity on the worms for approximately 52 to 54 h. Gene expression profile was analysed using the Affymetrix GeneChip® C. elegans 1.0 ST Array. Only one gene (R01H2.2) was found to be downregulated in nematode growth medium (NGM)-cultured worms exposed to simulated microgravity. On the other hand, eight genes were differentially expressed for C. elegans Maintenance Medium (CeMM)-cultured worms in microgravity; six were upregulated, while two were downregulated. Five of the upregulated genes (C07E3.15, C34H3.21, C32D5.16, F35H8.9 and C34F11.17) encode non-coding RNAs. In terms of biological phenotype, we observed that microgravity-simulated worms experienced minimal changes in terms of lifespan, locomotion and reproductive capabilities in comparison with the ground controls. Taking it all together, simulated microgravity on a single generation of C. elegans did not confer major changes to their gene expression and biological phenotype. Nevertheless, exposure of the worms to microgravity lead to higher expression of non-coding RNA genes, which may play an epigenetic role in the worms during longer terms of microgravity exposure.

  12. Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation

    PubMed Central

    Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; Taylor, Ronald C.; Weisenhorn, Pamela; Olson, Robert D.; Stevens, Rick L.; Rocha, Miguel; Rocha, Isabel; Best, Aaron A.; DeJongh, Matthew; Tintle, Nathan L.; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S.

    2016-01-01

    Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. An important step toward meeting the challenge of understanding gene function and regulation is the identification of sets of genes that are always co-expressed. These gene sets, Atomic Regulons (ARs), represent fundamental units of function within a cell and could be used to associate genes of unknown function with cellular processes and to enable rational genetic engineering of cellular systems. Here, we describe an approach for inferring ARs that leverages large-scale expression data sets, gene context, and functional relationships among genes. We computed ARs for Escherichia coli based on 907 gene expression experiments and compared our results with gene clusters produced by two prevalent data-driven methods: Hierarchical clustering and k-means clustering. We compared ARs and purely data-driven gene clusters to the curated set of regulatory interactions for E. coli found in RegulonDB, showing that ARs are more consistent with gold standard regulons than are data-driven gene clusters. We further examined the consistency of ARs and data-driven gene clusters in the context of gene interactions predicted by Context Likelihood of Relatedness (CLR) analysis, finding that the ARs show better agreement with CLR predicted interactions. We determined the impact of increasing amounts of expression data on AR construction and find that while more data improve ARs, it is not necessary to use the full set of gene expression experiments available for E. coli to produce high quality ARs. In order to explore the conservation of co-regulated gene sets across different organisms, we computed ARs for Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus, each of which represents increasing degrees of phylogenetic distance from E. coli. Comparison of the organism-specific ARs showed that the consistency of AR gene membership correlates with phylogenetic distance, but there is clear variability in the regulatory networks of closely related organisms. As large scale expression data sets become increasingly common for model and non-model organisms, comparative analyses of atomic regulons will provide valuable insights into fundamental regulatory modules used across the bacterial domain. PMID:27933038

  13. Strategies for comparing gene expression profiles from different microarray platforms: application to a case-control experiment.

    PubMed

    Severgnini, Marco; Bicciato, Silvio; Mangano, Eleonora; Scarlatti, Francesca; Mezzelani, Alessandra; Mattioli, Michela; Ghidoni, Riccardo; Peano, Clelia; Bonnal, Raoul; Viti, Federica; Milanesi, Luciano; De Bellis, Gianluca; Battaglia, Cristina

    2006-06-01

    Meta-analysis of microarray data is increasingly important, considering both the availability of multiple platforms using disparate technologies and the accumulation in public repositories of data sets from different laboratories. We addressed the issue of comparing gene expression profiles from two microarray platforms by devising a standardized investigative strategy. We tested this procedure by studying MDA-MB-231 cells, which undergo apoptosis on treatment with resveratrol. Gene expression profiles were obtained using high-density, short-oligonucleotide, single-color microarray platforms: GeneChip (Affymetrix) and CodeLink (Amersham). Interplatform analyses were carried out on 8414 common transcripts represented on both platforms, as identified by LocusLink ID, representing 70.8% and 88.6% of annotated GeneChip and CodeLink features, respectively. We identified 105 differentially expressed genes (DEGs) on CodeLink and 42 DEGs on GeneChip. Among them, only 9 DEGs were commonly identified by both platforms. Multiple analyses (BLAST alignment of probes with target sequences, gene ontology, literature mining, and quantitative real-time PCR) permitted us to investigate the factors contributing to the generation of platform-dependent results in single-color microarray experiments. An effective approach to cross-platform comparison involves microarrays of similar technologies, samples prepared by identical methods, and a standardized battery of bioinformatic and statistical analyses.

  14. Conditional clustering of temporal expression profiles

    PubMed Central

    Wang, Ling; Montano, Monty; Rarick, Matt; Sebastiani, Paola

    2008-01-01

    Background Many microarray experiments produce temporal profiles in different biological conditions but common cluster techniques are not able to analyze the data conditional on the biological conditions. Results This article presents a novel technique to cluster data from time course microarray experiments performed across several experimental conditions. Our algorithm uses polynomial models to describe the gene expression patterns over time, a full Bayesian approach with proper conjugate priors to make the algorithm invariant to linear transformations, and an iterative procedure to identify genes that have a common temporal expression profile across two or more experimental conditions, and genes that have a unique temporal profile in a specific condition. Conclusion We use simulated data to evaluate the effectiveness of this new algorithm in finding the correct number of clusters and in identifying genes with common and unique profiles. We also use the algorithm to characterize the response of human T cells to stimulations of antigen-receptor signaling gene expression temporal profiles measured in six different biological conditions and we identify common and unique genes. These studies suggest that the methodology proposed here is useful in identifying and distinguishing uniquely stimulated genes from commonly stimulated genes in response to variable stimuli. Software for using this clustering method is available from the project home page. PMID:18334028

  15. An Examination of Dynamic Gene Expression Changes in the Mouse Brain During Pregnancy and the Postpartum Period.

    PubMed

    Ray, Surjyendu; Tzeng, Ruei-Ying; DiCarlo, Lisa M; Bundy, Joseph L; Vied, Cynthia; Tyson, Gary; Nowakowski, Richard; Arbeitman, Michelle N

    2015-11-23

    The developmental transition to motherhood requires gene expression changes that alter the brain to drive the female to perform maternal behaviors. We broadly examined the global transcriptional response in the mouse maternal brain, by examining four brain regions: hypothalamus, hippocampus, neocortex, and cerebellum, in virgin females, two pregnancy time points, and three postpartum time points. We find that overall there are hundreds of differentially expressed genes, but each brain region and time point shows a unique molecular signature, with only 49 genes differentially expressed in all four regions. Interestingly, a set of "early-response genes" is repressed in all brain regions during pregnancy and postpartum stages. Several genes previously implicated in underlying postpartum depression change expression. This study serves as an atlas of gene expression changes in the maternal brain, with the results demonstrating that pregnancy, parturition, and postpartum maternal experience substantially impact diverse brain regions. Copyright © 2016 Ray et al.

  16. GESearch: An Interactive GUI Tool for Identifying Gene Expression Signature.

    PubMed

    Ye, Ning; Yin, Hengfu; Liu, Jingjing; Dai, Xiaogang; Yin, Tongming

    2015-01-01

    The huge amount of gene expression data generated by microarray and next-generation sequencing technologies present challenges to exploit their biological meanings. When searching for the coexpression genes, the data mining process is largely affected by selection of algorithms. Thus, it is highly desirable to provide multiple options of algorithms in the user-friendly analytical toolkit to explore the gene expression signatures. For this purpose, we developed GESearch, an interactive graphical user interface (GUI) toolkit, which is written in MATLAB and supports a variety of gene expression data files. This analytical toolkit provides four models, including the mean, the regression, the delegate, and the ensemble models, to identify the coexpression genes, and enables the users to filter data and to select gene expression patterns by browsing the display window or by importing knowledge-based genes. Subsequently, the utility of this analytical toolkit is demonstrated by analyzing two sets of real-life microarray datasets from cell-cycle experiments. Overall, we have developed an interactive GUI toolkit that allows for choosing multiple algorithms for analyzing the gene expression signatures.

  17. PathMAPA: a tool for displaying gene expression and performing statistical tests on metabolic pathways at multiple levels for Arabidopsis.

    PubMed

    Pan, Deyun; Sun, Ning; Cheung, Kei-Hoi; Guan, Zhong; Ma, Ligeng; Holford, Matthew; Deng, Xingwang; Zhao, Hongyu

    2003-11-07

    To date, many genomic and pathway-related tools and databases have been developed to analyze microarray data. In published web-based applications to date, however, complex pathways have been displayed with static image files that may not be up-to-date or are time-consuming to rebuild. In addition, gene expression analyses focus on individual probes and genes with little or no consideration of pathways. These approaches reveal little information about pathways that are key to a full understanding of the building blocks of biological systems. Therefore, there is a need to provide useful tools that can generate pathways without manually building images and allow gene expression data to be integrated and analyzed at pathway levels for such experimental organisms as Arabidopsis. We have developed PathMAPA, a web-based application written in Java that can be easily accessed over the Internet. An Oracle database is used to store, query, and manipulate the large amounts of data that are involved. PathMAPA allows its users to (i) upload and populate microarray data into a database; (ii) integrate gene expression with enzymes of the pathways; (iii) generate pathway diagrams without building image files manually; (iv) visualize gene expressions for each pathway at enzyme, locus, and probe levels; and (v) perform statistical tests at pathway, enzyme and gene levels. PathMAPA can be used to examine Arabidopsis thaliana gene expression patterns associated with metabolic pathways. PathMAPA provides two unique features for the gene expression analysis of Arabidopsis thaliana: (i) automatic generation of pathways associated with gene expression and (ii) statistical tests at pathway level. The first feature allows for the periodical updating of genomic data for pathways, while the second feature can provide insight into how treatments affect relevant pathways for the selected experiment(s).

  18. PathMAPA: a tool for displaying gene expression and performing statistical tests on metabolic pathways at multiple levels for Arabidopsis

    PubMed Central

    Pan, Deyun; Sun, Ning; Cheung, Kei-Hoi; Guan, Zhong; Ma, Ligeng; Holford, Matthew; Deng, Xingwang; Zhao, Hongyu

    2003-01-01

    Background To date, many genomic and pathway-related tools and databases have been developed to analyze microarray data. In published web-based applications to date, however, complex pathways have been displayed with static image files that may not be up-to-date or are time-consuming to rebuild. In addition, gene expression analyses focus on individual probes and genes with little or no consideration of pathways. These approaches reveal little information about pathways that are key to a full understanding of the building blocks of biological systems. Therefore, there is a need to provide useful tools that can generate pathways without manually building images and allow gene expression data to be integrated and analyzed at pathway levels for such experimental organisms as Arabidopsis. Results We have developed PathMAPA, a web-based application written in Java that can be easily accessed over the Internet. An Oracle database is used to store, query, and manipulate the large amounts of data that are involved. PathMAPA allows its users to (i) upload and populate microarray data into a database; (ii) integrate gene expression with enzymes of the pathways; (iii) generate pathway diagrams without building image files manually; (iv) visualize gene expressions for each pathway at enzyme, locus, and probe levels; and (v) perform statistical tests at pathway, enzyme and gene levels. PathMAPA can be used to examine Arabidopsis thaliana gene expression patterns associated with metabolic pathways. Conclusion PathMAPA provides two unique features for the gene expression analysis of Arabidopsis thaliana: (i) automatic generation of pathways associated with gene expression and (ii) statistical tests at pathway level. The first feature allows for the periodical updating of genomic data for pathways, while the second feature can provide insight into how treatments affect relevant pathways for the selected experiment(s). PMID:14604444

  19. ARG1 Functions in the Physiological Adaptation of Undifferentiated Plant Cells to Spaceflight.

    PubMed

    Zupanska, Agata K; Schultz, Eric R; Yao, JiQiang; Sng, Natasha J; Zhou, Mingqi; Callaham, Jordan B; Ferl, Robert J; Paul, Anna-Lisa

    2017-11-01

    Scientific access to spaceflight and especially the International Space Station has revealed that physiological adaptation to spaceflight is accompanied or enabled by changes in gene expression that significantly alter the transcriptome of cells in spaceflight. A wide range of experiments have shown that plant physiological adaptation to spaceflight involves gene expression changes that alter cell wall and other metabolisms. However, while transcriptome profiling aptly illuminates changes in gene expression that accompany spaceflight adaptation, mutation analysis is required to illuminate key elements required for that adaptation. Here we report how transcriptome profiling was used to gain insight into the spaceflight adaptation role of Altered response to gravity 1 (Arg1), a gene known to affect gravity responses in plants on Earth. The study compared expression profiles of cultured lines of Arabidopsis thaliana derived from wild-type (WT) cultivar Col-0 to profiles from a knock-out line deficient in the gene encoding ARG1 (ARG1 KO), both on the ground and in space. The cell lines were launched on SpaceX CRS-2 as part of the Cellular Expression Logic (CEL) experiment of the BRIC-17 spaceflight mission. The cultured cell lines were grown within 60 mm Petri plates in Petri Dish Fixation Units (PDFUs) that were housed within the Biological Research In Canisters (BRIC) hardware. Spaceflight samples were fixed on orbit. Differentially expressed genes were identified between the two environments (spaceflight and comparable ground controls) and the two genotypes (WT and ARG1 KO). Each genotype engaged unique genes during physiological adaptation to the spaceflight environment, with little overlap. Most of the genes altered in expression in spaceflight in WT cells were found to be Arg1-dependent, suggesting a major role for that gene in the physiological adaptation of undifferentiated cells to spaceflight. Key Words: ARG1-Spaceflight-Gene expression-Physiological adaptation-BRIC. Astrobiology 17, 1077-1111.

  20. Diurnal Corticosterone Presence and Phase Modulate Clock Gene Expression in the Male Rat Prefrontal Cortex

    PubMed Central

    Chun, Lauren E.; Hinds, Laura R.; Spencer, Robert L.

    2016-01-01

    Mood disorders are associated with dysregulation of prefrontal cortex (PFC) function, circadian rhythms, and diurnal glucocorticoid (corticosterone [CORT]) circulation. Entrainment of clock gene expression in some peripheral tissues depends on CORT. In this study, we characterized over the course of the day the mRNA expression pattern of the core clock genes Per1, Per2, and Bmal1 in the male rat PFC and suprachiasmatic nucleus (SCN) under different diurnal CORT conditions. In experiment 1, rats were left adrenal-intact (sham) or were adrenalectomized (ADX) followed by 10 daily antiphasic (opposite time of day of the endogenous CORT peak) ip injections of either vehicle or 2.5 mg/kg CORT. In experiment 2, all rats received ADX surgery followed by 13 daily injections of vehicle or CORT either antiphasic or in-phase with the endogenous CORT peak. In sham rats clock gene mRNA levels displayed a diurnal pattern of expression in the PFC and the SCN, but the phase differed between the 2 structures. ADX substantially altered clock gene expression patterns in the PFC. This alteration was normalized by in-phase CORT treatment, whereas antiphasic CORT treatment appears to have eliminated a diurnal pattern (Per1 and Bmal1) or dampened/inverted its phase (Per2). There was very little effect of CORT condition on clock gene expression in the SCN. These experiments suggest that an important component of glucocorticoid circadian physiology entails CORT regulation of the molecular clock in the PFC. Consequently, they also point to a possible mechanism that contributes to PFC disrupted function in disorders associated with abnormal CORT circulation. PMID:26901093

  1. Identification of repaglinide as a therapeutic drug for glioblastoma multiforme.

    PubMed

    Xiao, Zui Xuan; Chen, Ruo Qiao; Hu, Dian Xing; Xie, Xiao Qiang; Yu, Shang Bin; Chen, Xiao Qian

    2017-06-17

    Glioblastoma multiforme (GBM) is a highly aggressive brain tumor with a median survival time of only 14 months after treatment. It is urgent to find new therapeutic drugs that increase survival time of GBM patients. To achieve this goal, we screened differentially expressed genes between long-term and short-term survived GBM patients from Gene Expression Omnibus database and found gene expression signature for the long-term survived GBM patients. The signaling networks of all those differentially expressed genes converged to protein binding, extracellular matrix and tissue development as revealed in BiNGO and Cytoscape. Drug repositioning in Connectivity Map by using the gene expression signature identified repaglinide, a first-line drug for diabetes mellitus, as the most promising novel drug for GBM. In vitro experiments demonstrated that repaglinide significantly inhibited the proliferation and migration of human GBM cells. In vivo experiments demonstrated that repaglinide prominently prolonged the median survival time of mice bearing orthotopic glioma. Mechanistically, repaglinide significantly reduced Bcl-2, Beclin-1 and PD-L1 expression in glioma tissues, indicating that repaglinide may exert its anti-cancer effects via apoptotic, autophagic and immune checkpoint signaling. Taken together, repaglinide is likely to be an effective drug to prolong life span of GBM patients. Copyright © 2017. Published by Elsevier Inc.

  2. Dynamic changes in prefrontal cortex gene expression following lysergic acid diethylamide administration.

    PubMed

    Nichols, Charles D; Garcia, Efrain E; Sanders-Bush, Elaine

    2003-03-17

    Lysergic acid diethylamide (LSD) is a psychoactive drug that transiently alters human perception, behavior, and mood at extremely low doses. Certain aspects of the behavior elicited by acute doses of LSD closely resemble symptoms of mental disorders such as schizophrenia. Characterizing gene expression profiles after LSD will be important for understanding how it alters behavior, and will lead to novel insights into disorders, such as schizophrenia, whose behavioral symptoms resemble the temporary effects of hallucinogenic drugs. We previously identified a small collection of genes within the rat prefrontal cortex that respond to LSD. Many of the products of these genes are involved in the process of synaptic plasticity. In the current report, we present a detailed analysis of the expression of these genes within the brain using RNase protection analysis. We find that the gene response to LSD is quite dynamic. The expression of some genes increases rapidly and decreases rapidly, while other genes change more gradually. Dose-response studies show two classes of expression; gene expression maximally stimulated at lower doses, versus gene expression that continues to rise at the higher doses. The role of the 5-HT(1A) and 5-HT(2A) receptor in mediating the increases in gene expression was examined in a series of experiments using receptor specific antagonists. Most expression increases were due to activation of the 5-HT(2A) receptor, however expression of two genes had neither a 5-HT(1A) nor a 5-HT(2A) receptor component.

  3. NCBI GEO: mining millions of expression profiles--database and tools.

    PubMed

    Barrett, Tanya; Suzek, Tugba O; Troup, Dennis B; Wilhite, Stephen E; Ngau, Wing-Chi; Ledoux, Pierre; Rudnev, Dmitry; Lash, Alex E; Fujibuchi, Wataru; Edgar, Ron

    2005-01-01

    The Gene Expression Omnibus (GEO) at the National Center for Biotechnology Information (NCBI) is the largest fully public repository for high-throughput molecular abundance data, primarily gene expression data. The database has a flexible and open design that allows the submission, storage and retrieval of many data types. These data include microarray-based experiments measuring the abundance of mRNA, genomic DNA and protein molecules, as well as non-array-based technologies such as serial analysis of gene expression (SAGE) and mass spectrometry proteomic technology. GEO currently holds over 30,000 submissions representing approximately half a billion individual molecular abundance measurements, for over 100 organisms. Here, we describe recent database developments that facilitate effective mining and visualization of these data. Features are provided to examine data from both experiment- and gene-centric perspectives using user-friendly Web-based interfaces accessible to those without computational or microarray-related analytical expertise. The GEO database is publicly accessible through the World Wide Web at http://www.ncbi.nlm.nih.gov/geo.

  4. Near-isogenic cotton germplasm lines that differ in fiber-bundle strength have temporal differences in fiber gene expression patterns as revealed by comparative high-throughput profiling.

    PubMed

    Hinchliffe, Doug J; Meredith, William R; Yeater, Kathleen M; Kim, Hee Jin; Woodward, Andrew W; Chen, Z Jeffrey; Triplett, Barbara A

    2010-05-01

    Gene expression profiles of developing cotton (Gossypium hirsutum L.) fibers from two near-isogenic lines (NILs) that differ in fiber-bundle strength, short-fiber content, and in fewer than two genetic loci were compared using an oligonucleotide microarray. Fiber gene expression was compared at five time points spanning fiber elongation and secondary cell wall (SCW) biosynthesis. Fiber samples were collected from field plots in a randomized, complete block design, with three spatially distinct biological replications for each NIL at each time point. Microarray hybridizations were performed in a loop experimental design that allowed comparisons of fiber gene expression profiles as a function of time between the two NILs. Overall, developmental expression patterns revealed by the microarray experiment agreed with previously reported cotton fiber gene expression patterns for specific genes. Additionally, genes expressed coordinately with the onset of SCW biosynthesis in cotton fiber correlated with gene expression patterns of other SCW-producing plant tissues. Functional classification and enrichment analysis of differentially expressed genes between the two NILs revealed that genes associated with SCW biosynthesis were significantly up-regulated in fibers of the high-fiber quality line at the transition stage of cotton fiber development. For independent corroboration of the microarray results, 15 genes were selected for quantitative reverse transcription PCR analysis of fiber gene expression. These analyses, conducted over multiple field years, confirmed the temporal difference in fiber gene expression between the two NILs. We hypothesize that the loci conferring temporal differences in fiber gene expression between the NILs are important regulatory sequences that offer the potential for more targeted manipulation of cotton fiber quality.

  5. Comparison of global brain gene expression profiles between inbred long-sleep and inbred short-sleep mice by high-density gene array hybridization.

    PubMed

    Xu, Y; Ehringer, M; Yang, F; Sikela, J M

    2001-06-01

    Inbred long-sleep (ILS) and short-sleep (ISS) mice show significant central nervous system-mediated differences in sleep time for sedative dose of ethanol and are frequently used as a rodent model for ethanol sensitivity. In this study, we have used complementary DNA (cDNA) array hybridization methodology to identify genes that are differentially expressed between the brains of ILS and ISS mice. To carry out this analysis, we used both the gene discovery array (GDA) and the Mouse GEM 1 Microarray. GDA consists of 18,378 nonredundant mouse cDNA clones on a single nylon filter. Complex probes were prepared from total brain mRNA of ILS or ISS mice by using reverse transcription and 33P labeling. The labeled probes were hybridized in parallel to the gene array filters. Data from GDA experiments were analyzed with SQL-Plus and Oracle 8. The GEM microarray includes 8,730 sequence-verified clones on a glass chip. Two fluorescently labeled probes were used to hybridize a microarray simultaneously. Data from GEM experiments were analyzed by using the GEMTools software package (Incyte). Differentially expressed genes identified from each method were confirmed by relative quantitative reverse transcription-polymerase chain reaction (RT-PCR). A total of 41 genes or expressed sequence tags (ESTs) display significant expression level differences between brains of ILS and ISS mice after GDA, GEM1 hybridization, and quantitative RT-PCR confirmation. Among them, 18 clones were expressed higher in ILS mice, and 23 clones were expressed higher in ISS mice. The individual gene or EST's function and mapping information have been analyzed. This study identified 41 genes that are differentially expressed between brains of ILS and ISS mice. Some of them may have biological relevance in mediation of phenotypic variation between ILS and ISS mice for ethanol sensitivity. This study also demonstrates that parallel gene expression comparison with high-density cDNA arrays is a rapid and efficient way to discover potential genes and pathways involved in alcoholism and alcohol-related physiologic processes.

  6. Environmental stress alters genes expression and induces ovule abortion: reactive oxygen species appear as ovules commit to abort.

    PubMed

    Sun, Kelian; Cui, Yuehua; Hauser, Bernard A

    2005-11-01

    Environmental stress dramatically reduces plant reproduction. Previous results showed that placing roots in 200 mM NaCl for 12 h caused 90% of the developing Arabidopsis ovules to abort (Sun et al. in Plant Physiol 135:2358-2367, 2004). To discover the molecular responses that occur during ovule abortion, gene expression was monitored using Affymetrix 24k genome arrays. Transcript levels were measured in pistils that were stressed for 6, 12, 18, and 24 h, then compared with the levels in healthy pistils. Over the course of this experiment, a total of 535 salt-responsive genes were identified. Cluster analysis showed that differentially expressed genes exhibited reproducible changes in expression. The expression of 65 transcription factors, some of which are known to be involved in stress responses, were modulated during ovule abortion. In flowers, salt stress led to a 30-fold increase in Na+ ions and modest, but significant, decreases in the accumulation of other ions. The expression of cation exchangers and ion transporters were induced, presumably to reestablish ion homeostasis following salt stress. Genes that encode enzymes that detoxify reactive oxygen species (ROS), including ascorbate peroxidase and peroxidase, were downregulated after ovules committed to abort. These changes in gene expression coincided with the synthesis of ROS in female gametophytes. One day after salt stress, ROS spread from the gametophytes to the maternal chalaza and integuments. In addition, genes encoding proteins that regulate ethylene responses, including ethylene biosynthesis, ethylene signal transduction and ethylene-responsive transcription factors, were upregulated after stress. Hypotheses are proposed on the basis of this expression analysis, which will be evaluated further in future experiments.

  7. Direct multiplexed measurement of gene expression with color-coded probe pairs.

    PubMed

    Geiss, Gary K; Bumgarner, Roger E; Birditt, Brian; Dahl, Timothy; Dowidar, Naeem; Dunaway, Dwayne L; Fell, H Perry; Ferree, Sean; George, Renee D; Grogan, Tammy; James, Jeffrey J; Maysuria, Malini; Mitton, Jeffrey D; Oliveri, Paola; Osborn, Jennifer L; Peng, Tao; Ratcliffe, Amber L; Webster, Philippa J; Davidson, Eric H; Hood, Leroy; Dimitrov, Krassen

    2008-03-01

    We describe a technology, the NanoString nCounter gene expression system, which captures and counts individual mRNA transcripts. Advantages over existing platforms include direct measurement of mRNA expression levels without enzymatic reactions or bias, sensitivity coupled with high multiplex capability, and digital readout. Experiments performed on 509 human genes yielded a replicate correlation coefficient of 0.999, a detection limit between 0.1 fM and 0.5 fM, and a linear dynamic range of over 500-fold. Comparison of the NanoString nCounter gene expression system with microarrays and TaqMan PCR demonstrated that the nCounter system is more sensitive than microarrays and similar in sensitivity to real-time PCR. Finally, a comparison of transcript levels for 21 genes across seven samples measured by the nCounter system and SYBR Green real-time PCR demonstrated similar patterns of gene expression at all transcript levels.

  8. The Renilla luciferase gene as a reference gene for normalization of gene expression in transiently transfected cells.

    PubMed

    Jiwaji, Meesbah; Daly, Rónán; Pansare, Kshama; McLean, Pauline; Yang, Jingli; Kolch, Walter; Pitt, Andrew R

    2010-12-31

    The importance of appropriate normalization controls in quantitative real-time polymerase chain reaction (qPCR) experiments has become more apparent as the number of biological studies using this methodology has increased. In developing a system to study gene expression from transiently transfected plasmids, it became clear that normalization using chromosomally encoded genes is not ideal, at it does not take into account the transfection efficiency and the significantly lower expression levels of the plasmids. We have developed and validated a normalization method for qPCR using a co-transfected plasmid. The best chromosomal gene for normalization in the presence of the transcriptional activators used in this study, cadmium, dexamethasone, forskolin and phorbol-12-myristate 13-acetate was first identified. qPCR data was analyzed using geNorm, Normfinder and BestKeeper. Each software application was found to rank the normalization controls differently with no clear correlation. Including a co-transfected plasmid encoding the Renilla luciferase gene (Rluc) in this analysis showed that its calculated stability was not as good as the optimised chromosomal genes, most likely as a result of the lower expression levels and transfection variability. Finally, we validated these analyses by testing two chromosomal genes (B2M and ActB) and a co-transfected gene (Rluc) under biological conditions. When analyzing co-transfected plasmids, Rluc normalization gave the smallest errors compared to the chromosomal reference genes. Our data demonstrates that transfected Rluc is the most appropriate normalization reference gene for transient transfection qPCR analysis; it significantly reduces the standard deviation within biological experiments as it takes into account the transfection efficiencies and has easily controllable expression levels. This improves reproducibility, data validity and most importantly, enables accurate interpretation of qPCR data.

  9. Space experiment "Rad Gene"-report 1; p53-Dependent gene expression in human cultured cells exposed to space environment

    NASA Astrophysics Data System (ADS)

    Takahashi, Akihisa; Ohnishi, Takeo; Suzuki, Hiromi; Omori, Katsunori; Seki, Masaya; Hashizume, Toko; Shimazu, Toru; Ishioka, Noriaki

    The space environment contains two major biologically significant influences: space radiations and microgravity. A p53 tumor suppressor protein plays a role as a guardian of the genome through the activity of p53-centered signal transduction pathways. The aim of this study was to clarify the biological effects of space radiations, microgravity and a space environment on the gene and protein expression of p53-dependent regulated genes. Space experiments were performed with two human cultured lymphoblastoid cell lines: one cells line (TSCE5) bears a wild-type p53 gene status, and another cells line (WTK1) bears a mutated p53 gene status. Un-der one gravity or microgravity condition, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station (ISS) for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples also were cultured for 8 days in the CBEF on the ground during the same periods as space flight. Gene and protein expression was analyzed by using DNA chip (a 44k whole human genome microarray, Agilent Technologies Inc.) and protein chip (PanoramaTM Ab MicroArray, Sigma-Aldrich Co.), respectively. In addition, we analyzed the gene expression in cultured cells after space flight during 133 days with frozen condition. We report the results and discussion from the viewpoint of the functions of the up-regulated and down-regulated genes after an exposure to space radiations and/or microgravity. The initial goal of this space experiment was completely achieved. It is expected that data from this type of work will be helpful in designing physical protection from the deleterious effects of space radiations during long term stays in space.

  10. Effects of brevetoxin exposure on the immune system of loggerhead sea turtles.

    PubMed

    Walsh, Catherine J; Leggett, Stephanie R; Carter, Barbara J; Colle, Clarence

    2010-05-10

    Blooms of the toxic dinoflagellate, Karenia brevis, occur almost annually off the Florida coast. These blooms, commonly called "red tides", produce a group of neurotoxins collectively termed brevetoxins. Many species of sealife, including sea turtles, are severely impacted by brevetoxin exposure. Effects of brevetoxins on immune cells were investigated in rescued loggerhead sea turtles, Caretta caretta, as well as through in vitro experiments using peripheral blood leukocytes (PBL) collected from captive sea turtles. In rescued animals, plasma brevetoxin concentrations were measured using a competitive ELISA. Plasma lysozyme activity was measured using a turbidity assay. Lysozyme activity correlated positively with plasma brevetoxin concentrations. Differential expression of genes affected by brevetoxin exposure was determined using two separate suppression subtractive hybridization experiments. In one experiment, genes from PBL collected from sea turtles rescued from red tide toxin exposure were compared to genes from PBL collected from healthy captive loggerhead sea turtles. In the second experiment, PBL from healthy captive loggerhead sea turtles were exposed to brevetoxin (500 ng PbTx-2/ml) in vitro for 18 h and compared to unexposed PBL. Results from the subtraction hybridization experiment conducted with red tide rescued sea turtle PBL indicated that genes involved in oxidative stress or xenobiotic metabolism were up-regulated. Using quantitative real-time PCR, a greater than 2-fold increase in superoxide dismutase and thioredoxin and greater than 10-fold increase in expression of thiopurine S-methyltransferase were observed. Results from the in vitro subtraction hybridization experiment indicated that genes coding for cytochrome c oxidases were the major up-regulated genes. Using quantitative real-time PCR, a greater than 8-fold increase in expression of beta-tubulin and greater than 3-fold increase in expression of ubiquinol were observed. Brevetoxin exposure may have significant implications for immune function in loggerhead sea turtles. 2009 Elsevier B.V. All rights reserved.

  11. Mechanical Feedback and Arrest in Gene Expression

    NASA Astrophysics Data System (ADS)

    Sevier, Stuart; Levine, Herbert

    The ability to watch biochemical events at the single-molecule level has increasingly revealed that stochasticity plays a leading role in many biological phenomena. One important and well know example is the noisy, ``bursty'' manner of transcription. Recent experiments have revealed relationships between the level and noise in gene expression hinting at deeper stochastic connections. In this talk we will discuss how the mechanical nature of transcription can explain this relationship and examine the limits that the physical aspects of transcription place on gene expression.

  12. Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize

    PubMed Central

    Zhao, Yanxin; Cai, Manjun; Zhang, Xiaobo; Li, Yurong; Zhang, Jianhua; Zhao, Hailiang; Kong, Fei; Zheng, Yonglian; Qiu, Fazhan

    2014-01-01

    Plant mitochondrial transcription termination factor (mTERF) genes comprise a large family with important roles in regulating organelle gene expression. In this study, a comprehensive database search yielded 31 potential mTERF genes in maize (Zea mays L.) and most of them were targeted to mitochondria or chloroplasts. Maize mTERF were divided into nine main groups based on phylogenetic analysis, and group IX represented the mitochondria and species-specific clade that diverged from other groups. Tandem and segmental duplication both contributed to the expansion of the mTERF gene family in the maize genome. Comprehensive expression analysis of these genes, using microarray data and RNA-seq data, revealed that these genes exhibit a variety of expression patterns. Environmental stimulus experiments revealed differential up or down-regulation expression of maize mTERF genes in seedlings exposed to light/dark, salts and plant hormones, respectively, suggesting various important roles of maize mTERF genes in light acclimation and stress-related responses. These results will be useful for elucidating the roles of mTERF genes in the growth, development and stress response of maize. PMID:24718683

  13. Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

    PubMed

    Vieille-Grosjean, I; Huber, P

    1995-03-03

    The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

  14. Microarray expression profiling identifies genes with altered expression in HDL-deficient mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Callow, Matthew J.; Dudoit, Sandrine; Gong, Elaine L.

    2000-05-05

    Based on the assumption that severe alterations in the expression of genes known to be involved in HDL metabolism may affect the expression of other genes we screened an array of over 5000 mouse expressed sequence tags (ESTs) for altered gene expression in the livers of two lines of mice with dramatic decreases in HDL plasma concentrations. Labeled cDNA from livers of apolipoprotein AI (apo AI) knockout mice, Scavenger Receptor BI (SR-BI) transgenic mice and control mice were co-hybridized to microarrays. Two-sample t-statistics were used to identify genes with altered expression levels in the knockout or transgenic mice compared withmore » the control mice. In the SR-BI group we found 9 array elements representing at least 5 genes to be significantly altered on the basis of an adjusted p value of less than 0.05. In the apo AI knockout group 8 array elements representing 4 genes were altered compared with the control group (p < 0.05). Several of the genes identified in the SR-BI transgenic suggest altered sterol metabolism and oxidative processes. These studies illustrate the use of multiple-testing methods for the identification of genes with altered expression in replicated microarray experiments of apo AI knockout and SR-BI transgenic mice.« less

  15. Stability of Reference Gene Expression After Porcine Sapelovirus Infection in Porcine Intestinal Epithelial Cells.

    PubMed

    Huang, Yong; Chen, Yabing; Sun, Huan; Lan, Daoliang

    2016-01-01

    Intestinal epithelial cells, which serve as the first physical barrier to protect intestinal tract from external antigens, have an important role in the local innate immunity. Screening of reference genes that have stable expression levels after viral infection in porcine intestinal epithelial cells is critical for ensuring the reliability of the expression analysis on anti-infection genes in porcine intestinal epithelial cells. In this study, nine common reference genes in pigs, including ACTB, B2M, GAPDH, HMBS, SDHA, HPRT1, TBP, YWHAZ, and RPL32, were chosen as the candidate reference genes. Porcine sapelovirus (PSV) was used as a model virus to infect porcine intestinal epithelial cell line (IPEC-J2). The expression stability of the nine genes was assessed by the geNorm, NormFinder, and BestKeeper software. Moreover, RefFinder program was used to evaluate the analytical results of above three softwares, and a relative expression experiment of selected target gene was used to verify the analysis results. The comprehensive results indicated that the gene combination of TBP and RPL32 has the most stable expression, which could be considered as an appropriate reference gene for research on gene expression after PSV infection in IPEC-J2cells. The results provided essential data for expression analysis of anti-infection genes in porcine intestinal epithelial cells.

  16. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  17. PAF53 is essential in mammalian cells: CRISPR/Cas9 fails to eliminate PAF53 expression.

    PubMed

    Rothblum, Lawrence I; Rothblum, Katrina; Chang, Eugenie

    2017-05-15

    When mammalian cells are nutrient and/or growth factor deprived, exposed to inhibitors of protein synthesis, stressed by heat shock or grown to confluence, rDNA transcription is essentially shut off. Various mechanisms are available to accomplish this downshift in ribosome biogenesis. Muramatsu's laboratory (Hanada et al., 1996) first demonstrated that mammalian PAF53 was essential for specific rDNA transcription and that PAF53 levels were regulated in response to growth factors. While S. cerevisae A49, the homologue of vertebrate PAF53, is not essential for viability (Liljelund et al., 1992), deletion of yA49 results in colonies that grow at 6% of the wild type rate at 25°C. Experiments described by Wang et al. (2015) identified PAF53 as a gene "essential for optimal proliferation". However, they did not discriminate genes essential for viability. Hence, in order to resolve this question, we designed a series of experiments to determine if PAF53 was essential for cell survival. We set out to delete the gene product from mammalian cells using CRISPR/CAS9 technology. Human 293 cells were transfected with lentiCRISPR v2 carrying genes for various sgRNA that targeted PAF53. In some experiments, the cells were cotransfected in parallel with plasmids encoding FLAG-tagged mouse PAF53. After treating the transfected cells with puromycin (to select for the lentiCRISPR backbone), cells were cloned and analyzed by western blots for PAF53 expression. Genomic DNA was amplified across the "CRISPRd" exon, cloned and sequenced to identify mutated PAF53 genes. We obtained cell lines in which the endogenous PAF53 gene was "knocked out" only when we rescued with FLAG-PAF53. DNA sequencing demonstrated that in the absence of ectopic PAF53 expression, cells demonstrated unique means of surviving; including recombination or the utilization of alternative reading frames. We never observed a clone in which one PAF53 gene is expressed, unless there was also ectopic expression In the absence of ectopic gene expression, the gene products of both endogenous genes were expressed, irrespective of whether they were partially mutant proteins or not. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Knowledge-guided gene prioritization reveals new insights into the mechanisms of chemoresistance.

    PubMed

    Emad, Amin; Cairns, Junmei; Kalari, Krishna R; Wang, Liewei; Sinha, Saurabh

    2017-08-11

    Identification of genes whose basal mRNA expression predicts the sensitivity of tumor cells to cytotoxic treatments can play an important role in individualized cancer medicine. It enables detailed characterization of the mechanism of action of drugs. Furthermore, screening the expression of these genes in the tumor tissue may suggest the best course of chemotherapy or a combination of drugs to overcome drug resistance. We developed a computational method called ProGENI to identify genes most associated with the variation of drug response across different individuals, based on gene expression data. In contrast to existing methods, ProGENI also utilizes prior knowledge of protein-protein and genetic interactions, using random walk techniques. Analysis of two relatively new and large datasets including gene expression data on hundreds of cell lines and their cytotoxic responses to a large compendium of drugs reveals a significant improvement in prediction of drug sensitivity using genes identified by ProGENI compared to other methods. Our siRNA knockdown experiments on ProGENI-identified genes confirmed the role of many new genes in sensitivity to three chemotherapy drugs: cisplatin, docetaxel, and doxorubicin. Based on such experiments and extensive literature survey, we demonstrate that about 73% of our top predicted genes modulate drug response in selected cancer cell lines. In addition, global analysis of genes associated with groups of drugs uncovered pathways of cytotoxic response shared by each group. Our results suggest that knowledge-guided prioritization of genes using ProGENI gives new insight into mechanisms of drug resistance and identifies genes that may be targeted to overcome this phenomenon.

  19. Statistical Analysis of Microarray Data with Replicated Spots: A Case Study with Synechococcus WH8102

    PubMed Central

    Thomas, E. V.; Phillippy, K. H.; Brahamsha, B.; Haaland, D. M.; Timlin, J. A.; Elbourne, L. D. H.; Palenik, B.; Paulsen, I. T.

    2009-01-01

    Until recently microarray experiments often involved relatively few arrays with only a single representation of each gene on each array. A complete genome microarray with multiple spots per gene (spread out spatially across the array) was developed in order to compare the gene expression of a marine cyanobacterium and a knockout mutant strain in a defined artificial seawater medium. Statistical methods were developed for analysis in the special situation of this case study where there is gene replication within an array and where relatively few arrays are used, which can be the case with current array technology. Due in part to the replication within an array, it was possible to detect very small changes in the levels of expression between the wild type and mutant strains. One interesting biological outcome of this experiment is the indication of the extent to which the phosphorus regulatory system of this cyanobacterium affects the expression of multiple genes beyond those strictly involved in phosphorus acquisition. PMID:19404483

  20. Statistical Analysis of Microarray Data with Replicated Spots: A Case Study with Synechococcus WH8102

    DOE PAGES

    Thomas, E. V.; Phillippy, K. H.; Brahamsha, B.; ...

    2009-01-01

    Until recently microarray experiments often involved relatively few arrays with only a single representation of each gene on each array. A complete genome microarray with multiple spots per gene (spread out spatially across the array) was developed in order to compare the gene expression of a marine cyanobacterium and a knockout mutant strain in a defined artificial seawater medium. Statistical methods were developed for analysis in the special situation of this case study where there is gene replication within an array and where relatively few arrays are used, which can be the case with current array technology. Due in partmore » to the replication within an array, it was possible to detect very small changes in the levels of expression between the wild type and mutant strains. One interesting biological outcome of this experiment is the indication of the extent to which the phosphorus regulatory system of this cyanobacterium affects the expression of multiple genes beyond those strictly involved in phosphorus acquisition.« less

  1. In vivo gene delivery and expression by bacteriophage lambda vectors.

    PubMed

    Lankes, H A; Zanghi, C N; Santos, K; Capella, C; Duke, C M P; Dewhurst, S

    2007-05-01

    Bacteriophage vectors have potential as gene transfer and vaccine delivery vectors because of their low cost, safety and physical stability. However, little is known concerning phage-mediated gene transfer in mammalian hosts. We therefore performed experiments to examine phage-mediated gene transfer in vivo. Mice were inoculated with recombinant lambda phage containing a mammalian expression cassette encoding firefly luciferase (luc). Efficient, dose-dependent in vivo luc expression was detected, which peaked within 24 h of delivery and declined to undetectable levels within a week. Display of an integrin-binding peptide increased cellular internalization of phage in vitro and enhanced phage-mediated gene transfer in vivo. Finally, in vivo depletion of phagocytic cells using clodronate liposomes had only a minor effect on the efficiency of phage-mediated gene transfer. Unmodified lambda phage particles are capable of transducing mammalian cells in vivo, and may be taken up -- at least in part -- by nonphagocytic mechanisms. Surface modifications that enhance phage uptake result in more efficient in vivo gene transfer. These experiments shed light on the mechanisms involved in phage-mediated gene transfer in vivo, and suggest new approaches that may enhance the efficiency of this process.

  2. Low heat shock thresholds in wild Antarctic inter-tidal limpets (Nacella concinna)

    PubMed Central

    Geissler, Paul; Waller, Catherine; Fraser, Keiron P. P.; Barnes, David K. A.; Peck, Lloyd S.

    2008-01-01

    Heat shock proteins (HSPs) are a family of genes classically used to measure levels of organism stress. We have previously identified two HSP70 genes (HSP70A and HSP70B) in sub-tidal populations of the Antarctic limpet (Nacella concinna). These genes are up-regulated in response to increased seawater temperatures of 15°C or more during acute heat shock experiments, temperatures that have very little basis when considering the current Antarctic ecology of these animals. Therefore, the question was posed as to whether these animals could express HSP70 genes when subjected to more complex environmental conditions, such as those that occur in the inter-tidal. Inter-tidal limpets were collected on three occasions in different weather conditions at South Cove, Rothera Point, over a complete tidal cycle, and the expression levels of the HSP70 genes were measured. Both genes showed relative up-regulation of gene expression over the period of the tidal cycle. The average foot temperature of these animals was 3.3°C, far below that of the acute heat shock experiments. These experiments demonstrate that the temperature and expression levels of HSP production in wild animals cannot be accurately extrapolated from experimentally induced treatments, especially when considering the complexity of stressors in the natural environment. However, experimental manipulation can provide molecular markers for identifying stress in Antarctic molluscs, provided it is accompanied by environmental validation, as demonstrated here. Electronic supplementary material The online version of this article (doi:10.1007/s12192-008-0015-7) contains supplementary material, which is available to authorized users. PMID:18347941

  3. Expression Atlas: gene and protein expression across multiple studies and organisms

    PubMed Central

    Tang, Y Amy; Bazant, Wojciech; Burke, Melissa; Fuentes, Alfonso Muñoz-Pomer; George, Nancy; Koskinen, Satu; Mohammed, Suhaib; Geniza, Matthew; Preece, Justin; Jarnuczak, Andrew F; Huber, Wolfgang; Stegle, Oliver; Brazma, Alvis; Petryszak, Robert

    2018-01-01

    Abstract Expression Atlas (http://www.ebi.ac.uk/gxa) is an added value database that provides information about gene and protein expression in different species and contexts, such as tissue, developmental stage, disease or cell type. The available public and controlled access data sets from different sources are curated and re-analysed using standardized, open source pipelines and made available for queries, download and visualization. As of August 2017, Expression Atlas holds data from 3,126 studies across 33 different species, including 731 from plants. Data from large-scale RNA sequencing studies including Blueprint, PCAWG, ENCODE, GTEx and HipSci can be visualized next to each other. In Expression Atlas, users can query genes or gene-sets of interest and explore their expression across or within species, tissues, developmental stages in a constitutive or differential context, representing the effects of diseases, conditions or experimental interventions. All processed data matrices are available for direct download in tab-delimited format or as R-data. In addition to the web interface, data sets can now be searched and downloaded through the Expression Atlas R package. Novel features and visualizations include the on-the-fly analysis of gene set overlaps and the option to view gene co-expression in experiments investigating constitutive gene expression across tissues or other conditions. PMID:29165655

  4. Sequential social experiences interact to modulate aggression but not brain gene expression in the honey bee (Apis mellifera).

    PubMed

    Rittschof, Clare C

    2017-01-01

    In highly structured societies, individuals behave flexibly and cooperatively in order to achieve a particular group-level outcome. However, even in social species, environmental inputs can have long lasting effects on individual behavior, and variable experiences can even result in consistent individual differences and constrained behavioral flexibility. Despite the fact that such constraints on behavior could have implications for behavioral optimization at the social group level, few studies have explored how social experiences accumulate over time, and the mechanistic basis of these effects. In the current study, I evaluate how sequential social experiences affect individual and group level aggressive phenotypes, and individual brain gene expression, in the highly social honey bee ( Apis mellifera ). To do this, I combine a whole colony chronic predator disturbance treatment with a lab-based manipulation of social group composition. Compared to the undisturbed control, chronically disturbed individuals show lower aggression levels overall, but also enhanced behavioral flexibility in the second, lab-based social context. Disturbed bees display aggression levels that decline with increasing numbers of more aggressive, undisturbed group members. However, group level aggressive phenotypes are similar regardless of the behavioral tendencies of the individuals that make up the group, suggesting a combination of underlying behavioral tendency and negative social feedback influences the aggressive behaviors displayed, particularly in the case of disturbed individuals. An analysis of brain gene expression showed that aggression related biomarker genes reflect an individual's disturbance history, but not subsequent social group experience or behavioral outcomes. In highly social animals with collective behavioral phenotypes, social context may mask underlying variation in individual behavioral tendencies. Moreover, gene expression patterns may reflect behavioral tendency, while behavioral outcomes are further regulated by social cues perceived in real-time.

  5. Transcription-dependent radial distribution of TCF7L2 regulated genes in chromosome territories.

    PubMed

    Torabi, Keyvan; Wangsa, Darawalee; Ponsa, Immaculada; Brown, Markus; Bosch, Anna; Vila-Casadesús, Maria; Karpova, Tatiana S; Calvo, Maria; Castells, Antoni; Miró, Rosa; Ried, Thomas; Camps, Jordi

    2017-10-01

    Human chromosomes occupy distinct territories in the interphase nucleus. Such chromosome territories (CTs) are positioned according to gene density. Gene-rich CTs are generally located in the center of the nucleus, while gene-poor CTs are positioned more towards the nuclear periphery. However, the association between gene expression levels and the radial positioning of genes within the CT is still under debate. In the present study, we performed three-dimensional fluorescence in situ hybridization experiments in the colorectal cancer cell lines DLD-1 and LoVo using whole chromosome painting probes for chromosomes 8 and 11 and BAC clones targeting four genes with different expression levels assessed by gene expression arrays and RT-PCR. Our results confirmed that the two over-expressed genes, MYC on chromosome 8 and CCND1 on chromosome 11, are located significantly further away from the center of the CT compared to under-expressed genes on the same chromosomes, i.e., DLC1 and SCN3B. When CCND1 expression was reduced after silencing the major transcription factor of the WNT/β-catenin signaling pathway, TCF7L2, the gene was repositioned and mostly detected in the interior of the CT. Thus, we suggest a non-random distribution in which over-expressed genes are located more towards the periphery of the respective CTs.

  6. [Construction of rAAV2-GPIIb/IIIa vector and test of its expression and function in vitro].

    PubMed

    Wang, Kai; Peng, Jian-Qiang; Chen, Fang-Ping; Wu, Xiao-Bin

    2006-04-01

    This study was aimed to explore the possibility of rAAV2 vector-mediating gene therapy for Glanzmann' s thrombasthenia. The rAAV2-GPIIb/IIIa vector was constructed. The GPIIb/IIIa gene expression in mammal cell were examined by different methods, such as: detection of mRNA expression in BHK-21 cells after 24 hours of infection (MOI = 1 x 10(5) v.g/cell) was performed by RT-PCR; the relation between MOI and quantity of GPII6/IIIa gene expression was detected by FACS after 48 hours of infection; GPIIb/IIIa protein expression in BHK-21 cells after 48 hours of infection (MOI = 10(5) v x g/cell) was assayed by Western blot, GPIIb/IIIa protein expression on cell surface was detected by immunofluorescence, and the biological function of expressing product was determined by PAC-1 conjunct experiments. The results showed that GPIIb/IIIa gene expression in mRNA level could be detected in BHK-21 cells after 24 hours of infection at MOI = 1 x 10(5) v x g/cell and the GPIIb/IIIa gene expression in protein level could be detected in BHK-21 cells after 48 hours of infection at MOI = 1 x 10(5) v x g/cell. In certain range, quantity of GPIIb/IIIa gene expression increased with MOI, but overdose of MOI decreased quantity of GPIIb/IIIa gene expression. Activated product of GPIIb/IIIa gene expression could combined with PAC-I, and possesed normal biological function. In conclusion, rAAV2 vactor can effectively mediate GPIIb and GPIIIa gene expressing in mammal cells, and the products of these genes exhibit biological function. This result may provide a basis for application of rAAV2 vector in Glanzmann's thrombasthenia gene therapy in furture.

  7. Resveratrol-cyclodextrin complex affects the expression of genes associated with lipid metabolism in bovine in vitro produced embryos.

    PubMed

    Torres, V; Hamdi, M; Millán de la Blanca, M G; Urrego, R; Echeverri, J; López-Herrera, A; Rizos, D; Gutiérrez-Adán, A; Sánchez-Calabuig, M J

    2018-03-26

    Antioxidants have been widely used during in vitro production to decrease the negative effect of reactive oxygen species. It was reported that the complex resveratrol-methyl β-cyclodextrin (RV-CD) improves resveratrol's stability and bioavailability and increases its antioxidant activity. This study evaluates the effect of RV-CD during in vitro oocyte maturation (IVM) or in vitro embryo culture (IVC) on developmental competence and quantitative changes in gene expression of developmental important genes. In experiment 1, RV-CD was added to IVM media and maturation level, embryo development and oocytes, cumulus cells, and blastocysts gene expression by RT-qPCR were examined. In experiment 2, presumptive zygotes were cultured in SOF supplemented with RV-CD and embryo development and blastocysts gene expression by RT-qPCR were studied. A group without RV-CD (control - ) and a group with cyclodextrin (control + ) were included. No differences were found in cleavage rate or blastocyst yield between groups. However, the expression of LIPE was higher in blastocysts derived from oocytes treated with resveratrol compared with control groups (p < .05). Blastocysts produced by IVC with resveratrol showed that RV-CD could modify the expression of genes related to lipid metabolism (CYP51A1, PNPLA2 and MTORC1) compared with control groups (p < .05). RV-CD in the IVM and IVC media could reduce accumulated fat by increasing lipolysis and suppressing lipogenesis of blastocysts. © 2018 Blackwell Verlag GmbH.

  8. DNA microarray unravels rapid changes in transcriptome of MK-801 treated rat brain

    PubMed Central

    Kobayashi, Yuka; Kulikova, Sofya P; Shibato, Junko; Rakwal, Randeep; Satoh, Hiroyuki; Pinault, Didier; Masuo, Yoshinori

    2015-01-01

    AIM: To investigate the impact of MK-801 on gene expression patterns genome wide in rat brain regions. METHODS: Rats were treated with an intraperitoneal injection of MK-801 [0.08 (low-dose) and 0.16 (high-dose) mg/kg] or NaCl (vehicle control). In a first series of experiment, the frontoparietal electrocorticogram was recorded 15 min before and 60 min after injection. In a second series of experiments, the whole brain of each animal was rapidly removed at 40 min post-injection, and different regions were separated: amygdala, cerebral cortex, hippocampus, hypothalamus, midbrain and ventral striatum on ice followed by DNA microarray (4 × 44 K whole rat genome chip) analysis. RESULTS: Spectral analysis revealed that a single systemic injection of MK-801 significantly and selectively augmented the power of baseline gamma frequency (30-80 Hz) oscillations in the frontoparietal electroencephalogram. DNA microarray analysis showed the largest number (up- and down- regulations) of gene expressions in the cerebral cortex (378), midbrain (376), hippocampus (375), ventral striatum (353), amygdala (301), and hypothalamus (201) under low-dose (0.08 mg/kg) of MK-801. Under high-dose (0.16 mg/kg), ventral striatum (811) showed the largest number of gene expression changes. Gene expression changes were functionally categorized to reveal expression of genes and function varies with each brain region. CONCLUSION: Acute MK-801 treatment increases synchrony of baseline gamma oscillations, and causes very early changes in gene expressions in six individual rat brain regions, a first report. PMID:26629322

  9. Integration of multi-omics data for integrative gene regulatory network inference.

    PubMed

    Zarayeneh, Neda; Ko, Euiseong; Oh, Jung Hun; Suh, Sang; Liu, Chunyu; Gao, Jean; Kim, Donghyun; Kang, Mingon

    2017-01-01

    Gene regulatory networks provide comprehensive insights and indepth understanding of complex biological processes. The molecular interactions of gene regulatory networks are inferred from a single type of genomic data, e.g., gene expression data in most research. However, gene expression is a product of sequential interactions of multiple biological processes, such as DNA sequence variations, copy number variations, histone modifications, transcription factors, and DNA methylations. The recent rapid advances of high-throughput omics technologies enable one to measure multiple types of omics data, called 'multi-omics data', that represent the various biological processes. In this paper, we propose an Integrative Gene Regulatory Network inference method (iGRN) that incorporates multi-omics data and their interactions in gene regulatory networks. In addition to gene expressions, copy number variations and DNA methylations were considered for multi-omics data in this paper. The intensive experiments were carried out with simulation data, where iGRN's capability that infers the integrative gene regulatory network is assessed. Through the experiments, iGRN shows its better performance on model representation and interpretation than other integrative methods in gene regulatory network inference. iGRN was also applied to a human brain dataset of psychiatric disorders, and the biological network of psychiatric disorders was analysed.

  10. Integration of multi-omics data for integrative gene regulatory network inference

    PubMed Central

    Zarayeneh, Neda; Ko, Euiseong; Oh, Jung Hun; Suh, Sang; Liu, Chunyu; Gao, Jean; Kim, Donghyun

    2017-01-01

    Gene regulatory networks provide comprehensive insights and indepth understanding of complex biological processes. The molecular interactions of gene regulatory networks are inferred from a single type of genomic data, e.g., gene expression data in most research. However, gene expression is a product of sequential interactions of multiple biological processes, such as DNA sequence variations, copy number variations, histone modifications, transcription factors, and DNA methylations. The recent rapid advances of high-throughput omics technologies enable one to measure multiple types of omics data, called ‘multi-omics data’, that represent the various biological processes. In this paper, we propose an Integrative Gene Regulatory Network inference method (iGRN) that incorporates multi-omics data and their interactions in gene regulatory networks. In addition to gene expressions, copy number variations and DNA methylations were considered for multi-omics data in this paper. The intensive experiments were carried out with simulation data, where iGRN’s capability that infers the integrative gene regulatory network is assessed. Through the experiments, iGRN shows its better performance on model representation and interpretation than other integrative methods in gene regulatory network inference. iGRN was also applied to a human brain dataset of psychiatric disorders, and the biological network of psychiatric disorders was analysed. PMID:29354189

  11. Gene selection for tumor classification using neighborhood rough sets and entropy measures.

    PubMed

    Chen, Yumin; Zhang, Zunjun; Zheng, Jianzhong; Ma, Ying; Xue, Yu

    2017-03-01

    With the development of bioinformatics, tumor classification from gene expression data becomes an important useful technology for cancer diagnosis. Since a gene expression data often contains thousands of genes and a small number of samples, gene selection from gene expression data becomes a key step for tumor classification. Attribute reduction of rough sets has been successfully applied to gene selection field, as it has the characters of data driving and requiring no additional information. However, traditional rough set method deals with discrete data only. As for the gene expression data containing real-value or noisy data, they are usually employed by a discrete preprocessing, which may result in poor classification accuracy. In this paper, we propose a novel gene selection method based on the neighborhood rough set model, which has the ability of dealing with real-value data whilst maintaining the original gene classification information. Moreover, this paper addresses an entropy measure under the frame of neighborhood rough sets for tackling the uncertainty and noisy of gene expression data. The utilization of this measure can bring about a discovery of compact gene subsets. Finally, a gene selection algorithm is designed based on neighborhood granules and the entropy measure. Some experiments on two gene expression data show that the proposed gene selection is an effective method for improving the accuracy of tumor classification. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Concurrent hypothalamic gene expression under acute and chronic long days: Implications for initiation and maintenance of photoperiodic response in migratory songbirds.

    PubMed

    Mishra, Ila; Bhardwaj, Sanjay K; Malik, Shalie; Kumar, Vinod

    2017-01-05

    Hypothalamic expression of the thyroid hormone (TH) responsive gonadostimulatory (eya3, cga, tshβ, dio2, dio3, gnrh, gnih) and neurosteroid pathway genes (androgen receptor [ar], aromatase [cyp19], estrogen receptor [er] α and β) was examined in photosensitive redheaded buntings exposed to 2 (acute, experiment 1) or 12 (chronic, experiment 2) long days (16L:8D). Experiment 2 also included a photorefractory group. Acute long days caused a significant increase in eya3, cga, tshβ, dio2 and gnrh and decrease in dio3 mRNA levels. eya3, cga and tshβ expressions were unchanged after the chronic long days. We also found increased cyp19, erα and erβ mRNA levels after acute, and increased cyp19 and decreased erβ levels after the chronic long-day exposure. Photorefractory buntings showed expression patterns similar to that in the photosensitive state, except for high gnrh and gnih and low dio3 mRNA levels. Consistent with gene expression patterns, there were changes in fat deposition, body mass, testis size, and plasma levels of testosterone, tri-iodothyronine and thyroxine. These results show concurrent photostimulation of the TH-signalling and neurosteroid pathways, and extend the idea, based on differences in gene expression, that transitions in seasonal photoperiodic states are accomplished at the transcriptional levels in absolute photorefractory species. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Gene expression analysis of pancreatic cell lines reveals genes overexpressed in pancreatic cancer.

    PubMed

    Alldinger, Ingo; Dittert, Dag; Peiper, Matthias; Fusco, Alberto; Chiappetta, Gennaro; Staub, Eike; Lohr, Matthias; Jesnowski, Ralf; Baretton, Gustavo; Ockert, Detlef; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian

    2005-01-01

    Pancreatic cancer is one of the leading causes of cancer-related death. Using DNA gene expression analysis based on a custom made Affymetrix cancer array, we investigated the expression pattern of both primary and established pancreatic carcinoma cell lines. We analyzed the gene expression of 5 established pancreatic cancer cell lines (AsPC-1, BxPC-3, Capan-1, Capan-2 and HPAF II) and 5 primary isolates, 1 of them derived from benign pancreatic duct cells. Out of 1,540 genes which were expressed in at least 3 experiments, we found 122 genes upregulated and 18 downregulated in tumor cell lines compared to benign cells with a fold change >3. Several of the upregulated genes (like Prefoldin 5, ADAM9 and E-cadherin) have been associated with pancreatic cancer before. The other differentially regulated genes, however, play a so far unknown role in the course of human pancreatic carcinoma. By means of immunohistochemistry we could show that thymosin beta-10 (TMSB10), upregulated in tumor cell lines, is expressed in human pancreatic carcinoma, but not in non-neoplastic pancreatic tissue, suggesting a role for TMSB10 in the carcinogenesis of pancreatic carcinoma. Using gene expression profiling of pancreatic cell lines we were able to identify genes differentially expressed in pancreatic adenocarcinoma, which might contribute to pancreatic cancer development. Copyright 2005 S. Karger AG, Basel.

  14. Transient gene and microRNA expression profile changes of confluent human fibroblast cells in space

    NASA Astrophysics Data System (ADS)

    Wu, Honglu; Story, Michael; Karouia, Fathi; Stodieck, Louis; Zhang, Ye; Lu, Tao

    2016-07-01

    Microgravity, or an altered gravity environment from the Earth1g, has been shown to influence global gene expression patterns and protein levels in cultured cells. However, most of the reported studies conducted in space or using simulated microgravity on the ground have focused on the growth or differentiation of these cells. Whether non-proliferating cultured cells will sense the presence of microgravity in space has not been specifically addressed. In an experiment conducted onboard the International Space Station (ISS), confluent human fibroblast cells were fixed after being cultured in space for 3 and 14 days, respectively, for investigations of gene and miRNA expression profile changes in these cells. Results of the experiment showed that on Day 3, both the flown and ground cells were still proliferating slowly, as measured by the percentage of Ki-67 positive cells. Gene and miRNA expression data indicated activation of NFkB and other growth related pathways involving HGF and Vegf along with down regulation of the Let-7 miRNA family. On Day 14 when the cells were mostly non-proliferating, the gene and miRNA expression profiles between the flight and ground samples were indistinguishable. Comparison of gene and miRNA expressions in the Day 3 samples with respect to Day 14 revealed that most of the changes observed on Day 3 were related to cell growth for both the flown and ground cells. Analysis of cytoskeletal changes via immunohistochemistry staining of the cells with antibodies for αa-tubulin and fibronectin showed no difference between flown and ground samples. Taken together, our study suggests that in true non-dividing human fibroblast cells in culture, microgravity experienced in space has little effect on the gene and miRNA expression profiles.

  15. Transcriptomic responses to wounding: meta-analysis of gene expression microarray data.

    PubMed

    Sass, Piotr Andrzej; Dąbrowski, Michał; Charzyńska, Agata; Sachadyn, Paweł

    2017-11-07

    A vast amount of microarray data on transcriptomic response to injury has been collected so far. We designed the analysis in order to identify the genes displaying significant changes in expression after wounding in different organisms and tissues. This meta-analysis is the first study to compare gene expression profiles in response to wounding in as different tissues as heart, liver, skin, bones, and spinal cord, and species, including rat, mouse and human. We collected available microarray transcriptomic profiles obtained from different tissue injury experiments and selected the genes showing a minimum twofold change in expression in response to wounding in prevailing number of experiments for each of five wound healing stages we distinguished: haemostasis & early inflammation, inflammation, early repair, late repair and remodelling. During the initial phases after wounding, haemostasis & early inflammation and inflammation, the transcriptomic responses showed little consistency between different tissues and experiments. For the later phases, wound repair and remodelling, we identified a number of genes displaying similar transcriptional responses in all examined tissues. As revealed by ontological analyses, activation of certain pathways was rather specific for selected phases of wound healing, such as e.g. responses to vitamin D pronounced during inflammation. Conversely, we observed induction of genes encoding inflammatory agents and extracellular matrix proteins in all wound healing phases. Further, we selected several genes differentially upregulated throughout different stages of wound response, including established factors of wound healing in addition to those previously unreported  in this context such as PTPRC and AQP4. We found that transcriptomic responses to wounding showed similar traits in a diverse selection of tissues including skin, muscles, internal organs and nervous system. Notably, we distinguished transcriptional induction of inflammatory genes not only in the initial response to wounding, but also later, during wound repair and tissue remodelling.

  16. Fractal Clustering and Knowledge-driven Validation Assessment for Gene Expression Profiling.

    PubMed

    Wang, Lu-Yong; Balasubramanian, Ammaiappan; Chakraborty, Amit; Comaniciu, Dorin

    2005-01-01

    DNA microarray experiments generate a substantial amount of information about the global gene expression. Gene expression profiles can be represented as points in multi-dimensional space. It is essential to identify relevant groups of genes in biomedical research. Clustering is helpful in pattern recognition in gene expression profiles. A number of clustering techniques have been introduced. However, these traditional methods mainly utilize shape-based assumption or some distance metric to cluster the points in multi-dimension linear Euclidean space. Their results shows poor consistence with the functional annotation of genes in previous validation study. From a novel different perspective, we propose fractal clustering method to cluster genes using intrinsic (fractal) dimension from modern geometry. This method clusters points in such a way that points in the same clusters are more self-affine among themselves than to the points in other clusters. We assess this method using annotation-based validation assessment for gene clusters. It shows that this method is superior in identifying functional related gene groups than other traditional methods.

  17. Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function.

