Modulation of Mrp1 (ABCc1) and Pgp (ABCb1) by Bilirubin at the Blood-CSF and Blood-Brain Barriers in the Gunn Rat

PubMed Central

Gazzin, Silvia; Berengeno, Andrea Lorena; Strazielle, Nathalie; Fazzari, Francesco; Raseni, Alan; Ostrow, J. Donald; Wennberg, Richard; Ghersi-Egea, Jean-François; Tiribelli, Claudio

2011-01-01

Accumulation of unconjugated bilirubin (UCB) in the brain causes bilirubin encephalopathy. Pgp (ABCb1) and Mrp1 (ABCc1), highly expressed in the blood-brain barrier (BBB) and blood-cerebrospinal fluid barrier (BCSFB) respectively, may modulate the accumulation of UCB in brain. We examined the effect of prolonged exposure to elevated concentrations of UCB on expression of the two transporters in homozygous, jaundiced (jj) Gunn rats compared to heterozygous, not jaundiced (Jj) littermates at different developmental stages (2, 9, 17 and 60 days after birth). BBB Pgp protein expression was low in both jj and Jj pups at 9 days (about 16–27% of adult values), despite the up-regulation in jj animals (2 and 1.3 fold higher than age matched Jj animals at P9 and P17–P60, respectively); Mrp1 protein expression was barely detectable. Conversely, at the BCSFB Mrp1 protein expression was rather high (60–70% of the adult values) in both jj and Jj at P2, but was markedly (50%) down-regulated in jj pups starting at P9, particularly in the 4th ventricle choroid plexuses: Pgp was almost undetectable. The Mrp1 protein down regulation was accompanied by a modest up-regulation of mRNA, suggesting a translational rather than a transcriptional inhibition. In vitro exposure of choroid plexus epithelial cells obtained from normal rats to UCB, also resulted in a down-regulation of Mrp1 protein. These data suggest that down-regulation of Mrp1 protein at the BSCFB, resulting from a direct effect of UCB on epithelial cells, may impact the Mrp1-mediated neuroprotective functions of the blood-cerebrospinal fluid barrier and actually potentiate UCB neurotoxicity. PMID:21297965

Modulation of Mrp1 (ABCc1) and Pgp (ABCb1) by bilirubin at the blood-CSF and blood-brain barriers in the Gunn rat.

PubMed

Gazzin, Silvia; Berengeno, Andrea Lorena; Strazielle, Nathalie; Fazzari, Francesco; Raseni, Alan; Ostrow, J Donald; Wennberg, Richard; Ghersi-Egea, Jean-François; Tiribelli, Claudio

2011-01-31

Accumulation of unconjugated bilirubin (UCB) in the brain causes bilirubin encephalopathy. Pgp (ABCb1) and Mrp1 (ABCc1), highly expressed in the blood-brain barrier (BBB) and blood-cerebrospinal fluid barrier (BCSFB) respectively, may modulate the accumulation of UCB in brain. We examined the effect of prolonged exposure to elevated concentrations of UCB on expression of the two transporters in homozygous, jaundiced (jj) Gunn rats compared to heterozygous, not jaundiced (Jj) littermates at different developmental stages (2, 9, 17 and 60 days after birth). BBB Pgp protein expression was low in both jj and Jj pups at 9 days (about 16-27% of adult values), despite the up-regulation in jj animals (2 and 1.3 fold higher than age matched Jj animals at P9 and P17-P60, respectively); Mrp1 protein expression was barely detectable. Conversely, at the BCSFB Mrp1 protein expression was rather high (60-70% of the adult values) in both jj and Jj at P2, but was markedly (50%) down-regulated in jj pups starting at P9, particularly in the 4(th) ventricle choroid plexuses: Pgp was almost undetectable. The Mrp1 protein down regulation was accompanied by a modest up-regulation of mRNA, suggesting a translational rather than a transcriptional inhibition. In vitro exposure of choroid plexus epithelial cells obtained from normal rats to UCB, also resulted in a down-regulation of Mrp1 protein. These data suggest that down-regulation of Mrp1 protein at the BSCFB, resulting from a direct effect of UCB on epithelial cells, may impact the Mrp1-mediated neuroprotective functions of the blood-cerebrospinal fluid barrier and actually potentiate UCB neurotoxicity.

Developmental transcriptome analysis of floral transition in Rosa odorata var. gigantea.

PubMed

Guo, Xuelian; Yu, Chao; Luo, Le; Wan, Huihua; Zhen, Ni; Li, Yushu; Cheng, Tangren; Wang, Jia; Pan, Huitang; Zhang, Qixiang

2018-05-07

Expression analyses revealed that floral transition of Rosa odorata var. gigantea is mainly regulated by VRN1, COLs, DELLA and KSN, with contributions by the effects of phytohormone and starch metabolism. Seasonal plants utilize changing environmental and developmental cues to control the transition from vegetative growth to flowering at the correct time of year. This study investigated global gene expression profiles at different developmental stages of Rosa odorata var. gigantea by RNA-sequencing, combined with phenotypic characterization and physiological changes. Gene ontology enrichment analysis of the differentially expressed genes (DEGs) between four different developmental stages (vegetative meristem, pre-floral meristem, floral meristem and secondary axillary buds) indicated that DNA methylation and the light reaction played a large role in inducing the rose floral transition. The expression of SUF and FLC, which are known to play a role in delaying flowering until vernalization, was down-regulated from the vegetative to the pre-floral meristem stage. In contrast, the expression of VRN1, which promotes flowering by repressing FLC expression, increased. The expression of DELLA proteins, which function as central nodes in hormone signaling pathways, and probably involve interactions between GA, auxin, and ABA to promote the floral transition, was well correlated with the expression of floral integrators, such as AGL24, COL4. We also identified DEGs associated with starch metabolism correlated with SOC1, AGL15, SPL3, AGL24, respectively. Taken together, our results suggest that vernalization and photoperiod are prominent cues to induce the rose floral transition, and that DELLA proteins also act as key regulators. The results summarized in the study on the floral transition of the seasonal rose lay a foundation for further functional demonstration, and have profound economic and ornamental values.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation

PubMed Central

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-01-01

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in BdnflacZ/+ mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. PMID:26164656

Transcriptomic Analysis of Grapevine (cv. Summer Black) Leaf, Using the Illumina Platform

PubMed Central

Pervaiz, Tariq; Haifeng, Jia; Salman Haider, Muhammad; Cheng, Zhang; Cui, Mengjie; Wang, Mengqi; Cui, Liwen; Wang, Xicheng; Fang, Jinggui

2016-01-01

Proceeding to illumina sequencing, determining RNA integrity numbers for poly RNA were separated from each of the four developmental stages of cv. Summer Black leaves by using Illumina HiSeq™ 2000. The sums of 272,941,656 reads were generated from vitis vinifera leaf at four different developmental stages, with more than 27 billion nucleotides of the sequence data. At each growth stage, RNA samples were indexed through unique nucleic acid identifiers and sequenced. KEGG annotation results depicted that the highest number of transcripts in 2,963 (2Avs4A) followed by 1Avs4A (2,920), and 3Avs4A (2,294) out of 15,614 (71%) transcripts were recorded. In comparison, a total of 1,532 transcripts were annotated in GOs, including Cellular component, with the highest number in “Cell part” 251 out of 353 transcripts (71.1%), followed by intracellular organelle 163 out of 353 transcripts (46.2%), while in molecular function and metabolic process 375 out of 525 (71.4%) transcripts, multicellular organism process 40 out of 525 (7.6%) transcripts in biological process were most common in 1Avs2A. While in case of 1Avs3A, cell part 476 out of 662 transcripts (71.9%), and membrane-bounded organelle 263 out of 662 transcripts (39.7%) were recorded in Cellular component. In the grapevine transcriptome, during the initial stages of leaf development 1Avs2A showed single transcript was down-regulated and none of them were up-regulated. While in comparison of 1A to 3A showed one up-regulated (photosystem II reaction center protein C) and one down regulated (conserved gene of unknown function) transcripts, during the hormone regulating pathway namely SAUR-like auxin-responsive protein family having 2 up-regulated and 7 down-regulated transcripts, phytochrome-associated protein showed 1 up-regulated and 9 down-regulated transcripts, whereas genes associated with the Leucine-rich repeat protein kinase family protein showed 7 up-regulated and 1 down-regulated transcript, meanwhile Auxin Resistant 2 has single up-regulated transcript in second developmental stage, although 3 were down-regulated at lateral growth stages (3A and 4A). In the present study, 489 secondary metabolic pathways related genes were identified during leaf growth, which mainly includes alkaloid (40), anthocyanins (21), Diterpenoid (144), Monoterpenoid (90) and Flavonoids (93). Quantitative real-time PCR was applied to validate 10 differentially expressed transcripts patterns from flower, leaf and fruit metabolic pathways at different growth stages. PMID:26824474

Reciprocal Expression of lin-41 and the microRNAs let-7 and mir-125 During Mouse Embryogenesis

PubMed Central

Schulman, Betsy R. Maller; Esquela-Kerscher, Aurora; Slack, Frank J.

2008-01-01

In C. elegans, heterochronic genes control the timing of cell fate determination during development. Two heterochronic genes, let-7 and lin-4, encode microRNAs (miRNAs) that down-regulate a third heterochronic gene lin-41 by binding to complementary sites in its 3’UTR. let-7 and lin-4 are conserved in mammals. Here we report the cloning and sequencing of mammalian lin-41 orthologs. We find that mouse and human lin-41 genes contain predicted conserved complementary sites for let-7 and the lin-4 ortholog, mir-125, in their 3’UTRs. Mouse lin-41 (Mlin-41) is temporally expressed in developing mouse embryos, most dramatically in the limb buds. Mlin-41 is down-regulated during mid-embryogenesis at the time when mouse let-7c and mir-125 RNA levels are up-regulated. Our results suggest that mammalian lin-41 is temporally regulated by miRNAs in order to direct key developmental events such as limb formation. PMID:16247770

De novo sequencing and comparative transcriptome analysis of the male and hermaphroditic flowers provide insights into the regulation of flower formation in andromonoecious taihangia rupestris.

PubMed

Li, Weiguo; Zhang, Lihui; Ding, Zhan; Wang, Guodong; Zhang, Yandi; Gong, Hongmei; Chang, Tianjun; Zhang, Yanwen

2017-02-28

Taihangia rupestris, an andromonoecious plant species, bears both male and hermaphroditic flowers within the same individual. However, the establishment and development of male and hermaphroditic flowers in andromonoecious Taihangia remain poorly understood, due to the limited genetic and sequence information. To investigate the potential molecular mechanism in the regulation of Taihangia flower formation, we used de novo RNA sequencing to compare the transcriptome profiles of male and hermaphroditic flowers at early and late developmental stages. Four cDNA libraries, including male floral bud, hermaphroditic floral bud, male flower, and hermaphroditic flower, were constructed and sequenced by using the Illumina RNA-Seq method. Totally, 84,596,426 qualified Illumina reads were obtained and then assembled into 59,064 unigenes, of which 24,753 unigenes were annotated in the NCBI non-redundant protein database. In addition, 12,214, 7,153, and 8,115 unigenes were assigned into 53 Gene Ontology (GO) functional groups, 25 Clusters of Orthologous Group (COG) categories, and 126 Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, respectively. By pairwise comparison of unigene abundance between the samples, we identified 1,668 differential expressed genes (DEGs), including 176 transcription factors (TFs) between the male and hermaphroditic flowers. At the early developmental stage, we found 263 up-regulated genes and 436 down-regulated genes expressed in hermaphroditic floral buds, while 844 up-regulated genes and 314 down-regulated genes were detected in hermaphroditic flowers at the late developmental stage. GO and KEGG enrichment analyses showed that a large number of DEGs were associated with a wide range of functions, including cell cycle, epigenetic processes, flower development, and biosynthesis of unsaturated fatty acid pathway. Finally, real-time quantitative PCR was conducted to validate the DEGs identified in the present study. In this study, transcriptome data of this rare andromonoecious Taihangia were reported for the first time. Comparative transcriptome analysis revealed the significant differences in gene expression profiles between male and hermaphroditic flowers at early and late developmental stages. The transcriptome data of Taihangia would be helpful to improve the understanding of the underlying molecular mechanisms in regulation of flower formation and unisexual flower establishment in andromonoecious plants.

Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

PubMed Central

Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

2015-01-01

Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

ING2 (inhibitor of growth protein-2) plays a crucial role in preimplantation development.

PubMed

Zhou, Lin; Wang, Pei; Zhang, Juanjuan; Heng, Boon Chin; Tong, Guo Qing

2016-02-01

ING2 (inhibitor of growth protein-2) is a member of the ING-gene family and participates in diverse cellular processes involving tumor suppression, DNA repair, cell cycle regulation, and cellular senescence. As a subunit of the Sin3 histone deacetylase complex co-repressor complex, ING2 binds to H3K4me3 to regulate chromatin modification and gene expression. Additionally, ING2 recruits histone methyltransferase (HMT) activity for gene repression, which is independent of the HDAC class I or II pathway. However, the physiological function of ING2 in mouse preimplantation embryo development has not yet been characterized previously. The expression, localization and function of ING2 during preimplantation development were investigated in this study. We showed increasing expression of ING2 within the nucleus from the 4-cell embryo stage onwards; and that down-regulation of ING2 expression by endoribonuclease-prepared small interfering RNA (esiRNA) microinjection results in developmental arrest during the morula to blastocyst transition. Embryonic cells microinjected with ING2-specific esiRNA exhibited decreased blastulation rate compared to the negative control. Further investigation of the underlying mechanism indicated that down-regulation of ING2 significantly increased expression of p21, whilst decreasing expression of HDAC1. These results suggest that ING2 may play a crucial role in the process of preimplantation embryo development through chromatin regulation.

Interspecies modulation of bacterial development through iron competition and siderophore piracy

PubMed Central

Traxler, Matthew F.; Seyedsayamdost, Mohammad R.; Clardy, Jon; Kolter, Roberto

2012-01-01

Summary While soil-dwelling actinomycetes are renowned for secreting natural products, little is known about the roles of these molecules in mediating actinomycete interactions. In a previous co-culture screen, we found that one actinomycete, Amycolatopsis sp. AA4, inhibited aerial hyphae formation in adjacent colonies of Streptomyces coelicolor. A siderophore, amychelin, mediated this developmental arrest. Here we present genetic evidence that confirms the role of the amc locus in the production of amychelin and in the inhibition of S. coelicolor development. We further characterize the Amycolatopsis sp. AA4 - S. coelicolor interaction by examining expression of developmental and iron acquisition genes over time in co-culture. Manipulation of iron availability and/or growth near Amycolatopsis sp. AA4 led to alterations in expression of the critical developmental gene bldN, and other key down-stream genes in the S. coelicolor transcriptional cascade. In Amycolatopsis sp. AA4, siderophore genes were down-regulated when grown near S. coelicolor, leading us to find that deferrioxamine E, produced by S. coelicolor, could be readily utilized by Amycolatopsis sp. AA4. Collectively these results suggest that competition for iron via siderophore piracy and species-specific siderophores can alter patterns of gene expression and morphological differentiation during actinomycete interactions. PMID:22931126

Ontogenetic changes and developmental adjustments in lactate dehydrogenase isozymes of an obligate air-breathing fish Channa punctatus during deprivation of air access.

PubMed

Ahmad, Riaz; Hasnain, Absar-Ul

2005-02-01

In air-breathing snakehead Channa punctatus, Ldh-B is expressed at all ontogenetic and developmental stages, while Ldh-A is expressed temporally in pre-hatchlings 12-13 days ahead of bimodal respiration marked by air-breathing. Remarkable differences are observed in the LDH isozyme expression among various ontogenetic and developmental stages upon denying air access. When denied air access, water-breathing larvae show two distinct characteristics: (i) they survive longer than transitory air-breathers due to independence from air-breathing and (ii) there is more transient induction of Ldh-B than Ldh-A. Transition to bimodal breathing, which occurred post-hatching in 15-day old larvae, is coincidental with inducibility of Ldh-A and concomitant down-regulation of Ldh-B. Heart tissue from air-breathing adults denied air access shows a preferential expression of LDH-A subunit and slight down-regulation of LDH-B. Heterotetramers of A and B subunits participate in adjusting LDH levels among those stages which either precede air-breathing switchover, or are subsequent to this transition. The contribution of heterotetramers depends on the stage-specific levels of LDH homotetramers A(4) or B(4). Scaling of muscle mass during growth, tolerance to extended deprivation of air access and induction of Ldh-A are correlated. Response to restoring air contact indicated that advanced air-breathing stages of C. punctatus possess an inherent capacity to sense surface air. In kinetic properties, LDH isozymes of C. punctatus are teleost-like but species specificity is displayed in oxidative potential by cardiac muscle and in L-lactate reduction by skeletal muscle.

Striated muscle preferentially expressed genes alpha and beta are two serine/threonine protein kinases derived from the same gene as the aortic preferentially expressed gene-1.

PubMed

Hsieh, C M; Fukumoto, S; Layne, M D; Maemura, K; Charles, H; Patel, A; Perrella, M A; Lee, M E

2000-11-24

Aortic preferentially expressed gene (APEG)-1 is a 1.4-kilobase pair (kb) mRNA expressed in vascular smooth muscle cells and is down-regulated by vascular injury. An APEG-1 5'-end cDNA probe identified three additional isoforms. The 9-kb striated preferentially expressed gene (SPEG)alpha and the 11-kb SPEGbeta were found in skeletal muscle and heart. The 4-kb brain preferentially expressed gene was detected in the brain and aorta. We report here cloning of the 11-kb SPEGbeta cDNA. SPEGbeta encodes a 355-kDa protein that contains two serine/threonine kinase domains and is homologous to proteins of the myosin light chain kinase family. At least one kinase domain is active and capable of autophosphorylation. In the genome, all four isoforms share the middle three of the five exons of APEG-1, and they differ from each other by using different 5'- and 3'-ends and alternative splicing. We show that the expression of SPEGalpha and SPEGbeta is developmentally regulated in the striated muscle during C2C12 myoblast to myotube differentiation in vitro and cardiomyocyte maturation in vivo. This developmental regulation suggests that both SPEGalpha and SPEGbeta can serve as sensitive markers for striated muscle differentiation and that they may be important for adult striated muscle function.

Time-dependent inhibitory effects of Tris(1, 3-dichloro-2-propyl) phosphate on growth and transcription of genes involved in the GH/IGF axis, but not the HPT axis, in female zebrafish.

PubMed

Zhu, Ya; Su, Guanyong; Yang, Dandong; Zhang, Yongkang; Yu, Liqin; Li, Yufei; Giesy, John P; Letcher, Robert J; Liu, Chunsheng

2017-10-01

Growth curves were used to determine sensitive exposure windows for evaluation of developmental toxicity of chemicals to zebrafish. Dose- and time-dependent effects on body mass, body length and expression of genes involved in the growth hormone/insulin-like growth factor (GH/IGF) axis and the hypothalamic-pituitary-thyroid (HPT) axis were examined after exposure to environmentally relevant concentrations of tris(1,3-dichloro-2-propyl) phosphate (TDCIPP). Based on growth curves, zebrafish grew most rapidly between 60 and 90 days post fertilization (dpf). Exposure to environmentally relevant concentrations of TDCIPP significantly decreased body mass and body length and down-regulated expression of several genes involved in the GH/IGF axis of female zebrafish, but no such effects were observed in male zebrafish. Exposure to TDCIPP did not change concentrations of thyroid hormones or expression of genes along the HPT axis in female and male zebrafish. These results suggest that growth stages of zebrafish between 60 and 90 dpf might be most appropriate for evaluation of developmental toxicity of chemicals, and down-regulation of genes involved in the GH/IGF axis, but not the HPT axis, might be responsible for the observed growth inhibition in females exposed to TDCIPP. Copyright © 2017 Elsevier Ltd. All rights reserved.

Ectopic expression of UGT84A2 delayed flowering by indole-3-butyric acid-mediated transcriptional repression of ARF6 and ARF8 genes in Arabidopsis.

PubMed

Zhang, Gui-Zhi; Jin, Shang-Hui; Li, Pan; Jiang, Xiao-Yi; Li, Yan-Jie; Hou, Bing-Kai

2017-12-01

Ectopic expression of auxin glycosyltransferase UGT84A2 in Arabidopsis can delay flowering through increased indole-3-butyric acid and suppressed transcription of ARF6, ARF8 and flowering-related genes FT, SOC1, AP1 and LFY. Auxins are critical regulators for plant growth and developmental processes. Auxin homeostasis is thus an important issue for plant biology. Here, we identified an indole-3-butyric acid (IBA)-specific glycosyltransferase, UGT84A2, and characterized its role in Arabidopsis flowering development. UGT84A2 could catalyze the glycosylation of IBA, but not indole-3-acetic acid (IAA). UGT84A2 transcription expression was clearly induced by IBA. When ectopically expressing in Arabidopsis, UGT84A2 caused obvious delay in flowering. Correspondingly, the increase of IBA level, the down-regulation of AUXIN RESPONSE FACTOR 6 (ARF6) and ARF8, and the down-regulation of flowering-related genes such as FLOWERING LOCUS T (FT), SUPPRESSOR OF OVEREXPRESSION OF CO1(SOC1), APETALA1 (AP1), and LEAFY(LFY) were observed in transgenic plants. When exogenously applying IBA to wild-type plants, the late flowering phenotype, the down-regulation of ARF6, ARF8 and flowering-related genes recurred. We examined the arf6arf8 double mutants and found that the expression of flowering-related genes was also substantially decreased in these mutants. Together, our results suggest that glycosyltransferase UGT84A2 may be involved in flowering regulation through indole-3-butyric acid-mediated transcriptional repression of ARF6, ARF8 and downstream flowering pathway genes.

Postnatal reduction of BDNF regulates the developmental remodeling of taste bud innervation.

PubMed

Huang, Tao; Ma, Liqun; Krimm, Robin F

2015-09-15

The refinement of innervation is a common developmental mechanism that serves to increase the specificity of connections following initial innervation. In the peripheral gustatory system, the extent to which innervation is refined and how refinement might be regulated is unclear. The initial innervation of taste buds is controlled by brain-derived neurotrophic factor (BDNF). Following initial innervation, taste receptor cells are added and become newly innervated. The connections between the taste receptor cells and nerve fibers are likely to be specific in order to retain peripheral coding mechanisms. Here, we explored the possibility that the down-regulation of BDNF regulates the refinement of taste bud innervation during postnatal development. An analysis of BDNF expression in Bdnf(lacZ/+) mice and real-time reverse transcription polymerase chain reaction (RT-PCR) revealed that BDNF was down-regulated between postnatal day (P) 5 and P10. This reduction in BDNF expression was due to a loss of precursor/progenitor cells that express BDNF, while the expression of BDNF in the subpopulations of taste receptor cells did not change. Gustatory innervation, which was identified by P2X3 immunohistochemistry, was lost around the perimeter where most progenitor/precursor cells are located. In addition, the density of innervation in the taste bud was reduced between P5 and P10, because taste buds increase in size without increasing innervation. This reduction of innervation density was blocked by the overexpression of BDNF in the precursor/progenitor population of taste bud cells. Together these findings indicate that the process of BDNF restriction to a subpopulation of taste receptor cells between P5 and P10, results in a refinement of gustatory innervation. We speculate that this refinement results in an increased specificity of connections between neurons and taste receptor cells during development. Copyright © 2015 Elsevier Inc. All rights reserved.

Gene expression patterns during somatic embryo development and germination in maize Hi II callus cultures.

PubMed

Che, Ping; Love, Tanzy M; Frame, Bronwyn R; Wang, Kan; Carriquiry, Alicia L; Howell, Stephen H

2006-09-01

Gene expression patterns were profiled during somatic embryogenesis in a regeneration-proficient maize hybrid line, Hi II, in an effort to identify genes that might be used as developmental markers or targets to optimize regeneration steps for recovering maize plants from tissue culture. Gene expression profiles were generated from embryogenic calli induced to undergo embryo maturation and germination. Over 1,000 genes in the 12,060 element arrays showed significant time variation during somatic embryo development. A substantial number of genes were downregulated during embryo maturation, largely histone and ribosomal protein genes, which may result from a slowdown in cell proliferation and growth during embryo maturation. The expression of these genes dramatically recovered at germination. Other genes up-regulated during embryo maturation included genes encoding hydrolytic enzymes (nucleases, glucosidases and proteases) and a few storage genes (an alpha-zein and caleosin), which are good candidates for developmental marker genes. Germination is accompanied by the up-regulation of a number of stress response and membrane transporter genes, and, as expected, greening is associated with the up-regulation of many genes encoding photosynthetic and chloroplast components. Thus, some, but not all genes typically associated with zygotic embryogenesis are significantly up or down-regulated during somatic embryogenesis in Hi II maize line regeneration. Although many genes varied in expression throughout somatic embryo development in this study, no statistically significant gene expression changes were detected between total embryogenic callus and callus enriched for transition stage somatic embryos.

nAChRs-ERK1/2-Egr-1 signaling participates in the developmental toxicity of nicotine by epigenetically down-regulating placental 11β-HSD2.

PubMed

Zhou, Jin; Liu, Fulin; Yu, Luting; Xu, Dan; Li, Bin; Zhang, Guohui; Huang, Wen; Li, Lu; Zhang, Yuanzhen; Zhang, Wei; Wang, Hui

2018-04-01

Impaired placental 11β-hydroxysteroid dehydrogenase type 2 (11β-HSD2) activity which inactivates maternal glucocorticoids is associated with poor fetal growth and a higher risk of chronic diseases in adulthood. This study aimed to elucidate the epigenetically regulatory mechanism of nicotine on placental 11β-HSD2 expression. Pregnant Wistar rats were administered 1.0 mg/kg nicotine subcutaneously twice a day from gestational day 9 to 20. The results showed that prenatal nicotine exposure increased corticosterone levels in the placenta and fetal serum, disrupted placental morphology and endocrine function, and reduced fetal bodyweight. Meanwhile, histone modification abnormalities (decreased acetylation and increased di-methylation of histone 3 Lysine 9) on the HSD11B2 promoter and lower-expression of 11β-HSD2 were observed. Furthermore, the expression of nicotinic acetylcholine receptor (nAChR) α4/β2, the phosphorylation of extracellular regulated kinase 1/2 (ERK1/2) and Ets-like protein-1 (Elk-1), and the expression of early growth response-1 (Egr-1) were increased in the nicotine groups. In human BeWo cells, nicotine decreased 11β-HSD2 expression, increased nAChRα9 expression, and activated ERK1/2/Elk-1/Egr-1 signaling in the concentration (0.1-10 μM)-dependent manner. Antagonism of nAChRs, inhibition of ERK1/2 and Egr-1 knockdown by siRNA were able to block/abrogate the effects of nicotine on histone modification and expression of 11β-HSD2. Taken together, nicotine can impair placental structure and function, and induce fetal developmental toxicity. The underlying mechanism involves histone modifications and down-regulation of 11β-HSD2 through nAChRs/ERK1/2/Elk-1/Egr-1 signaling, which increases active glucocorticoids levels in the placenta and fetus, and eventually inhibits the fetal development. Copyright © 2018 Elsevier Inc. All rights reserved.

Protective effects of puerarin against tetrabromobisphenol a-induced apoptosis and cardiac developmental toxicity in zebrafish embryo-larvae.

PubMed

Yang, Suwen; Wang, Shengrui; Sun, Fengchao; Zhang, Mengmeng; Wu, Fengchang; Xu, Fanfan; Ding, Zhishan

2015-09-01

Tetrabromobisphenol A (TBBPA), a brominated flame retardant, is detected commonly in aquatic environments, where it is thought to be highly toxic to the development of aquatic life. In this study, zebrafish embryos and larvae were used to investigate the protective effects of puerarin after exposure to TBBPA. Malformation, blood flow disorders, pericardial edema, and spawn coagulation rates increased, whereas survival decreased significantly after exposure to 0.5 and 1.0 mg L(-1) TBBPA. The measured indices of morphological toxicity improved after treatment with puerarin. TBBPA also induced reactive oxygen species (ROS) production in a dose-dependent manner. Acridine orange staining results revealed that TBBPA exposure caused cardiomyocyte apoptosis and induced the expression of three proapoptotic genes: P53, Bax, and Caspase9. In contrast, the expression of the antiapoptotic gene Bcl2 was down-regulated. When genes related to cardiac development were assessed, the expression of Tbx1, Raldh2, and Bmp2b changed after exposure to the combination of TBBPA and puerarin. These results suggest that TBBPA induces cardiomyocyte apoptosis and ROS production, resulting in cardiac developmental toxicity in zebrafish embryos or larvae. Therefore, puerarin regulates the expression of cardiac developmental genes, such as Tbx1, Bmp2b, and Raldh2 by inhibiting ROS production, and subsequently modulates cardiac development after the exposure of zebrafish larvae to TBBPA. © 2014 Wiley Periodicals, Inc.

Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis

PubMed Central

Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K.

2012-01-01

Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3′ untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior. PMID:22645327

Sex-lethal enables germline stem cell differentiation by down-regulating Nanos protein levels during Drosophila oogenesis.

PubMed

Chau, Johnnie; Kulnane, Laura Shapiro; Salz, Helen K

2012-06-12

Drosophila ovarian germ cells require Sex-lethal (Sxl) to exit from the stem cell state and to enter the differentiation pathway. Sxl encodes a female-specific RNA binding protein and in somatic cells serves as the developmental switch gene for somatic sex determination and X-chromosome dosage compensation. None of the known Sxl target genes are required for germline differentiation, leaving open the question of how Sxl promotes the transition from stem cell to committed daughter cell. We address the mechanism by which Sxl regulates this transition through the identification of nanos as one of its target genes. Previous studies have shown that Nanos protein is necessary for GSC self-renewal and is rapidly down-regulated in the daughter cells fated to differentiate in the adult ovary. We find that this dynamic expression pattern is limited to female germ cells and is under Sxl control. In the absence of Sxl, or in male germ cells, Nanos protein is continuously expressed. Furthermore, this female-specific expression pattern is dependent on the presence of canonical Sxl binding sites located in the nanos 3' untranslated region. These results, combined with the observation that nanos RNA associates with the Sxl protein in ovarian extracts and loss and gain of function studies, suggest that Sxl enables the switch from germline stem cell to committed daughter cell by posttranscriptional down-regulation of nanos expression. These findings connect sexual identity to the stem cell self-renewal/differentiation decision and highlight the importance of posttranscriptional gene regulatory networks in controlling stem cell behavior.

Effects of seawater acidification on gene expression: resolving broader-scale trends in sea urchins.

PubMed

Evans, Tyler G; Watson-Wynn, Priscilla

2014-06-01

Sea urchins are ecologically and economically important calcifying organisms threatened by acidification of the global ocean caused by anthropogenic CO2 emissions. Propelled by the sequencing of the purple sea urchin (Strongylocentrotus purpuratus) genome, profiling changes in gene expression during exposure to high pCO2 seawater has emerged as a powerful and increasingly common method to infer the response of urchins to ocean change. However, analyses of gene expression are sensitive to experimental methodology, and comparisons between studies of genes regulated by ocean acidification are most often made in the context of major caveats. Here we perform meta-analyses as a means of minimizing experimental discrepancies and resolving broader-scale trends regarding the effects of ocean acidification on gene expression in urchins. Analyses across eight studies and four urchin species largely support prevailing hypotheses about the impact of ocean acidification on marine calcifiers. The predominant expression pattern involved the down-regulation of genes within energy-producing pathways, a clear indication of metabolic depression. Genes with functions in ion transport were significantly over-represented and are most plausibly contributing to intracellular pH regulation. Expression profiles provided extensive evidence for an impact on biomineralization, epitomized by the down-regulation of seven spicule matrix proteins. In contrast, expression profiles provided limited evidence for CO2-mediated developmental delay or induction of a cellular stress response. Congruence between studies of gene expression and the ocean acidification literature in general validates the accuracy of gene expression in predicting the consequences of ocean change and justifies its continued use in future studies. © 2014 Marine Biological Laboratory.

Extending juvenility in grasses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaeppler, Shawn; de Leon Gatti, Natalia; Foerster, Jillian

The present invention relates to compositions and methods for modulating the juvenile to adult developmental growth transition in plants, such as grasses (e.g. maize). In particular, the invention provides methods for enhancing agronomic properties in plants by modulating expression of GRMZM2G362718, GRMZM2G096016, or homologs thereof. Modulation of expression of one or more additional genes which affect juvenile to adult developmental growth transition such as Glossy15 or Cg1, in conjunction with such modulation of expression is also contemplated. Nucleic acid constructs for down-regulation of GRMZM2G362718 and/or GRMZM2G096016 are also contemplated, as are transgenic plants and products produced there from, that demonstratemore » altered, such as extended juvenile growth, and display associated phenotypes such as enhanced yield, improved digestibility, and increased disease resistance. Plants described herein may be used, for example, as improved forage or feed crops or in biofuel production.« less

A novel interplay between the ubiquitin–proteasome system and serine proteases during Drosophila development.