    PubMed

    Hatazawa, Yukino; Minami, Kimiko; Yoshimura, Ryoji; Onishi, Takumi; Manio, Mark Christian; Inoue, Kazuo; Sawada, Naoki; Suzuki, Osamu; Miura, Shinji; Kamei, Yasutomi

    2016-12-09

    The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared with that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α's function in the oxidative energy metabolism of skeletal muscles. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Effect of fenofibrate on oxidative DNA damage and on gene expression related to cell proliferation and apoptosis in rats.

    PubMed

    Nishimura, Jihei; Dewa, Yasuaki; Muguruma, Masako; Kuroiwa, Yuichi; Yasuno, Hiroaki; Shima, Tomomi; Jin, Mailan; Takahashi, Miwa; Umemura, Takashi; Mitsumori, Kunitoshi

    2007-05-01

    To investigate the relationship between fenofibrate (FF) and oxidative stress, enzymatic, histopathological, and molecular biological analyses were performed in the liver of male F344 rats fed 2 doses of FF (Experiment 1; 0 and 6000 ppm) for 3 weeks and 3 doses (Experiment 2; 0, 3000, and 6000 ppm) for 9 weeks. FF treatment increased the activity of enzymes such as carnitine acetyltransferase, carnitine palmitoyltransferase, fatty acyl-CoA oxidizing system, and catalase in the liver. However, it decreased those of superoxide dismutase in the liver in both experiments. Increased 8-hydroxy-2'-deoxyguanosine levels in liver DNA and lipofuscin accumulation were observed in the treated rats of Experiment 2. In vitro measurement of reactive oxygen species (ROS) in rat liver microsomes revealed a dose-dependent increase due to FF treatment. Microarray (only Experiment 1) or real-time reverse transcription-polymerase chain reaction analyses revealed that the expression levels of metabolism and DNA repair-related genes such as Aco, Cyp4a1, Cat, Yc2, Gpx2, Apex1, Xrcc5, Mgmt, Mlh1, Gadd45a, and Nbn were increased in FF-treated rats. These results provide evidence of a direct or indirect relationship between oxidative stress and FF treatment. In addition, increases in the expression levels of cell cycle-related genes such as Chek1, Cdc25a, and Ccdn1; increases in the expression levels of cell proliferation-related genes such as Hdgfrp3 and Vegfb; and fluctuations in the expression levels of apoptosis-related genes such as Casp11 and Trp53inp1 were observed in these rats. This suggests that cell proliferation induction, apoptosis suppression, and DNA damage due to oxidative stresses are probably involved in the mechanism of hepatocarcinogenesis due to FF in rats.

  19. Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies.

    PubMed

    Cheng, Changde; Kirkpatrick, Mark

    2016-09-01

    Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive "Twin Peaks" pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies.

  20. The Global Error Assessment (GEA) model for the selection of differentially expressed genes in microarray data.

    PubMed

    Mansourian, Robert; Mutch, David M; Antille, Nicolas; Aubert, Jerome; Fogel, Paul; Le Goff, Jean-Marc; Moulin, Julie; Petrov, Anton; Rytz, Andreas; Voegel, Johannes J; Roberts, Matthew-Alan

    2004-11-01

    Microarray technology has become a powerful research tool in many fields of study; however, the cost of microarrays often results in the use of a low number of replicates (k). Under circumstances where k is low, it becomes difficult to perform standard statistical tests to extract the most biologically significant experimental results. Other more advanced statistical tests have been developed; however, their use and interpretation often remain difficult to implement in routine biological research. The present work outlines a method that achieves sufficient statistical power for selecting differentially expressed genes under conditions of low k, while remaining as an intuitive and computationally efficient procedure. The present study describes a Global Error Assessment (GEA) methodology to select differentially expressed genes in microarray datasets, and was developed using an in vitro experiment that compared control and interferon-gamma treated skin cells. In this experiment, up to nine replicates were used to confidently estimate error, thereby enabling methods of different statistical power to be compared. Gene expression results of a similar absolute expression are binned, so as to enable a highly accurate local estimate of the mean squared error within conditions. The model then relates variability of gene expression in each bin to absolute expression levels and uses this in a test derived from the classical ANOVA. The GEA selection method is compared with both the classical and permutational ANOVA tests, and demonstrates an increased stability, robustness and confidence in gene selection. A subset of the selected genes were validated by real-time reverse transcription-polymerase chain reaction (RT-PCR). All these results suggest that GEA methodology is (i) suitable for selection of differentially expressed genes in microarray data, (ii) intuitive and computationally efficient and (iii) especially advantageous under conditions of low k. The GEA code for R software is freely available upon request to authors.

  1. Deletion of the transcriptional coactivator PGC1α in skeletal muscles is associated with reduced expression of genes related to oxidative muscle function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hatazawa, Yukino; Research Fellow of Japan Society for the Promotion of Science, Tokyo; Minami, Kimiko

    The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared withmore » that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α’s function in the oxidative energy metabolism of skeletal muscles. - Highlights: • Microarray analysis was performed in the skeletal muscle of PGC1α KO mice. • Expression of genes in the oxidative energy metabolism was decreased. • Bioinformatic analysis of promoter region of the genes predicted involvement of ERR. • PGC1α KO microarray data in this study show the mirror image of transgenic data.« less

  2. Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data.

    PubMed

    Zhu, Mingzhu; Dahmen, Jeremy L; Stacey, Gary; Cheng, Jianlin

    2013-09-22

    High-throughput RNA sequencing (RNA-Seq) is a revolutionary technique to study the transcriptome of a cell under various conditions at a systems level. Despite the wide application of RNA-Seq techniques to generate experimental data in the last few years, few computational methods are available to analyze this huge amount of transcription data. The computational methods for constructing gene regulatory networks from RNA-Seq expression data of hundreds or even thousands of genes are particularly lacking and urgently needed. We developed an automated bioinformatics method to predict gene regulatory networks from the quantitative expression values of differentially expressed genes based on RNA-Seq transcriptome data of a cell in different stages and conditions, integrating transcriptional, genomic and gene function data. We applied the method to the RNA-Seq transcriptome data generated for soybean root hair cells in three different development stages of nodulation after rhizobium infection. The method predicted a soybean nodulation-related gene regulatory network consisting of 10 regulatory modules common for all three stages, and 24, 49 and 70 modules separately for the first, second and third stage, each containing both a group of co-expressed genes and several transcription factors collaboratively controlling their expression under different conditions. 8 of 10 common regulatory modules were validated by at least two kinds of validations, such as independent DNA binding motif analysis, gene function enrichment test, and previous experimental data in the literature. We developed a computational method to reliably reconstruct gene regulatory networks from RNA-Seq transcriptome data. The method can generate valuable hypotheses for interpreting biological data and designing biological experiments such as ChIP-Seq, RNA interference, and yeast two hybrid experiments.

  3. Comparative transcriptomics indicate changes in cell wall organization and stress response in seedlings during spaceflight.

    PubMed

    Johnson, Christina M; Subramanian, Aswati; Pattathil, Sivakumar; Correll, Melanie J; Kiss, John Z

    2017-08-21

    Plants will play an important role in the future of space exploration as part of bioregenerative life support. Thus, it is important to understand the effects of microgravity and spaceflight on gene expression in plant development. We analyzed the transcriptome of Arabidopsis thaliana using the Biological Research in Canisters (BRIC) hardware during Space Shuttle mission STS-131. The bioinformatics methods used included RMA (robust multi-array average), MAS5 (Microarray Suite 5.0), and PLIER (probe logarithmic intensity error estimation). Glycome profiling was used to analyze cell wall composition in the samples. In addition, our results were compared to those of two other groups using the same hardware on the same mission (BRIC-16). In our BRIC-16 experiments, we noted expression changes in genes involved in hypoxia and heat shock responses, DNA repair, and cell wall structure between spaceflight samples compared to the ground controls. In addition, glycome profiling supported our expression analyses in that there was a difference in cell wall components between ground control and spaceflight-grown plants. Comparing our studies to those of the other BRIC-16 experiments demonstrated that, even with the same hardware and similar biological materials, differences in results in gene expression were found among these spaceflight experiments. A common theme from our BRIC-16 space experiments and those of the other two groups was the downregulation of water stress response genes in spaceflight. In addition, all three studies found differential regulation of genes associated with cell wall remodeling and stress responses between spaceflight-grown and ground control plants. © 2017 Botanical Society of America.

  4. Distributional fold change test – a statistical approach for detecting differential expression in microarray experiments

    PubMed Central

    2012-01-01

    Background Because of the large volume of data and the intrinsic variation of data intensity observed in microarray experiments, different statistical methods have been used to systematically extract biological information and to quantify the associated uncertainty. The simplest method to identify differentially expressed genes is to evaluate the ratio of average intensities in two different conditions and consider all genes that differ by more than an arbitrary cut-off value to be differentially expressed. This filtering approach is not a statistical test and there is no associated value that can indicate the level of confidence in the designation of genes as differentially expressed or not differentially expressed. At the same time the fold change by itself provide valuable information and it is important to find unambiguous ways of using this information in expression data treatment. Results A new method of finding differentially expressed genes, called distributional fold change (DFC) test is introduced. The method is based on an analysis of the intensity distribution of all microarray probe sets mapped to a three dimensional feature space composed of average expression level, average difference of gene expression and total variance. The proposed method allows one to rank each feature based on the signal-to-noise ratio and to ascertain for each feature the confidence level and power for being differentially expressed. The performance of the new method was evaluated using the total and partial area under receiver operating curves and tested on 11 data sets from Gene Omnibus Database with independently verified differentially expressed genes and compared with the t-test and shrinkage t-test. Overall the DFC test performed the best – on average it had higher sensitivity and partial AUC and its elevation was most prominent in the low range of differentially expressed features, typical for formalin-fixed paraffin-embedded sample sets. Conclusions The distributional fold change test is an effective method for finding and ranking differentially expressed probesets on microarrays. The application of this test is advantageous to data sets using formalin-fixed paraffin-embedded samples or other systems where degradation effects diminish the applicability of correlation adjusted methods to the whole feature set. PMID:23122055

  5. Expression Analysis of Stress-Related Genes in Kernels of Different Maize (Zea mays L.) Inbred Lines with Different Resistance to Aflatoxin Contamination

    PubMed Central

    Jiang, Tingbo; Zhou, Boru; Luo, Meng; Abbas, Hamed K.; Kemerait, Robert; Lee, Robert Dewey; Scully, Brian T.; Guo, Baozhu

    2011-01-01

    This research examined the expression patterns of 94 stress-related genes in seven maize inbred lines with differential expressions of resistance to aflatoxin contamination. The objective was to develop a set of genes/probes associated with resistance to A. flavus and/or aflatoxin contamination. Ninety four genes were selected from previous gene expression studies with abiotic stress to test the differential expression in maize lines, A638, B73, Lo964, Lo1016, Mo17, Mp313E, and Tex6, using real-time RT-PCR. Based on the relative-expression levels, the seven maize inbred lines clustered into two different groups. One group included B73, Lo1016 and Mo17, which had higher levels of aflatoxin contamination and lower levels of overall gene expression. The second group which included Tex6, Mp313E, Lo964 and A638 had lower levels of aflatoxin contamination and higher overall levels of gene expressions. A total of six “cross-talking” genes were identified between the two groups, which are highly expressed in the resistant Group 2 but down-regulated in susceptible Group 1. When further subjected to drought stress, Tex6 expressed more genes up-regulated and B73 has fewer genes up-regulated. The transcript patterns and interactions measured in these experiments indicate that the resistant mechanism is an interconnected process involving many gene products and transcriptional regulators, as well as various host interactions with environmental factors, particularly, drought and high temperature. PMID:22069724

  6. Integration of biological networks and gene expression data using Cytoscape

    PubMed Central

    Cline, Melissa S; Smoot, Michael; Cerami, Ethan; Kuchinsky, Allan; Landys, Nerius; Workman, Chris; Christmas, Rowan; Avila-Campilo, Iliana; Creech, Michael; Gross, Benjamin; Hanspers, Kristina; Isserlin, Ruth; Kelley, Ryan; Killcoyne, Sarah; Lotia, Samad; Maere, Steven; Morris, John; Ono, Keiichiro; Pavlovic, Vuk; Pico, Alexander R; Vailaya, Aditya; Wang, Peng-Liang; Adler, Annette; Conklin, Bruce R; Hood, Leroy; Kuiper, Martin; Sander, Chris; Schmulevich, Ilya; Schwikowski, Benno; Warner, Guy J; Ideker, Trey; Bader, Gary D

    2013-01-01

    Cytoscape is a free software package for visualizing, modeling and analyzing molecular and genetic interaction networks. This protocol explains how to use Cytoscape to analyze the results of mRNA expression profiling, and other functional genomics and proteomics experiments, in the context of an interaction network obtained for genes of interest. Five major steps are described: (i) obtaining a gene or protein network, (ii) displaying the network using layout algorithms, (iii) integrating with gene expression and other functional attributes, (iv) identifying putative complexes and functional modules and (v) identifying enriched Gene Ontology annotations in the network. These steps provide a broad sample of the types of analyses performed by Cytoscape. PMID:17947979

  7. Annotated Gene and Proteome Data Support Recognition of Interconnections Between the Results of Different Experiments in Space Research

    NASA Astrophysics Data System (ADS)

    Bauer, Johann; Wehland, Markus; Pietsch, Jessica; Sickmann, Albert; Weber, Gerhard; Grimm, Daniela

    2016-06-01

    In a series of studies, human thyroid and endothelial cells exposed to real or simulated microgravity were analyzed in terms of changes in gene expression patterns or protein content. Due to the limitation of available cells in many space research experiments, comparative and control experiments had to be done in a serial manner. Therefore, detected genes or proteins were annotated with gene names and SwissProt numbers, in order to allow searches for interconnections between results obtained in different experiments by different methods. A crosscheck of several studies on the behavior of cytoskeletal genes and proteins suggested that clusters of cytoskeletal components change differently under the influence of microgravity and/or vibration in different cell types. The result that LOX and ISG15 gene expression were clearly altered during the Shenzhou-8 spaceflight mission could be estimated by comparison with the results of other experiments. The more than 100-fold down-regulation of LOX supports our hypothesis that the amount and stability of extracellular matrix have a great influence on the formation of three-dimensional aggregates under microgravity. The approximately 40-fold up-regulation of ISG15 cannot yet be explained in detail, but strongly suggests that ISGylation, an alternative form of posttranslational modification, plays a role in longterm cultures.

  8. Identification of repaglinide as a therapeutic drug for glioblastoma multiforme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Zui Xuan; Chen, Ruo Qiao; Hu, Dian Xing

    Glioblastoma multiforme (GBM) is a highly aggressive brain tumor with a median survival time of only 14 months after treatment. It is urgent to find new therapeutic drugs that increase survival time of GBM patients. To achieve this goal, we screened differentially expressed genes between long-term and short-term survived GBM patients from Gene Expression Omnibus database and found gene expression signature for the long-term survived GBM patients. The signaling networks of all those differentially expressed genes converged to protein binding, extracellular matrix and tissue development as revealed in BiNGO and Cytoscape. Drug repositioning in Connectivity Map by using the genemore » expression signature identified repaglinide, a first-line drug for diabetes mellitus, as the most promising novel drug for GBM. In vitro experiments demonstrated that repaglinide significantly inhibited the proliferation and migration of human GBM cells. In vivo experiments demonstrated that repaglinide prominently prolonged the median survival time of mice bearing orthotopic glioma. Mechanistically, repaglinide significantly reduced Bcl-2, Beclin-1 and PD-L1 expression in glioma tissues, indicating that repaglinide may exert its anti-cancer effects via apoptotic, autophagic and immune checkpoint signaling. Taken together, repaglinide is likely to be an effective drug to prolong life span of GBM patients. - Highlights: • Gene expression signarue in long-term survived GBM patients are identified from Gene Expression Omnibus database. • Repaglinide is identified as a survival-related drug for GBM via drug repositioning in CMap. • Repaglinide effectively kills GBM cells, inhibits GBM cell migration and increases survival of mice bearing orthotopic glioma. • Repaglinide reduces Bcl-2, Beclin-1 and PD-L1 in GBM tissues.« less

  9. Two-pass imputation algorithm for missing value estimation in gene expression time series.

    PubMed

    Tsiporkova, Elena; Boeva, Veselka

    2007-10-01

    Gene expression microarray experiments frequently generate datasets with multiple values missing. However, most of the analysis, mining, and classification methods for gene expression data require a complete matrix of gene array values. Therefore, the accurate estimation of missing values in such datasets has been recognized as an important issue, and several imputation algorithms have already been proposed to the biological community. Most of these approaches, however, are not particularly suitable for time series expression profiles. In view of this, we propose a novel imputation algorithm, which is specially suited for the estimation of missing values in gene expression time series data. The algorithm utilizes Dynamic Time Warping (DTW) distance in order to measure the similarity between time expression profiles, and subsequently selects for each gene expression profile with missing values a dedicated set of candidate profiles for estimation. Three different DTW-based imputation (DTWimpute) algorithms have been considered: position-wise, neighborhood-wise, and two-pass imputation. These have initially been prototyped in Perl, and their accuracy has been evaluated on yeast expression time series data using several different parameter settings. The experiments have shown that the two-pass algorithm consistently outperforms, in particular for datasets with a higher level of missing entries, the neighborhood-wise and the position-wise algorithms. The performance of the two-pass DTWimpute algorithm has further been benchmarked against the weighted K-Nearest Neighbors algorithm, which is widely used in the biological community; the former algorithm has appeared superior to the latter one. Motivated by these findings, indicating clearly the added value of the DTW techniques for missing value estimation in time series data, we have built an optimized C++ implementation of the two-pass DTWimpute algorithm. The software also provides for a choice between three different initial rough imputation methods.

  10. CRISP-3, a protein with homology to plant defense proteins, is expressed in mouse B cells under the control of Oct2.

    PubMed

    Pfisterer, P; König, H; Hess, J; Lipowsky, G; Haendler, B; Schleuning, W D; Wirth, T

    1996-11-01

    The Oct2 transcription factor is expressed throughout the B-lymphoid lineage and plays an essential role during the terminal phase of B-cell differentiation. Several genes specifically expressed in B lymphocytes have been identified that contain a functional octamer motif in their regulatory elements. However, expression of only a single gene, the murine CD36 gene, has been shown to date to be dependent on Oct2. Here, we present the identification and characterization of a further gene, coding for cysteine-rich secreted protein 3 (CRISP-3), whose expression in B cells is regulated by Oct2. We show that CRISP-3 is expressed in the B-lymphoid lineage specifically at the pre-B-cell stage. By using different experimental strategies, including nuclear run-on experiments, we demonstrate that this gene is transcriptionally activated by Oct2. Furthermore, analysis of CRISP-3 expression in primary B cells derived from either wild-type or Oct2-deficient mice demonstrates the dependence on Oct2. Two variant octamer motifs were identified in the upstream promoter region of the crisp-3 gene, and Oct2 interacts with both of them in vitro. Cotransfection experiments with expression vectors for Oct1 and Oct2 together with a reporter driven by the crisp-3 promoter showed that transcriptional activation of this promoter can only be achieved with Oct2. The C-terminal transactivation domain of Oct2 is required for this activation. Finally, introducing specific mutations in the two variant octamer motifs revealed that both of them are important for full transcriptional activation by Oct2.

  11. High-efficiency Agrobacterium-mediated transformation of Norway spruce (Picea abies) and loblolly pine (Pinus taeda)

    NASA Technical Reports Server (NTRS)

    Wenck, A. R.; Quinn, M.; Whetten, R. W.; Pullman, G.; Sederoff, R.; Brown, C. S. (Principal Investigator)

    1999-01-01

    Agrobacterium-mediated gene transfer is the method of choice for many plant biotechnology laboratories; however, large-scale use of this organism in conifer transformation has been limited by difficult propagation of explant material, selection efficiencies and low transformation frequency. We have analyzed co-cultivation conditions and different disarmed strains of Agrobacterium to improve transformation. Additional copies of virulence genes were added to three common disarmed strains. These extra virulence genes included either a constitutively active virG or extra copies of virG and virB, both from pTiBo542. In experiments with Norway spruce, we increased transformation efficiencies 1000-fold from initial experiments where little or no transient expression was detected. Over 100 transformed lines expressing the marker gene beta-glucuronidase (GUS) were generated from rapidly dividing embryogenic suspension-cultured cells co-cultivated with Agrobacterium. GUS activity was used to monitor transient expression and to further test lines selected on kanamycin-containing medium. In loblolly pine, transient expression increased 10-fold utilizing modified Agrobacterium strains. Agrobacterium-mediated gene transfer is a useful technique for large-scale generation of transgenic Norway spruce and may prove useful for other conifer species.

  12. Optimization of cDNA microarrays procedures using criteria that do not rely on external standards.

    PubMed

    Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Laegreid, Astrid

    2007-10-18

    The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish.

  13. Optimization of cDNA microarrays procedures using criteria that do not rely on external standards

    PubMed Central

    Bruland, Torunn; Anderssen, Endre; Doseth, Berit; Bergum, Hallgeir; Beisvag, Vidar; Lægreid, Astrid

    2007-01-01

    Background The measurement of gene expression using microarray technology is a complicated process in which a large number of factors can be varied. Due to the lack of standard calibration samples such as are used in traditional chemical analysis it may be a problem to evaluate whether changes done to the microarray procedure actually improve the identification of truly differentially expressed genes. The purpose of the present work is to report the optimization of several steps in the microarray process both in laboratory practices and in data processing using criteria that do not rely on external standards. Results We performed a cDNA microarry experiment including RNA from samples with high expected differential gene expression termed "high contrasts" (rat cell lines AR42J and NRK52E) compared to self-self hybridization, and optimized a pipeline to maximize the number of genes found to be differentially expressed in the "high contrasts" RNA samples by estimating the false discovery rate (FDR) using a null distribution obtained from the self-self experiment. The proposed high-contrast versus self-self method (HCSSM) requires only four microarrays per evaluation. The effects of blocking reagent dose, filtering, and background corrections methodologies were investigated. In our experiments a dose of 250 ng LNA (locked nucleic acid) dT blocker, no background correction and weight based filtering gave the largest number of differentially expressed genes. The choice of background correction method had a stronger impact on the estimated number of differentially expressed genes than the choice of filtering method. Cross platform microarray (Illumina) analysis was used to validate that the increase in the number of differentially expressed genes found by HCSSM was real. Conclusion The results show that HCSSM can be a useful and simple approach to optimize microarray procedures without including external standards. Our optimizing method is highly applicable to both long oligo-probe microarrays which have become commonly used for well characterized organisms such as man, mouse and rat, as well as to cDNA microarrays which are still of importance for organisms with incomplete genome sequence information such as many bacteria, plants and fish. PMID:17949480

  14. Transcription profile of brewery yeast under fermentation conditions.

    PubMed

    James, T C; Campbell, S; Donnelly, D; Bond, U

    2003-01-01

    Yeast strains, used in the brewing industry, experience distinctive physiological conditions. During a brewing fermentation, yeast are exposed to anaerobic conditions, high pressure, high specific gravity and low temperatures. The purpose of this study was to examine the global gene expression profile of yeast subjected to brewing stress. We have carried out a microarray analysis of a typical brewer's yeast during the course of an 8-day fermentation in 15 degrees P wort. We used the probes derived from Saccharomyces cerevisiae genomic DNA on the chip and RNA isolated from three stages of brewing. This analysis shows a high level of expression of genes involved in fatty acid and ergosterol biosynthesis early in fermentation. Furthermore, genes involved in respiration and mitochondrial protein synthesis also show higher levels of expression. Surprisingly, we observed a complete repression of many stress response genes and genes involved in protein synthesis throughout the 8-day period compared with that at the start of fermentation. This microarray data set provides an analysis of gene expression under brewing fermentation conditions. The data provide an insight into the various metabolic processes altered or activated by brewing conditions of growth. This study leads to future experiments whereby selective alterations in brewing conditions could be introduced to take advantage of the changing transcript profile to improve the quality of the brew.

  15. Selection and Validation of Appropriate Reference Genes for qRT-PCR Analysis in Isatis indigotica Fort.

    PubMed Central

    Li, Tao; Wang, Jing; Lu, Miao; Zhang, Tianyi; Qu, Xinyun; Wang, Zhezhi

    2017-01-01

    Due to its sensitivity and specificity, real-time quantitative PCR (qRT-PCR) is a popular technique for investigating gene expression levels in plants. Based on the Minimum Information for Publication of Real-Time Quantitative PCR Experiments (MIQE) guidelines, it is necessary to select and validate putative appropriate reference genes for qRT-PCR normalization. In the current study, three algorithms, geNorm, NormFinder, and BestKeeper, were applied to assess the expression stability of 10 candidate reference genes across five different tissues and three different abiotic stresses in Isatis indigotica Fort. Additionally, the IiYUC6 gene associated with IAA biosynthesis was applied to validate the candidate reference genes. The analysis results of the geNorm, NormFinder, and BestKeeper algorithms indicated certain differences for the different sample sets and different experiment conditions. Considering all of the algorithms, PP2A-4 and TUB4 were recommended as the most stable reference genes for total and different tissue samples, respectively. Moreover, RPL15 and PP2A-4 were considered to be the most suitable reference genes for abiotic stress treatments. The obtained experimental results might contribute to improved accuracy and credibility for the expression levels of target genes by qRT-PCR normalization in I. indigotica. PMID:28702046

  16. A Meta-Analysis of Multiple Matched Copy Number and Transcriptomics Data Sets for Inferring Gene Regulatory Relationships

    PubMed Central

    Newton, Richard; Wernisch, Lorenz

    2014-01-01

    Inferring gene regulatory relationships from observational data is challenging. Manipulation and intervention is often required to unravel causal relationships unambiguously. However, gene copy number changes, as they frequently occur in cancer cells, might be considered natural manipulation experiments on gene expression. An increasing number of data sets on matched array comparative genomic hybridisation and transcriptomics experiments from a variety of cancer pathologies are becoming publicly available. Here we explore the potential of a meta-analysis of thirty such data sets. The aim of our analysis was to assess the potential of in silico inference of trans-acting gene regulatory relationships from this type of data. We found sufficient correlation signal in the data to infer gene regulatory relationships, with interesting similarities between data sets. A number of genes had highly correlated copy number and expression changes in many of the data sets and we present predicted potential trans-acted regulatory relationships for each of these genes. The study also investigates to what extent heterogeneity between cell types and between pathologies determines the number of statistically significant predictions available from a meta-analysis of experiments. PMID:25148247

  17. Mobile phone radiation causes changes in gene and protein expression in human endothelial cell lines and the response seems to be genome- and proteome-dependent.

    PubMed

    Nylund, Reetta; Leszczynski, Dariusz

    2006-09-01

    We have examined in vitro cell response to mobile phone radiation (900 MHz GSM signal) using two variants of human endothelial cell line: EA.hy926 and EA.hy926v1. Gene expression changes were examined in three experiments using cDNA Expression Arrays and protein expression changes were examined in ten experiments using 2-DE and PDQuest software. Obtained results show that gene and protein expression were altered, in both examined cell lines, in response to one hour mobile phone radiation exposure at an average specific absorption rate of 2.8 W/kg. However, the same genes and proteins were differently affected by the exposure in each of the cell lines. This suggests that the cell response to mobile phone radiation might be genome- and proteome-dependent. Therefore, it is likely that different types of cells and from different species might respond differently to mobile phone radiation or might have different sensitivity to this weak stimulus. Our findings might also explain, at least in part, the origin of discrepancies in replication studies between different laboratories.

  18. Microgravity simulation by diamagnetic levitation: effects of a strong gradient magnetic field on the transcriptional profile of Drosophila melanogaster.

    PubMed

    Herranz, Raul; Larkin, Oliver J; Dijkstra, Camelia E; Hill, Richard J A; Anthony, Paul; Davey, Michael R; Eaves, Laurence; van Loon, Jack J W A; Medina, F Javier; Marco, Roberto

    2012-02-01

    Many biological systems respond to the presence or absence of gravity. Since experiments performed in space are expensive and can only be undertaken infrequently, Earth-based simulation techniques are used to investigate the biological response to weightlessness. A high gradient magnetic field can be used to levitate a biological organism so that its net weight is zero. We have used a superconducting magnet to assess the effect of diamagnetic levitation on the fruit fly D. melanogaster in levitation experiments that proceeded for up to 22 consecutive days. We have compared the results with those of similar experiments performed in another paradigm for microgravity simulation, the Random Positioning Machine (RPM). We observed a delay in the development of the fruit flies from embryo to adult. Microarray analysis indicated changes in overall gene expression of imagoes that developed from larvae under diamagnetic levitation, and also under simulated hypergravity conditions. Significant changes were observed in the expression of immune-, stress-, and temperature-response genes. For example, several heat shock proteins were affected. We also found that a strong magnetic field, of 16.5 Tesla, had a significant effect on the expression of these genes, independent of the effects associated with magnetically-induced levitation and hypergravity. Diamagnetic levitation can be used to simulate an altered effective gravity environment in which gene expression is tuned differentially in diverse Drosophila melanogaster populations including those of different age and gender. Exposure to the magnetic field per se induced similar, but weaker, changes in gene expression.

  19. Microgravity simulation by diamagnetic levitation: effects of a strong gradient magnetic field on the transcriptional profile of Drosophila melanogaster

    PubMed Central

    2012-01-01

    Background Many biological systems respond to the presence or absence of gravity. Since experiments performed in space are expensive and can only be undertaken infrequently, Earth-based simulation techniques are used to investigate the biological response to weightlessness. A high gradient magnetic field can be used to levitate a biological organism so that its net weight is zero. Results We have used a superconducting magnet to assess the effect of diamagnetic levitation on the fruit fly D. melanogaster in levitation experiments that proceeded for up to 22 consecutive days. We have compared the results with those of similar experiments performed in another paradigm for microgravity simulation, the Random Positioning Machine (RPM). We observed a delay in the development of the fruit flies from embryo to adult. Microarray analysis indicated changes in overall gene expression of imagoes that developed from larvae under diamagnetic levitation, and also under simulated hypergravity conditions. Significant changes were observed in the expression of immune-, stress-, and temperature-response genes. For example, several heat shock proteins were affected. We also found that a strong magnetic field, of 16.5 Tesla, had a significant effect on the expression of these genes, independent of the effects associated with magnetically-induced levitation and hypergravity. Conclusions Diamagnetic levitation can be used to simulate an altered effective gravity environment in which gene expression is tuned differentially in diverse Drosophila melanogaster populations including those of different age and gender. Exposure to the magnetic field per se induced similar, but weaker, changes in gene expression. PMID:22296880

  20. Global analysis of gene expression dynamics within the marine microbial community during the VAHINE mesocosm experiment in the southwest Pacific

    NASA Astrophysics Data System (ADS)

    Pfreundt, Ulrike; Spungin, Dina; Bonnet, Sophie; Berman-Frank, Ilana; Hess, Wolfgang R.

    2016-07-01

    Microbial gene expression was followed for 23 days within a mesocosm (M1) isolating 50 m3 of seawater and in the surrounding waters in the Nouméa lagoon, New Caledonia, in the southwest Pacific as part of the VAriability of vertical and tropHIc transfer of diazotroph derived N in the south wEst Pacific (VAHINE) experiment. The aim of VAHINE was to examine the fate of diazotroph-derived nitrogen (DDN) in a low-nutrient, low-chlorophyll ecosystem. On day 4 of the experiment, the mesocosm was fertilized with phosphate. In the lagoon, gene expression was dominated by the cyanobacterium Synechococcus, closely followed by Alphaproteobacteria. In contrast, drastic changes in the microbial community composition and transcriptional activity were triggered within the mesocosm within the first 4 days, with transcription bursts from different heterotrophic bacteria in rapid succession. The microbial composition and activity of the surrounding lagoon ecosystem appeared more stable, although following similar temporal trends as in M1. We detected significant gene expression from Chromerida in M1, as well as the Nouméa lagoon, suggesting these photoautotrophic alveolates were present in substantial numbers in the open water. Other groups contributing substantially to the metatranscriptome were affiliated with marine Euryarchaeota Candidatus Thalassoarchaea (inside and outside) and Myoviridae bacteriophages likely infecting Synechococcus, specifically inside M1. High transcript abundances for ammonium transporters and glutamine synthetase in many different taxa (e.g., Pelagibacteraceae, Synechococcus, Prochlorococcus, and Rhodobacteraceae) was consistent with the known preference of most bacteria for this nitrogen source. In contrast, Alteromonadaceae highly expressed urease genes; Rhodobacteraceae and Prochlorococcus showed some urease expression, too. Nitrate reductase transcripts were detected on day 10 very prominently in Synechococcus and in Halomonadaceae. Alkaline phosphatase was expressed prominently only between days 12 and 23 in different organisms, suggesting that the microbial community was not limited by phosphate, even before the fertilization on day 4, whereas the post-fertilization community was. We observed high expression of the Synechococcus sqdB gene, only transiently lowered following phosphate fertilization. SqdB encodes UDP-sulfoquinovose synthase, possibly enabling marine picocyanobacteria to minimize their phosphorus requirements by substitution of phospholipids with sulphur-containing glycerolipids. This result suggests a link between sqdB expression and phosphate availability in situ. Gene expression of diazotrophic cyanobacteria was mainly attributed to Trichodesmium and Richelia intracellularis (diatom-diazotroph association) in the Nouméa lagoon and initially in M1. UCYN-A (Candidatus Atelocyanobacterium) transcripts were the third most abundant and declined both inside and outside after day 4, consistent with 16S- and nifH-based analyses. Transcripts related to the Epithemia turgida endosymbiont and Cyanothece ATCC 51142 increased during the second half of the experiment.

  1. Gene Expression Signatures Based on Variability can Robustly Predict Tumor Progression and Prognosis

    PubMed Central

    Dinalankara, Wikum; Bravo, Héctor Corrada

    2015-01-01

    Gene expression signatures are commonly used to create cancer prognosis and diagnosis methods, yet only a small number of them are successfully deployed in the clinic since many fail to replicate performance on subsequent validation. A primary reason for this lack of reproducibility is the fact that these signatures attempt to model the highly variable and unstable genomic behavior of cancer. Our group recently introduced gene expression anti-profiles as a robust methodology to derive gene expression signatures based on the observation that while gene expression measurements are highly heterogeneous across tumors of a specific cancer type relative to the normal tissue, their degree of deviation from normal tissue expression in specific genes involved in tissue differentiation is a stable tumor mark that is reproducible across experiments and cancer types. Here we show that constructing gene expression signatures based on variability and the anti-profile approach yields classifiers capable of successfully distinguishing benign growths from cancerous growths based on deviation from normal expression. We then show that this same approach generates stable and reproducible signatures that predict probability of relapse and survival based on tumor gene expression. These results suggest that using the anti-profile framework for the discovery of genomic signatures is an avenue leading to the development of reproducible signatures suitable for adoption in clinical settings. PMID:26078586

  2. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

  3. From wild wolf to domestic dog: gene expression changes in the brain.

    PubMed

    Saetre, Peter; Lindberg, Julia; Leonard, Jennifer A; Olsson, Kerstin; Pettersson, Ulf; Ellegren, Hans; Bergström, Tomas F; Vilà, Carles; Jazin, Elena

    2004-07-26

    Despite the relatively recent divergence time between domestic dogs (Canis familiaris) and gray wolves (Canis lupus), the two species show remarkable behavioral differences. Since dogs and wolves are nearly identical at the level of DNA sequence, we hypothesize that the two species may differ in patterns of gene expression. We compare gene expression patterns in dogs, wolves and a close relative, the coyote (Canis latrans), in three parts of the brain: hypothalamus, amygdala and frontal cortex, with microarray technology. Additionally, we identify genes with region-specific expression patterns in all three species. Among the wild canids, the hypothalamus has a highly conserved expression profile. This contrasts with a marked divergence in domestic dogs. Real-time PCR experiments confirm the altered expression of two neuropeptides, CALCB and NPY. Our results suggest that strong selection on dogs for behavior during domestication may have resulted in modifications of mRNA expression patterns in a few hypothalamic genes with multiple functions. This study indicates that rapid changes in brain gene expression may not be exclusive to the development of human brains. Instead, they may provide a common mechanism for rapid adaptive changes during speciation, particularly in cases that present strong selective pressures on behavioral characters.

  4. Global gene expression analysis of apple fruit development from the floral bud to ripe fruit

    PubMed Central

    Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

    2008-01-01

    Background Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45–55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Results Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Conclusion Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development. PMID:18279528

  5. Global gene expression analysis of apple fruit development from the floral bud to ripe fruit.

    PubMed

    Janssen, Bart J; Thodey, Kate; Schaffer, Robert J; Alba, Rob; Balakrishnan, Lena; Bishop, Rebecca; Bowen, Judith H; Crowhurst, Ross N; Gleave, Andrew P; Ledger, Susan; McArtney, Steve; Pichler, Franz B; Snowden, Kimberley C; Ward, Shayna

    2008-02-17

    Apple fruit develop over a period of 150 days from anthesis to fully ripe. An array representing approximately 13000 genes (15726 oligonucleotides of 45-55 bases) designed from apple ESTs has been used to study gene expression over eight time points during fruit development. This analysis of gene expression lays the groundwork for a molecular understanding of fruit growth and development in apple. Using ANOVA analysis of the microarray data, 1955 genes showed significant changes in expression over this time course. Expression of genes is coordinated with four major patterns of expression observed: high in floral buds; high during cell division; high when starch levels and cell expansion rates peak; and high during ripening. Functional analysis associated cell cycle genes with early fruit development and three core cell cycle genes are significantly up-regulated in the early stages of fruit development. Starch metabolic genes were associated with changes in starch levels during fruit development. Comparison with microarrays of ethylene-treated apple fruit identified a group of ethylene induced genes also induced in normal fruit ripening. Comparison with fruit development microarrays in tomato has been used to identify 16 genes for which expression patterns are similar in apple and tomato and these genes may play fundamental roles in fruit development. The early phase of cell division and tissue specification that occurs in the first 35 days after pollination has been associated with up-regulation of a cluster of genes that includes core cell cycle genes. Gene expression in apple fruit is coordinated with specific developmental stages. The array results are reproducible and comparisons with experiments in other species has been used to identify genes that may play a fundamental role in fruit development.

  6. Analysis of the Nicotiana tabacum Stigma/Style Transcriptome Reveals Gene Expression Differences between Wet and Dry Stigma Species1[W][OA

    PubMed Central

    Quiapim, Andréa C.; Brito, Michael S.; Bernardes, Luciano A.S.; daSilva, Idalete; Malavazi, Iran; DePaoli, Henrique C.; Molfetta-Machado, Jeanne B.; Giuliatti, Silvana; Goldman, Gustavo H.; Goldman, Maria Helena S.

    2009-01-01

    The success of plant reproduction depends on pollen-pistil interactions occurring at the stigma/style. These interactions vary depending on the stigma type: wet or dry. Tobacco (Nicotiana tabacum) represents a model of wet stigma, and its stigmas/styles express genes to accomplish the appropriate functions. For a large-scale study of gene expression during tobacco pistil development and preparation for pollination, we generated 11,216 high-quality expressed sequence tags (ESTs) from stigmas/styles and created the TOBEST database. These ESTs were assembled in 6,177 clusters, from which 52.1% are pistil transcripts/genes of unknown function. The 21 clusters with the highest number of ESTs (putative higher expression levels) correspond to genes associated with defense mechanisms or pollen-pistil interactions. The database analysis unraveled tobacco sequences homologous to the Arabidopsis (Arabidopsis thaliana) genes involved in specifying pistil identity or determining normal pistil morphology and function. Additionally, 782 independent clusters were examined by macroarray, revealing 46 stigma/style preferentially expressed genes. Real-time reverse transcription-polymerase chain reaction experiments validated the pistil-preferential expression for nine out of 10 genes tested. A search for these 46 genes in the Arabidopsis pistil data sets demonstrated that only 11 sequences, with putative equivalent molecular functions, are expressed in this dry stigma species. The reverse search for the Arabidopsis pistil genes in the TOBEST exposed a partial overlap between these dry and wet stigma transcriptomes. The TOBEST represents the most extensive survey of gene expression in the stigmas/styles of wet stigma plants, and our results indicate that wet and dry stigmas/styles express common as well as distinct genes in preparation for the pollination process. PMID:19052150

  7. Circular RNA and gene expression profiles in gastric cancer based on microarray chip technology.

    PubMed

    Sui, Weiguo; Shi, Zhoufang; Xue, Wen; Ou, Minglin; Zhu, Ying; Chen, Jiejing; Lin, Hua; Liu, Fuhua; Dai, Yong

    2017-03-01

    The aim of the present study was to screen gastric cancer (GC) tissue and adjacent tissue for differences in mRNA and circular (circRNA) expression, to analyze the differences in circRNA and mRNA expression, and to investigate the circRNA expression in gastric carcinoma and its mechanism. circRNA and mRNA differential expression profiles generated using Agilent microarray technology were analyzed in the GC tissues and adjacent tissues. qRT-PCR was used to verify the differential expression of circRNAs and mRNAs according to the interactions between circRNAs and miRNAs as well as the possible existence of miRNA and mRNA interactions. We found that: i) the circRNA expression profile revealed 1,285 significant differences in circRNA expression, with circRNA expression downregulated in 594 samples and upregulated in 691 samples via interactions with miRNAs. The qRT-PCR validation experiments showed that hsa_circRNA_400071, hsa_circRNA_000543 and hsa_circRNA_001959 expression was consistent with the microarray analysis results. ii) 29,112 genes were found in the GC tissues and adjacent tissues, including 5,460 differentially expressed genes. Among them, 2,390 differentially expressed genes were upregulated and 3,070 genes were downregulated. Gene Ontology (GO) analysis of the differentially expressed genes revealed these genes involved in biological process classification, cellular component classification and molecular function classification. Pathway analysis of the differentially expressed genes identified 83 significantly enriched genes, including 28 upregulated genes and 55 downregulated genes. iii) 69 differentially expressed circRNAs were found that might adsorb specific miRNAs to regulate the expression of their target gene mRNAs. The conclusions are: i) differentially expressed circRNAs had corresponding miRNA binding sites. These circRNAs regulated the expression of target genes through interactions with miRNAs and might become new molecular biomarkers for GC in the future. ii) Differentially expressed genes may be involved in the occurrence of GC via a variety of mechanisms. iii) CD44, CXXC5, MYH9, MALAT1 and other genes may have important implications for the occurrence and development of GC through the regulation, interaction, and mutual influence of circRNA-miRNA-mRNA via different mechanisms.

  8. MALDI-TOF mass spectrometry for quantitative gene expression analysis of acid responses in Staphylococcus aureus.

    PubMed

    Rode, Tone Mari; Berget, Ingunn; Langsrud, Solveig; Møretrø, Trond; Holck, Askild

    2009-07-01

    Microorganisms are constantly exposed to new and altered growth conditions, and respond by changing gene expression patterns. Several methods for studying gene expression exist. During the last decade, the analysis of microarrays has been one of the most common approaches applied for large scale gene expression studies. A relatively new method for gene expression analysis is MassARRAY, which combines real competitive-PCR and MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. In contrast to microarray methods, MassARRAY technology is suitable for analysing a larger number of samples, though for a smaller set of genes. In this study we compare the results from MassARRAY with microarrays on gene expression responses of Staphylococcus aureus exposed to acid stress at pH 4.5. RNA isolated from the same stress experiments was analysed using both the MassARRAY and the microarray methods. The MassARRAY and microarray methods showed good correlation. Both MassARRAY and microarray estimated somewhat lower fold changes compared with quantitative real-time PCR (qRT-PCR). The results confirmed the up-regulation of the urease genes in acidic environments, and also indicated the importance of metal ion regulation. This study shows that the MassARRAY technology is suitable for gene expression analysis in prokaryotes, and has advantages when a set of genes is being analysed for an organism exposed to many different environmental conditions.

  9. Evaluation and Validation of Housekeeping Genes as Reference for Gene Expression Studies in Pigeonpea (Cajanus cajan) Under Drought Stress Conditions

    PubMed Central

    Sinha, Pallavi; Singh, Vikas K.; Suryanarayana, V.; Krishnamurthy, L.; Saxena, Rachit K.; Varshney, Rajeev K.

    2015-01-01

    Gene expression analysis using quantitative real-time PCR (qRT-PCR) is a very sensitive technique and its sensitivity depends on the stable performance of reference gene(s) used in the study. A number of housekeeping genes have been used in various expression studies in many crops however, their expression were found to be inconsistent under different stress conditions. As a result, species specific housekeeping genes have been recommended for different expression studies in several crop species. However, such specific housekeeping genes have not been reported in the case of pigeonpea (Cajanus cajan) despite the fact that genome sequence has become available for the crop. To identify the stable housekeeping genes in pigeonpea for expression analysis under drought stress conditions, the relative expression variations of 10 commonly used housekeeping genes (EF1α, UBQ10, GAPDH, 18SrRNA, 25SrRNA, TUB6, ACT1, IF4α, UBC and HSP90) were studied on root, stem and leaves tissues of Asha (ICPL 87119). Three statistical algorithms geNorm, NormFinder and BestKeeper were used to define the stability of candidate genes. geNorm analysis identified IF4α and TUB6 as the most stable housekeeping genes however, NormFinder analysis determined IF4α and HSP90 as the most stable housekeeping genes under drought stress conditions. Subsequently validation of the identified candidate genes was undertaken in qRT-PCR based gene expression analysis of uspA gene which plays an important role for drought stress conditions in pigeonpea. The relative quantification of the uspA gene varied according to the internal controls (stable and least stable genes), thus highlighting the importance of the choice of as well as validation of internal controls in such experiments. The identified stable and validated housekeeping genes will facilitate gene expression studies in pigeonpea especially under drought stress conditions. PMID:25849964

  10. Evaluation and validation of housekeeping genes as reference for gene expression studies in pigeonpea (Cajanus cajan) under drought stress conditions.

    PubMed

    Sinha, Pallavi; Singh, Vikas K; Suryanarayana, V; Krishnamurthy, L; Saxena, Rachit K; Varshney, Rajeev K

    2015-01-01

    Gene expression analysis using quantitative real-time PCR (qRT-PCR) is a very sensitive technique and its sensitivity depends on the stable performance of reference gene(s) used in the study. A number of housekeeping genes have been used in various expression studies in many crops however, their expression were found to be inconsistent under different stress conditions. As a result, species specific housekeeping genes have been recommended for different expression studies in several crop species. However, such specific housekeeping genes have not been reported in the case of pigeonpea (Cajanus cajan) despite the fact that genome sequence has become available for the crop. To identify the stable housekeeping genes in pigeonpea for expression analysis under drought stress conditions, the relative expression variations of 10 commonly used housekeeping genes (EF1α, UBQ10, GAPDH, 18SrRNA, 25SrRNA, TUB6, ACT1, IF4α, UBC and HSP90) were studied on root, stem and leaves tissues of Asha (ICPL 87119). Three statistical algorithms geNorm, NormFinder and BestKeeper were used to define the stability of candidate genes. geNorm analysis identified IF4α and TUB6 as the most stable housekeeping genes however, NormFinder analysis determined IF4α and HSP90 as the most stable housekeeping genes under drought stress conditions. Subsequently validation of the identified candidate genes was undertaken in qRT-PCR based gene expression analysis of uspA gene which plays an important role for drought stress conditions in pigeonpea. The relative quantification of the uspA gene varied according to the internal controls (stable and least stable genes), thus highlighting the importance of the choice of as well as validation of internal controls in such experiments. The identified stable and validated housekeeping genes will facilitate gene expression studies in pigeonpea especially under drought stress conditions.

  11. Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

    PubMed

    Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

    1999-04-01

    The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

  12. Missing data and technical variability in single-cell RNA-sequencing experiments.

    PubMed

    Hicks, Stephanie C; Townes, F William; Teng, Mingxiang; Irizarry, Rafael A

    2017-11-06

    Until recently, high-throughput gene expression technology, such as RNA-Sequencing (RNA-seq) required hundreds of thousands of cells to produce reliable measurements. Recent technical advances permit genome-wide gene expression measurement at the single-cell level. Single-cell RNA-Seq (scRNA-seq) is the most widely used and numerous publications are based on data produced with this technology. However, RNA-seq and scRNA-seq data are markedly different. In particular, unlike RNA-seq, the majority of reported expression levels in scRNA-seq are zeros, which could be either biologically-driven, genes not expressing RNA at the time of measurement, or technically-driven, genes expressing RNA, but not at a sufficient level to be detected by sequencing technology. Another difference is that the proportion of genes reporting the expression level to be zero varies substantially across single cells compared to RNA-seq samples. However, it remains unclear to what extent this cell-to-cell variation is being driven by technical rather than biological variation. Furthermore, while systematic errors, including batch effects, have been widely reported as a major challenge in high-throughput technologies, these issues have received minimal attention in published studies based on scRNA-seq technology. Here, we use an assessment experiment to examine data from published studies and demonstrate that systematic errors can explain a substantial percentage of observed cell-to-cell expression variability. Specifically, we present evidence that some of these reported zeros are driven by technical variation by demonstrating that scRNA-seq produces more zeros than expected and that this bias is greater for lower expressed genes. In addition, this missing data problem is exacerbated by the fact that this technical variation varies cell-to-cell. Then, we show how this technical cell-to-cell variability can be confused with novel biological results. Finally, we demonstrate and discuss how batch-effects and confounded experiments can intensify the problem. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

    PubMed Central

    Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

    2013-01-01

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

  14. Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

    PubMed

    Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

    2013-01-04

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  15. Expression of stress/defense-related genes in barley grown under space environment

    NASA Astrophysics Data System (ADS)

    Sugimoto, Manabu; Shagimardanova, Elena; Gusev, Oleg; Bingham, Gail; Levinskikh, Margarita; Sychev, Vladimir

    Plants are exposed to the extreme environment in space, especially space radiation is suspected to induce oxidative stress by generating high-energy free radicals and microgravity would enhance the effect of space radiation, however, current understandings of plant growth and responses on this synergistic effect of radiation and microgravity is limited to a few experiments. In this study, expression of stress/defense-related genes in barley grown under space environment was analyzed by RT-PCR and DNA microarray experiments to understand plant responses and adaptation to space environment and to develop the space stress-tolerant plants. The seeds of barley, Hordeum vulgare L. cv. Haruna nijo, kept in the international space station (ISS) over 4 months, were germinated after 3 days of irrigation in LADA plant growth chamber onboard Russian segment of ISS and the final germination ratio was over 90 %. The height of plants was about 50 to 60 cm and flag leaf has been opened after 26 days of irrigation under 24 hr lighting, showing the similar growth to ground-grown barley. Expression levels of stress/defense-related genes in space-grown barley were compared to those in ground-grown barley by semi-quantitative RT-PCR. In 17 stress/defense-related genes that are up-regulated by oxidative stress or other abiotic stress, only catalase, pathogenesis-related protein 13, chalcone synthase, and phenylalanine ammonia-lyase genes were increased in space-grown barley. DNA microarrya analysis with the GeneChip Barley Genome Array showed the similar expression profiles of the stress/defense-related genes to those by RT-PCR experiment, suggesting that the barley germinated and grown in LADA onboard ISS is not damaged by space environment, especially oxidative stress induced by space radiation and microgravity.

  16. Experience-Dependent Epigenomic Reorganization in the Hippocampus

    ERIC Educational Resources Information Center

    Duke, Corey G.; Kennedy, Andrew J.; Gavin, Cristin F.; Day, Jeremy J.; Sweatt, J. David

    2017-01-01

    Using a hippocampus-dependent contextual threat learning and memory task, we report widespread, coordinated DNA methylation changes in CA1 hippocampus of Sprague-Dawley rats specific to threat learning at genes involved in synaptic transmission. Experience-dependent alternations in gene expression and DNA methylation were observed as early as 1 h…

  17. GeneMesh: a web-based microarray analysis tool for relating differentially expressed genes to MeSH terms.

    PubMed

    Jani, Saurin D; Argraves, Gary L; Barth, Jeremy L; Argraves, W Scott

    2010-04-01

    An important objective of DNA microarray-based gene expression experimentation is determining inter-relationships that exist between differentially expressed genes and biological processes, molecular functions, cellular components, signaling pathways, physiologic processes and diseases. Here we describe GeneMesh, a web-based program that facilitates analysis of DNA microarray gene expression data. GeneMesh relates genes in a query set to categories available in the Medical Subject Headings (MeSH) hierarchical index. The interface enables hypothesis driven relational analysis to a specific MeSH subcategory (e.g., Cardiovascular System, Genetic Processes, Immune System Diseases etc.) or unbiased relational analysis to broader MeSH categories (e.g., Anatomy, Biological Sciences, Disease etc.). Genes found associated with a given MeSH category are dynamically linked to facilitate tabular and graphical depiction of Entrez Gene information, Gene Ontology information, KEGG metabolic pathway diagrams and intermolecular interaction information. Expression intensity values of groups of genes that cluster in relation to a given MeSH category, gene ontology or pathway can be displayed as heat maps of Z score-normalized values. GeneMesh operates on gene expression data derived from a number of commercial microarray platforms including Affymetrix, Agilent and Illumina. GeneMesh is a versatile web-based tool for testing and developing new hypotheses through relating genes in a query set (e.g., differentially expressed genes from a DNA microarray experiment) to descriptors making up the hierarchical structure of the National Library of Medicine controlled vocabulary thesaurus, MeSH. The system further enhances the discovery process by providing links between sets of genes associated with a given MeSH category to a rich set of html linked tabular and graphic information including Entrez Gene summaries, gene ontologies, intermolecular interactions, overlays of genes onto KEGG pathway diagrams and heatmaps of expression intensity values. GeneMesh is freely available online at http://proteogenomics.musc.edu/genemesh/.

  18. DigOut: viewing differential expression genes as outliers.

    PubMed

    Yu, Hui; Tu, Kang; Xie, Lu; Li, Yuan-Yuan

    2010-12-01

    With regards to well-replicated two-conditional microarray datasets, the selection of differentially expressed (DE) genes is a well-studied computational topic, but for multi-conditional microarray datasets with limited or no replication, the same task is not properly addressed by previous studies. This paper adopts multivariate outlier analysis to analyze replication-lacking multi-conditional microarray datasets, finding that it performs significantly better than the widely used limit fold change (LFC) model in a simulated comparative experiment. Compared with the LFC model, the multivariate outlier analysis also demonstrates improved stability against sample variations in a series of manipulated real expression datasets. The reanalysis of a real non-replicated multi-conditional expression dataset series leads to satisfactory results. In conclusion, a multivariate outlier analysis algorithm, like DigOut, is particularly useful for selecting DE genes from non-replicated multi-conditional gene expression dataset.

  19. A Novel Terminator Primer and Enhancer Reagents for Direct Expression of PCR-Amplified Genes in Mammalian Cells.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Yarimizu, Tohru; Iwakiri, Ryo; Hoshida, Hisashi; Akada, Rinji

    2015-08-01

    Escherichia coli plasmids are commonly used for gene expression experiments in mammalian cells, while PCR-amplified DNAs are rarely used even though PCR is a much faster and easier method to construct recombinant DNAs. One difficulty may be the limited amount of DNA produced by PCR. For direct utilization of PCR-amplified DNA in transfection experiments, efficient transfection with a smaller amount of DNA should be attained. For this purpose, we investigated two enhancer reagents, polyethylene glycol and tRNA, for a chemical transfection method. The addition of the enhancers to a commercial transfection reagent individually and synergistically exhibited higher transfection efficiency applicable for several mammalian cell culture lines in a 96-well plate. By taking advantage of a simple transfection procedure using PCR-amplified DNA, SV40 and rabbit β-globin terminator lengths were minimized. The terminator length is short enough to design in oligonucleotides; thus, terminator primers can be used for the construction and analysis of numerous mutations, deletions, insertions, and tag-fusions at the 3'-terminus of any gene. The PCR-mediated gene manipulation with the terminator primers will transform gene expression by allowing for extremely simple and high-throughput experiments with small-scale, multi-well, and mammalian cell cultures.

  20. Effects of Larval Density on Gene Regulation in Caenorhabditis elegans During Routine L1 Synchronization.

    PubMed

    Chan, Io Long; Rando, Oliver J; Conine, Colin C

    2018-05-04

    Bleaching gravid C. elegans followed by a short period of starvation of the L1 larvae is a routine method performed by worm researchers for generating synchronous populations for experiments. During the process of investigating dietary effects on gene regulation in L1 stage worms by single-worm RNA-Seq, we found that the density of resuspended L1 larvae affects expression of many mRNAs. Specifically, a number of genes related to metabolism and signaling are highly expressed in worms arrested at low density, but are repressed at higher arrest densities. We generated a GFP reporter strain based on one of the most density-dependent genes in our dataset - lips-15 - and confirmed that this reporter was expressed specifically in worms arrested at relatively low density. Finally, we show that conditioned media from high density L1 cultures was able to downregulate lips-15 even in L1 animals arrested at low density, and experiments using daf-22 mutant animals demonstrated that this effect is not mediated by the ascaroside family of signaling pheromones. Together, our data implicate a soluble signaling molecule in density sensing by L1 stage C. elegans , and provide guidance for design of experiments focused on early developmental gene regulation. Copyright © 2018 Chan et al.

  1. STARNET 2: a web-based tool for accelerating discovery of gene regulatory networks using microarray co-expression data

    PubMed Central

    Jupiter, Daniel; Chen, Hailin; VanBuren, Vincent

    2009-01-01

    Background Although expression microarrays have become a standard tool used by biologists, analysis of data produced by microarray experiments may still present challenges. Comparison of data from different platforms, organisms, and labs may involve complicated data processing, and inferring relationships between genes remains difficult. Results STARNET 2 is a new web-based tool that allows post hoc visual analysis of correlations that are derived from expression microarray data. STARNET 2 facilitates user discovery of putative gene regulatory networks in a variety of species (human, rat, mouse, chicken, zebrafish, Drosophila, C. elegans, S. cerevisiae, Arabidopsis and rice) by graphing networks of genes that are closely co-expressed across a large heterogeneous set of preselected microarray experiments. For each of the represented organisms, raw microarray data were retrieved from NCBI's Gene Expression Omnibus for a selected Affymetrix platform. All pairwise Pearson correlation coefficients were computed for expression profiles measured on each platform, respectively. These precompiled results were stored in a MySQL database, and supplemented by additional data retrieved from NCBI. A web-based tool allows user-specified queries of the database, centered at a gene of interest. The result of a query includes graphs of correlation networks, graphs of known interactions involving genes and gene products that are present in the correlation networks, and initial statistical analyses. Two analyses may be performed in parallel to compare networks, which is facilitated by the new HEATSEEKER module. Conclusion STARNET 2 is a useful tool for developing new hypotheses about regulatory relationships between genes and gene products, and has coverage for 10 species. Interpretation of the correlation networks is supported with a database of previously documented interactions, a test for enrichment of Gene Ontology terms, and heat maps of correlation distances that may be used to compare two networks. The list of genes in a STARNET network may be useful in developing a list of candidate genes to use for the inference of causal networks. The tool is freely available at , and does not require user registration. PMID:19828039

  2. Shear stress influences the pluripotency of murine embryonic stem cells in stirred suspension bioreactors.

    PubMed

    Gareau, Tia; Lara, Giovanna G; Shepherd, Robert D; Krawetz, Roman; Rancourt, Derrick E; Rinker, Kristina D; Kallos, Michael S

    2014-04-01

    Pluripotent embryonic stem cells (ESCs) have been used increasingly in research as primary material for various tissue-engineering applications. Pluripotency, or the ability to give rise to all cells of the body, is an important characteristic of ESCs. Traditional methods use leukaemia inhibitory factor (LIF) to maintain murine embryonic stem cell (mESC) pluripotency in static and bioreactor cultures. When LIF is removed from mESCs in static cultures, pluripotency genes are downregulated and the cultures will spontaneously differentiate. Recently we have shown the maintenance of pluripotency gene expression of mESCs in stirred suspension bioreactors during differentiation experiments in the absence of LIF. This is undesired in a differentiation experiment, where the goal is downregulation of pluripotency gene expression and upregulation of gene expression characteristic to the differentiation. Thus, the objective of this study was to examine how effectively different levels of shear stress [100 rpm (6 dyne/cm(2) ), 60 rpm (3 dyne/cm(2) )] maintained and influenced pluripotency in suspension bioreactors. The pluripotency markers Oct-4, Nanog, Sox-2 and Rex-1 were assessed using gene expression profiles and flow-cytometry analysis and showed that shear stress does maintain and influence the gene expression of certain pluripotency markers. Some significant differences between the two levels of shear stress were seen and the combination of shear stress and LIF was observed to synergistically increase the expression of certain pluripotency markers. Overall, this study provides a better understanding of the environmental conditions within suspension bioreactors and how these conditions affect the pluripotency of mESCs. Copyright © 2012 John Wiley & Sons, Ltd.

  3. Cold Induction of Arabidopsis CBF Genes Involves Multiple ICE (Inducer of CBF Expression) Promoter Elements and a Cold-Regulatory Circuit That Is Desensitized by Low Temperature1

    PubMed Central

    Zarka, Daniel G.; Vogel, Jonathan T.; Cook, Daniel; Thomashow, Michael F.

    2003-01-01

    The Arabidopsis CBF1, 2, and 3 genes (also known as DREB1b, c, and a, respectively) encode transcriptional activators that have a central role in cold tolerance. CBF1-3 are rapidly induced upon exposing plants to low temperature, followed by expression of CBF-targeted genes, the CBF regulon, resulting in an increase in plant freezing tolerance. At present, little is known about the cold-sensing mechanism that controls CBF expression. Results presented here indicate that this mechanism does not require a cold shock to bring about the accumulation of CBF transcripts, but instead, absolute temperature is monitored with a greater degree of input, i.e. lower temperature, resulting in a greater output, i.e. higher levels of CBF transcripts. Temperature-shift experiments also indicate that the cold-sensing mechanism becomes desensitized to a given low temperature, such as 4°C, and that resensitization to that temperature requires between 8 and 24 h at warm temperature. Gene fusion experiments identified a 125-bp section of the CBF2 promoter that is sufficient to impart cold-responsive gene expression. Mutational analysis of this cold-responsive region identified two promoter segments that work in concert to impart robust cold-regulated gene expression. These sequences, designated ICEr1 and ICEr2 (induction of CBF expression region 1 or 2), were also shown to stimulate transcription in response to mechanical agitation and the protein synthesis inhibitor, cycloheximide. PMID:14500791

  4. Microgravity and immunity: Changes in lymphocyte gene expression.

    NASA Astrophysics Data System (ADS)

    Risin, D.; Ward, N. E.; Risin, S. A.; Pellis, N. R.

    Earlier studies had shown that modeled and true microgravity MG cause multiple direct effects on human lymphocytes MG inhibits lymphocyte locomotion suppresses polyclonal and antigen-specific activation affects signal transduction mechanisms as well as activation-induced apoptosis In this study we assessed changes in gene expression associated with lymphocyte exposure to microgravity in an attempt to identify microgravity-sensitive genes MGSG in general and specifically those genes that might be responsible for the functional and structural changes observed earlier Two sets of experiments targeting different goals were conducted In the first set T-lymphocytes from normal donors were activated with anti-CD3 and IL2 and then cultured in 1g static and modeled MG MMG conditions Rotating Wall Vessel bioreactor for 24 hours This setting allowed searching for MGSG by comparison of gene expression patterns in zero and 1 g gravity In the second set - activated T-cells after culturing for 24 hours in 1g and MMG were exposed three hours before harvesting to a secondary activation stimulus PHA thus triggering the apoptotic pathway Total RNA was extracted using the RNeasy isolation kit Qiagen Valencia CA Affymetrix Gene Chips U133A allowing testing for 18 400 human genes were used for microarray analysis The experiments were performed in triplicates with T-cells obtained from different blood donors to minimize the possible input of biological variation in gene expression and discriminate changes that are associated with the

  5. Differential gene expression during thermal stress and bleaching in the Caribbean coral Montastraea faveolata.

    PubMed

    DeSalvo, M K; Voolstra, C R; Sunagawa, S; Schwarz, J A; Stillman, J H; Coffroth, M A; Szmant, A M; Medina, M

    2008-09-01

    The declining health of coral reefs worldwide is likely to intensify in response to continued anthropogenic disturbance from coastal development, pollution, and climate change. In response to these stresses, reef-building corals may exhibit bleaching, which marks the breakdown in symbiosis between coral and zooxanthellae. Mass coral bleaching due to elevated water temperature can devastate coral reefs on a large geographical scale. In order to understand the molecular and cellular basis of bleaching in corals, we have measured gene expression changes associated with thermal stress and bleaching using a complementary DNA microarray containing 1310 genes of the Caribbean coral Montastraea faveolata. In a first experiment, we identified differentially expressed genes by comparing experimentally bleached M. faveolata fragments to control non-heat-stressed fragments. In a second experiment, we identified differentially expressed genes during a time course experiment with four time points across 9 days. Results suggest that thermal stress and bleaching in M. faveolata affect the following processes: oxidative stress, Ca(2+) homeostasis, cytoskeletal organization, cell death, calcification, metabolism, protein synthesis, heat shock protein activity, and transposon activity. These results represent the first medium-scale transcriptomic study focused on revealing the cellular foundation of thermal stress-induced coral bleaching. We postulate that oxidative stress in thermal-stressed corals causes a disruption of Ca(2+) homeostasis, which in turn leads to cytoskeletal and cell adhesion changes, decreased calcification, and the initiation of cell death via apoptosis and necrosis.