PubMed

Lipinszki, Zoltán; Klement, Eva; Hunyadi-Gulyas, Eva; Medzihradszky, Katalin F; Márkus, Róbert; Pál, Margit; Deák, Péter; Udvardy, Andor

2013-09-15

The concentrations of the Drosophila proteasomal and extraproteasomal polyubiquitin receptors fluctuate in a developmentally regulated fashion. This fluctuation is generated by a previously unidentified proteolytic activity. In the present paper, we describe the purification, identification and characterization of this protease (endoproteinase I). Its expression increases sharply at the L1-L2 larval stages, remains high until the second half of the L3 stage, then declines dramatically. This sharp decrease coincides precisely with the increase of polyubiquitin receptor concentrations in late L3 larvae, which suggests a tight developmental co-regulation. RNAi-induced down-regulation of endoproteinase I results in pupal lethality. Interestingly, we found a cross-talk between the 26S proteasome and this larval protease: transgenic overexpression of the in vivo target of endoproteinase I, the C-terminal half of the proteasomal polyubiquitin receptor subunit p54/Rpn10 results in transcriptional down-regulation of endoproteinase I and consequently a lower level of proteolytic elimination of the polyubiquitin receptors. Another larval protease, Jonah65A-IV, which degrades only unfolded proteins and exhibits similar cross-talk with the proteasome has also been purified and characterized. It may prevent the accumulation of polyubiquitylated proteins in larvae contrary to the low polyubiquitin receptor concentration.

Cumulus cells surrounding oocytes with high developmental competence exhibit down-regulation of phosphoinositol 1,3 kinase/protein kinase B (PI3K/AKT) signalling genes involved in proliferation and survival

PubMed Central

Artini, P G; Tatone, C; Sperduti, S; D’Aurora, M; Franchi, S; Di Emidio, G; Ciriminna, R; Vento, M; Di Pietro, C; Stuppia, L; Gatta, V

2017-01-01

Abstract STUDY QUESTION Is the phosphoinositol 1,3-kinase/protein kinase B (PI3K/AKT) pathway expression profile in cumulus cells (CCs) a potential marker of oocyte competence and predictive of pregnancy outcome? SUMMARY ANSWER Eleven genes (AKT1, ARHGEF7, BCL2L1, CCND1, E2F1, HRAS, KCNH2, PIK3C2A, SHC1, SOS1 and SPP1) in the PI3K/AKT pathway were significantly down-regulated in CCs from oocytes that went on to produce a pregnancy compared to CCs associated with a negative outcome. WHAT IS KNOWN ALREADY The PI3K/AKT pathway plays a pivotal role in the interdependence and continuous feedback between the oocyte and CCs. STUDY DESIGN SIZE, DURATION The expression analysis of 92 transcripts in the PI3K/AKT pathway in CCs from patients with negative or positive pregnancy outcome, after single embryo transfer, was performed. Mouse CCs target gene expression was conducted to associate the expression profile of PI3K/AKT pathway to oocyte developmental profile. PARTICIPANTS/MATERIALS, SETTING, METHODS Fifty-five good prognosis IVF patients who had been referred to IVF or intracytoplasmic sperm injection treatment for male-factor infertility or tubal disease were enroled. CCs from single cumulus-oocyte complexes (COCs) from 16 patients who underwent a single embryo transfer were analyzed. Twenty-five CD-1 mice were used to assess gene expression in CCs associated with oocytes with different competence in relation to hCG priming. A total 220 human COCs were collected. The RNA extracted from CCs of 16 selected patients was used to analyze PI3K/AKT pathway gene expression employing a 96-well custom TaqMan Array. Expression data of CCs associated to positive IVF outcome were compared to data from negative outcome samples. Mice were sacrificed after 9, 12, 15, 21 and 24 h post-hCG administration to obtain CCs from MII oocytes with different developmental competence. Akt1, Bcl2l2 and Shc1 expression were tested in the collected mouse CCs. In addition, the expression of upstream regulator ESR1, the gene encoding for the oestrogen receptor ERβ, and the downstream effectors of the pathway FOXO1, FOXO3 and FOXO4 was evaluated in human and mouse samples. MAIN RESULTS AND THE ROLE OF CHANCE Transcripts involved in the PI3K Signaling Pathway were selectively modulated according to the IVF/ICSI outcome of the oocyte. Eleven transcripts in this pathway were significantly down-regulated in all samples of CCs from oocytes with positive when compared those with a negative outcome. These outcomes were confirmed in mouse CCs associated with oocytes at different maturation stages. Expression data revealed that the down-regulation of ESR1 could be related to oocyte competence and is likely to be the driver of expression changes highlighted in the PI3K/AKT pathway. LIMITATIONS REASONS FOR CAUTION Small sample size and retrospective design. WIDER IMPLICATIONS OF THE FINDINGS The CCs expression profile of PI3K/AKT signaling genes, disclosed a specific CCs gene signature related to oocyte competence. It could be speculated that CCs associated with competent oocytes have completed their role in sustaining oocyte development and are influencing their fate in response to metabolic and hormonal changes by de-activating anti-apoptotic signals. STUDY FUNDING/COMPETING INTEREST(S) Supported by Merck Serono an affiliate of Merck KGaA, Darmstadt, Germany (research grant for the laboratory session; Merck KGaA reviewed the manuscript for medical accuracy only before journal submission. The authors are fully responsible for the content of this manuscript, and the views and opinions described in the publication reflect solely those of the authors). The authors declare no conflict of interest. PMID:29087515

A SWI/SNF Chromatin Remodelling Protein Controls Cytokinin Production through the Regulation of Chromatin Architecture

PubMed Central

Jégu, Teddy; Domenichini, Séverine; Blein, Thomas; Ariel, Federico; Christ, Aurélie; Kim, Soon-Kap; Crespi, Martin; Boutet-Mercey, Stéphanie; Mouille, Grégory; Bourge, Mickaël; Hirt, Heribert; Bergounioux, Catherine; Raynaud, Cécile; Benhamed, Moussa

2015-01-01

Chromatin architecture determines transcriptional accessibility to DNA and consequently gene expression levels in response to developmental and environmental stimuli. Recently, chromatin remodelers such as SWI/SNF complexes have been recognized as key regulators of chromatin architecture. To gain insight into the function of these complexes during root development, we have analyzed Arabidopsis knock-down lines for one sub-unit of SWI/SNF complexes: BAF60. Here, we show that BAF60 is a positive regulator of root development and cell cycle progression in the root meristem via its ability to down-regulate cytokinin production. By opposing both the deposition of active histone marks and the formation of a chromatin regulatory loop, BAF60 negatively regulates two crucial target genes for cytokinin biosynthesis (IPT3 and IPT7) and one cell cycle inhibitor (KRP7). Our results demonstrate that SWI/SNF complexes containing BAF60 are key factors governing the equilibrium between formation and dissociation of a chromatin loop controlling phytohormone production and cell cycle progression. PMID:26457678

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Left-right axis asymmetry determining human Cryptic gene is transcriptionally repressed by Snail.

PubMed

Gupta, Kartik; Pilli, Vijaya Satish Sekhar; Aradhyam, Gopala Krishna

2016-10-28

Establishment of the left-right axis is important for positioning organs asymmetrically in the developing vertebrate-embryo. A number of factors like maternally deposited molecules have emerged essential in initiating the specification of the axis; the downstream events, however, are regulated by signal-transduction and gene-expression changes identifying which remains a crucial challenge. The EGF-CFC family member Cryptic, that functions as a co-receptor for some TGF-beta ligands, is developmentally expressed in higher mammals and mutations in the gene cause loss or change in left-right axis asymmetry. Despite the strong phenotype, no transcriptional-regulator of this gene is known till date. Using promoter-analyses tools, we found strong evidence that the developmentally essential transcription factor Snail binds to the human Cryptic-promoter. We cloned the promoter-region of human Cryptic in a reporter gene and observed decreased Cryptic-promoter activation upon increasing Snail expression. Further, the expression of Cryptic is down-regulated upon exogenous Snail expression, validating the reporter assays and the previously identified role of Snail as a transcriptional repressor. Finally, we demonstrate using gel-shift assay that Snail in nuclear extract of PANC1 cells interacts with the promoter-construct bearing putative Snail binding sites and confirm this finding using chromatin immunoprecipitation assay. Snail represses the expression of human Cryptic and therefore, might affect the signaling via Nodal that has previously been demonstrated to specify the left-right axis using the EGF-CFC co-receptors.

Expressive Vocabulary in Young Children with Down Syndrome: From Research to Treatment.

ERIC Educational Resources Information Center

Kumin, Libby; Councill, Cheryl; Goodman, Mina

1999-01-01

Expressive vocabulary was studied in 130 children (ages 1 to 5 years) with Down syndrome. Although there was continuous growth in expressive referential vocabulary from birth through 5 years, age 5 was found to be an important developmental marker for multiword combinations and grammatical vocabulary. (Author/CR)

Serial analysis of gene expression in the silkworm, Bombyx mori.

PubMed

Huang, Jianhua; Miao, Xuexia; Jin, Weirong; Couble, Pierre; Mita, Kasuei; Zhang, Yong; Liu, Wenbin; Zhuang, Leijun; Shen, Yan; Keime, Celine; Gandrillon, Olivier; Brouilly, Patrick; Briolay, Jerome; Zhao, Guoping; Huang, Yongping

2005-08-01

The silkworm Bombyx mori is one of the most economically important insects and serves as a model for Lepidoptera insects. We used serial analysis of gene expression (SAGE) to derive profiles of expressed genes during the developmental life cycle of the silkworm and to create a reference for understanding silkworm metamorphosis. We generated four SAGE libraries, one from each of the four developmental stages of the silkworm. In total we obtained 257,964 SAGE tags, of which 39,485 were unique tags. Sorted by copy number, 14.1% of the unique tags were detected at a median to high level (five or more copies), 24.2% at lower levels (two to four copies), and 61.7% as single copies. Using a basic local alignment search tool on the EST database, 35% of the tags matched known silkworm expressed sequence tags. SAGE demonstrated that a number of the genes were up- or down-regulated during the four developmental phases of the egg, larva, pupa, and adult. Furthermore, we found that the generation of longer cDNA fragments from SAGE tags constituted the most efficient method of gene identification, which facilitated the analysis of a large number of unknown genes.

Gene expression in dopamine and GABA systems in an animal model of schizophrenia: effects of antipsychotic drugs.

PubMed

Lipska, Barbara K; Lerman, Daniel N; Khaing, Zin Z; Weickert, Cynthia Shannon; Weinberger, Daniel R

2003-07-01

We used in situ hybridization histochemistry to assess expression of dopamine receptors (D1R, D2R and D3R), neurotensin, proenkephalin and glutamate decarboxylase-67 (GAD67) in the prefrontal cortex, striatum, and/or nucleus accumbens in adult rats with neonatal ventral hippocampal (VH) lesions and in control animals after acute and chronic treatment with antipsychotic drugs clozapine and haloperidol. We also acquired these measures in a separate cohort of treatment-naïve sham and neonatally VH-lesioned rats used as an animal model of schizophrenia. Our results indicate that the neonatal VH lesion did not alter expression of D1R, D3R, neurotensin or proenkephalin expression in any brain region examined. However, D2R mRNA expression was down-regulated in the striatum, GAD67 mRNA was down-regulated in the prefrontal cortex and prodynorphin mRNA was up-regulated in the striatum of the VH-lesioned rats as compared with sham controls. Antipsychotic drugs did not alter expression of D1R, D2R or D3R receptor mRNAs but elevated neurotensin and proenkephalin expression in both groups of rats; patterns of changes were dependent on the duration of treatment and brain area examined. GAD67 mRNA was up-regulated by chronic antispychotics in the nucleus accumbens and the striatum and by chronic haloperidol in the prefrontal cortex in both sham and lesioned rats. These results indicate that the developmental VH lesion changed the striatal expression of D2R and prodynorphin and robustly compromised prefrontal GAD67 expression but did not modify drug-induced expression of any genes examined in this study.

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride

PubMed Central

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E.; Staege, Martin S.; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS. PMID:29515560

Investigation of Endogenous Retrovirus Sequences in the Neighborhood of Genes Up-regulated in a Neuroblastoma Model after Treatment with Hypoxia-Mimetic Cobalt Chloride.

PubMed

Brütting, Christine; Narasimhan, Harini; Hoffmann, Frank; Kornhuber, Malte E; Staege, Martin S; Emmer, Alexander

2018-01-01

Human endogenous retroviruses (ERVs) have been found to be associated with different diseases, e.g., multiple sclerosis (MS). Most human ERVs integrated in our genome are not competent to replicate and these sequences are presumably silent. However, transcription of human ERVs can be reactivated, e.g., by hypoxia. Interestingly, MS has been linked to hypoxia since decades. As some patterns of demyelination are similar to white matter ischemia, hypoxic damage is discussed. Therefore, we are interested in the association between hypoxia and ERVs. As a model, we used human SH-SY5Y neuroblastoma cells after treatment with the hypoxia-mimetic cobalt chloride and analyzed differences in the gene expression profiles in comparison to untreated cells. The vicinity of up-regulated genes was scanned for endogenous retrovirus-derived sequences. Five genes were found to be strongly up-regulated in SH-SY5Y cells after treatment with cobalt chloride: clusterin, glutathione peroxidase 3, insulin-like growth factor 2, solute carrier family 7 member 11, and neural precursor cell expressed developmentally down-regulated protein 9. In the vicinity of these genes we identified large (>1,000 bp) open reading frames (ORFs). Most of these ORFs showed only low similarities to proteins from retro-transcribing viruses. However, we found very high similarity between retrovirus envelope sequences and a sequence in the vicinity of neural precursor cell expressed developmentally down-regulated protein 9. This sequence encodes the human endogenous retrovirus group FRD member 1, the encoded protein product is called syncytin 2. Transfection of syncytin 2 into the well-characterized Ewing sarcoma cell line A673 was not able to modulate the low immunostimulatory activity of this cell line. Future research is needed to determine whether the identified genes and the human endogenous retrovirus group FRD member 1 might play a role in the etiology of MS.

Genome-wide expression and methylation profiling in the aged rodent brain due to early-life Pb exposure and its relevance to aging.

PubMed

Dosunmu, Remi; Alashwal, Hany; Zawia, Nasser H

2012-06-01

In this study, we assessed global gene expression patterns in adolescent mice exposed to lead (Pb) as infants and their aged siblings to identify reprogrammed genes. Global expression on postnatal day 20 and 700 was analyzed and genes that were down- and up-regulated (≥2 fold) were identified, clustered and analyzed for their relationship to DNA methylation. About 150 genes were differentially expressed in old age. In normal aging, we observed an up-regulation of genes related to the immune response, metal-binding, metabolism and transcription/transduction coupling. Prior exposure to Pb revealed a repression in these genes suggesting that disturbances in developmental stages of the brain compromise the ability to defend against age-related stressors, thus promoting the neurodegenerative process. Overexpression and repression of genes corresponded with their DNA methylation profile. Published by Elsevier Ireland Ltd.

Expression of Glycogen synthase kinase 3-β (GSK3-β) gene in azoospermic men.

PubMed

Nazarian, Hamid; Ghaffari Novin, Marefat; Jalili, Mohammad Reza; Mirfakhraie, Reza; Heidari, Mohammad Hassan; Hosseini, Seyed Jalil; Norouzian, Mohsen; Ehsani, Nahid

2014-05-01

The Wnt/β- The Wnt/β-catenin signaling pathway is involved in many developmental processes in both fetal and adult life; its abnormalities can lead to disorders including several types of cancers and malfunction of specific cells and tissues in both animals and humans. Its role in reproductive processes has been proven. This study was designed to evaluate the expression of the key regulator of this signaling pathway GSK3-β and its presumed role in azoospermia. WNT3a protein concentration and GSK3-β gene expression levels were measured and compared between two groups of infertile men. The test groups consisted of 10 patients with obstructive and 10 non-obstructive azoospermia. The control group was selected among healthy men after vasectomies that were willing to conceive a child using a testicular biopsy technique. Samples were obtained by testicular biopsy and screened for the most common mutations (84, 86 and 255) in the SRY region before analyzing. GSK3-β gene expression was assessed quantitatively by real time-PCR. The WNT3a protein concentration had no significant difference between the two test groups and controls. Expression of GSK3-β was down-regulated in non-obstructive azoospermia (3.10±0.19) compared with normal (7.12±0.39) and obstructive azoospermia (6.32±0.42) groups (p=0.001). Down-regulation of GSK-3β may cause to non-obstructive azoospermia. Regulation and modification of GSK-3β gene expression by drugs could be used as a therapeutic solution.

Recognition of Facial Expressions of Emotion in Adults with Down Syndrome

ERIC Educational Resources Information Center

Virji-Babul, Naznin; Watt, Kimberley; Nathoo, Farouk; Johnson, Peter

2012-01-01

Research on facial expressions in individuals with Down syndrome (DS) has been conducted using photographs. Our goal was to examine the effect of motion on perception of emotional expressions. Adults with DS, adults with typical development matched for chronological age (CA), and children with typical development matched for developmental age (DA)…

A cadmium metallothionein gene of ridgetail white prawn Exopalaemon carinicauda (Holthuis, 1950) and its expression

NASA Astrophysics Data System (ADS)

Zhang, Jiquan; Wang, Jing; Xiang, Jianhai

2013-11-01

Metallothioneins (MTs) are a group of low molecular weight cysteine-rich proteins capable of binding heavy metal ions. A cadmium metallothionein ( EcMT — Cd) cDNA with a 189 bp open reading frame (ORF) that encoded a 62 amino acid protein was obtained from Exopalaemon carinicauda. Seventeen cysteines were in the deduced amino acid sequence, and the cysteine (Cys)-rich characteristic was revealed in different metallothioneins in other species. In addition, the deduced amino acid sequence did not contain any aromatic amino acid residues, such as tyrosine (Tyr), tryptophan (Trp), and phenylalanine (Phe). EcMT—Cd mRNA was expressed in all tested tissues (the ovary, muscle, stomach, and hepatopancreas), and its expression profiles in the hepatopancreas were very different when shrimps were exposed to seawater containing either 50 μmol/L CuSO4 or 2.5 μmol/L CdCl 2. The expression of EcMT-Cd was significantly up-regulated in shrimp exposed to CuSO4 for 12 h and down-regulated in shrimps exposed to CdCl2 for 12 h. After 24 h exposure to both metals, its expression was down-regulated. By contrast, at 48 h the EcMT-Cd was up-regulated in test shrimps exposed to CdCl2. The transcript of EcMT-Cd was very low or even absent before the zoea stage, and the expression of EcMT-Cd was detected from mysis larvae-I, then its expression began to rise. In conclusion, a cadmium MT exists in E. carinicauda that is expressed in different tissues and during different developmental stages, and responds to the challenge with heavy metal ions, which provides a clue to understanding the function of cadmium MT.

Tyrosine hydroxylase down-regulation after loss of Abelson helper integration site 1 (AHI1) promotes depression via the circadian clock pathway in mice.

PubMed

Guo, Dongkai; Zhang, Shun; Sun, Hongyang; Xu, Xingyun; Hao, Zongbing; Mu, Chenchen; Xu, Xingshun; Wang, Guanghui; Ren, Haigang

2018-04-06

Abelson helper integration site 1 (AHI1) is associated with several neuropsychiatric and brain developmental disorders, such as schizophrenia, depression, autism, and Joubert syndrome. Ahi1 deficiency in mice leads to behaviors typical of depression. However, the mechanisms by which AHI1 regulates behavior remain to be elucidated. Here, we found that down-regulation of expression of the rate-limiting enzyme in dopamine biosynthesis, tyrosine hydroxylase (TH), in the midbrains of Ahi1- knockout (KO) mice is responsible for Ahi1 -deficiency-mediated depressive symptoms. We also found that Rev-Erbα, a TH transcriptional repressor and circadian regulator, is up-regulated in the Ahi1- KO mouse midbrains and Ahi1 -knockdown Neuro-2a cells. Moreover, brain and muscle Arnt-like protein 1 (BMAL1), the Rev-Erb α transcriptional regulator, is also increased in the Ahi1- KO mouse midbrains and Ahi1 -knockdown cells. Our results further revealed that AHI1 decreases BMAL1/Rev-Erbα expression by interacting with and repressing retinoic acid receptor-related orphan receptor α, a nuclear receptor and transcriptional regulator of circadian genes. Of note, Bmal1 deficiency reversed the reduction in TH expression induced by Ahi1 deficiency. Moreover, microinfusion of the Rev-Erbα inhibitor SR8278 into the ventral midbrain of Ahi1- KO mice significantly increased TH expression in the ventral tegmental area and improved their depressive symptoms. These findings provide a mechanistic explanation for a link between AHI1-related behaviors and the circadian clock pathway, indicating an involvement of circadian regulatory proteins in AHI1-regulated mood and behavior. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Differential Expression Patterns of Pleurotus ostreatus Catalase Genes during Developmental Stages and under Heat Stress

PubMed Central

Wang, Lining; Wu, Xiangli; Gao, Wei; Zhao, Mengran; Zhang, Jinxia

2017-01-01

Catalases are ubiquitous hydrogen peroxide-detoxifying enzymes. They participate in fungal growth and development, such as mycelial growth and cellular differentiation, and in protecting fungi from oxidative damage under stressful conditions. To investigate the potential functions of catalases in Pleurotus ostreatus, we obtained two catalase genes from a draft genome sequence of P. ostreatus, and cloned and characterized them (Po-cat1 and Po-cat2). Po-cat1 (group II) and Po-cat2 (group III) encoded putative peptides of 745 and 528 amino acids, respectively. Furthermore, the gene structures were variant between Po-cat1 and Po-cat2. Further research revealed that these two catalase genes have divergent expression patterns during different developmental stages. Po-cat1/Po-cat1 was at a barely detectable level in mycelia, accumulated gradually during reproductive growth, and was maximal in separated spores. But no catalase activity of Po-cat1 was detected by native-PAGE during any part of the developmental stages. In contrast, high Po-cat2/Po-cat2 expression and Po-cat2 activity found in mycelia were gradually lost during reproductive growth, and at a minimal level in separated spores. In addition, these two genes responded differentially under 32 °C and 40 °C heat stresses. Po-cat1 was up-regulated under both temperature conditions, while Po-cat2 was up-regulated at 32 °C but down-regulated at 40 °C. The accumulation of catalase proteins correlated with gene expression. These results indicate that the two divergent catalases in P. ostreatus may play different roles during development and under heat stress. PMID:29160795

MicroRNA-99 family members suppress Homeobox A1 expression in epithelial cells.

PubMed

Chen, Dan; Chen, Zujian; Jin, Yi; Dragas, Dragan; Zhang, Leitao; Adjei, Barima S; Wang, Anxun; Dai, Yang; Zhou, Xiaofeng

2013-01-01

The miR-99 family is one of the evolutionarily most ancient microRNA families, and it plays a critical role in developmental timing and the maintenance of tissue identity. Recent studies, including reports from our group, suggested that the miR-99 family regulates various physiological processes in adult tissues, such as dermal wound healing, and a number of disease processes, including cancer. By combining 5 independent genome-wide expression profiling experiments, we identified a panel of 266 unique transcripts that were down-regulated in epithelial cells transfected with miR-99 family members. A comprehensive bioinformatics analysis using 12 different sequence-based microRNA target prediction algorithms revealed that 81 out of these 266 down-regulated transcripts are potential direct targets for the miR-99 family. Confirmation experiments and functional analyses were performed to further assess 6 selected miR-99 target genes, including mammalian Target of rapamycin (mTOR), Homeobox A1 (HOXA1), CTD small phosphatase-like (CTDSPL), N-myristoyltransferase 1 (NMT1), Transmembrane protein 30A (TMEM30A), and SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (SMARCA5). HOXA1 is a known proto-oncogene, and it also plays an important role in embryonic development. The direct targeting of the miR-99 family to two candidate binding sequences located in the HOXA1 mRNA was confirmed using a luciferase reporter gene assay and a ribonucleoprotein-immunoprecipitation (RIP-IP) assay. Ectopic transfection of miR-99 family reduced the expression of HOXA1, which, in consequence, down-regulated the expression of its downstream gene (i.e., Bcl-2) and led to reduced proliferation and cell migration, as well as enhanced apoptosis. In summary, we identified a number of high-confidence miR-99 family target genes, including proto-oncogene HOXA1, which may play an important role in regulating epithelial cell proliferation and migration during physiological disease processes, such as dermal wound healing and tumorigenesis.

The AtRbx1 protein is part of plant SCF complexes, and its down-regulation causes severe growth and developmental defects.

PubMed

Lechner, Esther; Xie, Daoxin; Grava, Sandrine; Pigaglio, Emmanuelle; Planchais, Severine; Murray, James A H; Parmentier, Yves; Mutterer, Jerome; Dubreucq, Bertrand; Shen, Wen-Hui; Genschik, Pascal

2002-12-20

Recently in yeast and animal cells, one particular class of ubiquitin ligase (E3), called the SCF, was demonstrated to regulate diverse processes including cell cycle and development. In plants SCF-dependent proteolysis is also involved in different developmental and hormonal regulations. To further investigate the function of SCF, we characterized at the molecular level the Arabidopsis RING-H2 finger protein AtRbx1. We demonstrated that the plant gene is able to functionally complement a yeast knockout mutant strain and showed that AtRbx1 protein interacts physically with at least two members of the Arabidopsis cullin family (AtCul1 and AtCul4). AtRbx1 also associates with AtCul1 and the Arabidopsis SKP1-related proteins in planta, indicating that it is part of plant SCF complexes. AtRbx1 mRNAs accumulate in various tissues of the plant, but at higher levels in tissues containing actively dividing cells. Finally to study the function of the gene in planta, we either overexpressed AtRbx1 or reduced its expression by a dsRNA strategy. Down-regulation of AtRbx1 impaired seedling growth and development, indicating that the gene is essential in plants. Furthermore, the AtRbx1-silenced plants showed a reduced level of AtCul1 protein, but accumulated higher level of cyclin D3.

Transcriptome Analysis of ABA/JA-Dual Responsive Genes in Rice Shoot and Root.

PubMed

Kim, Jin-Ae; Bhatnagar, Nikita; Kwon, Soon Jae; Min, Myung Ki; Moon, Seok-Jun; Yoon, In Sun; Kwon, Taek-Ryoun; Kim, Sun Tae; Kim, Beom-Gi

2018-01-01

The phytohormone abscisic acid (ABA) enables plants to adapt to adverse environmental conditions through the modulation of metabolic pathways and of growth and developmental programs. We used comparative microarray analysis to identify genes exhibiting ABA-dependent expression and other hormone-dependent expression among them in Oryza sativa shoot and root. We identified 854 genes as significantly up- or down-regulated in root or shoot under ABA treatment condition. Most of these genes had similar expression profiles in root and shoot under ABA treatment condition, whereas 86 genes displayed opposite expression responses in root and shoot. To examine the crosstalk between ABA and other hormones, we compared the expression profiles of the ABA-dependently regulated genes under several different hormone treatment conditions. Interestingly, around half of the ABA-dependently expressed genes were also regulated by jasmonic acid based on microarray data analysis. We searched the promoter regions of these genes for cis-elements that could be responsible for their responsiveness to both hormones, and found that ABRE and MYC2 elements, among others, were common to the promoters of genes that were regulated by both ABA and JA. These results show that ABA and JA might have common gene expression regulation system and might explain why the JA could function for both abiotic and biotic stress tolerance.

Newborn Mouse Lens Proteome and Its Alteration by Lysine 6 Mutant Ubiquitin

PubMed Central

2015-01-01

Ubiquitin is a tag that often initiates degradation of proteins by the proteasome in the ubiquitin proteasome system. Targeted expression of K6W mutant ubiquitin (K6W-Ub) in the lens results in defects in lens development and cataract formation, suggesting critical functions for ubiquitin in lens. To study the developmental processes that require intact ubiquitin, we executed the most extensive characterization of the lens proteome to date. We quantified lens protein expression changes in multiple replicate pools of P1 wild-type and K6W-Ub-expressing mouse lenses. Lens proteins were digested with trypsin, peptides were separated using strong cation exchange and reversed-phase liquid chromatography, and tandem mass (MS/MS) spectra were collected with a linear ion trap. Transgenic mice that expressed low levels of K6W-Ub (low expressers) had normal, clear lenses at birth, whereas the lenses that expressed high levels of K6W-Ub (higher expressers) had abnormal lenses and cataracts at birth. A total of 2052 proteins were identified, of which 996 were reliably quantified and compared between wild-type and K6W-Ub transgenic mice. Consistent with a delayed developmental program, fiber-cell-specific proteins, such as γ-crystallins (γA, γB, γC, and γE), were down-regulated in K6W-Ub higher expressers. Up-regulated proteins were involved in energy metabolism, signal transduction, and proteolysis. The K6W-Ub low expressers exhibited delayed onset and milder cataract consistent with smaller changes in protein expression. Because lens protein expression changes occurred prior to lens morphological abnormalities and cataract formation in K6W-Ub low expressers, it appears that expression of K6W-Ub sets in motion a process of altered protein expression that results in developmental defects and cataract. PMID:24450463

Transcriptional profiling of the pea shoot apical meristem reveals processes underlying its function and maintenance

PubMed Central

Wong, Chui E; Bhalla, Prem L; Ottenhof, Harald; Singh, Mohan B

2008-01-01

Background Despite the importance of the shoot apical meristem (SAM) in plant development and organ formation, our understanding of the molecular mechanisms controlling its function is limited. Genomic tools have the potential to unravel the molecular mysteries of the SAM, and legume systems are increasingly being used in plant-development studies owing to their unique characteristics such as nitrogen fixation, secondary metabolism, and pod development. Garden pea (Pisum sativum) is a well-established classic model species for genetics studies that has been used since the Mendel era. In addition, the availability of a plethora of developmental mutants makes pea an ideal crop legume for genomics studies. This study aims to utilise genomics tools in isolating genes that play potential roles in the regulation of SAM activity. Results In order to identify genes that are differentially expressed in the SAM, we generated 2735 ESTs from three cDNA libraries derived from freshly micro-dissected SAMs from 10-day-old garden peas (Pisum sativum cv Torsdag). Custom-designed oligonucleotide arrays were used to compare the transcriptional profiles of pea SAMs and non-meristematic tissues. A total of 184 and 175 transcripts were significantly up- or down-regulated in the pea SAM, respectively. As expected, close to 61% of the transcripts down-regulated in the SAM were found in the public database, whereas sequences from the same source only comprised 12% of the genes that were expressed at higher levels in the SAM. This highlights the under-representation of transcripts from the meristematic tissues in the current public pea protein database, and demonstrates the utility of our SAM EST collection as an essential genetic resource for revealing further information on the regulation of this developmental process. In addition to unknowns, many of the up-regulated transcripts are known to encode products associated with cell division and proliferation, epigenetic regulation, auxin-mediated responses and microRNA regulation. Conclusion The presented data provide a picture of the transcriptional profile of the pea SAM, and reveal possible roles of differentially expressed transcripts in meristem function and maintenance. PMID:18590528

Global transcriptome analysis of the maize (Zea mays L.) inbred line 08LF during leaf senescence initiated by pollination-prevention.

PubMed

Wu, Liancheng; Li, Mingna; Tian, Lei; Wang, Shunxi; Wu, Liuji; Ku, Lixia; Zhang, Jun; Song, Xiaoheng; Liu, Haiping; Chen, Yanhui

2017-01-01

In maize (Zea mays), leaf senescence acts as a nutrient recycling process involved in proteins, lipids, and nucleic acids degradation and transport to the developing sink. However, the molecular mechanisms of pre-maturation associated with pollination-prevention remain unclear in maize. To explore global gene expression changes during the onset and progression of senescence in maize, the inbred line 08LF, with severe early senescence caused by pollination prevention, was selected. Phenotypic observation showed that the onset of leaf senescence of 08LF plants occurred approximately 14 days after silking (DAS) by pollination prevention. Transcriptional profiling analysis of the leaf at six developmental stages during induced senescence revealed that a total of 5,432 differentially expressed genes (DEGs) were identified, including 2314 up-regulated genes and 1925 down-regulated genes. Functional annotation showed that the up-regulated genes were mainly enriched in multi-organism process and nitrogen compound transport, whereas down-regulated genes were involved in photosynthesis. Expression patterns and pathway enrichment analyses of early-senescence related genes indicated that these DEGs are involved in complex regulatory networks, especially in the jasmonic acid pathway. In addition, transcription factors from several families were detected, particularly the CO-like, NAC, ERF, GRAS, WRKY and ZF-HD families, suggesting that these transcription factors might play important roles in driving leaf senescence in maize as a result of pollination-prevention.

Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster.

PubMed

Landis, Gary; Shen, Jie; Tower, John

2012-11-01

Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging.

Gene-expression profiles of epithelial cells treated with EMD in vitro: analysis using complementary DNA arrays.

PubMed

Kapferer, I; Schmidt, S; Gstir, R; Durstberger, G; Huber, L A; Vietor, I

2011-02-01

During surgical periodontal treatment, EMD is topically applied in order to facilitate regeneration of the periodontal ligament, acellular cementum and alveolar bone. Suppresion of epithelial down-growth is essential for successful periodontal regeneration; however, the underlying mechanisms of how EMD influences epithelial wound healing are poorly understood. In the present study, the effects of EMD on gene-expression profiling in an epithelial cell line (HSC-2) model were investigated. Gene-expression modifications, determined using a comparative genome-wide expression-profiling strategy, were independently validated by quantitative real-time RT-PCR. Additionally, cell cycle, cell growth and in vitro wound-healing assays were conducted. A set of 43 EMD-regulated genes was defined, which may be responsible for the reduced epithelial down-growth upon EMD application. Gene ontology analysis revealed genes that could be attributed to pathways of locomotion, developmental processes and associated processes such as regulation of cell size and cell growth. Additionally, eight regulated genes have previously been reported to take part in the process of epithelial-to-mesenchymal transition. Several independent experimental assays revealed significant inhibition of cell migration, growth and cell cycle by EMD. The set of EMD-regulated genes identified in this study offers the opportunity to clarify mechanisms underlying the effects of EMD on epithelial cells. Reduced epithelial repopulation of the dental root upon periodontal surgery may be the consequence of reduced migration and cell growth, as well as epithelial-to-mesenchymal transition. © 2010 John Wiley & Sons A/S.

Gene expression changes in response to aging compared to heat stress, oxidative stress and ionizing radiation in Drosophila melanogaster

PubMed Central

Landis, Gary; Shen, Jie; Tower, John

2012-01-01

Gene expression changes in response to aging, heat stress, hyperoxia, hydrogen peroxide, and ionizing radiation were compared using microarrays. A set of 18 genes were up-regulated across all conditions, indicating a general stress response shared with aging, including the heat shock protein (Hsp) genes Hsp70, Hsp83 and l(2)efl, the glutathione-S-transferase gene GstD2, and the mitochondrial unfolded protein response (mUPR) gene ref(2)P. Selected gene expression changes were confirmed using quantitative PCR, Northern analysis and GstD-GFP reporter constructs. Certain genes were altered in only a subset of the conditions, for example, up-regulation of numerous developmental pathway and signaling genes in response to hydrogen peroxide. While aging shared features with each stress, aging was more similar to the stresses most associated with oxidative stress (hyperoxia, hydrogen peroxide, ionizing radiation) than to heat stress. Aging is associated with down-regulation of numerous mitochondrial genes, including electron-transport-chain (ETC) genes and mitochondrial metabolism genes, and a sub-set of these changes was also observed upon hydrogen peroxide stress and ionizing radiation stress. Aging shared the largest number of gene expression changes with hyperoxia. The extensive down-regulation of mitochondrial and ETC genes during aging is consistent with an aging-associated failure in mitochondrial maintenance, which may underlie the oxidative stress-like and proteotoxic stress-like responses observed during aging. PMID:23211361

Identification of miRNAs during mouse postnatal ovarian development and superovulation.

PubMed

Khan, Hamid Ali; Zhao, Yi; Wang, Li; Li, Qian; Du, Yu-Ai; Dan, Yi; Huo, Li-Jun

2015-07-08

MicroRNAs are small noncoding RNAs that play critical roles in regulation of gene expression in wide array of tissues including the ovary through sequence complementarity at post-transcriptional level. Tight regulation of multitude of genes involved in ovarian development and folliculogenesis could be regulated at transcription level by these miRNAs. Therefore, tissue specific miRNAs identification is considered a key step towards understanding the role of miRNAs in biological processes. To investigate the role of microRNAs during ovarian development and folliculogenesis we sequenced eight different libraries using Illumina deep sequencing technology. Different developmental stages were selected to explore miRNAs expression pattern at different stages of gonadal maturation with/without treatment of PMSG/hCG for superovulation. From massive sequencing reads, clean reads of 16-26 bp were selected for further analysis of differential expression analysis and novel microRNA annotation. Expression analysis of all miRNAs at different developmental stages showed that some miRNAs were present ubiquitously while others were differentially expressed at different stages. Among differentially expressed miRNAs we reported 61 miRNAs with a fold change of more than 2 at different developmental stages among all libraries. Among the up-regulated miRNAs, mmu-mir-1298 had the highest fold change with 4.025 while mmu-mir-150 was down-regulated more than 3 fold. Furthermore, we found 2659 target genes for 20 differentially expressed microRNAs using seven different target predictions programs (DIANA-mT, miRanda, miRDB, miRWalk, RNAhybrid, PICTAR5, TargetScan). Analysis of the predicted targets showed certain ovary specific genes targeted by single or multiple microRNAs. Furthermore, pathway annotation and Gene ontology showed involvement of these microRNAs in basic cellular process. These results suggest the presence of different miRNAs at different stages of ovarian development and superovulation. Potential role of these microRNAs was elucidated using bioinformatics tools in regulation of different pathways, biological functions and cellular components underlying ovarian development and superovulation. These results provide a framework for extended analysis of miRNAs and their roles during ovarian development and superovulation. Furthermore, this study provides a base for characterization of individual miRNAs to discover their role in ovarian development and female fertility.

Mutations in MYB3R1 and MYB3R4 Cause Pleiotropic Developmental Defects and Preferential Down-Regulation of Multiple G2/M-Specific Genes in Arabidopsis1[C][W

PubMed Central

Haga, Nozomi; Kobayashi, Kosuke; Suzuki, Takamasa; Maeo, Kenichiro; Kubo, Minoru; Ohtani, Misato; Mitsuda, Nobutaka; Demura, Taku; Nakamura, Kenzo; Jürgens, Gerd; Ito, Masaki

2011-01-01

R1R2R3-Myb proteins represent an evolutionarily conserved class of Myb family proteins important for cell cycle regulation and differentiation in eukaryotic cells. In plants, this class of Myb proteins are believed to regulate the transcription of G2/M phase-specific genes by binding to common cis-elements, called mitosis-specific activator (MSA) elements. In Arabidopsis (Arabidopsis thaliana), MYB3R1 and MYB3R4 act as transcriptional activators and positively regulate cytokinesis by activating the transcription of KNOLLE, which encodes a cytokinesis-specific syntaxin. Here, we show that the double mutation myb3r1 myb3r4 causes pleiotropic developmental defects, some of which are due to deficiency of KNOLLE whereas other are not, suggesting that multiple target genes are involved. Consistently, microarray analysis of the double mutant revealed altered expression of many genes, among which G2/M-specific genes showed significant overrepresentation of the MSA motif and a strong tendency to be down-regulated by the double mutation. Our results demonstrate, on a genome-wide level, the importance of the MYB3R-MSA pathway for regulating G2/M-specific transcription. In addition, MYB3R1 and MYB3R4 may have diverse roles during plant development by regulating G2/M-specific genes with various functions as well as genes possibly unrelated to the cell cycle. PMID:21862669

The MSX1 homeobox transcription factor is a downstream target of PHOX2B and activates the Delta-Notch pathway in neuroblastoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Revet, Ingrid; Huizenga, Gerda; Chan, Alvin

Neuroblastoma is an embryonal tumour of the peripheral sympathetic nervous system (SNS). One of the master regulator genes for peripheral SNS differentiation, the homeobox transcription factor PHOX2B, is mutated in familiar and sporadic neuroblastomas. Here we report that inducible expression of PHOX2B in the neuroblastoma cell line SJNB-8 down-regulates MSX1, a homeobox gene important for embryonic neural crest development. Inducible expression of MSX1 in SJNB-8 caused inhibition of both cell proliferation and colony formation in soft agar. Affymetrix micro-array and Northern blot analysis demonstrated that MSX1 strongly up-regulated the Delta-Notch pathway genes DLK1, NOTCH3, and HEY1. In addition, the proneuralmore » gene NEUROD1 was down-regulated. Western blot analysis showed that MSX1 induction caused cleavage of the NOTCH3 protein to its activated form, further confirming activation of the Delta-Notch pathway. These experiments describe for the first time regulation of the Delta-Notch pathway by MSX1, and connect these genes to the PHOX2B oncogene, indicative of a role in neuroblastoma biology. Affymetrix micro-array analysis of a neuroblastic tumour series consisting of neuroblastomas and the more benign ganglioneuromas showed that MSX1, NOTCH3 and HEY1 are more highly expressed in ganglioneuromas. This suggests a block in differentiation of these tumours at distinct developmental stages or lineages.« less

Role of fibroblast growth factor receptors (FGFR) and FGFR like-1 (FGFRL1) in mesenchymal stromal cell differentiation to osteoblasts and adipocytes.

PubMed

Kähkönen, T E; Ivaska, K K; Jiang, M; Büki, K G; Väänänen, H K; Härkönen, P L

2018-02-05

Fibroblast growth factors (FGF) and their receptors (FGFRs) regulate many developmental processes including differentiation of mesenchymal stromal cells (MSC). We developed two MSC lines capable of differentiating to osteoblasts and adipocytes and studied the role of FGFRs in this process. We identified FGFR2 and fibroblast growth factor receptor like-1 (FGFRL1) as possible actors in MSC differentiation with gene microarray and qRT-PCR. FGFR2 and FGFRL1 mRNA expression strongly increased during MSC differentiation to osteoblasts. FGF2 treatment, resulting in downregulation of FGFR2, or silencing FGFR2 expression with siRNAs inhibited osteoblast differentiation. During adipocyte differentiation expression of FGFR1 and FGFRL1 increased and was down-regulated by FGF2. FGFR1 knockdown inhibited adipocyte differentiation. Silencing FGFR2 and FGFR1 in MSCs was associated with decreased FGFRL1 expression in osteoblasts and adipocytes, respectively. Our results suggest that FGFR1 and FGFR2 regulate FGFRL1 expression. FGFRL1 may mediate or modulate FGFR regulation of MSC differentiation together with FGFR2 in osteoblastic and FGFR1 in adipocytic lineage. Copyright © 2017 Elsevier B.V. All rights reserved.

PI3K/Akt-dependent functions of TFII-I transcription factors in mouse embryonic stem cells.

PubMed

Chimge, Nyam-Osor; Makeyev, Aleksandr V; Waigel, Sabine J; Enkhmandakh, Badam; Bayarsaihan, Dashzeveg

2012-04-01

Activation of PI3K/Akt signaling is sufficient to maintain the pluripotency of mouse embryonic stem cells (mESC) and results in down-regulation of Gtf2i and Gtf2ird1 encoding TFII-I family transcription factors. To investigate how these genes might be involved in the process of embryonic stem cell differentiation, we performed expression microarray profiling of mESC upon inhibition of PI3K by LY294002. This analysis revealed significant alterations in expression of genes for specific subsets of chromatin-modifying enzymes. Surprisingly, genome-wide promoter ChIP-chip mapping indicated that the majority of differently expressed genes could be direct targets of TFII-I regulation. The data support the hypothesis that upregulation of TFII-I factors leads to activation of a specific group of developmental genes during mESC differentiation. © 2011 Wiley Periodicals, Inc.

Monitoring the regulation of gene expression in a growing organ using a fluid mechanics formalism

PubMed Central

2010-01-01

Background Technological advances have enabled the accurate quantification of gene expression, even within single cell types. While transcriptome analyses are routinely performed, most experimental designs only provide snapshots of gene expression. Molecular mechanisms underlying cell fate or positional signalling have been revealed through these discontinuous datasets. However, in developing multicellular structures, temporal and spatial cues, known to directly influence transcriptional networks, get entangled as the cells are displaced and expand. Access to an unbiased view of the spatiotemporal regulation of gene expression occurring during development requires a specific framework that properly quantifies the rate of change of a property in a moving and expanding element, such as a cell or an organ segment. Results We show how the rate of change in gene expression can be quantified by combining kinematics and real-time polymerase chain reaction data in a mechanistic model which considers any organ as a continuum. This framework was applied in order to assess the developmental regulation of the two reference genes Actin11 and Elongation Factor 1-β in the apex of poplar root. The growth field was determined by time-lapse photography and transcript density was obtained at high spatial resolution. The net accumulation rates of the transcripts of the two genes were found to display highly contrasted developmental profiles. Actin11 showed pulses of up and down regulation in the accelerating and decelerating parts of the growth zone while the dynamic of EF1β were much slower. This framework provides key information about gene regulation in a developing organ, such as the location, the duration and the intensity of gene induction/repression. Conclusions We demonstrated that gene expression patterns can be monitored using the continuity equation without using mutants or reporter constructions. Given the rise of imaging technologies, this framework in our view opens a new way to dissect the molecular basis of growth regulation, even in non-model species or complex structures. PMID:20202192

Transcriptome profile analysis of floral sex determination in cucumber.

PubMed

Wu, Tao; Qin, Zhiwei; Zhou, Xiuyan; Feng, Zhuo; Du, Yalin

2010-07-15

Cucumber has been widely studied as a model for floral sex determination. In this investigation, we performed genome-wide transcriptional profiling of apical tissue of a gynoecious mutant (Csg-G) and the monoecious wild-type (Csg-M) of cucumber in an attempt to isolate genes involved in sex determination, using the Solexa technology. The profiling analysis revealed numerous changes in gene expression attributable to the mutation, which resulted in the down-regulation of 600 genes and the up-regulation of 143 genes. The Solexa data were confirmed by reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative RT-PCR (qRT-PCR). Gene ontology (GO) analysis revealed that the differentially expressed genes were mainly involved in biogenesis, transport and organization of cellular component, macromolecular and cellular biosynthesis, localization, establishment of localization, translation and other processes. Furthermore, the expression of some of these genes depended upon the tissue and the developmental stage of the flowers of gynoecious mutant. The results of this study suggest two important concepts, which govern sex determination in cucumber. First, the differential expression of genes involved in plant hormone signaling pathways, such as ACS, Asr1, CsIAA2, CS-AUX1 and TLP, indicate that phytohormones and their crosstalk might play a critical role in the sex determination. Second, the regulation of some transcription factors, including EREBP-9, may also be involved in this developmental process. Copyright (c) 2010 Elsevier GmbH. All rights reserved.

Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways.

PubMed

Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula

2014-01-20

Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response.

Identification of mechanosensitive genes during skeletal development: alteration of genes associated with cytoskeletal rearrangement and cell signalling pathways

PubMed Central

2014-01-01

Background Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. Results We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus into a transcriptional response. Conclusions This work identifies key developmental regulatory genes impacted by altered mechanical stimulation, sheds light on the molecular mechanisms that interpret mechanical stimulation during skeletal development and provides valuable resources for further investigation of the mechanistic basis of mechanoregulation. In particular it highlights the Wnt signalling pathway as a potential point of integration of mechanical and molecular signalling and cytoskeletal components as mediators of the response. PMID:24443808

Microarray Analyses of Gene Expression during Adventitious Root Development in Pinus contorta1[w

PubMed Central

Brinker, Monika; van Zyl, Leonel; Liu, Wenbin; Craig, Deborah; Sederoff, Ronald R.; Clapham, David H.; von Arnold, Sara

2004-01-01

In order to investigate the gene expression pattern during adventitious root development, RNA of Pinus contorta hypocotyls, pulse-treated with the auxin indole-3-butyric acid and harvested at distinct developmental time points of root development, was hybridized to microarrays containing 2,178 cDNAs from Pinus taeda. Over the period of observation of root development, the transcript levels of 220 genes changed significantly. During the root initiation phase, genes involved in cell replication and cell wall weakening and a transcript encoding a PINHEAD/ZWILLE-like protein were up-regulated, while genes related to auxin transport, photosynthesis, and cell wall synthesis were down-regulated. In addition, there were changes in transcript abundance of genes related to water stress. During the root meristem formation phase the transcript abundances of genes involved in auxin transport, auxin responsive transcription, and cell wall synthesis, and of a gene encoding a B-box zinc finger-like protein, increased, while those encoding proteins involved in cell wall weakening decreased. Changes of transcript abundance of genes related to water stress during the root meristem formation and root formation phase indicate that the plant roots had become functional in water transport. Simultaneously, genes involved in auxin transport were up-regulated, while genes related to cell wall modification were down-regulated. Finally, during the root elongation phase down-regulation of transcripts encoding proteins involved in cell replication and stress occurred. Based on the observed changes in transcript abundances, we suggest hypotheses about the relative importance of various physiological processes during the auxin-induced development of roots in P. contorta. PMID:15247392

Down-regulation of a novel ABC transporter gene (Pxwhite) is associated with Cry1Ac resistance in the diamondback moth, Plutella xylostella (L.).

PubMed

Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

2015-04-01

Biopesticides or transgenic crops based on Cry toxins from the soil bacterium Bacillus thuringiensis (Bt) effectively control agricultural insect pests. The sustainable use of Bt biopesticides and Bt crops is threatened, however, by the development of Cry resistance in the target pests. The diamondback moth, Plutella xylostella (L.), is the first pest that developed resistance to a Bt biopesticide in the field, and a recent study has shown that the resistance of P. xylostella to Cry1Ac is caused by a mutation in an ATP-binding cassette (ABC) transporter gene (ABCC2). In this study, we report that down-regulation of a novel ABC transporter gene from ABCG subfamily (Pxwhite) is associated with Cry1Ac resistance in P. xylostella. The full-length cDNA sequence of Pxwhite was cloned and analyzed. Spatial-temporal expression detection revealed that Pxwhite was expressed in all tissues and developmental stages, and highest expressed in Malpighian tubule tissue and in egg stage. Sequence variation analysis of Pxwhite indicated the absence of constant non-synonymous mutations between susceptible and resistant strains, whereas midgut transcript analysis showed that Pxwhite was remarkably reduced in all resistant strains and further reduced when larvae of the moderately resistant SZ-R strain were subjected to selection with Cry1Ac toxin. Furthermore, RNA interference (RNAi)-mediated suppression of Pxwhite gene expression significantly reduced larval susceptibility to Cry1Ac toxin, and genetic linkage analysis confirmed that down-regulation of Pxwhite gene is tightly linked to Cry1Ac resistance in P. xylostella. To our knowledge, this is the first report indicating that Pxwhite gene is involved in Cry1Ac resistance in P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.

Developmental programming modulates olfactory behavior in C. elegans via endogenous RNAi pathways

PubMed Central

Sims, Jennie R; Ow, Maria C; Nishiguchi, Mailyn A; Kim, Kyuhyung; Sengupta, Piali; Hall, Sarah E

2016-01-01

Environmental stress during early development can impact adult phenotypes via programmed changes in gene expression. C. elegans larvae respond to environmental stress by entering the stress-resistant dauer diapause pathway and resume development once conditions improve (postdauers). Here we show that the osm-9 TRPV channel gene is a target of developmental programming and is down-regulated specifically in the ADL chemosensory neurons of postdauer adults, resulting in a corresponding altered olfactory behavior that is mediated by ADL in an OSM-9-dependent manner. We identify a cis-acting motif bound by the DAF-3 SMAD and ZFP-1 (AF10) proteins that is necessary for the differential regulation of osm-9, and demonstrate that both chromatin remodeling and endo-siRNA pathways are major contributors to the transcriptional silencing of the osm-9 locus. This work describes an elegant mechanism by which developmental experience influences adult phenotypes by establishing and maintaining transcriptional changes via RNAi and chromatin remodeling pathways. DOI: http://dx.doi.org/10.7554/eLife.11642.001 PMID:27351255

Exposure to butachlor causes thyroid endocrine disruption and promotion of metamorphosis in Xenopus laevis.

PubMed

Li, Shuying; Li, Meng; Wang, Qiangwei; Gui, Wenjun; Zhu, Guonian

2016-06-01

Butachlor is extensively applied in rice paddy ecosystem in china, and has been widespread contaminant in the aquatic environment. Here, Xenopus laevis was used for the evaluation of teratogenesis developmental toxicity, and disruption of thyroid system when exposure to different concentrations of butachlor by window phase exposure. Acute toxicity investigation shown that 96 h-LC50 value of butachlor was 1.424 mg L(-1) and 0.962 mg L(-1) for tadpoles (starting from stages 46/47) and embryos (starting from stages 8/9), respectively. Exposure to butachlor caused malformation, including abnormal eye, pericardial edema, enlarged proctodaeum and bent tail. Window phase exposure test indicated that butachlor significantly promote the contents of whole-body thyroid hormones (THs, T3 and T4) at higher levels, indicating thyroid endocrine disruption. At 7 days, exposure to butachlor up-regulated the mRNA expression of genes involved in THs synthesis and metabolism (tshα, tg, tpo and dio1) and THs receptors (trα and trβ). At 14 days, up-regulation of the mRNA expression of genes related to THs synthesis and metabolism (tshα, tshβ, tg, tpo, dio1, dio2 and ttr) and THs receptors (trβ) were also observed after the exposure to butachlor. At 21 days, butachlor up-regulated the mRNA expression of tshα, tg, tpo genes and down-regulated the mRNA expression of tshβ, tg, dio1, ttr and trα genes. These results showed that butachlor could change the mRNA expression of genes involved in the HPT axis and increase whole-body thyroid hormones levels of X. laevis tadpoles in a dose- and time-dependent manner, causing thyroid endocrine disruption and developmental toxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Genome-wide identification and characterization of auxin response factor (ARF) family genes related to flower and fruit development in papaya (Carica papaya L.).

PubMed

Liu, Kaidong; Yuan, Changchun; Li, Haili; Lin, Wanhuang; Yang, Yanjun; Shen, Chenjia; Zheng, Xiaolin

2015-11-05

Auxin and auxin signaling are involved in a series of developmental processes in plants. Auxin Response Factors (ARFs) is reported to modulate the expression of target genes by binding to auxin response elements (AuxREs) and influence the transcriptional activation of down-stream target genes. However, how ARF genes function in flower development and fruit ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive characterization and expression profiling analysis of 11 C. papaya ARF (CpARF) genes was performed using the newly updated papaya reference genome data. We analyzed CpARF expression patterns at different developmental stages. CpARF1, CpARF2, CpARF4, CpARF5, and CpARF10 showed the highest expression at the initial stage of flower development, but decreased during the following developmental stages. CpARF6 expression increased during the developmental process and reached its peak level at the final stage of flower development. The expression of CpARF1 increased significantly during the fruit ripening stages. Many AuxREs were included in the promoters of two ethylene signaling genes (CpETR1 and CpETR2) and three ethylene-synthesis-related genes (CpACS1, CpACS2, and CpACO1), suggesting that CpARFs might be involved in fruit ripening via the regulation of ethylene signaling. Our study provided comprehensive information on ARF family in papaya, including gene structures, chromosome locations, phylogenetic relationships, and expression patterns. The involvement of CpARF gene expression changes in flower and fruit development allowed us to understand the role of ARF-mediated auxin signaling in the maturation of reproductive organs in papaya.

Differential gene expression related to Nora virus infection of Drosophila melanogaster

PubMed Central

Cordes, Ethan J.; Licking-Murray, Kellie D; Carlson, Kimberly A.

2013-01-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. PMID:23603562

Identification and Characterization of Genes Required for Early Myxococcus xanthus Developmental Gene Expression

PubMed Central

Guo, Dongchuan; Wu, Yun; Kaplan, Heidi B.

2000-01-01

Starvation and cell density regulate the developmental expression of Myxococcus xanthus gene 4521. Three classes of mutants allow expression of this developmental gene during growth on nutrient agar, such that colonies of strains containing a Tn5 lac Ω4521 fusion are Lac+. One class of these mutants inactivates SasN, a negative regulator of 4521 expression; another class activates SasS, a sensor kinase-positive regulator of 4521 expression; and a third class blocks lipopolysaccharide (LPS) O-antigen biosynthesis. To identify additional positive regulators of 4521 expression, 11 Lac− TnV.AS transposon insertion mutants were isolated from a screen of 18,000 Lac+ LPS O-antigen mutants containing Tn5 lac Ω4521 (Tcr). Ten mutations identified genes that could encode positive regulators of 4521 developmental expression based on their ability to abolish 4521 expression during development in the absence of LPS O antigen and in an otherwise wild-type background. Eight of these mutations mapped to the sasB locus, which encodes the known 4521 regulators SasS and SasN. One mapped to sasS, whereas seven identified new genes. Three mutations mapped to a gene encoding an NtrC-like response regulator homologue, designated sasR, and four others mapped to a gene designated sasP. One mutation, designated ssp10, specifically suppressed the LPS O-antigen defect; the ssp10 mutation had no effect on 4521 expression in an otherwise wild-type background but reduced 4521 developmental expression in the absence of LPS O antigen to a level close to that of the parent strain. All of the mutations except those in sasP conferred defects during growth and development. These data indicate that a number of elements are required for 4521 developmental expression and that most of these are necessary for normal growth and fruiting body development. PMID:10913090

Developmental up-regulation of vesicular glutamate transporter-1 promotes neocortical presynaptic terminal development.

PubMed

Berry, Corbett T; Sceniak, Michael P; Zhou, Louie; Sabo, Shasta L

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex.

Developmental Up-Regulation of Vesicular Glutamate Transporter-1 Promotes Neocortical Presynaptic Terminal Development

PubMed Central

Berry, Corbett T.; Sceniak, Michael P.; Zhou, Louie; Sabo, Shasta L.

2012-01-01

Presynaptic terminal formation is a complex process that requires assembly of proteins responsible for synaptic transmission at sites of axo-dendritic contact. Accumulation of presynaptic proteins at developing terminals is facilitated by glutamate receptor activation. Glutamate is loaded into synaptic vesicles for release via the vesicular glutamate transporters VGLUT1 and VGLUT2. During postnatal development there is a switch from predominantly VGLUT2 expression to high VGLUT1 and low VGLUT2, raising the question of whether the developmental increase in VGLUT1 is important for presynaptic development. Here, we addressed this question using confocal microscopy and quantitative immunocytochemistry in primary cultures of rat neocortical neurons. First, in order to understand the extent to which the developmental switch from VGLUT2 to VGLUT1 occurs through an increase in VGLUT1 at individual presynaptic terminals or through addition of VGLUT1-positive presynaptic terminals, we examined the spatio-temporal dynamics of VGLUT1 and VGLUT2 expression. Between 5 and 12 days in culture, the percentage of presynaptic terminals that expressed VGLUT1 increased during synapse formation, as did expression of VGLUT1 at individual terminals. A subset of VGLUT1-positive terminals also expressed VGLUT2, which decreased at these terminals. At individual terminals, the increase in VGLUT1 correlated with greater accumulation of other synaptic vesicle proteins, such as synapsin and synaptophysin. When the developmental increase in VGLUT1 was prevented using VGLUT1-shRNA, the density of presynaptic terminals and accumulation of synapsin and synaptophysin at terminals were decreased. Since VGLUT1 knock-down was limited to a small number of neurons, the observed effects were cell-autonomous and independent of changes in overall network activity. These results demonstrate that up-regulation of VGLUT1 is important for development of presynaptic terminals in the cortex. PMID:23226425

Comparative transcriptome and proteome profiling of two Citrus sinensis cultivars during fruit development and ripening.

PubMed

Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li

2017-12-21

Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.

Transcriptional profiles of Arabidopsis stomataless mutants reveal developmental and physiological features of life in the absence of stomata

PubMed Central

de Marcos, Alberto; Triviño, Magdalena; Pérez-Bueno, María Luisa; Ballesteros, Isabel; Barón, Matilde; Mena, Montaña; Fenoll, Carmen

2015-01-01

Loss of function of the positive stomata development regulators SPCH or MUTE in Arabidopsis thaliana renders stomataless plants; spch-3 and mute-3 mutants are extreme dwarfs, but produce cotyledons and tiny leaves, providing a system to interrogate plant life in the absence of stomata. To this end, we compared their cotyledon transcriptomes with that of wild-type plants. K-means clustering of differentially expressed genes generated four clusters: clusters 1 and 2 grouped genes commonly regulated in the mutants, while clusters 3 and 4 contained genes distinctively regulated in mute-3. Classification in functional categories and metabolic pathways of genes in clusters 1 and 2 suggested that both mutants had depressed secondary, nitrogen and sulfur metabolisms, while only a few photosynthesis-related genes were down-regulated. In situ quenching analysis of chlorophyll fluorescence revealed limited inhibition of photosynthesis. This and other fluorescence measurements matched the mutant transcriptomic features. Differential transcriptomes of both mutants were enriched in growth-related genes, including known stomata development regulators, which paralleled their epidermal phenotypes. Analysis of cluster 3 was not informative for developmental aspects of mute-3. Cluster 4 comprised genes differentially up−regulated in mute−3, 35% of which were direct targets for SPCH and may relate to the unique cell types of mute−3. A screen of T-DNA insertion lines in genes differentially expressed in the mutants identified a gene putatively involved in stomata development. A collection of lines for conditional overexpression of transcription factors differentially expressed in the mutants rendered distinct epidermal phenotypes, suggesting that these proteins may be novel stomatal development regulators. Thus, our transcriptome analysis represents a useful source of new genes for the study of stomata development and for characterizing physiology and growth in the absence of stomata. PMID:26157447

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Transcriptome analysis of PCOS arrested 2-cell embryos.

PubMed

Lu, Cuiling; Chi, Hongbin; Wang, Yapeng; Feng, Xue; Wang, Lina; Huang, Shuo; Yan, Liying; Lin, Shengli; Liu, Ping; Qiao, Jie

2018-06-18

In an attempt to explore the early developmental arrest in embryos from polycystic ovarian syndrome (PCOS) patients, we sequenced the transcriptome profiles of PCOS arrested 2-cell embryos, non-PCOS arrested 2-cell embryos and non-arrested 2-cell embryos using single-cell RNA-Seq technique. Differential expression analysis was performed using the DEGSeq R package. Gene Ontology (GO) enrichment was analyzed using the GOseq R package. Data revealed 62 differentially expressed genes between non-PCOS arrested and PCOS arrested embryos and 2217 differentially expressed genes between PCOS arrested and non-arrested 2-cell embryos. A total of 49 differently expressed genes (DEGs) were annotated with GO terms in the up-regulated genes between PCOS arrested and non-PCOS arrested embryos after GO enrichment. A total of 29 DEGs were annotated with GO terms in the down-regulated genes between PCOS arrested and non-arrested 2-cell embryos after GO enrichment. These data can provide a reference for screening specific genes involved in the arrest of PCOS embryos.

Interaction and developmental activation of two neuroendocrine systems that regulate light-mediated skin pigmentation.

PubMed

Bertolesi, Gabriel E; Song, Yi N; Atkinson-Leadbeater, Karen; Yang, Jung-Lynn J; McFarlane, Sarah

2017-07-01

Lower vertebrates use rapid light-regulated changes in skin colour for camouflage (background adaptation) or during circadian variation in irradiance levels. Two neuroendocrine systems, the eye/alpha-melanocyte-stimulating hormone (α-MSH) and the pineal complex/melatonin circuits, regulate the process through their respective dispersion and aggregation of pigment granules (melanosomes) in skin melanophores. During development, Xenopus laevis tadpoles raised on a black background or in the dark perceive less light sensed by the eye and darken in response to increased α-MSH secretion. As embryogenesis proceeds, the pineal complex/melatonin circuit becomes the dominant regulator in the dark and induces lightening of the skin of larvae. The eye/α-MSH circuit continues to mediate darkening of embryos on a black background, but we propose the circuit is shut down in complete darkness in part by melatonin acting on receptors expressed by pituitary cells to inhibit the expression of pomc, the precursor of α-MSH. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Synergistic role of Sprouty2 inactivation and c-Met up-regulation in mouse and human hepatocarcinogenesis.

PubMed

Lee, Susie A; Ladu, Sara; Evert, Matthias; Dombrowski, Frank; De Murtas, Valentina; Chen, Xin; Calvisi, Diego F

2010-08-01

Sprouty2 (Spry2), a negative feedback regulator of the Ras/mitogen-activated protein kinase (MAPK) pathway, is frequently down-regulated in human hepatocellular carcinoma (HCC). We tested the hypothesis that loss of Spry2 cooperates with unconstrained activation of the c-Met protooncogene to induce hepatocarcinogenesis via in vitro and in vivo approaches. We found coordinated down-regulation of Spry2 protein expression and activation of c-Met as well as its downstream effectors extracellular signal-regulated kinase (ERK) and v-akt murine thymoma viral oncogene homolog (AKT) in a subset of human HCC samples with poor outcome. Mechanistic studies revealed that Spry2 function is disrupted in human HCC via multiple mechanisms at both transcriptional and post-transcriptional level, including promoter hypermethylation, loss of heterozygosity, and proteosomal degradation by neural precursor cell expressed, developmentally down-regulated 4 (NEDD4). In HCC cell lines, Spry2 overexpression inhibits c-Met-induced cell proliferation as well as ERK and AKT activation, whereas loss of Spry2 potentiates c-Met signaling. Most importantly, we show that blocking Spry2 activity via a dominant negative form of Spry2 cooperates with c-Met to promote hepatocarcinogenesis in the mouse liver by sustaining proliferation and angiogenesis. The tumors exhibited high levels of activated ERK and AKT, recapitulating the subgroup of human HCC with a clinically aggressive phenotype. The occurrence of frequent genetic, epigenetic, and biochemical events leading to Spry2 inactivation provides solid evidence that Spry2 functions as a tumor suppressor gene in liver cancer. Coordinated deregulation of Spry2 and c-Met signaling may be a pivotal oncogenic mechanism responsible for unrestrained activation of ERK and AKT pathways in human hepatocarcinogenesis.