  6. SPARTA: Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis.

    PubMed

    Johnson, Benjamin K; Scholz, Matthew B; Teal, Tracy K; Abramovitch, Robert B

    2016-02-04

    Many tools exist in the analysis of bacterial RNA sequencing (RNA-seq) transcriptional profiling experiments to identify differentially expressed genes between experimental conditions. Generally, the workflow includes quality control of reads, mapping to a reference, counting transcript abundance, and statistical tests for differentially expressed genes. In spite of the numerous tools developed for each component of an RNA-seq analysis workflow, easy-to-use bacterially oriented workflow applications to combine multiple tools and automate the process are lacking. With many tools to choose from for each step, the task of identifying a specific tool, adapting the input/output options to the specific use-case, and integrating the tools into a coherent analysis pipeline is not a trivial endeavor, particularly for microbiologists with limited bioinformatics experience. To make bacterial RNA-seq data analysis more accessible, we developed a Simple Program for Automated reference-based bacterial RNA-seq Transcriptome Analysis (SPARTA). SPARTA is a reference-based bacterial RNA-seq analysis workflow application for single-end Illumina reads. SPARTA is turnkey software that simplifies the process of analyzing RNA-seq data sets, making bacterial RNA-seq analysis a routine process that can be undertaken on a personal computer or in the classroom. The easy-to-install, complete workflow processes whole transcriptome shotgun sequencing data files by trimming reads and removing adapters, mapping reads to a reference, counting gene features, calculating differential gene expression, and, importantly, checking for potential batch effects within the data set. SPARTA outputs quality analysis reports, gene feature counts and differential gene expression tables and scatterplots. SPARTA provides an easy-to-use bacterial RNA-seq transcriptional profiling workflow to identify differentially expressed genes between experimental conditions. This software will enable microbiologists with limited bioinformatics experience to analyze their data and integrate next generation sequencing (NGS) technologies into the classroom. The SPARTA software and tutorial are available at sparta.readthedocs.org.

  7. Sequential and combinatorial roles of maf family genes define proper lens development.

    PubMed

    Reza, Hasan Mahmud; Urano, Atsuyo; Shimada, Naoko; Yasuda, Kunio

    2007-01-16

    Maf proteins have been shown to play pivotal roles in lens development in vertebrates. The developing chick lens expresses at least three large Maf proteins. However, the transcriptional relationship among the three large maf genes and their various roles in transactivating the downstream genes largely remain to be elucidated. Chick embryos were electroporated with wild-type L-maf, c-maf, and mafB by in ovo electroporation, and their effects on gene expression were determined by in situ hybridization using specific probes or by immunostaining. Endogenous gene expression was determined using nonelectroporated samples. A regulation mechanism exists among the members of maf family gene. An early-expressed member of this gene family typically stimulates the expression of later-expressed members. We also examined the regulation of various lens-expressing genes with a focus on the interaction between different Maf proteins. We found that the transcriptional ability of Maf proteins varies, even when the target is the same, in parallel with their discrete functions. L-Maf and c-Maf have no effect on E-cadherin expression, whereas MafB enhances its expression and thereby impedes lens vesicle formation. This study also revealed that Maf proteins can regulate the expression of gap junction genes, connexins, and their interacting partner, major intrinsic protein (MIP), during lens development. Misexpression of L-Maf and c-Maf induces ectopic expression of Cx43 and MIP; in contrast, MafB appears to have no effect on Cx43, but induces MIP significantly as evidenced from our gain-of-function experiments. Our results indicate that large Maf function is indispensable for chick lens initiation and development. In addition, L-Maf positively regulates most of the essential genes in this program and directs a series of molecular events leading to proper formation of the lens.

  8. The Tomato Transcription Factor Pti4 Regulates Defense-Related Gene Expression via GCC Box and Non-GCC Box cis ElementsW⃞

    PubMed Central

    Chakravarthy, Suma; Tuori, Robert P.; D'Ascenzo, Mark D.; Fobert, Pierre R.; Després, Charles; Martin, Gregory B.

    2003-01-01

    The tomato transcription factor Pti4, an ethylene-responsive factor (ERF), interacts physically with the disease resistance protein Pto and binds the GCC box cis element that is present in the promoters of many pathogenesis-related (PR) genes. We reported previously that Arabidopsis plants expressing Pti4 constitutively express several GCC box–containing PR genes and show reduced disease symptoms compared with wild-type plants after inoculation with Pseudomonas syringae pv tomato or Erysiphe orontii. To gain insight into how genome-wide gene expression is affected by Pti4, we used serial analysis of gene expression (SAGE) to compare transcripts in wild-type and Pti4-expressing Arabidopsis plants. SAGE provided quantitative measurements of >20,000 transcripts and identified the 50 most highly expressed genes in Arabidopsis vegetative tissues. Comparison of the profiles from wild-type and Pti4-expressing Arabidopsis plants revealed 78 differentially abundant transcripts encoding defense-related proteins, protein kinases, ribosomal proteins, transporters, and two transcription factors (TFs). Many of the genes identified were expressed differentially in wild-type Arabidopsis during infection by Pseudomonas syringae pv tomato, supporting a role for them in defense-related processes. Unexpectedly, the promoters of most Pti4-regulated genes did not have a GCC box. Chromatin immunoprecipitation experiments confirmed that Pti4 binds in vivo to promoters lacking this cis element. Potential binding sites for ERF, MYB, and GBF TFs were present in statistically significantly increased numbers in promoters regulated by Pti4. Thus, Pti4 appears to regulate gene expression directly by binding the GCC box and possibly a non-GCC box element and indirectly by either activating the expression of TF genes or interacting physically with other TFs. PMID:14630974

  9. Fruit load modulates flowering-related gene expression in buds of alternate-bearing ‘Moncada’ mandarin

    PubMed Central

    Muñoz-Fambuena, Natalia; Mesejo, Carlos; González-Mas, M. Carmen; Primo-Millo, Eduardo; Agustí, Manuel; Iglesias, Domingo J.

    2012-01-01

    Background and Aims Gene determination of flowering is the result of complex interactions involving both promoters and inhibitors. In this study, the expression of flowering-related genes at the meristem level in alternate-bearing citrus trees is analysed, together with the interplay between buds and leaves in the determination of flowering. Methods First defruiting experiments were performed to manipulate blossoming intensity in ‘Moncada’ mandarin, Citrus clementina. Further defoliation was performed to elucidate the role leaves play in the flowering process. In both cases, the activity of flowering-related genes was investigated at the flower induction (November) and differentiation (February) stages. Key Results Study of the expression pattern of flowering-genes in buds from on (fully loaded) and off (without fruits) trees revealed that homologues of FLOWERING LOCUS T (CiFT), TWIN SISTER OF FT (TSF), APETALA1 (CsAP1) and LEAFY (CsLFY) were negatively affected by fruit load. CiFT and TSF activities showed a marked increase in buds from off trees through the study period (ten-fold in November). By contrast, expression of the homologues of the flowering inhibitors of TERMINAL FLOWER 1 (CsTFL), TERMINAL FLOWER 2 (TFL2) and FLOWERING LOCUS C (FLC) was generally lower in off trees. Regarding floral identity genes, the increase in CsAP1 expression in off trees was much greater in buds than in leaves, and significant variations in CsLFY expression (approx. 20 %) were found only in February. Defoliation experiments further revealed that the absence of leaves completely abolished blossoming and severely affected the expression of most of the flowering-related genes, particularly decreasing the activity of floral promoters and of CsAP1 at the induction stage. Conclusions These results suggest that the presence of fruit affects flowering by greatly altering gene-expression not only at the leaf but also at the meristem level. Although leaves are required for flowering to occur, their absence strongly affects the activity of floral promoters and identity genes. PMID:22915579

  10. Transcriptome Profiling of Lotus japonicus Roots During Arbuscular Mycorrhiza Development and Comparison with that of Nodulation

    PubMed Central

    Deguchi, Yuichi; Banba, Mari; Shimoda, Yoshikazu; Chechetka, Svetlana A.; Suzuri, Ryota; Okusako, Yasuhiro; Ooki, Yasuhiro; Toyokura, Koichi; Suzuki, Akihiro; Uchiumi, Toshiki; Higashi, Shiro; Abe, Mikiko; Kouchi, Hiroshi; Izui, Katsura; Hata, Shingo

    2007-01-01

    Abstract To better understand the molecular responses of plants to arbuscular mycorrhizal (AM) fungi, we analyzed the differential gene expression patterns of Lotus japonicus, a model legume, with the aid of a large-scale cDNA macroarray. Experiments were carried out considering the effects of contaminating microorganisms in the soil inoculants. When the colonization by AM fungi, i.e. Glomus mosseae and Gigaspora margarita, was well established, four cysteine protease genes were induced. In situ hybridization revealed that these cysteine protease genes were specifically expressed in arbuscule-containing inner cortical cells of AM roots. On the other hand, phenylpropanoid biosynthesis-related genes for phenylalanine ammonia-lyase (PAL), chalcone synthase, etc. were repressed in the later stage, although they were moderately up-regulated on the initial association with the AM fungus. Real-time RT–PCR experiments supported the array experiments. To further confirm the characteristic expression, a PAL promoter was fused with a reporter gene and introduced into L. japonicus, and then the transformants were grown with a commercial inoculum of G. mosseae. The reporter activity was augmented throughout the roots due to the presence of contaminating microorganisms in the inoculum. Interestingly, G. mosseae only colonized where the reporter activity was low. Comparison of the transcriptome profiles of AM roots and nitrogen-fixing root nodules formed with Mesorhizobium loti indicated that the PAL genes and other phenylpropanoid biosynthesis-related genes were similarly repressed in the two organs. PMID:17634281

  11. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    PubMed

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  12. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    PubMed Central

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  13. Tissue-specific expression of the gene coding for human Clara cell 10-kD protein, a phospholipase A2-inhibitory protein.

    PubMed Central

    Peri, A; Cordella-Miele, E; Miele, L; Mukherjee, A B

    1993-01-01

    Clara cell 10-kD protein (cc10kD), a secretory phospholipase A2 inhibitor, is suggested to be the human counterpart of rabbit uteroglobin (UG). Because cc10kD is expressed constitutively at a very high level in the human respiratory epithelium, the 5' region of its gene may be useful in achieving organ-specific expression of recombinant DNA in gene therapy of diseases such as cystic fibrosis. However, it is important to establish the tissue-specific expression of this gene before designing gene transfer experiments. Since the UG gene in the rabbit is expressed in many other organs besides the lung and the endometrium, we investigated the organ and tissue specificity of human cc10kD gene expression using polymerase chain reaction, nucleotide sequence analysis, immunofluorescence, and Northern blotting. Our results indicate that, in addition to the lung, cc10kD is expressed in several nonrespiratory organs, with a distribution pattern very similar, if not identical, to that of UG in the rabbit. These results underscore the necessity for more detailed analyses of the 5' region of the human cc10kD gene before its usefulness in gene therapy could be fully assessed. These data also suggest that cc10kD and UG may have similar physiological function(s). Images PMID:8227325

  14. Prediction of gene expression in embryonic structures of Drosophila melanogaster.

    PubMed

    Samsonova, Anastasia A; Niranjan, Mahesan; Russell, Steven; Brazma, Alvis

    2007-07-01

    Understanding how sets of genes are coordinately regulated in space and time to generate the diversity of cell types that characterise complex metazoans is a major challenge in modern biology. The use of high-throughput approaches, such as large-scale in situ hybridisation and genome-wide expression profiling via DNA microarrays, is beginning to provide insights into the complexities of development. However, in many organisms the collection and annotation of comprehensive in situ localisation data is a difficult and time-consuming task. Here, we present a widely applicable computational approach, integrating developmental time-course microarray data with annotated in situ hybridisation studies, that facilitates the de novo prediction of tissue-specific expression for genes that have no in vivo gene expression localisation data available. Using a classification approach, trained with data from microarray and in situ hybridisation studies of gene expression during Drosophila embryonic development, we made a set of predictions on the tissue-specific expression of Drosophila genes that have not been systematically characterised by in situ hybridisation experiments. The reliability of our predictions is confirmed by literature-derived annotations in FlyBase, by overrepresentation of Gene Ontology biological process annotations, and, in a selected set, by detailed gene-specific studies from the literature. Our novel organism-independent method will be of considerable utility in enriching the annotation of gene function and expression in complex multicellular organisms.

  15. Prediction of Gene Expression in Embryonic Structures of Drosophila melanogaster

    PubMed Central

    Samsonova, Anastasia A; Niranjan, Mahesan; Russell, Steven; Brazma, Alvis

    2007-01-01

    Understanding how sets of genes are coordinately regulated in space and time to generate the diversity of cell types that characterise complex metazoans is a major challenge in modern biology. The use of high-throughput approaches, such as large-scale in situ hybridisation and genome-wide expression profiling via DNA microarrays, is beginning to provide insights into the complexities of development. However, in many organisms the collection and annotation of comprehensive in situ localisation data is a difficult and time-consuming task. Here, we present a widely applicable computational approach, integrating developmental time-course microarray data with annotated in situ hybridisation studies, that facilitates the de novo prediction of tissue-specific expression for genes that have no in vivo gene expression localisation data available. Using a classification approach, trained with data from microarray and in situ hybridisation studies of gene expression during Drosophila embryonic development, we made a set of predictions on the tissue-specific expression of Drosophila genes that have not been systematically characterised by in situ hybridisation experiments. The reliability of our predictions is confirmed by literature-derived annotations in FlyBase, by overrepresentation of Gene Ontology biological process annotations, and, in a selected set, by detailed gene-specific studies from the literature. Our novel organism-independent method will be of considerable utility in enriching the annotation of gene function and expression in complex multicellular organisms. PMID:17658945

  16. [Effect of EMP-1 gene on human esophageal cancer cell line].

    PubMed

    Wang, Hai-tao; Liu, Zhi-hua; Wang, Xiu-qin; Wu, Min

    2002-03-01

    EMP-1 was selected from a series of differential expressed genes obtained from cDNA microarray in the authors' lab. Epithelial membrane pnteiu-1 gene (EMP-1) was expressed 6 fold lower in esophageal cancer than in normal tissue. The authors further designed the experiment to study the effect of human EMP-1 gene on human esophageal cancer cell line in order to explain the function of this gene on the carcinogensis and progression esophageal cancer. EMP-1 gene was cloned into eukaryotic vector and transfected into the human esophageal cancer cell line. The transfection effect was qualified by Western blot and RT-PCR method. The cell growth curve was observed and the cell cycle was checked by FACS method. EMP-1 was transfected into EC9706 cell line and its expression was up-regulated. The cell growth is accelerated and expression of EMP-1 is linked to induction of S phase arrest. EMP-1 gene has some relationship with carcinogenesis of esophagus.

  17. Distinguishing the rates of gene activation from phenotypic variations.

    PubMed

    Chen, Ye; Lv, Cheng; Li, Fangting; Li, Tiejun

    2015-06-18

    Stochastic genetic switching driven by intrinsic noise is an important process in gene expression. When the rates of gene activation/inactivation are relatively slow, fast, or medium compared with the synthesis/degradation rates of mRNAs and proteins, the variability of protein and mRNA levels may exhibit very different dynamical patterns. It is desirable to provide a systematic approach to identify their key dynamical features in different regimes, aiming at distinguishing which regime a considered gene regulatory network is in from their phenotypic variations. We studied a gene expression model with positive feedbacks when genetic switching rates vary over a wide range. With the goal of providing a method to distinguish the regime of the switching rates, we first focus on understanding the essential dynamics of gene expression system in different cases. In the regime of slow switching rates, we found that the effective dynamics can be reduced to independent evolutions on two separate layers corresponding to gene activation and inactivation states, and the transitions between two layers are rare events, after which the system goes mainly along deterministic ODE trajectories on a particular layer to reach new steady states. The energy landscape in this regime can be well approximated by using Gaussian mixture model. In the regime of intermediate switching rates, we analyzed the mean switching time to investigate the stability of the system in different parameter ranges. We also discussed the case of fast switching rates from the viewpoint of transition state theory. Based on the obtained results, we made a proposal to distinguish these three regimes in a simulation experiment. We identified the intermediate regime from the fact that the strength of cellular memory is lower than the other two cases, and the fast and slow regimes can be distinguished by their different perturbation-response behavior with respect to the switching rates perturbations. We proposed a simulation experiment to distinguish the slow, intermediate and fast regimes, which is the main point of our paper. In order to achieve this goal, we systematically studied the essential dynamics of gene expression system when the switching rates are in different regimes. Our theoretical understanding provides new insights on the gene expression experiments.

  18. Questioning the utility of pooling samples in microarray experiments with cell lines.

    PubMed

    Lusa, L; Cappelletti, V; Gariboldi, M; Ferrario, C; De Cecco, L; Reid, J F; Toffanin, S; Gallus, G; McShane, L M; Daidone, M G; Pierotti, M A

    2006-01-01

    We describe a microarray experiment using the MCF-7 breast cancer cell line in two different experimental conditions for which the same number of independent pools as the number of individual samples was hybridized on Affymetrix GeneChips. Unexpectedly, when using individual samples, the number of probe sets found to be differentially expressed between treated and untreated cells was about three times greater than that found using pools. These findings indicate that pooling samples in microarray experiments where the biological variability is expected to be small might not be helpful and could even decrease one's ability to identify differentially expressed genes.

  19. Biological effects of RNAi targeted inhibiting Tiam1 gene expression on cholangiocarcinoma cells.

    PubMed

    Cheng, Wei; Liu, Yaling; Zuo, Zhi; Yin, Xinmin; Jiang, Bo; Chen, Daojin; Peng, Chuang; Yang, Jianhui

    2015-01-01

    To investigate the characteristics of Tiam1 gene expression in human cholangiocarcinoma tissues and benign bile duct tissues, and to analyze the correlations between Tiam1 gene expression and the degree of tumor differentiation, invasive and metastatic abilities. To explore the effect of targeted inhibiting Tiam1 gene expression on proliferation and migration activity of human cholangiocarcinoma cells. Expression of Tiam1 in 83 cases of cholangiocarcinoma tissues and 25 cases of benign bile tissues was detected using immunohistochemistry. The clinical data of patients with cholangiocarcinoma were collected. The correlations between Tiam1 gene expression and the clinicopathologic features in patients with cholangiocarcinoma were analyzed. The human cholangiocarcinoma RBE cells were divided into 3 groups. Cells in experimental group and control group were respectively transfected with Tiam1 shRNA lentiviral vectors and negative shRNA lentiviral control vectors. Cells in blank group received no treatment. Real-time PCR endogenesis was used to verify Tiam1 gene expression. Cell cycle experiments and MTT assay were used to measure cell proliferation activity. Transwell test was used to detect cell migration activity. The negative rate Tiam1 protein expression in cholangiocarcinoma tissues was significantly higher than that in benign bile tissues (P<0.001). Tiam1 protein expression in cholangiocarcinoma tissues had correlations with cholangiocarcinoma differentiation degree, TNM stage and lymph node metastasis (P<0.05), and had no significant correlations with gender, age and distant metastasis (P>0.05). Real-time PCR detection indicated that Tiam1 expression of experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that Tiam1 shRNA was effective on Tiam1 gene silencing in RBE cells. Cell cycle experiment showed that the percentage of S phase in cell cycle in experimental group was lower than that in control group and blank group (P<0.05), demonstrating that after the down-regulation of Tiam1 gene expression, the speed of cell proliferation was inhibited. MTT assay results showed that the total growth speed in experimental group was significantly lower than that in control group and blank group (P<0.05), indicating that the proliferation activity of cholangiocarcinoma cells was inhibited after targeted inhibition of Tiam1 gene expression. Transwell detection results showed that the metastasis rate in experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that targeted inhibition of Tiam1 gene expression could significantly inhibit migration ability of RBE cells. Tiam1 expression significantly increased in cholangiocarcinoma tissues, and increased along with the degree of malignancy of cholangiocarcinoma. Targeted silencing Tiam1 expression could inhibit proliferation and migration activity of cholangiocarcinoma cells.

  20. Biological effects of RNAi targeted inhibiting Tiam1 gene expression on cholangiocarcinoma cells

    PubMed Central

    Cheng, Wei; Liu, Yaling; Zuo, Zhi; Yin, Xinmin; Jiang, Bo; Chen, Daojin; Peng, Chuang; Yang, Jianhui

    2015-01-01

    Objective: To investigate the characteristics of Tiam1 gene expression in human cholangiocarcinoma tissues and benign bile duct tissues, and to analyze the correlations between Tiam1 gene expression and the degree of tumor differentiation, invasive and metastatic abilities. To explore the effect of targeted inhibiting Tiam1 gene expression on proliferation and migration activity of human cholangiocarcinoma cells. Methods: Expression of Tiam1 in 83 cases of cholangiocarcinoma tissues and 25 cases of benign bile tissues was detected using immunohistochemistry. The clinical data of patients with cholangiocarcinoma were collected. The correlations between Tiam1 gene expression and the clinicopathologic features in patients with cholangiocarcinoma were analyzed. The human cholangiocarcinoma RBE cells were divided into 3 groups. Cells in experimental group and control group were respectively transfected with Tiam1 shRNA lentiviral vectors and negative shRNA lentiviral control vectors. Cells in blank group received no treatment. Real-time PCR endogenesis was used to verify Tiam1 gene expression. Cell cycle experiments and MTT assay were used to measure cell proliferation activity. Transwell test was used to detect cell migration activity. Results: The negative rate Tiam1 protein expression in cholangiocarcinoma tissues was significantly higher than that in benign bile tissues (P<0.001). Tiam1 protein expression in cholangiocarcinoma tissues had correlations with cholangiocarcinoma differentiation degree, TNM stage and lymph node metastasis (P<0.05), and had no significant correlations with gender, age and distant metastasis (P>0.05). Real-time PCR detection indicated that Tiam1 expression of experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that Tiam1 shRNA was effective on Tiam1 gene silencing in RBE cells. Cell cycle experiment showed that the percentage of S phase in cell cycle in experimental group was lower than that in control group and blank group (P<0.05), demonstrating that after the down-regulation of Tiam1 gene expression, the speed of cell proliferation was inhibited. MTT assay results showed that the total growth speed in experimental group was significantly lower than that in control group and blank group (P<0.05), indicating that the proliferation activity of cholangiocarcinoma cells was inhibited after targeted inhibition of Tiam1 gene expression. Transwell detection results showed that the metastasis rate in experimental group was significantly lower than that in control group and blank group (P<0.05), demonstrating that targeted inhibition of Tiam1 gene expression could significantly inhibit migration ability of RBE cells. Conclusion: Tiam1 expression significantly increased in cholangiocarcinoma tissues, and increased along with the degree of malignancy of cholangiocarcinoma. Targeted silencing Tiam1 expression could inhibit proliferation and migration activity of cholangiocarcinoma cells. PMID:26884821

  1. Complexities of gene expression patterns in natural populations of an extremophile fish (Poecilia mexicana, Poeciliidae)

    PubMed Central

    Passow, Courtney N.; Brown, Anthony P.; Arias-Rodriguez, Lenin; Yee, Muh-Ching; Sockell, Alexandra; Schartl, Manfred; Warren, Wesley C.; Bustamante, Carlos; Kelley, Joanna L.; Tobler, Michael

    2017-01-01

    Variation in gene expression can provide insights into organismal responses to environmental stress and physiological mechanisms mediating adaptation to habitats with contrasting environmental conditions. We performed an RNA-sequencing experiment to quantify gene expression patterns in fish adapted to habitats with different combinations of environmental stressors, including the presence of toxic hydrogen sulphide (H2S) and the absence of light in caves. We specifically asked how gene expression varies among populations living in different habitats, whether population differences were consistent among organs, and whether there is evidence for shared expression responses in populations exposed to the same stressors. We analysed organ-specific transcriptome-wide data from four ecotypes of Poecilia mexicana (nonsulphidic surface, sulphidic surface, nonsulphidic cave and sulphidic cave). The majority of variation in gene expression was correlated with organ type, and the presence of specific environmental stressors elicited unique expression differences among organs. Shared patterns of gene expression between populations exposed to the same environmental stressors increased with levels of organismal organization (from transcript to gene to physiological pathway). In addition, shared patterns of gene expression were more common between populations from sulphidic than populations from cave habitats, potentially indicating that physiochemical stressors with clear biochemical consequences can constrain the diversity of adaptive solutions that mitigate their adverse effects. Overall, our analyses provided insights into transcriptional variation in a unique system, in which adaptation to H2S and darkness coincide. Functional annotations of differentially expressed genes provide a springboard for investigating physiological mechanisms putatively underlying adaptation to extreme environments. PMID:28598519

  2. Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies

    PubMed Central

    Kirkpatrick, Mark

    2016-01-01

    Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive “Twin Peaks” pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies. PMID:27658217

  3. Transcriptional Analysis of Drought-Induced Genes in the Roots of a Tolerant Genotype of the Common Bean (Phaseolus vulgaris L.)

    PubMed Central

    Recchia, Gustavo Henrique; Caldas, Danielle Gregorio Gomes; Beraldo, Ana Luiza Ahern; da Silva, Márcio José; Tsai, Siu Mui

    2013-01-01

    In Brazil, common bean (Phaseolus vulgaris L.) productivity is severely affected by drought stress due to low technology cultivation systems. Our purpose was to identify differentially expressed genes in roots of a genotype tolerant to water deficit (BAT 477) when submitted to an interruption of irrigation during its development. A SSH library was constructed taking as “driver” the genotype Carioca 80SH (susceptible to drought). After clustering and data mining, 1572 valid reads were obtained, resulting in 1120 ESTs (expressed sequence tags). We found sequences for transcription factors, carbohydrates metabolism, proline-rich proteins, aquaporins, chaperones and ubiquitins, all of them organized according to their biological processes. Our suppressive subtractive hybridization (SSH) library was validated through RT-qPCR experiment by assessing the expression patterns of 10 selected genes in both genotypes under stressed and control conditions. Finally, the expression patterns of 31 ESTs, putatively related to drought responses, were analyzed in a time-course experiment. Our results confirmed that such genes are more expressed in the tolerant genotype during stress; however, they are not exclusive, since different levels of these transcripts were also detected in the susceptible genotype. In addition, we observed a fluctuation in gene regulation over time for both the genotypes, which seem to adopt and adapt different strategies in order to develop tolerance against this stress. PMID:23538843

  4. Genome-wide identification, characterisation and expression analysis of the MADS-box gene family in Prunus mume.

    PubMed

    Xu, Zongda; Zhang, Qixiang; Sun, Lidan; Du, Dongliang; Cheng, Tangren; Pan, Huitang; Yang, Weiru; Wang, Jia

    2014-10-01

    MADS-box genes encode transcription factors that play crucial roles in plant development, especially in flower and fruit development. To gain insight into this gene family in Prunus mume, an important ornamental and fruit plant in East Asia, and to elucidate their roles in flower organ determination and fruit development, we performed a genome-wide identification, characterisation and expression analysis of MADS-box genes in this Rosaceae tree. In this study, 80 MADS-box genes were identified in P. mume and categorised into MIKC, Mα, Mβ, Mγ and Mδ groups based on gene structures and phylogenetic relationships. The MIKC group could be further classified into 12 subfamilies. The FLC subfamily was absent in P. mume and the six tandemly arranged DAM genes might experience a species-specific evolution process in P. mume. The MADS-box gene family might experience an evolution process from MIKC genes to Mδ genes to Mα, Mβ and Mγ genes. The expression analysis suggests that P. mume MADS-box genes have diverse functions in P. mume development and the functions of duplicated genes diverged after the duplication events. In addition to its involvement in the development of female gametophytes, type I genes also play roles in male gametophytes development. In conclusion, this study adds to our understanding of the roles that the MADS-box genes played in flower and fruit development and lays a foundation for selecting candidate genes for functional studies in P. mume and other species. Furthermore, this study also provides a basis to study the evolution of the MADS-box family.

  5. Identification and evaluation of reference genes for qRT-PCR normalization in Ganoderma lucidum.

    PubMed

    Xu, Jiang; Xu, ZhiChao; Zhu, YingJie; Luo, HongMei; Qian, Jun; Ji, AiJia; Hu, YuanLei; Sun, Wei; Wang, Bo; Song, JingYuan; Sun, Chao; Chen, ShiLin

    2014-01-01

    Quantitative real-time reverse transcription PCR (qRT-PCR) is a rapid, sensitive, and reliable technique for gene expression studies. The accuracy and reliability of qRT-PCR results depend on the stability of the reference genes used for gene normalization. Therefore, a systematic process of reference gene evaluation is needed. Ganoderma lucidum is a famous medicinal mushroom in East Asia. In the current study, 10 potential reference genes were selected from the G. lucidum genomic data. The sequences of these genes were manually curated, and primers were designed following strict criteria. The experiment was conducted using qRT-PCR, and the stability of each candidate gene was assessed using four commonly used statistical programs-geNorm, NormFinder, BestKeeper, and RefFinder. According to our results, PP2A was expressed at the most stable levels under different fermentation conditions, and RPL4 was the most stably expressed gene in different tissues. RPL4, PP2A, and β-tubulin are the most commonly recommended reference genes for normalizing gene expression in the entire sample set. The current study provides a foundation for the further use of qRT-PCR in G. lucidum gene analysis.

  6. WP1: transgenic opto-animals

    NASA Astrophysics Data System (ADS)

    UŻarowska, E.; Czajkowski, Rafał; Konopka, W.

    2014-11-01

    We aim to create a set of genetic tools where permanent opsin expression (ChR or NpHR) is precisely limited to the population of neurons that express immediate early gene c-fos during a specific temporal window of behavioral training. Since the c-fos gene is only expressed in neurons that form experience-dependent ensemble, this approach will result in specific labeling of a small subset of cells that create memory trace for the learned behavior. To this end we employ two alternative inducible gene expression systems: Tet Expression System and Cre/lox System. In both cases, the temporal window for opsin induction is controlled pharmacologically, by doxycycline or tamoxifen, respectively. Both systems will be used for creating lines of transgenic animals.

  7. Modeling Bi-modality Improves Characterization of Cell Cycle on Gene Expression in Single Cells

    PubMed Central

    Danaher, Patrick; Finak, Greg; Krouse, Michael; Wang, Alice; Webster, Philippa; Beechem, Joseph; Gottardo, Raphael

    2014-01-01

    Advances in high-throughput, single cell gene expression are allowing interrogation of cell heterogeneity. However, there is concern that the cell cycle phase of a cell might bias characterizations of gene expression at the single-cell level. We assess the effect of cell cycle phase on gene expression in single cells by measuring 333 genes in 930 cells across three phases and three cell lines. We determine each cell's phase non-invasively without chemical arrest and use it as a covariate in tests of differential expression. We observe bi-modal gene expression, a previously-described phenomenon, wherein the expression of otherwise abundant genes is either strongly positive, or undetectable within individual cells. This bi-modality is likely both biologically and technically driven. Irrespective of its source, we show that it should be modeled to draw accurate inferences from single cell expression experiments. To this end, we propose a semi-continuous modeling framework based on the generalized linear model, and use it to characterize genes with consistent cell cycle effects across three cell lines. Our new computational framework improves the detection of previously characterized cell-cycle genes compared to approaches that do not account for the bi-modality of single-cell data. We use our semi-continuous modelling framework to estimate single cell gene co-expression networks. These networks suggest that in addition to having phase-dependent shifts in expression (when averaged over many cells), some, but not all, canonical cell cycle genes tend to be co-expressed in groups in single cells. We estimate the amount of single cell expression variability attributable to the cell cycle. We find that the cell cycle explains only 5%–17% of expression variability, suggesting that the cell cycle will not tend to be a large nuisance factor in analysis of the single cell transcriptome. PMID:25032992

  8. Spliced synthetic genes as internal controls in RNA sequencing experiments.

    PubMed

    Hardwick, Simon A; Chen, Wendy Y; Wong, Ted; Deveson, Ira W; Blackburn, James; Andersen, Stacey B; Nielsen, Lars K; Mattick, John S; Mercer, Tim R

    2016-09-01

    RNA sequencing (RNA-seq) can be used to assemble spliced isoforms, quantify expressed genes and provide a global profile of the transcriptome. However, the size and diversity of the transcriptome, the wide dynamic range in gene expression and inherent technical biases confound RNA-seq analysis. We have developed a set of spike-in RNA standards, termed 'sequins' (sequencing spike-ins), that represent full-length spliced mRNA isoforms. Sequins have an entirely artificial sequence with no homology to natural reference genomes, but they align to gene loci encoded on an artificial in silico chromosome. The combination of multiple sequins across a range of concentrations emulates alternative splicing and differential gene expression, and it provides scaling factors for normalization between samples. We demonstrate the use of sequins in RNA-seq experiments to measure sample-specific biases and determine the limits of reliable transcript assembly and quantification in accompanying human RNA samples. In addition, we have designed a complementary set of sequins that represent fusion genes arising from rearrangements of the in silico chromosome to aid in cancer diagnosis. RNA sequins provide a qualitative and quantitative reference with which to navigate the complexity of the human transcriptome.

  9. Effect of promoter architecture on the cell-to-cell variability in gene expression.

    PubMed

    Sanchez, Alvaro; Garcia, Hernan G; Jones, Daniel; Phillips, Rob; Kondev, Jané

    2011-03-01

    According to recent experimental evidence, promoter architecture, defined by the number, strength and regulatory role of the operators that control transcription, plays a major role in determining the level of cell-to-cell variability in gene expression. These quantitative experiments call for a corresponding modeling effort that addresses the question of how changes in promoter architecture affect variability in gene expression in a systematic rather than case-by-case fashion. In this article we make such a systematic investigation, based on a microscopic model of gene regulation that incorporates stochastic effects. In particular, we show how operator strength and operator multiplicity affect this variability. We examine different modes of transcription factor binding to complex promoters (cooperative, independent, simultaneous) and how each of these affects the level of variability in transcriptional output from cell-to-cell. We propose that direct comparison between in vivo single-cell experiments and theoretical predictions for the moments of the probability distribution of mRNA number per cell can be used to test kinetic models of gene regulation. The emphasis of the discussion is on prokaryotic gene regulation, but our analysis can be extended to eukaryotic cells as well.

  10. Effect of Promoter Architecture on the Cell-to-Cell Variability in Gene Expression

    PubMed Central

    Sanchez, Alvaro; Garcia, Hernan G.; Jones, Daniel; Phillips, Rob; Kondev, Jané

    2011-01-01

    According to recent experimental evidence, promoter architecture, defined by the number, strength and regulatory role of the operators that control transcription, plays a major role in determining the level of cell-to-cell variability in gene expression. These quantitative experiments call for a corresponding modeling effort that addresses the question of how changes in promoter architecture affect variability in gene expression in a systematic rather than case-by-case fashion. In this article we make such a systematic investigation, based on a microscopic model of gene regulation that incorporates stochastic effects. In particular, we show how operator strength and operator multiplicity affect this variability. We examine different modes of transcription factor binding to complex promoters (cooperative, independent, simultaneous) and how each of these affects the level of variability in transcriptional output from cell-to-cell. We propose that direct comparison between in vivo single-cell experiments and theoretical predictions for the moments of the probability distribution of mRNA number per cell can be used to test kinetic models of gene regulation. The emphasis of the discussion is on prokaryotic gene regulation, but our analysis can be extended to eukaryotic cells as well. PMID:21390269

  11. Overcoming confounded controls in the analysis of gene expression data from microarray experiments.

    PubMed

    Bhattacharya, Soumyaroop; Long, Dang; Lyons-Weiler, James

    2003-01-01

    A potential limitation of data from microarray experiments exists when improper control samples are used. In cancer research, comparisons of tumour expression profiles to those from normal samples is challenging due to tissue heterogeneity (mixed cell populations). A specific example exists in a published colon cancer dataset, in which tissue heterogeneity was reported among the normal samples. In this paper, we show how to overcome or avoid the problem of using normal samples that do not derive from the same tissue of origin as the tumour. We advocate an exploratory unsupervised bootstrap analysis that can reveal unexpected and undesired, but strongly supported, clusters of samples that reflect tissue differences instead of tumour versus normal differences. All of the algorithms used in the analysis, including the maximum difference subset algorithm, unsupervised bootstrap analysis, pooled variance t-test for finding differentially expressed genes and the jackknife to reduce false positives, are incorporated into our online Gene Expression Data Analyzer ( http:// bioinformatics.upmc.edu/GE2/GEDA.html ).

  12. Genetically engineered cardiac pacemaker: Stem cells transfected with HCN2 gene and myocytes—A model

    NASA Astrophysics Data System (ADS)

    Kanani, S.; Pumir, A.; Krinsky, V.

    2008-01-01

    One of the successfully tested methods to design genetically engineered cardiac pacemaker cells consists in transfecting a human mesenchymal stem cell (hMSC) with a HCN2 gene and connecting it to a myocyte. We develop and study a mathematical model, describing a myocyte connected to a hMSC transfected with a HCN2 gene. The cardiac action potential is described both with the simple Beeler Reuter model, as well as with the elaborate dynamic Luo Rudy model. The HCN2 channel is described by fitting electrophysiological records, in the spirit of Hodgkin Huxley. The model shows that oscillations can occur in a pair myocyte-stem cell, that was not observed in the experiments yet. The model predicted that: (1) HCN pacemaker channels can induce oscillations only if the number of expressed I channels is low enough. At too high an expression level of I channels, oscillations cannot be induced, no matter how many pacemaker channels are expressed. (2) At low expression levels of I channels, a large domain of values in the parameter space (n, N) exists, where oscillations should be observed. We denote N the number of expressed pacemaker channels in the stem cell, and n the number of gap junction channels coupling the stem cell and the myocyte. (3) The expression levels of I channels observed in ventricular myocytes, both in the Beeler Reuter and in the dynamic Luo Rudy models are too high to allow to observe oscillations. With expression levels below ˜1/4 of the original value, oscillations can be observed. The main consequence of this work is that in order to obtain oscillations in an experiment with a myocyte-stem cell pair, increasing the values of n, N is unlikely to be helpful, unless the expression level of I has been reduced enough. The model also allows us to explore levels of gene expression not yet achieved in experiments, and could be useful to plan new experiments, aimed at improving the robustness of the oscillations.

  13. Normalizing gene expression by quantitative PCR during somatic embryogenesis in two representative conifer species: Pinus pinaster and Picea abies.

    PubMed

    de Vega-Bartol, José J; Santos, Raquen Raissa; Simões, Marta; Miguel, Célia M

    2013-05-01

    Suitable internal control genes to normalize qPCR data from different stages of embryo development and germination were identified in two representative conifer species. Clonal propagation by somatic embryogenesis has a great application potentiality in conifers. Quantitative PCR (qPCR) is widely used for gene expression analysis during somatic embryogenesis and embryo germination. No single reference gene is universal, so a systematic characterization of endogenous genes for concrete conditions is fundamental for accuracy. We identified suitable internal control genes to normalize qPCR data obtained at different steps of somatic embryogenesis (embryonal mass proliferation, embryo maturation and germination) in two representative conifer species, Pinus pinaster and Picea abies. Candidate genes included endogenous genes commonly used in conifers, genes previously tested in model plants, and genes with a lower variation of the expression along embryo development according to genome-wide transcript profiling studies. Three different algorithms were used to evaluate expression stability. The geometric average of the expression values of elongation factor-1α, α-tubulin and histone 3 in P. pinaster, and elongation factor-1α, α-tubulin, adenosine kinase and CAC in P. abies were adequate for expression studies throughout somatic embryogenesis. However, improved accuracy was achieved when using other gene combinations in experiments with samples at a single developmental stage. The importance of studies selecting reference genes to use in different tissues or developmental stages within one or close species, and the instability of commonly used reference genes, is highlighted.

  14. Meta-Analysis of Tumor Stem-Like Breast Cancer Cells Using Gene Set and Network Analysis

    PubMed Central

    Lee, Won Jun; Kim, Sang Cheol; Yoon, Jung-Ho; Yoon, Sang Jun; Lim, Johan; Kim, You-Sun; Kwon, Sung Won; Park, Jeong Hill

    2016-01-01

    Generally, cancer stem cells have epithelial-to-mesenchymal-transition characteristics and other aggressive properties that cause metastasis. However, there have been no confident markers for the identification of cancer stem cells and comparative methods examining adherent and sphere cells are widely used to investigate mechanism underlying cancer stem cells, because sphere cells have been known to maintain cancer stem cell characteristics. In this study, we conducted a meta-analysis that combined gene expression profiles from several studies that utilized tumorsphere technology to investigate tumor stem-like breast cancer cells. We used our own gene expression profiles along with the three different gene expression profiles from the Gene Expression Omnibus, which we combined using the ComBat method, and obtained significant gene sets using the gene set analysis of our datasets and the combined dataset. This experiment focused on four gene sets such as cytokine-cytokine receptor interaction that demonstrated significance in both datasets. Our observations demonstrated that among the genes of four significant gene sets, six genes were consistently up-regulated and satisfied the p-value of < 0.05, and our network analysis showed high connectivity in five genes. From these results, we established CXCR4, CXCL1 and HMGCS1, the intersecting genes of the datasets with high connectivity and p-value of < 0.05, as significant genes in the identification of cancer stem cells. Additional experiment using quantitative reverse transcription-polymerase chain reaction showed significant up-regulation in MCF-7 derived sphere cells and confirmed the importance of these three genes. Taken together, using meta-analysis that combines gene set and network analysis, we suggested CXCR4, CXCL1 and HMGCS1 as candidates involved in tumor stem-like breast cancer cells. Distinct from other meta-analysis, by using gene set analysis, we selected possible markers which can explain the biological mechanisms and suggested network analysis as an additional criterion for selecting candidates. PMID:26870956

  15. Conifer reproductive development involves B-type MADS-box genes with distinct and different activities in male organ primordia.

    PubMed

    Sundström, Jens; Engström, Peter

    2002-07-01

    The Norway spruce MADS-box genes DAL11, DAL12 and DAL13 are phylogenetically related to the angiosperm B-function MADS-box genes: genes that act together with A-function genes in specifying petal identity and with C-function genes in specifying stamen identity to floral organs. In this report we present evidence to suggest that the B-gene function in the specification of identity of the pollen-bearing organs has been conserved between conifers and angiosperms. Expression of DAL11 or DAL12 in transgenic Arabidopsis causes phenotypic changes which partly resemble those caused by ectopic expression of the endogenous B-genes. In similar experiments, flowers of Arabidopsis plants expressing DAL13 showed a different homeotic change in that they formed ectopic anthers in whorls one, two or four. We also demonstrate the capacity of the spruce gene products to form homodimers, and that DAL11 and DAL13 may form heterodimers with each other and with the Arabidopsis B-protein AP3, but not with PI, the second B-gene product in Arabidopsis. In situ hybridization experiments show that the conifer B-like genes are expressed specifically in developing pollen cones, but differ in both temporal and spatial distribution patterns. These results suggest that the B-function in conifers is dual and is separated into a meristem identity and an organ identity function, the latter function possibly being independent of an interaction with the C-function. Thus, even though an ancestral B-function may have acted in combination with C to specify micro- and megasporangia, the B-function has evolved differently in conifers and angiosperms.

  16. A multi-Poisson dynamic mixture model to cluster developmental patterns of gene expression by RNA-seq.

    PubMed

    Ye, Meixia; Wang, Zhong; Wang, Yaqun; Wu, Rongling

    2015-03-01

    Dynamic changes of gene expression reflect an intrinsic mechanism of how an organism responds to developmental and environmental signals. With the increasing availability of expression data across a time-space scale by RNA-seq, the classification of genes as per their biological function using RNA-seq data has become one of the most significant challenges in contemporary biology. Here we develop a clustering mixture model to discover distinct groups of genes expressed during a period of organ development. By integrating the density function of multivariate Poisson distribution, the model accommodates the discrete property of read counts characteristic of RNA-seq data. The temporal dependence of gene expression is modeled by the first-order autoregressive process. The model is implemented with the Expectation-Maximization algorithm and model selection to determine the optimal number of gene clusters and obtain the estimates of Poisson parameters that describe the pattern of time-dependent expression of genes from each cluster. The model has been demonstrated by analyzing a real data from an experiment aimed to link the pattern of gene expression to catkin development in white poplar. The usefulness of the model has been validated through computer simulation. The model provides a valuable tool for clustering RNA-seq data, facilitating our global view of expression dynamics and understanding of gene regulation mechanisms. © The Author 2014. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  17. A method to identify differential expression profiles of time-course gene data with Fourier transformation.

    PubMed

    Kim, Jaehee; Ogden, Robert Todd; Kim, Haseong

    2013-10-18

    Time course gene expression experiments are an increasingly popular method for exploring biological processes. Temporal gene expression profiles provide an important characterization of gene function, as biological systems are both developmental and dynamic. With such data it is possible to study gene expression changes over time and thereby to detect differential genes. Much of the early work on analyzing time series expression data relied on methods developed originally for static data and thus there is a need for improved methodology. Since time series expression is a temporal process, its unique features such as autocorrelation between successive points should be incorporated into the analysis. This work aims to identify genes that show different gene expression profiles across time. We propose a statistical procedure to discover gene groups with similar profiles using a nonparametric representation that accounts for the autocorrelation in the data. In particular, we first represent each profile in terms of a Fourier basis, and then we screen out genes that are not differentially expressed based on the Fourier coefficients. Finally, we cluster the remaining gene profiles using a model-based approach in the Fourier domain. We evaluate the screening results in terms of sensitivity, specificity, FDR and FNR, compare with the Gaussian process regression screening in a simulation study and illustrate the results by application to yeast cell-cycle microarray expression data with alpha-factor synchronization.The key elements of the proposed methodology: (i) representation of gene profiles in the Fourier domain; (ii) automatic screening of genes based on the Fourier coefficients and taking into account autocorrelation in the data, while controlling the false discovery rate (FDR); (iii) model-based clustering of the remaining gene profiles. Using this method, we identified a set of cell-cycle-regulated time-course yeast genes. The proposed method is general and can be potentially used to identify genes which have the same patterns or biological processes, and help facing the present and forthcoming challenges of data analysis in functional genomics.

  18. RNA-sequence data normalization through in silico prediction of reference genes: the bacterial response to DNA damage as case study.

    PubMed

    Berghoff, Bork A; Karlsson, Torgny; Källman, Thomas; Wagner, E Gerhart H; Grabherr, Manfred G

    2017-01-01

    Measuring how gene expression changes in the course of an experiment assesses how an organism responds on a molecular level. Sequencing of RNA molecules, and their subsequent quantification, aims to assess global gene expression changes on the RNA level (transcriptome). While advances in high-throughput RNA-sequencing (RNA-seq) technologies allow for inexpensive data generation, accurate post-processing and normalization across samples is required to eliminate any systematic noise introduced by the biochemical and/or technical processes. Existing methods thus either normalize on selected known reference genes that are invariant in expression across the experiment, assume that the majority of genes are invariant, or that the effects of up- and down-regulated genes cancel each other out during the normalization. Here, we present a novel method, moose 2 , which predicts invariant genes in silico through a dynamic programming (DP) scheme and applies a quadratic normalization based on this subset. The method allows for specifying a set of known or experimentally validated invariant genes, which guides the DP. We experimentally verified the predictions of this method in the bacterium Escherichia coli , and show how moose 2 is able to (i) estimate the expression value distances between RNA-seq samples, (ii) reduce the variation of expression values across all samples, and (iii) to subsequently reveal new functional groups of genes during the late stages of DNA damage. We further applied the method to three eukaryotic data sets, on which its performance compares favourably to other methods. The software is implemented in C++ and is publicly available from http://grabherr.github.io/moose2/. The proposed RNA-seq normalization method, moose 2 , is a valuable alternative to existing methods, with two major advantages: (i) in silico prediction of invariant genes provides a list of potential reference genes for downstream analyses, and (ii) non-linear artefacts in RNA-seq data are handled adequately to minimize variations between replicates.

  19. Interferon stimulated genes as peripheral diagnostic markers of early pregnancy in sheep: a critical assessment.

    PubMed

    Mauffré, V; Grimard, B; Eozenou, C; Inghels, S; Silva, L; Giraud-Delville, C; Capo, D; Sandra, O; Constant, F

    2016-11-01

    We investigated the diagnostic reliability of pregnancy detection using changes in interferon stimulated gene (ISG) messenger RNA (mRNA) levels in circulating immune cells in ewes. Two different groups of ewes (an experimental group, experiment 1 and a farm group, experiment 2) were oestrus-synchronized and blood sampled on day 14 (D0=day of insemination in control animals, experiment 1) and day 15 (experiment 2). Real-time PCR were performed to evaluate the abundance of different ISG mRNAs. In the experimental group, peripheral blood mononuclear cells of 29 ewes born and bred in experimental facilities were isolated using a Percoll gradient method. Gene expression for Chemokine (C-X-C motif) ligand 10 (CXCL10), Myxovirus (influenza virus) resistance 1 (MX1) and Signal transducer and activator of transcription 1 (STAT1) mRNA were, respectively, 8.3-fold, 6.1-fold and 2.7-fold higher (P0.10) in CXCL10, STAT1, MX1, Myxovirus (influenza virus) resistance 2 (MX2) and ISG15 ubiquitin-like modifier (ISG15) mRNA expression were found between pregnant and non-pregnant ewes. The ROC curves and the hierarchical classification generated from the real-time PCR data failed to discriminate between pregnant and non-pregnant animals. In this group of animals, our results show a strong variability in ISG expression patterns: 17% of animals identified as non-pregnant by the five tests were in fact pregnant, only 52% of pregnant animals had at least two positive results (two genes above threshold), whereas up to five positive results (five genes above threshold) were needed to avoid misclassification. In conclusion, this study illustrates the high variability in ISG expression levels in immune circulating cells during early pregnancy and, therefore, highlights the limits of using ISG expression levels in blood samples, collected on PAXgene® tubes on farms, for early pregnancy detection in sheep.

  20. Expression of alcoholism-relevant genes in the liver are differently correlated to different parts of the brain.

    PubMed

    Wang, Lishi; Huang, Yue; Jiao, Yan; Chen, Hong; Cao, Yanhong; Bennett, Beth; Wang, Yongjun; Gu, Weikuan

    2013-01-01

    The purpose of this study is to investigate whether expression profiles of alcoholism-relevant genes in different parts of the brain are correlated differently with those in the liver. Four experiments were conducted. First, we used gene expression profiles from five parts of the brain (striatum, prefrontal cortex, nucleus accumbens, hippocampus, and cerebellum) and from liver in a population of recombinant inbred mouse strains to examine the expression association of 10 alcoholism-relevant genes. Second, we conducted the same association analysis between brain structures and the lung. Third, using five randomly selected, nonalcoholism-relevant genes, we conducted the association analysis between brain and liver. Finally, we compared the expression of 10 alcoholism-relevant genes in hippocampus and cerebellum between an alcohol preference strain and a wild-type control. We observed a difference in correlation patterns in expression levels of 10 alcoholism-relevant genes between different parts of the brain with those of liver. We then examined the association of gene expression between alcohol dehydrogenases (Adh1, Adh2, Adh5, and Adh7) and different parts of the brain. The results were similar to those of the 10 genes. Then, we found that the association of those genes between brain structures and lung was different from that of liver. Next, we found that the association patterns of five alcoholism-nonrelevant genes were different from those of 10 alcoholism-relevant genes. Finally, we found that the expression level of 10 alcohol-relevant genes is influenced more in hippocampus than in cerebellum in the alcohol preference strain. Our results show that the expression of alcoholism-relevant genes in liver is differently associated with the expression of genes in different parts of the brain. Because different structural changes in different parts of the brain in alcoholism have been reported, it is important to investigate whether those structural differences in the brains of those with alcoholism are due to the difference in the associations of gene expression between genes in liver and in different parts of the brain.

  1. Microarray and differential display identify genes involved in jasmonate-dependent anther development.

    PubMed

    Mandaokar, Ajin; Kumar, V Dinesh; Amway, Matt; Browse, John

    2003-07-01

    Jasmonate (JA) is a signaling compound essential for anther development and pollen fertility in Arabidopsis. Mutations that block the pathway of JA synthesis result into male sterility. To understand the processes of anther and pollen maturation, we used microarray and differential display approaches to compare gene expression pattern in anthers of wild-type Arabidopsis and the male-sterile mutant, opr3. Microarray experiment revealed 25 genes that were up-regulated more than 1.8-fold in wild-type anthers as compared to mutant anthers. Experiments based on differential display identified 13 additional genes up-regulated in wild-type anthers compared to opr3 for a total of 38 differentially expressed genes. Searches of the Arabidopsis and non-redundant databases disclosed known or likely functions for 28 of the 38 genes identified, while 10 genes encode proteins of unknown function. Northern blot analysis of eight representative clones as probes confirmed low expression in opr3 anthers compared with wild-type anthers. JA responsiveness of these same genes was also investigated by northern blot analysis of anther RNA isolated from wild-type and opr3 plants, In these experiments, four genes were induced in opr3 anthers within 0.5-1 h of JA treatment while the remaining genes were up-regulated only 1-8 h after JA application. None of these genes was induced by JA in anthers of the coil mutant that is deficient in JA responsiveness. The four early-induced genes in opr3 encode lipoxygenase, a putative bHLH transcription factor, epithiospecifier protein and an unknown protein. We propose that these and other early components may be involved in JA signaling and in the initiation of developmental processes. The four late genes encode an extensin-like protein, a peptide transporter and two unknown proteins, which may represent components required later in anther and pollen maturation. Transcript profiling has provided a successful approach to identify genes involved in anther and pollen maturation in Arabidopsis.

  2. Expression of Pluripotency Markers in Nonpluripotent Human Neural Stem and Progenitor Cells.

    PubMed

    Vincent, Per Henrik; Benedikz, Eirikur; Uhlén, Per; Hovatta, Outi; Sundström, Erik

    2017-06-15

    Nonpluripotent neural progenitor cells (NPCs) derived from the human fetal central nervous system were found to express a number of messenger RNA (mRNA) species associated with pluripotency, such as NANOG, REX1, and OCT4. The expression was restricted to small subpopulations of NPCs. In contrast to pluripotent stem cells, there was no coexpression of the pluripotency-associated genes studied. Although the expression of these genes rapidly declined during the in vitro differentiation of NPCs, we found no evidence that the discrete expression was associated with the markers of multipotent neural stem cells (CD133 + /CD24 lo ), the capacity of sphere formation, or high cell proliferation rates. The rate of cell death among NPCs expressing pluripotency-associated genes was also similar to that of other NPCs. Live cell imaging showed that NANOG- and REX1-expressing NPCs continuously changed morphology, as did the nonexpressing cells. Depletion experiments showed that after the complete removal of the subpopulations of NANOG- and REX1-expressing NPCs, the expression of these genes appeared in other NPCs within a few days. The percentage of NANOG- and REX1-expressing cells returned to that observed before depletion. Our results are best explained by a model in which there is stochastic transient expression of pluripotency-associated genes in proliferating NPCs.

  3. ImpulseDE: detection of differentially expressed genes in time series data using impulse models.

    PubMed

    Sander, Jil; Schultze, Joachim L; Yosef, Nir

    2017-03-01

    Perturbations in the environment lead to distinctive gene expression changes within a cell. Observed over time, those variations can be characterized by single impulse-like progression patterns. ImpulseDE is an R package suited to capture these patterns in high throughput time series datasets. By fitting a representative impulse model to each gene, it reports differentially expressed genes across time points from a single or between two time courses from two experiments. To optimize running time, the code uses clustering and multi-threading. By applying ImpulseDE , we demonstrate its power to represent underlying biology of gene expression in microarray and RNA-Seq data. ImpulseDE is available on Bioconductor ( https://bioconductor.org/packages/ImpulseDE/ ). niryosef@berkeley.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  4. An epigenetic state associated with areas of gene duplication

    PubMed Central

    Gimelbrant, Alexander A.; Chess, Andrew

    2006-01-01

    Asynchronous DNA replication is an epigenetically determined feature found in all cases of monoallelic expression, including genomic imprinting, X-inactivation, and random monoallelic expression of autosomal genes such as immunoglobulins and olfactory receptor genes. Most genes of the latter class were identified in experiments focused on genes functioning in the chemosensory and immune systems. We performed an unbiased survey of asynchronous replication in the mouse genome, excluding known asynchronously replicated genes. Fully 10% (eight of 80) of the genes tested exhibited asynchronous replication. A common feature of the newly identified asynchronously replicated areas is their proximity to areas of tandem gene duplication. Testing of other clustered areas supported the idea that such regions are enriched with asynchronously replicated genes. PMID:16687731

  5. Sources of Variance in Baseline Gene Expression in the Rodent Liver

    PubMed Central

    Corton, J. Christopher; Bushel, Pierre R.; Fostel, Jennifer; O'Lone, Raegan B.

    2012-01-01

    The use of gene expression profiling in both clinical and laboratory settings would be enhanced by better characterization of variation due to individual, environmental, and technical factors. Analysis of microarray data from untreated or vehicle-treated animals within the control arm of toxicogenomics studies has yielded useful information on baseline fluctuations in liver gene expression in the rodent. Here, studies which highlight contributions of different factors to gene expression variability in the rodent liver are discussed including a large meta-analysis of rat liver, which identified genes that vary in control animals in the absence of chemical treatment. Genes and their pathways that are the most and least variable were identified in a number of these studies. Life stage, fasting, sex, diet, circadian rhythm and liver lobe source can profoundly influence gene expression in the liver. Recognition of biological and technical factors that contribute to variability of background gene expression can help the investigator in the design of an experiment that maximizes sensitivity and reduces the influence of confounders that may lead to misinterpretation of genomic changes. The factors that contribute to variability in liver gene expression in rodents are likely analogous to those contributing to human interindividual variability in drug response and chemical toxicity. Identification of batteries of genes that are altered in a variety of background conditions could be used to predict responses to drugs and chemicals in appropriate models of the human liver. PMID:22230429

  6. Too much data, but little inter-changeability: a lesson learned from mining public data on tissue specificity of gene expression.

    PubMed

    Li, Shuyu; Li, Yiqun Helen; Wei, Tao; Su, Eric Wen; Duffin, Kevin; Liao, Birong

    2006-10-25

    The tissue expression pattern of a gene often provides an important clue to its potential role in a biological process. A vast amount of gene expression data have been and are being accumulated in public repository through different technology platforms. However, exploitations of these rich data sources remain limited in part due to issues of technology standardization. Our objective is to test the data comparability between SAGE and microarray technologies, through examining the expression pattern of genes under normal physiological states across variety of tissues. There are 42-54% of genes showing significant correlations in tissue expression patterns between SAGE and GeneChip, with 30-40% of genes whose expression patterns are positively correlated and 10-15% of genes whose expression patterns are negatively correlated at a statistically significant level (p = 0.05). Our analysis suggests that the discrepancy on the expression patterns derived from technology platforms is not likely from the heterogeneity of tissues used in these technologies, or other spurious correlations resulting from microarray probe design, abundance of genes, or gene function. The discrepancy can be partially explained by errors in the original assignment of SAGE tags to genes due to the evolution of sequence databases. In addition, sequence analysis has indicated that many SAGE tags and Affymetrix array probe sets are mapped to different splice variants or different sequence regions although they represent the same gene, which also contributes to the observed discrepancies between SAGE and array expression data. To our knowledge, this is the first report attempting to mine gene expression patterns across tissues using public data from different technology platforms. Unlike previous similar studies that only demonstrated the discrepancies between the two gene expression platforms, we carried out in-depth analysis to further investigate the cause for such discrepancies. Our study shows that the exploitation of rich public expression resource requires extensive knowledge about the technologies, and experiment. Informatic methodologies for better interoperability among platforms still remain a gap. One of the areas that can be improved practically is the accurate sequence mapping of SAGE tags and array probes to full-length genes.

  7. Genes@Work: an efficient algorithm for pattern discovery and multivariate feature selection in gene expression data.

    PubMed

    Lepre, Jorge; Rice, J Jeremy; Tu, Yuhai; Stolovitzky, Gustavo

    2004-05-01

    Despite the growing literature devoted to finding differentially expressed genes in assays probing different tissues types, little attention has been paid to the combinatorial nature of feature selection inherent to large, high-dimensional gene expression datasets. New flexible data analysis approaches capable of searching relevant subgroups of genes and experiments are needed to understand multivariate associations of gene expression patterns with observed phenotypes. We present in detail a deterministic algorithm to discover patterns of multivariate gene associations in gene expression data. The patterns discovered are differential with respect to a control dataset. The algorithm is exhaustive and efficient, reporting all existent patterns that fit a given input parameter set while avoiding enumeration of the entire pattern space. The value of the pattern discovery approach is demonstrated by finding a set of genes that differentiate between two types of lymphoma. Moreover, these genes are found to behave consistently in an independent dataset produced in a different laboratory using different arrays, thus validating the genes selected using our algorithm. We show that the genes deemed significant in terms of their multivariate statistics will be missed using other methods. Our set of pattern discovery algorithms including a user interface is distributed as a package called Genes@Work. This package is freely available to non-commercial users and can be downloaded from our website (http://www.research.ibm.com/FunGen).

  8. Course 10: Three Lectures on Biological Networks

    NASA Astrophysics Data System (ADS)

    Magnasco, M. O.

    1 Enzymatic networks. Proofreading knots: How DNA topoisomerases disentangle DNA 1.1 Length scales and energy scales 1.2 DNA topology 1.3 Topoisomerases 1.4 Knots and supercoils 1.5 Topological equilibrium 1.6 Can topoisomerases recognize topology? 1.7 Proposal: Kinetic proofreading 1.8 How to do it twice 1.9 The care and proofreading of knots 1.10 Suppression of supercoils 1.11 Problems and outlook 1.12 Disquisition 2 Gene expression networks. Methods for analysis of DNA chip experiments 2.1 The regulation of gene expression 2.2 Gene expression arrays 2.3 Analysis of array data 2.4 Some simplifying assumptions 2.5 Probeset analysis 2.6 Discussion 3 Neural and gene expression networks: Song-induced gene expression in the canary brain 3.1 The study of songbirds 3.2 Canary song 3.3 ZENK 3.4 The blush 3.5 Histological analysis 3.6 Natural vs. artificial 3.7 The Blush II: gAP 3.8 Meditation

  9. Patterns of gene expression in a scleractinian coral undergoing natural bleaching.

    PubMed

    Seneca, Francois O; Forêt, Sylvain; Ball, Eldon E; Smith-Keune, Carolyn; Miller, David J; van Oppen, Madeleine J H

    2010-10-01

    Coral bleaching is a major threat to coral reefs worldwide and is predicted to intensify with increasing global temperature. This study represents the first investigation of gene expression in an Indo-Pacific coral species undergoing natural bleaching which involved the loss of algal symbionts. Quantitative real-time polymerase chain reaction experiments were conducted to select and evaluate coral internal control genes (ICGs), and to investigate selected coral genes of interest (GOIs) for changes in gene expression in nine colonies of the scleractinian coral Acropora millepora undergoing bleaching at Magnetic Island, Great Barrier Reef, Australia. Among the six ICGs tested, glyceraldehyde 3-phosphate dehydrogenase and the ribosomal protein genes S7 and L9 exhibited the most constant expression levels between samples from healthy-looking colonies and samples from the same colonies when severely bleached a year later. These ICGs were therefore utilised for normalisation of expression data for seven selected GOIs. Of the seven GOIs, homologues of catalase, C-type lectin and chromoprotein genes were significantly up-regulated as a result of bleaching by factors of 1.81, 1.46 and 1.61 (linear mixed models analysis of variance, P < 0.05), respectively. We present these genes as potential coral bleaching response genes. In contrast, three genes, including one putative ICG, showed highly variable levels of expression between coral colonies. Potential variation in microhabitat, gene function unrelated to the stress response and individualised stress responses may influence such differences between colonies and need to be better understood when designing and interpreting future studies of gene expression in natural coral populations.

  10. Evaluation and Selection of Appropriate Reference Genes for Real-Time Quantitative PCR Analysis of Gene Expression in Nile Tilapia (Oreochromis niloticus) during Vaccination and Infection

    PubMed Central

    Wang, Erlong; Wang, Kaiyu; Chen, Defang; Wang, Jun; He, Yang; Long, Bo; Yang, Lei; Yang, Qian; Geng, Yi; Huang, Xiaoli; Ouyang, Ping; Lai, Weimin

    2015-01-01

    qPCR as a powerful and attractive methodology has been widely applied to aquaculture researches for gene expression analyses. However, the suitable reference selection is critical for normalizing target genes expression in qPCR. In the present study, six commonly used endogenous controls were selected as candidate reference genes to evaluate and analyze their expression levels, stabilities and normalization to immune-related gene IgM expression during vaccination and infection in spleen of tilapia with RefFinder and GeNorm programs. The results showed that all of these candidate reference genes exhibited transcriptional variations to some extent at different periods. Among them, EF1A was the most stable reference with RefFinder, followed by 18S rRNA, ACTB, UBCE, TUBA and GAPDH respectively and the optimal number of reference genes for IgM normalization under different experiment sets was two with GeNorm. Meanwhile, combination the Cq (quantification cycle) value and the recommended comprehensive ranking of reference genes, EF1A and ACTB, the two optimal reference genes, were used together as reference genes for accurate analysis of immune-related gene expression during vaccination and infection in Nile tilapia with qPCR. Moreover, the highest IgM expression level was at two weeks post-vaccination when normalized to EF1A, 18S rRNA, ACTB, and EF1A together with ACTB compared to one week post-vaccination before normalizing, which was also consistent with the IgM antibody titers detection by ELISA. PMID:25941937

  11. Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory.

    PubMed

    Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J; Honjo, Mie N; Fukuda, Hirokazu

    2015-01-01

    In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions.

  12. Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory

    PubMed Central

    Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J.; Honjo, Mie N.; Fukuda, Hirokazu

    2015-01-01

    In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions. PMID:26624004

  13. Reference genes for reverse transcription quantitative PCR in canine brain tissue.

    PubMed

    Stassen, Quirine E M; Riemers, Frank M; Reijmerink, Hannah; Leegwater, Peter A J; Penning, Louis C

    2015-12-09

    In the last decade canine models have been used extensively to study genetic causes of neurological disorders such as epilepsy and Alzheimer's disease and unravel their pathophysiological pathways. Reverse transcription quantitative polymerase chain reaction is a sensitive and inexpensive method to study expression levels of genes involved in disease processes. Accurate normalisation with stably expressed so-called reference genes is crucial for reliable expression analysis. Following the minimum information for publication of quantitative real-time PCR experiments precise guidelines, the expression of ten frequently used reference genes, namely YWHAZ, HMBS, B2M, SDHA, GAPDH, HPRT, RPL13A, RPS5, RPS19 and GUSB was evaluated in seven brain regions (frontal lobe, parietal lobe, occipital lobe, temporal lobe, thalamus, hippocampus and cerebellum) and whole brain of healthy dogs. The stability of expression varied between different brain areas. Using the GeNorm and Normfinder software HMBS, GAPDH and HPRT were the most reliable reference genes for whole brain. Furthermore based on GeNorm calculations it was concluded that as little as two to three reference genes are sufficient to obtain reliable normalisation, irrespective the brain area. Our results amend/extend the limited previously published data on canine brain reference genes. Despite the excellent expression stability of HMBS, GAPDH and HRPT, the evaluation of expression stability of reference genes must be a standard and integral part of experimental design and subsequent data analysis.