Global transcriptome analysis of the maize (Zea mays L.) inbred line 08LF during leaf senescence initiated by pollination-prevention

PubMed Central

Wang, Shunxi; Wu, Liuji; Ku, Lixia; Zhang, Jun; Song, Xiaoheng; Liu, Haiping

2017-01-01

In maize (Zea mays), leaf senescence acts as a nutrient recycling process involved in proteins, lipids, and nucleic acids degradation and transport to the developing sink. However, the molecular mechanisms of pre-maturation associated with pollination-prevention remain unclear in maize. To explore global gene expression changes during the onset and progression of senescence in maize, the inbred line 08LF, with severe early senescence caused by pollination prevention, was selected. Phenotypic observation showed that the onset of leaf senescence of 08LF plants occurred approximately 14 days after silking (DAS) by pollination prevention. Transcriptional profiling analysis of the leaf at six developmental stages during induced senescence revealed that a total of 5,432 differentially expressed genes (DEGs) were identified, including 2314 up-regulated genes and 1925 down-regulated genes. Functional annotation showed that the up-regulated genes were mainly enriched in multi-organism process and nitrogen compound transport, whereas down-regulated genes were involved in photosynthesis. Expression patterns and pathway enrichment analyses of early-senescence related genes indicated that these DEGs are involved in complex regulatory networks, especially in the jasmonic acid pathway. In addition, transcription factors from several families were detected, particularly the CO-like, NAC, ERF, GRAS, WRKY and ZF-HD families, suggesting that these transcription factors might play important roles in driving leaf senescence in maize as a result of pollination-prevention. PMID:28973044

Microarray identification of novel genes downstream of Six1, a critical factor in cranial placode, somite and kidney development

PubMed Central

Yan, Bo; Neilson, Karen M.; Ranganathan, Ramya; Maynard, Thomas; Streit, Andrea; Moody, Sally A.

2014-01-01

Background Six1 plays an important role in the development of several vertebrate organs, including cranial sensory placodes, somites and kidney. Although Six1 mutations cause one form of Branchio-Otic Syndrome (BOS), the responsible gene in many patients has not been identified; genes that act downstream of Six1 are potential BOS candidates. Results We sought to identify novel genes expressed during placode, somite and kidney development by comparing gene expression between control and Six1-expressing ectodermal explants. The expression patterns of 19 of the significantly up-regulated and 11 of the significantly down-regulated genes were assayed from cleavage to larval stages. 28/30 genes are expressed in the otocyst, a structure that is functionally disrupted in BOS, and 26/30 genes are expressed in the nephric mesoderm, a structure that is functionally disrupted in the related Branchio-Otic-Renal (BOR) syndrome. We also identified the chick homologues of 5 genes and show that they have conserved expression patterns. Conclusions Of the 30 genes selected for expression analyses, all are expressed at many of the developmental times and appropriate tissues to be regulated by Six1. Many have the potential to play a role in the disruption of hearing and kidney function seen in BOS/BOR patients. PMID:25403746

FOXO Regulates Organ-Specific Phenotypic Plasticity In Drosophila

PubMed Central

Tang, Hui Yuan; Smith-Caldas, Martha S. B.; Driscoll, Michael V.; Salhadar, Samy; Shingleton, Alexander W.

2011-01-01

Phenotypic plasticity, the ability for a single genotype to generate different phenotypes in response to environmental conditions, is biologically ubiquitous, and yet almost nothing is known of the developmental mechanisms that regulate the extent of a plastic response. In particular, it is unclear why some traits or individuals are highly sensitive to an environmental variable while other traits or individuals are less so. Here we elucidate the developmental mechanisms that regulate the expression of a particularly important form of phenotypic plasticity: the effect of developmental nutrition on organ size. In all animals, developmental nutrition is signaled to growing organs via the insulin-signaling pathway. Drosophila organs differ in their size response to developmental nutrition and this reflects differences in organ-specific insulin-sensitivity. We show that this variation in insulin-sensitivity is regulated at the level of the forkhead transcription factor FOXO, a negative growth regulator that is activated when nutrition and insulin signaling are low. Individual organs appear to attenuate growth suppression in response to low nutrition through an organ-specific reduction in FOXO expression, thereby reducing their nutritional plasticity. We show that FOXO expression is necessary to maintain organ-specific differences in nutritional-plasticity and insulin-sensitivity, while organ-autonomous changes in FOXO expression are sufficient to autonomously alter an organ's nutritional-plasticity and insulin-sensitivity. These data identify a gene (FOXO) that modulates a plastic response through variation in its expression. FOXO is recognized as a key player in the response of size, immunity, and longevity to changes in developmental nutrition, stress, and oxygen levels. FOXO may therefore act as a more general regulator of plasticity. These data indicate that the extent of phenotypic plasticity may be modified by changes in the expression of genes involved in signaling environmental information to developmental processes. PMID:22102829

Developmental regulation of ecdysone receptor (EcR) and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera)

PubMed Central

Mello, Tathyana R. P.; Aleixo, Aline C.; Pinheiro, Daniel G.; Nunes, Francis M. F.; Bitondi, Márcia M. G.; Hartfelder, Klaus; Barchuk, Angel R.; Simões, Zilá L. P.

2014-01-01

Major developmental transitions in multicellular organisms are driven by steroid hormones. In insects, these, together with juvenile hormone (JH), control development, metamorphosis, reproduction and aging, and are also suggested to play an important role in caste differentiation of social insects. Here, we aimed to determine how EcR transcription and ecdysteroid titers are related during honeybee postembryonic development and what may actually be the role of EcR in caste development of this social insect. In addition, we expected that knocking-down EcR gene expression would give us information on the participation of the respective protein in regulating downstream targets of EcR. We found that in Apis mellifera females, EcR-A is the predominantly expressed variant in postembryonic development, while EcR-B transcript levels are higher in embryos, indicating an early developmental switch in EcR function. During larval and pupal stages, EcR-B expression levels are very low, while EcR-A transcripts are more variable and abundant in workers compared to queens. Strikingly, these transcript levels are opposite to the ecdysteroid titer profile. 20-hydroxyecdysone (20E) application experiments revealed that low 20E levels induce EcR expression during development, whereas high ecdysteroid titers seem to be repressive. By means of RNAi-mediated knockdown (KD) of both EcR transcript variants we detected the differential expression of 234 poly-A+ transcripts encoding genes such as CYPs, MRJPs and certain hormone response genes (Kr-h1 and ftz-f1). EcR-KD also promoted the differential expression of 70 miRNAs, including highly conserved ones (e.g., miR-133 and miR-375), as well honeybee-specific ones (e.g., miR-3745 and miR-3761). Our results put in evidence a broad spectrum of EcR-controlled gene expression during postembryonic development of honeybees, revealing new facets of EcR biology in this social insect. PMID:25566327

Developmental programming: gestational bisphenol-A treatment alters trajectory of fetal ovarian gene expression.

PubMed

Veiga-Lopez, Almudena; Luense, Lacey J; Christenson, Lane K; Padmanabhan, Vasantha

2013-05-01

Bisphenol-A (BPA), a ubiquitous environmental endocrine disrupting chemical, is a component of polycarbonate plastic and epoxy resins. Because of its estrogenic properties, there is increasing concern relative to risks from exposures during critical periods of early organ differentiation. Prenatal BPA treatment in sheep results in low birth weight, hypergonadotropism, and ovarian cycle disruptions. This study tested the hypothesis that gestational exposure to bisphenol A, at an environmentally relevant dose, induces early perturbations in the ovarian transcriptome (mRNA and microRNA). Pregnant Suffolk ewes were treated with bisphenol A (0.5 mg/kg, sc, daily, produced ∼2.6 ng/mL of unconjugated BPA in umbilical arterial samples of BPA treated fetuses approaching median levels of BPA measured in maternal circulation) from days 30 to 90 of gestation. Expression of steroidogenic enzymes, steroid/gonadotropin receptors, key ovarian regulators, and microRNA biogenesis components were measured by RT-PCR using RNA derived from fetal ovaries collected on gestational days 65 and 90. An age-dependent effect was evident in most steroidogenic enzymes, steroid receptors, and key ovarian regulators. Prenatal BPA increased Cyp19 and 5α-reductase expression in day 65, but not day 90, ovaries. Fetal ovarian microRNA expression was altered by prenatal BPA with 45 down-regulated (>1.5-fold) at day 65 and 11 down-regulated at day 90 of gestation. These included microRNAs targeting Sry-related high-mobility-group box (SOX) family genes, kit ligand, and insulin-related genes. The results of this study demonstrate that exposure to BPA at an environmentally relevant dose alters fetal ovarian steroidogenic gene and microRNA expression of relevance to gonadal differentiation, folliculogenesis, and insulin homeostasis.

The Arabidopsis tandem CCCH zinc finger proteins AtTZF4, 5 and 6 are involved in light-, abscisic acid- and gibberellic acid-mediated regulation of seed germination.

PubMed

Bogamuwa, Srimathi; Jang, Jyan-Chyun

2013-08-01

Tandem CCCH zinc finger proteins (TZFs) are post-transcriptional regulators of gene expression in animals and yeast. Genetic studies indicate that plant TZFs are involved in hormone-mediated developmental and environmental responses. We have demonstrated previously that Arabidopsis AtTZF1 can localize to processing bodies (PBs) and stress granules (SGs), and affects abscisic acid (ABA)- and gibberellic acid (GA)-mediated growth, stress and gene expression responses. Here we show that AtTZF4, 5 and 6 are specifically expressed in seeds. Consistent with the observation that their expression levels decline during seed imbibition, AtTZF4, 5 and 6 are up-regulated by ABA and down-regulated by GA. Mutant analyses indicate that AtTZF4, 5 and 6 act as positive regulators for ABA- and negative regulators for light- and GA-mediated seed germination responses. Results of gene expression analysis indicate that AtTZF4, 5 and 6 affect seed germination by controlling genes critical for ABA and GA response. Furthermore, AtTZF4, 5 and 6 can co-localize with both PB and SG markers in Arabidopsis cells. Specifically, AtTZF6 can be assembled into PBs and SGs in embryos with the induction of stress hormone methyl jasmonate under the control of native AtTZF6 promoter. © 2013 John Wiley & Sons Ltd.

E-cadherin can replace N-cadherin during secretory-stage enamel development.

PubMed

Guan, Xiaomu; Bidlack, Felicitas B; Stokes, Nicole; Bartlett, John D

2014-01-01

N-cadherin is a cell-cell adhesion molecule and deletion of N-cadherin in mice is embryonic lethal. During the secretory stage of enamel development, E-cadherin is down-regulated and N-cadherin is specifically up-regulated in ameloblasts when groups of ameloblasts slide by one another to form the rodent decussating enamel rod pattern. Since N-cadherin promotes cell migration, we asked if N-cadherin is essential for ameloblast cell movement during enamel development. The enamel organ, including its ameloblasts, is an epithelial tissue and for this study a mouse strain with N-cadherin ablated from epithelium was generated. Enamel from wild-type (WT) and N-cadherin conditional knockout (cKO) mice was analyzed. μCT and scanning electron microscopy showed that thickness, surface structure, and prism pattern of the cKO enamel looked identical to WT. No significant difference in hardness was observed between WT and cKO enamel. Interestingly, immunohistochemistry revealed the WT and N-cadherin cKO secretory stage ameloblasts expressed approximately equal amounts of total cadherins. Strikingly, E-cadherin was not normally down-regulated during the secretory stage in the cKO mice suggesting that E-cadherin can compensate for the loss of N-cadherin. Previously it was demonstrated that bone morphogenetic protein-2 (BMP2) induces E- and N-cadherin expression in human calvaria osteoblasts and we show that the N-cadherin cKO enamel organ expressed significantly more BMP2 and significantly less of the BMP antagonist Noggin than did WT enamel organ. The E- to N-cadherin switch at the secretory stage is not essential for enamel development or for forming the decussating enamel rod pattern. E-cadherin can substitute for N-cadherin during these developmental processes. Bmp2 expression may compensate for the loss of N-cadherin by inducing or maintaining E-cadherin expression when E-cadherin is normally down-regulated. Notably, this is the first demonstration of a natural endogenous increase in E-cadherin expression due to N-cadherin ablation in a healthy developing tissue.

Enhancer of zeste acts as a major developmental regulator of Ciona intestinalis embryogenesis

PubMed Central

Le Goff, Emilie; Martinand-Mari, Camille; Martin, Marianne; Feuillard, Jérôme; Boublik, Yvan; Godefroy, Nelly; Mangeat, Paul; Baghdiguian, Stephen; Cavalli, Giacomo

2015-01-01

ABSTRACT The paradigm of developmental regulation by Polycomb group (PcG) proteins posits that they maintain silencing outside the spatial expression domains of their target genes, particularly of Hox genes, starting from mid embryogenesis. The Enhancer of zeste [E(z)] PcG protein is the catalytic subunit of the PRC2 complex, which silences its targets via deposition of the H3K27me3 mark. Here, we studied the ascidian Ciona intestinalis counterpart of E(z). Ci-E(z) is detected by immunohistochemistry as soon as the 2- and 4-cell stages as a cytoplasmic form and becomes exclusively nuclear thereafter, whereas the H3K27me3 mark is detected starting from the gastrula stage and later. Morpholino invalidation of Ci-E(z) leads to the total disappearance of both Ci-E(z) protein and its H3K27me3 mark. Ci-E(z) morphants display a severe phenotype. Strikingly, the earliest defects occur at the 4-cell stage with the dysregulation of cell positioning and mitotic impairment. At later stages, Ci-E(z)-deficient embryos are affected by terminal differentiation defects of neural, epidermal and muscle tissues, by the failure to form a notochord and by the absence of caudal nerve. These major phenotypic defects are specifically rescued by injection of a morpholino-resistant Ci-E(z) mRNA, which restores expression of Ci-E(z) protein and re-deposition of the H3K27me3 mark. As observed by qPCR analyses, Ci-E(z) invalidation leads to the early derepression of tissue-specific developmental genes, whereas late-acting developmental genes are generally down-regulated. Altogether, our results suggest that Ci-E(z) plays a major role during embryonic development in Ciona intestinalis by silencing early-acting developmental genes in a Hox-independent manner. PMID:26276097

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

PubMed

Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

2015-03-25

RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.

RNA interference-mediated knockdown of the hydroxyacid-oxoacid transhydrogenase gene decreases thiamethoxam resistance in adults of the whitefly Bemisia tabaci

PubMed Central

Yang, Xin; Xie, Wen; Li, Ru-mei; Zhou, Xiao-mao; Wang, Shao-li; Wu, Qing-jun; Yang, Ni-na; Xia, Ji-xing; Yang, Ze-zong; Guo, Li-tao; Liu, Ya-ting; Zhang, You-jun

2017-01-01

Bemisia tabaci has developed a high level of resistance to thiamethoxam, a second generation neonicotinoid insecticide that has been widely used to control this pest. In this study, we investigated whether hydroxyacid-oxoacid transhydrogenase (HOT) is involved in resistance to the neonicotinoid insecticide thiamethoxam in the whitefly. We cloned the full-length gene that encodes HOT in B. tabaci. Its cDNA contains a 1428-bp open reading frame encoding 475 amino acid residues. Then we evaluated the mRNA expression level of HOT in different developmental stages, and found HOT expression was significantly greater in thiamethoxam resistance adults than in thiamethoxam susceptible adults. Subsequently, seven field populations of B. tabaci adults were sampled, the expression of mRNA level of HOT significant positive correlated with thiamethoxam resistance level. At last, we used a modified gene silencing system to knock-down HOT expression in B. tabaci adults. The results showed that the HOT mRNA levels decreased by 57% and thiamethoxam resistance decreased significantly after 2 days of feeding on a diet containing HOT dsRNA. The results indicated that down-regulation of HOT expression decreases thiamethoxam resistance in B. tabaci adults. PMID:28117358

Developmental outcomes of Down syndrome and Dandy-Walker malformation

PubMed Central

Love, Kaitlin; Huddleston, Lillie; Olney, Pat; Wrubel, David; Visootsak, Jeannie

2012-01-01

Dandy-Walker syndrome (DWS), or Dandy-Walker complex, is a congenital brain malformation of the posterior fossa, typically resulting in developmental delay and cognitive disability. The co-occurrence of Down syndrome (DS) and DWS is relatively uncommon; thus, its impact on developmental outcomes has not been fully elucidated. Herein, we report a case of a 37-month-old child with DS and DWS, who is functioning at the following age-equivalent: gross motor at a 9-mo level, fine motor 6 mo, expressive language 14 mo, receptive language 9 mo. As such, it is important to determine how the DWS influences developmental outcomes, and appreciate the importance of early interventional therapy. PMID:22866020

C. elegans microRNAs.

PubMed

Vella, Monica C; Slack, Frank J

2005-09-21

MicroRNAs (miRNAs) are small, non-coding regulatory RNAs found in many phyla that control such diverse events as development, metabolism, cell fate and cell death. They have also been implicated in human cancers. The C. elegans genome encodes hundreds of miRNAs, including the founding members of the miRNA family lin-4 and let-7. Despite the abundance of C. elegans miRNAs, few miRNA targets are known and little is known about the mechanism by which they function. However, C. elegans research continues to push the boundaries of discovery in this area. lin-4 and let-7 are the best understood miRNAs. They control the timing of adult cell fate determination in hypodermal cells by binding to partially complementary sites in the mRNA of key developmental regulators to repress protein expression. For example, lin-4 is predicted to bind to seven sites in the lin-14 3' untranslated region (UTR) to repress LIN-14, while let-7 is predicted to bind two let-7 complementary sites in the lin-41 3' UTR to down-regulate LIN-41. Two other miRNAs, lsy-6 and mir-273, control left-right asymmetry in neural development, and also target key developmental regulators for repression. Approximately one third of the C. elegans miRNAs are differentially expressed during development indicating a major role for miRNAs in C. elegans development. Given the remarkable conservation of developmental mechanism across phylogeny, many of the principles of miRNAs discovered in C. elegans are likely to be applicable to higher animals.

Regulation of Expressive Behavior as Reflecting Affect Socialization.

ERIC Educational Resources Information Center

Saarni, Carolyn

Regulated expressiveness (the modification of expressive behavior) is a complex phenomenon. Accomplished basically in four ways, regulated expressiveness has developmental dimensions, motivational precursors, and cognitive antecedents, including perspective-taking ability and the growth of self-awareness. Ability to regulate expressiveness appears…

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

PubMed

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

Differential expression of genes in fetal brain as a consequence of maternal protein deficiency and nematode infection.

PubMed

Haque, Manjurul; Starr, Lisa M; Koski, Kristine G; Scott, Marilyn E

2018-01-01

Maternal dietary protein deficiency and gastrointestinal nematode infection during early pregnancy have negative impacts on both maternal placental gene expression and fetal growth in the mouse. Here we used next-generation RNA sequencing to test our hypothesis that maternal protein deficiency and/or nematode infection also alter the expression of genes in the developing fetal brain. Outbred pregnant CD1 mice were used in a 2×2 design with two levels of dietary protein (24% versus 6%) and two levels of infection (repeated sham versus Heligmosomoides bakeri beginning at gestation day 5). Pregnant dams were euthanized on gestation day 18 to harvest the whole fetal brain. Four fetal brains from each treatment group were analyzed using RNA Hi-Seq sequencing and the differential expression of genes was determined by the edgeR package using NetworkAnalyst. In response to maternal H. bakeri infection, 96 genes (88 up-regulated and eight down-regulated) were differentially expressed in the fetal brain. Differentially expressed genes were involved in metabolic processes, developmental processes and the immune system according to the PANTHER classification system. Among the important biological functions identified, several up-regulated genes have known neurological functions including neuro-development (Gdf15, Ing4), neural differentiation (miRNA let-7), synaptic plasticity (via suppression of NF-κβ), neuro-inflammation (S100A8, S100A9) and glucose metabolism (Tnnt1, Atf3). However, in response to maternal protein deficiency, brain-specific serine protease (Prss22) was the only up-regulated gene and only one gene (Dynlt1a) responded to the interaction of maternal nematode infection and protein deficiency. In conclusion, maternal exposure to GI nematode infection from day 5 to 18 of pregnancy may influence developmental programming of the fetal brain. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Metformin suppresses CYP1A1 and CYP1B1 expression in breast cancer cells by down-regulating aryl hydrocarbon receptor expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Do, Minh Truong; Kim, Hyung Gyun; Tran, Thi Thu Phuong

2014-10-01

Induction of cytochrome P450 (CYP) 1A1 and CYP1B1 by environmental xenobiotic chemicals or endogenous ligands through the activation of the aryl hydrocarbon receptor (AhR) has been implicated in a variety of cellular processes related to cancer, such as transformation and tumorigenesis. Here, we investigated the effects of the anti-diabetes drug metformin on expression of CYP1A1 and CYP1B1 in breast cancer cells under constitutive and inducible conditions. Our results indicated that metformin down-regulated the expression of CYP1A1 and CYP1B1 in breast cancer cells under constitutive and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced conditions. Down-regulation of AhR expression was required for metformin-mediated decreases in CYP1A1 andmore » CYP1B1 expression, and the metformin-mediated CYP1A1 and CYP1B1 reduction is irrelevant to estrogen receptor α (ERα) signaling. Furthermore, we found that metformin markedly down-regulated Sp1 protein levels in breast cancer cells. The use of genetic and pharmacological tools revealed that metformin-mediated down-regulation of AhR expression was mediated through the reduction of Sp1 protein. Metformin inhibited endogenous AhR ligand-induced CYP1A1 and CYP1B1 expression by suppressing tryptophan-2,3-dioxygenase (TDO) expression in MCF-7 cells. Finally, metformin inhibits TDO expression through a down-regulation of Sp1 and glucocorticoid receptor (GR) protein levels. Our findings demonstrate that metformin reduces CYP1A1 and CYP1B1 expression in breast cancer cells by down-regulating AhR signaling. Metformin would be able to act as a potential chemopreventive agent against CYP1A1 and CYP1B1-mediated carcinogenesis and development of cancer. - Graphical abstract: Schematic of the CYP1A1 and CYP1B1 gene regulation by metformin. - Highlights: • Metformin inhibits CYP1A1 and CYP1B1 expression. • Metformin down-regulates the AhR signaling. • Metformin reduces Sp1 protein expression. • Metformin suppresses TDO expression.« less

Anabaena sp. strain PCC 7120 conR contains a LytR-CpsA-Psr domain, is developmentally regulated, and is essential for diazotrophic growth and heterocyst morphogenesis.

PubMed

Mella-Herrera, Rodrigo A; Neunuebel, M Ramona; Golden, James W

2011-03-01

The conR (all0187) gene of the filamentous cyanobacterium Anabaena (Nostoc) sp. strain PCC 7120 is predicted to be part of a family of proteins that contain the LytR-CpsA-Psr domain associated with septum formation and cell wall maintenance. The conR gene was originally misannotated as a transcription regulator. Northern RNA blot analysis showed that conR expression was upregulated 8 h after nitrogen step-down. Fluorescence microscopy of a P(conR)-gfp reporter strain revealed increased GFP fluorescence in proheterocysts and heterocysts beginning 9 h after nitrogen step-down. Insertional inactivation of conR caused a septum-formation defect of vegetative cells grown in nitrate-containing medium. In nitrate-free medium, mutant filaments formed abnormally long heterocysts and were defective for diazotrophic growth. Septum formation between heterocysts and adjacent vegetative cells was abnormal, often with one or both poles of the heterocysts appearing partially open. In a conR mutant, expression of nifH was delayed after nitrogen step-down and nitrogenase activity was approximately 70 % of wild-type activity, indicating that heterocysts of the conR mutant strain are partially functional. We hypothesize that the diazotrophic growth defect is caused by an inability of the heterocysts to transport fixed nitrogen to the neighbouring vegetative cells.

Differential gene expression related to Nora virus infection of Drosophila melanogaster.

PubMed

Cordes, Ethan J; Licking-Murray, Kellie D; Carlson, Kimberly A

2013-08-01

Nora virus is a recently discovered RNA picorna-like virus that produces a persistent infection in Drosophila melanogaster, but the antiviral pathway or change in gene expression is unknown. We performed cDNA microarray analysis comparing the gene expression profiles of Nora virus infected and uninfected wild-type D. melanogaster. This analysis yielded 58 genes exhibiting a 1.5-fold change or greater and p-value less than 0.01. Of these genes, 46 were up-regulated and 12 down-regulated in response to infection. To validate the microarray results, qRT-PCR was performed with probes for Chorion protein 16 and Troponin C isoform 4, which show good correspondence with cDNA microarray results. Differential regulation of genes associated with Toll and immune-deficient pathways, cytoskeletal development, Janus Kinase-Signal Transducer and Activator of Transcription interactions, and a potential gut-specific innate immune response were found. This genome-wide expression profile of Nora virus infection of D. melanogaster can pinpoint genes of interest for further investigation of antiviral pathways employed, genetic mechanisms, sites of replication, viral persistence, and developmental effects. Copyright © 2013. Published by Elsevier B.V.

Collagen triple helix repeat containing-1 promotes pancreatic cancer progression by regulating migration and adhesion of tumor cells.

PubMed

Park, Eun Hye; Kim, Seokho; Jo, Ji Yoon; Kim, Su Jin; Hwang, Yeonsil; Kim, Jin-Man; Song, Si Young; Lee, Dong-Ki; Koh, Sang Seok

2013-03-01

Collagen triple helix repeat containing-1 (CTHRC1) is a secreted protein involved in vascular remodeling, bone formation and developmental morphogenesis. CTHRC1 has recently been shown to be expressed in human cancers such as breast cancer and melanoma. In this study, we show that CTHRC1 is highly expressed in human pancreatic cancer tissues and plays a role in the progression and metastasis of the disease. CTHRC1 promoted primary tumor growth and metastatic spread of cancer cells to distant organs in orthotopic xenograft tumor mouse models. Overexpression of CTHRC1 in cancer cells resulted in increased motility and adhesiveness, whereas these cellular activities were diminished by down-regulation of the protein. CTHRC1 activated several key signaling molecules, including Src, focal adhesion kinase, paxillin, mitogen-activated protein kinase kinase (MEK), extracellular signal-regulated kinase and Rac1. Treatment with chemical inhibitors of Src, MEK or Rac1 and expression of dominant-negative Rac1 attenuated CTHRC1-induced cell migration and adhesion. Collectively, our results suggest that CTHRC1 has a role in pancreatic cancer progression and metastasis by regulating migration and adhesion activities of cancer cells.

Quantitative analysis of oyster larval proteome provides new insights into the effects of multiple climate change stressors.

PubMed

Dineshram, Ramadoss; Chandramouli, Kondethimmanahalli; Ko, Ginger Wai Kuen; Zhang, Huoming; Qian, Pei-Yuan; Ravasi, Timothy; Thiyagarajan, Vengatesen

2016-06-01

The metamorphosis of planktonic larvae of the Pacific oyster (Crassostrea gigas) underpins their complex life-history strategy by switching on the molecular machinery required for sessile life and building calcite shells. Metamorphosis becomes a survival bottleneck, which will be pressured by different anthropogenically induced climate change-related variables. Therefore, it is important to understand how metamorphosing larvae interact with emerging climate change stressors. To predict how larvae might be affected in a future ocean, we examined changes in the proteome of metamorphosing larvae under multiple stressors: decreased pH (pH 7.4), increased temperature (30 °C), and reduced salinity (15 psu). Quantitative protein expression profiling using iTRAQ-LC-MS/MS identified more than 1300 proteins. Decreased pH had a negative effect on metamorphosis by down-regulating several proteins involved in energy production, metabolism, and protein synthesis. However, warming switched on these down-regulated pathways at pH 7.4. Under multiple stressors, cell signaling, energy production, growth, and developmental pathways were up-regulated, although metamorphosis was still reduced. Despite the lack of lethal effects, significant physiological responses to both individual and interacting climate change related stressors were observed at proteome level. The metamorphosing larvae of the C. gigas population in the Yellow Sea appear to have adequate phenotypic plasticity at the proteome level to survive in future coastal oceans, but with developmental and physiological costs. © 2016 John Wiley & Sons Ltd.

Gene expression as a sensitive endpoint to evaluate cell differentiation and maturation of the developing central nervous system in primary cultures of rat cerebellar granule cells (CGCs) exposed to pesticides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hogberg, Helena T.; Department of Physiology, Wenner-Gren Institute, Stockholm University; Kinsner-Ovaskainen, Agnieszka

The major advantage of primary neuronal cultures for developmental neurotoxicity (DNT) testing is their ability to replicate the crucial stages of neurodevelopment. In our studies using primary culture of cerebellar granule cells (CGCs) we have evaluated whether the gene expression relevant to the most critical developmental processes such as neuronal differentiation (NF-68 and NF-200) and functional maturation (NMDA and GABA{sub A} receptors), proliferation and differentiation of astrocytes (GFAP and S100{beta}) as well as the presence of neural precursor cells (nestin and Sox10) could be used as an endpoint for in vitro DNT. The expression of these genes was assessed aftermore » exposure to various pesticides (paraquat parathion, dichlorvos, pentachlorophenol and cycloheximide) that could induce developmental neurotoxicity through different mechanisms. All studied pesticides significantly modified the expression of selected genes, related to the different stages of neuronal and/or glial cell development and maturation. The most significant changes were observed after exposure to paraquat and parathion (i.e. down-regulation of mRNA expression of NF-68 and NF-200, NMDA and GABA{sub A} receptors). Similarly, dichlorvos affected mainly neurons (decreased mRNA expression of NF-68 and GABA{sub A} receptors) whereas cycloheximide had an effect on neurons and astrocytes, as significant decreases in the mRNA expression of both neurofilaments (NF-68 and NF-200) and the astrocyte marker (S100{beta}) were observed. Our results suggest that toxicity induced by pesticides that target multiple pathways of neurodevelopment can be identified by studying expression of genes that are involved in different stages of cell development and maturation, and that gene expression could be used as a sensitive endpoint for initial screening to identify the compounds with the potential to cause developmental neurotoxicity.« less

Epidermal growth factor receptor expression is related to post-mitotic events in cerebellar development: regulation by thyroid hormone.

PubMed

Carrasco, Emilce; Blum, Mariann; Weickert, Cynthia Shannon; Casper, Diana

2003-01-10

It has been established that thyroid hormone and neurotrophic factors both orchestrate developmental events in the brain. However, it is not clear how these two influences are related. In this study, we investigated the effects of thyroid hormone on cerebellar development and the coincident expression of transforming growth factor-alpha (TGF-alpha), a ligand in the epidermal growth factor (EGF) family, and the epidermal growth factor receptor (EGFR). Profiles of thyroid hormone expression were measured in postnatal animals and were found to peak at postnatal day 15 (P15). These levels dropped below detectable levels when mice were made hypothyroid with propylthiouracil (PTU). TGF-alpha and EGFR expression, as determined by RNAse protection assay, was maximal at P6 in normal animals, but remained low in hypothyroid animals, suggesting that thyroid hormone was responsible for their induction. In situ hybridization and immunohistochemical analysis of EGFR expression revealed that this receptor was present on granule cells within the inner zone of the external granule cell layer (EGL), suggesting that EGFR-ligands were not inducing granule cell proliferation. The persistence of EGFR expression on migrating granule cells and subsequent down-regulation of expression in the internal granule cell layer (IGL) implicates a role for EGFR-ligands in differentiation and/or migration. In hypothyroid animals, we observed a delayed progression of granule cell migration, consistent with the persistence of EGFR labeling in the EGL, and in the 'pile-up' of labeled cells at the interface between the molecular layer and the Purkinje cell layer. Taken together, these results implicate thyroid hormone in the coordinated expression of TGF-alpha and EGFR, which are positioned to play a role in post-mitotic developmental events in the cerebellum.

Developmentally Regulated Sesquiterpene Production Confers Resistance to Colletotrichum gloeosporioides in Ripe Pepper Fruits

PubMed Central

Im, Soonduk; Han, Yun-Jeong; Lee, Sungbeom; Back, Kyoungwhan; Kim, Jeong-Il; Kim, Young Soon

2014-01-01

Sesquiterpenoid capsidiol, exhibiting antifungal activity against pathogenic fungus, is accumulated in infected ripe pepper fruits. In this study, we found a negative relation between the capsidiol level and lesion size in fruits infected with Colletotrichum gloeosporioides, depending on the stage of ripening. To understand the developmental regulation of capsidiol biosynthesis, fungal-induced gene expressions in the isoprenoid biosynthetic pathways were examined in unripe and ripe pepper fruits. The sterol biosynthetic pathway was almost shut down in healthy ripe fruits, showing very low expression of hydroxymethyl glutaryl CoA reductase (HMGR) and squalene synthase (SS) genes. In contrast, genes in the carotenoid pathway were highly expressed in ripe fruits. In the sesquiterpene pathway, 5-epi-aristolochene synthase (EAS), belonging to a sesquiterpene cyclase (STC) family, was significantly induced in the ripe fruits upon fungal infection. Immunoblot and enzyme activity analyses showed that the STCs were induced both in the infected unripe and ripe fruits, while capsidiol was synthesized discriminatively in the ripe fruits, implying diverse enzymatic specificity of multiple STCs. Thereby, to divert sterol biosynthesis into sesquiterpene production, infected fruits were pretreated with an SS inhibitor, zaragozic acid (ZA), resulting in increased levels of capsidiol by more than 2-fold in the ripe fruits, with concurrent reduction of phytosterols. Taken together, the present results suggest that the enhanced expression and activity of EAS in the ripe fruits play an important role in capsidiol production, contributing to the incompatibility between the anthracnose fungus and the ripe pepper fruits. PMID:25286411

The Arabidopsis microtubule-associated protein MAP65-3 supports infection by filamentous biotrophic pathogens by down-regulating salicylic acid-dependent defenses.

PubMed

Quentin, Michaël; Baurès, Isabelle; Hoefle, Caroline; Caillaud, Marie-Cécile; Allasia, Valérie; Panabières, Franck; Abad, Pierre; Hückelhoven, Ralph; Keller, Harald; Favery, Bruno

2016-03-01

The oomycete Hyaloperonospora arabidopsidis and the ascomycete Erysiphe cruciferarum are obligate biotrophic pathogens causing downy mildew and powdery mildew, respectively, on Arabidopsis. Upon infection, the filamentous pathogens induce the formation of intracellular bulbous structures called haustoria, which are required for the biotrophic lifestyle. We previously showed that the microtubule-associated protein AtMAP65-3 plays a critical role in organizing cytoskeleton microtubule arrays during mitosis and cytokinesis. This renders the protein essential for the development of giant cells, which are the feeding sites induced by root knot nematodes. Here, we show that AtMAP65-3 expression is also induced in leaves upon infection by the downy mildew oomycete and the powdery mildew fungus. Loss of AtMAP65-3 function in the map65-3 mutant dramatically reduced infection by both pathogens, predominantly at the stages of leaf penetration. Whole-transcriptome analysis showed an over-represented, constitutive activation of genes involved in salicylic acid (SA) biosynthesis, signaling, and defense execution in map65-3, whereas jasmonic acid (JA)-mediated signaling was down-regulated. Preventing SA synthesis and accumulation in map65-3 rescued plant susceptibility to pathogens, but not the developmental phenotype caused by cytoskeleton defaults. AtMAP65-3 thus has a dual role. It positively regulates cytokinesis, thus plant growth and development, and negatively interferes with plant defense against filamentous biotrophs. Our data suggest that downy mildew and powdery mildew stimulate AtMAP65-3 expression to down-regulate SA signaling for infection. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Genome-wide activity of unliganded estrogen receptor-α in breast cancer cells

PubMed Central

Caizzi, Livia; Ferrero, Giulio; Cutrupi, Santina; Cordero, Francesca; Ballaré, Cecilia; Miano, Valentina; Reineri, Stefania; Ricci, Laura; Friard, Olivier; Testori, Alessandro; Corà, Davide; Caselle, Michele; Di Croce, Luciano; De Bortoli, Michele

2014-01-01

Estrogen receptor-α (ERα) has central role in hormone-dependent breast cancer and its ligand-induced functions have been extensively characterized. However, evidence exists that ERα has functions that are independent of ligands. In the present work, we investigated the binding of ERα to chromatin in the absence of ligands and its functions on gene regulation. We demonstrated that in MCF7 breast cancer cells unliganded ERα binds to more than 4,000 chromatin sites. Unexpectedly, although almost entirely comprised in the larger group of estrogen-induced binding sites, we found that unliganded-ERα binding is specifically linked to genes with developmental functions, compared with estrogen-induced binding. Moreover, we found that siRNA-mediated down-regulation of ERα in absence of estrogen is accompanied by changes in the expression levels of hundreds of coding and noncoding RNAs. Down-regulated mRNAs showed enrichment in genes related to epithelial cell growth and development. Stable ERα down-regulation using shRNA, which caused cell growth arrest, was accompanied by increased H3K27me3 at ERα binding sites. Finally, we found that FOXA1 and AP2γ binding to several sites is decreased upon ERα silencing, suggesting that unliganded ERα participates, together with other factors, in the maintenance of the luminal-specific cistrome in breast cancer cells. PMID:24639548

Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

PubMed Central

Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

2016-01-01

Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

2013-10-01

The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

The miRNAome dynamics during developmental and metabolic reprogramming of tomato root infected with potato cyst nematode.

PubMed

Koter, Marek D; Święcicka, Magdalena; Matuszkiewicz, Mateusz; Pacak, Andrzej; Derebecka, Natalia; Filipecki, Marcin

2018-03-01

Cyst-forming plant-parasitic nematodes are pests threatening many crops. By means of their secretions cyst nematodes induce the developmental and metabolic reprogramming of host cells that lead to the formation of a syncytium, which is the sole food source for growing nematodes. The in depth micro RNA (miRNA) dynamics in the syncytia induced by Globodera rostochiensis in tomato roots was studied. The miRNAomes were obtained from syncytia covering the early and intermediate developmental stages, and were the subject of differential expression analysis. The expression of 1235 miRNAs was monitored. The fold change (log 2 FC) ranged from -7.36 to 8.38, indicating that this transcriptome fraction was very variable. Moreover, we showed that the DE (differentially expressed) miRNAs do not fully overlap between the selected time points, suggesting infection stage specific regulation by miRNA. The correctness of RNA-seq expression profiling was confirmed by qRT-PCR (quantitative Real Time Polymerase Chain Reaction) for seven miRNA species. Down- and up-regulated miRNA species, including their isomiRs, were further used to identify their potential targets. Among them there are a large number of transcription factors linked to different aspects of plant development belonging to gene families, such as APETALA2 (AP2), SQUAMOSA (MADS-box), MYB, GRAS, and AUXIN RESPONSE FACTOR (ARF). The substantial portion of potential target genes belong to the NB-LRR and RLK (RECEPTOR-LIKE KINASE) families, indicating the involvement of miRNA mediated regulation in defense responses. We also collected the evidence for target cleavage in the case of 29 miRNAs using one of three alternative methods: 5' RACE (5' Rapid Amplification of cDNA Ends), a search of tasiRNA within our datasets, and the meta-analysis of tomato degradomes in the GEO (Gene Expression Omnibus) database. Eight target transcripts showed a negative correlation with their respective miRNAs at two or three time points. These results indicate a large regulatory potential for miRNAs in tuning the development and defense responses. Copyright © 2017 Elsevier B.V. All rights reserved.

Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai).

PubMed

Lee, Sang Yoon; Nam, Yoon Kwon

2016-11-01

A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.

Expression and responses to dehydration and salinity stresses of V-PPase gene members in wheat.

PubMed

Wang, Yuezhi; Xu, Haibin; Zhang, Guangxiang; Zhu, Huilan; Zhang, Lixia; Zhang, Zhengzhi; Zhang, Caiqin; Ma, Zhengqiang

2009-12-01

Vacuolar H(+)-translocating pyrophosphatase (V-PPase) is a key enzyme related to plant growth as well as abiotic stress tolerance. In this work, wheat V-PPase genes TaVP1, TaVP2 and TaVP3 were identified. TaVP1 and TaVP2 are more similar to each other than to TaVP3. Their deduced polypeptide sequences preserve the topological structure and essential residues of V-PPases. Phylogenetic studies suggested that monocot plants, at least monocot grasses, have three VP paralogs. TaVP3 transcripts were only detected in developing seeds, and no TaVP2 transcripts were found in germinating seeds. TaVP2 was mainly expressed in shoot tissues and down-regulated in leaves under dehydration. Its expression was up-regulated in roots under high salinity. TaVP1 was relatively more ubiquitously and evenly expressed than TaVP2. Its expression level in roots was highest among the tissues examined, and was inducible by salinity stress. These results indicated that the V-PPase gene paralogs in wheat are differentially regulated spatially and in response to dehydration and salinity stresses. 2009 Institute of Genetics and Developmental Biology and the Genetics Society of China. Published by Elsevier Ltd. All rights reserved.

A DNA damage checkpoint pathway coordinates the division of dikaryotic cells in the ink cap mushroom Coprinopsis cinerea.

PubMed

de Sena-Tomás, Carmen; Navarro-González, Mónica; Kües, Ursula; Pérez-Martín, José

2013-09-01

The fungal fruiting body or mushroom is a multicellular structure essential for sexual reproduction. It is composed of dikaryotic cells that contain one haploid nucleus from each mating partner sharing the same cytoplasm without undergoing nuclear fusion. In the mushroom, the pileus bears the hymenium, a layer of cells that includes the specialized basidia in which nuclear fusion, meiosis, and sporulation occur. Coprinopsis cinerea is a well-known model fungus used to study developmental processes associated with the formation of the fruiting body. Here we describe that knocking down the expression of Atr1 and Chk1, two kinases shown to be involved in the response to DNA damage in a number of eukaryotic organisms, dramatically impairs the ability to develop fruiting bodies in C. cinerea, as well as other developmental decisions such as sclerotia formation. These developmental defects correlated with the impairment in silenced strains to sustain an appropriated dikaryotic cell cycle. Dikaryotic cells in which chk1 or atr1 genes were silenced displayed a higher level of asynchronous mitosis and as a consequence aberrant cells carrying an unbalanced dose of nuclei. Since fruiting body initiation is dependent on the balanced mating-type regulator doses present in the dikaryon, we believe that the observed developmental defects were a consequence of the impaired cell cycle in the dikaryon. Our results suggest a connection between the DNA damage response cascade, cell cycle regulation, and developmental processes in this fungus.

Down-regulation of Transducin-Like Enhancer of Split protein 4 in hepatocellular carcinoma promotes cell proliferation and epithelial-Mesenchymal-Transition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Xiao-cai; Xiao, Cui-cui; Li, Hua

Background: Transducin-Like Enhancer of Split protein 4 (TLE4) has been reported to be involved in some subsets of acute myeloid leukemia and colorectal cancer. In the present study, we aimed to explore the role of TLE4 in tumorigenesis and cancer progression in hepatocellular carcinoma (HCC). Methods: The expression pattern of TLE4 in HCC was determined by Western-blot and qRT-PCR, gain-of-function and loss-of-function was used to explore the biological role of TLE4 in HCC cells. A xenograft model was established to confirm its effects on proliferation. Results: The protein expression levels of TLE4 were significantly down-regulated in HCC tissues compared tomore » matched adjacent normal liver tissues. In vitro, down-regulation of TLE4 in Huh7 or SMMC-7721 promoted cell proliferation and ectopical expression of TLE4 in Hep3B or Bel-7404 suppressed cell proliferation. In addition, the cell colony formation ability was enhanced after down-regulation of TLE4 expression in Huh-7 but suppressed after over-expression in Hep3B. Furthermore, down-regulation of TLE4 increased the cell invasion ability, as well as increased the expression level of Vimentin and decreased that of E-cadherin, indicating a phenotype of epithelial-mesenchymal transition (EMT) in HCC cells. On the contrary, ectopical expression of TLE4 in HCC cells decreased the cell invasion ability and inhibited EMT. In vivo, compared to control group, xenograft tumor volumes were significantly decreased in TLE4 overexpression group. Conclusions: These results demonstrated that TLE4 might play important regulatory roles in cellular proliferation and EMT process in HCC. - Highlights: • TLE4 is significantly down-regulated in HCC samples. • Down regulated of TLE4 in HCC cells promotes cell proliferation. • Down regulated of TLE4 in HCC cells promotes epithelial-to-mesenchymal transition.« less

Bruton's tyrosine kinase and SLP-65 regulate pre-B cell differentiation and the induction of Ig light chain gene rearrangement.

PubMed

Kersseboom, Rogier; Ta, Van B T; Zijlstra, A J Esther; Middendorp, Sabine; Jumaa, Hassan; van Loo, Pieter Fokko; Hendriks, Rudolf W

2006-04-15

Bruton's tyrosine kinase (Btk) and the adapter protein SLP-65 (Src homology 2 domain-containing leukocyte-specific phosphoprotein of 65 kDa) transmit precursor BCR (pre-BCR) signals that are essential for efficient developmental progression of large cycling into small resting pre-B cells. We show that Btk- and SLP-65-deficient pre-B cells have a specific defect in Ig lambda L chain germline transcription. In Btk/SLP-65 double-deficient pre-B cells, both kappa and lambda germline transcripts are severely reduced. Although these observations point to an important role for Btk and SLP-65 in the initiation of L chain gene rearrangement, the possibility remained that these signaling molecules are only required for termination of pre-B cell proliferation or for pre-B cell survival, whereby differentiation and L chain rearrangement is subsequently initiated in a Btk/SLP-65-independent fashion. Because transgenic expression of the antiapoptotic protein Bcl-2 did not rescue the developmental arrest of Btk/SLP-65 double-deficient pre-B cells, we conclude that defective L chain opening in Btk/SLP-65-deficient small resting pre-B cells is not due to their reduced survival. Next, we analyzed transgenic mice expressing the constitutively active Btk mutant E41K. The expression of E41K-Btk in Ig H chain-negative pro-B cells induced 1) surface marker changes that signify cellular differentiation, including down-regulation of surrogate L chain and up-regulation of CD2, CD25, and MHC class II; and 2) premature rearrangement and expression of kappa and lambda light chains. These findings demonstrate that Btk and SLP-65 transmit signals that induce cellular maturation and Ig L chain rearrangement independently of their role in termination of pre-B cell expansion.

Characterization of the altered gene expression profile in early porcine embryos generated from parthenogenesis and somatic cell chromatin transfer.

PubMed

Zhou, Chi; Dobrinsky, John; Tsoi, Stephen; Foxcroft, George R; Dixon, Walter T; Stothard, Paul; Verstegen, John; Dyck, Michael K

2014-01-01

The in vitro production of early porcine embryos is of particular scientific and economic interest. In general, embryos produced from in vitro Assisted Reproductive Technologies (ART) manipulations, such as somatic cell chromatin transfer (CT) and parthenogenetic activation (PA), are less developmentally competent than in vivo-derived embryos. The mechanisms underlying the deficiencies of embryos generated from PA and CT have not been completely understood. To characterize the altered genes and gene networks in embryos generated from CT and PA, comparative transcriptomic analyses of in vivo (IVV) expanded blastocysts (XB), IVV hatched blastocyst (HB), PA XB, PA HB, and CT HB were performed using a custom microarray platform enriched for genes expressed during early embryonic development. Differential expressions of 1492 and 103 genes were identified in PA and CT HB, respectively, in comparison with IVV HB. The "eIF2 signalling", "mitochondrial dysfunction", "regulation of eIF4 and p70S6K signalling", "protein ubiquitination", and "mTOR signalling" pathways were down-regulated in PA HB. Dysregulation of notch signalling-associated genes were observed in both PA and CT HB. TP53 was predicted to be activated in both PA and CT HB, as 136 and 23 regulation targets of TP53 showed significant differential expression in PA and CT HB, respectively, in comparison with IVV HB. In addition, dysregulations of several critical pluripotency, trophoblast development, and implantation-associated genes (NANOG, GATA2, KRT8, LGMN, and DPP4) were observed in PA HB during the blastocyst hatching process. The critical genes that were observed to be dysregulated in CT and PA embryos could be indicative of underlying developmental deficiencies of embryos produced from these technologies.

Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in high glucose treated human mesangial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yang; Department of Geriatrics, Zhu Jiang Hospital, Southern Medical University, Guangzhou, Guangdong; Hu, Fang

Diabetic kidney disease (DKD) has become the leading cause of end-stage renal disease worldwide and is associated with glomerular mesangial cell (MC) proliferation and excessive extracellular matrix (ECM) production. Klotho can attenuate renal fibrosis in part by inhibiting TGF-β1/Smad3 signaling in DKD. Early growth response factor 1 (Egr-1) has been shown to play a key role in renal fibrosis in part by facilitating the formation of a positive feedback loop involving TGF-β1. However, whether Klotho down-regulates Egr-1 by inhibiting TGF-β1/Smad3 signaling in DKD is unclear. In the present study, we assessed human MCs that were incubated under high-glucose conditions tomore » mimic diabetes. Then, we transfected the cells with Klotho plasmid or siRNA to overexpress or knock down Klotho gene and protein expression. Klotho, Egr-1, fibronectin (FN), collagen type I (Col I), Smad3 and phosphorylated Smad3 (p-Smad3) gene and protein expression levels were determined by RT-qPCR and western blotting respectively. High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. pcDNA3.1-Klotho transfection-mediated Klotho overexpression down-regulated Egr-1, FN and Col I expression and the p-Smad3/Smad3 ratio in human MCs. Conversely, siRNA-mediated Klotho silencing up-regulated Egr-1, FN, and Col I expression and the p-Smad3/Smad3 ratio. Moreover, the effects of si-Klotho on Egr-1 expression were abolished by the TGF-β1 inhibitor SB-431542. Klotho overexpression can prevent mesangial ECM production in high-glucose-treated human MCs, an effect that has been partially attributed to Egr-1 down-regulation facilitated by TGF-β1/Smad3 signaling inhibition. - Highlights: • High glucose time-dependently down-regulated Klotho mRNA and protein expression in cultured human MCs. • Klotho overexpression down-regulated Egr-1 and prevented mesangial ECM production in high-glucose-treated human MCs. • Klotho down-regulated Egr-1 by inhibiting TGF-β1/Smad3 signaling in high-glucose-treated human MCs.« less

Genome-wide transcriptomics of aging in the rotifer Brachionus manjavacas, an emerging model system.

PubMed

Gribble, Kristin E; Mark Welch, David B

2017-03-01

Understanding gene expression changes over lifespan in diverse animal species will lead to insights to conserved processes in the biology of aging and allow development of interventions to improve health. Rotifers are small aquatic invertebrates that have been used in aging studies for nearly 100 years and are now re-emerging as a modern model system. To provide a baseline to evaluate genetic responses to interventions that change health throughout lifespan and a framework for new hypotheses about the molecular genetic mechanisms of aging, we examined the transcriptome of an asexual female lineage of the rotifer Brachionus manjavacas at five life stages: eggs, neonates, and early-, late-, and post-reproductive adults. There are widespread shifts in gene expression over the lifespan of B. manjavacas; the largest change occurs between neonates and early reproductive adults and is characterized by down-regulation of developmental genes and up-regulation of genes involved in reproduction. The expression profile of post-reproductive adults was distinct from that of other life stages. While few genes were significantly differentially expressed in the late- to post-reproductive transition, gene set enrichment analysis revealed multiple down-regulated pathways in metabolism, maintenance and repair, and proteostasis, united by genes involved in mitochondrial function and oxidative phosphorylation. This study provides the first examination of changes in gene expression over lifespan in rotifers. We detected differential expression of many genes with human orthologs that are absent in Drosophila and C. elegans, highlighting the potential of the rotifer model in aging studies. Our findings suggest that small but coordinated changes in expression of many genes in pathways that integrate diverse functions drive the aging process. The observation of simultaneous declines in expression of genes in multiple pathways may have consequences for health and longevity not detected by single- or multi-gene knockdown in otherwise healthy animals. Investigation of subtle but genome-wide change in these pathways during aging is an important area for future study.

Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: Identification and expression in response to water accommodated fractions (WAFs).

PubMed

Puthumana, Jayesh; Lee, Min-Chul; Han, Jeonghoon; Kim, Hui-Su; Hwang, Dae-Sik; Lee, Jae-Seong

2017-02-01

Ecdysteroid hormones are pivotal in the development, growth, and molting of arthropods, and the hormone pathway is triggered by binding ecdysteroid to a heterodimer of the two nuclear receptors; ecdysone receptors (EcR) and ultraspiracle (USP). We have characterized EcR and USP genes, and their 5'-untranslated region (5'-UTR) from the copepod Paracyclopina nana, and studied mRNA transcription levels in post-embryonic stages and in response to water accommodated fractions (WAFs) of crude oil. The open reading frames (ORF) of EcR and USP were 1470 and 1287bp that encoded 490 and 429 amino acids with molecular weight of 121.18 and 105.03kDa, respectively. Also, a well conserved DNA-binding domain (DBD) and ligand-binding domain (LBD) were identified which confirmed by phylogenetic analysis. Messenger RNA transcriptional levels of EcR and USP were developmental stage-specific in early post-embryonic stages (N3-4). However, an evoked expression of USP was observed throughout copepodid stage and in adult females. WAFs (40 and 80%) were acted as an ecdysone agonist in P. nana, and elicited the mRNA transcription levels in adults. Developmental stage-specific transcriptional activation of EcR and USP in response to WAFs was observed. USP gene was down-regulated in the nauplius in response to WAF, whereas up-regulation of USP was observed in the adults. This study represents the first data of molecular elucidation of EcR and USP genes and their regulatory elements from P. nana and the developmental stage specific expression in response to WAFs, which can be used as potential biomarkers for environmental stressors with ecotoxicological evaluations in copepods. Copyright © 2016 Elsevier Inc. All rights reserved.

Regulatory RNA at the root of animals: dynamic expression of developmental lincRNAs in the calcisponge Sycon ciliatum.

PubMed

Bråte, Jon; Adamski, Marcin; Neumann, Ralf S; Shalchian-Tabrizi, Kamran; Adamska, Maja

2015-12-22

Long non-coding RNAs (lncRNAs) play important regulatory roles during animal development, and it has been hypothesized that an RNA-based gene regulation was important for the evolution of developmental complexity in animals. However, most studies of lncRNA gene regulation have been performed using model animal species, and very little is known about this type of gene regulation in non-bilaterians. We have therefore analysed RNA-Seq data derived from a comprehensive set of embryogenesis stages in the calcareous sponge Sycon ciliatum and identified hundreds of developmentally expressed intergenic lncRNAs (lincRNAs) in this species. In situ hybridization of selected lincRNAs revealed dynamic spatial and temporal expression during embryonic development. More than 600 lincRNAs constitute integral parts of differentially expressed gene modules, which also contain known developmental regulatory genes, e.g. transcription factors and signalling molecules. This study provides insights into the non-coding gene repertoire of one of the earliest evolved animal lineages, and suggests that RNA-based gene regulation was probably present in the last common ancestor of animals. © 2015 The Authors.

CO2 induced seawater acidification impacts sea urchin larval development II: gene expression patterns in pluteus larvae.

PubMed

Stumpp, M; Dupont, S; Thorndyke, M C; Melzner, F

2011-11-01

Extensive use of fossil fuels is leading to increasing CO(2) concentrations in the atmosphere and causes changes in the carbonate chemistry of the oceans which represents a major sink for anthropogenic CO(2). As a result, the oceans' surface pH is expected to decrease by ca. 0.4 units by the year 2100, a major change with potentially negative consequences for some marine species. Because of their carbonate skeleton, sea urchins and their larval stages are regarded as likely to be one of the more sensitive taxa. In order to investigate sensitivity of pre-feeding (2 days post-fertilization) and feeding (4 and 7 days post-fertilization) pluteus larvae, we raised Strongylocentrotus purpuratus embryos in control (pH 8.1 and pCO(2) 41 Pa e.g. 399 μatm) and CO(2) acidified seawater with pH of 7.7 (pCO(2) 134 Pa e.g. 1318 μatm) and investigated growth, calcification and survival. At three time points (day 2, day 4 and day 7 post-fertilization), we measured the expression of 26 representative genes important for metabolism, calcification and ion regulation using RT-qPCR. After one week of development, we observed a significant difference in growth. Maximum differences in size were detected at day 4 (ca. 10% reduction in body length). A comparison of gene expression patterns using PCA and ANOSIM clearly distinguished between the different age groups (two-way ANOSIM: Global R=1) while acidification effects were less pronounced (Global R=0.518). Significant differences in gene expression patterns (ANOSIM R=0.938, SIMPER: 4.3% difference) were also detected at day 4 leading to the hypothesis that differences between CO(2) treatments could reflect patterns of expression seen in control experiments of a younger larva and thus a developmental artifact rather than a direct CO(2) effect. We found an up regulation of metabolic genes (between 10%and 20% in ATP-synthase, citrate synthase, pyruvate kinase and thiolase at day 4) and down regulation of calcification related genes (between 23% and 36% in msp130, SM30B, and SM50 at day 4). Ion regulation was mainly impacted by up regulation of Na(+)/K(+)-ATPase at day 4 (15%) and down regulation of NHE3 at day 4 (45%). We conclude that in studies in which a stressor induces an alteration in the speed of development, it is crucial to employ experimental designs with a high time resolution in order to correct for developmental artifacts. This helps prevent misinterpretation of stressor effects on organism physiology. Copyright © 2011 Elsevier Inc. All rights reserved.

Active Hexose-correlated Compound Down-regulates Heat Shock Factor 1, a Transcription Factor for HSP27, in Gemcitabine-resistant Human Pancreatic Cancer Cells.

PubMed

Tokunaga, Masayuki; Baron, Byron; Kitagawa, Takao; Tokuda, Kazuhiro; Kuramitsu, Yasuhiro

2015-11-01

Active hexose-correlated compound (AHCC) is an extract of a basidiomycete mushroom that enhances the therapeutic effects and reduces the side-effects of chemotherapy. Our previous studies demonstrated that heat-shock protein 27 (HSP27) was involved in gemcitabine-resistance of pancreatic cancer cells and it was down-regulated by AHCC-treatment. However, how AHCC down-regulated HSP27 is unknown. In the present study, we focused on two transcription factors reported to induce HSP27, heat shock factor 1 (HSF1) and high-mobility group box 1 (HMGB1) and investigated the effect of AHCC on their expression. KLM1-R cells were treated with AHCC and the protein expression of HSF1 and HMGB1 were analyzed by western blotting. The protein expression of HSF1 in KLM1-R was down-regulated by AHCC treatment. On the other hand, the protein expression of HMGB1 was not reduced in KLM1-R cells after AHCC treatment. The possibility that AHCC down-regulated HSP27 through down-regulation of the HSF1, was herein shown. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Keratinocyte growth factor and the expression of wound-healing-related genes in primary human keratinocytes from burn patients.

PubMed

Chomiski, Verônica; Gragnani, Alfredo; Bonucci, Jéssica; Correa, Silvana Aparecida Alves; Noronha, Samuel Marcos Ribeiro de; Ferreira, Lydia Masako

2016-08-01

To evaluate the effect of keratinocyte growth factor (KGF) treatment on the expression of wound-healing-related genes in cultured keratinocytes from burn patients. Keratinocytes were cultured and divided into 4 groups (n=4 in each group): TKB (KGF-treated keratinocytes from burn patients), UKB (untreated keratinocytes from burn patients), TKC (KGF-treated keratinocytes from controls), and UKC (untreated keratinocytes from controls). Gene expression analysis using quantitative polymerase chain reaction (qPCR) array was performed to compare (1) TKC versus UKC, (2) UKB versus UKC, (3) TKB versus UKC, (4) TKB versus UKB, (5) TKB versus TKC, and (6) UKB versus TKC. Comparison 1 showed one down-regulated and one up-regulated gene; comparisons 2 and 3 resulted in the same five down-regulated genes; comparison 4 had no significant difference in relative gene expression; comparison 5 showed 26 down-regulated and 7 up-regulated genes; and comparison 6 showed 25 down-regulated and 11 up-regulated genes. There was no differential expression of wound-healing-related genes in cultured primary keratinocytes from burn patients treated with keratinocyte growth factor.

Nitric Oxide Mediates the Hormonal Control of Crassulacean Acid Metabolism Expression in Young Pineapple Plants1[W][OA

PubMed Central

Freschi, Luciano; Rodrigues, Maria Aurineide; Domingues, Douglas Silva; Purgatto, Eduardo; Van Sluys, Marie-Anne; Magalhaes, Jose Ronaldo; Kaiser, Werner M.; Mercier, Helenice

2010-01-01

Genotypic, developmental, and environmental factors converge to determine the degree of Crassulacean acid metabolism (CAM) expression. To characterize the signaling events controlling CAM expression in young pineapple (Ananas comosus) plants, this photosynthetic pathway was modulated through manipulations in water availability. Rapid, intense, and completely reversible up-regulation in CAM expression was triggered by water deficit, as indicated by the rise in nocturnal malate accumulation and in the expression and activity of important CAM enzymes. During both up- and down-regulation of CAM, the degree of CAM expression was positively and negatively correlated with the endogenous levels of abscisic acid (ABA) and cytokinins, respectively. When exogenously applied, ABA stimulated and cytokinins repressed the expression of CAM. However, inhibition of water deficit-induced ABA accumulation did not block the up-regulation of CAM, suggesting that a parallel, non-ABA-dependent signaling route was also operating. Moreover, strong evidence revealed that nitric oxide (NO) may fulfill an important role during CAM signaling. Up-regulation of CAM was clearly observed in NO-treated plants, and a conspicuous temporal and spatial correlation was also evident between NO production and CAM expression. Removal of NO from the tissues either by adding NO scavenger or by inhibiting NO production significantly impaired ABA-induced up-regulation of CAM, indicating that NO likely acts as a key downstream component in the ABA-dependent signaling pathway. Finally, tungstate or glutamine inhibition of the NO-generating enzyme nitrate reductase completely blocked NO production during ABA-induced up-regulation of CAM, characterizing this enzyme as responsible for NO synthesis during CAM signaling in pineapple plants. PMID:20147491

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Dynamics of gene expression during development and expansion of vegetative stem internodes of bioenergy sorghum

DOE PAGES

Kebrom, Tesfamichael H.; McKinley, Brian; Mullet, John E.

2017-06-21

Bioenergy sorghum accumulates 75% of shoot biomass in stem internodes. Grass stem internodes are formed during vegetative growth and elongate in response to developmental and environmental signals. To identify genes and molecular mechanisms that modulate the extent of internode growth, we conducted microscopic and transcriptomic analyses of four successive sub-apical vegetative internodes representing different stages of internode development of the bioenergy sorghum genotype R.07020. Stem internodes of sorghum genotype R.07020 are formed during the vegetative phase and their length is enhanced by environmental signals such as shade and floral induction in short days. During vegetative growth, the first visible andmore » youngest sub-apical internode was ~0.7 cm in length, whereas the fourth fully expanded internode was ~5 cm in length. Microscopic analyses revealed that all internode tissue types including pith parenchyma and vascular bundles are present in the four successive internodes. Growth in the first two sub-apical internodes occurred primarily through an increase in cell number consistent with expression of genes involved in the cell cycle and DNA replication. Growth of the 3rd internode was associated with an increase in cell length and growth cessation in the 4th internode was associated with up-regulation of genes involved in secondary cell wall deposition. The expression of genes involved in hormone metabolism and signaling indicates that GA, BR, and CK activity decreased while ethylene, ABA, and JA increased in the 3rd/4th internodes. While the level of auxin appears to be increasing as indicated by the up-regulation of ARFs, down-regulation of TIR during development indicates that auxin signaling is also modified. The expression patterns of transcription factors are closely associated with their role during the development of the vegetative internodes. Microscopic and transcriptome analyses of four successive sub-apical internodes characterized the developmental progression of vegetative stem internodes from initiation through full elongation in the sorghum genotype R.07020. Transcriptome profiling indicates that dynamic variation in the levels and action of GA, CK, IAA, BR, ethylene, ABA, and JA modulate gene expression and growth during internode growth and development. Thus, this study provides detailed microscopic and transcriptomic data useful for identifying genes and molecular pathways regulating internode elongation in response to various developmental and environmental signals.« less

Disruption of neurogenesis and cortical development in transgenic mice misexpressing Olig2, a gene in the Down syndrome critical region.

PubMed

Liu, Wei; Zhou, Hui; Liu, Lei; Zhao, Chuntao; Deng, Yaqi; Chen, Lina; Wu, Laiman; Mandrycky, Nicole; McNabb, Christopher T; Peng, Yuanbo; Fuchs, Perry N; Lu, Jie; Sheen, Volney; Qiu, Mengsheng; Mao, Meng; Lu, Q Richard

2015-05-01

The basic helix-loop-helix (bHLH) transcription factor Olig2 is crucial for mammalian central nervous system development. Human ortholog OLIG2 is located in the Down syndrome critical region in trisomy 21. To investigate the effect of Olig2 misexpression on brain development, we generated a developmentally regulated Olig2-overexpressing transgenic line with a Cre/loxP system. The transgenic mice with Olig2 misexpression in cortical neural stem/progenitor cells exhibited microcephaly, cortical dyslamination, hippocampus malformation, and profound motor deficits. Ectopic misexpression of Olig2 impaired cortical progenitor proliferation and caused precocious cell cycle exit. Massive neuronal cell death was detected in the developing cortex of Olig2-misexpressing mice. In addition, Olig2 misexpression led to a significant downregulation of neuronal specification factors including Ngn1, Ngn2 and Pax6, and a defect in cortical neurogenesis. Chromatin-immunoprecipitation and sequencing (ChIP-Seq) analysis indicates that Olig2 directly targets the promoter and/or enhancer regions of Nfatc4, Dscr1/Rcan1 and Dyrk1a, the critical neurogenic genes that contribute to Down syndrome phenotypes, and inhibits their expression. Together, our study suggests that Olig2 misexpression in neural stem cells elicits neurogenesis defects and neuronal cell death, which may contribute to developmental disorders including Down syndrome, where OLIG2 is triplicated on chromosomal 21. Copyright © 2015 Elsevier Inc. All rights reserved.

Transcription of G-protein coupled receptors in corporal smooth muscle is regulated by sialorphin (an endogenous neutral endopeptidase inhibitor)

PubMed Central

Tong, Yuehong; Tiplitsky, Scott I.; Tar, Moses; Melman, Arnold; Davies, Kelvin P.