  14. Transcriptional response of Pasteurella multocida to defined iron sources.

    PubMed

    Paustian, Michael L; May, Barbara J; Cao, Dongwei; Boley, Daniel; Kapur, Vivek

    2002-12-01

    Pasteurella multocida was grown in iron-free chemically defined medium supplemented with hemoglobin, transferrin, ferritin, and ferric citrate as iron sources. Whole-genome DNA microarrays were used to monitor global gene expression over seven time points after the addition of the defined iron source to the medium. This resulted in a set of data containing over 338,000 gene expression observations. On average, 12% of P. multocida genes were differentially expressed under any single condition. A majority of these genes encoded P. multocida proteins that were involved in either transport and binding or were annotated as hypothetical proteins. Several trends are evident when the data from different iron sources are compared. In general, only two genes (ptsN and sapD) were expressed at elevated levels under all of the conditions tested. The results also show that genes with increased expression in the presence of hemoglobin did not respond to transferrin or ferritin as an iron source. Correspondingly, genes with increased expression in the transferrin and ferritin experiments were expressed at reduced levels when hemoglobin was supplied as the sole iron source. Finally, the data show that genes that were most responsive to the presence of ferric citrate did not follow a trend similar to that of the other iron sources, suggesting that different pathways respond to inorganic or organic sources of iron in P. multocida. Taken together, our results demonstrate that unique subsets of P. multocida genes are expressed in response to different iron sources and that many of these genes have yet to be functionally characterized.

  15. Gene Expression Profiling Specifies Chemokine, Mitochondrial and Lipid Metabolism Signatures in Leprosy

    PubMed Central

    Guerreiro, Luana Tatiana Albuquerque; Robottom-Ferreira, Anna Beatriz; Ribeiro-Alves, Marcelo; Toledo-Pinto, Thiago Gomes; Rosa Brito, Tiana; Rosa, Patrícia Sammarco; Sandoval, Felipe Galvan; Jardim, Márcia Rodrigues; Antunes, Sérgio Gomes; Shannon, Edward J.; Sarno, Euzenir Nunes; Pessolani, Maria Cristina Vidal; Williams, Diana Lynn; Moraes, Milton Ozório

    2013-01-01

    Herein, we performed microarray experiments in Schwann cells infected with live M. leprae and identified novel differentially expressed genes (DEG) in M. leprae infected cells. Also, we selected candidate genes associated or implicated with leprosy in genetic studies and biological experiments. Forty-seven genes were selected for validation in two independent types of samples by multiplex qPCR. First, an in vitro model using THP-1 cells was infected with live Mycobacterium leprae and M. bovis bacillus Calmette-Guérin (BCG). In a second situation, mRNA obtained from nerve biopsies from patients with leprosy or other peripheral neuropathies was tested. We detected DEGs that discriminate M. bovis BCG from M. leprae infection. Specific signatures of susceptible responses after M. leprae infection when compared to BCG lead to repression of genes, including CCL2, CCL3, IL8 and SOD2. The same 47-gene set was screened in nerve biopsies, which corroborated the down-regulation of CCL2 and CCL3 in leprosy, but also evidenced the down-regulation of genes involved in mitochondrial metabolism, and the up-regulation of genes involved in lipid metabolism and ubiquitination. Finally, a gene expression signature from DEG was identified in patients confirmed of having leprosy. A classification tree was able to ascertain 80% of the cases as leprosy or non-leprous peripheral neuropathy based on the expression of only LDLR and CCL4. A general immune and mitochondrial hypo-responsive state occurs in response to M. leprae infection. Also, the most important genes and pathways have been highlighted providing new tools for early diagnosis and treatment of leprosy. PMID:23798993

  16. Characterization of Gravity Regulated Osteoprotegerin Expression in Fish Models

    NASA Astrophysics Data System (ADS)

    Renn, J.; Nourizadeh-Lillabadi, R.; Alestrom, P.; Seibt, D.; Goerlich, R.; Schartl, M.; Winkler, C.

    Human osteoprotegerin (opg) is a secreted protein of 401 amino acids that acts as a decoy receptor for RANKL (receptor activator of NFB ligand). Opg prevents binding of RANKL to its receptor, which is present on osteoclasts and their precursors. Thereby, opg blocks the formation, differentiation and activation of osteoclasts and stimulates apoptosis of mature osteoclasts. As a consequence, opg regulates the degree of bone resorption in order to keep a constant bone mass under normal gravity conditions. Recently, clinorotation experiments using mammalian cell cultures have shown that the opg gene is down-regulated in simulated microgravity at the transcriptional level (Kanematsu et al., Bone 30, 2002). We have identified opg genes in the fish models Medaka and zebrafish to study gravity regulation of opg expression in these models at the organismal level. In Medaka embryos, opg expression starts at stages when first skeletal elements are already detectable. Putative consensus binding sites for transcription factors were identified in the promoter region of the Medaka opg gene indicating possible evolutionary conservation of gene regulatory mechanisms between fish and mammals. To analyze, whether model fish species are suitable tools to study microgravity induced changes at the molecular level in vivo, we investigated regulation of fish opg genes as a consequence of altered gravity. For this, we performed centrifugation and clinorotation experiments, subjecting fish larvae to hypergravity and simulated microgravity, and analyzed expression profiles of skeletal genes by real-time PCR. Our data represent the first experiments using whole animal model organisms to study gravity induced alteration of skeletal factors at the molecular level. Acknowledgement: This work is supported by the German Aerospace Center (DLR) (50 WB 0152) and the European Space Agency (AO-LS-99-MAP-LSS-003).

  17. Evaluation of Suitable Reference Genes for Normalization of qPCR Gene Expression Studies in Brinjal (Solanum melongena L.) During Fruit Developmental Stages.

    PubMed

    Kanakachari, Mogilicherla; Solanke, Amolkumar U; Prabhakaran, Narayanasamy; Ahmad, Israr; Dhandapani, Gurusamy; Jayabalan, Narayanasamy; Kumar, Polumetla Ananda

    2016-02-01

    Brinjal/eggplant/aubergine is one of the major solanaceous vegetable crops. Recent availability of genome information greatly facilitates the fundamental research on brinjal. Gene expression patterns during different stages of fruit development can provide clues towards the understanding of its biological functions. Quantitative real-time PCR (qPCR) has become one of the most widely used methods for rapid and accurate quantification of gene expression. However, its success depends on the use of a suitable reference gene for data normalization. For qPCR analysis, a single reference gene is not universally suitable for all experiments. Therefore, reference gene validation is a crucial step. Suitable reference genes for qPCR analysis of brinjal fruit development have not been investigated so far. In this study, we have selected 21 candidate reference genes from the Brinjal (Solanum melongena) Plant Gene Indices database (compbio.dfci.harvard.edu/tgi/plant.html) and studied their expression profiles by qPCR during six different fruit developmental stages (0, 5, 10, 20, 30, and 50 days post anthesis) along with leaf samples of the Pusa Purple Long (PPL) variety. To evaluate the stability of gene expression, geNorm and NormFinder analytical softwares were used. geNorm identified SAND (SAND family protein) and TBP (TATA binding protein) as the best pairs of reference genes in brinjal fruit development. The results showed that for brinjal fruit development, individual or a combination of reference genes should be selected for data normalization. NormFinder identified Expressed gene (expressed sequence) as the best single reference gene in brinjal fruit development. In this study, we have identified and validated for the first time reference genes to provide accurate transcript normalization and quantification at various fruit developmental stages of brinjal which can also be useful for gene expression studies in other Solanaceae plant species.

  18. Differentiation of EL4 lymphoma cells by tumoral environment is associated with inappropriate expression of the large chondroitin sulfate proteoglycan PG-M and the tumor-associated antigen HTgp-175.

    PubMed

    Rottiers, P; Verfaillie, T; Contreras, R; Revets, H; Desmedt, M; Dooms, H; Fiers, W; Grooten, J

    1998-11-09

    Progression to malignancy of transformed cells involves complex genetic alterations and aberrant gene expression patterns. While aberrant gene expression is often caused by alterations in individual genes, the contribution of the tumoral environment to the triggering of this gene expression is less well established. The stable but heterogeneous expression in cultured EL4/13 cells of a novel tumor-associated antigen, designated as HTgp-175, was chosen for the investigation of gene expression during tumor formation. Homogeneously HTgp-175-negative EL4/13 cells, isolated by cell sorting or obtained by subcloning, acquired HTgp-175 expression as a result of tumor formation. The tumorigenicity of HTgp-175-negative vs. HTgp-175-positive EL4 variants was identical, indicating that induction but not selection accounted for the phenotypic switch from HTgp-175-negative to HTgp-175-positive. Although mutagenesis experiments showed that the protein was not essential for tumor establishment, tumor-derived cells showed increased malignancy, linking HTgp-175 expression with genetic changes accompanying tumor progression. This novel gene expression was not an isolated event, since it was accompanied by ectopic expression of the large chondroitin sulfate proteoglycan PG-M and of normal differentiation antigens. We conclude that signals derived from the tumoral microenvironment contribute significantly to the aberrant gene expression pattern of malignant cells, apparently by fortuitous activation of differentiation processes and cause expression of novel differentiation antigens as well as of inappropriate tumor-associated and ectopic antigens.

  19. Fox (forkhead) genes are involved in the dorso-ventral patterning of the Xenopus mesoderm.

    PubMed

    El-Hodiri, H; Bhatia-Dey, N; Kenyon, K; Ault, K; Dirksen, M; Jamrich, M

    2001-01-01

    Fox (forkhead/winged helix) genes encode a family of transcription factors that are involved in embryonic pattern formation, regulation of tissue specific gene expression and tumorigenesis. Several of them are transcribed during Xenopus embryogenesis and are important for the patterning of ectoderm, mesoderm and endoderm. We have isolated three forkhead genes that are activated during gastrulation and play an important role in the dorso-ventral patterning of the mesoderm. XFKH1 (FoxA4b), the first vertebrate forkhead gene to be implicated in embryonic pattern formation, is expressed in the Spemann-Mangold organizer region and later in the embryonic notochord. XFKH7, the Xenopus orthologue of the murine Mfh1(Foxc2), is expressed in the presomitic mesoderm, but not in the notochord or lateral plate mesoderm. Finally, XFD-13'(FoxF1b)1 is expressed in the lateral plate mesoderm, but not in the notochord or presomitic mesoderm. Expression pattern and functional experiments indicate that these three forkhead genes are involved in the dorso-ventral patterning of the mesoderm.

  20. Clustering approaches to identifying gene expression patterns from DNA microarray data.

    PubMed

    Do, Jin Hwan; Choi, Dong-Kug

    2008-04-30

    The analysis of microarray data is essential for large amounts of gene expression data. In this review we focus on clustering techniques. The biological rationale for this approach is the fact that many co-expressed genes are co-regulated, and identifying co-expressed genes could aid in functional annotation of novel genes, de novo identification of transcription factor binding sites and elucidation of complex biological pathways. Co-expressed genes are usually identified in microarray experiments by clustering techniques. There are many such methods, and the results obtained even for the same datasets may vary considerably depending on the algorithms and metrics for dissimilarity measures used, as well as on user-selectable parameters such as desired number of clusters and initial values. Therefore, biologists who want to interpret microarray data should be aware of the weakness and strengths of the clustering methods used. In this review, we survey the basic principles of clustering of DNA microarray data from crisp clustering algorithms such as hierarchical clustering, K-means and self-organizing maps, to complex clustering algorithms like fuzzy clustering.

  1. IDP-ASE: haplotyping and quantifying allele-specific expression at the gene and gene isoform level by hybrid sequencing

    PubMed Central

    Deonovic, Benjamin; Wang, Yunhao; Weirather, Jason; Wang, Xiu-Jie; Au, Kin Fai

    2017-01-01

    Abstract Allele-specific expression (ASE) is a fundamental problem in studying gene regulation and diploid transcriptome profiles, with two key challenges: (i) haplotyping and (ii) estimation of ASE at the gene isoform level. Existing ASE analysis methods are limited by a dependence on haplotyping from laborious experiments or extra genome/family trio data. In addition, there is a lack of methods for gene isoform level ASE analysis. We developed a tool, IDP-ASE, for full ASE analysis. By innovative integration of Third Generation Sequencing (TGS) long reads with Second Generation Sequencing (SGS) short reads, the accuracy of haplotyping and ASE quantification at the gene and gene isoform level was greatly improved as demonstrated by the gold standard data GM12878 data and semi-simulation data. In addition to methodology development, applications of IDP-ASE to human embryonic stem cells and breast cancer cells indicate that the imbalance of ASE and non-uniformity of gene isoform ASE is widespread, including tumorigenesis relevant genes and pluripotency markers. These results show that gene isoform expression and allele-specific expression cooperate to provide high diversity and complexity of gene regulation and expression, highlighting the importance of studying ASE at the gene isoform level. Our study provides a robust bioinformatics solution to understand ASE using RNA sequencing data only. PMID:27899656

  2. Effects of a social stimulus on gene expression in a mouse model of fragile X syndrome.

    PubMed

    Rogers, Tiffany D; Anacker, Allison M J; Kerr, Travis M; Forsberg, C Gunnar; Wang, Jing; Zhang, Bing; Veenstra-VanderWeele, Jeremy

    2017-01-01

    People with fragile X syndrome (FXS) often have deficits in social behavior, and a substantial portion meet criteria for autism spectrum disorder. Though the genetic cause of FXS is known to be due to the silencing of FMR1 , and the Fmr1 null mouse model representing this lesion has been extensively studied, the contributions of this gene and its protein product, FMRP, to social behavior are not well understood. Fmr1 null mice and wildtype littermates were exposed to a social or non-social stimulus. In one experiment, subjects were assessed for expression of the inducible transcription factor c-Fos in response to the stimulus, to detect brain regions with social-specific activity. In a separate experiment, tissue was taken from those brain regions showing differential activity, and RNA sequencing was performed. Immunohistochemistry revealed a significantly greater number of c-Fos-positive cells in the lateral amygdala and medial amygdala in the brains of mice exposed to a social stimulus, compared to a non-social stimulus. In the prelimbic cortex, there was no significant effect of social stimulus; although the number of c-Fos-positive cells was lower in the social condition compared to the non-social condition, and negatively correlated with c-Fos in the amygdala. RNA sequencing revealed differentially expressed genes enriched for molecules known to interact with FMRP and also for autism-related genes identified in the Simons Foundation Autism Research Initiative gene database. Ingenuity Pathway Analysis detected enrichment of differentially expressed genes in networks and pathways related to neuronal development, intracellular signaling, and inflammatory response. Using the Fmr1 null mouse model of fragile X syndrome, we have identified brain regions, gene networks, and molecular pathways responsive to a social stimulus. These findings, and future experiments following up on the role of specific gene networks, may shed light on the neural mechanisms underlying dysregulated social behaviors in fragile X syndrome and more broadly.

  3. Lhx2 Determines Odorant Receptor Expression Frequency in Mature Olfactory Sensory Neurons

    PubMed Central

    Zhang, Guangfan; Titlow, William B.; Biecker, Stephanie M.; Stromberg, Arnold J.

    2016-01-01

    Abstract A developmental program of epigenetic repression prepares each mammalian olfactory sensory neuron (OSN) to strongly express one allele from just one of hundreds of odorant receptor (OR) genes, but what completes this process of OR gene choice by driving the expression of this allele is incompletely understood. Conditional deletion experiments in mice demonstrate that Lhx2 is necessary for normal expression frequencies of nearly all ORs and all trace amine-associated receptors, irrespective of whether the deletion of Lhx2 is initiated in immature or mature OSNs. Given previous evidence that Lhx2 binds OR gene control elements, these findings indicate that Lhx2 is directly involved in driving OR expression. The data also support the conclusion that OR expression is necessary to allow immature OSNs to complete differentiation and become mature. In contrast to the robust effects of conditional deletion of Lhx2, the loss of Emx2 has much smaller effects and more often causes increased expression frequencies. Lhx2:Emx2 double mutants show opposing effects on Olfr15 expression that reveal independent effects of these two transcription factors. While Lhx2 is necessary for OR expression that supports OR gene choice, Emx2 can act differently; perhaps by helping to control the availability of OR genes for expression. PMID:27822500

  4. Cross-study projections of genomic biomarkers: an evaluation in cancer genomics.

    PubMed

    Lucas, Joseph E; Carvalho, Carlos M; Chen, Julia Ling-Yu; Chi, Jen-Tsan; West, Mike

    2009-01-01

    Human disease studies using DNA microarrays in both clinical/observational and experimental/controlled studies are having increasing impact on our understanding of the complexity of human diseases. A fundamental concept is the use of gene expression as a "common currency" that links the results of in vitro controlled experiments to in vivo observational human studies. Many studies--in cancer and other diseases--have shown promise in using in vitro cell manipulations to improve understanding of in vivo biology, but experiments often simply fail to reflect the enormous phenotypic variation seen in human diseases. We address this with a framework and methods to dissect, enhance and extend the in vivo utility of in vitro derived gene expression signatures. From an experimentally defined gene expression signature we use statistical factor analysis to generate multiple quantitative factors in human cancer gene expression data. These factors retain their relationship to the original, one-dimensional in vitro signature but better describe the diversity of in vivo biology. In a breast cancer analysis, we show that factors can reflect fundamentally different biological processes linked to molecular and clinical features of human cancers, and that in combination they can improve prediction of clinical outcomes.

  5. Analysis of genetic association using hierarchical clustering and cluster validation indices.

    PubMed

    Pagnuco, Inti A; Pastore, Juan I; Abras, Guillermo; Brun, Marcel; Ballarin, Virginia L

    2017-10-01

    It is usually assumed that co-expressed genes suggest co-regulation in the underlying regulatory network. Determining sets of co-expressed genes is an important task, based on some criteria of similarity. This task is usually performed by clustering algorithms, where the genes are clustered into meaningful groups based on their expression values in a set of experiment. In this work, we propose a method to find sets of co-expressed genes, based on cluster validation indices as a measure of similarity for individual gene groups, and a combination of variants of hierarchical clustering to generate the candidate groups. We evaluated its ability to retrieve significant sets on simulated correlated and real genomics data, where the performance is measured based on its detection ability of co-regulated sets against a full search. Additionally, we analyzed the quality of the best ranked groups using an online bioinformatics tool that provides network information for the selected genes. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. GENE EXPRESSION CHANGES AFTER SEIZURE PRECONDITIONING IN THE THREE MAJOR HIPPOCAMPAL CELL LAYERS

    PubMed Central

    Borges, Karin; Shaw, Renee; Dingledine, Raymond

    2008-01-01

    Rodents experience hippocampal damage after status epilepticus (SE) mainly in pyramidal cells while sparing the dentate granule cell layer (DGCL). Hippocampal damage was prevented in rats that had been preconditioned by brief seizures on two consecutive days before SE. To identify neuroprotective genes and biochemical pathways changed after preconditioning we compared the effect of preconditioning on gene expression in the CA1 and CA3 pyramidal and DGCLs, harvested by laser capture microscopy. In the DGCL the expression of 632 genes was altered, compared to only 151 and 58 genes in CA1 and CA3 pyramidal cell layers. Most of the differentially expressed genes regulate tissue structure and intra- and extracellular signaling, including neurotransmission. A selective upregulation of energy metabolism transcripts occurred in CA1 pyramidal cells relative to the DGCL. These results reveal a broad transcriptional response of the DGCL to preconditioning, and suggest several mechanisms underlying the neuroprotective effect of preconditioning seizures. PMID:17239605

  7. Quantifying Extrinsic Noise in Gene Expression Using the Maximum Entropy Framework

    PubMed Central

    Dixit, Purushottam D.

    2013-01-01

    We present a maximum entropy framework to separate intrinsic and extrinsic contributions to noisy gene expression solely from the profile of expression. We express the experimentally accessible probability distribution of the copy number of the gene product (mRNA or protein) by accounting for possible variations in extrinsic factors. The distribution of extrinsic factors is estimated using the maximum entropy principle. Our results show that extrinsic factors qualitatively and quantitatively affect the probability distribution of the gene product. We work out, in detail, the transcription of mRNA from a constitutively expressed promoter in Escherichia coli. We suggest that the variation in extrinsic factors may account for the observed wider-than-Poisson distribution of mRNA copy numbers. We successfully test our framework on a numerical simulation of a simple gene expression scheme that accounts for the variation in extrinsic factors. We also make falsifiable predictions, some of which are tested on previous experiments in E. coli whereas others need verification. Application of the presented framework to more complex situations is also discussed. PMID:23790383

  8. Quantifying extrinsic noise in gene expression using the maximum entropy framework.

    PubMed

    Dixit, Purushottam D

    2013-06-18

    We present a maximum entropy framework to separate intrinsic and extrinsic contributions to noisy gene expression solely from the profile of expression. We express the experimentally accessible probability distribution of the copy number of the gene product (mRNA or protein) by accounting for possible variations in extrinsic factors. The distribution of extrinsic factors is estimated using the maximum entropy principle. Our results show that extrinsic factors qualitatively and quantitatively affect the probability distribution of the gene product. We work out, in detail, the transcription of mRNA from a constitutively expressed promoter in Escherichia coli. We suggest that the variation in extrinsic factors may account for the observed wider-than-Poisson distribution of mRNA copy numbers. We successfully test our framework on a numerical simulation of a simple gene expression scheme that accounts for the variation in extrinsic factors. We also make falsifiable predictions, some of which are tested on previous experiments in E. coli whereas others need verification. Application of the presented framework to more complex situations is also discussed. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  9. A stele-enriched gene regulatory network in the Arabidopsis root

    PubMed Central

    Brady, Siobhan M; Zhang, Lifang; Megraw, Molly; Martinez, Natalia J; Jiang, Eric; Yi, Charles S; Liu, Weilin; Zeng, Anna; Taylor-Teeples, Mallorie; Kim, Dahae; Ahnert, Sebastian; Ohler, Uwe; Ware, Doreen; Walhout, Albertha J M; Benfey, Philip N

    2011-01-01

    Tightly controlled gene expression is a hallmark of multicellular development and is accomplished by transcription factors (TFs) and microRNAs (miRNAs). Although many studies have focused on identifying downstream targets of these molecules, less is known about the factors that regulate their differential expression. We used data from high spatial resolution gene expression experiments and yeast one-hybrid (Y1H) and two-hybrid (Y2H) assays to delineate a subset of interactions occurring within a gene regulatory network (GRN) that determines tissue-specific TF and miRNA expression in plants. We find that upstream TFs are expressed in more diverse cell types than their targets and that promoters that are bound by a relatively large number of TFs correspond to key developmental regulators. The regulatory consequence of many TFs for their target was experimentally determined using genetic analysis. Remarkably, molecular phenotypes were identified for 65% of the TFs, but morphological phenotypes were associated with only 16%. This indicates that the GRN is robust, and that gene expression changes may be canalized or buffered. PMID:21245844

  10. Arabidopsis gene expression patterns are altered during spaceflight

    NASA Astrophysics Data System (ADS)

    Paul, Anna-Lisa; Popp, Michael P.; Gurley, William B.; Guy, Charles; Norwood, Kelly L.; Ferl, Robert J.

    The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments results in differential gene expression. A 5-day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β-Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on gene expression patterns initially by using the Adh/GUS transgene to address specifically the possibility that spaceflight induces a hypoxic stress response (Paul, A.L., Daugherty, C.J., Bihn, E.A., Chapman, D.K., Norwood, K.L., Ferl, R.J., 2001. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis, Plant Physiol. 126, 613-621). As a follow-on to the reporter gene analysis, we report here the evaluation of genome-wide patterns of native gene expression within Arabidopsis shoots utilizing the Agilent DNA array of 21,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes was further characterized with quantitative Real-Time RT PCR (ABI - Taqman®). Comparison of the patterns of expression for arrays probed with RNA isolated from plants exposed to spaceflight compared to RNA isolated from ground control plants revealed 182 genes that were differentially expressed in response to the spaceflight mission by more than 4-fold, and of those only 50 genes were expressed at levels chosen to support a conservative change call. None of the genes that are hallmarks of hypoxic stress were induced to this level. However, genes related to heat shock were dramatically induced - but in a pattern and under growth conditions that are not easily explained by elevated temperatures. These gene expression data are discussed in light of current models for plant responses to the spaceflight environment and with regard to potential future spaceflight experiment opportunities.

  11. Aflatoxin formation and gene expression in response to carbon source media shift in Aspergillus parasiticus.

    PubMed

    Wilkinson, J R; Yu, J; Abbas, H K; Scheffler, B E; Kim, H S; Nierman, W C; Bhatnagar, D; Cleveland, T E

    2007-10-01

    Aflatoxins are toxic and carcinogenic polyketide metabolites produced by fungal species, including Aspergillus flavus and A. parasiticus. The biosynthesis of aflatoxins is modulated by many environmental factors, including the availability of a carbon source. The gene expression profile of A. parasiticus was evaluated during a shift from a medium with low concentration of simple sugars, yeast extract (YE), to a similar medium with sucrose, yeast extract sucrose (YES). Gene expression and aflatoxins (B1, B2, G1, and G2) were quantified from fungal mycelia harvested pre- and post-shifting. When compared with YE media, YES caused temporary reduction of the aflatoxin levels detected at 3-h post-shifting and they remained low well past 12 h post-shift. Aflatoxin levels did not exceed the levels in YE until 24 h post-shift, at which time point a tenfold increase was observed over YE. Microarray analysis comparing the RNA samples from the 48-h YE culture to the YES samples identified a total of 2120 genes that were expressed across all experiments, including most of the aflatoxin biosynthesis genes. One-way analysis of variance (ANOVA) identified 56 genes that were expressed with significant variation across all time points. Three genes responsible for converting norsolorinic acid to averantin were identified among these significantly expressed genes. The potential involvement of these genes in the regulation of aflatoxin biosynthesis is discussed.

  12. New target genes in endometrial tumors show a role for the estrogen-receptor pathway in microsatellite-unstable cancers.

    PubMed

    Ferreira, Ana M; Tuominen, Iina; Sousa, Sónia; Gerbens, Frans; van Dijk-Bos, Krista; Osinga, Jan; Kooi, Krista A; Sanjabi, Bahram; Esendam, Chris; Oliveira, Carla; Terpstra, Peter; Hardonk, Menno; van der Sluis, Tineke; Zazula, Monika; Stachura, Jerzy; van der Zee, Ate G; Hollema, Harry; Sijmons, Rolf H; Aaltonen, Lauri A; Seruca, Raquel; Hofstra, Robert M W; Westers, Helga

    2014-12-01

    Microsatellite instability (MSI) in tumors results in an accumulation of mutations in (target) genes. Previous studies suggest that the profile of target genes differs according to tumor type. This paper describes the first genome-wide search for target genes for mismatch repair-deficient endometrial cancers. Genes expressed in normal endometrium containing coding repeats were analyzed for mutations in tumors. We identified 44 possible genes of which seven are highly mutated (>15%). Some candidates were also found mutated in colorectal and gastric tumors. The most frequently mutated gene, NRIP1 encoding nuclear receptor-interacting protein 1, was silenced in an endometrial tumor cell line and expression microarray experiments were performed. Silencing of NRIP1 was associated with differences in the expression of several genes in the estrogen-receptor network. Furthermore, an enrichment of genes related to cell cycle (regulation) and replication was observed. We present a new profile of target genes, some of them tissue specific, whereas others seem to play a more general role in MSI tumors. The high-mutation frequency combined with the expression data suggest, for the first time, an involvement of NRIP1 in endometrial cancer development. © 2014 WILEY PERIODICALS, INC.

  13. Transient Gene and miRNA Expression Profile Changes of Confluent Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Lu, Tao; Wong, Michael; Feiveson, Alan; Stodieck, Louis; Karouia, Fathi; Wang, Xiaoyu; Wu, Honglu

    2015-01-01

    Microgravity or an altered gravity environment from the static 1 gravitational constant has been shown to influence global gene expression patterns and protein levels in cultured cells. However, most of the reported studies conducted in space or using simulated microgravity on the ground have focused on the growth or differentiation of the cells. Whether non-dividing cultured cells will sense the presence of microgravity in space has not been specifically addressed. In an experiment conducted on the International Space Station, confluent human fibroblast cells were fixed after being cultured in space for 3 and 14 days for investigations of gene and miRNA (microRNA) expression profile changes in these cells. A fibroblast is a type of cell that synthesizes the extracellular matrix and collagen, the structural framework for tissues, and plays a critical role in wound healing and other functions. Results of the experiment showed that on Day 3, both the flown and ground cells were still proliferating slowly even though they were confluent, as measured by the expression of the protein Ki-67 positive cells, and the cells in space grew slightly faster. Gene and miRNA expression data indicated activation of NF(sub kappa)B (nuclear factor kappa-light-chain-enhancer of activated B cells) and other growth related pathways involving HGF and VEGF in the flown cells. On Day 14 when the cells were mostly non-dividing, the gene and miRNA expression profiles between the flight and ground samples were indistinguishable. Comparison of gene and miRNA expressions in the Day 3 samples in respect to Day 14 revealed that most of the changes observed on Day 3 were related to cell growth for both the flown and ground cells. Analysis of cytoskeleton changes by immunohistochemistry staining of the cells with antibodies for alpha-tubulin showed no difference between the flight and ground samples. Results of our study suggest that in true non-dividing human fibroblast cells, microgravity in space has little effect on the gene and miRNA expression. Gene and miRNA expression changes were observed in cells that were confluent, but still proliferating slowly. The faster growth in the flown cells was associated with the activation of NF(sub kappa)B pathways which triggers the expression of several growth factors and the suppression of the cell cycle checkpoint.

  14. Variable directionality of gene expression changes across generations does not constitute negative evidence of epigenetic inheritance.

    PubMed

    Sharma, Abhay

    2015-01-01

    Transgenerational epigenetic inheritance in mammals has been controversial due to inherent difficulties in its experimental demonstration. A recent report has, however, opened a new front in the ongoing debate by claiming that endocrine disrupting chemicals, contrary to previous findings, do not cause effects across generations. This claim is based on the observation that gene expression changes induced by these chemicals in the exposed and unexposed generations are mainly in the opposite direction. This analysis shows that the pattern of gene expression reported in the two generations is not expected by chance and is suggestive of transmission across generations. A meta-analysis of diverse data sets related to endocrine disruptor-induced transgenerational gene expression alterations, including the data provided in the said report, further suggests that effects of endocrine disrupting chemicals persist in unexposed generations. Based on the prior evidence of phenotypic variability and gene expression alterations in opposite direction between generations, it is argued here that calling evidence of mismatched directionality in gene expression in experiments testing potential of environmental agents in inducing epigenetic inheritance of phenotypic traits as negative is untenable. This is expected to settle the newly raised doubts over epigenetic inheritance in mammals.

  15. Computational Selection of Transcriptomics Experiments Improves Guilt-by-Association Analyses

    PubMed Central

    Bhat, Prajwal; Yang, Haixuan; Bögre, László; Devoto, Alessandra; Paccanaro, Alberto

    2012-01-01

    The Guilt-by-Association (GBA) principle, according to which genes with similar expression profiles are functionally associated, is widely applied for functional analyses using large heterogeneous collections of transcriptomics data. However, the use of such large collections could hamper GBA functional analysis for genes whose expression is condition specific. In these cases a smaller set of condition related experiments should instead be used, but identifying such functionally relevant experiments from large collections based on literature knowledge alone is an impractical task. We begin this paper by analyzing, both from a mathematical and a biological point of view, why only condition specific experiments should be used in GBA functional analysis. We are able to show that this phenomenon is independent of the functional categorization scheme and of the organisms being analyzed. We then present a semi-supervised algorithm that can select functionally relevant experiments from large collections of transcriptomics experiments. Our algorithm is able to select experiments relevant to a given GO term, MIPS FunCat term or even KEGG pathways. We extensively test our algorithm on large dataset collections for yeast and Arabidopsis. We demonstrate that: using the selected experiments there is a statistically significant improvement in correlation between genes in the functional category of interest; the selected experiments improve GBA-based gene function prediction; the effectiveness of the selected experiments increases with annotation specificity; our algorithm can be successfully applied to GBA-based pathway reconstruction. Importantly, the set of experiments selected by the algorithm reflects the existing literature knowledge about the experiments. [A MATLAB implementation of the algorithm and all the data used in this paper can be downloaded from the paper website: http://www.paccanarolab.org/papers/CorrGene/]. PMID:22879875

  16. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study

    PubMed Central

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J.; Shafer, Martin M.; Sioutas, Constantinos; Gillen, Daniel L.; Delfino, Ralph J.

    2015-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM0.25-2.5 PAH and/or PM0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level. PMID:25564368

  17. Nrf2-related gene expression and exposure to traffic-related air pollution in elderly subjects with cardiovascular disease: An exploratory panel study.

    PubMed

    Wittkopp, Sharine; Staimer, Norbert; Tjoa, Thomas; Stinchcombe, Timothy; Daher, Nancy; Schauer, James J; Shafer, Martin M; Sioutas, Constantinos; Gillen, Daniel L; Delfino, Ralph J

    2016-01-01

    Gene expression changes are linked to air pollutant exposures in in vitro and animal experiments. However, limited data are available on how these outcomes relate to ambient air pollutant exposures in humans. We performed an exploratory analysis testing whether gene expression levels were associated with air pollution exposures in a Los Angeles area cohort of elderly subjects with coronary artery disease. Candidate genes (35) were selected from published studies of gene expression-pollutant associations. Expression levels were measured weekly in 43 subjects (≤ 12 weeks) using quantitative PCR. Exposures included gaseous pollutants O3, nitrogen oxides (NOx), and CO; particulate matter (PM) pollutants elemental and black carbon (EC, BC); and size-fractionated PM mass. We measured organic compounds from PM filter extracts, including polycyclic aromatic hydrocarbons (PAHs), and determined the in vitro oxidative potential of particle extracts. Associations between exposures and gene expression levels were analyzed using mixed-effects regression models. We found positive associations of traffic-related pollutants (EC, BC, primary organic carbon, PM 0.25-2.5 PAH and/or PM 0.25 PAH, and NOx) with NFE2L2, Nrf2-mediated genes (HMOX1, NQO1, and SOD2), CYP1B1, IL1B, and SELP. Findings suggest that NFE2L2 gene expression links associations of traffic-related air pollution with phase I and II enzyme genes at the promoter transcription level.

  18. Hepatic gene expression in rainbow trout (Oncorhynchus mykiss) exposed to different hydrocarbon mixtures.

    PubMed

    Hook, Sharon E; Lampi, Mark A; Febbo, Eric J; Ward, Jeff A; Parkerton, Thomas F

    2010-09-01

    Traditional biomarkers for hydrocarbon exposure are not induced by all petroleum substances. The objective of this study was to determine if exposure to a crude oil and different refined oils would generate a common hydrocarbon-specific response in gene expression profiles that could be used as generic biomarkers of hydrocarbon exposure. Juvenile rainbow trout (Oncorhynchus mykiss) were exposed to the water accommodated fraction (WAF) of either kerosene, gas oil, heavy fuel oil, or crude oil for 96 h. Tissue was collected for RNA extraction and microarray analysis. Exposure to each WAF resulted in a different list of differentially regulated genes, with few genes in common across treatments. Exposure to crude oil WAF changed the expression of genes including cytochrome P4501A (CYP1A) and glutathione-S-transferase (GST) with known roles in detoxification pathways. These gene expression profiles were compared to others from previous experiments that used a diverse suite of toxicants. Clustering algorithms successfully identified gene expression profiles resulting from hydrocarbon exposure. These preliminary analyses highlight the difficulties of using single genes as diagnostic of petroleum hydrocarbon exposures. Further work is needed to determine if multivariate transcriptomic-based biomarkers may be a more effective tool than single gene studies for exposure monitoring of different oils. Copyright 2010 SETAC.

  19. Gene switching in Amoeba proteus caused by endosymbiotic bacteria.

    PubMed

    Jeon, Taeck J; Jeon, Kwang W

    2004-02-01

    The expression of genes for S-adenosylmethionine synthetase (SAMS), which catalyzes the synthesis of S-adenosylmethionine (AdoMet), a major methyl donor in cells, was studied in symbiont-free (D) and symbiont-bearing (xD) amoeba strains to determine the effect of bacterial endosymbionts. The symbionts suppressed the expression of the gene in host xD amoebae, but amoebae still exhibited about half the enzyme activity found in symbiont-free D amoebae. The study was aimed at elucidating mechanisms of the suppression of the amoeba's gene and determining the alternative source for the gene product. Unexpectedly, we found a second sams (sams2) gene in amoebae, which encoded 390 amino acids. Results of experiments measuring SAMS activities and amounts of AdoMet in D and xD amoebae showed that the half SAMS activity found in xD amoebae came from the amoeba's SAMS2 and not from their endosymbionts. The expression of amoeba sams genes was switched from sams1 to sams2 as a result of infection with X-bacteria, raising the possibility that the switch in the expression of sams genes by bacteria plays a role in the development of symbiosis and the host-pathogen interactions. This is the first report showing such a switch in the expression of host sams genes by infecting bacteria.

  20. Pluripotency, Differentiation, and Reprogramming: A Gene Expression Dynamics Model with Epigenetic Feedback Regulation

    PubMed Central

    Miyamoto, Tadashi; Furusawa, Chikara; Kaneko, Kunihiko

    2015-01-01

    Embryonic stem cells exhibit pluripotency: they can differentiate into all types of somatic cells. Pluripotent genes such as Oct4 and Nanog are activated in the pluripotent state, and their expression decreases during cell differentiation. Inversely, expression of differentiation genes such as Gata6 and Gata4 is promoted during differentiation. The gene regulatory network controlling the expression of these genes has been described, and slower-scale epigenetic modifications have been uncovered. Although the differentiation of pluripotent stem cells is normally irreversible, reprogramming of cells can be experimentally manipulated to regain pluripotency via overexpression of certain genes. Despite these experimental advances, the dynamics and mechanisms of differentiation and reprogramming are not yet fully understood. Based on recent experimental findings, we constructed a simple gene regulatory network including pluripotent and differentiation genes, and we demonstrated the existence of pluripotent and differentiated states from the resultant dynamical-systems model. Two differentiation mechanisms, interaction-induced switching from an expression oscillatory state and noise-assisted transition between bistable stationary states, were tested in the model. The former was found to be relevant to the differentiation process. We also introduced variables representing epigenetic modifications, which controlled the threshold for gene expression. By assuming positive feedback between expression levels and the epigenetic variables, we observed differentiation in expression dynamics. Additionally, with numerical reprogramming experiments for differentiated cells, we showed that pluripotency was recovered in cells by imposing overexpression of two pluripotent genes and external factors to control expression of differentiation genes. Interestingly, these factors were consistent with the four Yamanaka factors, Oct4, Sox2, Klf4, and Myc, which were necessary for the establishment of induced pluripotent stem cells. These results, based on a gene regulatory network and expression dynamics, contribute to our wider understanding of pluripotency, differentiation, and reprogramming of cells, and they provide a fresh viewpoint on robustness and control during development. PMID:26308610

  1. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    PubMed

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in different cotton plant organs; GhACT4 and GhUBQ14 for flower development, GhACT4 and GhFBX6 for the floral organs and GhMZA and GhPTB for fruit development. We also provide the primer sequences whose performance in qPCR experiments is demonstrated. These genes will enable more accurate and reliable normalization of qPCR results for gene expression studies in this important crop, the major source of natural fiber and also an important source of edible oil. The use of bona fide reference genes allowed a detailed and accurate characterization of the temporal and spatial expression pattern of two MADS-box genes in cotton.

  2. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    PubMed Central

    2010-01-01

    Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in different cotton plant organs; GhACT4 and GhUBQ14 for flower development, GhACT4 and GhFBX6 for the floral organs and GhMZA and GhPTB for fruit development. We also provide the primer sequences whose performance in qPCR experiments is demonstrated. These genes will enable more accurate and reliable normalization of qPCR results for gene expression studies in this important crop, the major source of natural fiber and also an important source of edible oil. The use of bona fide reference genes allowed a detailed and accurate characterization of the temporal and spatial expression pattern of two MADS-box genes in cotton. PMID:20302670

  3. Transcription in space--environmental vs. genetic effects on differential immune gene expression.

    PubMed

    Lenz, Tobias L

    2015-09-01

    Understanding how organisms adapt to their local environment is one of the key goals in molecular ecology. Adaptation can be achieved through qualitative changes in the coding sequence and/or quantitative changes in gene expression, where the optimal dosage of a gene's product in a given environment is being selected for. Differences in gene expression among populations inhabiting distinct environments can be suggestive of locally adapted gene regulation and have thus been studied in different species (Whitehead & Crawford ; Hodgins-Davis & Townsend ). However, in contrast to a gene's coding sequence, its expression level at a given point in time may depend on various factors, including the current environment. Although critical for understanding the extent of local adaptation, it is usually difficult to disentangle the heritable differences in gene regulation from environmental effects. In this issue of Molecular Ecology, Stutz et al. () describe an experiment in which they reciprocally transplanted three-spined sticklebacks (Gasterosteus aculeatus) between independent pairs of small and large lakes. Their experimental design allows them to attribute differences in gene expression among sticklebacks either to lake of origin or destination lake. Interestingly, they find that translocated sticklebacks show a pattern of gene expression more similar to individuals from the destination lake than to individuals from the lake of origin, suggesting that expression of the targeted genes is more strongly regulated by environmental effects than by genetics. The environmental effect by itself is not entirely surprising; however, the relative extent of it is. Especially when put in the context of local adaptation and population differentiation, as done here, these findings cast a new light onto the heritability of differential gene expression and specifically its relative importance during population divergence and ultimately ecological speciation. © 2015 John Wiley & Sons Ltd.

  4. Radiofrequency-enhanced vascular gene transduction and expression for intravascular MR imaging-guided therapy: feasibility study in pigs.

    PubMed

    Du, Xiangying; Qiu, Bensheng; Zhan, Xiangcan; Kolmakova, Antonina; Gao, Fabao; Hofmann, Lawrence V; Cheng, Linzhao; Chatterjee, Subroto; Yang, Xiaoming

    2005-09-01

    To evaluate the feasibility of radiofrequency (RF)-enhanced vascular gene transduction and expression by using a magnetic resonance (MR) imaging-heating guidewire as an intravascular heating vehicle during MR imaging-guided therapy. The institutional committee for animal care and use approved the experimental protocol. The study included in vitro evaluation of the use of RF energy to enhance gene transduction and expression in vascular cells, as well as in vivo validation of the feasibility of intravascular MR imaging-guided RF-enhanced vascular gene transduction and expression in pig arteries. For in vitro experiments, approximately 10(4) vascular smooth muscle cells were seeded in each of four chambers of a cell culture plate. Next, 1 mL of a green fluorescent protein gene (gfp)-bearing lentivirus was added to each chamber. Chamber 4 was heated at approximately 41 degrees C for 15 minutes by using an MR imaging-heating guidewire connected to a custom RF generator. At day 6 after transduction, the four chambers were examined and compared at confocal microscopy to determine the efficiency of gfp transduction and expression. For the in vivo experiments, a lentivirus vector bearing a therapeutic gene, vascular endothelial growth factor 165 (VEGF-165), was transferred by using a gene delivery balloon catheter in 18 femoral-iliac arteries (nine artery pairs) in domestic pigs and Yucatan pigs with atherosclerosis. During gene infusion, one femoral-iliac artery in each pig was heated to approximately 41 degrees C with RF energy transferred via the intravascular MR imaging-heating guidewire, while the contralateral artery was not heated (control condition). At day 6, the 18 arteries were harvested for quantitative Western blot analysis to compare VEGF-165 transduction and expression efficiency between RF-heated and nonheated arterial groups. Confocal microscopy showed gfp expression in chamber 4 that was 293% the level of expression in chamber 1 (49.6% +/- 25.8 vs 16.8% +/- 8.0). Results of Western blot analysis showed VEGF-165 expression for normal arteries in the RF-heated group that was 300% the level of expression in the nonheated group (70.4 arbitrary units [au] +/- 107.1 vs 23.5 au +/- 29.8), and, for atherosclerotic arteries in the RF-heated group, 986% the level in the nonheated group (129.2 au +/- 100.3 vs 13.1 au +/- 4.9). Simultaneous monitoring and enhancement of vascular gene delivery and expression is feasible with the MR imaging-heating guidewire.

  5. GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.

    PubMed

    Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G

    2016-09-13

    The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Stem carbohydrate dynamics and expression of genes involved in fructan accumulation and remobilization during grain growth in wheat (Triticum aestivum L.) genotypes with contrasting tolerance to water stress.

    PubMed

    Yáñez, Alejandra; Tapia, Gerardo; Guerra, Fernando; Del Pozo, Alejandro

    2017-01-01

    The genetic and physiological mechanisms underlying the relationship between water-soluble carbohydrates (WSC) and water stress tolerance are scarcely known. This study aimed to evaluate the main WSC in stems, and the expression of genes involved in fructan metabolism in wheat genotypes growing in a glasshouse with water stress (WS; 50% field capacity from heading) and full irrigation (FI; 100% field capacity). Eight wheat genotypes (five tolerant and three susceptible to water stress) were evaluated initially (experiment 1) and the two most contrasting genotypes in terms of WSC accumulation were evaluated in a subsequent experiment (experiment 2). Maximum accumulation of WSC occurred 10-20 days after anthesis. Under WS, the stress-tolerant genotype exhibited higher concentrations of WSC, glucose, fructose and fructan in the stems, compared to FI. In addition, the stress-tolerant genotype exhibited higher up-regulation of the fructan 1-fructosyltransferase B (1-FFTB) and fructan 1-exohydrolase w2 (1-FEHw2) genes, whereas the susceptible cultivar presented an up-regulation of the fructan 6-fructosyltransferase (6-SFT) and fructan 1-exohydrolase w3 (1-FEHw3) genes. Our results indicated clear differences in the pattern of WSC accumulation and the expression of genes regulating fructan metabolism between the tolerant and susceptible genotypes under WS.

  7. Stem carbohydrate dynamics and expression of genes involved in fructan accumulation and remobilization during grain growth in wheat (Triticum aestivum L.) genotypes with contrasting tolerance to water stress

    PubMed Central

    Yáñez, Alejandra; Tapia, Gerardo; Guerra, Fernando

    2017-01-01

    The genetic and physiological mechanisms underlying the relationship between water-soluble carbohydrates (WSC) and water stress tolerance are scarcely known. This study aimed to evaluate the main WSC in stems, and the expression of genes involved in fructan metabolism in wheat genotypes growing in a glasshouse with water stress (WS; 50% field capacity from heading) and full irrigation (FI; 100% field capacity). Eight wheat genotypes (five tolerant and three susceptible to water stress) were evaluated initially (experiment 1) and the two most contrasting genotypes in terms of WSC accumulation were evaluated in a subsequent experiment (experiment 2). Maximum accumulation of WSC occurred 10–20 days after anthesis. Under WS, the stress-tolerant genotype exhibited higher concentrations of WSC, glucose, fructose and fructan in the stems, compared to FI. In addition, the stress-tolerant genotype exhibited higher up-regulation of the fructan 1-fructosyltransferase B (1-FFTB) and fructan 1-exohydrolase w2 (1-FEHw2) genes, whereas the susceptible cultivar presented an up-regulation of the fructan 6-fructosyltransferase (6-SFT) and fructan 1-exohydrolase w3 (1-FEHw3) genes. Our results indicated clear differences in the pattern of WSC accumulation and the expression of genes regulating fructan metabolism between the tolerant and susceptible genotypes under WS. PMID:28552955

  8. Effects of Radiation and Dietary Iron on Expression of Genes and Proteins Involved in Drug Metabolism

    NASA Technical Reports Server (NTRS)

    Faust, K. M.; Wotring, V. E.

    2014-01-01

    Liver function, especially the rate of metabolic enzyme activities, determines the concentration of circulating drugs and the duration of their efficacy. Most pharmaceuticals are metabolized by the liver, and clinically-used medication doses are given with normal liver function in mind. A drug overdose can result in the case of a liver that is damaged and removing pharmaceuticals from the circulation at a rate slower than normal. Alternatively, if liver function is elevated and removing drugs from the system more quickly than usual, it would be as if too little drug had been given for effective treatment. Because of the importance of the liver in drug metabolism, we want to understand any effects of spaceflight on the enzymes of the liver. Dietary factors and exposure to radiation are aspects of spaceflight that are potential oxidative stressors and both can be modeled in ground experiments. In this experiment, we examined the effects of high dietary iron and low dose gamma radiation (individually and combined) on the gene expression of enzymes involved in drug metabolism, redox homeostasis, and DNA repair. METHODS All procedures were approved by the JSC Animal Care and Use Committee. Male Sprague-Dawley rats were divided into 4 groups (n=8); control, high Fe diet (650 mg iron/kg), radiation (fractionated 3 Gy exposure from a Cs- 137 source) and combined high Fe diet + radiation exposure. Animals were euthanized 24h after the last treatment of radiation; livers were removed immediately and flash -frozen in liquid nitrogen. Expression of genes thought to be involved in redox homeostasis, drug metabolism and DNA damage repair was measured by RT-qPCR. Where possible, protein expression of the same genes was measured by western blotting. All data are expressed as % change in expression normalized to reference gene expression; comparisons were then made of each treatment group to the sham exposed/ normal diet control group. Data was considered significant at p< 0.5. RESULTS Among the redox homeostasis genes examined, metallothionein showed a significant down regulation in the radiation treated group (-3.85 fold) and a trend toward down regulation in the high Fe + rad group. Metallothionein is involved in the regulation of physiological metals and also has antioxidant activities. Among the drug metabolism genes examined, ATP binding cassette subfamily B (Abcb1b) gene expression increased more than 10-fold in both groups that received radiation treatments. This increased expression was also seen at the protein level. This ABC transporter carries many different compounds across cell membranes, including administered medications. The cytochrome P450 2E1 enzyme, a mixed-function oxidase that deactivates some medications and activates others, showed about a 2-fold increase in gene expression in both radiation-treated groups, with a trend toward increased expression at the protein level. Expression of epoxide hydrolase, which detoxifies polycyclic aromatic hydrocarbons, showed similar 2-fold increases. Among the DNA repair genes examined, expression of RAD51 was significantly down regulated (1.5 fold) in the radiation treated group. RAD51 is involved in repair of double-stranded DNA breaks. CONCLUSION This experiment used 2 different sources of physiological oxidative stress, administered separately and together, and examined their impacts on liver gene and protein expression. It is clear that significant changes occurred in expression of several genes and proteins in the radiation-treated animals. If the results from this ground analog of portions of the spaceflight environment hold true for the spaceflight environment itself, the physiological roles of the affected enzymes (drug transport and metabolism, redox homeostasis) could mean consequences in redox homeostasis or the pharmacokinetics of administered medications

  9. Gene expression under chronic heat stress in populations of the mustard hill coral (Porites astreoides) from different thermal environments.

    PubMed

    Kenkel, C D; Meyer, E; Matz, M V

    2013-08-01

    Recent evidence suggests that corals can acclimatize or adapt to local stress factors through differential regulation of their gene expression. Profiling gene expression in corals from diverse environments can elucidate the physiological processes that may be responsible for maximizing coral fitness in their natural habitat and lead to a better understanding of the coral's capacity to survive the effects of global climate change. In an accompanying paper, we show that Porites astreoides from thermally different reef habitats exhibit distinct physiological responses when exposed to 6 weeks of chronic temperature stress in a common garden experiment. Here, we describe expression profiles obtained from the same corals for a panel of 9 previously reported and 10 novel candidate stress response genes identified in a pilot RNA-Seq experiment. The strongest expression change was observed in a novel candidate gene potentially involved in calcification, SLC26, a member of the solute carrier family 26 anion exchangers, which was down-regulated by 92-fold in bleached corals relative to controls. The most notable signature of divergence between coral populations was constitutive up-regulation of metabolic genes in corals from the warmer inshore location, including the gluconeogenesis enzymes pyruvate carboxylase and phosphoenolpyruvate carboxykinase and the lipid beta-oxidation enzyme acyl-CoA dehydrogenase. Our observations highlight several molecular pathways that were not previously implicated in the coral stress response and suggest that host management of energy budgets might play an adaptive role in holobiont thermotolerance. © 2013 John Wiley & Sons Ltd.

  10. Environmental regulation of plant gene expression: an RT-qPCR laboratory project for an upper-level undergraduate biochemistry or molecular biology course.

    PubMed

    Eickelberg, Garrett J; Fisher, Alison J

    2013-01-01

    We present a novel laboratory project employing "real-time" RT-qPCR to measure the effect of environment on the expression of the FLOWERING LOCUS C gene, a key regulator of floral timing in Arabidopsis thaliana plants. The project requires four 3-hr laboratory sessions and is aimed at upper-level undergraduate students in biochemistry or molecular biology courses. The project provides students with hands-on experience with RT-qPCR, the current "gold standard" for gene expression analysis, including detailed data analysis using the common 2-ΔΔCT method. Moreover, it provides a convenient starting point for many inquiry-driven projects addressing diverse questions concerning ecological biochemistry, naturally occurring genetic variation, developmental biology, and the regulation of gene expression in nature. Copyright © 2013 Wiley Periodicals, Inc.

  11. The role of transcriptome resilience in resistance of corals to bleaching.

    PubMed

    Seneca, Francois O; Palumbi, Stephen R

    2015-04-01

    Wild populations increasingly experience extreme conditions as climate change amplifies environmental variability. How individuals respond to environmental extremes determines the impact of climate change overall. The variability of response from individual to individual can represent the opportunity for natural selection to occur as a result of extreme conditions. Here, we experimentally replicated the natural exposure to extreme temperatures of the reef lagoon at Ofu Island (American Samoa), where corals can experience severe heat stress during midday low tide. We investigated the bleaching and transcriptome response of 20 Acropora hyacinthus colonies 5 and 20 h after exposure to control (29 °C) or heated (35 °C) conditions. We found a highly dynamic transcriptome response: 27% of the coral transcriptome was significantly regulated 1 h postheat exposure. Yet 15 h later, when heat-induced coral bleaching became apparent, only 12% of the transcriptome was differentially regulated. A large proportion of responsive genes at the first time point returned to control levels, others remained differentially expressed over time, while an entirely different subset of genes was successively regulated at the second time point. However, a noteworthy variability in gene expression was observed among individual coral colonies. Among the genes of which expression lingered over time, fast return to normal levels was associated with low bleaching. Colonies that maintained higher expression levels of these genes bleached severely. Return to normal levels of gene expression after stress has been termed transcriptome resilience, and in the case of some specific genes may signal the physiological health and response ability of individuals to environmental stress. © 2015 John Wiley & Sons Ltd.

  12. Directed random walks and constraint programming reveal active pathways in hepatocyte growth factor signaling.

    PubMed

    Kittas, Aristotelis; Delobelle, Aurélien; Schmitt, Sabrina; Breuhahn, Kai; Guziolowski, Carito; Grabe, Niels

    2016-01-01

    An effective means to analyze mRNA expression data is to take advantage of established knowledge from pathway databases, using methods such as pathway-enrichment analyses. However, pathway databases are not case-specific and expression data could be used to infer gene-regulation patterns in the context of specific pathways. In addition, canonical pathways may not always describe the signaling mechanisms properly, because interactions can frequently occur between genes in different pathways. Relatively few methods have been proposed to date for generating and analyzing such networks, preserving the causality between gene interactions and reasoning over the qualitative logic of regulatory effects. We present an algorithm (MCWalk) integrated with a logic programming approach, to discover subgraphs in large-scale signaling networks by random walks in a fully automated pipeline. As an exemplary application, we uncover the signal transduction mechanisms in a gene interaction network describing hepatocyte growth factor-stimulated cell migration and proliferation from gene-expression measured with microarray and RT-qPCR using in-house perturbation experiments in a keratinocyte-fibroblast co-culture. The resulting subgraphs illustrate possible associations of hepatocyte growth factor receptor c-Met nodes, differentially expressed genes and cellular states. Using perturbation experiments and Answer Set programming, we are able to select those which are more consistent with the experimental data. We discover key regulator nodes by measuring the frequency with which they are traversed when connecting signaling between receptors and significantly regulated genes and predict their expression-shift consistently with the measured data. The Java implementation of MCWalk is publicly available under the MIT license at: https://bitbucket.org/akittas/biosubg. © 2015 FEBS.

  13. Reconstructing directed gene regulatory network by only gene expression data.

    PubMed

    Zhang, Lu; Feng, Xi Kang; Ng, Yen Kaow; Li, Shuai Cheng

    2016-08-18

    Accurately identifying gene regulatory network is an important task in understanding in vivo biological activities. The inference of such networks is often accomplished through the use of gene expression data. Many methods have been developed to evaluate gene expression dependencies between transcription factor and its target genes, and some methods also eliminate transitive interactions. The regulatory (or edge) direction is undetermined if the target gene is also a transcription factor. Some methods predict the regulatory directions in the gene regulatory networks by locating the eQTL single nucleotide polymorphism, or by observing the gene expression changes when knocking out/down the candidate transcript factors; regrettably, these additional data are usually unavailable, especially for the samples deriving from human tissues. In this study, we propose the Context Based Dependency Network (CBDN), a method that is able to infer gene regulatory networks with the regulatory directions from gene expression data only. To determine the regulatory direction, CBDN computes the influence of source to target by evaluating the magnitude changes of expression dependencies between the target gene and the others with conditioning on the source gene. CBDN extends the data processing inequality by involving the dependency direction to distinguish between direct and transitive relationship between genes. We also define two types of important regulators which can influence a majority of the genes in the network directly or indirectly. CBDN can detect both of these two types of important regulators by averaging the influence functions of candidate regulator to the other genes. In our experiments with simulated and real data, even with the regulatory direction taken into account, CBDN outperforms the state-of-the-art approaches for inferring gene regulatory network. CBDN identifies the important regulators in the predicted network: 1. TYROBP influences a batch of genes that are related to Alzheimer's disease; 2. ZNF329 and RB1 significantly regulate those 'mesenchymal' gene expression signature genes for brain tumors. By merely leveraging gene expression data, CBDN can efficiently infer the existence of gene-gene interactions as well as their regulatory directions. The constructed networks are helpful in the identification of important regulators for complex diseases.

  14. Cancer Detection in Microarray Data Using a Modified Cat Swarm Optimization Clustering Approach

    PubMed

    M, Pandi; R, Balamurugan; N, Sadhasivam

    2017-12-29

    Objective: A better understanding of functional genomics can be obtained by extracting patterns hidden in gene expression data. This could have paramount implications for cancer diagnosis, gene treatments and other domains. Clustering may reveal natural structures and identify interesting patterns in underlying data. The main objective of this research was to derive a heuristic approach to detection of highly co-expressed genes related to cancer from gene expression data with minimum Mean Squared Error (MSE). Methods: A modified CSO algorithm using Harmony Search (MCSO-HS) for clustering cancer gene expression data was applied. Experiment results are analyzed using two cancer gene expression benchmark datasets, namely for leukaemia and for breast cancer. Result: The results indicated MCSO-HS to be better than HS and CSO, 13% and 9% with the leukaemia dataset. For breast cancer dataset improvement was by 22% and 17%, respectively, in terms of MSE. Conclusion: The results showed MCSO-HS to outperform HS and CSO with both benchmark datasets. To validate the clustering results, this work was tested with internal and external cluster validation indices. Also this work points to biological validation of clusters with gene ontology in terms of function, process and component. Creative Commons Attribution License

  15. Assessing technical performance in differential gene expression experiments with external spike-in RNA control ratio mixtures.

    PubMed

    Munro, Sarah A; Lund, Steven P; Pine, P Scott; Binder, Hans; Clevert, Djork-Arné; Conesa, Ana; Dopazo, Joaquin; Fasold, Mario; Hochreiter, Sepp; Hong, Huixiao; Jafari, Nadereh; Kreil, David P; Łabaj, Paweł P; Li, Sheng; Liao, Yang; Lin, Simon M; Meehan, Joseph; Mason, Christopher E; Santoyo-Lopez, Javier; Setterquist, Robert A; Shi, Leming; Shi, Wei; Smyth, Gordon K; Stralis-Pavese, Nancy; Su, Zhenqiang; Tong, Weida; Wang, Charles; Wang, Jian; Xu, Joshua; Ye, Zhan; Yang, Yong; Yu, Ying; Salit, Marc

    2014-09-25

    There is a critical need for standard approaches to assess, report and compare the technical performance of genome-scale differential gene expression experiments. Here we assess technical performance with a proposed standard 'dashboard' of metrics derived from analysis of external spike-in RNA control ratio mixtures. These control ratio mixtures with defined abundance ratios enable assessment of diagnostic performance of differentially expressed transcript lists, limit of detection of ratio (LODR) estimates and expression ratio variability and measurement bias. The performance metrics suite is applicable to analysis of a typical experiment, and here we also apply these metrics to evaluate technical performance among laboratories. An interlaboratory study using identical samples shared among 12 laboratories with three different measurement processes demonstrates generally consistent diagnostic power across 11 laboratories. Ratio measurement variability and bias are also comparable among laboratories for the same measurement process. We observe different biases for measurement processes using different mRNA-enrichment protocols.

  16. Inferring causal genomic alterations in breast cancer using gene expression data

    PubMed Central

    2011-01-01

    Background One of the primary objectives in cancer research is to identify causal genomic alterations, such as somatic copy number variation (CNV) and somatic mutations, during tumor development. Many valuable studies lack genomic data to detect CNV; therefore, methods that are able to infer CNVs from gene expression data would help maximize the value of these studies. Results We developed a framework for identifying recurrent regions of CNV and distinguishing the cancer driver genes from the passenger genes in the regions. By inferring CNV regions across many datasets we were able to identify 109 recurrent amplified/deleted CNV regions. Many of these regions are enriched for genes involved in many important processes associated with tumorigenesis and cancer progression. Genes in these recurrent CNV regions were then examined in the context of gene regulatory networks to prioritize putative cancer driver genes. The cancer driver genes uncovered by the framework include not only well-known oncogenes but also a number of novel cancer susceptibility genes validated via siRNA experiments. Conclusions To our knowledge, this is the first effort to systematically identify and validate drivers for expression based CNV regions in breast cancer. The framework where the wavelet analysis of copy number alteration based on expression coupled with the gene regulatory network analysis, provides a blueprint for leveraging genomic data to identify key regulatory components and gene targets. This integrative approach can be applied to many other large-scale gene expression studies and other novel types of cancer data such as next-generation sequencing based expression (RNA-Seq) as well as CNV data. PMID:21806811

  17. Identification of suitable internal control genes for expression studies in Coffea arabica under different experimental conditions

    PubMed Central

    Barsalobres-Cavallari, Carla F; Severino, Fábio E; Maluf, Mirian P; Maia, Ivan G

    2009-01-01

    Background Quantitative data from gene expression experiments are often normalized by transcription levels of reference or housekeeping genes. An inherent assumption for their use is that the expression of these genes is highly uniform in living organisms during various phases of development, in different cell types and under diverse environmental conditions. To date, the validation of reference genes in plants has received very little attention and suitable reference genes have not been defined for a great number of crop species including Coffea arabica. The aim of the research reported herein was to compare the relative expression of a set of potential reference genes across different types of tissue/organ samples of coffee. We also validated the expression profiles of the selected reference genes at various stages of development and under a specific biotic stress. Results The expression levels of five frequently used housekeeping genes (reference genes), namely alcohol dehydrogenase (adh), 14-3-3, polyubiquitin (poly), β-actin (actin) and glyceraldehyde-3-phosphate dehydrogenase (gapdh) was assessed by quantitative real-time RT-PCR over a set of five tissue/organ samples (root, stem, leaf, flower, and fruits) of Coffea arabica plants. In addition to these commonly used internal controls, three other genes encoding a cysteine proteinase (cys), a caffeine synthase (ccs) and the 60S ribosomal protein L7 (rpl7) were also tested. Their stability and suitability as reference genes were validated by geNorm, NormFinder and BestKeeper programs. The obtained results revealed significantly variable expression levels of all reference genes analyzed, with the exception of gapdh, which showed no significant changes in expression among the investigated experimental conditions. Conclusion Our data suggests that the expression of housekeeping genes is not completely stable in coffee. Based on our results, gapdh, followed by 14-3-3 and rpl7 were found to be homogeneously expressed and are therefore adequate for normalization purposes, showing equivalent transcript levels in different tissue/organ samples. Gapdh is therefore the recommended reference gene for measuring gene expression in Coffea arabica. Its use will enable more accurate and reliable normalization of tissue/organ-specific gene expression studies in this important cherry crop plant. PMID:19126214

  18. Microarray Meta-Analysis Focused on the Response of Genes Involved in Redox Homeostasis to Diverse Abiotic Stresses in Rice

    PubMed Central

    de Abreu Neto, Joao B.; Frei, Michael

    2016-01-01

    Plants are exposed to a wide range of abiotic stresses (AS), which often occur in combination. Because physiological investigations typically focus on one stress, our understanding of unspecific stress responses remains limited. The plant redox homeostasis, i.e., the production and removal of reactive oxygen species (ROS), may be involved in many environmental stress conditions. Therefore, this study intended to identify genes, which are activated in diverse AS, focusing on ROS-related pathways. We conducted a meta-analysis (MA) of microarray experiments, focusing on rice. Transcriptome data were mined from public databases and fellow researchers, which represented 36 different experiments and investigated diverse AS, including ozone stress, drought, heat, cold, salinity, and mineral deficiencies/toxicities. To overcome the inherent artifacts of different MA methods, data were processed using Fisher, rOP, REM, and product of rank (GeneSelector), and genes identified by most approaches were considered as shared differentially expressed genes (DEGs). Two MA strategies were adopted: first, datasets were separated into shoot, root, and seedling experiments, and these tissues were analyzed separately to identify shared DEGs. Second, shoot and seedling experiments were classed into oxidative stress (OS), i.e., ozone and hydrogen peroxide treatments directly producing ROS in plant tissue, and other AS, in which ROS production is indirect. In all tissues and stress conditions, genes a priori considered as ROS-related were overrepresented among the DEGs, as they represented 4% of all expressed genes but 7–10% of the DEGs. The combined MA approach was substantially more conservative than individual MA methods and identified 1001 shared DEGs in shoots, 837 shared DEGs in root, and 1172 shared DEGs in seedlings. Within the OS and AS groups, 990 and 1727 shared DEGs were identified, respectively. In total, 311 genes were shared between OS and AS, including many regulatory genes. Combined co-expression analysis identified among those a cluster of 42 genes, many involved in the photosynthetic apparatus and responsive to drought, iron deficiency, arsenic toxicity, and ozone. Our data demonstrate the importance of redox homeostasis in plant stress responses and the power of MA to identify candidate genes underlying unspecific signaling pathways. PMID:26793229

  19. Methylation of an alpha-foetoprotein gene intragenic site modulates gene activity.

    PubMed Central

    Opdecamp, K; Rivière, M; Molné, M; Szpirer, J; Szpirer, C

    1992-01-01

    By comparing the methylation pattern of Mspl/Hpall sites in the 5' region of the mouse alpha-foetoprotein (AFP) gene of different cells (hepatoma cells, foetal and adult liver, fibroblasts), we found a correlation between gene expression and unmethylation of a site located in the first intron of the gene. Other sites did not show this correlation. In transfection experiments of unmethylated and methylated AFP-CAT chimeric constructions, we then showed that methylation of the intronic site negatively modulates expression of CAT activity. We also found that a DNA segment centered on this site binds nuclear proteins; however methylation did not affect protein binding. Images PMID:1371343

  20. Comparative expression profiling of Nicotiana benthamiana leaves systemically infected with three fruit tree viruses.