2009-01-01

Purpose Several reports have suggested the rat Vcsa1 gene is down-regulated in models of erectile dysfunction (ED). Vcsa’s protein product, sialorphin, is an endogenous neutral endopeptidase (NEP), and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated if down- regulation of Vcsa1 could result in adaptive change in the expression of G-protein coupled receptors (GPCR). Materials and Methods Gene expression in cultured rat corporal smooth muscle cells (CSM) following treatment with siRNA directed against Vcsa1 or the NEP gene was analyzed using microarray and quantitative RT-PCR. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernosal nerves. Using that animal model, we also investigated whether the down-regulation of Vcsa1 is accompanied by similar changes in gene expression observed in the CSM cells where Vcsa1 was knocked-down in vitro. Results Microarray analysis and quantitative RT-PCR demonstrated that CSM cells treated in vitro with siRNA against Vcsa1 resulted in up-regulation of GPCR as a functional group. In contrast, treatment of CSM cells that lowered NEP activity resulted in decreases in GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on NEP. In animals with bilaterally transected cavernous nerves the reduced expression of Vcsa1 is accompanied by increased GPCR expression in cavernosal tissue. Conclusions These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression. PMID:18554633

Transcription of G-protein coupled receptors in corporeal smooth muscle is regulated by the endogenous neutral endopeptidase inhibitor sialorphin.

PubMed

Tong, Yuehong; Tiplitsky, Scott I; Tar, Moses; Melman, Arnold; Davies, Kelvin P

2008-08-01

Several reports suggest that the rat Vcsa1 gene is down-regulated in models of erectile dysfunction. The Vcsa protein product sialorphin is an endogenous neutral endopeptidase inhibitor and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated whether Vcsa1 down-regulation could result in an adaptive change in GPCR (G-protein coupled receptor) expression. Gene expression in cultured rat corporeal smooth muscle cells following treatment with siRNA directed against Vcsa1 or the neutral endopeptidase gene was analyzed using microarray and quantitative reverse transcriptase-polymerase chain reaction. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernous nerves. In that animal model we also investigated whether Vcsa1 down-regulation was accompanied by similar changes in gene expression in corporeal smooth muscle cells in which Vcsa1 was knocked down in vitro. Microarray analysis and quantitative reverse transcriptase-polymerase chain reaction demonstrated that corporeal smooth muscle cells treated in vitro with siRNA against Vcsa1 resulted in GPCR up-regulation as a functional group. In contrast, treatment of corporeal smooth muscle cells that lowered neutral endopeptidase activity resulted in decreased GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on neutral endopeptidase. In animals with bilaterally transected cavernous nerves the decreased Vcsa1 expression is accompanied by increased GPCR expression in cavernous tissue. These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression.

Neotenic phenomenon in gene expression in the skin of Foxn1- deficient (nude) mice - a projection for regenerative skin wound healing.

PubMed

Kur-Piotrowska, Anna; Kopcewicz, Marta; Kozak, Leslie P; Sachadyn, Pawel; Grabowska, Anna; Gawronska-Kozak, Barbara

2017-01-09

Mouse fetuses up to 16 day of embryonic development and nude (Foxn1- deficient) mice are examples of animals that undergo regenerative (scar-free) skin healing. The expression of transcription factor Foxn1 in the epidermis of mouse fetuses begins at embryonic day 16.5 which coincides with the transition point from scar-free to scar-forming skin wound healing. In the present study, we tested the hypothesis that Foxn1 expression in the skin is an essential condition to establish the adult skin phenotype and that Foxn1 inactivity in nude mice keeps skin in the immature stage resembling the phenomena of neoteny. Uninjured skin of adult C57BL/6J (B6) mice, mouse fetuses at days 14 (E14) and 18 (E18) of embryonic development and B6.Cg-Foxn1 nu (nude) mice were characterized for their gene expression profiles by RNA sequencing that was validated through qRT-PCR, Western Blot and immunohistochemistry. Differentially regulated genes indicated that nude mice were more similar to E14 (model of regenerative healing) and B6 were more similar to E18 (model of reparative healing). The up-regulated genes in nude and E14 mice were associated with tissue remodeling, cytoskeletal rearrangement, wound healing and immune response, whereas the down-regulated genes were associated with differentiation. E14 and nude mice exhibit prominent up-regulation of keratin (Krt23, -73, -82, -16, -17), involucrin (Ivl) and filaggrin (Flg2) genes. The transcription factors associated with the Hox genes known to specify cell fate during embryonic development and promote embryonic stem cells differentiation were down-regulated in both nude and E14. Among the genes enriched in the nude skin but not shared with E14 fetuses were members of the Wnt and matrix metalloproteinases (Mmps) families whereas Bmp and Notch related genes were down-regulated. In summary, Foxn1 appears to be a pivotal control element of the developmental program and skin maturation. Nude mice may be considered as a model of neoteny among mammals. The resemblance of gene expression profiles in the skin of both nude and E14 mice are direct or indirect consequences of the Foxn1 deficiency. Foxn1 appears to regulate the balance between cell proliferation and differentiation and its inactivity creates a pro-regenerative environment.

Aberrant expression of miR-218 and miR-204 in human mesial temporal lobe epilepsy and hippocampal sclerosis-convergence on axonal guidance.

PubMed

Kaalund, Sanne S; Venø, Morten T; Bak, Mads; Møller, Rikke S; Laursen, Henning; Madsen, Flemming; Broholm, Helle; Quistorff, Bjørn; Uldall, Peter; Tommerup, Niels; Kauppinen, Sakari; Sabers, Anne; Fluiter, Kees; Møller, Lisbeth B; Nossent, Anne Y; Silahtaroglu, Asli; Kjems, Jørgen; Aronica, Eleonora; Tümer, Zeynep

2014-12-01

Mesial temporal lobe epilepsy (MTLE) is one of the most common types of the intractable epilepsies and is most often associated with hippocampal sclerosis (HS), which is characterized by pronounced loss of hippocampal pyramidal neurons. microRNAs (miRNAs) have been shown to be dysregulated in epilepsy and neurodegenerative diseases, and we hypothesized that miRNAs could be involved in the pathogenesis of MTLE and HS. miRNA expression was quantified in hippocampal specimens from human patients using miRNA microarray and quantitative real-time polymerase chain reaction RT-PCR, and by RNA-seq on fetal brain specimens from domestic pigs. In situ hybridization was used to show the spatial distribution of miRNAs in the human hippocampus. The potential effect of miRNAs on targets genes was investigated using the dual luciferase reporter gene assay. miRNA expression profiling showed that 25 miRNAs were up-regulated and 5 were down-regulated in hippocampus biopsies of MTLE/HS patients compared to controls. We showed that miR-204 and miR-218 were significantly down-regulated in MTLE and HS, and both were expressed in neurons in all subfields of normal hippocampus. Moreover, miR-204 and miR-218 showed strong changes in expression during fetal development of the hippocampus in pigs, and we identified four target genes, involved in axonal guidance and synaptic plasticity, ROBO1, GRM1, SLC1A2, and GNAI2, as bona fide targets of miR-218. GRM1 was also shown to be a direct target of miR-204. miR-204 and miR-218 are developmentally regulated in the hippocampus and may contribute to the molecular mechanisms underlying the pathogenesis of MTLE and HS. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.

Differential gene expression at different stages of mesocarp development in high- and low-yielding oil palm.

PubMed

Wong, Yick Ching; Teh, Huey Fang; Mebus, Katharina; Ooi, Tony Eng Keong; Kwong, Qi Bin; Koo, Ka Loo; Ong, Chuang Kee; Mayes, Sean; Chew, Fook Tim; Appleton, David R; Kulaveerasingam, Harikrishna

2017-06-21

The oil yield trait of oil palm is expected to involve multiple genes, environmental influences and interactions. Many of the underlying mechanisms that contribute to oil yield are still poorly understood. In this study, we used a microarray approach to study the gene expression profiles of mesocarp tissue at different developmental stages, comparing genetically related high- and low- oil yielding palms to identify genes that contributed to the higher oil-yielding palm and might contribute to the wider genetic improvement of oil palm breeding populations. A total of 3412 (2001 annotated) gene candidates were found to be significantly differentially expressed between high- and low-yielding palms at at least one of the different stages of mesocarp development evaluated. Gene Ontologies (GO) enrichment analysis identified 28 significantly enriched GO terms, including regulation of transcription, fatty acid biosynthesis and metabolic processes. These differentially expressed genes comprise several transcription factors, such as, bHLH, Dof zinc finger proteins and MADS box proteins. Several genes involved in glycolysis, TCA, and fatty acid biosynthesis pathways were also found up-regulated in high-yielding oil palm, among them; pyruvate dehydrogenase E1 component Subunit Beta (PDH), ATP-citrate lyase, β- ketoacyl-ACP synthases I (KAS I), β- ketoacyl-ACP synthases III (KAS III) and ketoacyl-ACP reductase (KAR). Sucrose metabolism-related genes such as Invertase, Sucrose Synthase 2 and Sucrose Phosphatase 2 were found to be down-regulated in high-yielding oil palms, compared to the lower yield palms. Our findings indicate that a higher carbon flux (channeled through down-regulation of the Sucrose Synthase 2 pathway) was being utilized by up-regulated genes involved in glycolysis, TCA and fatty acid biosynthesis leading to enhanced oil production in the high-yielding oil palm. These findings are an important stepping stone to understand the processes that lead to production of high-yielding oil palms and have implications for breeding to maximize oil production.

Prenatal ethanol exposure-induced adrenal developmental abnormality of male offspring rats and its possible intrauterine programming mechanisms.

PubMed

Huang, Hegui; He, Zheng; Zhu, Chunyan; Liu, Lian; Kou, Hao; Shen, Lang; Wang, Hui

2015-10-01

Fetal adrenal developmental status is the major determinant of fetal tissue maturation and offspring growth. We have previously proposed that prenatal ethanol exposure (PEE) suppresses fetal adrenal corticosterone (CORT) synthesis. Here, we focused on PEE-induced adrenal developmental abnormalities of male offspring rats before and after birth, and aimed to explore its intrauterine programming mechanisms. A rat model of intrauterine growth retardation (IUGR) was established by PEE (4g/kg·d). In PEE fetus, increased serum CORT concentration and decreased insulin-like growth factor 1 (IGF1) concentration, with lower bodyweight and structural abnormalities as well as a decreased Ki67 expression (proliferative marker), were observed in the male fetal adrenal cortex. Adrenal glucocorticoid (GC)-metabolic activation system was enhanced while gene expression of IGF1 signaling pathway with steroidogenic acute regulatory protein (StAR), 3β-hydroxysteroid dehydrogenase (3β-HSD) was decreased. Furthermore, in the male adult offspring of PEE, serum CORT level was decreased but IGF1 was increased with partial catch-up growth, and Ki67 expression demonstrated no obvious change. Adrenal GC-metabolic activation system was inhibited, while IGF1 signaling pathway and 3β-HSD was enhanced with the steroidogenic factor 1 (SF1), and StAR was down-regulated in the adult adrenal. Based on these findings, we propose a "two-programming" mechanism for PEE-induced adrenal developmental toxicity: "the first programming" is a lower functional programming of adrenal steroidogenesis, and "the second programming" is GC-metabolic activation system-related GC-IGF1 axis programming. Copyright © 2015 Elsevier Inc. All rights reserved.

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

DOE PAGES

Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...

2015-03-25

Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less

Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR.

PubMed

Chen, Yi-Yung; Rosario, Fredrick J; Shehab, Majida Abu; Powell, Theresa L; Gupta, Madhulika B; Jansson, Thomas

2015-12-01

Placental amino acid transport is decreased in intrauterine growth restriction (IUGR); however, the underlying mechanisms remain largely unknown. We have shown that mechanistic target of rapamycin (mTOR) signalling regulates system A amino acid transport by modulating the ubiquitination and plasma membrane trafficking of sodium-coupled neutral amino acid transporter 2 (SNAT-2) in cultured primary human trophoblast cells. We hypothesize that IUGR is associated with (1) inhibition of placental mTORC1 and mTORC2 signalling pathways, (2) increased amino acid transporter ubiquitination in placental homogenates and (3) decreased protein expression of SNAT-2 in the syncytiotrophoblast microvillous plasma membrane (MVM). To test this hypothesis, we collected placental tissue and isolated MVM from women with pregnancies complicated by IUGR (n=25) and gestational age-matched women with appropriately grown control infants (n=19, birth weights between the twenty-fifth to seventy-fifth percentiles). The activity of mTORC1 and mTORC2 was decreased whereas the protein expression of the ubiquitin ligase NEDD4-2 (neural precursor cell expressed developmentally down-regulated protein 4-2; +72%, P<0.0001) and the ubiquitination of SNAT-2 (+180%, P<0.05) were increased in homogenates of IUGR placentas. Furthermore, IUGR was associated with decreased system A amino acid transport activity (-72%, P<0.0001) and SNAT-1 (-42%, P<0.05) and SNAT-2 (-31%, P<0.05) protein expression in MVM. In summary, these findings are consistent with the possibility that decreased placental mTOR activity causes down-regulation of placental system A activity by shifting SNAT-2 trafficking towards proteasomal degradation, thereby contributing to decreased fetal amino acid availability and restricted fetal growth in IUGR. © 2015 Authors; published by Portland Press Limited.

Increased ubiquitination and reduced plasma membrane trafficking of placental amino acid transporter SNAT-2 in human IUGR

PubMed Central

Rosario, Fredrick J.; Shehab, Majida Abu; Powell, Theresa L.; Gupta, Madhulika B.; Jansson, Thomas

2015-01-01

Placental amino acid transport is decreased in intrauterine growth restriction (IUGR); however, the underlying mechanisms remain largely unknown. We have shown that mechanistic target of rapamycin (mTOR) signalling regulates system A amino acid transport by modulating the ubiquitination and plasma membrane trafficking of sodium-coupled neutral amino acid transporter 2 (SNAT-2) in cultured primary human trophoblast cells. We hypothesize that IUGR is associated with (1) inhibition of placental mTORC1 and mTORC2 signalling pathways, (2) increased amino acid transporter ubiquitination in placental homogenates and (3) decreased protein expression of SNAT-2 in the syncytiotrophoblast microvillous plasma membrane (MVM). To test this hypothesis, we collected placental tissue and isolated MVM from women with pregnancies complicated by IUGR (n=25) and gestational age-matched women with appropriately grown control infants (n=19, birth weights between the twenty-fifth to seventy-fifth percentiles). The activity of mTORC1 and mTORC2 was decreased whereas the protein expression of the ubiquitin ligase NEDD4-2 (neural precursor cell expressed developmentally down-regulated protein 4-2; +72%, P<0.0001) and the ubiquitination of SNAT-2 (+180%, P<0.05) were increased in homogenates of IUGR placentas. Furthermore, IUGR was associated with decreased system A amino acid transport activity (–72%, P<0.0001) and SNAT-1 (–42%, P<0.05) and SNAT-2 (–31%, P<0.05) protein expression in MVM. In summary, these findings are consistent with the possibility that decreased placental mTOR activity causes down-regulation of placental system A activity by shifting SNAT-2 trafficking towards proteasomal degradation, thereby contributing to decreased fetal amino acid availability and restricted fetal growth in IUGR. PMID:26374858

Roles of DgBRC1 in Regulation of Lateral Branching in Chrysanthemum (Dendranthema ×grandiflora cv. Jinba)

PubMed Central

Chen, Xiaoli; Zhou, Xiaoyang; Xi, Lin; Li, Junxiang; Zhao, Ruiyan; Ma, Nan; Zhao, Liangjun

2013-01-01

The diverse plasticity of plant architecture is largely determined by shoot branching. Shoot branching is an event regulated by multiple environmental, developmental and hormonal stimuli through triggering lateral bud response. After perceiving these signals, the lateral buds will respond and make a decision on whether to grow out. TCP transcriptional factors, BRC1/TB1/FC1, were previously proven to be involved in local inhibition of shoot branching in Arabidopsis, pea, tomato, maize and rice. To investigate the function of BRC1, we isolated the BRC1 homolog from chrysanthemum. There were two transcripts of DgBRC1 coming from two alleles in one locus, both of which complemented the multiple branches phenotype of Arabidopsis brc1-1, indicating that both are functionally conserved. DgBRC1 was mainly expressed in dormant axillary buds, and down-regulated at the bud activation stage, and up-regulated by higher planting densities. DgBRC1 transcripts could respond to apical auxin supply and polar auxin transport. Moreover, we found that the acropetal cytokinin stream promoted branch outgrowth whether or not apical auxin was present. Basipetal cytokinin promoted outgrowth of branches in the absence of apical auxin, while strengthening the inhibitory effects on lower buds in the presence of apical auxin. The influence of auxin and strigolactons (SLs) on the production of cytokinin was investigated, we found that auxin locally down-regulated biosynthesis of cytokinin in nodes, SLs also down-regulated the biosynthesis of cytokinin, the interactions among these phytohormones need further investigation. PMID:23613914

Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses1[OPEN

PubMed Central

Andrade, Paola; Caudepón, Daniel; Arró, Montserrat

2016-01-01

Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. PMID:27382138

Suppressing Farnesyl Diphosphate Synthase Alters Chloroplast Development and Triggers Sterol-Dependent Induction of Jasmonate- and Fe-Related Responses.

PubMed

Manzano, David; Andrade, Paola; Caudepón, Daniel; Altabella, Teresa; Arró, Montserrat; Ferrer, Albert

2016-09-01

Farnesyl diphosphate synthase (FPS) catalyzes the synthesis of farnesyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate. Arabidopsis (Arabidopsis thaliana) contains two genes (FPS1 and FPS2) encoding FPS. Single fps1 and fps2 knockout mutants are phenotypically indistinguishable from wild-type plants, while fps1/fps2 double mutants are embryo lethal. To assess the effect of FPS down-regulation at postembryonic developmental stages, we generated Arabidopsis conditional knockdown mutants expressing artificial microRNAs devised to simultaneously silence both FPS genes. Induction of silencing from germination rapidly caused chlorosis and a strong developmental phenotype that led to seedling lethality. However, silencing of FPS after seed germination resulted in a slight developmental delay only, although leaves and cotyledons continued to show chlorosis and altered chloroplasts. Metabolomic analyses also revealed drastic changes in the profile of sterols, ubiquinones, and plastidial isoprenoids. RNA sequencing and reverse transcription-quantitative polymerase chain reaction transcriptomic analysis showed that a reduction in FPS activity levels triggers the misregulation of genes involved in biotic and abiotic stress responses, the most prominent one being the rapid induction of a set of genes related to the jasmonic acid pathway. Down-regulation of FPS also triggered an iron-deficiency transcriptional response that is consistent with the iron-deficient phenotype observed in FPS-silenced plants. The specific inhibition of the sterol biosynthesis pathway by chemical and genetic blockage mimicked these transcriptional responses, indicating that sterol depletion is the primary cause of the observed alterations. Our results highlight the importance of sterol homeostasis for normal chloroplast development and function and reveal important clues about how isoprenoid and sterol metabolism is integrated within plant physiology and development. © 2016 American Society of Plant Biologists. All rights reserved.

Bex2 regulates cell proliferation and apoptosis in malignant glioma cells via the c-Jun NH2-terminal kinase pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Xiuping, E-mail: xpzhou@xzmc.edu.cn; Lab of Neurosurgery, Xuzhou Medical College, Xuzhou, Jiangsu; Key Laboratory of Brain Disease Biology, Affiliated Hospital of Xuzhou Medical College, Jiangsu

Highlights: Black-Right-Pointing-Pointer The expression levels of Bex2 markedly increased in glioma tissues. Black-Right-Pointing-Pointer Bex2 over-expression promoted cell proliferation, while its down-regulation inhibited cell growth. Black-Right-Pointing-Pointer Bex2 down-regulation promoted cell apoptosis via JNK/c-Jun signaling pathway. -- Abstract: The function of Bex2, a member of the Brain Expressed X-linked gene family, in glioma is controversial and its mechanism is largely unknown. We report here that Bex2 regulates cell proliferation and apoptosis in malignant glioma cells via the c-Jun NH2-terminal kinase (JNK) pathway. The expression level of Bex2 is markedly increased in glioma tissues. We observed that Bex2 over-expression promotes cell proliferation, whilemore » down-regulation of Bex2 inhibits cell growth. Furthermore, Bex2 down-regulation promotes cell apoptosis and activates the JNK pathway; these effects were abolished by administration of the JNK specific inhibitor, (SP600125). Thus, Bex2 may be an important player during the development of glioma.« less

Rice ethylene-response AP2/ERF factor OsEATB restricts internode elongation by down-regulating a gibberellin biosynthetic gene.

PubMed

Qi, Weiwei; Sun, Fan; Wang, Qianjie; Chen, Mingluan; Huang, Yunqing; Feng, Yu-Qi; Luo, Xiaojin; Yang, Jinshui

2011-09-01

Plant height is a decisive factor in plant architecture. Rice (Oryza sativa) plants have the potential for rapid internodal elongation, which determines plant height. A large body of physiological research has shown that ethylene and gibberellin are involved in this process. The APETALA2 (AP2)/Ethylene-Responsive Element Binding Factor (ERF) family of transcriptional factors is only present in the plant kingdom. This family has various developmental and physiological functions. A rice AP2/ERF gene, OsEATB (for ERF protein associated with tillering and panicle branching) was cloned from indica rice variety 9311. Bioinformatic analysis suggested that this ERF has a potential new function. Ectopic expression of OsEATB showed that the cross talk between ethylene and gibberellin, which is mediated by OsEATB, might underlie differences in rice internode elongation. Analyses of gene expression demonstrated that OsEATB restricts ethylene-induced enhancement of gibberellin responsiveness during the internode elongation process by down-regulating the gibberellin biosynthetic gene, ent-kaurene synthase A. Plant height is negatively correlated with tiller number, and higher yields are typically obtained from dwarf crops. OsEATB reduces rice plant height and panicle length at maturity, promoting the branching potential of both tillers and spikelets. These are useful traits for breeding high-yielding crops.

Metastatic Melanoma Secreted IL-10 Down-Regulates CD1 Molecules on Dendritic Cells in Metastatic Tumor Lesions

PubMed Central

Gerlini, Gianni; Tun-Kyi, Adrian; Dudli, Christa; Burg, Günter; Pimpinelli, Nicola; Nestle, Frank O.

2004-01-01

CD1 molecules are expressed by antigen-presenting cells such as dendritic cells and mediate primary immune responses to lipids and glycolipids which have been shown to be expressed by various tumors. Glycolipids are expressed by melanoma cells but, despite their immunogenicity, no efficient spontaneous immune responses are elicited. As IL-10 has previously been shown to down-regulate CD1a on dendritic cells and is known to be expressed by various melanoma cell lines, we investigated if melanoma-derived IL-10 could down-regulate CD1 molecule expression on dendritic cells as a possible way to circumvent immune recognition. We found that CD1a, CD1b, CD1c, and CD1d were significantly down-regulated on dendritic cells in metastatic (n = 10) but not in primary melanoma lesions (n = 10). We further detected significantly higher IL-10 protein levels in metastatic than in primary melanomas. Moreover, supernatants from metastatic melanomas were significantly more effective in down-regulating CD1 molecules on dendritic cells than supernatants from primary melanoma cultures. This effect was blocked using a neutralizing IL-10 antibody in a dose dependent manner. Our findings suggest that metastatic but not primary melanomas can down-regulate CD1 molecules on infiltrating dendritic cells by secreting IL-10 which may represent a novel way to escape the immune response directed against the tumor. PMID:15579430

Developmental Toxicity of Diclofenac and Elucidation of Gene Regulation in zebrafish (Danio rerio)

NASA Astrophysics Data System (ADS)

Chen, Jia-Bin; Gao, Hong-Wen; Zhang, Ya-Lei; Zhang, Yong; Zhou, Xue-Fei; Li, Chun-Qi; Gao, Hai-Ping

2014-05-01

Environmental pollution by emerging contaminants, e.g. pharmaceuticals, has become a matter of widespread concern in recent years. We investigated the membrane transport of diclofenac and its toxic effects on gene expression and the development of zebrafish embryos. The association of diclofenac with the embryos conformed to the general partition model at low concentration, the partition coefficient being 0.0033 ml per embryo. At high concentration, the interaction fitted the Freundlich model. Most of the diclofenac remained in the extracellular aqueous solution with less than 5% interacting with the embryo, about half of which was adsorbed on the membranes while the rest entered the cytoplasm. Concentrations of diclofenac over 10.13 μM were lethal to all the embryos, while 3.78 μM diclofenac was teratogenic. The development abnormalities at 4 day post treatment (dpt) include shorter body length, smaller eye, pericardial and body edema, lack of liver, intestine and circulation, muscle degeneration, and abnormal pigmentation. The portion of the diclofenac transferred into the embryo altered the expression of certain genes, e.g. down-regulation of Wnt3a and Gata4 and up-regulation of Wnt8a. The alteration of expression of such genes or the regulation of downstream genes could cause defects in the cardiovascular and nervous systems.

FGF-2 deficiency does not influence FGF ligand and receptor expression during development of the nigrostriatal system.

PubMed

Ratzka, Andreas; Baron, Olga; Grothe, Claudia

2011-01-01

Secreted proteins of the fibroblast growth factor (FGF) family play important roles during development of various organ systems. A detailed knowledge of their temporal and spatial expression profiles, especially of closely related FGF family members, are essential to further identification of specific functions in distinct tissues. In the central nervous system dopaminergic neurons of the substantia nigra and their axonal projections into the striatum progressively degenerate in Parkinson's disease. In contrast, FGF-2 deficient mice display increased numbers of dopaminergic neurons. In this study, we determined the expression profiles of all 22 FGF-ligands and 10 FGF-receptor isoforms, in order to clarify, if FGF-2 deficiency leads to compensatory up-regulation of other FGFs in the nigrostriatal system. Three tissues, ventral mesencephalon (VM), striatum (STR) and as reference tissue spinal cord (SC) of wild-type and FGF-2 deficient mice at four developmental stages E14.5, P0, P28, and adult were comparatively analyzed by quantitative RT-PCR. As no differences between the genotypes were observed, a compensatory up-regulation can be excluded. Moreover, this analysis revealed that the majority of FGF-ligands (18/22) and FGF-receptors (9/10) are expressed during normal development of the nigrostriatal system and identified dynamic changes for some family members. By comparing relative expression level changes to SC reference tissue, general alterations in all 3 tissues, such as increased expression of FGF-1, -2, -22, FgfR-2c, -3c and decreased expression of FGF-13 during postnatal development were identified. Further, specific changes affecting only one tissue, such as increased FGF-16 (STR) or decreased FGF-17 (VM) expression, or two tissues, such as decreased expression of FGF-8 (VM, STR) and FGF-15 (SC, VM) were found. Moreover, 3 developmentally down-regulated FGFs (FGF-8b, FGF-15, FGF-17a) were functionally characterized by plasmid-based over-expression in dissociated E11.5 VM cell cultures, however, such a continuous exposure had no influence on the yield of dopaminergic neurons in vitro.

Deciphering life history transcriptomes in different environments

PubMed Central

Etges, William J.; Trotter, Meredith V.; de Oliveira, Cássia C.; Rajpurohit, Subhash; Gibbs, Allen G.; Tuljapurkar, Shripad

2014-01-01

We compared whole transcriptome variation in six preadult stages and seven adult female ages in two populations of cactophilic Drosophila mojavensis reared on two host plants in order to understand how differences in gene expression influence standing life history variation. We used Singular Value Decomposition (SVD) to identify dominant trajectories of life cycle gene expression variation, performed pair-wise comparisons of stage and age differences in gene expression across the life cycle, identified when genes exhibited maximum levels of life cycle gene expression, and assessed population and host cactus effects on gene expression. Life cycle SVD analysis returned four significant components of transcriptional variation, revealing functional enrichment of genes responsible for growth, metabolic function, sensory perception, neural function, translation and aging. Host cactus effects on female gene expression revealed population and stage specific differences, including significant host plant effects on larval metabolism and development, as well as adult neurotransmitter binding and courtship behavior gene expression levels. In 3 - 6 day old virgin females, significant up-regulation of genes associated with meiosis and oogenesis was accompanied by down-regulation of genes associated with somatic maintenance, evidence for a life history tradeoff. The transcriptome of D. mojavensis reared in natural environments throughout its life cycle revealed core developmental transitions and genome wide influences on life history variation in natural populations. PMID:25442828

Early gene Broad complex plays a key role in regulating the immune response triggered by ecdysone in the Malpighian tubules of Drosophila melanogaster.

PubMed

Verma, Puja; Tapadia, Madhu G

2015-08-01

In insects, humoral response to injury is accomplished by the production of antimicrobial peptides (AMPs) which are secreted in the hemolymph to eliminate the pathogen. Drosophila Malpighian tubules (MTs), however, are unique immune organs that show constitutive expression of AMPs even in unchallenged conditions and the onset of immune response is developmental stage dependent. Earlier reports have shown ecdysone positively regulates immune response after pathogenic challenge however, a robust response requires prior potentiation by the hormone. Here we provide evidence to show that MTs do not require prior potentiation with ecdysone hormone for expression of AMPs and they respond to ecdysone very fast even without immune challenge, although the different AMPs Diptericin, Cecropin, Attacin, Drosocin show differential expression in response to ecdysone. We show that early gene Broad complex (BR-C) could be regulating the IMD pathway by activating Relish and physically interacting with it to activate AMPs expression. BR-C depletion from Malpighian tubules renders the flies susceptible to infection. We also show that in MTs ecdysone signaling is transduced by EcR-B1 and B2. In the absence of ecdysone signaling the IMD pathway associated genes are down regulated and activation and translocation of transcription factor Relish is also affected. Copyright © 2015 Elsevier Ltd. All rights reserved.

The utility of zebrafish to study the mechanisms by which ethanol affects social behavior and anxiety during early brain development.

PubMed

Parker, Matthew O; Annan, Leonette V; Kanellopoulos, Alexandros H; Brock, Alistair J; Combe, Fraser J; Baiamonte, Matteo; Teh, Muy-Teck; Brennan, Caroline H

2014-12-03

Exposure to moderate levels of ethanol during brain development has a number of effects on social behavior but the molecular mechanisms that mediate this are not well understood. Gaining a better understanding of these factors may help to develop therapeutic interventions in the future. Zebrafish offer a potentially useful model in this regard. Here, we introduce a zebrafish model of moderate prenatal ethanol exposure. Embryos were exposed to 20mM ethanol for seven days (48hpf-9dpf) and tested as adults for individual social behavior and shoaling. We also tested their basal anxiety with the novel tank diving test. We found that the ethanol-exposed fish displayed reductions in social approach and shoaling, and an increase in anxiety in the novel tank test. These behavioral differences corresponded to differences in hrt1aa, slc6a4 and oxtr expression. Namely, acute ethanol caused a spike in oxtr and ht1aa mRNA expression, which was followed by down-regulation at 7dpf, and an up-regulation in slc6a4 at 72hpf. This study confirms the utility of zebrafish as a model system for studying the molecular basis of developmental ethanol exposure. Furthermore, it proposes a putative developmental mechanism characterized by ethanol-induced OT inhibition leading to suppression of 5-HT and up-regulation of 5-HT1A, which leads, in turn, to possible homeostatic up-regulation of 5-HTT at 72hpf and subsequent imbalance of the 5-HT system. Copyright © 2014 Elsevier Inc. All rights reserved.

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration

PubMed Central

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2, which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words “neuron” or “axonogenesis” were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer’s, Parkinson’s, and Huntington’s diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell–cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin–radixin–moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2’s importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases. PMID:28798667

The FOXP2-Driven Network in Developmental Disorders and Neurodegeneration.

PubMed

Oswald, Franz; Klöble, Patricia; Ruland, André; Rosenkranz, David; Hinz, Bastian; Butter, Falk; Ramljak, Sanja; Zechner, Ulrich; Herlyn, Holger

2017-01-01

The transcription repressor FOXP2 is a crucial player in nervous system evolution and development of humans and songbirds. In order to provide an additional insight into its functional role we compared target gene expression levels between human neuroblastoma cells (SH-SY5Y) stably overexpressing FOXP2 cDNA of either humans or the common chimpanzee, Rhesus monkey, and marmoset, respectively. RNA-seq led to identification of 27 genes with differential regulation under the control of human FOXP2 , which were previously reported to have FOXP2-driven and/or songbird song-related expression regulation. RT-qPCR and Western blotting indicated differential regulation of additional 13 new target genes in response to overexpression of human FOXP2. These genes may be directly regulated by FOXP2 considering numerous matches of established FOXP2-binding motifs as well as publicly available FOXP2-ChIP-seq reads within their putative promoters. Ontology analysis of the new and reproduced targets, along with their interactors in a network, revealed an enrichment of terms relating to cellular signaling and communication, metabolism and catabolism, cellular migration and differentiation, and expression regulation. Notably, terms including the words "neuron" or "axonogenesis" were also enriched. Complementary literature screening uncovered many connections to human developmental (autism spectrum disease, schizophrenia, Down syndrome, agenesis of corpus callosum, trismus-pseudocamptodactyly, ankyloglossia, facial dysmorphology) and neurodegenerative diseases and disorders (Alzheimer's, Parkinson's, and Huntington's diseases, Lewy body dementia, amyotrophic lateral sclerosis). Links to deafness and dyslexia were detected, too. Such relations existed for single proteins (e.g., DCDC2, NURR1, PHOX2B, MYH8, and MYH13) and groups of proteins which conjointly function in mRNA processing, ribosomal recruitment, cell-cell adhesion (e.g., CDH4), cytoskeleton organization, neuro-inflammation, and processing of amyloid precursor protein. Conspicuously, many links pointed to an involvement of the FOXP2-driven network in JAK/STAT signaling and the regulation of the ezrin-radixin-moesin complex. Altogether, the applied phylogenetic perspective substantiated FOXP2's importance for nervous system development, maintenance, and functioning. However, the study also disclosed new regulatory pathways that might prove to be useful for understanding the molecular background of the aforementioned developmental disorders and neurodegenerative diseases.