    PubMed

    Dardick, Christopher

    2007-08-01

    Plant viruses cause a wide array of disease symptoms and cytopathic effects. Although some of these changes are virus specific, many appear to be common even among diverse viruses. Currently, little is known about the underlying molecular determinants. To identify gene expression changes that are concomitant with virus symptoms, we performed comparative expression profiling experiments on Nicotiana benthamiana leaves infected with one of three different fruit tree viruses that produce distinct symptoms: Plum pox potyvirus (PPV; leaf distortion and mosaic), Tomato ringspot nepovirus (ToRSV; tissue necrosis and general chlorosis), and Prunus necrotic ringspot ilarvirus (PNRSV; subtle chlorotic mottling). The numbers of statistically significant genes identified were consistent with the severity of the observed symptoms: 1,082 (ToRSV), 744 (PPV), and 89 (PNRSV). In all, 56% of the gene expression changes found in PPV-infected leaves also were altered by ToRSV, 87% of which changed in the same direction. Both PPV- and ToRSV-infected leaves showed widespread repression of genes associated with plastid functions. PPV uniquely induced the expression of large numbers of cytosolic ribosomal genes whereas ToRSV repressed the expression of plastidic ribosomal genes. How these and other observed expression changes might be associated with symptom development are discussed.

  1. Life science experiments performed in space in the ISS/Kibo facility and future research plans

    PubMed Central

    Ohnishi, Takeo

    2016-01-01

    Over the past several years, current techniques in molecular biology have been used to perform experiments in space, focusing on the nature and effects of space radiation. In the Japanese ‘Kibo’ facility in the International Space Station (ISS), the Japan Aerospace Exploration Agency (JAXA) has performed five life science experiments since 2009, and two additional experiments are currently in progress. The first life science experiment in space was the ‘Rad Gene’ project, which utilized two human cultured lymphoblastoid cell lines containing a mutated p53 gene (mp53) and a parental wild-type p53 gene (wtp53) respectively. Four parameters were examined: (i) detecting space radiation–induced DSBs by observing γH2AX foci; (ii) observing p53-dependent gene expression during space flight; (iii) observing p53-dependent gene expression after space flight; and (iv) observing the adaptive response in the two cell lines containing the mutated and wild type p53 genes after exposure to space radiation. These observations were completed and have been reported, and this paper is a review of these experiments. In addition, recent new information from space-based experiments involving radiation biology is presented here. These experiments involve human cultured cells, silkworm eggs, mouse embryonic stem cells and mouse eggs in various experiments designed by other principal investigators in the ISS/Kibo. The progress of Japanese science groups involved in these space experiments together with JAXA are also discussed here. The Japanese Society for Biological Sciences in Space (JSBSS), the Utilization Committee of Space Environment Science (UCSES) and the Science Council of Japan (ACJ) have supported these new projects and new experimental facilities in ISS/Kibo. Currently, these organizations are proposing new experiments for the ISS through 2024. PMID:27130692

  2. The hepatic transcriptome of young suckling and aging intrauterine growth restricted male rats

    PubMed Central

    Freije, William A.; Thamotharan, Shanthie; Lee, Regina; Shin, Bo-Chul; Devaskar, Sherin U.

    2015-01-01

    Intrauterine growth restriction leads to the development of adult onset obesity/metabolic syndrome, diabetes mellitus, cardiovascular disease, hypertension, stroke, dyslipidemia, and non-alcoholic fatty liver disease/steatohepatitis. Continued postnatal growth restriction has been shown to ameliorate many of these sequelae. To further our understanding of the mechanism of how intrauterine and early postnatal growth affects adult health we have employed Affymetrix microarray-based expression profiling to characterize hepatic gene expression of male offspring in a rat model of maternal nutrient restriction in early and late life. At day 21 of life (p21) combined intrauterine and postnatal calorie restriction treatment led to expression changes in circadian, metabolic, and insulin-like growth factor genes as part of a larger transcriptional response that encompasses 144 genes. Independent and controlled experiments at p21 confirm the early life circadian, metabolic, and growth factor perturbations. In contrast to the p21 transcriptional response, at day 450 of life (d450) only seven genes, largely uncharacterized, were differentially expressed. This lack of a transcriptional response identifies non-transcriptional mechanisms mediating the adult sequelae of intrauterine growth restriction. Independent experiments at d450 identify a circadian defect as well as validate expression changes to four of the genes identified by the microarray screen which have a novel association with growth restriction. Emerging from this rich dataset is a portrait of how the liver responds to growth restriction through circadian dysregulation, energy/substrate management, and growth factor modulation. PMID:25371150

  3. The hepatic transcriptome of young suckling and aging intrauterine growth restricted male rats.

    PubMed

    Freije, William A; Thamotharan, Shanthie; Lee, Regina; Shin, Bo-Chul; Devaskar, Sherin U

    2015-04-01

    Intrauterine growth restriction leads to the development of adult onset obesity/metabolic syndrome, diabetes mellitus, cardiovascular disease, hypertension, stroke, dyslipidemia, and non-alcoholic fatty liver disease/steatohepatitis. Continued postnatal growth restriction has been shown to ameliorate many of these sequelae. To further our understanding of the mechanism of how intrauterine and early postnatal growth affects adult health we have employed Affymetrix microarray-based expression profiling to characterize hepatic gene expression of male offspring in a rat model of maternal nutrient restriction in early and late life. At day 21 of life (p21) combined intrauterine and postnatal calorie restriction treatment led to expression changes in circadian, metabolic, and insulin-like growth factor genes as part of a larger transcriptional response that encompasses 144 genes. Independent and controlled experiments at p21 confirm the early life circadian, metabolic, and growth factor perturbations. In contrast to the p21 transcriptional response, at day 450 of life (d450) only seven genes, largely uncharacterized, were differentially expressed. This lack of a transcriptional response identifies non-transcriptional mechanisms mediating the adult sequelae of intrauterine growth restriction. Independent experiments at d450 identify a circadian defect as well as validate expression changes to four of the genes identified by the microarray screen which have a novel association with growth restriction. Emerging from this rich dataset is a portrait of how the liver responds to growth restriction through circadian dysregulation, energy/substrate management, and growth factor modulation. © 2014 Wiley Periodicals, Inc.

  4. The synthetic gestagen levonorgestrel directly affects gene expression in thyroid and pituitary glands of Xenopus laevis tadpoles.

    PubMed

    Lorenz, Claudia; Opitz, Robert; Trubiroha, Achim; Lutz, Ilka; Zikova, Andrea; Kloas, Werner

    2016-08-01

    The synthetic gestagen levonorgestrel (LNG) was previously shown to perturb thyroid hormone-dependent metamorphosis in Xenopus laevis. However, so far the mechanisms underlying the anti-metamorphic effects of LNG remained unknown. Therefore, a series of in vivo and ex vivo experiments was performed to identify potential target sites of LNG action along the pituitary-thyroid axis of X. laevis tadpoles. Prometamorphic tadpoles were treated in vivo with LNG (0.01-10nM) for 72h and brain-pituitary and thyroid tissue was analyzed for marker gene expression. While no treatment-related changes were observed in brain-pituitary tissue, LNG treatment readily affected thyroidal gene expression in tadpoles including decreased slc5a5 and iyd mRNA expression and a strong induction of dio2 and dio3 expression. When using an ex vivo organ explant culture approach, direct effects of LNG on both pituitary and thyroid gland gene expression were detecTable Specifically, treatment of pituitary explants with 10nM LNG strongly stimulated dio2 expression and concurrently suppressed tshb expression. In thyroid glands, ex vivo LNG treatment induced dio2 and dio3 mRNA expression in a thyrotropin-independent manner. When thyroid explants were cultured in thyrotropin-containing media, LNG caused similar gene expression changes as seen after 72h in vivo treatment including a very strong repression of thyrotropin-induced slc5a5 expression. Concerning the anti-thyroidal activity of LNG as seen under in vivo conditions, our ex vivo data provide clear evidence that LNG directly affects expression of genes important for thyroidal iodide handling as well as genes involved in negative feedback regulation of pituitary tshb expression. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. A two-step hierarchical hypothesis set testing framework, with applications to gene expression data on ordered categories

    PubMed Central

    2014-01-01

    Background In complex large-scale experiments, in addition to simultaneously considering a large number of features, multiple hypotheses are often being tested for each feature. This leads to a problem of multi-dimensional multiple testing. For example, in gene expression studies over ordered categories (such as time-course or dose-response experiments), interest is often in testing differential expression across several categories for each gene. In this paper, we consider a framework for testing multiple sets of hypothesis, which can be applied to a wide range of problems. Results We adopt the concept of the overall false discovery rate (OFDR) for controlling false discoveries on the hypothesis set level. Based on an existing procedure for identifying differentially expressed gene sets, we discuss a general two-step hierarchical hypothesis set testing procedure, which controls the overall false discovery rate under independence across hypothesis sets. In addition, we discuss the concept of the mixed-directional false discovery rate (mdFDR), and extend the general procedure to enable directional decisions for two-sided alternatives. We applied the framework to the case of microarray time-course/dose-response experiments, and proposed three procedures for testing differential expression and making multiple directional decisions for each gene. Simulation studies confirm the control of the OFDR and mdFDR by the proposed procedures under independence and positive correlations across genes. Simulation results also show that two of our new procedures achieve higher power than previous methods. Finally, the proposed methodology is applied to a microarray dose-response study, to identify 17 β-estradiol sensitive genes in breast cancer cells that are induced at low concentrations. Conclusions The framework we discuss provides a platform for multiple testing procedures covering situations involving two (or potentially more) sources of multiplicity. The framework is easy to use and adaptable to various practical settings that frequently occur in large-scale experiments. Procedures generated from the framework are shown to maintain control of the OFDR and mdFDR, quantities that are especially relevant in the case of multiple hypothesis set testing. The procedures work well in both simulations and real datasets, and are shown to have better power than existing methods. PMID:24731138

  6. Identification of BSAP (Pax-5) target genes in early B-cell development by loss- and gain-of-function experiments.

    PubMed Central

    Nutt, S L; Morrison, A M; Dörfler, P; Rolink, A; Busslinger, M

    1998-01-01

    The Pax-5 gene codes for the transcription factor BSAP which is essential for the progression of adult B lymphopoiesis beyond an early progenitor (pre-BI) cell stage. Although several genes have been proposed to be regulated by BSAP, CD19 is to date the only target gene which has been genetically confirmed to depend on this transcription factor for its expression. We have now taken advantage of cultured pre-BI cells of wild-type and Pax-5 mutant bone marrow to screen a large panel of B lymphoid genes for additional BSAP target genes. Four differentially expressed genes were shown to be under the direct control of BSAP, as their expression was rapidly regulated in Pax-5-deficient pre-BI cells by a hormone-inducible BSAP-estrogen receptor fusion protein. The genes coding for the B-cell receptor component Ig-alpha (mb-1) and the transcription factors N-myc and LEF-1 are positively regulated by BSAP, while the gene coding for the cell surface protein PD-1 is efficiently repressed. Distinct regulatory mechanisms of BSAP were revealed by reconstituting Pax-5-deficient pre-BI cells with full-length BSAP or a truncated form containing only the paired domain. IL-7 signalling was able to efficiently induce the N-myc gene only in the presence of full-length BSAP, while complete restoration of CD19 synthesis was critically dependent on the BSAP protein concentration. In contrast, the expression of the mb-1 and LEF-1 genes was already reconstituted by the paired domain polypeptide lacking any transactivation function, suggesting that the DNA-binding domain of BSAP is sufficient to recruit other transcription factors to the regulatory regions of these two genes. In conclusion, these loss- and gain-of-function experiments demonstrate that BSAP regulates four newly identified target genes as a transcriptional activator, repressor or docking protein depending on the specific regulatory sequence context. PMID:9545244

  7. Analysis of genetic association in Listeria and Diabetes using Hierarchical Clustering and Silhouette Index

    NASA Astrophysics Data System (ADS)

    Pagnuco, Inti A.; Pastore, Juan I.; Abras, Guillermo; Brun, Marcel; Ballarin, Virginia L.

    2016-04-01

    It is usually assumed that co-expressed genes suggest co-regulation in the underlying regulatory network. Determining sets of co-expressed genes is an important task, where significative groups of genes are defined based on some criteria. This task is usually performed by clustering algorithms, where the whole family of genes, or a subset of them, are clustered into meaningful groups based on their expression values in a set of experiment. In this work we used a methodology based on the Silhouette index as a measure of cluster quality for individual gene groups, and a combination of several variants of hierarchical clustering to generate the candidate groups, to obtain sets of co-expressed genes for two real data examples. We analyzed the quality of the best ranked groups, obtained by the algorithm, using an online bioinformatics tool that provides network information for the selected genes. Moreover, to verify the performance of the algorithm, considering the fact that it doesn’t find all possible subsets, we compared its results against a full search, to determine the amount of good co-regulated sets not detected.

  8. Systems biology approach to late-onset Alzheimer's disease genome-wide association study identifies novel candidate genes validated using brain expression data and Caenorhabditis elegans experiments.

    PubMed

    Mukherjee, Shubhabrata; Russell, Joshua C; Carr, Daniel T; Burgess, Jeremy D; Allen, Mariet; Serie, Daniel J; Boehme, Kevin L; Kauwe, John S K; Naj, Adam C; Fardo, David W; Dickson, Dennis W; Montine, Thomas J; Ertekin-Taner, Nilufer; Kaeberlein, Matt R; Crane, Paul K

    2017-10-01

    We sought to determine whether a systems biology approach may identify novel late-onset Alzheimer's disease (LOAD) loci. We performed gene-wide association analyses and integrated results with human protein-protein interaction data using network analyses. We performed functional validation on novel genes using a transgenic Caenorhabditis elegans Aβ proteotoxicity model and evaluated novel genes using brain expression data from people with LOAD and other neurodegenerative conditions. We identified 13 novel candidate LOAD genes outside chromosome 19. Of those, RNA interference knockdowns of the C. elegans orthologs of UBC, NDUFS3, EGR1, and ATP5H were associated with Aβ toxicity, and NDUFS3, SLC25A11, ATP5H, and APP were differentially expressed in the temporal cortex. Network analyses identified novel LOAD candidate genes. We demonstrated a functional role for four of these in a C. elegans model and found enrichment of differentially expressed genes in the temporal cortex. Copyright © 2017 the Alzheimer's Association. Published by Elsevier Inc. All rights reserved.

  9. Differential Connectivity in Colorectal Cancer Gene Expression Network

    PubMed

    Izadi, Fereshteh

    2018-05-30

    Colorectal cancer (CRC) is one of the challenging types of cancers; thus, exploring effective biomarkers related to colorectal could lead to significant progresses toward the treatment of this disease. In the present study, CRC gene expression datasets have been reanalyzed. Mutual differentially expressed genes across 294 normal mucosa and adjacent tumoral samples were then utilized in order to build two independent transcriptional regulatory networks. By analyzing the networks topologically, genes with differential global connectivity related to cancer state were determined for which the potential transcriptional regulators including transcription factors were identified. The majority of differentially connected genes (DCGs) were up-regulated in colorectal transcriptome experiments. Moreover, a number of these genes have been experimentally validated as cancer or CRC-associated genes. The DCGs, including GART, TGFB1, ITGA2, SLC16A5, SOX9, and MMP7, were investigated across 12 cancer types. Functional enrichment analysis followed by detailed data mining exhibited that these candidate genes could be related to CRC by mediating in metastatic cascade in addition to shared pathways with 12 cancer types by triggering the inflammatory events Our study uncovered correlated alterations in gene expression related to CRC susceptibility and progression that the potent candidate biomarkers could provide a link to disease.

  10. Rebamipide increases the mucin-like glycoprotein production in corneal epithelial cells.

    PubMed

    Takeji, Yasuhiro; Urashima, Hiroki; Aoki, Akihiro; Shinohara, Hisashi

    2012-06-01

    Dry eye is a multifactorial disease of tears and the ocular surface due to tear deficiency or excessive tear evaporation. Tear film instability is due to a disturbance in ocular surface mucin leading to a dysfunction of mucin, resulting in dry eye. In this study, we examined the effect of rebamipide, an anti-ulcer agent, on glycoconjugate production, as an indicator of mucin-like glycoprotein in cultured corneal epithelial cells. Further, we investigated the effect of rebamipide on the gene expression of membrane-associated mucins. Confluent cultured human corneal epithelial cells were incubated with rebamipide for 24 h. The glycoconjugate content in the supernatant and the cell extracts was measured by wheat germ agglutinin-enzyme-linked lectin assay combined gel-filtration method. In the experiment on mucin gene expression, cultured human corneal epithelial cells were collected at 0, 3, 6, and 12 h after administration of rebamipide. Real-time quantitative polymerase chain reaction was used to analyze the quantity of MUC1, MUC 4, and MUC16 gene expression. Rebamipide significantly increased the glycoconjugate contents in the supernatant and cell extract. In the mucin gene expression in the cells, rebamipide increased MUC1 and MUC4 gene expression, but did not increase MUC16 gene expression. Rebamipide promoted glycoconjugate, which has a property as a mucin-like glycoprotein, in human corneal epithelial cells. The increased production was mediated by MUC1 and MUC4 gene expression.

  11. BASIC PENTACYSTEINE Proteins Mediate MADS Domain Complex Binding to the DNA for Tissue-Specific Expression of Target Genes in Arabidopsis[W

    PubMed Central

    Simonini, Sara; Roig-Villanova, Irma; Gregis, Veronica; Colombo, Bilitis; Colombo, Lucia; Kater, Martin M.

    2012-01-01

    BASIC PENTACYSTEINE (BPC) transcription factors have been identified in a large variety of plant species. In Arabidopsis thaliana there are seven BPC genes, which, except for BPC5, are expressed ubiquitously. BPC genes are functionally redundant in a wide range of developmental processes. Recently, we reported that BPC1 binds to guanine and adenine (GA)–rich consensus sequences in the SEEDSTICK (STK) promoter in vitro and induces conformational changes. Here we show by chromatin immunoprecipitation experiments that in vivo BPCs also bind to the consensus boxes, and when these were mutated, expression from the STK promoter was derepressed, resulting in ectopic expression in the inflorescence. We also reveal that SHORT VEGETATIVE PHASE (SVP) is a direct regulator of STK. SVP is a floral meristem identity gene belonging to the MADS box gene family. The SVP-APETALA1 (AP1) dimer recruits the SEUSS (SEU)-LEUNIG (LUG) transcriptional cosuppressor to repress floral homeotic gene expression in the floral meristem. Interestingly, we found that GA consensus sequences in the STK promoter to which BPCs bind are essential for recruitment of the corepressor complex to this promoter. Our data suggest that we have identified a new regulatory mechanism controlling plant gene expression that is probably generally used, when considering BPCs’ wide expression profile and the frequent presence of consensus binding sites in plant promoters. PMID:23054472

  12. Latent Herpes Simplex Virus Infection of Sensory Neurons Alters Neuronal Gene Expression

    PubMed Central

    Kramer, Martha F.; Cook, W. James; Roth, Frederick P.; Zhu, Jia; Holman, Holly; Knipe, David M.; Coen, Donald M.

    2003-01-01

    The persistence of herpes simplex virus (HSV) and the diseases that it causes in the human population can be attributed to the maintenance of a latent infection within neurons in sensory ganglia. Little is known about the effects of latent infection on the host neuron. We have addressed the question of whether latent HSV infection affects neuronal gene expression by using microarray transcript profiling of host gene expression in ganglia from latently infected versus mock-infected mouse trigeminal ganglia. 33P-labeled cDNA probes from pooled ganglia harvested at 30 days postinfection or post-mock infection were hybridized to nylon arrays printed with 2,556 mouse genes. Signal intensities were acquired by phosphorimager. Mean intensities (n = 4 replicates in each of three independent experiments) of signals from mock-infected versus latently infected ganglia were compared by using a variant of Student's t test. We identified significant changes in the expression of mouse neuronal genes, including several with roles in gene expression, such as the Clk2 gene, and neurotransmission, such as genes encoding potassium voltage-gated channels and a muscarinic acetylcholine receptor. We confirmed the neuronal localization of some of these transcripts by using in situ hybridization. To validate the microarray results, we performed real-time reverse transcriptase PCR analyses for a selection of the genes. These studies demonstrate that latent HSV infection can alter neuronal gene expression and might provide a new mechanism for how persistent viral infection can cause chronic disease. PMID:12915567

  13. Characteristics of carboxylesterase genes and their expression-level between acaricide-susceptible and resistant Tetranychus cinnabarinus (Boisduval).

    PubMed

    Wei, Peng; Shi, Li; Shen, Guangmao; Xu, Zhifeng; Liu, Jialu; Pan, Yu; He, Lin

    2016-07-01

    Carboxylesterases (CarEs) play important roles in metabolism and detoxification of dietary and environmental xenobiotics in insects and mites. On the basis of the Tetranychuscinnabarinus transcriptome dataset, 23 CarE genes (6 genes are full sequence and 17 genes are partial sequence) were identified. Synergist bioassay showed that CarEs were involved in acaricide detoxification and resistance in fenpropathrin- (FeR) and cyflumetofen-resistant (CyR) strains. In order to further reveal the relationship between CarE gene's expression and acaricide-resistance in T. cinnabarinus, we profiled their expression in susceptible (SS) and resistant strains (FeR, and CyR). There were 8 and 4 over-expressed carboxylesterase genes in FeR and CyR, respectively, from which the over-expressions were detected at mRNA level, but not DNA level. Pesticide induction experiment elucidated that 4 of 8 and 2 of 4 up-regulated genes were inducible with significance in FeR and CyR strains, respectively, but they could not be induced in SS strain, which indicated that these genes became more enhanced and effective to withstand the pesticides' stress in resistant T. cinnabarinus. Most expression-changed and all inducible genes possess the Abhydrolase_3 motif, which is a catalytic domain for hydrolyzing. As a whole, these findings in current study provide clues for further elucidating the function and regulation mechanism of these carboxylesterase genes in T. cinnabarinus' resistance formation. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Analysis of temporal gene expression profiles: clustering by simulated annealing and determining the optimal number of clusters.

    PubMed

    Lukashin, A V; Fuchs, R

    2001-05-01

    Cluster analysis of genome-wide expression data from DNA microarray hybridization studies has proved to be a useful tool for identifying biologically relevant groupings of genes and samples. In the present paper, we focus on several important issues related to clustering algorithms that have not yet been fully studied. We describe a simple and robust algorithm for the clustering of temporal gene expression profiles that is based on the simulated annealing procedure. In general, this algorithm guarantees to eventually find the globally optimal distribution of genes over clusters. We introduce an iterative scheme that serves to evaluate quantitatively the optimal number of clusters for each specific data set. The scheme is based on standard approaches used in regular statistical tests. The basic idea is to organize the search of the optimal number of clusters simultaneously with the optimization of the distribution of genes over clusters. The efficiency of the proposed algorithm has been evaluated by means of a reverse engineering experiment, that is, a situation in which the correct distribution of genes over clusters is known a priori. The employment of this statistically rigorous test has shown that our algorithm places greater than 90% genes into correct clusters. Finally, the algorithm has been tested on real gene expression data (expression changes during yeast cell cycle) for which the fundamental patterns of gene expression and the assignment of genes to clusters are well understood from numerous previous studies.

  15. Identification of Gene Expression Signatures in the Chicken Intestinal Intraepithelial Lymphocytes in Response to Herb Additive Supplementations

    PubMed Central

    Won, Kyeong-Hye; Song, Ki-Duk; Park, Jong-Eun; Kim, Duk-Kyung; Na, Chong-Sam

    2016-01-01

    Anethole and garlic have an immune modulatory effects on avian coccidiosis, and these effects are correlated with gene expression changes in intestinal epithelial lymphocytes (IELs). In this study, we integrated gene expression datasets from two independent experiments and investigated gene expression profile changes by anethole and garlic respectively, and identified gene expression signatures, which are common targets of these herbs as they might be used for the evaluation of the effect of plant herbs on immunity toward avian coccidiosis. We identified 4,382 and 371 genes, which were differentially expressed in IELs of chickens supplemented with garlic and anethole respectively. The gene ontology (GO) term of differentially expressed genes (DEGs) from garlic treatment resulted in the biological processes (BPs) related to proteolysis, e.g., “modification-dependent protein catabolic process”, “proteolysis involved in cellular protein catabolic process”, “cellular protein catabolic process”, “protein catabolic process”, and “ubiquitin-dependent protein catabolic process”. In GO analysis, one BP term, “Proteolysis”, was obtained. Among DEGs, 300 genes were differentially regulated in response to both garlic and anethole, and 234 and 59 genes were either up- or down-regulated in supplementation with both herbs. Pathway analysis resulted in enrichment of the pathways related to digestion such as “Starch and sucrose metabolism” and “Insulin signaling pathway”. Taken together, the results obtained in the present study could contribute to the effective development of evaluation system of plant herbs based on molecular signatures related with their immunological functions in chicken IELs. PMID:26954117

  16. Establishment of lysozyme gene RNA interference systemand its involvement in salinity tolerance in sea cucumber (Apostichopus japonicus).

    PubMed

    Tian, Yi; Jiang, Yanan; Shang, Yanpeng; Zhang, Yu-Peng; Geng, Chen-Fan; Wang, Li-Qiang; Chang, Ya-Qing

    2017-06-01

    The lysozyme gene was silenced using RNA interference (RNAi) to analyze the function of lysozyme in sea cucumber under salt stress. The interfering efficiency of four lysozyme RNAi oligos ranged from 0.55 to 0.70. From the four oligos, p-miR-L245 was used for further interfering experiments because it had the best silencing efficiency. Peristomial film injection of p-miR-L245 (10 μg) was used for further interfering experiments. The lowest gene expression, determined by RT-PCR assay, in muscle, coelomic fluid, and parapodium occurred 48 h after p-miR-L245 injection, while that of body wall and tube foot was 96 h and 24 h, respectively. Lysozyme activity in muscle and body wall was significantly lower than the controls. The lowest lysozyme activity in muscle, body wall and parapodium, was found at 48, 72, and 48 h, respectively, which was consistent with the transcription expression of lysozyme. The lowest point of lysozyme activity was at 96 h in coelomic fluid and tube foot, which was laid behind lysozyme expression in transcription level. The expression profile of the lysozyme transcription level and lysozyme activity in the body wall and tube foot increased at 12 h after p-miR-L245 injection before the interference effect appeared. NKA gene expression was expressed at a high level in the positive control (PC) and negative control (NC) groups at 12, 24, and 48 h, while NKA was expressed at low levels in the lysozyme RNAi injection group at 12 and 24 h. The level of NKA gene expression recovered to the level of the PC and NC group at 48, 72, and 96 h after the lysozyme RNAi injection. NKCC1 gene expression was high in the PC and NC groups at 96 h, while the NKCC1 was expressed at a low level 96 h after lysozyme RNAi injection. The results suggest that lysozyme decay involves NKA and NKCC1 gene expression under salinity 18 psμ. The K + and Cl - concentration after lysozyme RNAi injection was lower than in the PC and NC group. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Mechanism of Gene Expression of Arabidopsis Glutathione S-Transferase, AtGST1, and AtGST11 in Response to Aluminum Stress1

    PubMed Central

    Ezaki, Bunichi; Suzuki, Masakatsu; Motoda, Hirotoshi; Kawamura, Masako; Nakashima, Susumu; Matsumoto, Hideaki

    2004-01-01

    The gene expression of two Al-induced Arabidopsis glutathione S-transferase genes, AtGST1 and AtGST11, was analyzed to investigate the mechanism underlying the response to Al stress. An approximately 1-kb DNA fragment of the 5′-upstream region of each gene was fused to a β-glucuronidase (GUS) reporter gene (pAtGST1::GUS and pAtGST11::GUS) and introduced into Arabidopsis ecotype Landsberg erecta. The constructed transgenic lines showed a time-dependent gene expression to a different degree in the root and/or leaf by Al stress. The pAtGST1::GUS gene was induced after a short Al treatment (maximum expression after a 2-h exposure), while the pAtGST11::GUS gene was induced by a longer Al treatment (approximately 8 h for maximum expression). Since the gene expression was observed in the leaf when only the root was exposed to Al stress, a signaling system between the root and shoot was suggested in Al stress. A GUS staining experiment using an adult transgenic line carrying the pAtGST11::GUS gene supported this suggestion. Furthermore, Al treatment simultaneously with various Ca depleted conditions in root region enhanced the gene expression of the pAtGST11::GUS in the shoot region. This result suggested that the degree of Al toxicity in the root reflects the gene response of pAtGST11::GUS in the shoot via the deduced signaling system. Both transgenic lines also showed an increase of GUS activity after cold stress, heat stress, metal toxicity, and oxidative damages, suggesting a common induction mechanism in response to the tested stresses including Al stress. PMID:15047894

  18. Genexpi: a toolset for identifying regulons and validating gene regulatory networks using time-course expression data.

    PubMed

    Modrák, Martin; Vohradský, Jiří

    2018-04-13

    Identifying regulons of sigma factors is a vital subtask of gene network inference. Integrating multiple sources of data is essential for correct identification of regulons and complete gene regulatory networks. Time series of expression data measured with microarrays or RNA-seq combined with static binding experiments (e.g., ChIP-seq) or literature mining may be used for inference of sigma factor regulatory networks. We introduce Genexpi: a tool to identify sigma factors by combining candidates obtained from ChIP experiments or literature mining with time-course gene expression data. While Genexpi can be used to infer other types of regulatory interactions, it was designed and validated on real biological data from bacterial regulons. In this paper, we put primary focus on CyGenexpi: a plugin integrating Genexpi with the Cytoscape software for ease of use. As a part of this effort, a plugin for handling time series data in Cytoscape called CyDataseries has been developed and made available. Genexpi is also available as a standalone command line tool and an R package. Genexpi is a useful part of gene network inference toolbox. It provides meaningful information about the composition of regulons and delivers biologically interpretable results.

  19. Isolation, sequence identification and tissue expression profiles of 3 novel porcine genes: ASPA, NAGA, and HEXA.

    PubMed

    Shu, Xianghua; Liu, Yonggang; Yang, Liangyu; Song, Chunlian; Hou, Jiafa

    2008-01-01

    The complete coding sequences of 3 porcine genes - ASPA, NAGA, and HEXA - were amplified by the reverse transcriptase polymerase chain reaction (RT-PCR) based on the conserved sequence information of the mouse or other mammals and referenced pig ESTs. These 3 novel porcine genes were then deposited in the NCBI database and assigned GeneIDs: 100142661, 100142664 and 100142667. The phylogenetic tree analysis revealed that the porcine ASPA, NAGA, and HEXA all have closer genetic relationships with the ASPA, NAGA, and HEXA of cattle. Tissue expression profile analysis was also carried out and results revealed that swine ASPA, NAGA, and HEXA genes were differentially expressed in various organs, including skeletal muscle, the heart, liver, fat, kidney, lung, and small and large intestines. Our experiment is the first one to establish the foundation for further research on these 3 swine genes.

  20. Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

    PubMed Central

    Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

    2010-01-01

    Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results suggest that highly-active particle-attached microbiota in the Columbia River water column may perform dissimilatory nitrate reduction (both dentrification and DNRA) within anoxic particle microniches. PMID:20967204

  1. RNA-seq reveals more consistent reference genes for gene expression studies in human non-melanoma skin cancers

    PubMed Central

    Tan, Jean-Marie; Payne, Elizabeth J.; Lin, Lynlee L.; Sinnya, Sudipta; Raphael, Anthony P.; Lambie, Duncan; Frazer, Ian H.; Dinger, Marcel E.; Soyer, H. Peter

    2017-01-01

    Identification of appropriate reference genes (RGs) is critical to accurate data interpretation in quantitative real-time PCR (qPCR) experiments. In this study, we have utilised next generation RNA sequencing (RNA-seq) to analyse the transcriptome of a panel of non-melanoma skin cancer lesions, identifying genes that are consistently expressed across all samples. Genes encoding ribosomal proteins were amongst the most stable in this dataset. Validation of this RNA-seq data was examined using qPCR to confirm the suitability of a set of highly stable genes for use as qPCR RGs. These genes will provide a valuable resource for the normalisation of qPCR data for the analysis of non-melanoma skin cancer. PMID:28852586

  2. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

    PubMed

    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-04-01

    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  3. Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus▿

    PubMed Central

    Cosme, Ruth S. Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-01-01

    Human cytomegalovirus (HCMV), a member of the β subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

  4. The Impact of Hypergravity and Vibration on Gene and Protein Expression of Thyroid Cells

    NASA Astrophysics Data System (ADS)

    Wehland, Markus; Warnke, Elisabeth; Frett, Timo; Hemmersbach, Ruth; Hauslage, Jens; Ma, Xiao; Aleshcheva, Ganna; Pietsch, Jessica; Bauer, Johann; Grimm, Daniela

    2016-06-01

    Experiments in space either on orbital missions on-board the ISS, or in suborbital missions using sounding rockets, like TEXUS as well as parabolic flight campaigns are still the gold standard to achieve real microgravity conditions in the field of gravitational biology and medicine. However, during launch, and in flight, hypergravity and vibrations occur which might interfere with the effects of microgravity. It is therefore important to know these effects and discriminate them from the microgravity effects. This can be achieved by ground-based facilities like centrifuges or vibration platforms. Recently, we have conducted several experiments with different thyroid cancer cell lines. This study, as part of the ESA-CORA-GBF 2010-203 project, focused on the influence of vibration and hypergravity on benign human thyroid follicular epithelial cells (Nthy-ori 3-1 cell line). Gene and in part protein expression regulation under both conditions were analyzed for VCAN, ITGA10, ITGB1, OPN, ADAM19, ANXA1, TNFA, ABL2, ACTB, PFN2, TLN1, EZR, RDX, MSN, CTGF, PRKCA, and PRKAA1 using quantitative real-time PCR and Western Blot. We found that hypergravity and vibration affected genes and proteins involved in the extracellular matrix, the cytoskeleton, apoptosis, cell growth and signaling. Vibration always led to a down-regulation, whereas hypergravity resulted in a more heterogeneous expression pattern. Overall we conclude that both conditions can influence gene regulation and production of various genes and proteins. As a consequence, it is important to perform control experiments on hypergravity and vibration facilities in parallel to flight experiments.

  5. TIPMaP: a web server to establish transcript isoform profiles from reliable microarray probes.

    PubMed

    Chitturi, Neelima; Balagannavar, Govindkumar; Chandrashekar, Darshan S; Abinaya, Sadashivam; Srini, Vasan S; Acharya, Kshitish K

    2013-12-27

    Standard 3' Affymetrix gene expression arrays have contributed a significantly higher volume of existing gene expression data than other microarray platforms. These arrays were designed to identify differentially expressed genes, but not their alternatively spliced transcript forms. No resource can currently identify expression pattern of specific mRNA forms using these microarray data, even though it is possible to do this. We report a web server for expression profiling of alternatively spliced transcripts using microarray data sets from 31 standard 3' Affymetrix arrays for human, mouse and rat species. The tool has been experimentally validated for mRNAs transcribed or not-detected in a human disease condition (non-obstructive azoospermia, a male infertility condition). About 4000 gene expression datasets were downloaded from a public repository. 'Good probes' with complete coverage and identity to latest reference transcript sequences were first identified. Using them, 'Transcript specific probe-clusters' were derived for each platform and used to identify expression status of possible transcripts. The web server can lead the user to datasets corresponding to specific tissues, conditions via identifiers of the microarray studies or hybridizations, keywords, official gene symbols or reference transcript identifiers. It can identify, in the tissues and conditions of interest, about 40% of known transcripts as 'transcribed', 'not-detected' or 'differentially regulated'. Corresponding additional information for probes, genes, transcripts and proteins can be viewed too. We identified the expression of transcripts in a specific clinical condition and validated a few of these transcripts by experiments (using reverse transcription followed by polymerase chain reaction). The experimental observations indicated higher agreements with the web server results, than contradictions. The tool is accessible at http://resource.ibab.ac.in/TIPMaP. The newly developed online tool forms a reliable means for identification of alternatively spliced transcript-isoforms that may be differentially expressed in various tissues, cell types or physiological conditions. Thus, by making better use of existing data, TIPMaP avoids the dependence on precious tissue-samples, in experiments with a goal to establish expression profiles of alternative splice forms--at least in some cases.

  6. Early social learning triggers neurogenomic expression changes in a swordtail fish.

    PubMed

    Cui, Rongfeng; Delclos, Pablo J; Schumer, Molly; Rosenthal, Gil G

    2017-05-17

    Mate choice can play a pivotal role in the nature and extent of reproductive isolation between species. Mating preferences are often dependent on an individual's social experience with adult phenotypes throughout development. We show that olfactory preference in a swordtail fish ( Xiphophorus malinche ) is affected by previous experience with adult olfactory signals. We compare transcriptome-wide gene expression levels of pooled sensory and brain tissues between three treatment groups that differ by social experience: females with no adult exposure, females exposed to conspecifics and females exposed to heterospecifics. We identify potential functionally relevant genes and biological pathways differentially expressed not only between control and exposure groups, but also between groups exposed to conspecifics and heterospecifics. Based on our results, we speculate that vomeronasal receptor type 2 paralogs may detect species-specific pheromone components and thus play an important role in reproductive isolation between species. © 2017 The Author(s).

  7. Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing.

    PubMed

    Jäger, Marten; Ott, Claus-Eric; Grünhagen, Johannes; Hecht, Jochen; Schell, Hanna; Mundlos, Stefan; Duda, Georg N; Robinson, Peter N; Lienau, Jasmin

    2011-03-24

    The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism.

  8. Composite transcriptome assembly of RNA-seq data in a sheep model for delayed bone healing

    PubMed Central

    2011-01-01

    Background The sheep is an important model organism for many types of medically relevant research, but molecular genetic experiments in the sheep have been limited by the lack of knowledge about ovine gene sequences. Results Prior to our study, mRNA sequences for only 1,556 partial or complete ovine genes were publicly available. Therefore, we developed a composite de novo transcriptome assembly method for next-generation sequence data to combine known ovine mRNA and EST sequences, mRNA sequences from mouse and cow, and sequences assembled de novo from short read RNA-Seq data into a composite reference transcriptome, and identified transcripts from over 12 thousand previously undescribed ovine genes. Gene expression analysis based on these data revealed substantially different expression profiles in standard versus delayed bone healing in an ovine tibial osteotomy model. Hundreds of transcripts were differentially expressed between standard and delayed healing and between the time points of the standard and delayed healing groups. We used the sheep sequences to design quantitative RT-PCR assays with which we validated the differential expression of 26 genes that had been identified by RNA-seq analysis. A number of clusters of characteristic expression profiles could be identified, some of which showed striking differences between the standard and delayed healing groups. Gene Ontology (GO) analysis showed that the differentially expressed genes were enriched in terms including extracellular matrix, cartilage development, contractile fiber, and chemokine activity. Conclusions Our results provide a first atlas of gene expression profiles and differentially expressed genes in standard and delayed bone healing in a large-animal model and provide a number of clues as to the shifts in gene expression that underlie delayed bone healing. In the course of our study, we identified transcripts of 13,987 ovine genes, including 12,431 genes for which no sequence information was previously available. This information will provide a basis for future molecular research involving the sheep as a model organism. PMID:21435219

  9. Expression analysis in response to drought stress in soybean: Shedding light on the regulation of metabolic pathway genes.

    PubMed

    Guimarães-Dias, Fábia; Neves-Borges, Anna Cristina; Viana, Antonio Americo Barbosa; Mesquita, Rosilene Oliveira; Romano, Eduardo; de Fátima Grossi-de-Sá, Maria; Nepomuceno, Alexandre Lima; Loureiro, Marcelo Ehlers; Alves-Ferreira, Márcio

    2012-06-01

    Metabolomics analysis of wild type Arabidopsis thaliana plants, under control and drought stress conditions revealed several metabolic pathways that are induced under water deficit. The metabolic response to drought stress is also associated with ABA dependent and independent pathways, allowing a better understanding of the molecular mechanisms in this model plant. Through combining an in silico approach and gene expression analysis by quantitative real-time PCR, the present work aims at identifying genes of soybean metabolic pathways potentially associated with water deficit. Digital expression patterns of Arabidopsis genes, which were selected based on the basis of literature reports, were evaluated under drought stress condition by Genevestigator. Genes that showed strong induction under drought stress were selected and used as bait to identify orthologs in the soybean genome. This allowed us to select 354 genes of putative soybean orthologs of 79 Arabidopsis genes belonging to 38 distinct metabolic pathways. The expression pattern of the selected genes was verified in the subtractive libraries available in the GENOSOJA project. Subsequently, 13 genes from different metabolic pathways were selected for validation by qPCR experiments. The expression of six genes was validated in plants undergoing drought stress in both pot-based and hydroponic cultivation systems. The results suggest that the metabolic response to drought stress is conserved in Arabidopsis and soybean plants.

  10. Mechanisms of stable lipid loss in a social insect

    PubMed Central

    Ament, Seth A.; Chan, Queenie W.; Wheeler, Marsha M.; Nixon, Scott E.; Johnson, S. Peir; Rodriguez-Zas, Sandra L.; Foster, Leonard J.; Robinson, Gene E.

    2011-01-01

    SUMMARY Worker honey bees undergo a socially regulated, highly stable lipid loss as part of their behavioral maturation. We used large-scale transcriptomic and proteomic experiments, physiological experiments and RNA interference to explore the mechanistic basis for this lipid loss. Lipid loss was associated with thousands of gene expression changes in abdominal fat bodies. Many of these genes were also regulated in young bees by nutrition during an initial period of lipid gain. Surprisingly, in older bees, which is when maximum lipid loss occurs, diet played less of a role in regulating fat body gene expression for components of evolutionarily conserved nutrition-related endocrine systems involving insulin and juvenile hormone signaling. By contrast, fat body gene expression in older bees was regulated more strongly by evolutionarily novel regulatory factors, queen mandibular pheromone (a honey bee-specific social signal) and vitellogenin (a conserved yolk protein that has evolved novel, maturation-related functions in the bee), independent of nutrition. These results demonstrate that conserved molecular pathways can be manipulated to achieve stable lipid loss through evolutionarily novel regulatory processes. PMID:22031746

  11. Mechanisms of stable lipid loss in a social insect.

    PubMed

    Ament, Seth A; Chan, Queenie W; Wheeler, Marsha M; Nixon, Scott E; Johnson, S Peir; Rodriguez-Zas, Sandra L; Foster, Leonard J; Robinson, Gene E

    2011-11-15

    Worker honey bees undergo a socially regulated, highly stable lipid loss as part of their behavioral maturation. We used large-scale transcriptomic and proteomic experiments, physiological experiments and RNA interference to explore the mechanistic basis for this lipid loss. Lipid loss was associated with thousands of gene expression changes in abdominal fat bodies. Many of these genes were also regulated in young bees by nutrition during an initial period of lipid gain. Surprisingly, in older bees, which is when maximum lipid loss occurs, diet played less of a role in regulating fat body gene expression for components of evolutionarily conserved nutrition-related endocrine systems involving insulin and juvenile hormone signaling. By contrast, fat body gene expression in older bees was regulated more strongly by evolutionarily novel regulatory factors, queen mandibular pheromone (a honey bee-specific social signal) and vitellogenin (a conserved yolk protein that has evolved novel, maturation-related functions in the bee), independent of nutrition. These results demonstrate that conserved molecular pathways can be manipulated to achieve stable lipid loss through evolutionarily novel regulatory processes.

  12. Long-Range Chromosome Interactions Mediated by Cohesin Shape Circadian Gene Expression

    PubMed Central

    Xu, Yichi; Guo, Weimin; Li, Ping; Zhang, Yan; Zhao, Meng; Fan, Zenghua; Zhao, Zhihu; Yan, Jun

    2016-01-01

    Mammalian circadian rhythm is established by the negative feedback loops consisting of a set of clock genes, which lead to the circadian expression of thousands of downstream genes in vivo. As genome-wide transcription is organized under the high-order chromosome structure, it is largely uncharted how circadian gene expression is influenced by chromosome architecture. We focus on the function of chromatin structure proteins cohesin as well as CTCF (CCCTC-binding factor) in circadian rhythm. Using circular chromosome conformation capture sequencing, we systematically examined the interacting loci of a Bmal1-bound super-enhancer upstream of a clock gene Nr1d1 in mouse liver. These interactions are largely stable in the circadian cycle and cohesin binding sites are enriched in the interactome. Global analysis showed that cohesin-CTCF co-binding sites tend to insulate the phases of circadian oscillating genes while cohesin-non-CTCF sites are associated with high circadian rhythmicity of transcription. A model integrating the effects of cohesin and CTCF markedly improved the mechanistic understanding of circadian gene expression. Further experiments in cohesin knockout cells demonstrated that cohesin is required at least in part for driving the circadian gene expression by facilitating the enhancer-promoter looping. This study provided a novel insight into the relationship between circadian transcriptome and the high-order chromosome structure. PMID:27135601

  13. Systematic identification of genes involved in divergent skeletal muscle growth rates of broiler and layer chickens.

    PubMed

    Zheng, Qi; Zhang, Yong; Chen, Ying; Yang, Ning; Wang, Xiu-Jie; Zhu, Dahai

    2009-02-22

    The genetic closeness and divergent muscle growth rates of broilers and layers make them great models for myogenesis study. In order to discover the molecular mechanisms determining the divergent muscle growth rates and muscle mass control in different chicken lines, we systematically identified differentially expressed genes between broiler and layer skeletal muscle cells during different developmental stages by microarray hybridization experiment. Taken together, 543 differentially expressed genes were identified between broilers and layers across different developmental stages. We found that differential regulation of slow-type muscle gene expression, satellite cell proliferation and differentiation, protein degradation rate and genes in some metabolic pathways could give great contributions to the divergent muscle growth rates of the two chicken lines. Interestingly, the expression profiles of a few differentially expressed genes were positively or negatively correlated with the growth rates of broilers and layers, indicating that those genes may function in regulating muscle growth during development. The multiple muscle cell growth regulatory processes identified by our study implied that complicated molecular networks involved in the regulation of chicken muscle growth. These findings will not only offer genetic information for identifying candidate genes for chicken breeding, but also provide new clues for deciphering mechanisms underlining muscle development in vertebrates.

  14. Reproductive Experience Alters Prolactin Receptor Expression in Mammary and Hepatic Tissues in Female Rats1

    PubMed Central

    Bridges, Robert S.; Scanlan, Victoria F.; Lee, Jong-O; Byrnes, Elizabeth M.

    2011-01-01

    Recent studies have reported that reproductive experience in female rats alters prolactin (PRL) receptor gene expression in the brain as well as neural sensitivity to PRL. Given PRL's actions in nonneural tissues, that is, mammary tissue and liver, it was asked whether reproductive experience may also alter prolactin receptor (Prlr) gene expression in these tissues. Groups of age-matched female rats were generated with varying reproductive histories. Separate groups of primiparous (first lactation) and multiparous (second lactation) had mammary tissue and liver samples collected on Day 3 or 10 of lactation. A fifth group raised one litter to weaning and then resumed estrous cyclicity. This group and a final group of age-matched, virgin controls were killed on diestrus. Tissue was processed by quantitative PCR for expression rates of the long and short forms of Prlr mRNA as well as casein beta mRNA (mammary tissue only). Western blots were performed to quantify receptor protein content. Multiple lactations as well as lactation itself resulted in alterations in Prlr expression. Prlr gene expression in mammary tissue was increased in primiparous mothers compared with that in multiparous dams, whereas in the liver, Prlr expression was reduced during an initial lactation. In contrast, PRLR protein levels declined during lactation in mammary, but not hepatic, tissues. Overall, the results demonstrate that the prolactin receptor system is altered in nonneural tissues as a result of the female's reproductive history. The findings are discussed in the context of milk and bile production and PRL's possible role in breast cancer. PMID:21508351

  15. Reproductive experience alters prolactin receptor expression in mammary and hepatic tissues in female rats.

    PubMed

    Bridges, Robert S; Scanlan, Victoria F; Lee, Jong-O; Byrnes, Elizabeth M

    2011-08-01

    Recent studies have reported that reproductive experience in female rats alters prolactin (PRL) receptor gene expression in the brain as well as neural sensitivity to PRL. Given PRL's actions in nonneural tissues, that is, mammary tissue and liver, it was asked whether reproductive experience may also alter prolactin receptor (Prlr) gene expression in these tissues. Groups of age-matched female rats were generated with varying reproductive histories. Separate groups of primiparous (first lactation) and multiparous (second lactation) had mammary tissue and liver samples collected on Day 3 or 10 of lactation. A fifth group raised one litter to weaning and then resumed estrous cyclicity. This group and a final group of age-matched, virgin controls were killed on diestrus. Tissue was processed by quantitative PCR for expression rates of the long and short forms of Prlr mRNA as well as casein beta mRNA (mammary tissue only). Western blots were performed to quantify receptor protein content. Multiple lactations as well as lactation itself resulted in alterations in Prlr expression. Prlr gene expression in mammary tissue was increased in primiparous mothers compared with that in multiparous dams, whereas in the liver, Prlr expression was reduced during an initial lactation. In contrast, PRLR protein levels declined during lactation in mammary, but not hepatic, tissues. Overall, the results demonstrate that the prolactin receptor system is altered in nonneural tissues as a result of the female's reproductive history. The findings are discussed in the context of milk and bile production and PRL's possible role in breast cancer.

  16. Investigation of MACC1 Gene Expression in Head and Neck Cancer and Cancer Stem Cells.

    PubMed

    Evran, Ebru; Şahin, Hilal; Akbaş, Kübra; Çiğdem, Sadik; Gündüz, Esra

    2016-12-01

    By investigating the MACC1 gene (metastasis-associated in colon cancer 1) in cancer stem cells (CSC) resistant to chemotherapy and in cancer stem cells (CSC) resistant to chemotherapy and in cancer cells (CS) sensitive to chemotherapy we determineda steady expression in both types of cells in head and neck cancer. In conformity with the result we examined if this gene could be a competitor gene for chemotherapy. According to literature, the MACC1 gene shows a clear expression in head and neck cancer cells [1]. Here we examined MACC1 expression in CSC and investigated it as a possible biomarker. Our experiments were performed in the UT -SCC -74 in primary head and neck cancer cell line. We examined the MACC -1 gene expression by Real Time PCR from both isolated CSC and CS. Expression of MACC -1 gene of cancer stem cells showed an two-fold increase compared with cancer cells. Based on the positive expression of MACC1 in both CS and CSC, this gene may serve as a potential biomarker in head and neck cancer. By comparing the results of this study with the novel features of MACC1, two important hypotheses could be examined. The first hypothesis is that MACC1 is a possible transcripton factor in colon cancer, which influences a high expression of CSC in head and neck and affects the expression of three biomarkers of the CSC control group biomarkers. The second hypothesisis is that the positive expression of MACC1 in patients with a malignant prognosis of tongue cancer, which belongs to head and neck cancer types, operates a faster development of CSC to cancer cells.

  17. Regulation of Msx genes by a Bmp gradient is essential for neural crest specification.

    PubMed

    Tribulo, Celeste; Aybar, Manuel J; Nguyen, Vu H; Mullins, Mary C; Mayor, Roberto

    2003-12-01

    There is evidence in Xenopus and zebrafish embryos that the neural crest/neural folds are specified at the border of the neural plate by a precise threshold concentration of a Bmp gradient. In order to understand the molecular mechanism by which a gradient of Bmp is able to specify the neural crest, we analyzed how the expression of Bmp targets, the Msx genes, is regulated and the role that Msx genes has in neural crest specification. As Msx genes are directly downstream of Bmp, we analyzed Msx gene expression after experimental modification in the level of Bmp activity by grafting a bead soaked with noggin into Xenopus embryos, by expressing in the ectoderm a dominant-negative Bmp4 or Bmp receptor in Xenopus and zebrafish embryos, and also through Bmp pathway component mutants in the zebrafish. All the results show that a reduction in the level of Bmp activity leads to an increase in the expression of Msx genes in the neural plate border. Interestingly, by reaching different levels of Bmp activity in animal cap ectoderm, we show that a specific concentration of Bmp induces msx1 expression to a level similar to that required to induce neural crest. Our results indicate that an intermediate level of Bmp activity specifies the expression of Msx genes in the neural fold region. In addition, we have analyzed the role that msx1 plays on neural crest specification. As msx1 has a role in dorsoventral pattering, we have carried out conditional gain- and loss-of-function experiments using different msx1 constructs fused to a glucocorticoid receptor element to avoid an early effect of this factor. We show that msx1 expression is able to induce all other early neural crest markers tested (snail, slug, foxd3) at the time of neural crest specification. Furthermore, the expression of a dominant negative of Msx genes leads to the inhibition of all the neural crest markers analyzed. It has been previously shown that snail is one of the earliest genes acting in the neural crest genetic cascade. In order to study the hierarchical relationship between msx1 and snail/slug we performed several rescue experiments using dominant negatives for these genes. The rescuing activity by snail and slug on neural crest development of the msx1 dominant negative, together with the inability of msx1 to rescue the dominant negatives of slug and snail strongly argue that msx1 is upstream of snail and slug in the genetic cascade that specifies the neural crest in the ectoderm. We propose a model where a gradient of Bmp activity specifies the expression of Msx genes in the neural folds, and that this expression is essential for the early specification of the neural crest.

  18. A Novel Tightly Regulated Gene Expression System for the Human Intestinal Symbiont Bacteroides thetaiotaomicron.

    PubMed

    Horn, Nikki; Carvalho, Ana L; Overweg, Karin; Wegmann, Udo; Carding, Simon R; Stentz, Régis

    2016-01-01

    There is considerable interest in studying the function of Bacteroides species resident in the human gastrointestinal (GI)-tract and the contribution they make to host health. Reverse genetics and protein expression techniques, such as those developed for well-characterized Escherichia coli cannot be applied to Bacteroides species as they and other members of the Bacteriodetes phylum have unique promoter structures. The availability of useful Bacteroides-specific genetic tools is therefore limited. Here we describe the development of an effective mannan-controlled gene expression system for Bacteroides thetaiotaomicron containing the mannan-inducible promoter-region of an α-1,2-mannosidase gene (BT_3784), a ribosomal binding site designed to modulate expression, a multiple cloning site to facilitate the cloning of genes of interest, and a transcriptional terminator. Using the Lactobacillus pepI as a reporter gene, mannan induction resulted in an increase of reporter activity in a time- and concentration-dependent manner with a wide range of activity. The endogenous BtcepA cephalosporinase gene was used to demonstrate the suitability of this novel expression system, enabling the isolation of a His-tagged version of BtCepA. We have also shown with experiments performed in mice that the system can be induced in vivo in the presence of an exogenous source of mannan. By enabling the controlled expression of endogenous and exogenous genes in B. thetaiotaomicron this novel inducer-dependent expression system will aid in defining the physiological role of individual genes and the functional analyses of their products.

  19. Identification of Differentially Expressed IGFBP5-Related Genes in Breast Cancer Tumor Tissues Using cDNA Microarray Experiments.

    PubMed

    Akkiprik, Mustafa; Peker, İrem; Özmen, Tolga; Amuran, Gökçe Güllü; Güllüoğlu, Bahadır M; Kaya, Handan; Özer, Ayşe

    2015-11-10

    IGFBP5 is an important regulatory protein in breast cancer progression. We tried to identify differentially expressed genes (DEGs) between breast tumor tissues with IGFBP5 overexpression and their adjacent normal tissues. In this study, thirty-eight breast cancer and adjacent normal breast tissue samples were used to determine IGFBP5 expression by qPCR. cDNA microarrays were applied to the highest IGFBP5 overexpressed tumor samples compared to their adjacent normal breast tissue. Microarray analysis revealed that a total of 186 genes were differentially expressed in breast cancer compared with normal breast tissues. Of the 186 genes, 169 genes were downregulated and 17 genes were upregulated in the tumor samples. KEGG pathway analyses showed that protein digestion and absorption, focal adhesion, salivary secretion, drug metabolism-cytochrome P450, and phenylalanine metabolism pathways are involved. Among these DEGs, the prominent top two genes (MMP11 and COL1A1) which potentially correlated with IGFBP5 were selected for validation using real time RT-qPCR. Only COL1A1 expression showed a consistent upregulation with IGFBP5 expression and COL1A1 and MMP11 were significantly positively correlated. We concluded that the discovery of coordinately expressed genes related with IGFBP5 might contribute to understanding of the molecular mechanism of the function of IGFBP5 in breast cancer. Further functional studies on DEGs and association with IGFBP5 may identify novel biomarkers for clinical applications in breast cancer.

  20. A formal concept analysis approach to consensus clustering of multi-experiment expression data

    PubMed Central

    2014-01-01

    Background Presently, with the increasing number and complexity of available gene expression datasets, the combination of data from multiple microarray studies addressing a similar biological question is gaining importance. The analysis and integration of multiple datasets are expected to yield more reliable and robust results since they are based on a larger number of samples and the effects of the individual study-specific biases are diminished. This is supported by recent studies suggesting that important biological signals are often preserved or enhanced by multiple experiments. An approach to combining data from different experiments is the aggregation of their clusterings into a consensus or representative clustering solution which increases the confidence in the common features of all the datasets and reveals the important differences among them. Results We propose a novel generic consensus clustering technique that applies Formal Concept Analysis (FCA) approach for the consolidation and analysis of clustering solutions derived from several microarray datasets. These datasets are initially divided into groups of related experiments with respect to a predefined criterion. Subsequently, a consensus clustering algorithm is applied to each group resulting in a clustering solution per group. These solutions are pooled together and further analysed by employing FCA which allows extracting valuable insights from the data and generating a gene partition over all the experiments. In order to validate the FCA-enhanced approach two consensus clustering algorithms are adapted to incorporate the FCA analysis. Their performance is evaluated on gene expression data from multi-experiment study examining the global cell-cycle control of fission yeast. The FCA results derived from both methods demonstrate that, although both algorithms optimize different clustering characteristics, FCA is able to overcome and diminish these differences and preserve some relevant biological signals. Conclusions The proposed FCA-enhanced consensus clustering technique is a general approach to the combination of clustering algorithms with FCA for deriving clustering solutions from multiple gene expression matrices. The experimental results presented herein demonstrate that it is a robust data integration technique able to produce good quality clustering solution that is representative for the whole set of expression matrices. PMID:24885407

  1. Antagonizing the Spemann organizer: role of the homeobox gene Xvent-1.

    PubMed Central

    Gawantka, V; Delius, H; Hirschfeld, K; Blumenstock, C; Niehrs, C

    1995-01-01

    We have identified a novel homeobox gene, Xvent-1, that is differentially expressed in the ventral marginal zone of the early Xenopus gastrula. Evidence is presented from mRNA microinjection experiments for a role for this gene in dorsoventral patterning of mesoderm. First, Xvent-1 is induced by BMP-4, a gene known to be a key regulator of ventral mesoderm development. Second, Xvent-1 and the organizer-specific gene goosecoid are able to interact, directly or indirectly, in a cross-regulatory loop suppressing each other's expression, consistent with their mutually exclusive expression in the marginal zone. Third, microinjection of Xvent-1 mRNA ventralizes dorsal mesoderm. The results suggest that Xvent-1 functions in a ventral signaling pathway that maintains the ventral mesodermal state and antagonizes the Spemann organizer. Images PMID:8557046

  2. Molecular brake pad hypothesis: pulling off the brakes for emotional memory

    PubMed Central

    Vogel-Ciernia, Annie

    2015-01-01

    Under basal conditions histone deacetylases (HDACs) and their associated co-repressor complexes serve as molecular ‘brake pads’ to prevent the gene expression required for long-term memory formation. Following a learning event, HDACs and their co-repressor complexes are removed from a subset of specific gene promoters, allowing the histone acetylation and active gene expression required for long-term memory formation. Inhibition of HDACs increases histone acetylation, extends gene expression profiles, and allows for the formation of persistent long-term memories for training events that are otherwise forgotten. We propose that emotionally salient experiences have utilized this system to form strong and persistent memories for behaviorally significant events. Consequently, the presence or absence of HDACs at a selection of specific gene promoters could serve as a critical barrier for permitting the formation of long-term memories. PMID:23096102

  3. CGI: Java Software for Mapping and Visualizing Data from Array-based Comparative Genomic Hybridization and Expression Profiling

    PubMed Central

    Gu, Joyce Xiuweu-Xu; Wei, Michael Yang; Rao, Pulivarthi H.; Lau, Ching C.; Behl, Sanjiv; Man, Tsz-Kwong

    2007-01-01

    With the increasing application of various genomic technologies in biomedical research, there is a need to integrate these data to correlate candidate genes/regions that are identified by different genomic platforms. Although there are tools that can analyze data from individual platforms, essential software for integration of genomic data is still lacking. Here, we present a novel Java-based program called CGI (Cytogenetics-Genomics Integrator) that matches the BAC clones from array-based comparative genomic hybridization (aCGH) to genes from RNA expression profiling datasets. The matching is computed via a fast, backend MySQL database containing UCSC Genome Browser annotations. This program also provides an easy-to-use graphical user interface for visualizing and summarizing the correlation of DNA copy number changes and RNA expression patterns from a set of experiments. In addition, CGI uses a Java applet to display the copy number values of a specific BAC clone in aCGH experiments side by side with the expression levels of genes that are mapped back to that BAC clone from the microarray experiments. The CGI program is built on top of extensible, reusable graphic components specifically designed for biologists. It is cross-platform compatible and the source code is freely available under the General Public License. PMID:19936083

  4. CGI: Java software for mapping and visualizing data from array-based comparative genomic hybridization and expression profiling.

    PubMed

    Gu, Joyce Xiuweu-Xu; Wei, Michael Yang; Rao, Pulivarthi H; Lau, Ching C; Behl, Sanjiv; Man, Tsz-Kwong

    2007-10-06

    With the increasing application of various genomic technologies in biomedical research, there is a need to integrate these data to correlate candidate genes/regions that are identified by different genomic platforms. Although there are tools that can analyze data from individual platforms, essential software for integration of genomic data is still lacking. Here, we present a novel Java-based program called CGI (Cytogenetics-Genomics Integrator) that matches the BAC clones from array-based comparative genomic hybridization (aCGH) to genes from RNA expression profiling datasets. The matching is computed via a fast, backend MySQL database containing UCSC Genome Browser annotations. This program also provides an easy-to-use graphical user interface for visualizing and summarizing the correlation of DNA copy number changes and RNA expression patterns from a set of experiments. In addition, CGI uses a Java applet to display the copy number values of a specific BAC clone in aCGH experiments side by side with the expression levels of genes that are mapped back to that BAC clone from the microarray experiments. The CGI program is built on top of extensible, reusable graphic components specifically designed for biologists. It is cross-platform compatible and the source code is freely available under the General Public License.

  5. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    PubMed

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  6. A Rhodopsin-Like Gene May Be Associated With the Light-Sensitivity of Adult Pacific Oyster Crassostrea gigas

    PubMed Central

    Wu, Changlu; Jiang, Qiuyun; Wei, Lei; Cai, Zhongqiang; Chen, Jun; Yu, Wenchao; He, Cheng; Wang, Jiao; Guo, Wen; Wang, Xiaotong

    2018-01-01

    Light-sensitivity is important for mollusc survival, as it plays a vital role in reproduction and predator avoidance. Light-sensitivity has been demonstrated in the adult Pacific oyster Crassostrea gigas, but the genes associated with light-sensitivity remain unclear. In the present study, we designed experiments to identify the genes associated with light-sensitivity in adult oysters. First, we assessed the Pacific oyster genome and identified 368 genes annotated with the terms associated with light-sensitivity. Second, the function of the four rhodopsin-like superfamily member genes was tested by using RNAi. The results showed that the highest level of mRNA expression of the vision-related genes was in the mantle; however, this finding is not true for all oyster genes. Interestingly, we also found four rhodopsin-like superfamily member genes expressed at an very high level in the mantle tissue. In the RNAi experiment, when one of rhodopsin-like superfamily member genes (CGI_1001253) was inhibited, the light-sensitivity capacity of the injected oysters was significantly reduced, suggesting that CGI_10012534 may be associated with light-sensitivity in the adult Pacific oyster. PMID:29615921

  7. Computational exploration of cis-regulatory modules in rhythmic expression data using the "Exploration of Distinctive CREs and CRMs" (EDCC) and "CRM Network Generator" (CNG) programs.

    PubMed

    Bekiaris, Pavlos Stephanos; Tekath, Tobias; Staiger, Dorothee; Danisman, Selahattin

    2018-01-01

    Understanding the effect of cis-regulatory elements (CRE) and clusters of CREs, which are called cis-regulatory modules (CRM), in eukaryotic gene expression is a challenge of computational biology. We developed two programs that allow simple, fast and reliable analysis of candidate CREs and CRMs that may affect specific gene expression and that determine positional features between individual CREs within a CRM. The first program, "Exploration of Distinctive CREs and CRMs" (EDCC), correlates candidate CREs and CRMs with specific gene expression patterns. For pairs of CREs, EDCC also determines positional preferences of the single CREs in relation to each other and to the transcriptional start site. The second program, "CRM Network Generator" (CNG), prioritizes these positional preferences using a neural network and thus allows unbiased rating of the positional preferences that were determined by EDCC. We tested these programs with data from a microarray study of circadian gene expression in Arabidopsis thaliana. Analyzing more than 1.5 million pairwise CRE combinations, we found 22 candidate combinations, of which several contained known clock promoter elements together with elements that had not been identified as relevant to circadian gene expression before. CNG analysis further identified positional preferences of these CRE pairs, hinting at positional information that may be relevant for circadian gene expression. Future wet lab experiments will have to determine which of these combinations confer daytime specific circadian gene expression.

  8. Computational exploration of cis-regulatory modules in rhythmic expression data using the “Exploration of Distinctive CREs and CRMs” (EDCC) and “CRM Network Generator” (CNG) programs

    PubMed Central

    Staiger, Dorothee

    2018-01-01

    Understanding the effect of cis-regulatory elements (CRE) and clusters of CREs, which are called cis-regulatory modules (CRM), in eukaryotic gene expression is a challenge of computational biology. We developed two programs that allow simple, fast and reliable analysis of candidate CREs and CRMs that may affect specific gene expression and that determine positional features between individual CREs within a CRM. The first program, “Exploration of Distinctive CREs and CRMs” (EDCC), correlates candidate CREs and CRMs with specific gene expression patterns. For pairs of CREs, EDCC also determines positional preferences of the single CREs in relation to each other and to the transcriptional start site. The second program, “CRM Network Generator” (CNG), prioritizes these positional preferences using a neural network and thus allows unbiased rating of the positional preferences that were determined by EDCC. We tested these programs with data from a microarray study of circadian gene expression in Arabidopsis thaliana. Analyzing more than 1.5 million pairwise CRE combinations, we found 22 candidate combinations, of which several contained known clock promoter elements together with elements that had not been identified as relevant to circadian gene expression before. CNG analysis further identified positional preferences of these CRE pairs, hinting at positional information that may be relevant for circadian gene expression. Future wet lab experiments will have to determine which of these combinations confer daytime specific circadian gene expression. PMID:29298348

  9. A method to identify differential expression profiles of time-course gene data with Fourier transformation

    PubMed Central

    2013-01-01

    Background Time course gene expression experiments are an increasingly popular method for exploring biological processes. Temporal gene expression profiles provide an important characterization of gene function, as biological systems are both developmental and dynamic. With such data it is possible to study gene expression changes over time and thereby to detect differential genes. Much of the early work on analyzing time series expression data relied on methods developed originally for static data and thus there is a need for improved methodology. Since time series expression is a temporal process, its unique features such as autocorrelation between successive points should be incorporated into the analysis. Results This work aims to identify genes that show different gene expression profiles across time. We propose a statistical procedure to discover gene groups with similar profiles using a nonparametric representation that accounts for the autocorrelation in the data. In particular, we first represent each profile in terms of a Fourier basis, and then we screen out genes that are not differentially expressed based on the Fourier coefficients. Finally, we cluster the remaining gene profiles using a model-based approach in the Fourier domain. We evaluate the screening results in terms of sensitivity, specificity, FDR and FNR, compare with the Gaussian process regression screening in a simulation study and illustrate the results by application to yeast cell-cycle microarray expression data with alpha-factor synchronization. The key elements of the proposed methodology: (i) representation of gene profiles in the Fourier domain; (ii) automatic screening of genes based on the Fourier coefficients and taking into account autocorrelation in the data, while controlling the false discovery rate (FDR); (iii) model-based clustering of the remaining gene profiles. Conclusions Using this method, we identified a set of cell-cycle-regulated time-course yeast genes. The proposed method is general and can be potentially used to identify genes which have the same patterns or biological processes, and help facing the present and forthcoming challenges of data analysis in functional genomics. PMID:24134721

  10. ExpressionDB: An open source platform for distributing genome-scale datasets.

    PubMed

    Hughes, Laura D; Lewis, Scott A; Hughes, Michael E

    2017-01-01

    RNA-sequencing (RNA-seq) and microarrays are methods for measuring gene expression across the entire transcriptome. Recent advances have made these techniques practical and affordable for essentially any laboratory with experience in molecular biology. A variety of computational methods have been developed to decrease the amount of bioinformatics expertise necessary to analyze these data. Nevertheless, many barriers persist which discourage new labs from using functional genomics approaches. Since high-quality gene expression studies have enduring value as resources to the entire research community, it is of particular importance that small labs have the capacity to share their analyzed datasets with the research community. Here we introduce ExpressionDB, an open source platform for visualizing RNA-seq and microarray data accommodating virtually any number of different samples. ExpressionDB is based on Shiny, a customizable web application which allows data sharing locally and online with customizable code written in R. ExpressionDB allows intuitive searches based on gene symbols, descriptions, or gene ontology terms, and it includes tools for dynamically filtering results based on expression level, fold change, and false-discovery rates. Built-in visualization tools include heatmaps, volcano plots, and principal component analysis, ensuring streamlined and consistent visualization to all users. All of the scripts for building an ExpressionDB with user-supplied data are freely available on GitHub, and the Creative Commons license allows fully open customization by end-users. We estimate that a demo database can be created in under one hour with minimal programming experience, and that a new database with user-supplied expression data can be completed and online in less than one day.

  11. Life science experiments performed in space in the ISS/Kibo facility and future research plans.

    PubMed

    Ohnishi, Takeo

    2016-08-01

    Over the past several years, current techniques in molecular biology have been used to perform experiments in space, focusing on the nature and effects of space radiation. In the Japanese 'Kibo' facility in the International Space Station (ISS), the Japan Aerospace Exploration Agency (JAXA) has performed five life science experiments since 2009, and two additional experiments are currently in progress. The first life science experiment in space was the 'Rad Gene' project, which utilized two human cultured lymphoblastoid cell lines containing a mutated P53 : gene (m P53 : ) and a parental wild-type P53 : gene (wt P53 : ) respectively. Four parameters were examined: (i) detecting space radiation-induced DSBs by observing γH2AX foci; (ii) observing P53 : -dependent gene expression during space flight; (iii) observing P53 : -dependent gene expression after space flight; and (iv) observing the adaptive response in the two cell lines containing the mutated and wild type P53 : genes after exposure to space radiation. These observations were completed and have been reported, and this paper is a review of these experiments. In addition, recent new information from space-based experiments involving radiation biology is presented here. These experiments involve human cultured cells, silkworm eggs, mouse embryonic stem cells and mouse eggs in various experiments designed by other principal investigators in the ISS/Kibo. The progress of Japanese science groups involved in these space experiments together with JAXA are also discussed here. The Japanese Society for Biological Sciences in Space (JSBSS), the Utilization Committee of Space Environment Science (UCSES) and the Science Council of Japan (ACJ) have supported these new projects and new experimental facilities in ISS/Kibo. Currently, these organizations are proposing new experiments for the ISS through 2024. © The Author 2016. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  12. Transcriptional maturation of the mouse auditory forebrain.

    PubMed

    Hackett, Troy A; Guo, Yan; Clause, Amanda; Hackett, Nicholas J; Garbett, Krassimira; Zhang, Pan; Polley, Daniel B; Mirnics, Karoly

    2015-08-14

    The maturation of the brain involves the coordinated expression of thousands of genes, proteins and regulatory elements over time. In sensory pathways, gene expression profiles are modified by age and sensory experience in a manner that differs between brain regions and cell types. In the auditory system of altricial animals, neuronal activity increases markedly after the opening of the ear canals, initiating events that culminate in the maturation of auditory circuitry in the brain. This window provides a unique opportunity to study how gene expression patterns are modified by the onset of sensory experience through maturity. As a tool for capturing these features, next-generation sequencing of total RNA (RNAseq) has tremendous utility, because the entire transcriptome can be screened to index expression of any gene. To date, whole transcriptome profiles have not been generated for any central auditory structure in any species at any age. In the present study, RNAseq was used to profile two regions of the mouse auditory forebrain (A1, primary auditory cortex; MG, medial geniculate) at key stages of postnatal development (P7, P14, P21, adult) before and after the onset of hearing (~P12). Hierarchical clustering, differential expression, and functional geneset enrichment analyses (GSEA) were used to profile the expression patterns of all genes. Selected genesets related to neurotransmission, developmental plasticity, critical periods and brain structure were highlighted. An accessible repository of the entire dataset was also constructed that permits extraction and screening of all data from the global through single-gene levels. To our knowledge, this is the first whole transcriptome sequencing study of the forebrain of any mammalian sensory system. Although the data are most relevant for the auditory system, they are generally applicable to forebrain structures in the visual and somatosensory systems, as well. The main findings were: (1) Global gene expression patterns were tightly clustered by postnatal age and brain region; (2) comparing A1 and MG, the total numbers of differentially expressed genes were comparable from P7 to P21, then dropped to nearly half by adulthood; (3) comparing successive age groups, the greatest numbers of differentially expressed genes were found between P7 and P14 in both regions, followed by a steady decline in numbers with age; (4) maturational trajectories in expression levels varied at the single gene level (increasing, decreasing, static, other); (5) between regions, the profiles of single genes were often asymmetric; (6) GSEA revealed that genesets related to neural activity and plasticity were typically upregulated from P7 to adult, while those related to structure tended to be downregulated; (7) GSEA and pathways analysis of selected functional networks were not predictive of expression patterns in the auditory forebrain for all genes, reflecting regional specificity at the single gene level. Gene expression in the auditory forebrain during postnatal development is in constant flux and becomes increasingly stable with age. Maturational changes are evident at the global through single gene levels. Transcriptome profiles in A1 and MG are distinct at all ages, and differ from other brain regions. The database generated by this study provides a rich foundation for the identification of novel developmental biomarkers, functional gene pathways, and targeted studies of postnatal maturation in the auditory forebrain.

  13. Effects of Methionine Supplementation on the Expression of Protein Deposition-Related Genes in Acute Heat Stress-Exposed Broilers

    PubMed Central

    Grieser, Daiane Oliveira; Zancanela, Vittor; Voltolini, Débora Marques; Khatlab, Angélica Souza; Guimarães, Simone Eliza Facioni; Soares, Maria Amélia Menck; Neto, Adhemar Rodrigues Oliveira

    2015-01-01

    The objective of this study was to evaluate the effect of heat stress and methionine supplementation on the gene expression of insulin-like growth factor I (IGF-I), growth hormone receptor (GHR), phosphatidylinositol 3-kinase, and regulatory 1 (PI3KR1) in the liver, as well as the expression of the atrogin 1 and cathepsin L2 (CTSL2) genes in the breast muscle of broilers. Broilers from 1–21 and 22–42 days of age were divided into three treatments related to methionine supplementation as follows: without methionine supplementation (MD), recommended level of methionine (DL1), and excess supplementation of methionine (DL2). The animals were either maintained at a thermal comfort temperature or exposed to heat stress (HS) (38°C for 24 hours, starting on day 20 or day 41 for experiments 1 and 2, respectively). The heat stress increased the body temperature at both ages. Starter period: The HS animals presented increased plasma creatinine content (P<0.0001) and the highest CTSL2 gene expression (P<0.0001). The methionine supplementation increased the IGF-I (P = 0.0144) and GHR (P = 0.0011) gene expression and decreased the CTSL2 (P = 0.0004) and atrogin 1 (P = 0.0012) gene expression. Grower period: Significant effects for the interaction between supplementation and environment were observed for GHR (P = 0.0252) and CTSL2 (P = 0.0011) gene expression. The highest GHR expression was observed in animals that remained in thermal comfort on the DL2 diet, and the lowest expression occurred in the HS animals fed the MD diet. For CTSL2, the HS animals fed the MD diet presented the highest CTSL2 gene expression, and the lowest expression was observed in the animals maintained at thermal comfort on DL1 and DL2 diets. Only methionine supplementation had effect on atrogin-1 gene expression (P<0.0001), with higher methionine content in the diet lower atrogin-1 gene expression was observed. Our results suggest that heat stress induces greater protein degradation and that methionine supplementation could induce protein deposition because methionine increased the expression of genes related to protein synthesis and decreased the expression of genes related to protein breakdown. PMID:25714089

  14. Caffeine exposure alters cardiac gene expression in embryonic cardiomyocytes

    PubMed Central

    Fang, Xiefan; Mei, Wenbin; Barbazuk, William B.; Rivkees, Scott A.

    2014-01-01

    Previous studies demonstrated that in utero caffeine treatment at embryonic day (E) 8.5 alters DNA methylation patterns, gene expression, and cardiac function in adult mice. To provide insight into the mechanisms, we examined cardiac gene and microRNA (miRNA) expression in cardiomyocytes shortly after exposure to physiologically relevant doses of caffeine. In HL-1 and primary embryonic cardiomyocytes, caffeine treatment for 48 h significantly altered the expression of cardiac structural genes (Myh6, Myh7, Myh7b, Tnni3), hormonal genes (Anp and BnP), cardiac transcription factors (Gata4, Mef2c, Mef2d, Nfatc1), and microRNAs (miRNAs; miR208a, miR208b, miR499). In addition, expressions of these genes were significantly altered in embryonic hearts exposed to in utero caffeine. For in utero experiments, pregnant CD-1 dams were treated with 20–60 mg/kg of caffeine, which resulted in maternal circulation levels of 37.3–65.3 μM 2 h after treatment. RNA sequencing was performed on embryonic ventricles treated with vehicle or 20 mg/kg of caffeine daily from E6.5-9.5. Differential expression (DE) analysis revealed that 124 genes and 849 transcripts were significantly altered, and differential exon usage (DEU) analysis identified 597 exons that were changed in response to prenatal caffeine exposure. Among the DE genes identified by RNA sequencing were several cardiac structural genes and genes that control DNA methylation and histone modification. Pathway analysis revealed that pathways related to cardiovascular development and diseases were significantly affected by caffeine. In addition, global cardiac DNA methylation was reduced in caffeine-treated cardiomyocytes. Collectively, these data demonstrate that caffeine exposure alters gene expression and DNA methylation in embryonic cardiomyocytes. PMID:25354728

  15. Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

    PubMed

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

  16. Effect of Korean Red Ginseng treatment on the gene expression profile of diabetic rat retina

    PubMed Central

    Yang, Hana; Son, Gun Woo; Park, Hye Rim; Lee, Seung Eun; Park, Yong Seek

    2015-01-01

    Background Korean Red Ginseng (KRG) is a herbal medicine used in Asian countries and is very popular for its beneficial biological properties. Diabetes mellitus (DM) and its complications are rapidly becoming a global public health concern. The literature on transcriptional changes induced by KRG in rat models of diabetic retinopathy is limited. Considering these facts, we designed this study to determine whether retinopathy-associated genes are altered in retinas of rats with DM and whether the induced changes are reversed by KRG. Methods Male Sprague–Dawley rats were intravenously injected with streptozotocin (50 mg/kg body weight) to induce DM, following which, KRG powder (200 mg/kg body weight) was orally administered to the KRG-treated DM rat group for 10 wks. The rats were then sacrificed, and their retinas were harvested for total RNA extraction. Microarray gene expression profiling was performed on the extracted RNA samples. Results From among > 31,000 genes investigated, the expression of 268 genes was observed to be upregulated and that of 58 genes was downregulated, with twofold altered expression levels in the DM group compared with those in the control group. Moreover, 39 genes were upregulated more than twofold and 84 genes were downregulated in the KRG-treated group compared to the DM group. The expression of the genes was significantly reversed by KRG treatment; some of these genes were analyzed further to verify the results of the microarray experiments. Conclusion Taken together, our data suggest that reversed changes in the gene expression may mediate alleviating activities of KRG in rats with diabetic retinopathy. PMID:26843816

  17. The structure of a gene co-expression network reveals biological functions underlying eQTLs.

    PubMed

    Villa-Vialaneix, Nathalie; Liaubet, Laurence; Laurent, Thibault; Cherel, Pierre; Gamot, Adrien; SanCristobal, Magali

    2013-01-01

    What are the commonalities between genes, whose expression level is partially controlled by eQTL, especially with regard to biological functions? Moreover, how are these genes related to a phenotype of interest? These issues are particularly difficult to address when the genome annotation is incomplete, as is the case for mammalian species. Moreover, the direct link between gene expression and a phenotype of interest may be weak, and thus difficult to handle. In this framework, the use of a co-expression network has proven useful: it is a robust approach for modeling a complex system of genetic regulations, and to infer knowledge for yet unknown genes. In this article, a case study was conducted with a mammalian species. It showed that the use of a co-expression network based on partial correlation, combined with a relevant clustering of nodes, leads to an enrichment of biological functions of around 83%. Moreover, the use of a spatial statistics approach allowed us to superimpose additional information related to a phenotype; this lead to highlighting specific genes or gene clusters that are related to the network structure and the phenotype. Three main results are worth noting: first, key genes were highlighted as a potential focus for forthcoming biological experiments; second, a set of biological functions, which support a list of genes under partial eQTL control, was set up by an overview of the global structure of the gene expression network; third, pH was found correlated with gene clusters, and then with related biological functions, as a result of a spatial analysis of the network topology.

  18. Assessing differential gene expression with small sample sizes in oligonucleotide arrays using a mean-variance model.

    PubMed

    Hu, Jianhua; Wright, Fred A

    2007-03-01

    The identification of the genes that are differentially expressed in two-sample microarray experiments remains a difficult problem when the number of arrays is very small. We discuss the implications of using ordinary t-statistics and examine other commonly used variants. For oligonucleotide arrays with multiple probes per gene, we introduce a simple model relating the mean and variance of expression, possibly with gene-specific random effects. Parameter estimates from the model have natural shrinkage properties that guard against inappropriately small variance estimates, and the model is used to obtain a differential expression statistic. A limiting value to the positive false discovery rate (pFDR) for ordinary t-tests provides motivation for our use of the data structure to improve variance estimates. Our approach performs well compared to other proposed approaches in terms of the false discovery rate.

  19. Expression Profiling of Castanea Genes during Resistant and Susceptible Interactions with the Oomycete Pathogen Phytophthora cinnamomi Reveal Possible Mechanisms of Immunity

    PubMed Central

    Santos, Carmen; Duarte, Sofia; Tedesco, Sara; Fevereiro, Pedro; Costa, Rita L.

    2017-01-01

    The most dangerous pathogen affecting the production of chestnuts is Phytophthora cinnamomi a hemibiotrophic that causes root rot, also known as ink disease. Little information has been acquired in chestnut on the molecular defense strategies against this pathogen. The expression of eight candidate genes potentially involved in the defense to P. cinnamomi was quantified by digital PCR in Castanea genotypes showing different susceptibility to the pathogen. Seven of the eight candidate genes displayed differentially expressed levels depending on genotype and time-point after inoculation. Cast_Gnk2-like revealed to be the most expressed gene across all experiments and the one that best discriminates between susceptible and resistant genotypes. Our data suggest that the pre-formed defenses are crucial for the resistance of C. crenata to P. cinnamomi. A lower and delayed expression of the eight studied genes was found in the susceptible Castanea sativa, which may be related with the establishment and spread of the disease in this species. A working model integrating the obtained results is presented. PMID:28443110

  20. dictyExpress: a web-based platform for sequence data management and analytics in Dictyostelium and beyond.

    PubMed

    Stajdohar, Miha; Rosengarten, Rafael D; Kokosar, Janez; Jeran, Luka; Blenkus, Domen; Shaulsky, Gad; Zupan, Blaz

    2017-06-02

    Dictyostelium discoideum, a soil-dwelling social amoeba, is a model for the study of numerous biological processes. Research in the field has benefited mightily from the adoption of next-generation sequencing for genomics and transcriptomics. Dictyostelium biologists now face the widespread challenges of analyzing and exploring high dimensional data sets to generate hypotheses and discovering novel insights. We present dictyExpress (2.0), a web application designed for exploratory analysis of gene expression data, as well as data from related experiments such as Chromatin Immunoprecipitation sequencing (ChIP-Seq). The application features visualization modules that include time course expression profiles, clustering, gene ontology enrichment analysis, differential expression analysis and comparison of experiments. All visualizations are interactive and interconnected, such that the selection of genes in one module propagates instantly to visualizations in other modules. dictyExpress currently stores the data from over 800 Dictyostelium experiments and is embedded within a general-purpose software framework for management of next-generation sequencing data. dictyExpress allows users to explore their data in a broader context by reciprocal linking with dictyBase-a repository of Dictyostelium genomic data. In addition, we introduce a companion application called GenBoard, an intuitive graphic user interface for data management and bioinformatics analysis. dictyExpress and GenBoard enable broad adoption of next generation sequencing based inquiries by the Dictyostelium research community. Labs without the means to undertake deep sequencing projects can mine the data available to the public. The entire information flow, from raw sequence data to hypothesis testing, can be accomplished in an efficient workspace. The software framework is generalizable and represents a useful approach for any research community. To encourage more wide usage, the backend is open-source, available for extension and further development by bioinformaticians and data scientists.

  1. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants

    PubMed Central

    Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.

    2008-01-01

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4′-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1–3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA’s. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as “expression signatures”. The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action. PMID:16488489

  2. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants.

    PubMed

    Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

    2006-05-25

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4'-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1-3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA's. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as "expression signatures". The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action.

  3. Detecting differentially expressed genes in heterogeneous diseases using half Student's t-test.

    PubMed

    Hsu, Chun-Lun; Lee, Wen-Chung

    2010-12-01

    Microarray technology provides information about hundreds and thousands of gene-expression data in a single experiment. To search for disease-related genes, researchers test for those genes that are differentially expressed between the case subjects and the control subjects. The authors propose a new test, the 'half Student's t-test', specifically for detecting differentially expressed genes in heterogeneous diseases. Monte-Carlo simulation shows that the test maintains the nominal α level quite well for both normal and non-normal distributions. Power of the half Student's t is higher than that of the conventional 'pooled' Student's t when there is heterogeneity in the disease under study. The power gain by using the half Student's t can reach ∼10% when the standard deviation of the case group is 50% larger than that of the control group. Application to a colon cancer data reveals that when the false discovery rate (FDR) is controlled at 0.05, the half Student's t can detect 344 differentially expressed genes, whereas the pooled Student's t can detect only 65 genes. Or alternatively, if only 50 genes are to be selected, the FDR for the pooled Student's t has to be set at 0.0320 (false positive rate of ∼3%), but for the half Student's t, it can be at as low as 0.0001 (false positive rate of about one per ten thousands). The half Student's t-test is to be recommended for the detection of differentially expressed genes in heterogeneous diseases.

  4. Novel gene sets improve set-level classification of prokaryotic gene expression data.

    PubMed

    Holec, Matěj; Kuželka, Ondřej; Železný, Filip

    2015-10-28

    Set-level classification of gene expression data has received significant attention recently. In this setting, high-dimensional vectors of features corresponding to genes are converted into lower-dimensional vectors of features corresponding to biologically interpretable gene sets. The dimensionality reduction brings the promise of a decreased risk of overfitting, potentially resulting in improved accuracy of the learned classifiers. However, recent empirical research has not confirmed this expectation. Here we hypothesize that the reported unfavorable classification results in the set-level framework were due to the adoption of unsuitable gene sets defined typically on the basis of the Gene ontology and the KEGG database of metabolic networks. We explore an alternative approach to defining gene sets, based on regulatory interactions, which we expect to collect genes with more correlated expression. We hypothesize that such more correlated gene sets will enable to learn more accurate classifiers. We define two families of gene sets using information on regulatory interactions, and evaluate them on phenotype-classification tasks using public prokaryotic gene expression data sets. From each of the two gene-set families, we first select the best-performing subtype. The two selected subtypes are then evaluated on independent (testing) data sets against state-of-the-art gene sets and against the conventional gene-level approach. The novel gene sets are indeed more correlated than the conventional ones, and lead to significantly more accurate classifiers. The novel gene sets are indeed more correlated than the conventional ones, and lead to significantly more accurate classifiers. Novel gene sets defined on the basis of regulatory interactions improve set-level classification of gene expression data. The experimental scripts and other material needed to reproduce the experiments are available at http://ida.felk.cvut.cz/novelgenesets.tar.gz.

  5. Dexpanthenol modulates gene expression in skin wound healing in vivo.

    PubMed

    Heise, R; Skazik, C; Marquardt, Y; Czaja, K; Sebastian, K; Kurschat, P; Gan, L; Denecke, B; Ekanayake-Bohlig, S; Wilhelm, K-P; Merk, H F; Baron, J M

    2012-01-01

    Topical application of dexpanthenol is widely used in clinical practice for the improvement of wound healing. Previous in vitro experiments identified a stimulatory effect of pantothenate on migration, proliferation and gene regulation in cultured human dermal fibroblasts. To correlate these in vitro findings with the more complex in vivo situation of wound healing, a clinical trial was performed in which the dexpanthenol-induced gene expression profile in punch biopsies of previously injured and dexpanthenol-treated skin in comparison to placebo-treated skin was analyzed at the molecular level by Affymetrix® GeneChip analysis. Upregulation of IL-6, IL-1β, CYP1B1, CXCL1, CCL18 and KAP 4-2 gene expression and downregulation of psorasin mRNA and protein expression were identified in samples treated topically with dexpanthenol. This in vivo study might provide new insight into the molecular mechanisms responsible for the effect of dexpanthenol in wound healing and shows strong correlations to previous in vitro data using cultured dermal fibroblasts. Copyright © 2012 S. Karger AG, Basel.

  6. Gene Expression Omnibus (GEO): Microarray data storage, submission, retrieval, and analysis

    PubMed Central

    Barrett, Tanya

    2006-01-01

    The Gene Expression Omnibus (GEO) repository at the National Center for Biotechnology Information (NCBI) archives and freely distributes high-throughput molecular abundance data, predominantly gene expression data generated by DNA microarray technology. The database has a flexible design that can handle diverse styles of both unprocessed and processed data in a MIAME- (Minimum Information About a Microarray Experiment) supportive infrastructure that promotes fully annotated submissions. GEO currently stores about a billion individual gene expression measurements, derived from over 100 organisms, submitted by over 1,500 laboratories, addressing a wide range of biological phenomena. To maximize the utility of these data, several user-friendly Web-based interfaces and applications have been implemented that enable effective exploration, query, and visualization of these data, at the level of individual genes or entire studies. This chapter describes how the data are stored, submission procedures, and mechanisms for data retrieval and query. GEO is publicly accessible at http://www.ncbi.nlm.nih.gov/projects/geo/. PMID:16939800

  7. Control of developmentally primed erythroid genes by combinatorial co-repressor actions

    PubMed Central

    Stadhouders, Ralph; Cico, Alba; Stephen, Tharshana; Thongjuea, Supat; Kolovos, Petros; Baymaz, H. Irem; Yu, Xiao; Demmers, Jeroen; Bezstarosti, Karel; Maas, Alex; Barroca, Vilma; Kockx, Christel; Ozgur, Zeliha; van Ijcken, Wilfred; Arcangeli, Marie-Laure; Andrieu-Soler, Charlotte; Lenhard, Boris; Grosveld, Frank; Soler, Eric

    2015-01-01

    How transcription factors (TFs) cooperate within large protein complexes to allow rapid modulation of gene expression during development is still largely unknown. Here we show that the key haematopoietic LIM-domain-binding protein-1 (LDB1) TF complex contains several activator and repressor components that together maintain an erythroid-specific gene expression programme primed for rapid activation until differentiation is induced. A combination of proteomics, functional genomics and in vivo studies presented here identifies known and novel co-repressors, most notably the ETO2 and IRF2BP2 proteins, involved in maintaining this primed state. The ETO2–IRF2BP2 axis, interacting with the NCOR1/SMRT co-repressor complex, suppresses the expression of the vast majority of archetypical erythroid genes and pathways until its decommissioning at the onset of terminal erythroid differentiation. Our experiments demonstrate that multimeric regulatory complexes feature a dynamic interplay between activating and repressing components that determines lineage-specific gene expression and cellular differentiation. PMID:26593974

  8. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  9. ALE: automated label extraction from GEO metadata.

    PubMed

    Giles, Cory B; Brown, Chase A; Ripperger, Michael; Dennis, Zane; Roopnarinesingh, Xiavan; Porter, Hunter; Perz, Aleksandra; Wren, Jonathan D

    2017-12-28

    NCBI's Gene Expression Omnibus (GEO) is a rich community resource containing millions of gene expression experiments from human, mouse, rat, and other model organisms. However, information about each experiment (metadata) is in the format of an open-ended, non-standardized textual description provided by the depositor. Thus, classification of experiments for meta-analysis by factors such as gender, age of the sample donor, and tissue of origin is not feasible without assigning labels to the experiments. Automated approaches are preferable for this, primarily because of the size and volume of the data to be processed, but also because it ensures standardization and consistency. While some of these labels can be extracted directly from the textual metadata, many of the data available do not contain explicit text informing the researcher about the age and gender of the subjects with the study. To bridge this gap, machine-learning methods can be trained to use the gene expression patterns associated with the text-derived labels to refine label-prediction confidence. Our analysis shows only 26% of metadata text contains information about gender and 21% about age. In order to ameliorate the lack of available labels for these data sets, we first extract labels from the textual metadata for each GEO RNA dataset and evaluate the performance against a gold standard of manually curated labels. We then use machine-learning methods to predict labels, based upon gene expression of the samples and compare this to the text-based method. Here we present an automated method to extract labels for age, gender, and tissue from textual metadata and GEO data using both a heuristic approach as well as machine learning. We show the two methods together improve accuracy of label assignment to GEO samples.

  10. Identification of differentially regulated genes in human patent ductus arteriosus

    PubMed Central

    Parikh, Pratik; Bai, Haiqing; Swartz, Michael F; Alfieris, George M

    2016-01-01

    In order to identify differentially expressed genes that are specific to the ductus arteriosus, 18 candidate genes were evaluated in matched ductus arteriosus and aortic samples from infants with coarctation of the aorta. The cell specificity of the gene's promoters was assessed by performing transient transfection studies in primary cells derived from several patients. Segments of ductus arteriosus and aorta were isolated from infants requiring repair for coarctation of the aorta and used for mRNA quantitation and culturing of cells. Differences in expression were determined by quantitative PCR using the ΔΔCt method. Promoter regions of six of these genes were cloned into luciferase reporter plasmids for transient transfection studies in matched human ductus arteriosus and aorta cells. Transcription factor AP-2b and phospholipase A2 were significantly up-regulated in ductus arteriosus compared to aorta in whole tissues and cultured cells, respectively. In transient transfection experiments, Angiotensin II type 1 receptor and Prostaglandin E receptor 4 promoters consistently gave higher expression in matched ductus arteriosus versus aorta cells from multiple patients. Taken together, these results demonstrate that several genes are differentially expressed in ductus arteriosus and that their promoters may be used to drive ductus arteriosus-enriched transgene expression. PMID:27465141

  11. PROSPECT improves cis-acting regulatory element prediction by integrating expression profile data with consensus pattern searches

    PubMed Central

    Fujibuchi, Wataru; Anderson, John S. J.; Landsman, David

    2001-01-01

    Consensus pattern and matrix-based searches designed to predict cis-acting transcriptional regulatory sequences have historically been subject to large numbers of false positives. We sought to decrease false positives by incorporating expression profile data into a consensus pattern-based search method. We have systematically analyzed the expression phenotypes of over 6000 yeast genes, across 121 expression profile experiments, and correlated them with the distribution of 14 known regulatory elements over sequences upstream of the genes. Our method is based on a metric we term probabilistic element assessment (PEA), which is a ranking of potential sites based on sequence similarity in the upstream regions of genes with similar expression phenotypes. For eight of the 14 known elements that we examined, our method had a much higher selectivity than a naïve consensus pattern search. Based on our analysis, we have developed a web-based tool called PROSPECT, which allows consensus pattern-based searching of gene clusters obtained from microarray data. PMID:11574681

  12. Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

    PubMed

    Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

    2015-04-01

    Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

  13. Quantifying Intrinsic and Extrinsic Variability in Stochastic Gene Expression Models

    PubMed Central

    Singh, Abhyudai; Soltani, Mohammad

    2013-01-01

    Genetically identical cell populations exhibit considerable intercellular variation in the level of a given protein or mRNA. Both intrinsic and extrinsic sources of noise drive this variability in gene expression. More specifically, extrinsic noise is the expression variability that arises from cell-to-cell differences in cell-specific factors such as enzyme levels, cell size and cell cycle stage. In contrast, intrinsic noise is the expression variability that is not accounted for by extrinsic noise, and typically arises from the inherent stochastic nature of biochemical processes. Two-color reporter experiments are employed to decompose expression variability into its intrinsic and extrinsic noise components. Analytical formulas for intrinsic and extrinsic noise are derived for a class of stochastic gene expression models, where variations in cell-specific factors cause fluctuations in model parameters, in particular, transcription and/or translation rate fluctuations. Assuming mRNA production occurs in random bursts, transcription rate is represented by either the burst frequency (how often the bursts occur) or the burst size (number of mRNAs produced in each burst). Our analysis shows that fluctuations in the transcription burst frequency enhance extrinsic noise but do not affect the intrinsic noise. On the contrary, fluctuations in the transcription burst size or mRNA translation rate dramatically increase both intrinsic and extrinsic noise components. Interestingly, simultaneous fluctuations in transcription and translation rates arising from randomness in ATP abundance can decrease intrinsic noise measured in a two-color reporter assay. Finally, we discuss how these formulas can be combined with single-cell gene expression data from two-color reporter experiments for estimating model parameters. PMID:24391934

  14. Quantifying intrinsic and extrinsic variability in stochastic gene expression models.

    PubMed

    Singh, Abhyudai; Soltani, Mohammad

    2013-01-01

    Genetically identical cell populations exhibit considerable intercellular variation in the level of a given protein or mRNA. Both intrinsic and extrinsic sources of noise drive this variability in gene expression. More specifically, extrinsic noise is the expression variability that arises from cell-to-cell differences in cell-specific factors such as enzyme levels, cell size and cell cycle stage. In contrast, intrinsic noise is the expression variability that is not accounted for by extrinsic noise, and typically arises from the inherent stochastic nature of biochemical processes. Two-color reporter experiments are employed to decompose expression variability into its intrinsic and extrinsic noise components. Analytical formulas for intrinsic and extrinsic noise are derived for a class of stochastic gene expression models, where variations in cell-specific factors cause fluctuations in model parameters, in particular, transcription and/or translation rate fluctuations. Assuming mRNA production occurs in random bursts, transcription rate is represented by either the burst frequency (how often the bursts occur) or the burst size (number of mRNAs produced in each burst). Our analysis shows that fluctuations in the transcription burst frequency enhance extrinsic noise but do not affect the intrinsic noise. On the contrary, fluctuations in the transcription burst size or mRNA translation rate dramatically increase both intrinsic and extrinsic noise components. Interestingly, simultaneous fluctuations in transcription and translation rates arising from randomness in ATP abundance can decrease intrinsic noise measured in a two-color reporter assay. Finally, we discuss how these formulas can be combined with single-cell gene expression data from two-color reporter experiments for estimating model parameters.

  15. Transcript levels of several epigenome regulatory genes in bovine somatic donor cells are not correlated with their cloning efficiency.

    PubMed

    Zhou, Wenli; Sadeghieh, Sanaz; Abruzzese, Ronald; Uppada, Subhadra; Meredith, Justin; Ohlrichs, Charletta; Broek, Diane; Polejaeva, Irina

    2009-09-01

    Among many factors that potentially affect somatic cell nuclear transfer (SCNT) embryo development is the donor cell itself. Cloning potentials of somatic donor cells vary greatly, possibly because the cells have different capacities to be reprogrammed by ooplasma. It is therefore intriguing to identify factors that regulate the reprogrammability of somatic donor cells. Gene expression analysis is a widely used tool to investigate underlying mechanisms of various phenotypes. In this study, we conducted a retrospective analysis investigating whether donor cell lines with distinct cloning efficiencies express different levels of genes involved in epigenetic reprogramming including histone deacetylase-1 (HDAC1), -2 (HDAC2); DNA methyltransferase-1 (DNMT1), -3a (DNMT3a),-3b (DNMT3b), and the bovine homolog of yeast sucrose nonfermenting-2 (SNF2L), a SWI/SNF family of ATPases. Cell samples from 12 bovine donor cell lines were collected at the time of nuclear transfer experiments and expression levels of the genes were measured using quantitative polymerase chain reaction (PCR). Our results show that there are no significant differences in expression levels of these genes between donor cell lines of high and low cloning efficiency defined as live calving rates, although inverse correlations are observed between in vitro embryo developmental rates and expression levels of HDAC2 and SNF2L. We also show that selection of stable reference genes is important for relative quantification, and different batches of cells can have different gene expression patterns. In summary, we demonstrate that expression levels of these epigenome regulatory genes in bovine donor cells are not correlated with cloning potential. The experimental design and data analysis method reported here can be applied to study any genes expressed in donor cells.

  16. Integration of Steady-State and Temporal Gene Expression Data for the Inference of Gene Regulatory Networks

    PubMed Central

    Wang, Yi Kan; Hurley, Daniel G.; Schnell, Santiago; Print, Cristin G.; Crampin, Edmund J.

    2013-01-01

    We develop a new regression algorithm, cMIKANA, for inference of gene regulatory networks from combinations of steady-state and time-series gene expression data. Using simulated gene expression datasets to assess the accuracy of reconstructing gene regulatory networks, we show that steady-state and time-series data sets can successfully be combined to identify gene regulatory interactions using the new algorithm. Inferring gene networks from combined data sets was found to be advantageous when using noisy measurements collected with either lower sampling rates or a limited number of experimental replicates. We illustrate our method by applying it to a microarray gene expression dataset from human umbilical vein endothelial cells (HUVECs) which combines time series data from treatment with growth factor TNF and steady state data from siRNA knockdown treatments. Our results suggest that the combination of steady-state and time-series datasets may provide better prediction of RNA-to-RNA interactions, and may also reveal biological features that cannot be identified from dynamic or steady state information alone. Finally, we consider the experimental design of genomics experiments for gene regulatory network inference and show that network inference can be improved by incorporating steady-state measurements with time-series data. PMID:23967277

  17. Changes in expression of genes involved in apoptosis in activated human T-cells in response to modeled microgravity

    NASA Astrophysics Data System (ADS)

    Ward, Nancy E.; Pellis, Neal R.; Risin, Diana; Risin, Semyon A.; Liu, Wenbin

    2006-09-01

    Space flights result in remarkable effects on various physiological systems, including a decline in cellular immune functions. Previous studies have shown that exposure to microgravity, both true and modeled, can cause significant changes in numerous lymphocyte functions. The purpose of this study was to search for microgravity-sensitive genes, and specifically for apoptotic genes influenced by the microgravity environment and other genes related to immune response. The experiments were performed on anti-CD3 and IL-2 activated human T cells. To model microgravity conditions we have utilized the NASA rotating wall vessel bioreactor. Control lymphocytes were cultured in static 1g conditions. To assess gene expression we used DNA microarray chip technology. We had shown that multiple genes (approximately 3-8% of tested genes) respond to microgravity conditions by 1.5 and more fold change in expression. There is a significant variability in the response. However, a certain reproducible pattern in gene response could be identified. Among the genes showing reproducible changes in expression in modeled microgravity, several genes involved in apoptosis as well as in immune response were identified. These are IL-7 receptor, Granzyme B, Beta-3-endonexin, Apo2 ligand and STAT1. Possible functional consequences of these changes are discussed.

  18. Molecular genetic responses to lysergic acid diethylamide include transcriptional activation of MAP kinase phosphatase-1, C/EBP-beta and ILAD-1, a novel gene with homology to arrestins.

    PubMed

    Nichols, Charles D; Sanders-Bush, Elaine

    2004-08-01

    We recently demonstrated that the potent hallucinogenic drug lysergic acid diethylamide (LSD) dynamically influences the expression of a small collection of genes within the mammalian prefrontal cortex. Towards generating a greater understanding of the molecular genetic effects of hallucinogens and how they may relate to alterations in behavior, we have identified and characterized expression patterns of a new collection of three genes increased in expression by acute LSD administration. These genes were identified through additional screens of Affymetrix DNA microarrays and examined in experiments to assess dose-response, time course and the receptor mediating the expression changes. The first induced gene, C/EBP-beta, is a transcription factor. The second gene, MKP-1, suggests that LSD activates the MAP (mitogen activated protein) kinase pathway. The third gene, ILAD-1, demonstrates sequence similarity to the arrestins. The increase in expression of each gene was partially mediated through LSD interactions at 5-HT2A (serotonin) receptors. There is evidence of alternative splicing at the ILAD-1 locus. Furthermore, data suggests that various splice isoforms of ILAD-1 respond differently at the transcriptional level to LSD. The genes thus far found to be responsive to LSD are beginning to give a more complete picture of the complex intracellular events initiated by hallucinogens.

  19. The Schizophrenia Risk Gene MIR137 Acts as a Hippocampal Gene Network Node Orchestrating the Expression of Genes Relevant to Nervous System Development and Function

    PubMed Central

    Loohuis, Nikkie FM Olde; Kasri, Nael Nadif; Glennon, Jeffrey C; van Bokhoven, Hans; Hébert, Sébastien S; Kaplan, Barry B.; Martens, Gerard JM; Aschrafi, Armaz

    2016-01-01

    MicroRNAs (miRs) are small regulatory molecules, which orchestrate neuronal development and plasticity through modulation of complex gene networks. microRNA-137 (miR-137) is a brain-enriched RNA with a critical role in regulating brain development and in mediating synaptic plasticity. Importantly, mutations in this miR are associated with the pathoetiology of schizophrenia (SZ), and there is a widespread assumption that disruptions in miR-137 expression lead to aberrant expression of gene regulatory networks associated with SZ. To systematically identify the mRNA targets for this miR, we performed miR-137 gain- and loss-of-function experiments in primary rat hippocampal neurons and profiled differentially expressed mRNAs through next-generation sequencing. We identified 500 genes that were bidirectionally activated or repressed in their expression by the modulation of miR-137 levels. Gene ontology analysis using two independent software resources suggested functions for these miR-137-regulated genes in neurodevelopmental processes, neuronal maturation processes and cell maintenance, all of which known to be critical for proper brain circuitry formation. Since many of the putative miR-137 targets identified here also have been previously shown to be associated with SZ, we propose that this miR acts as a critical gene network hub contributing to the pathophysiology of this neurodevelopmental disorder. PMID:26925706

  20. Rapid stress-induced transcriptomic changes in the brain depend on beta-adrenergic signaling.

    PubMed

    Roszkowski, Martin; Manuella, Francesca; von Ziegler, Lukas; Durán-Pacheco, Gonzalo; Moreau, Jean-Luc; Mansuy, Isabelle M; Bohacek, Johannes

    2016-08-01

    Acute exposure to stressful experiences can rapidly increase anxiety and cause neuropsychiatric disorders. The effects of stress result in part from the release of neurotransmitters and hormones, which regulate gene expression in different brain regions. The fast neuroendocrine response to stress is largely mediated by norepinephrine (NE) and corticotropin releasing hormone (CRH), followed by a slower and more sustained release of corticosterone. While corticosterone is an important regulator of gene expression, it is not clear which stress-signals contribute to the rapid regulation of gene expression observed immediately after stress exposure. Here, we demonstrate in mice that 45 min after an acute swim stress challenge, large changes in gene expression occur across the transcriptome in the hippocampus, a region sensitive to the effects of stress. We identify multiple candidate genes that are rapidly and transiently altered in both males and females. Using a pharmacological approach, we show that most of these rapidly induced genes are regulated by NE through β-adrenergic receptor signaling. We find that CRH and corticosterone can also contribute to rapid changes in gene expression, although these effects appear to be restricted to fewer genes. These results newly reveal a widespread impact of NE on the transcriptome and identify novel genes associated with stress and adrenergic signaling. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Bacterial reference genes for gene expression studies by RT-qPCR: survey and analysis.

    PubMed

    Rocha, Danilo J P; Santos, Carolina S; Pacheco, Luis G C

    2015-09-01

    The appropriate choice of reference genes is essential for accurate normalization of gene expression data obtained by the method of reverse transcription quantitative real-time PCR (RT-qPCR). In 2009, a guideline called the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) highlighted the importance of the selection and validation of more than one suitable reference gene for obtaining reliable RT-qPCR results. Herein, we searched the recent literature in order to identify the bacterial reference genes that have been most commonly validated in gene expression studies by RT-qPCR (in the first 5 years following publication of the MIQE guidelines). Through a combination of different search parameters with the text mining tool MedlineRanker, we identified 145 unique bacterial genes that were recently tested as candidate reference genes. Of these, 45 genes were experimentally validated and, in most of the cases, their expression stabilities were verified using the software tools geNorm and NormFinder. It is noteworthy that only 10 of these reference genes had been validated in two or more of the studies evaluated. An enrichment analysis using Gene Ontology classifications demonstrated that genes belonging to the functional categories of DNA Replication (GO: 0006260) and Transcription (GO: 0006351) rendered a proportionally higher number of validated reference genes. Three genes in the former functional class were also among the top five most stable genes identified through an analysis of gene expression data obtained from the Pathosystems Resource Integration Center. These results may provide a guideline for the initial selection of candidate reference genes for RT-qPCR studies in several different bacterial species.

  2. The In Vitro Effect of Ivermectin on the Activity of Trehalose Synthesis Pathway Enzymes and Their mRNA Expression in the Muscle of Adult Female Ascaris suum (Nematoda)

    PubMed Central

    Łopieńska-Biernat, Elżbieta; Zaobidna, Ewa Anna

    2014-01-01

    The in vitro effect of ivermectin lethal dose on the activity of trehalose-6-phosphate synthase (TPS) and phosphatase (TPP) and the expression of their mRNA (tps1, tps2, and tpp genes) in the muscle of adult female Ascaris suum was investigated. The presence of ivermectin in the medium caused a decrease in TPS and TPP activities during the experiment compared with the start and control groups. The exception was the group of worms grown for 8 hours in a IVM solution, in which there was a little higher TPS activity than in the control. Real-time qPCR analysis showed reduced expression of tps1 and tps2, and unchanged tpp expression after 20 hours of incubation relative to the expression at time zero. Relative to the appropriate control groups, the expression of tps2 gene was slight increased but the other two genes were reduced after 8-hours of IVM-treatment. Then the expression of all three genes was lower at the end of cultivation. The level of gene expression was positively correlated with the activity of specific enzymes. In the case of tpp gene there was only a weak correlation. Prolonged exposure to ivermectin was effective in lowering TPS and TPP activity and their mRNA expression. However, the drug did not block the pathway. PMID:25405239

  3. The in vitro effect of ivermectin on the activity of trehalose synthesis pathway enzymes and their mRNA expression in the muscle of adult female Ascaris suum (Nematoda).

    PubMed

    Dmitryjuk, Małgorzata; Łopieńska-Biernat, Elżbieta; Zaobidna, Ewa Anna

    2014-01-01

    The in vitro effect of ivermectin lethal dose on the activity of trehalose-6-phosphate synthase (TPS) and phosphatase (TPP) and the expression of their mRNA (tps1, tps2, and tpp genes) in the muscle of adult female Ascaris suum was investigated. The presence of ivermectin in the medium caused a decrease in TPS and TPP activities during the experiment compared with the start and control groups. The exception was the group of worms grown for 8 hours in a IVM solution, in which there was a little higher TPS activity than in the control. Real-time qPCR analysis showed reduced expression of tps1 and tps2, and unchanged tpp expression after 20 hours of incubation relative to the expression at time zero. Relative to the appropriate control groups, the expression of tps2 gene was slight increased but the other two genes were reduced after 8-hours of IVM-treatment. Then the expression of all three genes was lower at the end of cultivation. The level of gene expression was positively correlated with the activity of specific enzymes. In the case of tpp gene there was only a weak correlation. Prolonged exposure to ivermectin was effective in lowering TPS and TPP activity and their mRNA expression. However, the drug did not block the pathway.

  4. Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

    PubMed

    Wang, Jian-Hua; Chen, Shi-Shu

    2002-07-01

    To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

  5. Web application for automatic prediction of gene translation elongation efficiency.

    PubMed

    Sokolov, Vladimir; Zuraev, Bulat; Lashin, Sergei; Matushkin, Yury

    2015-09-03

    Expression efficiency is one of the major characteristics describing genes in various modern investigations. Expression efficiency of genes is regulated at various stages: transcription, translation, posttranslational protein modification and others. In this study, a special EloE (Elongation Efficiency) web application is described. The EloE sorts the organism's genes in a descend order on their theoretical rate of the elongation stage of translation based on the analysis of their nucleotide sequences. Obtained theoretical data have a significant correlation with available experimental data of gene expression in various organisms. In addition, the program identifies preferential codons in organism's genes and defines distribution of potential secondary structures energy in 5´ and 3´ regions of mRNA. The EloE can be useful in preliminary estimation of translation elongation efficiency for genes for which experimental data are not available yet. Some results can be used, for instance, in other programs modeling artificial genetic structures in genetically engineered experiments.

  6. Genetic Evidence of Human Adaptation to a Cooked Diet

    PubMed Central

    Carmody, Rachel N.; Dannemann, Michael; Briggs, Adrian W.; Nickel, Birgit; Groopman, Emily E.; Wrangham, Richard W.; Kelso, Janet

    2016-01-01

    Humans have been argued to be biologically adapted to a cooked diet, but this hypothesis has not been tested at the molecular level. Here, we combine controlled feeding experiments in mice with comparative primate genomics to show that consumption of a cooked diet influences gene expression and that affected genes bear signals of positive selection in the human lineage. Liver gene expression profiles in mice fed standardized diets of meat or tuber were affected by food type and cooking, but not by caloric intake or consumer energy balance. Genes affected by cooking were highly correlated with genes known to be differentially expressed in liver between humans and other primates, and more genes in this overlap set show signals of positive selection in humans than would be expected by chance. Sequence changes in the genes under selection appear before the split between modern humans and two archaic human groups, Neandertals and Denisovans, supporting the idea that human adaptation to a cooked diet had begun by at least 275,000 years ago. PMID:26979798

  7. Studies of plant gene expression and function stimulated by space microgravity

    NASA Astrophysics Data System (ADS)

    Lu, Jinying; Liu, Min; Li, Huasheng; Zhao, Hui

    2016-07-01

    One of the important questions in space biology is how plants respond to an outer space environment i.e., how genetic expression is altered in space microgravity. In this study, the transcriptome of Arabidopsis thaliana seedlings was analyzed as part of the Germany SIMBOX (Science in Microgravity Box) spaceflight experiment on Shenzhou 8. A gene chip was used to screen gene expression differences in Arabidopsis thaliana seedlings between microgravity and 1g centrifugal force in space. Microarray analysis revealed that 368 genes were differentially expressed. Gene Ontology (GO) analysis indicated that these genes were involved in the plant's response to stress, secondary metabolism, hormone metabolism, transcription, protein phosphorylation, lipid metabolism, transport and cell wall metabolism processes. Real time PCR was used to analyzed the miRNA expression including Arabidopsis miR160,miR161, miR394, miR402, miR403, and miR408. MiR408 was significantly upregulated. An overexpression vector of Arabidopsis miR408 was constructed and transferred to Arabidopsis plant. The roots of plants over expressing miR408 exhibited a slower reorientation upon gravistimulation in comparison with those of wild-type. This result indicated that miR408 could play a role in root gravitropic response.

  8. Pan- and core- network analysis of co-expression genes in a model plant

    DOE PAGES

    He, Fei; Maslov, Sergei

    2016-12-16

    Genome-wide gene expression experiments have been performed using the model plant Arabidopsis during the last decade. Some studies involved construction of coexpression networks, a popular technique used to identify groups of co-regulated genes, to infer unknown gene functions. One approach is to construct a single coexpression network by combining multiple expression datasets generated in different labs. We advocate a complementary approach in which we construct a large collection of 134 coexpression networks based on expression datasets reported in individual publications. To this end we reanalyzed public expression data. To describe this collection of networks we introduced concepts of ‘pan-network’ andmore » ‘core-network’ representing union and intersection between a sizeable fractions of individual networks, respectively. Here, we showed that these two types of networks are different both in terms of their topology and biological function of interacting genes. For example, the modules of the pan-network are enriched in regulatory and signaling functions, while the modules of the core-network tend to include components of large macromolecular complexes such as ribosomes and photosynthetic machinery. Our analysis is aimed to help the plant research community to better explore the information contained within the existing vast collection of gene expression data in Arabidopsis.« less

  9. Pan- and core- network analysis of co-expression genes in a model plant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Fei; Maslov, Sergei

    Genome-wide gene expression experiments have been performed using the model plant Arabidopsis during the last decade. Some studies involved construction of coexpression networks, a popular technique used to identify groups of co-regulated genes, to infer unknown gene functions. One approach is to construct a single coexpression network by combining multiple expression datasets generated in different labs. We advocate a complementary approach in which we construct a large collection of 134 coexpression networks based on expression datasets reported in individual publications. To this end we reanalyzed public expression data. To describe this collection of networks we introduced concepts of ‘pan-network’ andmore » ‘core-network’ representing union and intersection between a sizeable fractions of individual networks, respectively. Here, we showed that these two types of networks are different both in terms of their topology and biological function of interacting genes. For example, the modules of the pan-network are enriched in regulatory and signaling functions, while the modules of the core-network tend to include components of large macromolecular complexes such as ribosomes and photosynthetic machinery. Our analysis is aimed to help the plant research community to better explore the information contained within the existing vast collection of gene expression data in Arabidopsis.« less

  10. [Molecular cloning, expression of rat Msx-1 and Msx-2 during early embryo genesis and roles for mandibular chondrogenesis].

    PubMed

    Ishiguro, S

    1999-03-01

    Quail-chick chimera experiments have shown a contribution of carnial neural crest cells to the craniofacial skeletal elements. Moreover, tissue interactions between epithelial-mesenchymal interaction during early facial process development are required for both skeletal differentiation and morphogenesis. In this study, it was observed that Msx homeobox containing genes expressed in the facial process were important molecules of cartilage morphogenesis. Rat cDNAs were isolated and encoded by Msx-1 and -2, and then the expression patterns using in situ hybridization were investigated during early rat face development. These genes were correlatively expressed in the cranial neural crest forming area (E 9.5 dpc) and the facial process (E 12.5 dpc). Antisence inhibition of Msx genes in the E 12.5 mandibular process exhibited the alteration of their gene expression and cartilage patterns. Antisence inhibition of Msx-1 induced lack of the medial portion of cartilage, and antisence inhibition of Msx-2 enhanced chondrogenesis of mandibular process under the organ culture condition. Thus it was concluded that expression of Msx genes during mandibular process development comprises important signals of chondrogenesis.

  11. Medium-throughput processing of whole mount in situ hybridisation experiments into gene expression domains.

    PubMed

    Crombach, Anton; Cicin-Sain, Damjan; Wotton, Karl R; Jaeger, Johannes

    2012-01-01

    Understanding the function and evolution of developmental regulatory networks requires the characterisation and quantification of spatio-temporal gene expression patterns across a range of systems and species. However, most high-throughput methods to measure the dynamics of gene expression do not preserve the detailed spatial information needed in this context. For this reason, quantification methods based on image bioinformatics have become increasingly important over the past few years. Most available approaches in this field either focus on the detailed and accurate quantification of a small set of gene expression patterns, or attempt high-throughput analysis of spatial expression through binary pattern extraction and large-scale analysis of the resulting datasets. Here we present a robust, "medium-throughput" pipeline to process in situ hybridisation patterns from embryos of different species of flies. It bridges the gap between high-resolution, and high-throughput image processing methods, enabling us to quantify graded expression patterns along the antero-posterior axis of the embryo in an efficient and straightforward manner. Our method is based on a robust enzymatic (colorimetric) in situ hybridisation protocol and rapid data acquisition through wide-field microscopy. Data processing consists of image segmentation, profile extraction, and determination of expression domain boundary positions using a spline approximation. It results in sets of measured boundaries sorted by gene and developmental time point, which are analysed in terms of expression variability or spatio-temporal dynamics. Our method yields integrated time series of spatial gene expression, which can be used to reverse-engineer developmental gene regulatory networks across species. It is easily adaptable to other processes and species, enabling the in silico reconstitution of gene regulatory networks in a wide range of developmental contexts.

  12. Different waves of effector genes with contrasted genomic location are expressed by Leptosphaeria maculans during cotyledon and stem colonization of oilseed rape.

    PubMed

    Gervais, Julie; Plissonneau, Clémence; Linglin, Juliette; Meyer, Michel; Labadie, Karine; Cruaud, Corinne; Fudal, Isabelle; Rouxel, Thierry; Balesdent, Marie-Hélène

    2017-10-01

    Leptosphaeria maculans, the causal agent of stem canker disease, colonizes oilseed rape (Brassica napus) in two stages: a short and early colonization stage corresponding to cotyledon or leaf colonization, and a late colonization stage during which the fungus colonizes systemically and symptomlessly the plant during several months before stem canker appears. To date, the determinants of the late colonization stage are poorly understood; L. maculans may either successfully escape plant defences, leading to stem canker development, or the plant may develop an 'adult-stage' resistance reducing canker incidence. To obtain an insight into these determinants, we performed an RNA-sequencing (RNA-seq) pilot project comparing fungal gene expression in infected cotyledons and in symptomless or necrotic stems. Despite the low fraction of fungal material in infected stems, sufficient fungal transcripts were detected and a large number of fungal genes were expressed, thus validating the feasibility of the approach. Our analysis showed that all avirulence genes previously identified are under-expressed during stem colonization compared with cotyledon colonization. A validation RNA-seq experiment was then performed to investigate the expression of candidate effector genes during systemic colonization. Three hundred and seven 'late' effector candidates, under-expressed in the early colonization stage and over-expressed in the infected stems, were identified. Finally, our analysis revealed a link between the regulation of expression of effectors and their genomic location: the 'late' effector candidates, putatively involved in systemic colonization, are located in gene-rich genomic regions, whereas the 'early' effector genes, over-expressed in the early colonization stage, are located in gene-poor regions of the genome. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  13. A distinct adipose tissue gene expression response to caloric restriction predicts 6-mo weight maintenance in obese subjects.

    PubMed

    Mutch, David M; Pers, Tune H; Temanni, M Ramzi; Pelloux, Veronique; Marquez-Quiñones, Adriana; Holst, Claus; Martinez, J Alfredo; Babalis, Dimitris; van Baak, Marleen A; Handjieva-Darlenska, Teodora; Walker, Celia G; Astrup, Arne; Saris, Wim H M; Langin, Dominique; Viguerie, Nathalie; Zucker, Jean-Daniel; Clément, Karine

    2011-12-01

    Weight loss has been shown to reduce risk factors associated with cardiovascular disease and diabetes; however, successful maintenance of weight loss continues to pose a challenge. The present study was designed to assess whether changes in subcutaneous adipose tissue (scAT) gene expression during a low-calorie diet (LCD) could be used to differentiate and predict subjects who experience successful short-term weight maintenance from subjects who experience weight regain. Forty white women followed a dietary protocol consisting of an 8-wk LCD phase followed by a 6-mo weight-maintenance phase. Participants were classified as weight maintainers (WMs; 0-10% weight regain) and weight regainers (WRs; 50-100% weight regain) by considering changes in body weight during the 2 phases. Anthropometric measurements, bioclinical variables, and scAT gene expression were studied in all individuals before and after the LCD. Energy intake was estimated by using 3-d dietary records. No differences in body weight and fasting insulin were observed between WMs and WRs at baseline or after the LCD period. The LCD resulted in significant decreases in body weight and in several plasma variables in both groups. WMs experienced a significant reduction in insulin secretion in response to an oral-glucose-tolerance test after the LCD; in contrast, no changes in insulin secretion were observed in WRs after the LCD. An ANOVA of scAT gene expression showed that genes regulating fatty acid metabolism, citric acid cycle, oxidative phosphorylation, and apoptosis were regulated differently by the LCD in WM and WR subjects. This study suggests that LCD-induced changes in insulin secretion and scAT gene expression may have the potential to predict successful short-term weight maintenance. This trial was registered at clinicaltrials.gov as NCT00390637.

  14. Problem-Solving Test: The Role of a Micro-RNA in the Regulation of "fos" Gene Expression

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    The "fos" proto-oncogene codes for a component of the AP1 transcription factor, an important regulator of gene expression and cell proliferation. Dysregulation of AP1 function may lead to the malignant transformation of the cell. The present test describes an experiment in which the role of a micro-RNA (miR-7b) in the regulation of "fos" gene…

  15. Evaluating between-pathway models with expression data.

    PubMed

    Hescott, B J; Leiserson, M D M; Cowen, L J; Slonim, D K

    2010-03-01

    Between-pathway models (BPMs) are network motifs consisting of pairs of putative redundant pathways. In this article, we show how adding another source of high-throughput data--microarray gene expression data from knockout experiments--allows us to identify a compensatory functional relationship between genes from the two BPM pathways. We evaluate the quality of the BPMs from four different studies, and we describe how our methods might be extended to refine pathways.

  16. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    PubMed Central

    2010-01-01

    Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system. PMID:20492695

  17. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    PubMed

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  18. Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines.

    PubMed

    Kowarz, Eric; Löscher, Denise; Marschalek, Rolf

    2015-04-01

    Stable gene expression in mammalian cells is a prerequisite for many in vitro and in vivo experiments. However, either the integration of plasmids into mammalian genomes or the use of retro-/lentiviral systems have intrinsic limitations. The use of transposable elements, e.g. the Sleeping Beauty system (SB), circumvents most of these drawbacks (integration sites, size limitations) and allows the quick generation of stable cell lines. The integration process of SB is catalyzed by a transposase and the handling of this gene transfer system is easy, fast and safe. Here, we report our improvements made to the existing SB vector system and present two new vector types for robust constitutive or inducible expression of any gene of interest. Both types are available in 16 variants with different selection marker (puromycin, hygromycin, blasticidin, neomycin) and fluorescent protein expression (GFP, RFP, BFP) to fit most experimental requirements. With this system it is possible to generate cell lines from stable transfected cells quickly and reliably in a medium-throughput setting (three to five days). Cell lines robustly express any gene-of-interest, either constitutively or tightly regulated by doxycycline. This allows many laboratory experiments to speed up generation of data in a rapid and robust manner. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Emiliania huxleyi increases calcification but not expression of calcification-related genes in long-term exposure to elevated temperature and pCO2.

    PubMed

    Benner, Ina; Diner, Rachel E; Lefebvre, Stephane C; Li, Dian; Komada, Tomoko; Carpenter, Edward J; Stillman, Jonathon H

    2013-01-01

    Increased atmospheric pCO2 is expected to render future oceans warmer and more acidic than they are at present. Calcifying organisms such as coccolithophores that fix and export carbon into the deep sea provide feedbacks to increasing atmospheric pCO2. Acclimation experiments suggest negative effects of warming and acidification on coccolithophore calcification, but the ability of these organisms to adapt to future environmental conditions is not well understood. Here, we tested the combined effect of pCO2 and temperature on the coccolithophore Emiliania huxleyi over more than 700 generations. Cells increased inorganic carbon content and calcification rate under warm and acidified conditions compared with ambient conditions, whereas organic carbon content and primary production did not show any change. In contrast to findings from short-term experiments, our results suggest that long-term acclimation or adaptation could change, or even reverse, negative calcification responses in E. huxleyi and its feedback to the global carbon cycle. Genome-wide profiles of gene expression using RNA-seq revealed that genes thought to be essential for calcification are not those that are most strongly differentially expressed under long-term exposure to future ocean conditions. Rather, differentially expressed genes observed here represent new targets to study responses to ocean acidification and warming.

  20. A simple implementation of a normal mixture approach to differential gene expression in multiclass microarrays.

    PubMed

    McLachlan, G J; Bean, R W; Jones, L Ben-Tovim

    2006-07-01

    An important problem in microarray experiments is the detection of genes that are differentially expressed in a given number of classes. We provide a straightforward and easily implemented method for estimating the posterior probability that an individual gene is null. The problem can be expressed in a two-component mixture framework, using an empirical Bayes approach. Current methods of implementing this approach either have some limitations due to the minimal assumptions made or with more specific assumptions are computationally intensive. By converting to a z-score the value of the test statistic used to test the significance of each gene, we propose a simple two-component normal mixture that models adequately the distribution of this score. The usefulness of our approach is demonstrated on three real datasets.

  1. GExplore: a web server for integrated queries of protein domains, gene expression and mutant phenotypes

    PubMed Central

    2009-01-01

    Background The majority of the genes even in well-studied multi-cellular model organisms have not been functionally characterized yet. Mining the numerous genome wide data sets related to protein function to retrieve potential candidate genes for a particular biological process remains a challenge. Description GExplore has been developed to provide a user-friendly database interface for data mining at the gene expression/protein function level to help in hypothesis development and experiment design. It supports combinatorial searches for proteins with certain domains, tissue- or developmental stage-specific expression patterns, and mutant phenotypes. GExplore operates on a stand-alone database and has fast response times, which is essential for exploratory searches. The interface is not only user-friendly, but also modular so that it accommodates additional data sets in the future. Conclusion GExplore is an online database for quick mining of data related to gene and protein function, providing a multi-gene display of data sets related to the domain composition of proteins as well as expression and phenotype data. GExplore is publicly available at: http://genome.sfu.ca/gexplore/ PMID:19917126

  2. Microarray Meta-Analysis Identifies Acute Lung Injury Biomarkers in Donor Lungs That Predict Development of Primary Graft Failure in Recipients

    PubMed Central

    Haitsma, Jack J.; Furmli, Suleiman; Masoom, Hussain; Liu, Mingyao; Imai, Yumiko; Slutsky, Arthur S.; Beyene, Joseph; Greenwood, Celia M. T.; dos Santos, Claudia

    2012-01-01

    Objectives To perform a meta-analysis of gene expression microarray data from animal studies of lung injury, and to identify an injury-specific gene expression signature capable of predicting the development of lung injury in humans. Methods We performed a microarray meta-analysis using 77 microarray chips across six platforms, two species and different animal lung injury models exposed to lung injury with or/and without mechanical ventilation. Individual gene chips were classified and grouped based on the strategy used to induce lung injury. Effect size (change in gene expression) was calculated between non-injurious and injurious conditions comparing two main strategies to pool chips: (1) one-hit and (2) two-hit lung injury models. A random effects model was used to integrate individual effect sizes calculated from each experiment. Classification models were built using the gene expression signatures generated by the meta-analysis to predict the development of lung injury in human lung transplant recipients. Results Two injury-specific lists of differentially expressed genes generated from our meta-analysis of lung injury models were validated using external data sets and prospective data from animal models of ventilator-induced lung injury (VILI). Pathway analysis of gene sets revealed that both new and previously implicated VILI-related pathways are enriched with differentially regulated genes. Classification model based on gene expression signatures identified in animal models of lung injury predicted development of primary graft failure (PGF) in lung transplant recipients with larger than 80% accuracy based upon injury profiles from transplant donors. We also found that better classifier performance can be achieved by using meta-analysis to identify differentially-expressed genes than using single study-based differential analysis. Conclusion Taken together, our data suggests that microarray analysis of gene expression data allows for the detection of “injury" gene predictors that can classify lung injury samples and identify patients at risk for clinically relevant lung injury complications. PMID:23071521

  3. Gene expression analysis and microdialysis suggest hypothalamic triiodothyronine (T3) gates daily torpor in Djungarian hamsters (Phodopus sungorus).