α-Phellandrene alters expression of genes associated with DNA damage, cell cycle, and apoptosis in murine leukemia WEHI-3 cells.

PubMed

Lin, Jen-Jyh; Yu, Chien-Chih; Lu, Kung-Wen; Chang, Shu-Jen; Yu, Fu-Shun; Liao, Ching-Lung; Lin, Jaung-Geng; Chung, Jing-Gung

2014-08-01

α-phellandrene (α-PA) is a cyclic monoterpene, present in natural plants such as Schinus molle L. α-PA promotes immune responses in mice in vivo. However, there is no available information on whether α-PA affects gene expression in leukemia cells. The present study determined effects of α-PA on expression levels of genes associated with DNA damage, cell cycle and apoptotic cell death in mouse leukemia WEHI-3 cells. WEHI-3 cells were treated with 10 μM α-PA for 24 h, cells were harvested and total RNA was extracted, and gene expression was analyzed by cDNA microarray. Results indicated that α-PA up-regulated 10 genes 4-fold, 13 by over 3-fold and 175 by over 2-fold; 21 genes were down-regulated by over 4-fold, 26 genes by over 3-fold and expression of 204 genes was altered by at leas 2-fold compared with the untreated control cells. DNA damage-associated genes such as DNA damage-inducer transcript 4 and DNA fragmentation factor were up-regulated by 4-fold and over 2-fold, respectively; cell-cycle check point genes such as cyclin G2 and cyclin-dependent kinases inhibitor 2D and IA (p21) were up-regulated by over 3-fold and over 2-fold, respectively; apoptosis-associated genes such as BCL2/adenovirus EIB interacting protein 3, XIAP-associated factor 1, BCL2 modifying factor, caspase-8 and FADD-like apoptosis regulator were over 2-fold up-regulated. Furthermore, DNA damage-associated gene TATA box binding protein was over 4-fold down-regulated, and D19Ertd652c (DNA segment) over 2-fold down-regulated; cell cycle-associated gene cyclin E2 was over 2-fold down-regulated; apoptosis associated gene growth arrest-specific 5 was over 9-fold down-regulated, Gm5426 (ATP synthase) was over 3-fold down-regulated, and death box polypeptide 33 was over 2-fold down-regulated. Based on these observations, α-PA altered gene expression in WEHI-3 cells in vitro. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Up-regulation of heat shock proteins is essential for cold survival during insect diapause

PubMed Central

Rinehart, Joseph P.; Li, Aiqing; Yocum, George D.; Robich, Rebecca M.; Hayward, Scott A. L.; Denlinger, David L.

2007-01-01

Diapause, the dormancy common to overwintering insects, evokes a unique pattern of gene expression. In the flesh fly, most, but not all, of the fly's heat shock proteins (Hsps) are up-regulated. The diapause up-regulated Hsps include two members of the Hsp70 family, one member of the Hsp60 family (TCP-1), at least four members of the small Hsp family, and a small Hsp pseudogene. Expression of an Hsp70 cognate, Hsc70, is uninfluenced by diapause, and Hsp90 is actually down-regulated during diapause, thus diapause differs from common stress responses that elicit synchronous up-regulation of all Hsps. Up-regulation of the Hsps begins at the onset of diapause, persists throughout the overwintering period, and ceases within hours after the fly receives the signal to reinitiate development. The up-regulation of Hsps appears to be common to diapause in species representing diverse insect orders including Diptera, Lepidoptera, Coleoptera, and Hymenoptera as well as in diapauses that occur in different developmental stages (embryo, larva, pupa, adult). Suppressing expression of Hsp23 and Hsp70 in flies by using RNAi did not alter the decision to enter diapause or the duration of diapause, but it had a profound effect on the pupa's ability to survive low temperatures. We thus propose that up-regulation of Hsps during diapause is a major factor contributing to cold-hardiness of overwintering insects. PMID:17522254

Wingless is a positive regulator of eyespot color patterns in Bicyclus anynana butterflies.

PubMed

Özsu, Nesibe; Chan, Qian Yi; Chen, Bin; Gupta, Mainak Das; Monteiro, Antónia

2017-09-01

Eyespot patterns of nymphalid butterflies are an example of a novel trait yet, the developmental origin of eyespots is still not well understood. Several genes have been associated with eyespot development but few have been tested for function. One of these genes is the signaling ligand, wingless, which is expressed in the eyespot centers during early pupation and may function in eyespot signaling and color ring differentiation. Here we tested the function of wingless in wing and eyespot development by down-regulating it in transgenic Bicyclus anynana butterflies via RNAi driven by an inducible heat-shock promoter. Heat-shocks applied during larval and early pupal development led to significant decreases in wingless mRNA levels and to decreases in eyespot size and wing size in adult butterflies. We conclude that wingless is a positive regulator of eyespot and wing development in B. anynana butterflies. Copyright © 2017 Elsevier Inc. All rights reserved.

The Bicoid Class Homeodomain Factors ceh-36/OTX and unc-30/PITX Cooperate in C. elegans Embryonic Progenitor Cells to Regulate Robust Development

PubMed Central

Walton, Travis; Preston, Elicia; Nair, Gautham; Zacharias, Amanda L.; Raj, Arjun; Murray, John Isaac

2015-01-01

While many transcriptional regulators of pluripotent and terminally differentiated states have been identified, regulation of intermediate progenitor states is less well understood. Previous high throughput cellular resolution expression studies identified dozens of transcription factors with lineage-specific expression patterns in C. elegans embryos that could regulate progenitor identity. In this study we identified a broad embryonic role for the C. elegans OTX transcription factor ceh-36, which was previously shown to be required for the terminal specification of four neurons. ceh-36 is expressed in progenitors of over 30% of embryonic cells, yet is not required for embryonic viability. Quantitative phenotyping by computational analysis of time-lapse movies of ceh-36 mutant embryos identified cell cycle or cell migration defects in over 100 of these cells, but most defects were low-penetrance, suggesting redundancy. Expression of ceh-36 partially overlaps with that of the PITX transcription factor unc-30. unc-30 single mutants are viable but loss of both ceh-36 and unc-30 causes 100% lethality, and double mutants have significantly higher frequencies of cellular developmental defects in the cells where their expression normally overlaps. These factors are also required for robust expression of the downstream developmental regulator mls-2/HMX. This work provides the first example of genetic redundancy between the related yet evolutionarily distant OTX and PITX families of bicoid class homeodomain factors and demonstrates the power of quantitative developmental phenotyping in C. elegans to identify developmental regulators acting in progenitor cells. PMID:25738873

Identification of a cis-Regulatory Element Involved in Phytochrome Down-Regulated Expression of the Pea Small GTPase Gene pra21

PubMed Central

Inaba, Takehito; Nagano, Yukio; Sakakibara, Toshihiro; Sasaki, Yukiko

1999-01-01

The pra2 gene encodes a pea (Pisum sativum) small GTPase belonging to the YPT/rab family, and its expression is down-regulated by light, mediated by phytochrome. We have isolated and characterized a genomic clone of this gene and constructed a fusion DNA of its 5′-upstream region in front of the gene for firefly luciferase. Using this construct in a transient assay, we determined a pra2 cis-regulatory region sufficient to direct the light down-regulation of the luciferase reporter gene. Both 5′- and internal deletion analyses revealed that the 93-bp sequence between −734 and −642 from the transcriptional start site was important for phytochrome down-regulation. Gain-of-function analysis showed that this 93-bp region could confer light down-regulation when fused to the cauliflower mosaic virus 35S promoter. Furthermore, linker-scanning analysis showed that a 12-bp sequence within the 93-bp region mediated phytochrome down-regulation. Gel-retardation analysis showed the presence of a nuclear factor that was specifically bound to the 12-bp sequence in vitro. These results indicate that this element is a cis-regulatory element involved in phytochrome down-regulated expression. PMID:10364400

Human adipose tissue-derived mesenchymal stem cells differentiate into insulin, somatostatin, and glucagon expressing cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timper, Katharina; Seboek, Dalma; Eberhardt, Michael

2006-03-24

Mesenchymal stem cells (MSC) from mouse bone marrow were shown to adopt a pancreatic endocrine phenotype in vitro and to reverse diabetes in an animal model. MSC from human bone marrow and adipose tissue represent very similar cell populations with comparable phenotypes. Adipose tissue is abundant and easily accessible and could thus also harbor cells with the potential to differentiate in insulin producing cells. We isolated human adipose tissue-derived MSC from four healthy donors. During the proliferation period, the cells expressed the stem cell markers nestin, ABCG2, SCF, Thy-1 as well as the pancreatic endocrine transcription factor Isl-1. The cellsmore » were induced to differentiate into a pancreatic endocrine phenotype by defined culture conditions within 3 days. Using quantitative PCR a down-regulation of ABCG2 and up-regulation of pancreatic developmental transcription factors Isl-1, Ipf-1, and Ngn3 were observed together with induction of the islet hormones insulin, glucagon, and somatostatin.« less

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-03-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19.

H19, a marker of developmental transition, is reexpressed in human atherosclerotic plaques and is regulated by the insulin family of growth factors in cultured rabbit smooth muscle cells.

PubMed Central

Han, D K; Khaing, Z Z; Pollock, R A; Haudenschild, C C; Liau, G

1996-01-01

H19 is a developmentally regulated gene with putative tumor suppressor activity, and loss of H19 expression may be involved in Wilms' tumorigenesis. In this report, we have performed in situ hybridization analysis of H19 expression during normal rabbit development and in human atherosclerotic plaques. We have also used cultured smooth muscle cells to identify H19 regulatory factors. Our data indicate that H19 expression in the developing skeletal and smooth muscles correlated with specific differentiation events in these tissues. Expression of H19 in the skeletal muscle correlated with nonproliferative, actin-positive muscle cells. In the prenatal blood vessel, H19 expression was both temporally and spatially regulated with initial loss of expression in the inner smooth muscle layers adjacent to the lumen. We also identified H19-positive cells within the adult atherosclerotic lesion and we suggest that these cells may recapitulate earlier developmental events. These results, along with the identification of the insulin family of growth factors as potent regulatory molecules for H19 expression, provide additional clues toward understanding the physiological regulation and function of H19. PMID:8636440

Polypyrimidine tract-binding protein 1-mediated down-regulation of ATG10 facilitates metastasis of colorectal cancer cells.

PubMed

Jo, Yoon Kyung; Roh, Seon Ae; Lee, Heejin; Park, Na Yeon; Choi, Eun Sun; Oh, Ju-Hee; Park, So Jung; Shin, Ji Hyun; Suh, Young-Ah; Lee, Eun Kyung; Cho, Dong-Hyung; Kim, Jin Cheon

2017-01-28

Autophagy plays complex roles in tumor initiation and development, and the expression of autophagy-related genes (ATGs) is differentially regulated in various cancer cells, depending on their environment. In this study, we analyzed the expressional relationship between polypyrimidine tract-binding protein 1 (PTBP1) and ATG10 in metastatic colorectal cancer. PTBP1 is associated with tumor metastasis in primary colorectal tumors and colorectal cancer liver metastasis (CLM) tissues. In addition, PTPB1 directly interacts with mRNA of ATG10, and regulates ATG10 expression level in colorectal cancer cells. Ectopic expression of PTBP1 decreased ATG10 expression, whereas down-regulation of PTBP1 increased ATG10 level. In contrast to PTBP1, expression of ATG10 was decreased in CLM tissues. Knock down of ATG10 promoted cell migration and invasion of colorectal cancer cells. Moreover, depletion of ATG10 modulated epithelial-mesenchymal transition-associated proteins in colorectal cancer cells: N-cadherin, TCF-8/ZEB1, and CD44 were up-regulated, whereas E-cadherin was down-regulated. Taken together, our findings suggest that expression of ATG10 negatively regulated by PTBP1 is associated with metastasis of colorectal cancer cells. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Prenatal ethanol exposure-induced adrenal developmental abnormality of male offspring rats and its possible intrauterine programming mechanisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Hegui; He, Zheng; Zhu, Chunyan

Fetal adrenal developmental status is the major determinant of fetal tissue maturation and offspring growth. We have previously proposed that prenatal ethanol exposure (PEE) suppresses fetal adrenal corticosterone (CORT) synthesis. Here, we focused on PEE-induced adrenal developmental abnormalities of male offspring rats before and after birth, and aimed to explore its intrauterine programming mechanisms. A rat model of intrauterine growth retardation (IUGR) was established by PEE (4 g/kg·d). In PEE fetus, increased serum CORT concentration and decreased insulin-like growth factor 1 (IGF1) concentration, with lower bodyweight and structural abnormalities as well as a decreased Ki67 expression (proliferative marker), were observedmore » in the male fetal adrenal cortex. Adrenal glucocorticoid (GC)-metabolic activation system was enhanced while gene expression of IGF1 signaling pathway with steroidogenic acute regulatory protein (StAR), 3β-hydroxysteroid dehydrogenase (3β-HSD) was decreased. Furthermore, in the male adult offspring of PEE, serum CORT level was decreased but IGF1 was increased with partial catch-up growth, and Ki67 expression demonstrated no obvious change. Adrenal GC-metabolic activation system was inhibited, while IGF1 signaling pathway and 3β-HSD was enhanced with the steroidogenic factor 1 (SF1), and StAR was down-regulated in the adult adrenal. Based on these findings, we propose a “two-programming” mechanism for PEE-induced adrenal developmental toxicity: “the first programming” is a lower functional programming of adrenal steroidogenesis, and “the second programming” is GC-metabolic activation system-related GC-IGF1 axis programming. - Highlights: • Prenatal ethanol exposure induces adrenal developmental abnormality in offspring rats. • Prenatal ethanol exposure induces intrauterine programming of adrenal steroidogenesis. • Intrauterine GC-IGF1 axis programming might mediate adrenal developmental abnormality.« less

In vivo interference with AtTCP20 function induces severe plant growth alterations and deregulates the expression of many genes important for development.

PubMed

Hervé, Christine; Dabos, Patrick; Bardet, Claude; Jauneau, Alain; Auriac, Marie Christine; Ramboer, Agnès; Lacout, Fabrice; Tremousaygue, Dominique

2009-03-01

AtTCP20 is a transcription factor belonging to the Arabidopsis (Arabidopsis thaliana) TCP-P subfamily, characterized by its capacity to bind to site II motifs (TGGGCY). Our aim was to understand the role of AtTCP20 in plant development. The expression pattern of a translational fusion of Prom(TCP20):CDS20GUSGFP suggested a function for AtTCP20 in several plant organs and stages of development. The role of AtTCP20 was challenged in planta by inducing expression of AtTCP20 proteins fused with either a transcriptional activator domain (VP16) or a repressor domain (EAR). Expression of both modified proteins led to severe developmental phenotypes. In-depth analysis suggested that AtTCP20 may participate in the regulation of cell expansion, cell division, and cell differentiation. Gene expression profiling in roots and hypocotyls revealed that 252 genes were down-regulated in both organs after induction of the AtTCP20EAR repressor gene. Site II motifs (TGGGCY) were underrepresented in their promoters. Conversely, GG(A/T)CCC sequences related to binding sites identified for TCP proteins in rice (Oryza sativa) were overrepresented, and a TCP20 fusion protein was shown to bind to these sequences in vitro. Gene ontology indicated that many targeted genes were involved in cell wall biogenesis and modification during expansion and also encoded numerous transcription factors controlling plant development. Our results are consistent with the previous proposal that AtTCP20 is involved in cell division and growth coordination. Moreover, they further suggest that AtTCP20 also contributes to cell expansion control and indicate a different involvement of this protein in plant morphogenesis depending on the organ and the developmental stage.

Ursolic Acid Attenuates Diabetic Mesangial Cell Injury through the Up-Regulation of Autophagy via miRNA-21/PTEN/Akt/mTOR Suppression

PubMed Central

Lu, Xinxing; Fan, Qiuling; Xu, Li; Li, Lin; Yue, Yuan; Xu, Yanyan; Su, Yan; Zhang, Dongcheng; Wang, Lining

2015-01-01

Objective To investigate the effect of ursolic acid on autophagy mediated through the miRNA-21-targeted phosphoinositide 3 kinase (PI3K)/protein kinase B (Akt)/mammalian target of rapamycin (mTOR) pathway in rat mesangial cells cultured under high glucose (HG) conditions. Methods Rat glomerular mesangial cells were cultured under normal glucose, HG, HG with the PI3K inhibitor LY294002 or HG with ursolic acid conditions. Cell proliferation and hypertrophy were assayed using an MTT assay and the ratio of total protein to cell number, respectively. The miRNA-21 expression was detected using RT-qPCR. The expression of phosphatase and tensin homolog (PTEN)/AKT/mTOR signaling signatures, autophagy-associated protein and collagen I was detected by western blotting and RT-qPCR. Autophagosomes were observed using electron microscopy. Results Compared with mesangial cells cultured under normal glucose conditions, the cells exposed to HG showed up-regulated miRNA-21 expression, down-regulated PTEN protein and mRNA expression, up-regulated p85PI3K, pAkt, pmTOR, p62/SQSTMI, and collagen I expression and down-regulated LC3II expression. Ursolic acid and LY294002 inhibited HG-induced mesangial cell hypertrophy and proliferation, down-regulated p85PI3K, pAkt, pmTOR, p62/SQSTMI, and collagen I expression and up-regulated LC3II expression. However, LY294002 did not affect the expression of miRNA-21 and PTEN. Ursolic acid down-regulated miRNA-21 expression and up-regulated PTEN protein and mRNA expression. Conclusions Ursolic acid inhibits the glucose-induced up-regulation of mesangial cell miRNA-21 expression, up-regulates PTEN expression, inhibits the activation of PI3K/Akt/mTOR signaling pathway, and enhances autophagy to reduce the accumulation of the extracellular matrix and ameliorate cell hypertrophy and proliferation. PMID:25689721

Comprehensive Analyses of Molecules with Altered Expression in the Brain of a Mouse Model of Down Syndrome for Identification of Pharmacotherapeutic Targets.

PubMed

Ishihara, Keiichi

2017-01-01

Down syndrome, caused by the triplication of human chromosome 21, is the most frequent genetic cause of mental retardation. Mice with a segmental trisomy for mouse chromosome 16, which is orthologous to human chromosome 21, exhibit abnormalities similar to those in individuals with Down syndrome and therefore offer the opportunity for a genotype-phenotype correlation. In the current review, I present several mouse lines with trisomic regions of various lengths and discuss their usefulness for elucidating the mechanisms underlying Down syndrome-associated developmental cognitive disabilities. In addition, our recent comprehensive study attempting to identify molecules with disturbed expression in the brain of a mouse model of Down syndrome in order to develop a pharmacologic therapy for Down syndrome is described.

Molecular candidates for early-stage flower-to-fruit transition in stenospermocarpic table grape (Vitis vinifera L.) inflorescences ascribed by differential transcriptome and metabolome profiles.

PubMed

Domingos, Sara; Fino, Joana; Paulo, Octávio S; Oliveira, Cristina M; Goulao, Luis F

2016-03-01

Flower-to-fruit transition depends of nutrient availability and regulation at the molecular level by sugar and hormone signalling crosstalk. However, in most species, the identities of fruit initiation regulators and their targets are largely unknown. To ascertain the main pathways involved in stenospermocarpic table grape fruit set, comprehensive transcriptional and metabolomic analyses were conducted specifically targeting the early phase of this developmental stage in 'Thompson Seedless'. The high-throughput analyses performed disclosed the involvement of 496 differentially expressed genes and 28 differently accumulated metabolites in the sampled inflorescences. Our data show broad transcriptome reprogramming of molecule transporters, globally down-regulating gene expression, and suggest that regulation of sugar- and hormone-mediated pathways determines the downstream activation of berry development. The most affected gene was the SWEET14 sugar transporter. Hormone-related transcription changes were observed associated with increased indole-3-acetic acid, stimulation of ethylene and gibberellin metabolisms and cytokinin degradation, and regulation of MADS-box and AP2-like ethylene-responsive transcription factor expression. Secondary metabolism, the most representative biological process at transcriptome level, was predominantly repressed. The results add to the knowledge of molecular events occurring in grapevine inflorescence fruit set and provide a list of candidates, paving the way for genetic manipulation aimed at model research and plant breeding. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

IMPACT Is a Developmentally Regulated Protein in Neurons That Opposes the Eukaryotic Initiation Factor 2α Kinase GCN2 in the modulation of Neurite Outgrowth*

PubMed Central

Roffé, Martín; Hajj, Glaucia N. M.; Azevedo, Hátylas F.; Alves, Viviane S.; Castilho, Beatriz A.

2013-01-01

The product of the mouse Imprinted and Ancient gene, IMPACT, is preferentially expressed in neurons. We have previously shown that IMPACT overexpression inhibits the activation of the protein kinase GCN2, which signals amino acid starvation. GCN2 phosphorylates the α-subunit of eukaryotic translation initiation factor 2 (eIF2α), resulting in inhibition of general protein synthesis but increased translation of specific messages, such as ATF4. GCN2 is also involved in the regulation of neuronal functions, controlling synaptic plasticity, memory, and feeding behavior. We show here that IMPACT abundance increases during differentiation of neurons and neuron-like N2a cells, whereas GCN2 displays lowered activation levels. Upon differentiation, IMPACT associates with translating ribosomes, enhances translation initiation, and down-regulates the expression of ATF4. We further show that endogenous IMPACT promotes neurite outgrowth whereas GCN2 is a strong inhibitor of spontaneous neuritogenesis. Together, these results uncover the participation of the GCN2-IMPACT module of translational regulation in a highly controlled step in the development of the nervous system. PMID:23447528

IMPACT is a developmentally regulated protein in neurons that opposes the eukaryotic initiation factor 2α kinase GCN2 in the modulation of neurite outgrowth.

PubMed

Roffé, Martín; Hajj, Glaucia N M; Azevedo, Hátylas F; Alves, Viviane S; Castilho, Beatriz A

2013-04-12

The product of the mouse Imprinted and Ancient gene, IMPACT, is preferentially expressed in neurons. We have previously shown that IMPACT overexpression inhibits the activation of the protein kinase GCN2, which signals amino acid starvation. GCN2 phosphorylates the α-subunit of eukaryotic translation initiation factor 2 (eIF2α), resulting in inhibition of general protein synthesis but increased translation of specific messages, such as ATF4. GCN2 is also involved in the regulation of neuronal functions, controlling synaptic plasticity, memory, and feeding behavior. We show here that IMPACT abundance increases during differentiation of neurons and neuron-like N2a cells, whereas GCN2 displays lowered activation levels. Upon differentiation, IMPACT associates with translating ribosomes, enhances translation initiation, and down-regulates the expression of ATF4. We further show that endogenous IMPACT promotes neurite outgrowth whereas GCN2 is a strong inhibitor of spontaneous neuritogenesis. Together, these results uncover the participation of the GCN2-IMPACT module of translational regulation in a highly controlled step in the development of the nervous system.

Transcriptional Regulatory Network Analysis of MYB Transcription Factor Family Genes in Rice.

PubMed

Smita, Shuchi; Katiyar, Amit; Chinnusamy, Viswanathan; Pandey, Dev M; Bansal, Kailash C

2015-01-01

MYB transcription factor (TF) is one of the largest TF families and regulates defense responses to various stresses, hormone signaling as well as many metabolic and developmental processes in plants. Understanding these regulatory hierarchies of gene expression networks in response to developmental and environmental cues is a major challenge due to the complex interactions between the genetic elements. Correlation analyses are useful to unravel co-regulated gene pairs governing biological process as well as identification of new candidate hub genes in response to these complex processes. High throughput expression profiling data are highly useful for construction of co-expression networks. In the present study, we utilized transcriptome data for comprehensive regulatory network studies of MYB TFs by "top-down" and "guide-gene" approaches. More than 50% of OsMYBs were strongly correlated under 50 experimental conditions with 51 hub genes via "top-down" approach. Further, clusters were identified using Markov Clustering (MCL). To maximize the clustering performance, parameter evaluation of the MCL inflation score (I) was performed in terms of enriched GO categories by measuring F-score. Comparison of co-expressed cluster and clads analyzed from phylogenetic analysis signifies their evolutionarily conserved co-regulatory role. We utilized compendium of known interaction and biological role with Gene Ontology enrichment analysis to hypothesize function of coexpressed OsMYBs. In the other part, the transcriptional regulatory network analysis by "guide-gene" approach revealed 40 putative targets of 26 OsMYB TF hubs with high correlation value utilizing 815 microarray data. The putative targets with MYB-binding cis-elements enrichment in their promoter region, functional co-occurrence as well as nuclear localization supports our finding. Specially, enrichment of MYB binding regions involved in drought-inducibility implying their regulatory role in drought response in rice. Thus, the co-regulatory network analysis facilitated the identification of complex OsMYB regulatory networks, and candidate target regulon genes of selected guide MYB genes. The results contribute to the candidate gene screening, and experimentally testable hypotheses for potential regulatory MYB TFs, and their targets under stress conditions.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

PubMed

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

2008-12-23

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans

PubMed Central

Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.

2008-01-01

In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934

Prostaglandin E2 mediates growth arrest in NFS-60 cells by down-regulating interleukin-6 receptor expression.

PubMed

de Silva, Kumudika I; Daud, Asif N; Deng, JiangPing; Jones, Stephen B; Gamelli, Richard L; Shankar, Ravi

2003-02-15

Interleukin-6 (IL-6), a potent myeloid mitogen, and the immunosuppressive prostanoid prostaglandin E2 (PGE2) are elevated following thermal injury and sepsis. We have previously demonstrated that bone marrow myeloid commitment shifts toward monocytopoiesis and away from granulocytopoiesis during thermal injury and sepsis and that PGE2 plays a central role in this alteration. Here we investigated whether PGE2 can modulate IL-6-stimulated growth in the promyelocytic cell line, NFS-60, by down-regulating IL-6 receptor (IL-6r) expression. Exposure of NFS-60 cells to PGE2 suppressed IL-6-stimulated proliferation as well as IL-6r expression. Receptor down-regulation is functionally significant since IL-6-induced signal transduction through activators of transcription (STAT)-3 is also decreased. Down-regulation of IL-6r correlated with the ability of PGE2 to arrest cells in the G0/G1 phase of the cell cycle. PGE2 appears to signal through EP2 receptors. Butaprost (EP2 agonist) but not sulprostone (EP3 agonist) inhibited IL-6-stimulated proliferation. In addition, an EP2 antagonist (AH6809) alleviated the anti-proliferative effects of PGE2. NFS-60 cells express predominantly EP2 and EP4 receptors. While PGE2 down-regulated both the IL-6r protein and mRNA expression, it had no influence on EP2 or EP4 mRNA expression. The present study demonstrates that PGE2 is a potent down-regulator of IL-6r expression and thus may provide a mechanistic explanation for the granulocytopenia seen in thermal injury and sepsis.

Individual blastomeres of 16- and 32-cell mouse embryos are able to develop into foetuses and mice.

PubMed

Tarkowski, Andrzej K; Suwińska, Aneta; Czołowska, Renata; Ożdżeński, Wacław

2010-12-15

Cell and developmental studies have clarified how, by the time of implantation, the mouse embryo forms three primary cell lineages: epiblast (EPI), primitive endoderm (PE), and trophectoderm (TE). However, it still remains unknown when cells allocated to these three lineages become determined in their developmental fate. To address this question, we studied the developmental potential of single blastomeres derived from 16- and 32-cell stage embryos and supported by carrier, tetraploid blastomeres. We were able to generate singletons, identical twins, triplets, and quadruplets from individual inner and outer cells of 16-cell embryos and, sporadically, foetuses from single cells of 32-cell embryos. The use of embryos constitutively expressing GFP as the donors of single diploid blastomeres enabled us to identify their cell progeny in the constructed 2n↔4n blastocysts. We showed that the descendants of donor blastomeres were able to locate themselves in all three first cell lineages, i.e., epiblast, primitive endoderm, and trophectoderm. In addition, the application of Cdx2 and Gata4 markers for trophectoderm and primitive endoderm, respectively, showed that the expression of these two genes in the descendants of donor blastomeres was either down- or up-regulated, depending on the cell lineage they happened to occupy. Thus, our results demonstrate that up to the early blastocysts stage, the destiny of at least some blastomeres, although they have begun to express markers of different lineage, is still labile. Copyright © 2010 Elsevier Inc. All rights reserved.

An endogenous RNA transcript antisense to CNG(alpha)1 cation channel mRNA.

PubMed

Cheng, Chin-Hung; Yew, David Tai-Wai; Kwan, Hiu-Yee; Zhou, Qing; Huang, Yu; Liu, Yong; Chan, Wing-Yee; Yao, Xiaoqiang

2002-10-01

CNG channels are cyclic nucleotide-gated Ca(2+)-permeable channels that are suggested to be involved in the activity-dependent alterations of synaptic strength that are thought to underlie information storage in the CNS. In this study, we isolated an endogenous RNA transcript antisense to CNG(alpha)1 mRNA. This transcript was capable of down-regulating the expression of sense CNG(alpha)1 in the Xenopus oocyte expression system. RT-PCR, Northern blot, and in situ hybridization analyses showed that the transcript was coexpressed with CNG(alpha)1 mRNA in many regions of human brain, notably in those regions that were involved in long-term potentiation and long-term depression, such as hippocampal CA1 and CA3, dentate gyrus, and cerebellar Purkinje layer. Comparison of expression patterns between adult and fetal cerebral cortex revealed that there were concurrent developmental changes in the expression levels of anti-CNG1 and CNG(alpha)1. Treatment of human glioma cell T98 with thyroid hormone T(3) caused a significant increase in anti-CNG1 expression and a parallel decrease in sense CNG(alpha)1 expression. These data suggest that the suppression of CNG(alpha)1 expression by anti-CNG1 may play an important role in neuronal functions, especially in synaptic plasticity and cortical development. Endogenous antisense RNA-mediated regulation may represent a new mechanism through which the activity of ion channels can be regulated in the human CNS.

Identification and characterization of cis-acting elements involved in the regulation of ABA- and/or GA-mediated LuPLR1 gene expression and lignan biosynthesis in flax (Linum usitatissimum L.) cell cultures.

PubMed

Corbin, Cyrielle; Renouard, Sullivan; Lopez, Tatiana; Lamblin, Frédéric; Lainé, Eric; Hano, Christophe

2013-03-15

Pinoresinol lariciresinol reductase 1, encoded by the LuPLR1 gene in flax (Linum usitatissimum L.), is responsible for the biosynthesis of (+)-secoisolariciresinol, a cancer chemopreventive phytoestrogenic lignan accumulated in high amount in the hull of flaxseed. Our recent studies have demonstrated a key role of abscisic acid (ABA) in the regulation of LuPLR1 gene expression and thus of the (+)-secoisolariciresinol synthesis during the flax seedcoat development. It is well accepted that gibberellins (GA) and ABA play antagonistic roles in the regulation of numerous developmental processes; therefore it is of interest to clarify their respective effects on lignan biosynthesis. Herein, using flax cell suspension cultures, we demonstrate that LuPLR1 gene expression and (+)-secoisolariciresinol synthesis are up-regulated by ABA and down-regulated by GA. The LuPLR1 gene promoter analysis and mutation experiments allow us to identify and characterize two important cis-acting sequences (ABRE and MYB2) required for these regulations. These results imply that a cross-talk between ABA and GA signaling orchestrated by transcription factors is involved in the regulation of lignan biosynthesis. This is particularly evidenced in the case of the ABRE cis-regulatory sequence of LuPLR1 gene promoter that appears to be a common target sequence of GA and ABA signals. Copyright © 2012 Elsevier GmbH. All rights reserved.

Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF-{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsukasaki, Masayuki; Yamada, Atsushi, E-mail: yamadaa@dent.showa-u.ac.jp; Suzuki, Dai

2011-07-15

Highlights: {yields} TNF-{alpha} inhibits POEM gene expression. {yields} Inhibition of POEM gene expression is caused by NF-{kappa}B activation by TNF-{alpha}. {yields} Over-expression of POEM recovers inhibition of osteoblast differentiation by TNF-{alpha}. -- Abstract: POEM, also known as nephronectin, is an extracellular matrix protein considered to be a positive regulator of osteoblast differentiation. In the present study, we found that tumor necrosis factor-{alpha} (TNF-{alpha}), a key regulator of bone matrix properties and composition that also inhibits terminal osteoblast differentiation, strongly inhibited POEM expression in the mouse osteoblastic cell line MC3T3-E1. TNF-{alpha}-induced down-regulation of POEM gene expression occurred in both time- andmore » dose-dependent manners through the nuclear factor kappa B (NF-{kappa}B) pathway. In addition, expressions of marker genes in differentiated osteoblasts were down-regulated by TNF-{alpha} in a manner consistent with our findings for POEM, while over-expression of POEM recovered TNF-{alpha}-induced inhibition of osteoblast differentiation. These results suggest that TNF-{alpha} inhibits POEM expression through the NF-{kappa}B signaling pathway and down-regulation of POEM influences the inhibition of osteoblast differentiation by TNF-{alpha}.« less

Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

PubMed Central

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-01-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

PubMed

Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

2014-09-01

We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

Down-regulation of cancer/testis antigen OY-TES-1 attenuates malignant behaviors of hepatocellular carcinoma cells in vitro.