    PubMed

    Bank, Jonathan H H; Cubuk, Ceyda; Wilson, Dana; Rijntjes, Eddy; Kemmling, Julia; Markovsky, Hanna; Barrett, Perry; Herwig, Annika

    2017-07-01

    Thyroid hormones play an important role in regulating seasonal adaptations of mammals. Several studies suggested that reduced availability of 3,3',5-triiodothyronine (T3) in the hypothalamus is required for the physiological adaptation to winter in Djungarian hamsters. We have previously shown that T3 is involved in the regulation of daily torpor, but it remains unclear, whether T3 affects torpor by central or peripheral mechanisms. To determine the effect of T3 concentrations within the hypothalamus in regulating daily torpor, we tested the hypothesis that low hypothalamic T3 metabolism would favour torpor and high T3 concentrations would not. In experiment 1 gene expression in torpid hamsters was assessed for transporters carrying thyroid hormones between cerebrospinal fluid and hypothalamic cells and for deiodinases enzymes, activating or inactivating T3 within hypothalamic cells. Gene expression analysis suggests reduced T3 in hypothalamic cells during torpor. In experiment 2, hypothalamic T3 concentrations were altered via microdialysis and torpor behaviour was continuously monitored by implanted body temperature transmitters. Increased T3 concentrations in the hypothalamus reduced expression of torpor as well as torpor bout duration and depth. Subsequent analysis of gene expression in the ependymal layer of the third ventricle showed clear up-regulation of T3 inactivating deiodinase 3 but no changes in several other genes related to photoperiodic adaptations in hamsters. Finally, serum analysis revealed that increased total T3 serum concentrations were not necessary to inhibit torpor expression. Taken together, our results are consistent with the hypothesis that T3 availability within the hypothalamus significantly contributes to the regulation of daily torpor via a central pathway.

  4. A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor.

    PubMed

    Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S

    2012-02-01

    Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.

  5. A modular and optimized single marker system for generating Trypanosoma brucei cell lines expressing T7 RNA polymerase and the tetracycline repressor

    PubMed Central

    Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.

    2012-01-01

    Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659

  6. Molecular pathology of acute kidney injury in a choline-deficient model and fish oil protective effect.

    PubMed

    Denninghoff, Valeria; Ossani, Georgina; Uceda, Ana; Rugnone, Matias; Fernández, Elmer; Fresno, Cristóbal; González, German; Díaz, Maria Luisa; Avagnina, Alejandra; Elsner, Boris; Monserrat, Alberto

    2014-04-01

    The aim of this work was to investigate the potential protective effects of fish oil on the basis of kidney transcriptomic data on a nutritional experimental model. Male weanling Wistar rats were divided into four groups and fed choline-deficient (CD) and choline-supplemented (CS) diets with vegetable oil (VO) and menhaden oil (MO): CSVO, CDVO, CSMO and CDMO. Animals were killed after receiving the diets for 6 days. Total RNA was purified from the right kidney and hybridized to Affymetrix GeneChip Rat Gene 1.0 ST Array. Differentially expressed genes were analyzed. All CSVO, CSMO and CDMO rats showed no renal alterations, while all CDVO rats showed renal cortical necrosis. A thorough analysis of the differential expression between groups CSMO and CDMO was carried out. There were no differential genes for p < 0.01. The analysis of the differential expression between groups CSVO and CSMO revealed 32 genes, 11 were over-expressed and 21 were under-expressed in CSMO rats. This work was part of a large set of experiments and was used in a hypothesis-generating manner. The comprehensive analysis of genetic expression allowed confirming that menhaden oil has a protective effect on this nutritional experimental model and identifying 32 genes that could be responsible for that protection, including Gstp1. These results reveal that gene changes could play a role in renal injury.

  7. Salmonella induces prominent gene expression in the rat colon

    PubMed Central

    Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg MJ

    2007-01-01

    Background Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Results Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFNγ and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. Conclusion We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression. PMID:17850650

  8. Salmonella induces prominent gene expression in the rat colon.

    PubMed

    Rodenburg, Wendy; Keijer, Jaap; Kramer, Evelien; Roosing, Susanne; Vink, Carolien; Katan, Martijn B; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg M J

    2007-09-12

    Salmonella enteritidis is suggested to translocate in the small intestine. In vivo it induces gene expression changes in the ileal mucosa and Peyer's patches. Stimulation of Salmonella translocation by dietary prebiotics fermented in colon suggests involvement of the colon as well. However, effects of Salmonella on colonic gene expression in vivo are largely unknown. We aimed to characterize time dependent Salmonella-induced changes of colonic mucosal gene expression in rats using whole genome microarrays. For this, rats were orally infected with Salmonella enteritidis to mimic a foodborne infection and colonic gene expression was determined at days 1, 3 and 6 post-infection (n = 8 rats per time-point). As fructo-oligosaccharides (FOS) affect colonic physiology, we analyzed colonic mucosal gene expression of FOS-fed versus cellulose-fed rats infected with Salmonella in a separate experiment. Colonic mucosal samples were isolated at day 2 post-infection. Salmonella affected transport (e.g. Chloride channel calcium activated 6, H+/K+ transporting Atp-ase), antimicrobial defense (e.g. Lipopolysaccharide binding protein, Defensin 5 and phospholipase A2), inflammation (e.g. calprotectin), oxidative stress related genes (e.g. Dual oxidase 2 and Glutathione peroxidase 2) and Proteolysis (e.g. Ubiquitin D and Proteosome subunit beta type 9). Furthermore, Salmonella translocation increased serum IFN gamma and many interferon-related genes in colonic mucosa. The gene most strongly induced by Salmonella infection was Pancreatitis Associated Protein (Pap), showing >100-fold induction at day 6 after oral infection. Results were confirmed by Q-PCR in individual rats. Stimulation of Salmonella translocation by dietary FOS was accompanied by enhancement of the Salmonella-induced mucosal processes, not by induction of other processes. We conclude that the colon is a target tissue for Salmonella, considering the abundant changes in mucosal gene expression.

  9. Translating standards into practice - one Semantic Web API for Gene Expression.

    PubMed

    Deus, Helena F; Prud'hommeaux, Eric; Miller, Michael; Zhao, Jun; Malone, James; Adamusiak, Tomasz; McCusker, Jim; Das, Sudeshna; Rocca Serra, Philippe; Fox, Ronan; Marshall, M Scott

    2012-08-01

    Sharing and describing experimental results unambiguously with sufficient detail to enable replication of results is a fundamental tenet of scientific research. In today's cluttered world of "-omics" sciences, data standards and standardized use of terminologies and ontologies for biomedical informatics play an important role in reporting high-throughput experiment results in formats that can be interpreted by both researchers and analytical tools. Increasing adoption of Semantic Web and Linked Data technologies for the integration of heterogeneous and distributed health care and life sciences (HCLSs) datasets has made the reuse of standards even more pressing; dynamic semantic query federation can be used for integrative bioinformatics when ontologies and identifiers are reused across data instances. We present here a methodology to integrate the results and experimental context of three different representations of microarray-based transcriptomic experiments: the Gene Expression Atlas, the W3C BioRDF task force approach to reporting Provenance of Microarray Experiments, and the HSCI blood genomics project. Our approach does not attempt to improve the expressivity of existing standards for genomics but, instead, to enable integration of existing datasets published from microarray-based transcriptomic experiments. SPARQL Construct is used to create a posteriori mappings of concepts and properties and linking rules that match entities based on query constraints. We discuss how our integrative approach can encourage reuse of the Experimental Factor Ontology (EFO) and the Ontology for Biomedical Investigations (OBIs) for the reporting of experimental context and results of gene expression studies. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

    PubMed

    Matsunaga, Taichi; Yamashita, Jun K

    2014-02-07

    Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Probabilistic representation of gene regulatory networks.

    PubMed

    Mao, Linyong; Resat, Haluk

    2004-09-22

    Recent experiments have established unambiguously that biological systems can have significant cell-to-cell variations in gene expression levels even in isogenic populations. Computational approaches to studying gene expression in cellular systems should capture such biological variations for a more realistic representation. In this paper, we present a new fully probabilistic approach to the modeling of gene regulatory networks that allows for fluctuations in the gene expression levels. The new algorithm uses a very simple representation for the genes, and accounts for the repression or induction of the genes and for the biological variations among isogenic populations simultaneously. Because of its simplicity, introduced algorithm is a very promising approach to model large-scale gene regulatory networks. We have tested the new algorithm on the synthetic gene network library bioengineered recently. The good agreement between the computed and the experimental results for this library of networks, and additional tests, demonstrate that the new algorithm is robust and very successful in explaining the experimental data. The simulation software is available upon request. Supplementary material will be made available on the OUP server.

  12. Conditioned taste aversion dependent regulation of amygdala gene expression.

    PubMed

    Panguluri, Siva K; Kuwabara, Nobuyuki; Kang, Yi; Cooper, Nigel; Lundy, Robert F

    2012-02-28

    The present experiments investigated gene expression in the amygdala following contingent taste/LiCl treatment that supports development of conditioned taste aversion (CTA). The use of whole genome chips and stringent data set filtering led to the identification of 168 genes regulated by CTA compared to non-contingent LiCl treatment that does not support CTA learning. Seventy-six of these genes were eligible for network analysis. Such analysis identified "behavior" as the top biological function, which was represented by 15 of the 76 genes. These genes included several neuropeptides, G protein-coupled receptors, ion channels, kinases, and phosphatases. Subsequent qRT-PCR analyses confirmed changes in mRNA expression for 5 of 7 selected genes. We were able to demonstrate directionally consistent changes in protein level for 3 of these genes; insulin 1, oxytocin, and major histocompatibility complex class I-C. Behavioral analyses demonstrated that blockade of central insulin receptors produced a weaker CTA that was less resistant to extinction. Together, these results support the notion that we have identified downstream genes in the amygdala that contribute to CTA learning. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. NCBI GEO: archive for high-throughput functional genomic data.

    PubMed

    Barrett, Tanya; Troup, Dennis B; Wilhite, Stephen E; Ledoux, Pierre; Rudnev, Dmitry; Evangelista, Carlos; Kim, Irene F; Soboleva, Alexandra; Tomashevsky, Maxim; Marshall, Kimberly A; Phillippy, Katherine H; Sherman, Patti M; Muertter, Rolf N; Edgar, Ron

    2009-01-01

    The Gene Expression Omnibus (GEO) at the National Center for Biotechnology Information (NCBI) is the largest public repository for high-throughput gene expression data. Additionally, GEO hosts other categories of high-throughput functional genomic data, including those that examine genome copy number variations, chromatin structure, methylation status and transcription factor binding. These data are generated by the research community using high-throughput technologies like microarrays and, more recently, next-generation sequencing. The database has a flexible infrastructure that can capture fully annotated raw and processed data, enabling compliance with major community-derived scientific reporting standards such as 'Minimum Information About a Microarray Experiment' (MIAME). In addition to serving as a centralized data storage hub, GEO offers many tools and features that allow users to effectively explore, analyze and download expression data from both gene-centric and experiment-centric perspectives. This article summarizes the GEO repository structure, content and operating procedures, as well as recently introduced data mining features. GEO is freely accessible at http://www.ncbi.nlm.nih.gov/geo/.

  14. De novo transcriptome assembly and analysis of differential gene expression in response to drought in European beech

    PubMed Central

    Seifert, Sarah; Lübbe, Torben; Leuschner, Christoph; Finkeldey, Reiner

    2017-01-01

    Despite the ecological and economic importance of European beech (Fagus sylvatica L.) genomic resources of this species are still limited. This hampers an understanding of the molecular basis of adaptation to stress. Since beech will most likely be threatened by the consequences of climate change, an understanding of adaptive processes to climate change-related drought stress is of major importance. Here, we used RNA-seq to provide the first drought stress-related transcriptome of beech. In a drought stress trial with beech saplings, 50 samples were taken for RNA extraction at five points in time during a soil desiccation experiment. De novo transcriptome assembly and analysis of differential gene expression revealed 44,335 contigs, and 662 differentially expressed genes between the stress and normally watered control group. Gene expression was specific to the different time points, and only five genes were significantly differentially expressed between the stress and control group on all five sampling days. GO term enrichment showed that mostly genes involved in lipid- and homeostasis-related processes were upregulated, whereas genes involved in oxidative stress response were downregulated in the stressed seedlings. This study gives first insights into the genomic drought stress response of European beech, and provides new genetic resources for adaptation research in this species. PMID:28873454

  15. Studies on the expression of an H-2K/human growth hormone fusion gene in giant transgenic mice.

    PubMed Central

    Morello, D; Moore, G; Salmon, A M; Yaniv, M; Babinet, C

    1986-01-01

    Transgenic mice carrying the H-2K/human growth hormone (hGH) fusion gene were produced by microinjecting into the pronucleus of fertilized eggs DNA molecules containing 2 kb of the 5' flanking sequences (including promoter) of the class I H-2Kb gene joined to the coding sequences of the hGH gene. Thirteen transgenic mice were obtained which all contained detectable levels of hGH hormone in their blood. Nine grew larger than their control litter-mates. Endogenous H-2Kb and exogenous hGH mRNA levels were analysed by S1 nuclease digestion experiments. hGH transcripts were found in all the tissues examined and the pattern of expression paralleled that of endogenous H-2K gene expression, being high in liver and lymphoid organs and low in muscle and brain. Thus 2 kb of the 5' promoter/regulatory region of the H-2K gene are sufficient to ensure regulated expression of hGH in transgenic mice. This promoter may therefore be of use to target the expression of different exogenous genes in most tissues of transgenic mice and to study the biological role of the corresponding proteins in different cellular environments. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3019667

  16. Role of NF-Kappa B Signaling in X-Box Binding Protein 1 (XBP1)-Mediated Antiestrogen Resistance in Breast Cancer

    DTIC Science & Technology

    2013-10-01

    experiments, a statistically significant data is not yet available. Additional experiments are needed for us to be able to draw   conclu comb Figure...well-defined stress pathways, UPR and autophagy, are involved breast involution regulation. Using published gene expression array datasets from...performed involution time-course experiments using both low-dose drug interventions and an autophagy-related gene 7 (ATG7) deletion mouse model

  17. Arbuscular mycorrhizal fungi differ in their ability to regulate the expression of phosphate transportors in maize (Zea mays L.)

    USDA-ARS?s Scientific Manuscript database

    A greenhouse experiment was conducted to study the expression of two phosphate (P) transporter genes ZEAma:Pht1;3 (epidermal-expressed) and ZEAma:Pht1;6 (AM specific induced, and expressed around arbuscules) in maize root to colonization by different arbuscular mycorrhizal (AM) fungal inoculants. No...

  18. Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli.

    PubMed

    Goh, Shan; Hohmeier, Angela; Stone, Timothy C; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam

    2015-08-15

    Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  19. Silencing of Essential Genes within a Highly Coordinated Operon in Escherichia coli

    PubMed Central

    Hohmeier, Angela; Stone, Timothy C.; Offord, Victoria; Sarabia, Francisco; Garcia-Ruiz, Cristina; Good, Liam

    2015-01-01

    Essential bacterial genes located within operons are particularly challenging to study independently because of coordinated gene expression and the nonviability of knockout mutants. Essentiality scores for many operon genes remain uncertain. Antisense RNA (asRNA) silencing or in-frame gene disruption of genes may help establish essentiality but can lead to polar effects on genes downstream or upstream of the target gene. Here, the Escherichia coli ribF-ileS-lspA-fkpB-ispH operon was used to evaluate the possibility of independently studying an essential gene using expressed asRNA and target gene overexpression to deregulate coupled expression. The gene requirement for growth in conditional silencing strains was determined by the relationship of target mRNA reduction with growth inhibition as the minimum transcript level required for 50% growth (MTL50). Mupirocin and globomycin, the protein inhibitors of IleS and LspA, respectively, were used in sensitization assays of strains containing both asRNA-expressing and open reading frame-expressing plasmids to examine deregulation of the overlapping ileS-lspA genes. We found upstream and downstream polar silencing effects when either ileS or lspA was silenced, indicating coupled expression. Weighted MTL50 values (means and standard deviations) of ribF, ileS, and lspA were 0.65 ± 0.18, 0.64 ± 0.06, and 0.76 ± 0.10, respectively. However, they were not significantly different (P = 0.71 by weighted one-way analysis of variance). The gene requirement for ispH could not be determined due to insufficient growth reduction. Mupirocin and globomycin sensitization experiments indicated that ileS-lspA expression could not be decoupled. The results highlight the inherent challenges associated with genetic analyses of operons; however, coupling of essential genes may provide opportunities to improve RNA-silencing antimicrobials. PMID:26070674

  20. TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

    PubMed

    Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

    2017-01-01

    During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

  1. TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

    PubMed Central

    Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

    2017-01-01

    During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

  2. Gene Expression Changes in Cervical Squamous Cell Carcinoma After Initiation of Chemoradiation and Correlation With Clinical Outcome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klopp, Ann H.; Jhingran, Anuja; Ramdas, Latha

    2008-05-01

    Purpose: The purpose of this study was to investigate early gene expression changes after chemoradiation in a human solid tumor, allowing identification of chemoradiation-induced gene expression changes in the tumor as well as the tumor microenvironment. In addition we aimed to identify a gene expression profile that was associated with clinical outcome. Methods and Materials: Microarray experiments were performed on cervical cancer specimens obtained before and 48 h after chemoradiation from 12 patients with Stage IB2 to IIIB squamous cell carcinoma of the cervix treated between April 2001 and August 2002. Results: A total of 262 genes were identified thatmore » were significantly changed after chemoradiation. Genes involved in DNA repair were identified including DDB2, ERCC4, GADD45A, and XPC. In addition, significantly regulated cell-to-cell signaling pathways included insulin-like growth factor-1 (IGF-1), interferon, and vascular endothelial growth factor signaling. At a median follow-up of 41 months, 5 of 12 patients had experienced either local or distant failure. Supervised clustering analysis identified a 58-gene set from the pretreatment samples that were differentially expressed between patients with and without recurrence. Genes involved in integrin signaling and apoptosis pathways were identified in this gene set. Immortalization-upregulated protein (IMUP), IGF-2, and ARHD had particularly marked differences in expression between patients with and without recurrence. Conclusions: Genetic profiling identified genes regulated by chemoradiation including DNA damage and cell-to-cell signaling pathways. Genes associated with recurrence were identified that will require validation in an independent patient data set to determine whether the 58-gene set associated with clinical outcome could be useful as a prognostic assay.« less

  3. Time-Course Analysis of Gene Expression During the Saccharomyces cerevisiae Hypoxic Response.

    PubMed

    Bendjilali, Nasrine; MacLeon, Samuel; Kalra, Gurmannat; Willis, Stephen D; Hossian, A K M Nawshad; Avery, Erica; Wojtowicz, Olivia; Hickman, Mark J

    2017-01-05

    Many cells experience hypoxia, or low oxygen, and respond by dramatically altering gene expression. In the yeast Saccharomyces cerevisiae, genes that respond are required for many oxygen-dependent cellular processes, such as respiration, biosynthesis, and redox regulation. To more fully characterize the global response to hypoxia, we exposed yeast to hypoxic conditions, extracted RNA at different times, and performed RNA sequencing (RNA-seq) analysis. Time-course statistical analysis revealed hundreds of genes that changed expression by up to 550-fold. The genes responded with varying kinetics suggesting that multiple regulatory pathways are involved. We identified most known oxygen-regulated genes and also uncovered new regulated genes. Reverse transcription-quantitative PCR (RT-qPCR) analysis confirmed that the lysine methyltransferase EFM6 and the recombinase DMC1, both conserved in humans, are indeed oxygen-responsive. Looking more broadly, oxygen-regulated genes participate in expected processes like respiration and lipid metabolism, but also in unexpected processes like amino acid and vitamin metabolism. Using principle component analysis, we discovered that the hypoxic response largely occurs during the first 2 hr and then a new steady-state expression state is achieved. Moreover, we show that the oxygen-dependent genes are not part of the previously described environmental stress response (ESR) consisting of genes that respond to diverse types of stress. While hypoxia appears to cause a transient stress, the hypoxic response is mostly characterized by a transition to a new state of gene expression. In summary, our results reveal that hypoxia causes widespread and complex changes in gene expression to prepare the cell to function with little or no oxygen. Copyright © 2017 Bendjilali et al.

  4. Genome-wide identification of physically clustered genes suggests chromatin-level co-regulation in male reproductive development in Arabidopsis thaliana

    PubMed Central

    Reimegård, Johan; Kundu, Snehangshu; Pendle, Ali; Irish, Vivian F.; Shaw, Peter

    2017-01-01

    Abstract Co-expression of physically linked genes occurs surprisingly frequently in eukaryotes. Such chromosomal clustering may confer a selective advantage as it enables coordinated gene regulation at the chromatin level. We studied the chromosomal organization of genes involved in male reproductive development in Arabidopsis thaliana. We developed an in-silico tool to identify physical clusters of co-regulated genes from gene expression data. We identified 17 clusters (96 genes) involved in stamen development and acting downstream of the transcriptional activator MS1 (MALE STERILITY 1), which contains a PHD domain associated with chromatin re-organization. The clusters exhibited little gene homology or promoter element similarity, and largely overlapped with reported repressive histone marks. Experiments on a subset of the clusters suggested a link between expression activation and chromatin conformation: qRT-PCR and mRNA in situ hybridization showed that the clustered genes were up-regulated within 48 h after MS1 induction; out of 14 chromatin-remodeling mutants studied, expression of clustered genes was consistently down-regulated only in hta9/hta11, previously associated with metabolic cluster activation; DNA fluorescence in situ hybridization confirmed that transcriptional activation of the clustered genes was correlated with open chromatin conformation. Stamen development thus appears to involve transcriptional activation of physically clustered genes through chromatin de-condensation. PMID:28175342

  5. GOexpress: an R/Bioconductor package for the identification and visualisation of robust gene ontology signatures through supervised learning of gene expression data.

    PubMed

    Rue-Albrecht, Kévin; McGettigan, Paul A; Hernández, Belinda; Nalpas, Nicolas C; Magee, David A; Parnell, Andrew C; Gordon, Stephen V; MacHugh, David E

    2016-03-11

    Identification of gene expression profiles that differentiate experimental groups is critical for discovery and analysis of key molecular pathways and also for selection of robust diagnostic or prognostic biomarkers. While integration of differential expression statistics has been used to refine gene set enrichment analyses, such approaches are typically limited to single gene lists resulting from simple two-group comparisons or time-series analyses. In contrast, functional class scoring and machine learning approaches provide powerful alternative methods to leverage molecular measurements for pathway analyses, and to compare continuous and multi-level categorical factors. We introduce GOexpress, a software package for scoring and summarising the capacity of gene ontology features to simultaneously classify samples from multiple experimental groups. GOexpress integrates normalised gene expression data (e.g., from microarray and RNA-seq experiments) and phenotypic information of individual samples with gene ontology annotations to derive a ranking of genes and gene ontology terms using a supervised learning approach. The default random forest algorithm allows interactions between all experimental factors, and competitive scoring of expressed genes to evaluate their relative importance in classifying predefined groups of samples. GOexpress enables rapid identification and visualisation of ontology-related gene panels that robustly classify groups of samples and supports both categorical (e.g., infection status, treatment) and continuous (e.g., time-series, drug concentrations) experimental factors. The use of standard Bioconductor extension packages and publicly available gene ontology annotations facilitates straightforward integration of GOexpress within existing computational biology pipelines.

  6. Combining mouse mammary gland gene expression and comparative mapping for the identification of candidate genes for QTL of milk production traits in cattle

    PubMed Central

    Ron, Micha; Israeli, Galit; Seroussi, Eyal; Weller, Joel I; Gregg, Jeffrey P; Shani, Moshe; Medrano, Juan F

    2007-01-01

    Background Many studies have found segregating quantitative trait loci (QTL) for milk production traits in different dairy cattle populations. However, even for relatively large effects with a saturated marker map the confidence interval for QTL location by linkage analysis spans tens of map units, or hundreds of genes. Combining mapping and arraying has been suggested as an approach to identify candidate genes. Thus, gene expression analysis in the mammary gland of genes positioned in the confidence interval of the QTL can bridge the gap between fine mapping and quantitative trait nucleotide (QTN) determination. Results We hybridized Affymetrix microarray (MG-U74v2), containing 12,488 murine probes, with RNA derived from mammary gland of virgin, pregnant, lactating and involuting C57BL/6J mice in a total of nine biological replicates. We combined microarray data from two additional studies that used the same design in mice with a total of 75 biological replicates. The same filtering and normalization was applied to each microarray data using GeneSpring software. Analysis of variance identified 249 differentially expressed probe sets common to the three experiments along the four developmental stages of puberty, pregnancy, lactation and involution. 212 genes were assigned to their bovine map positions through comparative mapping, and thus form a list of candidate genes for previously identified QTLs for milk production traits. A total of 82 of the genes showed mammary gland-specific expression with at least 3-fold expression over the median representing all tissues tested in GeneAtlas. Conclusion This work presents a web tool for candidate genes for QTL (cgQTL) that allows navigation between the map of bovine milk production QTL, potential candidate genes and their level of expression in mammary gland arrays and in GeneAtlas. Three out of four confirmed genes that affect QTL in livestock (ABCG2, DGAT1, GDF8, IGF2) were over expressed in the target organ. Thus, cgQTL can be used to determine priority of candidate genes for QTN analysis based on differential expression in the target organ. PMID:17584498

  7. Expression of bacteriocin LsbB is dependent on a transcription terminator.

    PubMed

    Uzelac, Gordana; Miljkovic, Marija; Lozo, Jelena; Radulovic, Zorica; Tosic, Natasa; Kojic, Milan

    2015-10-01

    The production of LsbB, leaderless class II bacteriocin, is encoded by genes (lsbB and lmrB) located on plasmid pMN5 in Lactococcus lactis BGMN1-5. Heterologous expression of the lsbB gene using the pAZIL vector (pAZIL-lsbB) in L. lactis subsp. cremoris MG7284 resulted in a significant reduction (more than 30 times) of bacteriocin LsbB expression. Subcloning and deletion experiments with plasmid pMN5 revealed that full expression of LsbB requires the presence of a complete transcription terminator located downstream of the lsbB gene. RNA stability analysis revealed that the presence of a transcription terminator increased the RNA stability by three times and the expression of LsbB by 30 times. The study of the influence of transcription terminator on the expression of other bacteriocin genes (lcnB, for lactococcin B production) indicated that this translational terminator likely functions in a lsbB-specific manner rather than in a general manner. Copyright © 2015 Elsevier GmbH. All rights reserved.

  8. Regulatory network rewiring for secondary metabolism in Arabidopsis thaliana under various conditions

    PubMed Central

    2014-01-01

    Background Plant secondary metabolites are critical to various biological processes. However, the regulations of these metabolites are complex because of regulatory rewiring or crosstalk. To unveil how regulatory behaviors on secondary metabolism reshape biological processes, we constructed and analyzed a dynamic regulatory network of secondary metabolic pathways in Arabidopsis. Results The dynamic regulatory network was constructed through integrating co-expressed gene pairs and regulatory interactions. Regulatory interactions were either predicted by conserved transcription factor binding sites (TFBSs) or proved by experiments. We found that integrating two data (co-expression and predicted regulatory interactions) enhanced the number of highly confident regulatory interactions by over 10% compared with using single data. The dynamic changes of regulatory network systematically manifested regulatory rewiring to explain the mechanism of regulation, such as in terpenoids metabolism, the regulatory crosstalk of RAV1 (AT1G13260) and ATHB1 (AT3G01470) on HMG1 (hydroxymethylglutaryl-CoA reductase, AT1G76490); and regulation of RAV1 on epoxysqualene biosynthesis and sterol biosynthesis. Besides, we investigated regulatory rewiring with expression, network topology and upstream signaling pathways. Regulatory rewiring was revealed by the variability of genes’ expression: pathway genes and transcription factors (TFs) were significantly differentially expressed under different conditions (such as terpenoids biosynthetic genes in tissue experiments and E2F/DP family members in genotype experiments). Both network topology and signaling pathways supported regulatory rewiring. For example, we discovered correlation among the numbers of pathway genes, TFs and network topology: one-gene pathways (such as δ-carotene biosynthesis) were regulated by a fewer TFs, and were not critical to metabolic network because of their low degrees in topology. Upstream signaling pathways of 50 TFs were identified to comprehend the underlying mechanism of TFs’ regulatory rewiring. Conclusion Overall, this dynamic regulatory network largely improves the understanding of perplexed regulatory rewiring in secondary metabolism in Arabidopsis. PMID:24993737

  9. Pre-amplification in the context of high-throughput qPCR gene expression experiment.

    PubMed

    Korenková, Vlasta; Scott, Justin; Novosadová, Vendula; Jindřichová, Marie; Langerová, Lucie; Švec, David; Šídová, Monika; Sjöback, Robert

    2015-03-11

    With the introduction of the first high-throughput qPCR instrument on the market it became possible to perform thousands of reactions in a single run compared to the previous hundreds. In the high-throughput reaction, only limited volumes of highly concentrated cDNA or DNA samples can be added. This necessity can be solved by pre-amplification, which became a part of the high-throughput experimental workflow. Here, we focused our attention on the limits of the specific target pre-amplification reaction and propose the optimal, general setup for gene expression experiment using BioMark instrument (Fluidigm). For evaluating different pre-amplification factors following conditions were combined: four human blood samples from healthy donors and five transcripts having high to low expression levels; each cDNA sample was pre-amplified at four cycles (15, 18, 21, and 24) and five concentrations (equivalent to 0.078 ng, 0.32 ng, 1.25 ng, 5 ng, and 20 ng of total RNA). Factors identified as critical for a success of cDNA pre-amplification were cycle of pre-amplification, total RNA concentration, and type of gene. The selected pre-amplification reactions were further tested for optimal Cq distribution in a BioMark Array. The following concentrations combined with pre-amplification cycles were optimal for good quality samples: 20 ng of total RNA with 15 cycles of pre-amplification, 20x and 40x diluted; and 5 ng and 20 ng of total RNA with 18 cycles of pre-amplification, both 20x and 40x diluted. We set up upper limits for the bulk gene expression experiment using gene expression Dynamic Array and provided an easy-to-obtain tool for measuring of pre-amplification success. We also showed that variability of the pre-amplification, introduced into the experimental workflow of reverse transcription-qPCR, is lower than variability caused by the reverse transcription step.

  10. Clinical significance of In vivo Cytarabine Induced Gene Expression Signature in AML

    PubMed Central

    Lamba, Jatinder K.; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R.; Cogle, Christopher R.; Bhise, Neha; Raimondi, Susana C.; Downing, James R.; Baker, Sharyn D.; Ribeiro, Raul C.; Rubnitz, Jeffrey E.

    2016-01-01

    Despite initial remission, approximately 60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML, however extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy can trigger adaptive response by influencing leukemic cell transcriptome and hence development of resistance or refractory disease. It is however challenging to perform such a study due to lack of availability of specimens post-drug treatment. In this study our primary objective was to identify in vivo cytarabine induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. Our results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response. PMID:26366682

  11. Clinical significance of in vivo cytarabine-induced gene expression signature in AML.

    PubMed

    Lamba, Jatinder K; Pounds, Stanley; Cao, Xueyuan; Crews, Kristine R; Cogle, Christopher R; Bhise, Neha; Raimondi, Susana C; Downing, James R; Baker, Sharyn D; Ribeiro, Raul C; Rubnitz, Jeffrey E

    2016-01-01

    Despite initial remission, ∼60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML; however, the extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy, can trigger adaptive response by influencing leukemic cell transcriptome and, hence, development of resistance or refractory disease. It is, however, challenging to perform such a study due to lack of availability of specimens post-drug treatment. The primary objective of this study was to identify in vivo cytarabine-induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. The results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response.

  12. Identifying gnostic predictors of the vaccine response.

    PubMed

    Haining, W Nicholas; Pulendran, Bali

    2012-06-01

    Molecular predictors of the response to vaccination could transform vaccine development. They would allow larger numbers of vaccine candidates to be rapidly screened, shortening the development time for new vaccines. Gene-expression based predictors of vaccine response have shown early promise. However, a limitation of gene-expression based predictors is that they often fail to reveal the mechanistic basis of their ability to classify response. Linking predictive signatures to the function of their component genes would advance basic understanding of vaccine immunity and also improve the robustness of vaccine prediction. New analytic tools now allow more biological meaning to be extracted from predictive signatures. Functional genomic approaches to perturb gene expression in mammalian cells permit the function of predictive genes to be surveyed in highly parallel experiments. The challenge for vaccinologists is therefore to use these tools to embed mechanistic insights into predictors of vaccine response. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Identifying gnostic predictors of the vaccine response

    PubMed Central

    Haining, W. Nicholas; Pulendran, Bali

    2012-01-01

    Molecular predictors of the response to vaccination could transform vaccine development. They would allow larger numbers of vaccine candidates to be rapidly screened, shortening the development time for new vaccines. Gene-expression based predictors of vaccine response have shown early promise. However, a limitation of gene-expression based predictors is that they often fail to reveal the mechanistic basis for their ability to classify response. Linking predictive signatures to the function of their component genes would advance basic understanding of vaccine immunity and also improve the robustness of outcome classification. New analytic tools now allow more biological meaning to be extracted from predictive signatures. Functional genomic approaches to perturb gene expression in mammalian cells permit the function of predictive genes to be surveyed in highly parallel experiments. The challenge for vaccinologists is therefore to use these tools to embed mechanistic insights into predictors of vaccine response. PMID:22633886

  14. Non-invasive imaging using reporter genes altering cellular water permeability

    NASA Astrophysics Data System (ADS)

    Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.

    2016-12-01

    Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.

  15. Molecular cloning of the Coch gene of guinea pig inner ear and its expression analysis in cultured fibrocytes of the spiral ligament.

    PubMed

    Li, Lishu; Ikezono, Tetsuo; Sekine, Kuwon; Shindo, Susumu; Matsumura, Tomohiro; Pawankar, Ruby; Ichimiya, Issei; Yagi, Toshiaki

    2010-08-01

    We have cloned guinea pig Coch cDNA and the sequence information will be useful for future molecular study combined with physiological experiments. Proper Coch gene expression appears to be dependent on the unique extracellular micro-environment of the inner ear in vivo. These results provide insight into the Coch gene expression and its regulation. To characterize the guinea pig Coch gene, we performed molecular cloning and expression analysis in the inner ear and cultured fibrocytes of the spiral ligament. The Coch cDNA was isolated using RACE. Cochlin isofoms were studied by Western blot using three different types of mammalian inner ear. The cochlear fibrocytes were cultured and characterized by immunostaining. Coch gene expression in the fibrocytes was investigated and the influence of cytokine stimulation was evaluated. The full-length 1991 bp Coch cDNA that encodes a 553 amino acid protein was isolated. The sequence had significant homology with other mammals, and the sizes of the Cochlin isoforms were identical. In the cultured fibrocytes, Coch mRNA was expressed in a very small amount and the isoform production was different, compared with the results in vivo. Cytokine stimulation did not alter the level of mRNA expression or isoform formation.

  16. Intraarticular expression of biologically active interleukin 1-receptor-antagonist protein by ex vivo gene transfer.

    PubMed Central

    Bandara, G; Mueller, G M; Galea-Lauri, J; Tindal, M H; Georgescu, H I; Suchanek, M K; Hung, G L; Glorioso, J C; Robbins, P D; Evans, C H

    1993-01-01

    Gene therapy offers a radical different approach to the treatment of arthritis. Here we have demonstrated that two marker genes (lacZ and neo) and cDNA coding for a potentially therapeutic protein (human interleukin 1-receptor-antagonist protein; IRAP or IL-1ra) can be delivered, by ex vivo techniques, to the synovial lining of joints; intraarticular expression of IRAP inhibited intraarticular responses to interleukin 1. To achieve this, lapine synoviocytes were first transduced in culture by retroviral infection. The genetically modified synovial cells were then transplanted by intraarticular injection into the knee joints of rabbits, where they efficiently colonized the synovium. Assay of joint lavages confirmed the in vivo expression of biologically active human IRAP. With allografted cells, IRAP expression was lost by 12 days after transfer. In contrast, autografted synoviocytes continued to express IRAP for approximately 5 weeks. Knee joints expressing human IRAP were protected from the leukocytosis that otherwise follows the intraarticular injection of recombinant human interleukin 1 beta. Thus, we report the intraarticular expression and activity of a potentially therapeutic protein by gene-transfer technology; these experiments demonstrate the feasibility of treating arthritis and other joint disorders with gene therapy. Images Fig. 1 Fig. 2 PMID:8248169

  17. Gene expression responses of paper birch to elevated O3 and CO2 during leaf maturation and senescence

    NASA Astrophysics Data System (ADS)

    Kontunen-Soppela, S.; Parviainen, J.; Ruhanen, H.; Brosché, M.; Keinanen, M.; Thakur, R. C.; Kolehmainen, M.; Kangasjarvi, J.; Oksanen, E.; Karnosky, D. F.; Vapaavuori, E.

    2009-12-01

    Forest trees are exposed to increasing concentrations of O3 and CO2 simultaneously. The rise of concentration in these gases causes changes in the gene expression of trees, which can be small in acclimated trees, but yet pivotal for the metabolism of the trees. We have studied the response of paper birch (Betula papyrifera) leaf gene expression to elevated O3 and CO2 concentrations during leaf maturation and senescence. The hypotheses were:(1) Elevated O3 induces oxidative stress in leaves. During long O3-exposure repair mechanisms are activated. Because chemical defense requires energy and carbon uptake is reduced, leaf senescence is activated earlier. Alternatively, the senescence-associated processes, remobilization and storage of carbohydrates and nutrients, may not be completed. (2) In the combination of elevated CO2+O3, the O3-caused damages are not seen or they are smaller, due to closure of the stomata under elevated CO2 and decreased O3 uptake by the leaves. On the other hand, elevated CO2 may provide energy and increase defense chemicals, enabling leaves to repair the O3-caused damages. Gene expression responses of paper birch leaves to elevated O3 and CO2 were studied with microarray analyses. Samples were collected from the long-term O3 and CO2 fumigation experiment Aspen FACE in Rhinelander, WI, USA (http://aspenface.mtu.edu/). The site contains 12 FACE rings receiving CO2, O3, CO2+O3, and ambient air (controls). Birches have been exposed to elevated CO2 (550ppm) and O3 (1.5X ambient) since 1998. Leaf samples were collected in July, August and September 2004. The cDNA-microarrays used for hybridizations consisted of Populus euphratica ESTs representing ca 6500 different genes. In order to detect similar gene expression patterns within samplings and treatments, the microarray data was analyzed with multivariate methods; clustering with Self-Organizing Map, finding optimal cluster grouping by K-means clustering and visualizing the results with Sammon's mapping. Most of the alterations in the gene expression in comparison to ambient rings were caused by O3, alone and in combination with elevated CO2. O3 reduced photosynthesis and carbon assimilation and induced defense to oxidative stress resulting in earlier leaf senescence. Transport and proteolysis gene expressions were activated, indicating that at least some remobilization of nutrients for storage was completed. The combined CO2+O3 treatment resembled the O3 treatment, indicating that elevated CO2 is not able to totally alleviate the harmful effects of elevated O3. Some specific gene expression changes in the combined O3+CO2 treatment showed that experiments with O3 or CO2-exposure alone are not sufficient to predict plant responses to these gases together, and that field experiments with multiple variables are essential in order to understand responses to future environmental conditions.

  18. Dynamics of Immune System Gene Expression upon Bacterial Challenge and Wounding in a Social Insect (Bombus terrestris)

    PubMed Central

    Erler, Silvio; Popp, Mario; Lattorff, H. Michael G.

    2011-01-01

    The innate immune system which helps individuals to combat pathogens comprises a set of genes representing four immune system pathways (Toll, Imd, JNK and JAK/STAT). There is a lack of immune genes in social insects (e.g. honeybees) when compared to Diptera. Potentially, this might be compensated by an advanced system of social immunity (synergistic action of several individuals). The bumble bee, Bombus terrestris, is a primitively eusocial species with an annual life cycle and colonies headed by a single queen. We used this key pollinator to study the temporal dynamics of immune system gene expression in response to wounding and bacterial challenge. Antimicrobial peptides (AMP) (abaecin, defensin 1, hymenoptaecin) were strongly up-regulated by wounding and bacterial challenge, the latter showing a higher impact on the gene expression level. Sterile wounding down-regulated TEP A, an effector gene of the JAK/STAT pathway, and bacterial infection influenced genes of the Imd (relish) and JNK pathway (basket). Relish was up-regulated within the first hour after bacterial challenge, but decreased strongly afterwards. AMP expression following wounding and bacterial challenge correlates with the expression pattern of relish whereas correlated expression with dorsal was absent. Although expression of AMPs was high, continuous bacterial growth was observed throughout the experiment. Here we demonstrate for the first time the temporal dynamics of immune system gene expression in a social insect. Wounding and bacterial challenge affected the innate immune system significantly. Induction of AMP expression due to wounding might comprise a pre-adaptation to accompanying bacterial infections. Compared with solitary species this social insect exhibits reduced immune system efficiency, as bacterial growth could not be inhibited. A negative feedback loop regulating the Imd-pathway is suggested. AMPs, the end product of the Imd-pathway, inhibited the up-regulation of the transcription factor relish, which is necessary for effector gene expression. PMID:21479237

  19. In situ hybridization analysis of the expression of futsch, tau, and MESK2 homologues in the brain of the European honeybee (Apis mellifera L.).

    PubMed

    Kaneko, Kumi; Hori, Sayaka; Morimoto, Mai M; Nakaoka, Takayoshi; Paul, Rajib Kumar; Fujiyuki, Tomoko; Shirai, Kenichi; Wakamoto, Akiko; Tsuboko, Satomi; Takeuchi, Hideaki; Kubo, Takeo

    2010-02-16

    The importance of visual sense in Hymenopteran social behavior is suggested by the existence of a Hymenopteran insect-specific neural circuit related to visual processing and the fact that worker honeybee brain changes morphologically according to its foraging experience. To analyze molecular and neural bases that underlie the visual abilities of the honeybees, we used a cDNA microarray to search for gene(s) expressed in a neural cell-type preferential manner in a visual center of the honeybee brain, the optic lobes (OLs). Expression analysis of candidate genes using in situ hybridization revealed two genes expressed in a neural cell-type preferential manner in the OLs. One is a homologue of Drosophila futsch, which encodes a microtubule-associated protein and is preferentially expressed in the monopolar cells in the lamina of the OLs. The gene for another microtubule-associated protein, tau, which functionally overlaps with futsch, was also preferentially expressed in the monopolar cells, strongly suggesting the functional importance of these two microtubule-associated proteins in monopolar cells. The other gene encoded a homologue of Misexpression Suppressor of Dominant-negative Kinase Suppressor of Ras 2 (MESK2), which might activate Ras/MAPK-signaling in Drosophila. MESK2 was expressed preferentially in a subclass of neurons located in the ventral region between the lamina and medulla neuropil in the OLs, suggesting that this subclass is a novel OL neuron type characterized by MESK2-expression. These three genes exhibited similar expression patterns in the worker, drone, and queen brains, suggesting that they function similarly irrespective of the honeybee sex or caste. Here we identified genes that are expressed in a monopolar cell (Amfutsch and Amtau) or ventral medulla-preferential manner (AmMESK2) in insect OLs. These genes may aid in visualizing neurites of monopolar cells and ventral medulla cells, as well as in analyzing the function of these neurons.

  20. Gene coexpression measures in large heterogeneous samples using count statistics.

    PubMed

    Wang, Y X Rachel; Waterman, Michael S; Huang, Haiyan

    2014-11-18

    With the advent of high-throughput technologies making large-scale gene expression data readily available, developing appropriate computational tools to process these data and distill insights into systems biology has been an important part of the "big data" challenge. Gene coexpression is one of the earliest techniques developed that is still widely in use for functional annotation, pathway analysis, and, most importantly, the reconstruction of gene regulatory networks, based on gene expression data. However, most coexpression measures do not specifically account for local features in expression profiles. For example, it is very likely that the patterns of gene association may change or only exist in a subset of the samples, especially when the samples are pooled from a range of experiments. We propose two new gene coexpression statistics based on counting local patterns of gene expression ranks to take into account the potentially diverse nature of gene interactions. In particular, one of our statistics is designed for time-course data with local dependence structures, such as time series coupled over a subregion of the time domain. We provide asymptotic analysis of their distributions and power, and evaluate their performance against a wide range of existing coexpression measures on simulated and real data. Our new statistics are fast to compute, robust against outliers, and show comparable and often better general performance.

  1. A Novel Tightly Regulated Gene Expression System for the Human Intestinal Symbiont Bacteroides thetaiotaomicron

    PubMed Central

    Horn, Nikki; Carvalho, Ana L.; Overweg, Karin; Wegmann, Udo; Carding, Simon R.; Stentz, Régis

    2016-01-01

    There is considerable interest in studying the function of Bacteroides species resident in the human gastrointestinal (GI)-tract and the contribution they make to host health. Reverse genetics and protein expression techniques, such as those developed for well-characterized Escherichia coli cannot be applied to Bacteroides species as they and other members of the Bacteriodetes phylum have unique promoter structures. The availability of useful Bacteroides-specific genetic tools is therefore limited. Here we describe the development of an effective mannan-controlled gene expression system for Bacteroides thetaiotaomicron containing the mannan-inducible promoter–region of an α-1,2-mannosidase gene (BT_3784), a ribosomal binding site designed to modulate expression, a multiple cloning site to facilitate the cloning of genes of interest, and a transcriptional terminator. Using the Lactobacillus pepI as a reporter gene, mannan induction resulted in an increase of reporter activity in a time- and concentration-dependent manner with a wide range of activity. The endogenous BtcepA cephalosporinase gene was used to demonstrate the suitability of this novel expression system, enabling the isolation of a His-tagged version of BtCepA. We have also shown with experiments performed in mice that the system can be induced in vivo in the presence of an exogenous source of mannan. By enabling the controlled expression of endogenous and exogenous genes in B. thetaiotaomicron this novel inducer-dependent expression system will aid in defining the physiological role of individual genes and the functional analyses of their products. PMID:27468280

  2. Transcriptome analysis of genes involved in defense against alkaline stress in roots of wild jujube (Ziziphus acidojujuba)

    PubMed Central

    Tian, Shan; Wang, Bei; Zhao, Xusheng

    2017-01-01

    Wild jujube (Ziziphus acidojujuba Mill.) is highly tolerant to alkaline, saline and drought stress; however, no studies have performed transcriptome profiling to study the response of wild jujube to these and other abiotic stresses. In this study, we examined the tolerance of wild jujube to NaHCO3-NaOH solution and analyzed gene expression profiles in response to alkaline stress. Physiological experiments revealed that H2O2 content in leaves increased significantly and root activity decreased quickly during alkaline of pH 9.5 treatment. For transcriptome analysis, wild jujube plants grown hydroponically were treated with NaHCO3-NaOH solution for 0, 1, and 12 h and six transcriptomes from roots were built. In total, 32,758 genes were generated, and 3,604 differentially expressed genes (DEGs) were identified. After 1 h, 853 genes showed significantly different expression between control and treated plants; after 12 h, expression of 2,856 genes was significantly different. The expression pattern of nine genes was validated by quantitative real-time PCR. After gene annotation and gene ontology enrichment analysis, the genes encoding transcriptional factors, serine/threonine-protein kinases, heat shock proteins, cysteine-like kinases, calmodulin-like proteins, and reactive oxygen species (ROS) scavengers were found to be closely involved in alkaline stress response. These results will provide useful insights for elucidating the mechanisms underlying alkaline tolerance in wild jujube. PMID:28976994

  3. Fibromodulin modulates myoblast differentiation by controlling calcium channel.

    PubMed

    Lee, Eun Ju; Nam, Joo Hyun; Choi, Inho

    2018-06-16

    Fibromodulin (FMOD) is a proteoglycan present in extracellular matrix (ECM). Based on our previous findings that FMOD controls myoblast differentiation by regulating the gene expressions of collagen type I alpha 1 (COL1α1) and integral membrane protein 2 A (Itm2a), we undertook this study to investigate relationships between FMOD and calcium channels and to understand further the mechanism by which they control myoblast differentiation. Gene expression studies and luciferase reporter assays showed FMOD affected calcium channel gene expressions by regulating calcium channel gene promoter, and patch-clamp experiments showed both L- and T-type calcium channel currents were almost undetectable in FMOD knocked down cells. In addition, gene knock-down studies demonstrated the COL1α1 and Itm2a genes both regulate the expressions of calcium channel genes. Studies using a cardiotoxin-induced mouse muscle injury model demonstrated calcium channels play important roles in the regeneration of muscle tissue, possibly by promoting the differentiation of muscle stem cells (MSCs). Summarizing, the study demonstrates ECM components secreted by myoblasts during differentiation provide an essential environment for muscle differentiation and regeneration. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. BASiCS: Bayesian Analysis of Single-Cell Sequencing Data

    PubMed Central

    Vallejos, Catalina A.; Marioni, John C.; Richardson, Sylvia

    2015-01-01

    Single-cell mRNA sequencing can uncover novel cell-to-cell heterogeneity in gene expression levels in seemingly homogeneous populations of cells. However, these experiments are prone to high levels of unexplained technical noise, creating new challenges for identifying genes that show genuine heterogeneous expression within the population of cells under study. BASiCS (Bayesian Analysis of Single-Cell Sequencing data) is an integrated Bayesian hierarchical model where: (i) cell-specific normalisation constants are estimated as part of the model parameters, (ii) technical variability is quantified based on spike-in genes that are artificially introduced to each analysed cell’s lysate and (iii) the total variability of the expression counts is decomposed into technical and biological components. BASiCS also provides an intuitive detection criterion for highly (or lowly) variable genes within the population of cells under study. This is formalised by means of tail posterior probabilities associated to high (or low) biological cell-to-cell variance contributions, quantities that can be easily interpreted by users. We demonstrate our method using gene expression measurements from mouse Embryonic Stem Cells. Cross-validation and meaningful enrichment of gene ontology categories within genes classified as highly (or lowly) variable supports the efficacy of our approach. PMID:26107944

  5. BASiCS: Bayesian Analysis of Single-Cell Sequencing Data.

    PubMed

    Vallejos, Catalina A; Marioni, John C; Richardson, Sylvia

    2015-06-01

    Single-cell mRNA sequencing can uncover novel cell-to-cell heterogeneity in gene expression levels in seemingly homogeneous populations of cells. However, these experiments are prone to high levels of unexplained technical noise, creating new challenges for identifying genes that show genuine heterogeneous expression within the population of cells under study. BASiCS (Bayesian Analysis of Single-Cell Sequencing data) is an integrated Bayesian hierarchical model where: (i) cell-specific normalisation constants are estimated as part of the model parameters, (ii) technical variability is quantified based on spike-in genes that are artificially introduced to each analysed cell's lysate and (iii) the total variability of the expression counts is decomposed into technical and biological components. BASiCS also provides an intuitive detection criterion for highly (or lowly) variable genes within the population of cells under study. This is formalised by means of tail posterior probabilities associated to high (or low) biological cell-to-cell variance contributions, quantities that can be easily interpreted by users. We demonstrate our method using gene expression measurements from mouse Embryonic Stem Cells. Cross-validation and meaningful enrichment of gene ontology categories within genes classified as highly (or lowly) variable supports the efficacy of our approach.

  6. Quantifying the contribution of chromatin dynamics to stochastic gene expression reveals long, locus-dependent periods between transcriptional bursts.

    PubMed

    Viñuelas, José; Kaneko, Gaël; Coulon, Antoine; Vallin, Elodie; Morin, Valérie; Mejia-Pous, Camila; Kupiec, Jean-Jacques; Beslon, Guillaume; Gandrillon, Olivier

    2013-02-25

    A number of studies have established that stochasticity in gene expression may play an important role in many biological phenomena. This therefore calls for further investigations to identify the molecular mechanisms at stake, in order to understand and manipulate cell-to-cell variability. In this work, we explored the role played by chromatin dynamics in the regulation of stochastic gene expression in higher eukaryotic cells. For this purpose, we generated isogenic chicken-cell populations expressing a fluorescent reporter integrated in one copy per clone. Although the clones differed only in the genetic locus at which the reporter was inserted, they showed markedly different fluorescence distributions, revealing different levels of stochastic gene expression. Use of chromatin-modifying agents showed that direct manipulation of chromatin dynamics had a marked effect on the extent of stochastic gene expression. To better understand the molecular mechanism involved in these phenomena, we fitted these data to a two-state model describing the opening/closing process of the chromatin. We found that the differences between clones seemed to be due mainly to the duration of the closed state, and that the agents we used mainly seem to act on the opening probability. In this study, we report biological experiments combined with computational modeling, highlighting the importance of chromatin dynamics in stochastic gene expression. This work sheds a new light on the mechanisms of gene expression in higher eukaryotic cells, and argues in favor of relatively slow dynamics with long (hours to days) periods of quiet state.

  7. Quantifying whole transcriptome size, a prerequisite for understanding transcriptome evolution across species: an example from a plant allopolyploid.

    PubMed

    Coate, Jeremy E; Doyle, Jeff J

    2010-01-01

    Evolutionary biologists are increasingly comparing gene expression patterns across species. Due to the way in which expression assays are normalized, such studies provide no direct information about expression per gene copy (dosage responses) or per cell and can give a misleading picture of genes that are differentially expressed. We describe an assay for estimating relative expression per cell. When used in conjunction with transcript profiling data, it is possible to compare the sizes of whole transcriptomes, which in turn makes it possible to compare expression per cell for each gene in the transcript profiling data set. We applied this approach, using quantitative reverse transcriptase-polymerase chain reaction and high throughput RNA sequencing, to a recently formed allopolyploid and showed that its leaf transcriptome was approximately 1.4-fold larger than either progenitor transcriptome (70% of the sum of the progenitor transcriptomes). In contrast, the allopolyploid genome is 94.3% as large as the sum of its progenitor genomes and retains > or =93.5% of the sum of its progenitor gene complements. Thus, "transcriptome downsizing" is greater than genome downsizing. Using this transcriptome size estimate, we inferred dosage responses for several thousand genes and showed that the majority exhibit partial dosage compensation. Homoeologue silencing is nonrandomly distributed across dosage responses, with genes showing extreme responses in either direction significantly more likely to have a silent homoeologue. This experimental approach will add value to transcript profiling experiments involving interspecies and interploidy comparisons by converting expression per transcriptome to expression per genome, eliminating the need for assumptions about transcriptome size.

  8. Re-analysis of RNA-seq transcriptome data reveals new aspects of gene activity in Arabidopsis root hairs

    PubMed Central

    Li, Wenfeng; Lan, Ping

    2015-01-01

    Root hairs, tubular-shaped outgrowths from root epidermal cells, play important roles in the acquisition of nutrients and water, interaction with microbe, and in plant anchorage. As a specialized cell type, root hairs, especially in Arabidopsis, provide a pragmatic research system for various aspects of studies. Here, we re-analyzed the RNA-seq transcriptome profile of Arabidopsis root hair cells by Tophat software and used Cufflinks program to mine the differentially expressed genes. Results showed that ERD14, RIN4, AT5G64401 were among the most abundant genes in the root hair cells; while ATGSTU2, AT5G54940, AT4G30530 were highly expressed in non-root hair tissues. In total, 5409 genes, with a fold change greater than two-fold (FDR adjusted P < 0.05), showed differential expression between root hair cells and non-root hair tissues. Of which, 61 were expressed only in root hair cells. One hundred and thirty-six out of 5409 genes have been reported to be “core” root epidermal genes, which could be grouped into nine clusters according to expression patterns. Gene ontology (GO) analysis of the 5409 genes showed that processes of “response to salt stress,” “ribosome biogenesis,” “protein phosphorylation,” and “response to water deprivation” were enriched. Whereas only process of “intracellular signal transduction” was enriched in the subset of 61 genes expressed only in the root hair cells. One hundred and twenty-one unannotated transcripts were identified and 14 of which were shown to be differentially expressed between root hair cells and non-root hair tissues, with transcripts XLOC_000763, XLOC_031361, and XLOC_005665 being highly expressed in the root hair cells. The comprehensive transcriptomic analysis provides new information on root hair gene activity and sets the stage for follow-up experiments to certify the biological functions of the newly identified genes and novel transcripts in root hair cell morphogenesis. PMID:26106402

  9. Gene expression profile in cardiovascular disease and preeclampsia: a meta-analysis of the transcriptome based on raw data from human studies deposited in Gene Expression Omnibus.

    PubMed

    Sitras, V; Fenton, C; Acharya, G

    2015-02-01

    Cardiovascular disease (CVD) and preeclampsia (PE) share common clinical features. We aimed to identify common transcriptomic signatures involved in CVD and PE in humans. Meta-analysis of individual raw microarray data deposited in GEO, obtained from blood samples of patients with CVD versus controls and placental samples from women with PE versus healthy women with uncomplicated pregnancies. Annotation of cases versus control samples was taken directly from the microarray documentation. Genes that showed a significant differential expression in the majority of experiments were selected for subsequent analysis. Hypergeometric gene list analysis was performed using Bioconductor GOstats package. Bioinformatic analysis was performed in PANTHER. Seven studies in CVD and 5 studies in PE were eligible for meta-analysis. A total of 181 genes were found to be differentially expressed in microarray studies investigating gene expression in blood samples obtained from patients with CVD compared to controls and 925 genes were differentially expressed between preeclamptic and healthy placentas. Among these differentially expressed genes, 22 were common between CVD and PE. Bioinformatic analysis of these genes revealed oxidative stress, p-53 pathway feedback, inflammation mediated by chemokines and cytokines, interleukin signaling, B-cell activation, PDGF signaling, Wnt signaling, integrin signaling and Alzheimer disease pathways to be involved in the pathophysiology of both CVD and PE. Metabolism, development, response to stimulus, immune response and cell communication were the associated biologic processes in both conditions. Gene set enrichment analysis showed the following overlapping pathways between CVD and PE: TGF-β-signaling, apoptosis, graft-versus-host disease, allograft rejection, chemokine signaling, steroid hormone synthesis, type I and II diabetes mellitus, VEGF signaling, pathways in cancer, GNRH signaling, Huntingtons disease and Notch signaling. CVD and PE share same common traits in their gene expression profile indicating common pathways in their pathophysiology. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. DFP: a Bioconductor package for fuzzy profile identification and gene reduction of microarray data

    PubMed Central

    Glez-Peña, Daniel; Álvarez, Rodrigo; Díaz, Fernando; Fdez-Riverola, Florentino

    2009-01-01

    Background Expression profiling assays done by using DNA microarray technology generate enormous data sets that are not amenable to simple analysis. The greatest challenge in maximizing the use of this huge amount of data is to develop algorithms to interpret and interconnect results from different genes under different conditions. In this context, fuzzy logic can provide a systematic and unbiased way to both (i) find biologically significant insights relating to meaningful genes, thereby removing the need for expert knowledge in preliminary steps of microarray data analyses and (ii) reduce the cost and complexity of later applied machine learning techniques being able to achieve interpretable models. Results DFP is a new Bioconductor R package that implements a method for discretizing and selecting differentially expressed genes based on the application of fuzzy logic. DFP takes advantage of fuzzy membership functions to assign linguistic labels to gene expression levels. The technique builds a reduced set of relevant genes (FP, Fuzzy Pattern) able to summarize and represent each underlying class (pathology). A last step constructs a biased set of genes (DFP, Discriminant Fuzzy Pattern) by intersecting existing fuzzy patterns in order to detect discriminative elements. In addition, the software provides new functions and visualisation tools that summarize achieved results and aid in the interpretation of differentially expressed genes from multiple microarray experiments. Conclusion DFP integrates with other packages of the Bioconductor project, uses common data structures and is accompanied by ample documentation. It has the advantage that its parameters are highly configurable, facilitating the discovery of biologically relevant connections between sets of genes belonging to different pathologies. This information makes it possible to automatically filter irrelevant genes thereby reducing the large volume of data supplied by microarray experiments. Based on these contributions GENECBR, a successful tool for cancer diagnosis using microarray datasets, has recently been released. PMID:19178723

  11. Discovery of Possible Gene Relationships through the Application of Self-Organizing Maps to DNA Microarray Databases

    PubMed Central

    Chavez-Alvarez, Rocio; Chavoya, Arturo; Mendez-Vazquez, Andres

    2014-01-01

    DNA microarrays and cell cycle synchronization experiments have made possible the study of the mechanisms of cell cycle regulation of Saccharomyces cerevisiae by simultaneously monitoring the expression levels of thousands of genes at specific time points. On the other hand, pattern recognition techniques can contribute to the analysis of such massive measurements, providing a model of gene expression level evolution through the cell cycle process. In this paper, we propose the use of one of such techniques –an unsupervised artificial neural network called a Self-Organizing Map (SOM)–which has been successfully applied to processes involving very noisy signals, classifying and organizing them, and assisting in the discovery of behavior patterns without requiring prior knowledge about the process under analysis. As a test bed for the use of SOMs in finding possible relationships among genes and their possible contribution in some biological processes, we selected 282 S. cerevisiae genes that have been shown through biological experiments to have an activity during the cell cycle. The expression level of these genes was analyzed in five of the most cited time series DNA microarray databases used in the study of the cell cycle of this organism. With the use of SOM, it was possible to find clusters of genes with similar behavior in the five databases along two cell cycles. This result suggested that some of these genes might be biologically related or might have a regulatory relationship, as was corroborated by comparing some of the clusters obtained with SOMs against a previously reported regulatory network that was generated using biological knowledge, such as protein-protein interactions, gene expression levels, metabolism dynamics, promoter binding, and modification, regulation and transport of proteins. The methodology described in this paper could be applied to the study of gene relationships of other biological processes in different organisms. PMID:24699245

  12. DFP: a Bioconductor package for fuzzy profile identification and gene reduction of microarray data.

    PubMed

    Glez-Peña, Daniel; Alvarez, Rodrigo; Díaz, Fernando; Fdez-Riverola, Florentino

    2009-01-29

    Expression profiling assays done by using DNA microarray technology generate enormous data sets that are not amenable to simple analysis. The greatest challenge in maximizing the use of this huge amount of data is to develop algorithms to interpret and interconnect results from different genes under different conditions. In this context, fuzzy logic can provide a systematic and unbiased way to both (i) find biologically significant insights relating to meaningful genes, thereby removing the need for expert knowledge in preliminary steps of microarray data analyses and (ii) reduce the cost and complexity of later applied machine learning techniques being able to achieve interpretable models. DFP is a new Bioconductor R package that implements a method for discretizing and selecting differentially expressed genes based on the application of fuzzy logic. DFP takes advantage of fuzzy membership functions to assign linguistic labels to gene expression levels. The technique builds a reduced set of relevant genes (FP, Fuzzy Pattern) able to summarize and represent each underlying class (pathology). A last step constructs a biased set of genes (DFP, Discriminant Fuzzy Pattern) by intersecting existing fuzzy patterns in order to detect discriminative elements. In addition, the software provides new functions and visualisation tools that summarize achieved results and aid in the interpretation of differentially expressed genes from multiple microarray experiments. DFP integrates with other packages of the Bioconductor project, uses common data structures and is accompanied by ample documentation. It has the advantage that its parameters are highly configurable, facilitating the discovery of biologically relevant connections between sets of genes belonging to different pathologies. This information makes it possible to automatically filter irrelevant genes thereby reducing the large volume of data supplied by microarray experiments. Based on these contributions GENECBR, a successful tool for cancer diagnosis using microarray datasets, has recently been released.

  13. Validation of Reference Genes for Robust qRT-PCR Gene Expression Analysis in the Rice Blast Fungus Magnaporthe oryzae.

    PubMed

    Che Omar, Sarena; Bentley, Michael A; Morieri, Giulia; Preston, Gail M; Gurr, Sarah J

    2016-01-01

    The rice blast fungus causes significant annual harvest losses. It also serves as a genetically-tractable model to study fungal ingress. Whilst pathogenicity determinants have been unmasked and changes in global gene expression described, we know little about Magnaporthe oryzae cell wall remodelling. Our interests, in wall remodelling genes expressed during infection, vegetative growth and under exogenous wall stress, demand robust choice of reference genes for quantitative Real Time-PCR (qRT-PCR) data normalisation. We describe the expression stability of nine candidate reference genes profiled by qRT-PCR with cDNAs derived during asexual germling development, from sexual stage perithecia and from vegetative mycelium grown under various exogenous stressors. Our Minimum Information for Publication of qRT-PCR Experiments (MIQE) compliant analysis reveals a set of robust reference genes used to track changes in the expression of the cell wall remodelling gene MGG_Crh2 (MGG_00592). We ranked nine candidate reference genes by their expression stability (M) and report the best gene combination needed for reliable gene expression normalisation, when assayed in three tissue groups (Infective, Vegetative, and Global) frequently used in M. oryzae expression studies. We found that MGG_Actin (MGG_03982) and the 40S 27a ribosomal subunit MGG_40s (MGG_02872) proved to be robust reference genes for the Infection group and MGG_40s and MGG_Ef1 (Elongation Factor1-α) for both Vegetative and Global groups. Using the above validated reference genes, M. oryzae MGG_Crh2 expression was found to be significantly (p<0.05) elevated three-fold during vegetative growth as compared with dormant spores and two fold higher under cell wall stress (Congo Red) compared to growth under optimal conditions. We recommend the combinatorial use of two reference genes, belonging to the cytoskeleton and ribosomal synthesis functional groups, MGG_Actin, MGG_40s, MGG_S8 (Ribosomal subunit 40S S8) or MGG_Ef1, which demonstrated low M values across heterogeneous tissues. By contrast, metabolic pathway genes MGG_Fad (FAD binding domain-containing protein) and MGG_Gapdh (Glyceraldehyde-3-phosphate dehydrogenase) performed poorly, due to their lack of expression stability across samples.

  14. Comprehensive RNA-Seq Expression Analysis of Sensory Ganglia with a Focus on Ion Channels and GPCRs in Trigeminal Ganglia

    PubMed Central

    Manteniotis, Stavros; Lehmann, Ramona; Flegel, Caroline; Vogel, Felix; Hofreuter, Adrian; Schreiner, Benjamin S. P.; Altmüller, Janine; Becker, Christian; Schöbel, Nicole; Hatt, Hanns; Gisselmann, Günter

    2013-01-01

    The specific functions of sensory systems depend on the tissue-specific expression of genes that code for molecular sensor proteins that are necessary for stimulus detection and membrane signaling. Using the Next Generation Sequencing technique (RNA-Seq), we analyzed the complete transcriptome of the trigeminal ganglia (TG) and dorsal root ganglia (DRG) of adult mice. Focusing on genes with an expression level higher than 1 FPKM (fragments per kilobase of transcript per million mapped reads), we detected the expression of 12984 genes in the TG and 13195 in the DRG. To analyze the specific gene expression patterns of the peripheral neuronal tissues, we compared their gene expression profiles with that of the liver, brain, olfactory epithelium, and skeletal muscle. The transcriptome data of the TG and DRG were scanned for virtually all known G-protein-coupled receptors (GPCRs) as well as for ion channels. The expression profile was ranked with regard to the level and specificity for the TG. In total, we detected 106 non-olfactory GPCRs and 33 ion channels that had not been previously described as expressed in the TG. To validate the RNA-Seq data, in situ hybridization experiments were performed for several of the newly detected transcripts. To identify differences in expression profiles between the sensory ganglia, the RNA-Seq data of the TG and DRG were compared. Among the differentially expressed genes (> 1 FPKM), 65 and 117 were expressed at least 10-fold higher in the TG and DRG, respectively. Our transcriptome analysis allows a comprehensive overview of all ion channels and G protein-coupled receptors that are expressed in trigeminal ganglia and provides additional approaches for the investigation of trigeminal sensing as well as for the physiological and pathophysiological mechanisms of pain. PMID:24260241

  15. Tumour necrosis factor α (TNF)–TNF receptor 1-inducible cytoprotective proteins in the mouse liver: relevance of suppressors of cytokine signalling

    PubMed Central

    Sass, Gabriele; Shembade, Noula D.; Tiegs, Gisa

    2004-01-01

    TNF (tumour necrosis factor α) induces tolerance towards itself in experimental liver injury. Tolerance induction has been shown to be dependent on TNFR1 (TNF receptor 1) signalling, but mechanisms and mediators of TNF-induced hepatic tolerance are unknown. We investigated the TNF-inducible gene-expression profile in livers of TNFR2−/− mice, using cDNA array technology. We found that, out of 793 investigated genes involved in inflammation, cell cycle and signal transduction, 282 were expressed in the mouse liver in response to TNF via TNFR1. Among those, expression of 78 genes was induced, while expression of 60 genes was reduced. We investigated further the cellular expression of the 27 most prominently induced genes, and found that 20 of these genes were up-regulated directly in parenchymal liver cells, representing potentially protective proteins and possible mediators of TNF tolerance. In vitro experiments revealed that overexpression of SOCS1 (silencer of cytokine signalling 1), a member of the SOCS family of proteins, as well as of HO-1 (haem oxygenase-1), but not of SOCS2 or SOCS3, protected isolated primary mouse hepatocytes from TNF-induced apoptosis. The identification of protective genes in hepatocytes is the prerequisite for future development of gene therapies for immune-mediated liver diseases. PMID:15554901

  16. GEM2Net: from gene expression modeling to -omics networks, a new CATdb module to investigate Arabidopsis thaliana genes involved in stress response.

    PubMed

    Zaag, Rim; Tamby, Jean Philippe; Guichard, Cécile; Tariq, Zakia; Rigaill, Guillem; Delannoy, Etienne; Renou, Jean-Pierre; Balzergue, Sandrine; Mary-Huard, Tristan; Aubourg, Sébastien; Martin-Magniette, Marie-Laure; Brunaud, Véronique

    2015-01-01

    CATdb (http://urgv.evry.inra.fr/CATdb) is a database providing a public access to a large collection of transcriptomic data, mainly for Arabidopsis but also for other plants. This resource has the rare advantage to contain several thousands of microarray experiments obtained with the same technical protocol and analyzed by the same statistical pipelines. In this paper, we present GEM2Net, a new module of CATdb that takes advantage of this homogeneous dataset to mine co-expression units and decipher Arabidopsis gene functions. GEM2Net explores 387 stress conditions organized into 18 biotic and abiotic stress categories. For each one, a model-based clustering is applied on expression differences to identify clusters of co-expressed genes. To characterize functions associated with these clusters, various resources are analyzed and integrated: Gene Ontology, subcellular localization of proteins, Hormone Families, Transcription Factor Families and a refined stress-related gene list associated to publications. Exploiting protein-protein interactions and transcription factors-targets interactions enables to display gene networks. GEM2Net presents the analysis of the 18 stress categories, in which 17,264 genes are involved and organized within 681 co-expression clusters. The meta-data analyses were stored and organized to compose a dynamic Web resource. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Mutual regulatory interactions of the trunk gap genes during blastoderm patterning in the hemipteran Oncopeltus fasciatus.

    PubMed

    Ben-David, Jonathan; Chipman, Ariel D

    2010-10-01

    The early embryo of the milkweed bug, Oncopeltus fasciatus, appears as a single cell layer - the embryonic blastoderm - covering the entire egg. It is at this blastoderm stage that morphological domains are first determined, long before the appearance of overt segmentation. Central to the process of patterning the blastoderm into distinct domains are a group of transcription factors known as gap genes. In Drosophila melanogaster these genes form a network of interactions, and maintain sharp expression boundaries through strong mutual repression. Their restricted expression domains define specific areas along the entire body. We have studied the expression domains of the four trunk gap gene homologues in O. fasciatus and have determined their interactions through dsRNA gene knockdown experiments, followed by expression analyses. While the blastoderm in O. fasciatus includes only the first six segments of the embryo, the expression domains of the gap genes within these segments are broadly similar to those in Drosophila where the blastoderm includes all 15 segments. However, the interactions between the gap genes are surprisingly different from those in Drosophila, and mutual repression between the genes seems to play a much less significant role. This suggests that the well-studied interaction pattern in Drosophila is evolutionarily derived, and has evolved from a less strongly interacting network. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Why chloroplasts and mitochondria retain their own genomes and genetic systems: Colocation for redox regulation of gene expression

    PubMed Central

    Allen, John F.

    2015-01-01

    Chloroplasts and mitochondria are subcellular bioenergetic organelles with their own genomes and genetic systems. DNA replication and transmission to daughter organelles produces cytoplasmic inheritance of characters associated with primary events in photosynthesis and respiration. The prokaryotic ancestors of chloroplasts and mitochondria were endosymbionts whose genes became copied to the genomes of their cellular hosts. These copies gave rise to nuclear chromosomal genes that encode cytosolic proteins and precursor proteins that are synthesized in the cytosol for import into the organelle into which the endosymbiont evolved. What accounts for the retention of genes for the complete synthesis within chloroplasts and mitochondria of a tiny minority of their protein subunits? One hypothesis is that expression of genes for protein subunits of energy-transducing enzymes must respond to physical environmental change by means of a direct and unconditional regulatory control—control exerted by change in the redox state of the corresponding gene product. This hypothesis proposes that, to preserve function, an entire redox regulatory system has to be retained within its original membrane-bound compartment. Colocation of gene and gene product for redox regulation of gene expression (CoRR) is a hypothesis in agreement with the results of a variety of experiments designed to test it and which seem to have no other satisfactory explanation. Here, I review evidence relating to CoRR and discuss its development, conclusions, and implications. This overview also identifies predictions concerning the results of experiments that may yet prove the hypothesis to be incorrect. PMID:26286985

  19. Identification of Mouse Serum miRNA Endogenous References by Global Gene Expression Profiles

    PubMed Central

    Mi, Qing-Sheng; Weiland, Matthew; Qi, Rui-Qun; Gao, Xing-Hua; Poisson, Laila M.; Zhou, Li

    2012-01-01

    MicroRNAs (miRNAs) are recently discovered small non-coding RNAs and can serve as serum biomarkers for disease diagnosis and prognoses. Lack of reliable serum miRNA endogenous references for normalization in miRNA gene expression makes single miRNA assays inaccurate. Using TaqMan® real-time PCR miRNA arrays with a global gene expression normalization strategy, we have analyzed serum miRNA expression profiles of 20 female mice of NOD/ShiLtJ (n = 8), NOR/LtJ (n = 6), and C57BL/6J (n = 6) at different ages and disease conditions. We identified five miRNAs, miR-146a, miR-16, miR-195, miR-30e and miR-744, to be stably expressed in all strains, which could serve as mouse serum miRNA endogenous references for single assay experiments. PMID:22348064

  20. Stability of gene expression in human T cells in different gravity environments is clustered in chromosomal region 11p15.4.

    PubMed

    Thiel, Cora S; Huge, Andreas; Hauschild, Swantje; Tauber, Svantje; Lauber, Beatrice A; Polzer, Jennifer; Paulsen, Katrin; Lier, Hartwin; Engelmann, Frank; Schmitz, Burkhard; Schütte, Andreas; Layer, Liliana E; Ullrich, Oliver

    2017-01-01

    In the last decades, a plethora of in vitro studies with living human cells contributed a vast amount of knowledge about cellular and molecular effects of microgravity. Previous studies focused mostly on the identification of gravity-responsive genes, whereas a multi-platform analysis at an integrative level, which specifically evaluates the extent and robustness of transcriptional response to an altered gravity environment was not performed so far. Therefore, we investigated the stability of gene expression response in non-activated human Jurkat T lymphocytic cells in different gravity environments through the combination of parabolic flights with a suborbital ballistic rocket and 2D clinostat and centrifuge experiments, using strict controls for excluding all possible other factors of influence. We revealed an overall high stability of gene expression in microgravity and identified olfactory gene expression in the chromosomal region 11p15.4 as particularly robust to altered gravity. We identified that classical reference genes ABCA5 , GAPDH , HPRT1 , PLA2G4A , and RPL13A were stably expressed in all tested gravity conditions and platforms, while ABCA5 and GAPDH were also known to be stably expressed in U937 cells in all gravity conditions. In summary, 10-20% of all transcripts remained totally unchanged in any gravitational environment tested (between 10 -4 and 9 g), 20-40% remained unchanged in microgravity (between 10 -4 and 10 -2  g) and 97-99% were not significantly altered in microgravity if strict exclusion criteria were applied. Therefore, we suppose a high stability of gene expression in microgravity. Comparison with other stressors suggests that microgravity alters gene expression homeostasis not stronger than other environmental factors.

  1. Plastid-to-Nucleus Retrograde Signals Are Essential for the Expression of Nuclear Starch Biosynthesis Genes during Amyloplast Differentiation in Tobacco BY-2 Cultured Cells1[W][OA

    PubMed Central

    Enami, Kazuhiko; Ozawa, Tomoki; Motohashi, Noriko; Nakamura, Masayuki; Tanaka, Kan; Hanaoka, Mitsumasa

    2011-01-01

    Amyloplasts, a subtype of plastid, are found in nonphotosynthetic tissues responsible for starch synthesis and storage. When tobacco (Nicotiana tabacum) Bright Yellow-2 cells are cultured in the presence of cytokinin instead of auxin, their plastids differentiate from proplastids to amyloplasts. In this program, it is well known that the expression of nucleus-encoded starch biosynthesis genes, such as ADP-Glucose Pyrophosphorylase (AgpS) and Granule-Bound Starch Synthase (GBSS), is specifically induced. In this study, we investigated the roles of plastid gene expression in amyloplast differentiation. Microarray analysis of plastid genes revealed that no specific transcripts were induced in amyloplasts. Nevertheless, amyloplast development accompanied with starch biosynthesis was drastically inhibited in the presence of plastid transcription/translation inhibitors. Surprisingly, the expression of nuclear AgpS and GBSS was significantly repressed by the addition of these inhibitors, suggesting that a plastid-derived signal(s) that reflects normal plastid gene expression was essential for nuclear gene expression. A series of experiments was performed to examine the effects of intermediates and inhibitors of tetrapyrrole biosynthesis, since some of the intermediates have been characterized as candidates for plastid-to-nucleus retrograde signals. Addition of levulinic acid, an inhibitor of tetrapyrrole biosynthesis, resulted in the up-regulation of nuclear AgpS and GBSS gene expression as well as starch accumulation, while the addition of heme showed opposite effects. Thus, these results indicate that plastid transcription and/or translation are required for normal amyloplast differentiation, regulating the expression of specific nuclear genes by unknown signaling mechanisms that can be partly mediated by tetrapyrrole intermediates. PMID:21771917

  2. Exploring Plant Co-Expression and Gene-Gene Interactions with CORNET 3.0.

    PubMed

    Van Bel, Michiel; Coppens, Frederik

    2017-01-01

    Selecting and filtering a reference expression and interaction dataset when studying specific pathways and regulatory interactions can be a very time-consuming and error-prone task. In order to reduce the duplicated efforts required to amass such datasets, we have created the CORNET (CORrelation NETworks) platform which allows for easy access to a wide variety of data types: coexpression data, protein-protein interactions, regulatory interactions, and functional annotations. The CORNET platform outputs its results in either text format or through the Cytoscape framework, which is automatically launched by the CORNET website.CORNET 3.0 is the third iteration of the web platform designed for the user exploration of the coexpression space of plant genomes, with a focus on the model species Arabidopsis thaliana. Here we describe the platform: the tools, data, and best practices when using the platform. We indicate how the platform can be used to infer networks from a set of input genes, such as upregulated genes from an expression experiment. By exploring the network, new target and regulator genes can be discovered, allowing for follow-up experiments and more in-depth study. We also indicate how to avoid common pitfalls when evaluating the networks and how to avoid over interpretation of the results.All CORNET versions are available at http://bioinformatics.psb.ugent.be/cornet/ .

  3. Using gene chips to identify organ-specific, smooth muscle responses to experimental diabetes: potential applications to urological diseases.

    PubMed

    Hipp, Jason D; Davies, Kelvin P; Tar, Moses; Valcic, Mira; Knoll, Abraham; Melman, Arnold; Christ, George J

    2007-02-01

    To identify early diabetes-related alterations in gene expression in bladder and erectile tissue that would provide novel diagnostic and therapeutic treatment targets to prevent, delay or ameliorate the ensuing bladder and erectile dysfunction. The RG-U34A rat GeneChip (Affymetrix Inc., Sunnyvale, CA, USA) oligonucleotide microarray (containing approximately 8799 genes) was used to evaluate gene expression in corporal and male bladder tissue excised from rats 1 week after confirmation of a diabetic state, but before demonstrable changes in organ function in vivo. A conservative analytical approach was used to detect alterations in gene expression, and gene ontology (GO) classifications were used to identify biological themes/pathways involved in the aetiology of the organ dysfunction. In all, 320 and 313 genes were differentially expressed in bladder and corporal tissue, respectively. GO analysis in bladder tissue showed prominent increases in biological pathways involved in cell proliferation, metabolism, actin cytoskeleton and myosin, as well as decreases in cell motility, and regulation of muscle contraction. GO analysis in corpora showed increases in pathways related to ion channel transport and ion channel activity, while there were decreases in collagen I and actin genes. The changes in gene expression in these initial experiments are consistent with the pathophysiological characteristics of the bladder and erectile dysfunction seen later in the diabetic disease process. Thus, the observed changes in gene expression might be harbingers or biomarkers of impending organ dysfunction, and could provide useful diagnostic and therapeutic targets for a variety of progressive urological diseases/conditions (i.e. lower urinary tract symptoms related to benign prostatic hyperplasia, erectile dysfunction, etc.).

  4. NRSF-dependent epigenetic mechanisms contribute to programming of stress-sensitive neurons by neonatal experience, promoting resilience.

    PubMed

    Singh-Taylor, A; Molet, J; Jiang, S; Korosi, A; Bolton, J L; Noam, Y; Simeone, K; Cope, J; Chen, Y; Mortazavi, A; Baram, T Z

    2018-03-01

    Resilience to stress-related emotional disorders is governed in part by early-life experiences. Here we demonstrate experience-dependent re-programming of stress-sensitive hypothalamic neurons, which takes place through modification of neuronal gene expression via epigenetic mechanisms. Specifically, we found that augmented maternal care reduced glutamatergic synapses onto stress-sensitive hypothalamic neurons and repressed expression of the stress-responsive gene, Crh. In hypothalamus in vitro, reduced glutamatergic neurotransmission recapitulated the repressive effects of augmented maternal care on Crh, and this required recruitment of the transcriptional repressor repressor element-1 silencing transcription factor/neuron restrictive silencing factor (NRSF). Increased NRSF binding to chromatin was accompanied by sequential repressive epigenetic changes which outlasted NRSF binding. chromatin immunoprecipitation-seq analyses of NRSF targets identified gene networks that, in addition to Crh, likely contributed to the augmented care-induced phenotype, including diminished depression-like and anxiety-like behaviors. Together, we believe these findings provide the first causal link between enriched neonatal experience, synaptic refinement and induction of epigenetic processes within specific neurons. They uncover a novel mechanistic pathway from neonatal environment to emotional resilience.

  5. Survival, gene and metabolite responses of Litoria verreauxii alpina frogs to fungal disease chytridiomycosis

    NASA Astrophysics Data System (ADS)

    Grogan, Laura F.; Mulvenna, Jason; Gummer, Joel P. A.; Scheele, Ben C.; Berger, Lee; Cashins, Scott D.; McFadden, Michael S.; Harlow, Peter; Hunter, David A.; Trengove, Robert D.; Skerratt, Lee F.

    2018-03-01

    The fungal skin disease chytridiomycosis has caused the devastating decline and extinction of hundreds of amphibian species globally, yet the potential for evolving resistance, and the underlying pathophysiological mechanisms remain poorly understood. We exposed 406 naïve, captive-raised alpine tree frogs (Litoria verreauxii alpina) from multiple populations (one evolutionarily naïve to chytridiomycosis) to the aetiological agent Batrachochytrium dendrobatidis in two concurrent and controlled infection experiments. We investigated (A) survival outcomes and clinical pathogen burdens between populations and clutches, and (B) individual host tissue responses to chytridiomycosis. Here we present multiple interrelated datasets associated with these exposure experiments, including animal signalment, survival and pathogen burden of 355 animals from Experiment A, and the following datasets related to 61 animals from Experiment B: animal signalment and pathogen burden; raw RNA-Seq reads from skin, liver and spleen tissues; de novo assembled transcriptomes for each tissue type; raw gene expression data; annotation data for each gene; and raw metabolite expression data from skin and liver tissues. These data provide an extensive baseline for future analyses.

  6. Evaluating whole transcriptome amplification for gene profiling experiments using RNA-Seq.

    PubMed

    Faherty, Sheena L; Campbell, C Ryan; Larsen, Peter A; Yoder, Anne D

    2015-07-30

    RNA-Seq has enabled high-throughput gene expression profiling to provide insight into the functional link between genotype and phenotype. Low quantities of starting RNA can be a severe hindrance for studies that aim to utilize RNA-Seq. To mitigate this bottleneck, whole transcriptome amplification (WTA) technologies have been developed to generate sufficient sequencing targets from minute amounts of RNA. Successful WTA requires accurate replication of transcript abundance without the loss or distortion of specific mRNAs. Here, we test the efficacy of NuGEN's Ovation RNA-Seq V2 system, which uses linear isothermal amplification with a unique chimeric primer for amplification, using white adipose tissue from standard laboratory rats (Rattus norvegicus). Our goal was to investigate potential biological artifacts introduced through WTA approaches by establishing comparisons between matched raw and amplified RNA libraries derived from biological replicates. We found that 93% of expressed genes were identical between all unamplified versus matched amplified comparisons, also finding that gene density is similar across all comparisons. Our sequencing experiment and downstream bioinformatic analyses using the Tuxedo analysis pipeline resulted in the assembly of 25,543 high-quality transcripts. Libraries constructed from raw RNA and WTA samples averaged 15,298 and 15,253 expressed genes, respectively. Although significant differentially expressed genes (P < 0.05) were identified in all matched samples, each of these represents less than 0.15% of all shared genes for each comparison. Transcriptome amplification is efficient at maintaining relative transcript frequencies with no significant bias when using this NuGEN linear isothermal amplification kit under ideal laboratory conditions as presented in this study. This methodology has broad applications, from clinical and diagnostic, to field-based studies when sample acquisition, or sample preservation, methods prove challenging.

  7. Genome-Wide Responses of Female Fruit Flies Subjected to Divergent Mating Regimes

    PubMed Central

    Gerrard, Dave T.; Fricke, Claudia; Edward, Dominic A.; Edwards, Dylan R.; Chapman, Tracey

    2013-01-01

    Elevated rates of mating and reproduction cause decreased female survival and lifetime reproductive success across a wide range of taxa from flies to humans. These costs are fundamentally important to the evolution of life histories. Here we investigate the potential mechanistic basis of this classic life history component. We conducted 4 independent replicated experiments in which female Drosophila melanogaster were subjected to ‘high’ and ‘low’ mating regimes, resulting in highly significant differences in lifespan. We sampled females for transcriptomic analysis at day 10 of life, before the visible onset of ageing, and used Tiling expression arrays to detect differential gene expression in two body parts (abdomen versus head+thorax). The divergent mating regimes were associated with significant differential expression in a network of genes showing evidence for interactions with ecdysone receptor. Preliminary experimental manipulation of two genes in that network with roles in post-transcriptional modification (CG11486, eyegone) tended to enhance sensitivity to mating costs. However, the subtle nature of those effects suggests substantial functional redundancy or parallelism in this gene network, which could buffer females against excessive responses. There was also evidence for differential expression in genes involved in germline maintenance, cell proliferation and in gustation / odorant reception. Interestingly, we detected differential expression in three specific genes (EcR, keap1, lbk1) and one class of genes (gustation / odorant receptors) with previously reported roles in determining lifespan. Our results suggest that high and low mating regimes that lead to divergence in lifespan are associated with changes in the expression of genes such as reproductive hormones, that influence resource allocation to the germ line, and that may modify post-translational gene expression. This predicts that the correct signalling of nutrient levels to the reproductive system is important for maintaining organismal integrity. PMID:23826372

  8. Gene expression profiling of long-lived dwarf mice: longevity-associated genes and relationships with diet, gender and aging

    PubMed Central

    Swindell, William R

    2007-01-01

    Background Long-lived strains of dwarf mice carry mutations that suppress growth hormone (GH) and insulin-like growth factor I (IGF-I) signaling. The downstream effects of these endocrine abnormalities, however, are not well understood and it is unclear how these processes interact with aging mechanisms. This study presents a comparative analysis of microarray experiments that have measured hepatic gene expression levels in long-lived strains carrying one of four mutations (Prop1df/df, Pit1dw/dw, Ghrhrlit/lit, GHR-KO) and describes how the effects of these mutations relate to one another at the transcriptional level. Points of overlap with the effects of calorie restriction (CR), CR mimetic compounds, low fat diets, gender dimorphism and aging were also examined. Results All dwarf mutations had larger and more consistent effects on IGF-I expression than dietary treatments. In comparison to dwarf mutations, however, the transcriptional effects of CR (and some CR mimetics) overlapped more strongly with those of aging. Surprisingly, the Ghrhrlit/lit mutation had much larger effects on gene expression than the GHR-KO mutation, even though both mutations affect the same endocrine pathway. Several genes potentially regulated or co-regulated with the IGF-I transcript in liver tissue were identified, including a DNA repair gene (Snm1) that is upregulated in proportion to IGF-I inhibition. A total of 13 genes exhibiting parallel differential expression patterns among all four strains of long-lived dwarf mice were identified, in addition to 30 genes with matching differential expression patterns in multiple long-lived dwarf strains and under CR. Conclusion Comparative analysis of microarray datasets can identify patterns and consistencies not discernable from any one dataset individually. This study implements new analytical approaches to provide a detailed comparison among the effects of life-extending mutations, dietary treatments, gender and aging. This comparison provides insight into a broad range of issues relevant to the study of mammalian aging. In this context, 43 longevity-associated genes are identified and individual genes with the highest level of support among all microarray experiments are highlighted. These results provide promising targets for future experimental investigation as well as potential clues for understanding the functional basis of lifespan extension in mammalian systems. PMID:17915019

  9. Selection of Reference Genes for Quantitative Real Time PCR (qPCR) Assays in Tissue from Human Ascending Aorta

    PubMed Central

    Rueda-Martínez, Carmen; Lamas, Oscar; Mataró, María José; Robledo-Carmona, Juan; Sánchez-Espín, Gemma; Jiménez-Navarro, Manuel; Such-Martínez, Miguel; Fernández, Borja

    2014-01-01

    Dilatation of the ascending aorta (AAD) is a prevalent aortopathy that occurs frequently associated with bicuspid aortic valve (BAV), the most common human congenital cardiac malformation. The molecular mechanisms leading to AAD associated with BAV are still poorly understood. The search for differentially expressed genes in diseased tissue by quantitative real-time PCR (qPCR) is an invaluable tool to fill this gap. However, studies dedicated to identify reference genes necessary for normalization of mRNA expression in aortic tissue are scarce. In this report, we evaluate the qPCR expression of six candidate reference genes in tissue from the ascending aorta of 52 patients with a variety of clinical and demographic characteristics, normal and dilated aortas, and different morphologies of the aortic valve (normal aorta and normal valve n = 30; dilated aorta and normal valve n = 10; normal aorta and BAV n = 4; dilated aorta and BAV n = 8). The expression stability of the candidate reference genes was determined with three statistical algorithms, GeNorm, NormFinder and Bestkeeper. The expression analyses showed that the most stable genes for the three algorithms employed were CDKN1β, POLR2A and CASC3, independently of the structure of the aorta and the valve morphology. In conclusion, we propose the use of these three genes as reference genes for mRNA expression analysis in human ascending aorta. However, we suggest searching for specific reference genes when conducting qPCR experiments with new cohort of samples. PMID:24841551

  10. Applying dynamic Bayesian networks to perturbed gene expression data.

    PubMed

    Dojer, Norbert; Gambin, Anna; Mizera, Andrzej; Wilczyński, Bartek; Tiuryn, Jerzy

    2006-05-08

    A central goal of molecular biology is to understand the regulatory mechanisms of gene transcription and protein synthesis. Because of their solid basis in statistics, allowing to deal with the stochastic aspects of gene expressions and noisy measurements in a natural way, Bayesian networks appear attractive in the field of inferring gene interactions structure from microarray experiments data. However, the basic formalism has some disadvantages, e.g. it is sometimes hard to distinguish between the origin and the target of an interaction. Two kinds of microarray experiments yield data particularly rich in information regarding the direction of interactions: time series and perturbation experiments. In order to correctly handle them, the basic formalism must be modified. For example, dynamic Bayesian networks (DBN) apply to time series microarray data. To our knowledge the DBN technique has not been applied in the context of perturbation experiments. We extend the framework of dynamic Bayesian networks in order to incorporate perturbations. Moreover, an exact algorithm for inferring an optimal network is proposed and a discretization method specialized for time series data from perturbation experiments is introduced. We apply our procedure to realistic simulations data. The results are compared with those obtained by standard DBN learning techniques. Moreover, the advantages of using exact learning algorithm instead of heuristic methods are analyzed. We show that the quality of inferred networks dramatically improves when using data from perturbation experiments. We also conclude that the exact algorithm should be used when it is possible, i.e. when considered set of genes is small enough.

  11. An efficient annotation and gene-expression derivation tool for Illumina Solexa datasets.

    PubMed

    Hosseini, Parsa; Tremblay, Arianne; Matthews, Benjamin F; Alkharouf, Nadim W

    2010-07-02

    The data produced by an Illumina flow cell with all eight lanes occupied, produces well over a terabyte worth of images with gigabytes of reads following sequence alignment. The ability to translate such reads into meaningful annotation is therefore of great concern and importance. Very easily, one can get flooded with such a great volume of textual, unannotated data irrespective of read quality or size. CASAVA, a optional analysis tool for Illumina sequencing experiments, enables the ability to understand INDEL detection, SNP information, and allele calling. To not only extract from such analysis, a measure of gene expression in the form of tag-counts, but furthermore to annotate such reads is therefore of significant value. We developed TASE (Tag counting and Analysis of Solexa Experiments), a rapid tag-counting and annotation software tool specifically designed for Illumina CASAVA sequencing datasets. Developed in Java and deployed using jTDS JDBC driver and a SQL Server backend, TASE provides an extremely fast means of calculating gene expression through tag-counts while annotating sequenced reads with the gene's presumed function, from any given CASAVA-build. Such a build is generated for both DNA and RNA sequencing. Analysis is broken into two distinct components: DNA sequence or read concatenation, followed by tag-counting and annotation. The end result produces output containing the homology-based functional annotation and respective gene expression measure signifying how many times sequenced reads were found within the genomic ranges of functional annotations. TASE is a powerful tool to facilitate the process of annotating a given Illumina Solexa sequencing dataset. Our results indicate that both homology-based annotation and tag-count analysis are achieved in very efficient times, providing researchers to delve deep in a given CASAVA-build and maximize information extraction from a sequencing dataset. TASE is specially designed to translate sequence data in a CASAVA-build into functional annotations while producing corresponding gene expression measurements. Achieving such analysis is executed in an ultrafast and highly efficient manner, whether the analysis be a single-read or paired-end sequencing experiment. TASE is a user-friendly and freely available application, allowing rapid analysis and annotation of any given Illumina Solexa sequencing dataset with ease.

  12. Target research on tumor biology characteristics of mir-155-5p regulation on gastric cancer cell.

    PubMed

    Feng, Jun-an

    2016-03-01

    After the mir-155-5p over expressed in gastric cancer cells, the expression profile chip was adopted to screen its target genes. Some of the intersection of target genes were selected based on the bioinformatics prediction, in order to study the mechanism of its function and role of research. Affymetrix eukaryotic gene expression spectrum was conducted to screen mir-155-5p regulated genetic experiment. Western blot technique was employed to detect and screen the protein expression of target genes. Mimics was transfected in BGC-823 of gastric cancer cells. Compared with mimics-nc group and mock group, the mRNA expression quantities of SMAD1, STAT1, CAB39, CXCR4 and CA9 were significantly lower. After the gastric cancer cells BGC-823 and MKN-45 had been transfected by mimics, compared with mimics-nc (MNC) group and mock (MOCK) group, it was decreased for the protein expression of SMAD1, STAT1 and CAB39 in mimics (MIMICS) group. The verification of qRT-PCR demonstrated that SMAD1, STAT1, CAB39, CXCR4 and CA9 were the predicted target genes and target proteins of mir-155-5p, the over expression of mir-155-5p could enable the decreasing of its expression level in gastric cancer cells MKN-45 and BGC-823.

  13. Recombinant avian adeno-associated virus: transgene expression in vivo and enhancement of expression in vitro.

    PubMed

    Estevez, Carlos; Villegas, Pedro

    2006-06-01

    Recombinant avian adeno-associated viruses coding for the LacZ gene were used to inoculate embryonating chicken eggs, to assess the usefulness of the system for the expression of a transgene in vivo. The results obtained indicate significantly higher levels of expression of the reporter gene at various time intervals in the embryos inoculated with the recombinant virus in comparison with the mock-inoculated controls. At the embryo level, significant differences were evident at 120 hr postinoculation; hatched chicks showed transgene expression up to 14 days of age. In a second experiment, different cell-line cultures were transfected with plasmids encoding for a reporter gene flanked by the avian adeno-associated virus inverted terminal repeats (ITR), either alone or in the presence of the major nonstructural proteins of the virus (Rep 78/68) to assess the ability of these proteins and DNA elements to enhance gene expression. Results indicate that the inclusion of the viral ITR alone or during coexpression of the Rep proteins significantly enhances the expression of the transgene in all cell lines tested, as evidenced by the detection of the beta-galacrosidase protein through chemiluminescence reactions and staining of transfected monolayers.

  14. CDH4 suppresses the progression of salivary adenoid cystic carcinoma via E-cadherin co-expression.

    PubMed

    Xie, Jian; Feng, Yan; Lin, Ting; Huang, Xiao-Yu; Gan, Rui-Huan; Zhao, Yong; Su, Bo-Hua; Ding, Lin-Can; She, Lin; Chen, Jiang; Lin, Li-Song; Lin, Xu; Zheng, Da-Li; Lu, You-Guang

    2016-12-13

    The cadherin-4 gene (CDH4) of the cadherin family encodes non-epithelial R-cadherin (R-cad); however, the function of this gene in different types of cancer remains controversial. In this study, we found higher expression of CDH4 mRNA in a salivary adenoid cystic carcinoma (SACC) cell line with low metastatic potential (SACC-83) than in a cell line with high metastatic potential (SACC-LM). By analyzing 67 samples of SACC tissues and 40 samples of paraneoplastic normal tissues, we found R-cad highly expressed in 100% of normal paraneoplastic tissue but only expressed in 64% of SACC tumor tissues (P<0.001). Knockdown of CDH4 expression in vitro promoted the growth, mobility and invasion of SACC cells, and in vivo experiments showed that decreased CDH4 expression enhanced SACC tumorigenicity. Furthermore, CDH4 suppression resulted in down-regulation of E-cadherin (E-cad), which is encoded by CDH1 gene and is a well-known tumor suppressor gene by inhibition of cell proliferation and migration. These results indicate that CDH4 may play a negative role in the growth and metastasis of SACC via co-expression with E-cadherin.

  15. Antifungal genes expressed in transgenic pea (Pisum sativum L.) do not affect root colonization of arbuscular mycorrhizae fungi.

    PubMed

    Kahlon, Jagroop Gill; Jacobsen, Hans-Jörg; Cahill, James F; Hall, Linda M

    2017-10-01

    Genetically modified crops have raised concerns about unintended consequences on non-target organisms including beneficial soil associates. Pea transformed with four antifungal genes 1-3 β glucanase, endochitinase, polygalacturonase-inhibiting proteins, and stilbene synthase is currently under field-testing for efficacy against fungal diseases in Canada. Transgenes had lower expression in the roots than leaves in greenhouse experiment. To determine the impact of disease-tolerant pea or gene products on colonization by non-target arbuscular mycorrhizae and nodulation by rhizobium, a field trial was established. Transgene insertion, as single gene or stacked genes, did not alter root colonization by arbuscular mycorrhiza fungus (AMF) or root nodulation by rhizobium inoculation in the field. We found no effect of transgenes on the plant growth and performance although, having a dual inoculant with both AMF and rhizobium yielded higher fresh weight shoot-to-root ratio in all the lines tested. This initial risk assessment of transgenic peas expressing antifungal genes showed no deleterious effect on non-target organisms.

  16. Modeling T-cell activation using gene expression profiling and state-space models.

    PubMed

    Rangel, Claudia; Angus, John; Ghahramani, Zoubin; Lioumi, Maria; Sotheran, Elizabeth; Gaiba, Alessia; Wild, David L; Falciani, Francesco

    2004-06-12

    We have used state-space models to reverse engineer transcriptional networks from highly replicated gene expression profiling time series data obtained from a well-established model of T-cell activation. State space models are a class of dynamic Bayesian networks that assume that the observed measurements depend on some hidden state variables that evolve according to Markovian dynamics. These hidden variables can capture effects that cannot be measured in a gene expression profiling experiment, e.g. genes that have not been included in the microarray, levels of regulatory proteins, the effects of messenger RNA and protein degradation, etc. Bootstrap confidence intervals are developed for parameters representing 'gene-gene' interactions over time. Our models represent the dynamics of T-cell activation and provide a methodology for the development of rational and experimentally testable hypotheses. Supplementary data and Matlab computer source code will be made available on the web at the URL given below. http://public.kgi.edu/~wild/LDS/index.htm

  17. Mixture models for detecting differentially expressed genes in microarrays.

    PubMed

    Jones, Liat Ben-Tovim; Bean, Richard; McLachlan, Geoffrey J; Zhu, Justin Xi

    2006-10-01

    An important and common problem in microarray experiments is the detection of genes that are differentially expressed in a given number of classes. As this problem concerns the selection of significant genes from a large pool of candidate genes, it needs to be carried out within the framework of multiple hypothesis testing. In this paper, we focus on the use of mixture models to handle the multiplicity issue. With this approach, a measure of the local FDR (false discovery rate) is provided for each gene. An attractive feature of the mixture model approach is that it provides a framework for the estimation of the prior probability that a gene is not differentially expressed, and this probability can subsequently be used in forming a decision rule. The rule can also be formed to take the false negative rate into account. We apply this approach to a well-known publicly available data set on breast cancer, and discuss our findings with reference to other approaches.

  18. Molecular Mechanisms at the Basis of Plasticity in the Developing Visual Cortex: Epigenetic Processes and Gene Programs

    PubMed Central

    Maya-Vetencourt, José Fernando; Pizzorusso, Tommaso

    2013-01-01

    Neuronal circuitries in the mammalian visual system change as a function of experience. Sensory experience modifies neuronal networks connectivity via the activation of different physiological processes such as excitatory/inhibitory synaptic transmission, neurotrophins, and signaling of extracellular matrix molecules. Long-lasting phenomena of plasticity occur when intracellular signal transduction pathways promote epigenetic alterations of chromatin structure that regulate the induction of transcription factors that in turn drive the expression of downstream targets, the products of which then work via the activation of structural and functional mechanisms that modify synaptic connectivity. Here, we review recent findings in the field of visual cortical plasticity while focusing on how physiological mechanisms associated with experience promote structural changes that determine functional modifications of neural circuitries in V1. We revise the role of microRNAs as molecular transducers of environmental stimuli and the role of immediate early genes that control gene expression programs underlying plasticity in the developing visual cortex. PMID:25157210

  19. Split-plot microarray experiments: issues of design, power and sample size.

    PubMed

    Tsai, Pi-Wen; Lee, Mei-Ling Ting

    2005-01-01

    This article focuses on microarray experiments with two or more factors in which treatment combinations of the factors corresponding to the samples paired together onto arrays are not completely random. A main effect of one (or more) factor(s) is confounded with arrays (the experimental blocks). This is called a split-plot microarray experiment. We utilise an analysis of variance (ANOVA) model to assess differentially expressed genes for between-array and within-array comparisons that are generic under a split-plot microarray experiment. Instead of standard t- or F-test statistics that rely on mean square errors of the ANOVA model, we use a robust method, referred to as 'a pooled percentile estimator', to identify genes that are differentially expressed across different treatment conditions. We illustrate the design and analysis of split-plot microarray experiments based on a case application described by Jin et al. A brief discussion of power and sample size for split-plot microarray experiments is also presented.

  20. Heterologous Expression of the Oxytetracycline Biosynthetic Pathway in Myxococcus xanthus▿

    PubMed Central

    Stevens, D. Cole; Henry, Michael R.; Murphy, Kimberly A.; Boddy, Christopher N.

    2010-01-01

    New natural products for drug discovery may be accessed by heterologous expression of bacterial biosynthetic pathways in metagenomic DNA libraries. However, a “universal” host is needed for this experiment. Herein, we show that Myxococcus xanthus is a potential “universal” host for heterologous expression of polyketide biosynthetic gene clusters. PMID:20208031

  1. Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

    PubMed Central

    Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

    2012-01-01

    We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

  2. Clustered metallothionein genes are co-regulated in rice and ectopic expression of OsMT1e-P confers multiple abiotic stress tolerance in tobacco via ROS scavenging

    PubMed Central

    2012-01-01

    Background Metallothioneins (MT) are low molecular weight, cysteine rich metal binding proteins, found across genera and species, but their function(s) in abiotic stress tolerance are not well documented. Results We have characterized a rice MT gene, OsMT1e-P, isolated from a subtractive library generated from a stressed salinity tolerant rice genotype, Pokkali. Bioinformatics analysis of the rice genome sequence revealed that this gene belongs to a multigenic family, which consists of 13 genes with 15 protein products. OsMT1e-P is located on chromosome XI, away from the majority of other type I genes that are clustered on chromosome XII. Various members of this MT gene cluster showed a tight co-regulation pattern under several abiotic stresses. Sequence analysis revealed the presence of conserved cysteine residues in OsMT1e-P protein. Salinity stress was found to regulate the transcript abundance of OsMT1e-P in a developmental and organ specific manner. Using transgenic approach, we found a positive correlation between ectopic expression of OsMT1e-P and stress tolerance. Our experiments further suggest ROS scavenging to be the possible mechanism for multiple stress tolerance conferred by OsMT1e-P. Conclusion We present an overview of MTs, describing their gene structure, genome localization and expression patterns under salinity and development in rice. We have found that ectopic expression of OsMT1e-P enhances tolerance towards multiple abiotic stresses in transgenic tobacco and the resultant plants could survive and set viable seeds under saline conditions. Taken together, the experiments presented here have indicated that ectopic expression of OsMT1e-P protects against oxidative stress primarily through efficient scavenging of reactive oxygen species. PMID:22780875

  3. Clustered metallothionein genes are co-regulated in rice and ectopic expression of OsMT1e-P confers multiple abiotic stress tolerance in tobacco via ROS scavenging.

    PubMed

    Kumar, Gautam; Kushwaha, Hemant Ritturaj; Panjabi-Sabharwal, Vaishali; Kumari, Sumita; Joshi, Rohit; Karan, Ratna; Mittal, Shweta; Pareek, Sneh L Singla; Pareek, Ashwani

    2012-07-10

    Metallothioneins (MT) are low molecular weight, cysteine rich metal binding proteins, found across genera and species, but their function(s) in abiotic stress tolerance are not well documented. We have characterized a rice MT gene, OsMT1e-P, isolated from a subtractive library generated from a stressed salinity tolerant rice genotype, Pokkali. Bioinformatics analysis of the rice genome sequence revealed that this gene belongs to a multigenic family, which consists of 13 genes with 15 protein products. OsMT1e-P is located on chromosome XI, away from the majority of other type I genes that are clustered on chromosome XII. Various members of this MT gene cluster showed a tight co-regulation pattern under several abiotic stresses. Sequence analysis revealed the presence of conserved cysteine residues in OsMT1e-P protein. Salinity stress was found to regulate the transcript abundance of OsMT1e-P in a developmental and organ specific manner. Using transgenic approach, we found a positive correlation between ectopic expression of OsMT1e-P and stress tolerance. Our experiments further suggest ROS scavenging to be the possible mechanism for multiple stress tolerance conferred by OsMT1e-P. We present an overview of MTs, describing their gene structure, genome localization and expression patterns under salinity and development in rice. We have found that ectopic expression of OsMT1e-P enhances tolerance towards multiple abiotic stresses in transgenic tobacco and the resultant plants could survive and set viable seeds under saline conditions. Taken together, the experiments presented here have indicated that ectopic expression of OsMT1e-P protects against oxidative stress primarily through efficient scavenging of reactive oxygen species.

  4. Opposite actions of transforming growth factor-beta 1 on the gene expression of atrial natriuretic peptide biological and clearance receptors in a murine thymic stromal cell line.

    PubMed

    Agui, T; Xin, X; Cai, Y; Shim, G; Muramatsu, Y; Yamada, T; Fujiwara, H; Matsumoto, K

    1995-09-01

    The regulation of the gene expression of the atrial natriuretic peptide receptor (ANPR) subtypes, ANPR-A, ANPR-B, and ANPR-C, was investigated in a murine thymic stromal cell line, MRL 104.8a. When MRL 104.8a cells were cultured with transforming growth factor (TGF)-beta1, [125I]ANP binding sites increased with increasing dose of TGF-beta1. These binding sites were identified as ANPR-C by a displacement experiment with ANPR-C-specific ligand, C-ANF, and by the affinity cross-linking of the [125I]ANP binding sites with a chemical cross-linker to determine the molecular weight of the ANPR. This augmentation of the ANPR-C expression was elucidated to occur at the transcriptional level by Northern blot experiment, comparison of the relative amounts of mRNA by reverse transcription (RT)-PCR, and in vitro nuclear transcription assay. Conversely, the expression of the ANP biological receptors, ANPR-A and ANPR-B, was shown to be down-regulated by TGF-beta1. These data suggest that TGF-beta1 regulates the gene expression of ANPRs in the thymic stromal cells and that ANP and TGF-beta1 might affect the thymic stromal cell functions.

  5. Selection of appropriate reference genes for RT-qPCR analysis in a streptozotocin-induced Alzheimer's disease model of cynomolgus monkeys (Macaca fascicularis).

    PubMed

    Park, Sang-Je; Kim, Young-Hyun; Lee, Youngjeon; Kim, Kyoung-Min; Kim, Heui-Soo; Lee, Sang-Rae; Kim, Sun-Uk; Kim, Sang-Hyun; Kim, Ji-Su; Jeong, Kang-Jin; Lee, Kyoung-Min; Huh, Jae-Won; Chang, Kyu-Tae

    2013-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) has been widely used to quantify relative gene expression because of the specificity, sensitivity, and accuracy of this technique. In order to obtain reliable gene expression data from RT-qPCR experiments, it is important to utilize optimal reference genes for the normalization of target gene expression under varied experimental conditions. Previously, we developed and validated a novel icv-STZ cynomolgus monkey model for Alzheimer's disease (AD) research. However, in order to enhance the reliability of this disease model, appropriate reference genes must be selected to allow meaningful analysis of the gene expression levels in the icv-STZ cynomolgus monkey brain. In this study, we assessed the expression stability of 9 candidate reference genes in 2 matched-pair brain samples (5 regions) of control cynomolgus monkeys and those who had received intracerebroventricular injection of streptozotocin (icv-STZ). Three well-known analytical programs geNorm, NormFinder, and BestKeeper were used to choose the suitable reference genes from the total sample group, control group, and icv-STZ group. Combination analysis of the 3 different programs clearly indicated that the ideal reference genes are RPS19 and YWHAZ in the total sample group, GAPDH and RPS19 in the control group, and ACTB and GAPDH in the icv-STZ group. Additionally, we validated the normalization accuracy of the most appropriate reference genes (RPS19 and YWHAZ) by comparison with the least stable gene (TBP) using quantification of the APP and MAPT genes in the total sample group. To the best of our knowledge, this research is the first study to identify and validate the appropriate reference genes in cynomolgus monkey brains. These findings provide useful information for future studies involving the expression of target genes in the cynomolgus monkey.

  6. Stressing "Escherichia coli" to Educate Students about Research: A CURE to Investigate Multiple Levels of Gene Regulation

    ERIC Educational Resources Information Center

    McDonough, Janet; Goudsouzian, Lara K.; Papaj, Agllai; Maceli, Ashley R.; Klepac-Ceraj, Vanja; Peterson, Celeste N.

    2017-01-01

    Course-based undergraduate research experiences (CUREs) have been shown to increase student retention and learning in the biological sciences. Most CURES cover only one aspect of gene regulation, such as transcriptional control. Here we present a new inquiry-based lab that engages understanding of gene expression from multiple perspectives.…

  7. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

  8. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    DOE PAGES

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

    2008-01-01

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

  9. PM2.5-induced alterations of cell cycle associated gene expression in lung cancer cells and rat lung tissues.

    PubMed

    Zhao, Hui; Yang, Biao; Xu, Jia; Chen, Dong-Mei; Xiao, Chun-Ling

    2017-06-01

    The aim of the current study was to investigate the expression of cell cycle-associated genes induced by fine particulate matter (PM 2.5 ) in lung cancer cell line and tissues. The pulmonary lymph node metastasis cells (H292) were treated with PM 2.5 in vitro. Wistar rats were used to perform an in vivo study. Rats were randomly assigned to experiment and control groups and those in the experiment group were exposed to PM 2.5 once every 15 d, while those in the control group were exposed to normal saline. The cell cycle-associated genes expression was analyzed by real-time PCR. Trachea and lung tissues of rats were processed for scanning electron microscopic (SEM) examinations. Exposure of H292 cells to PM 2.5 dramatically increased the expressions of p53 and cyclin-dependent kinase 2 (CDK2) after 24h of exposure (p<0.01) and markedly increased the expressions of the cell division cycle 2 (Cdc2) and cyclin B after 48h of exposure (p<0.01), while those genes expressions were significantly reduced after 72h of exposure, at which time the expression of p21 was predominant (p<0.01). In vivo studies further demonstrated these results. The results of SEM suggested that both of the trachea and lung tissues were damaged and the degree of damage was time-dependent. In conclusion, PM 2.5 can induce significantly alterations of p53 and CDK2 in the early phase, Cdc2 and cyclin B in mid-term and p21 in long-term exposure. The degree of PM 2.5 -induced damage to the trachea and lung tissue was time-dependent. Copyright © 2017. Published by Elsevier B.V.

  10. Chronic Postnatal Stress Induces Depressive-like Behavior in Male Mice and Programs second-Hit Stress-Induced Gene Expression Patterns of OxtR and AvpR1a in Adulthood.

    PubMed

    Lesse, Alexandra; Rether, Kathy; Gröger, Nicole; Braun, Katharina; Bock, Jörg

    2017-08-01

    Chronic stress (CS) during early life represents a major risk factor for the development of mental disorders, including depression. According to the Two/Multiple-Hit hypothesis, the etiology of neuropsychiatric disorders usually involves multiple stressors experienced subsequently during different phases of life. However, the molecular and cellular mechanisms modulating neuronal and behavioral changes induced by multiple stress experiences are just poorly understood. Since the oxytocinergic and vasopressinergic systems are neuroendocrine modulators involved in environmentally driven adaptations of stress sensitivity we hypothesized that postnatal CS programs oxytocinergic and vasopressinergic receptor expression changes in response to a second stress exposure in young adulthood. First we investigated if postnatal CS (maternal separation + social isolation) induces depressive-like behavior and alters oxytocin receptor (OxtR) and arginine vasopressin receptor type 1a (AvpR1a) gene expression in the hippocampus (HC) of male mice and (2) if a second single stressor (forced swimming, FS) in young adulthood affects gene expression of OxtR and AvpR1a at adulthood dependent on CS pre-experience. We found that postnatal CS induced depressive-like behavior and enhanced AvpR1a expression in HC at young adulthood. Moreover, in line with our hypothesis, only combined stress exposure (CS + FS), but not CS or FS alone, resulted in increased gene expression of OxtR in HC at adulthood. In contrast, AvpR1a expression was decreased in both adult FS and CS + FS animals. Overall, our results provide evidence that CS programs neuroendocrine systems and thereby influences stress responses in later life periods.

  11. Human primitive brain displays negative mitochondrial-nuclear expression correlation of respiratory genes.

    PubMed

    Barshad, Gilad; Blumberg, Amit; Cohen, Tal; Mishmar, Dan

    2018-06-14

    Oxidative phosphorylation (OXPHOS), a fundamental energy source in all human tissues, requires interactions between mitochondrial (mtDNA)- and nuclear (nDNA)-encoded protein subunits. Although such interactions are fundamental to OXPHOS, bi-genomic coregulation is poorly understood. To address this question, we analyzed ∼8500 RNA-seq experiments from 48 human body sites. Despite well-known variation in mitochondrial activity, quantity, and morphology, we found overall positive mtDNA-nDNA OXPHOS genes' co-expression across human tissues. Nevertheless, negative mtDNA-nDNA gene expression correlation was identified in the hypothalamus, basal ganglia, and amygdala (subcortical brain regions, collectively termed the "primitive" brain). Single-cell RNA-seq analysis of mouse and human brains revealed that this phenomenon is evolutionarily conserved, and both are influenced by brain cell types (involving excitatory/inhibitory neurons and nonneuronal cells) and by their spatial brain location. As the "primitive" brain is highly oxidative, we hypothesized that such negative mtDNA-nDNA co-expression likely controls for the high mtDNA transcript levels, which enforce tight OXPHOS regulation, rather than rewiring toward glycolysis. Accordingly, we found "primitive" brain-specific up-regulation of lactate dehydrogenase B ( LDHB ), which associates with high OXPHOS activity, at the expense of LDHA , which promotes glycolysis. Analyses of co-expression, DNase-seq, and ChIP-seq experiments revealed candidate RNA-binding proteins and CEBPB as the best regulatory candidates to explain these phenomena. Finally, cross-tissue expression analysis unearthed tissue-dependent splice variants and OXPHOS subunit paralogs and allowed revising the list of canonical OXPHOS transcripts. Taken together, our analysis provides a comprehensive view of mito-nuclear gene co-expression across human tissues and provides overall insights into the bi-genomic regulation of mitochondrial activities. © 2018 Barshad et al.; Published by Cold Spring Harbor Laboratory Press.

  12. A Survey for Novel Imprinted Genes in the Mouse Placenta by mRNA-seq

    PubMed Central

    Wang, Xu; Soloway, Paul D.; Clark, Andrew G.

    2011-01-01

    Many questions about the regulation, functional specialization, computational prediction, and evolution of genomic imprinting would be better addressed by having an exhaustive genome-wide catalog of genes that display parent-of-origin differential expression. As a first-pass scan for novel imprinted genes, we performed mRNA-seq experiments on embryonic day 17.5 (E17.5) mouse placenta cDNA samples from reciprocal cross F1 progeny of AKR and PWD mouse strains and quantified the allele-specific expression and the degree of parent-of-origin allelic imbalance. We confirmed the imprinting status of 23 known imprinted genes in the placenta and found that 12 genes reported previously to be imprinted in other tissues are also imprinted in mouse placenta. Through a well-replicated design using an orthogonal allelic-expression technology, we verified 5 novel imprinted genes that were not previously known to be imprinted in mouse (Pde10, Phf17, Phactr2, Zfp64, and Htra3). Our data suggest that most of the strongly imprinted genes have already been identified, at least in the placenta, and that evidence supports perhaps 100 additional weakly imprinted genes. Despite previous appearance that the placenta tends to display an excess of maternally expressed imprinted genes, with the addition of our validated set of placenta-imprinted genes, this maternal bias has disappeared. PMID:21705755

  13. Analysis of expressed sequence tags from a NaHCO(3)-treated alkali-tolerant plant, Chloris virgata.

    PubMed

    Nishiuchi, Shunsaku; Fujihara, Kazumasa; Liu, Shenkui; Takano, Tetsuo

    2010-04-01

    Chloris virgata Swartz (C. virgata) is a gramineous wild plant that can survive in saline-alkali areas in northeast China. To examine the tolerance mechanisms of C. virgata, we constructed a cDNA library from whole plants of C. virgata that had been treated with 100 mM NaHCO(3) for 24 h and sequenced 3168 randomly selected clones. Most (2590) of the expressed sequence tags (ESTs) showed significant similarity to sequences in the NCBI database. Of the 2590 genes, 1893 were unique. Gene Ontology (GO) Slim annotations were obtained for 1081 ESTs by BLAST2GO and it was found that 75 genes of them were annotated with GO terms "response to stress", "response to abiotic stimulus", and "response to biotic stimulus", indicating these genes were likely to function in tolerance mechanism of C. virgata. In a separate experiment, 24 genes that are known from previous studies to be associated with abiotic stress tolerance were further examined by real-time RT-PCR to see how their expressions were affected by NaHCO(3) stress. NaHCO(3) treatment up-regulated the expressions of pathogenesis-related gene (DC998527), Win1 precursor gene (DC998617), catalase gene (DC999385), ribosome inactivating protein 1 (DC999555), Na(+)/H(+) antiporter gene (DC998043), and two-component regulator gene (DC998236). Copyright 2010 Elsevier Masson SAS. All rights reserved.

  14. Honey bee aggression supports a link between gene regulation and behavioral evolution.

    PubMed

    Alaux, Cédric; Sinha, Saurabh; Hasadsri, Linda; Hunt, Greg J; Guzmán-Novoa, Ernesto; DeGrandi-Hoffman, Gloria; Uribe-Rubio, José Luis; Southey, Bruce R; Rodriguez-Zas, Sandra; Robinson, Gene E

    2009-09-08

    A prominent theory states that animal phenotypes arise by evolutionary changes in gene regulation, but the extent to which this theory holds true for behavioral evolution is not known. Because "nature and nurture" are now understood to involve hereditary and environmental influences on gene expression, we studied whether environmental influences on a behavioral phenotype, i.e., aggression, could have evolved into inherited differences via changes in gene expression. Here, with microarray analysis of honey bees, we show that aggression-related genes with inherited patterns of brain expression are also environmentally regulated. There were expression differences in the brain for hundreds of genes between the highly aggressive Africanized honey bee compared with European honey bee (EHB) subspecies. Similar results were obtained for EHB in response to exposure to alarm pheromone (which provokes aggression) and when comparing old and young bees (aggressive tendencies increase with age). There was significant overlap of the gene lists generated from these three microarray experiments. Moreover, there was statistical enrichment of several of the same cis regulatory motifs in promoters of genes on all three gene lists. Aggression shows a remarkably robust brain molecular signature regardless of whether it occurs because of inherited, age-related, or environmental (social) factors. It appears that one element in the evolution of different degrees of aggressive behavior in honey bees involved changes in regulation of genes that mediate the response to alarm pheromone.

  15. An Approach for Treating the Hepatobiliary Disease of Cystic Fibrosis by Somatic Gene Transfer

    NASA Astrophysics Data System (ADS)

    Yang, Yiping; Raper, Steven E.; Cohn, Jonathan A.; Engelhardt, John F.; Wilson, James M.

    1993-05-01

    Cystic fibrosis (CF) is an inherited disease of epithelial cell ion transport that is associated with pathology in multiple organ systems, including lung, pancreas, and liver. As treatment of the pulmonary manifestations of CF has improved, management of CF liver disease has become increasingly important in adult patients. This report describes an approach for treating CF liver disease by somatic gene transfer. In situ hybridization and immunocytochemistry analysis of rat liver sections indicated that the endogenous CFTR (cystic fibrosis transmembrane conductance regulator) gene is primarily expressed in the intrahepatic biliary epithelial cells. To specifically target recombinant genes to the biliary epithelium in vivo, recombinant adenoviruses expressing lacZ or human CFTR were infused retrograde into the biliary tract through the common bile duct. Conditions were established for achieving recombinant gene expression in virtually all cells of the intrahepatic bile ducts in vivo. Expression persisted in the smaller bile ducts for the duration of the experiment, which was 21 days. These studies suggest that it may be feasible to prevent CF liver disease by genetically reconstituting CFTR expression in the biliary tract, using an approach that is clinically feasible.

  16. Tuning the chemosensory window

    PubMed Central

    Zhou, Shanshan; Mackay, Trudy FC

    2010-01-01

    Accurate perception of chemical signals from the environment is critical for the fitness of most animals. Drosophila melanogaster experiences its chemical environment through families of chemoreceptors that include olfactory receptors, gustatory receptors and odorant binding proteins. Its chemical environment, however, changes during its life cycle and the interpretation of chemical signals is dependent on dynamic social and physical surroundings. Phenotypic plasticity of gene expression of the chemoreceptor repertoire allows flies to adjust the chemosensory window through which they “view” their world and to modify the ensemble of expressed chemoreceptor proteins in line with their developmental and physiological state and according to their needs to locate food and oviposition sites under different social and physical environmental conditions. Furthermore, males and females differ in their expression profiles of chemoreceptor genes. Thus, each sex experiences its chemical environment via combinatorial activation of distinct chemoreceptor ensembles. The remarkable phenotypic plasticity of the chemoreceptor repertoire raises several fundamental questions. What are the mechanisms that translate environmental cues into regulation of chemoreceptor gene expression? How are gustatory and olfactory cues integrated perceptually? What is the relationship between ensembles of odorant binding proteins and odorant receptors? And, what is the significance of co-regulated chemoreceptor transcriptional networks? PMID:20305396

  17. Microgravity elicits reproducible alterations in cytoskeletal and metabolic gene and protein expression in space-flown Caenorhabditis elegans

    PubMed Central

    Higashibata, Akira; Hashizume, Toko; Nemoto, Kanako; Higashitani, Nahoko; Etheridge, Timothy; Mori, Chihiro; Harada, Shunsuke; Sugimoto, Tomoko; Szewczyk, Nathaniel J; Baba, Shoji A; Mogami, Yoshihiro; Fukui, Keiji; Higashitani, Atsushi

    2016-01-01

    Although muscle atrophy is a serious problem during spaceflight, little is known about the sequence of molecular events leading to atrophy in response to microgravity. We carried out a spaceflight experiment using Caenorhabditis elegans onboard the Japanese Experiment Module of the International Space Station. Worms were synchronously cultured in liquid media with bacterial food for 4 days under microgravity or on a 1-G centrifuge. Worms were visually observed for health and movement and then frozen. Upon return, we analyzed global gene and protein expression using DNA microarrays and mass spectrometry. Body length and fat accumulation were also analyzed. We found that in worms grown from the L1 larval stage to adulthood under microgravity, both gene and protein expression levels for muscular thick filaments, cytoskeletal elements, and mitochondrial metabolic enzymes decreased relative to parallel cultures on the 1-G centrifuge (95% confidence interval (P⩽0.05)). In addition, altered movement and decreased body length and fat accumulation were observed in the microgravity-cultured worms relative to the 1-G cultured worms. These results suggest protein expression changes that may account for the progressive muscular atrophy observed in astronauts. PMID:28725720

  18. Brain selective transgene expression in zebrafish using an NRSE derived motif

    PubMed Central

    Bergeron, Sadie A.; Hannan, Markus C.; Codore, Hiba; Fero, Kandice; Li, Grace H.; Moak, Zachary; Yokogawa, Tohei; Burgess, Harold A.

    2012-01-01

    Transgenic technologies enable the manipulation and observation of circuits controlling behavior by permitting expression of genetically encoded reporter genes in neurons. Frequently though, neuronal expression is accompanied by transgene expression in non-neuronal tissues, which may preclude key experimental manipulations, including assessment of the contribution of neurons to behavior by ablation. To better restrict transgene expression to the nervous system in zebrafish larvae, we have used DNA sequences derived from the neuron-restrictive silencing element (NRSE). We find that one such sequence, REx2, when used in conjunction with several basal promoters, robustly suppresses transgene expression in non-neuronal tissues. Both in transient transgenic experiments and in stable enhancer trap lines, suppression is achieved without compromising expression within the nervous system. Furthermore, in REx2 enhancer trap lines non-neuronal expression can be de-repressed by knocking down expression of the NRSE binding protein RE1-silencing transcription factor (Rest). In one line, we show that the resulting pattern of reporter gene expression coincides with that of the adjacent endogenous gene, hapln3. We demonstrate that three common basal promoters are susceptible to the effects of the REx2 element, suggesting that this method may be useful for confining expression from many other promoters to the nervous system. This technique enables neural specific targeting of reporter genes and thus will facilitate the use of transgenic methods to manipulate circuit function in freely behaving larvae. PMID:23293587

  19. Genetic architecture of wood properties based on association analysis and co-expression networks in white spruce.

    PubMed

    Lamara, Mebarek; Raherison, Elie; Lenz, Patrick; Beaulieu, Jean; Bousquet, Jean; MacKay, John

    2016-04-01

    Association studies are widely utilized to analyze complex traits but their ability to disclose genetic architectures is often limited by statistical constraints, and functional insights are usually minimal in nonmodel organisms like forest trees. We developed an approach to integrate association mapping results with co-expression networks. We tested single nucleotide polymorphisms (SNPs) in 2652 candidate genes for statistical associations with wood density, stiffness, microfibril angle and ring width in a population of 1694 white spruce trees (Picea glauca). Associations mapping identified 229-292 genes per wood trait using a statistical significance level of P < 0.05 to maximize discovery. Over-representation of genes associated for nearly all traits was found in a xylem preferential co-expression group developed in independent experiments. A xylem co-expression network was reconstructed with 180 wood associated genes and several known MYB and NAC regulators were identified as network hubs. The network revealed a link between the gene PgNAC8, wood stiffness and microfibril angle, as well as considerable within-season variation for both genetic control of wood traits and gene expression. Trait associations were distributed throughout the network suggesting complex interactions and pleiotropic effects. Our findings indicate that integration of association mapping and co-expression networks enhances our understanding of complex wood traits. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  20. A detailed transcript-level probe annotation reveals alternative splicing based microarray platform differences

    PubMed Central

    Lee, Joseph C; Stiles, David; Lu, Jun; Cam, Margaret C

    2007-01-01

    Background Microarrays are a popular tool used in experiments to measure gene expression levels. Improving the reproducibility of microarray results produced by different chips from various manufacturers is important to create comparable and combinable experimental results. Alternative splicing has been cited as a possible cause of differences in expression measurements across platforms, though no study to this point has been conducted to show its influence in cross-platform differences. Results Using probe sequence data, a new microarray probe/transcript annotation was created based on the AceView Aug05 release that allowed for the categorization of genes based on their expression measurements' susceptibility to alternative splicing differences across microarray platforms. Examining gene expression data from multiple platforms in light of the new categorization, genes unsusceptible to alternative splicing differences showed higher signal agreement than those genes most susceptible to alternative splicing differences. The analysis gave rise to a different probe-level visualization method that can highlight probe differences according to transcript specificity. Conclusion The results highlight the need for detailed probe annotation at the transcriptome level. The presence of alternative splicing within a given sample can affect gene expression measurements and is a contributing factor to overall technical differences across platforms. PMID:17708771

Top