PubMed

Fu, Jun; Luo, Bin; Guo, Wen-Wen; Zhang, Qing-Mei; Shi, Lei; Hu, Qi-Ping; Chen, Fang; Xiao, Shao-Wen; Xie, Xiao-Xun

2015-01-01

Cancer/testis (CT) antigens are normally expressed in testis and overexpressed in various tumor types. However, their biological function is largely unknown. OY-TES-1, one of cancer/testis (CT) antigens, is reported overexpression in hepatocellular carcinoma (HCC). And we assumed that OY-TES-1 contribute to oncogenesis and progression of HCC. In this study, we knocked down OY-TES-1 by small interference RNA (siRNA) in HCC cell lines (HepG2 and BEL-7404) to verify this assumption and evaluate its potential as therapeutic targets for HCC. We showed that down regulation of OY-TES-1 decreased cell growth, induced the G0/G1 arrest and apoptosis, and prevented migration and invasion in the two HCC cell lines. Further analysis revealed that down regulation of OY-TES-1 increased expression of apoptosis-regulated protein caspase-3, and decreased expression of cell cycle-regulated protein cyclin E, migration/invasion-regulated proteins MMP2 and MMP9. These findings may shed light on the gene therapy about the OY-TES-1 expression in HCC cells.

Down-regulation of cancer/testis antigen OY-TES-1 attenuates malignant behaviors of hepatocellular carcinoma cells in vitro

PubMed Central

Fu, Jun; Luo, Bin; Guo, Wen-Wen; Zhang, Qing-Mei; Shi, Lei; Hu, Qi-Ping; Chen, Fang; Xiao, Shao-Wen; Xie, Xiao-Xun

2015-01-01

Cancer/testis (CT) antigens are normally expressed in testis and overexpressed in various tumor types. However, their biological function is largely unknown. OY-TES-1, one of cancer/testis (CT) antigens, is reported overexpression in hepatocellular carcinoma (HCC). And we assumed that OY-TES-1 contribute to oncogenesis and progression of HCC. In this study, we knocked down OY-TES-1 by small interference RNA (siRNA) in HCC cell lines (HepG2 and BEL-7404) to verify this assumption and evaluate its potential as therapeutic targets for HCC. We showed that down regulation of OY-TES-1 decreased cell growth, induced the G0/G1 arrest and apoptosis, and prevented migration and invasion in the two HCC cell lines. Further analysis revealed that down regulation of OY-TES-1 increased expression of apoptosis-regulated protein caspase-3, and decreased expression of cell cycle-regulated protein cyclin E, migration/invasion-regulated proteins MMP2 and MMP9. These findings may shed light on the gene therapy about the OY-TES-1 expression in HCC cells. PMID:26339343

Microarray-based gene expression profiling to elucidate effectiveness of fermented Codonopsis lanceolata in mice.

PubMed

Choi, Woon Yong; Kim, Ji Seon; Park, Sung Jin; Ma, Choong Je; Lee, Hyeon Yong

2014-04-08

In this study, the effect of Codonopsis lanceolata fermented by lactic acid on controlling gene expression levels related to obesity was observed in an oligonucleotide chip microarray. Among 8170 genes, 393 genes were up regulated and 760 genes were down regulated in feeding the fermented C. lanceolata (FCL). Another 374 genes were up regulated and 527 genes down regulated without feeding the sample. The genes were not affected by the FCL sample. It was interesting that among those genes, Chytochrome P450, Dmbt1, LOC76487, and thyroid hormones, etc., were mostly up or down regulated. These genes are more related to lipid synthesis. We could conclude that the FCL possibly controlled the gene expression levels related to lipid synthesis, which resulted in reducing obesity. However, more detailed protein expression experiments should be carried out.

TGF-β signaling in insects regulates metamorphosis via juvenile hormone biosynthesis

PubMed Central

Ishimaru, Yoshiyasu; Tomonari, Sayuri; Matsuoka, Yuji; Watanabe, Takahito; Miyawaki, Katsuyuki; Bando, Tetsuya; Tomioka, Kenji; Ohuchi, Hideyo; Noji, Sumihare; Mito, Taro

2016-01-01

Although butterflies undergo a dramatic morphological transformation from larva to adult via a pupal stage (holometamorphosis), crickets undergo a metamorphosis from nymph to adult without formation of a pupa (hemimetamorphosis). Despite these differences, both processes are regulated by common mechanisms that involve 20-hydroxyecdysone (20E) and juvenile hormone (JH). JH regulates many aspects of insect physiology, such as development, reproduction, diapause, and metamorphosis. Consequently, strict regulation of JH levels is crucial throughout an insect’s life cycle. However, it remains unclear how JH synthesis is regulated. Here, we report that in the corpora allata of the cricket, Gryllus bimaculatus, Myoglianin (Gb’Myo), a homolog of Drosophila Myoglianin/vertebrate GDF8/11, is involved in the down-regulation of JH production by suppressing the expression of a gene encoding JH acid O-methyltransferase, Gb’jhamt. In contrast, JH production is up-regulated by Decapentaplegic (Gb’Dpp) and Glass-bottom boat/60A (Gb’Gbb) signaling that occurs as part of the transcriptional activation of Gb’jhamt. Gb’Myo defines the nature of each developmental transition by regulating JH titer and the interactions between JH and 20E. When Gb’myo expression is suppressed, the activation of Gb’jhamt expression and secretion of 20E induce molting, thereby leading to the next instar before the last nymphal instar. Conversely, high Gb’myo expression induces metamorphosis during the last nymphal instar through the cessation of JH synthesis. Gb’myo also regulates final insect size. Because Myo/GDF8/11 and Dpp/bone morphogenetic protein (BMP)2/4-Gbb/BMP5–8 are conserved in both invertebrates and vertebrates, the present findings provide common regulatory mechanisms for endocrine control of animal development. PMID:27140602

TGF-β signaling in insects regulates metamorphosis via juvenile hormone biosynthesis.

PubMed

Ishimaru, Yoshiyasu; Tomonari, Sayuri; Matsuoka, Yuji; Watanabe, Takahito; Miyawaki, Katsuyuki; Bando, Tetsuya; Tomioka, Kenji; Ohuchi, Hideyo; Noji, Sumihare; Mito, Taro

2016-05-17

Although butterflies undergo a dramatic morphological transformation from larva to adult via a pupal stage (holometamorphosis), crickets undergo a metamorphosis from nymph to adult without formation of a pupa (hemimetamorphosis). Despite these differences, both processes are regulated by common mechanisms that involve 20-hydroxyecdysone (20E) and juvenile hormone (JH). JH regulates many aspects of insect physiology, such as development, reproduction, diapause, and metamorphosis. Consequently, strict regulation of JH levels is crucial throughout an insect's life cycle. However, it remains unclear how JH synthesis is regulated. Here, we report that in the corpora allata of the cricket, Gryllus bimaculatus, Myoglianin (Gb'Myo), a homolog of Drosophila Myoglianin/vertebrate GDF8/11, is involved in the down-regulation of JH production by suppressing the expression of a gene encoding JH acid O-methyltransferase, Gb'jhamt In contrast, JH production is up-regulated by Decapentaplegic (Gb'Dpp) and Glass-bottom boat/60A (Gb'Gbb) signaling that occurs as part of the transcriptional activation of Gb'jhamt Gb'Myo defines the nature of each developmental transition by regulating JH titer and the interactions between JH and 20E. When Gb'myo expression is suppressed, the activation of Gb'jhamt expression and secretion of 20E induce molting, thereby leading to the next instar before the last nymphal instar. Conversely, high Gb'myo expression induces metamorphosis during the last nymphal instar through the cessation of JH synthesis. Gb'myo also regulates final insect size. Because Myo/GDF8/11 and Dpp/bone morphogenetic protein (BMP)2/4-Gbb/BMP5-8 are conserved in both invertebrates and vertebrates, the present findings provide common regulatory mechanisms for endocrine control of animal development.

BMP6 down-regulates GDNF expression through SMAD1/5 and ERK1/2 signaling pathways in human granulosa-lutein cells.

PubMed

Zhang, Xin-Yue; Chang, Hsun-Ming; Taylor, Elizabeth L; Leung, Peter C K; Liu, Rui-Zhi

2018-05-09

Bone morphogenetic protein 6 (BMP6) is a critical regulator of follicular development that is expressed in mammalian oocytes and granulosa cells. Glial cell line-derived neurotrophic factor (GDNF) is an intraovarian neurotrophic factor that plays an essential role in regulating mammalian oocyte maturation. The aim of this study was to investigate the effect of BMP6 on the regulation of GDNF expression and the potential underlying mechanisms. We used an established immortalized human granulosa cell line (SVOG cells) and primary human granulosa-lutein cells as in vitro cell models. Our results showed that BMP6 significantly down-regulated the expression of GDNF in both SVOG and primary human granulosa-lutein cells. Using dual inhibition approaches (kinase receptor inhibitor and small interfering RNA knockdown), our results showed that both ALK2 and ALK3 are involved in BMP6-induced down-regulation of GDNF. In addition, BMP6 induced the phosphorylation of SMAD1/5/8 and ERK1/2 but not AKT or p38. Among three downstream mediators, both SMAD1 and SMAD5 are involved in BMP6-induced down-regulation of GDNF. Moreover, concomitant knockdown of endogenous SMAD4 and inhibition of ERK1/2 activity completely reversed BMP6-induced down-regulation of GDNF, indicating that both SMAD and ERK1/2 signaling pathways are required for the regulatory effect of BMP6 on GDNF expression. Our findings suggest an additional role for an intrafollicular growth factor in regulating follicular function through their paracrine interactions in human granulosa cells.

Biology of childhood germ cell tumours, focussing on the significance of microRNAs.

PubMed

Murray, M J; Nicholson, J C; Coleman, N

2015-01-01

Genomic and protein-coding transcriptomic data have suggested that germ cell tumours (GCTs) of childhood are biologically distinct from those of adulthood. Global messenger RNA profiles segregate malignant GCTs primarily by histology, but then also by age, with numerous transcripts showing age-related differential expression. Such differences are likely to account for the heterogeneous clinico-pathological behaviour of paediatric and adult malignant GCTs. In contrast, as global microRNA signatures of human tumours reflect their developmental lineage, we hypothesized that microRNA profiles would identify common biological abnormalities in all malignant GCTs owing to their presumed shared origin from primordial germ cells. MicroRNAs are short, non-protein-coding RNAs that regulate gene expression via translational repression and/or mRNA degradation. We showed that all malignant GCTs over-express the miR-371-373 and miR-302/367 clusters, regardless of patient age, histological subtype or anatomical tumour site. Furthermore, bioinformatic approaches and subsequent Gene Ontology analysis revealed that these two over-expressed microRNAs clusters co-ordinately down-regulated genes involved in biologically significant pathways in malignant GCTs. The translational potential of this finding has been demonstrated with the detection of elevated serum levels of miR-371-373 and miR-302/367 microRNAs at the time of malignant GCT diagnosis, with levels falling after treatment. The tumour-suppressor let-7 microRNA family has also been shown to be universally down-regulated in malignant GCTs, because of abundant expression of the regulatory gene LIN28. Low let-7 levels resulted in up-regulation of oncogenes including MYCN, AURKB and LIN28 itself, the latter through a direct feedback mechanism. Targeting LIN28, or restoring let-7 levels, both led to effective inhibition of this pathway. In summary, paediatric malignant GCTs show biological differences from their adult counterparts at a genomic and protein-coding transcriptome level, whereas they both display very similar microRNA expression profiles. These similarities and differences may be exploited for diagnostic and/or therapeutic purposes. © 2014 The Authors. Andrology published by John Wiley & Sons Ltd on behalf of American Society of Andrology.

Gene function in early mouse embryonic stem cell differentiation

PubMed Central

Sene, Kagnew Hailesellasse; Porter, Christopher J; Palidwor, Gareth; Perez-Iratxeta, Carolina; Muro, Enrique M; Campbell, Pearl A; Rudnicki, Michael A; Andrade-Navarro, Miguel A

2007-01-01

Background Little is known about the genes that drive embryonic stem cell differentiation. However, such knowledge is necessary if we are to exploit the therapeutic potential of stem cells. To uncover the genetic determinants of mouse embryonic stem cell (mESC) differentiation, we have generated and analyzed 11-point time-series of DNA microarray data for three biologically equivalent but genetically distinct mESC lines (R1, J1, and V6.5) undergoing undirected differentiation into embryoid bodies (EBs) over a period of two weeks. Results We identified the initial 12 hour period as reflecting the early stages of mESC differentiation and studied probe sets showing consistent changes of gene expression in that period. Gene function analysis indicated significant up-regulation of genes related to regulation of transcription and mRNA splicing, and down-regulation of genes related to intracellular signaling. Phylogenetic analysis indicated that the genes showing the largest expression changes were more likely to have originated in metazoans. The probe sets with the most consistent gene changes in the three cell lines represented 24 down-regulated and 12 up-regulated genes, all with closely related human homologues. Whereas some of these genes are known to be involved in embryonic developmental processes (e.g. Klf4, Otx2, Smn1, Socs3, Tagln, Tdgf1), our analysis points to others (such as transcription factor Phf21a, extracellular matrix related Lama1 and Cyr61, or endoplasmic reticulum related Sc4mol and Scd2) that have not been previously related to mESC function. The majority of identified functions were related to transcriptional regulation, intracellular signaling, and cytoskeleton. Genes involved in other cellular functions important in ESC differentiation such as chromatin remodeling and transmembrane receptors were not observed in this set. Conclusion Our analysis profiles for the first time gene expression at a very early stage of mESC differentiation, and identifies a functional and phylogenetic signature for the genes involved. The data generated constitute a valuable resource for further studies. All DNA microarray data used in this study are available in the StemBase database of stem cell gene expression data [1] and in the NCBI's GEO database. PMID:17394647

Neural FoxP2 and FoxP1 expression in the budgerigar, an avian species with adult vocal learning.

PubMed

Hara, Erina; Perez, Jemima M; Whitney, Osceola; Chen, Qianqian; White, Stephanie A; Wright, Timothy F

2015-04-15

Vocal learning underlies acquisition of both language in humans and vocal signals in some avian taxa. These bird groups and humans exhibit convergent developmental phases and associated brain pathways for vocal communication. The transcription factor FoxP2 plays critical roles in vocal learning in humans and songbirds. Another member of the forkhead box gene family, FoxP1 also shows high expression in brain areas involved in vocal learning and production. Here, we investigate FoxP2 and FoxP1 mRNA and protein in adult male budgerigars (Melopsittacus undulatus), a parrot species that exhibits vocal learning as both juveniles and adults. To examine these molecules in adult vocal learners, we compared their expression patterns in the budgerigar striatal nucleus involved in vocal learning, magnocellular nucleus of the medial striatum (MMSt), across birds with different vocal states, such as vocalizing to a female (directed), vocalizing alone (undirected), and non-vocalizing. We found that both FoxP2 mRNA and protein expressions were consistently lower in MMSt than in the adjacent striatum regardless of the vocal states, whereas previous work has shown that songbirds exhibit down-regulation in the homologous region, Area X, only after singing alone. In contrast, FoxP1 levels were high in MMSt compared to the adjacent striatum in all groups. Taken together these results strengthen the general hypothesis that FoxP2 and FoxP1 have specialized expression in vocal nuclei across a range of taxa, and suggest that the adult vocal plasticity seen in budgerigars may be a product of persistent down-regulation of FoxP2 in MMSt. Copyright © 2015 Elsevier B.V. All rights reserved.

Yap1 Protein Regulates Vascular Smooth Muscle Cell Phenotypic Switch by Interaction with Myocardin*

PubMed Central

Xie, Changqing; Guo, Yanhong; Zhu, Tianqing; Zhang, Jifeng; Ma, Peter X.; Chen, Y. Eugene

2012-01-01

The Hippo-Yap (Yes-associated protein) signaling pathway has emerged as one of the critical pathways regulating cell proliferation, differentiation, and apoptosis in response to environmental and developmental cues. However, Yap1 roles in vascular smooth muscle cell (VSMC) biology have not been investigated. VSMCs undergo phenotypic switch, a process characterized by decreased gene expression of VSMC contractile markers and increased proliferation, migration, and matrix synthesis. The goals of the present studies were to investigate the relationship between Yap1 and VSMC phenotypic switch and to determine the molecular mechanisms by which Yap1 affects this essential process in VSMC biology. Results demonstrated that the expression of Yap1 was rapidly up-regulated by stimulation with PDGF-BB (a known inducer of phenotypic switch in VSMCs) and in the injured vessel wall. Knockdown of Yap1 impaired VSMC proliferation in vitro and enhanced the expression of VSMC contractile genes as well by increasing serum response factor binding to CArG-containing regions of VSMC-specific contractile genes within intact chromatin. Conversely, the interaction between serum response factor and its co-activator myocardin was reduced by overexpression of Yap1 in a dose-dependent manner. Taken together, these results indicate that down-regulation of Yap1 promotes VSMC contractile phenotype by both up-regulating myocardin expression and promoting the association of the serum response factor-myocardin complex with VSMC contractile gene promoters and suggest that the Yap1 signaling pathway is a central regulator of phenotypic switch of VSMCs. PMID:22411986

Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis).

PubMed

Zhou, Xiangjun; Fei, Zhangjun; Thannhauser, Theodore W; Li, Li

2011-11-23

Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and the regulatory control of chloroplast biogenesis and development remain to be elucidated. Green cauliflower mutant causes ectopic development of chloroplasts in the curd tissue of the plant, turning the otherwise white curd green. To investigate the transcriptional control of chloroplast development, we compared gene expression between green and white curds using the RNA-seq approach. Deep sequencing produced over 15 million reads with lengths of 86 base pairs from each cDNA library. A total of 7,155 genes were found to exhibit at least 3-fold changes in expression between green and white curds. These included light-regulated genes, genes encoding chloroplast constituents, and genes involved in chlorophyll biosynthesis. Moreover, we discovered that the cauliflower ELONGATED HYPOCOTYL5 (BoHY5) was expressed higher in green curds than white curds and that 2616 HY5-targeted genes, including 1600 up-regulated genes and 1016 down-regulated genes, were differently expressed in green in comparison to white curd tissue. All these 1600 up-regulated genes were HY5-targeted genes in the light. The genome-wide profiling of gene expression by RNA-seq in green curds led to the identification of large numbers of genes associated with chloroplast development, and suggested the role of regulatory genes in the high hierarchy of light signaling pathways in mediating the ectopic chloroplast development in the green curd cauliflower mutant.

Transcriptome analysis of ectopic chloroplast development in green curd cauliflower (Brassica oleracea L. var. botrytis)

PubMed Central

2011-01-01

Background Chloroplasts are the green plastids where photosynthesis takes place. The biogenesis of chloroplasts requires the coordinate expression of both nuclear and chloroplast genes and is regulated by developmental and environmental signals. Despite extensive studies of this process, the genetic basis and the regulatory control of chloroplast biogenesis and development remain to be elucidated. Results Green cauliflower mutant causes ectopic development of chloroplasts in the curd tissue of the plant, turning the otherwise white curd green. To investigate the transcriptional control of chloroplast development, we compared gene expression between green and white curds using the RNA-seq approach. Deep sequencing produced over 15 million reads with lengths of 86 base pairs from each cDNA library. A total of 7,155 genes were found to exhibit at least 3-fold changes in expression between green and white curds. These included light-regulated genes, genes encoding chloroplast constituents, and genes involved in chlorophyll biosynthesis. Moreover, we discovered that the cauliflower ELONGATED HYPOCOTYL5 (BoHY5) was expressed higher in green curds than white curds and that 2616 HY5-targeted genes, including 1600 up-regulated genes and 1016 down-regulated genes, were differently expressed in green in comparison to white curd tissue. All these 1600 up-regulated genes were HY5-targeted genes in the light. Conclusions The genome-wide profiling of gene expression by RNA-seq in green curds led to the identification of large numbers of genes associated with chloroplast development, and suggested the role of regulatory genes in the high hierarchy of light signaling pathways in mediating the ectopic chloroplast development in the green curd cauliflower mutant. PMID:22112144

MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma.

PubMed

Chen, Jiamin; Feilotter, Harriet E; Paré, Geneviève C; Zhang, Xiao; Pemberton, Joshua G W; Garady, Cherif; Lai, Dulcie; Yang, Xiaolong; Tron, Victor A

2010-05-01

Cutaneous melanoma is an aggressive form of human skin cancer characterized by high metastatic potential and poor prognosis. To better understand the role of microRNAs (miRNAs) in melanoma, the expression of 470 miRNAs was profiled in tissue samples from benign nevi and metastatic melanomas. We identified 31 miRNAs that were differentially expressed (13 up-regulated and 18 down-regulated) in metastatic melanomas relative to benign nevi. Notably, miR-193b was significantly down-regulated in the melanoma tissues examined. To understand the role of miR-193b in melanoma, functional studies were undertaken. Overexpression of miR-193b in melanoma cell lines repressed cell proliferation. Gene expression profiling identified 314 genes down-regulated by overexpression of miR-193b in Malme-3M cells. Eighteen of these down-regulated genes, including cyclin D1 (CCND1), were also identified as putative miR-193b targets by TargetScan. Overexpression of miR-193b in Malme-3M cells down-regulated CCND1 mRNA and protein by > or = 50%. A luciferase reporter assay confirmed that miR-193b directly regulates CCND1 by binding to the 3'untranslated region of CCND1 mRNA. These studies indicate that miR-193b represses cell proliferation and regulates CCND1 expression and suggest that dysregulation of miR-193b may play an important role in melanoma development.

MicroRNA-193b Represses Cell Proliferation and Regulates Cyclin D1 in Melanoma

PubMed Central

Chen, Jiamin; Feilotter, Harriet E.; Paré, Geneviève C.; Zhang, Xiao; Pemberton, Joshua G.W.; Garady, Cherif; Lai, Dulcie; Yang, Xiaolong; Tron, Victor A.

2010-01-01

Cutaneous melanoma is an aggressive form of human skin cancer characterized by high metastatic potential and poor prognosis. To better understand the role of microRNAs (miRNAs) in melanoma, the expression of 470 miRNAs was profiled in tissue samples from benign nevi and metastatic melanomas. We identified 31 miRNAs that were differentially expressed (13 up-regulated and 18 down-regulated) in metastatic melanomas relative to benign nevi. Notably, miR-193b was significantly down-regulated in the melanoma tissues examined. To understand the role of miR-193b in melanoma, functional studies were undertaken. Overexpression of miR-193b in melanoma cell lines repressed cell proliferation. Gene expression profiling identified 314 genes down-regulated by overexpression of miR-193b in Malme-3M cells. Eighteen of these down-regulated genes, including cyclin D1 (CCND1), were also identified as putative miR-193b targets by TargetScan. Overexpression of miR-193b in Malme-3M cells down-regulated CCND1 mRNA and protein by ≥50%. A luciferase reporter assay confirmed that miR-193b directly regulates CCND1 by binding to the 3′untranslated region of CCND1 mRNA. These studies indicate that miR-193b represses cell proliferation and regulates CCND1 expression and suggest that dysregulation of miR-193b may play an important role in melanoma development. PMID:20304954

Effects of bisphenol A on the expression of cytochrome P450 aromatase (CYP19) in human fetal osteoblastic and granulosa cell-like cell lines.

PubMed

Watanabe, Masatada; Ohno, Shuji; Nakajin, Shizuo

2012-04-05

The effects of bisphenol A (BPA), an endocrine disruptor, on aromatase (CYP19) expression in human osteoblastic (SV-HFO) and ovarian granulosa-like (KGN) cell lines were examined. CYP19 enzyme activity was suppressed in the presence of BPA in a dose-dependent fashion in both cell lines. CYP19 gene transcript expression, as well as activities of promoter I.4 in SV-HFO and promoter II in KGN, was down-regulated by BPA, suggesting that BPA affects CYP19 at the gene-expression level. These data and the previous finding that BPA induced the down-regulation of promoter I.1 activity within the human placental cell line suggest that there may be a conserved signaling pathway that down-regulates CYP19 expression in response to BPA in both cell lines. Additionally, differences between promoter I.4 and II suggest that there may be cell- and promoter-specific down-regulating mechanisms downstream from the actions of BPA. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Acute exposure to tris (2-butoxyethyl) phosphate (TBOEP) affects growth and development of embryo-larval zebrafish.

PubMed

Liu, Yiran; Wu, Ding; Xu, Qinglong; Yu, Liqin; Liu, Chunsheng; Wang, Jianghua

2017-10-01

Tris (2-butoxyethyl) phosphate (TBOEP), is used as a flame retardant worldwide. It is an additive in materials and can be easily discharged into the surrounding environment. There is evidence linking TBOEP exposure to abnormal development and growth in zebrafish embryos/larvae. Here, using zebrafish embryo as a model, we investigated toxicological effects on developing zebrafish (Danio rerio) caused by TBOEP at concentrations of 0, 20, 200, 1000, 2000μg/L starting from 2h post-fertilization (hpf). Our findings revealed that TBOEP exposure caused developmental toxicity, such as malformation, growth delay and decreased heart rate in zebrafish larvae. Correlation analysis indicated that inhibition of growth was possibly due to down-regulation of expression of genes related to the growth hormone/insulin-like growth factor (GH/IGF) axis. Furthermore, exposure to TBOEP significantly increased thyroxine (T4) and 3,5,3'-triiodothyronine (T3) in whole larvae. In addition, changed expression of genes involved in the hypothalamic-pituitary-thyroid (HPT) axis was observed, indicating that perturbation of HPT axis might be responsible for the developmental damage and growth delay induced by TBOEP. The present study provides a new set of evidence that exposure of embryo-larval zebrafish to TBOEP can cause perturbation of GH/IGF axis and HPT axis, which could result in developmental impairment and growth inhibition. Copyright © 2017. Published by Elsevier B.V.

Sensitivity of hiPSC-derived neural stem cells (NSC) to Pyrroloquinoline quinone depends on their developmental stage.

PubMed

Augustyniak, J; Lenart, J; Zychowicz, M; Lipka, G; Gaj, P; Kolanowska, M; Stepien, P P; Buzanska, L

2017-12-01

Pyrroloquinoline quinone (PQQ) is a factor influencing on the mitochondrial biogenesis. In this study the PQQ effect on viability, total cell number, antioxidant capacity, mitochondrial biogenesis and differentiation potential was investigated in human induced Pluripotent Stem Cells (iPSC) - derived: neural stem cells (NSC), early neural progenitors (eNP) and neural progenitors (NP). Here we demonstrated that sensitivity to PQQ is dependent upon its dose and neural stage of development. Induction of the mitochondrial biogenesis by PQQ at three stages of neural differentiation was evaluated at mtDNA, mRNA and protein level. Changes in NRF1, TFAM and PPARGC1A gene expression were observed at all developmental stages, but only at eNP were correlated with the statistically significant increase in the mtDNA copy numbers and enhancement of SDHA, COX-1 protein level. Thus, the "developmental window" of eNP for PQQ-evoked mitochondrial biogenesis is proposed. This effect was independent of high antioxidant capacity of PQQ, which was confirmed in all tested cell populations, regardless of the stage of hiPSC neural differentiation. Furthermore, a strong induction of GFAP, with down regulation of MAP2 gene expression upon PQQ treatment was observed. This indicates a possibility of shifting the balance of cell differentiation in the favor of astroglia, but more research is needed at this point. Copyright © 2017 Elsevier Ltd. All rights reserved.

Targeted expression of suicide gene by tissue-specific promoter and microRNA regulation for cancer gene therapy.

PubMed

Danda, Ravikanth; Krishnan, Gopinath; Ganapathy, Kalaivani; Krishnan, Uma Maheswari; Vikas, Khetan; Elchuri, Sailaja; Chatterjee, Nivedita; Krishnakumar, Subramanian

2013-01-01

In order to realise the full potential of cancer suicide gene therapy that allows the precise expression of suicide gene in cancer cells, we used a tissue specific Epithelial cell adhesion molecule (EpCAM) promoter (EGP-2) that directs transgene Herpes simplex virus-thymidine kinase (HSV-TK) expression preferentially in EpCAM over expressing cancer cells. EpCAM levels are considerably higher in retinoblastoma (RB), a childhood eye cancer with limited expression in normal cells. Use of miRNA regulation, adjacent to the use of the tissue-specific promoter, would provide the second layer of control to the transgene expression only in the tumor cells while sparing the normal cells. To test this hypothesis we cloned let-7b miRNA targets in the 3'UTR region of HSV-TK suicide gene driven by EpCAM promoter because let-7 family miRNAs, including let-7b, were found to be down regulated in the RB tumors and cell lines. We used EpCAM over expressing and let-7 down regulated RB cell lines Y79, WERI-Rb1 (EpCAM (+ve)/let-7b(down-regulated)), EpCAM down regulated, let-7 over expressing normal retinal Müller glial cell line MIO-M1(EpCAM (-ve)/let-7b(up-regulated)), and EpCAM up regulated, let-7b up-regulated normal thyroid cell line N-Thy-Ori-3.1(EpCAM (+ve)/let-7b(up-regulated)) in the study. The cell proliferation was measured by MTT assay, apoptosis was measured by probing cleaved Caspase3, EpCAM and TK expression were quantified by Western blot. Our results showed that the EGP2-promoter HSV-TK (EGP2-TK) construct with 2 or 4 copies of let-7b miRNA targets expressed TK gene only in Y79, WERI-Rb-1, while the TK gene did not express in MIO-M1. In summary, we have developed a tissue-specific, miRNA-regulated dual control vector, which selectively expresses the suicide gene in EpCAM over expressing cells.

Human microRNA-1245 down-regulates the NKG2D receptor in natural killer cells and impairs NKG2D-mediated functions

PubMed Central

Espinoza, J. Luis; Takami, Akiyoshi; Yoshioka, Katsuji; Nakata, Katsuya; Sato, Tokiharu; Kasahara, Yoshihito; Nakao, Shinji

2012-01-01

Background NKG2D is an activating receptor expressed by natural killer and T cells, which have crucial functions in tumor and microbial immunosurveillance. Several cytokines have been identified as modulators of NKG2D receptor expression. However, little is known about NKG2D gene regulation. In this study, we found that microRNA 1245 attenuated the expression of NKG2D in natural killer cells. Design and Methods We investigated the potential interactions between the 3′-untranslated region of the NKG2D gene and microRNA as well as their functional roles in the regulation of NKG2D expression and cytotoxicity in natural killer cells. Results Transforming growth factor-β1, a major negative regulator of NKG2D expression, post-transcriptionally up-regulated mature microRNA-1245 expression, thus down-regulating NKG2D expression and impairing NKG2D-mediated immune responses in natural killer cells. Conversely, microRNA-1245 down-regulation significantly increased the expression of NKG2D expression in natural killer cells, resulting in more efficient NKG2D-mediated cytotoxicity. Conclusions These results reveal a novel NKG2D regulatory pathway mediated by microRNA-1245, which may represent one of the mechanisms used by transforming growth factor-β1 to attenuate NKG2D expression in natural killer cells. PMID:22491735

Overexpression of the transcription factor NF-YC9 confers abscisic acid hypersensitivity in Arabidopsis.

PubMed

Bi, Chao; Ma, Yu; Wang, Xiao-Fang; Zhang, Da-Peng

2017-11-01

Nuclear factor Y (NF-Y) family proteins are involved in many developmental processes and responses to environmental cues in plants, but whether and how they regulate phytohormone abscisic acid (ABA) signaling need further studies. In the present study, we showed that over-expression of the NF-YC9 gene confers ABA hypersensitivity in both the early seedling growth and stomatal response, while down-regulation of NF-YC9 does not affect ABA response in these processes. We also showed that over-expression of the NF-YC9 gene confers salt and osmotic hypersensitivity in early seedling growth, which is likely to be directly associated with the ABA hypersensitivity. Further, we observed that NF-YC9 physically interacts with the ABA-responsive bZIP transcription factor ABA-INSENSITIVE5 (ABI5), and facilitates the function of ABI5 to bind and activate the promoter of a target gene EM6. Additionally, NF-YC9 up-regulates expression of the ABI5 gene in response to ABA. These findings show that NF-YC9 may be involved in ABA signaling as a positive regulator and likely functions redundantly together with other NF-YC members, and support the model that the NF-YC9 mediates ABA signaling via targeting to and aiding the ABA-responsive transcription factors such as ABI5.

Rice Ethylene-Response AP2/ERF Factor OsEATB Restricts Internode Elongation by Down-Regulating a Gibberellin Biosynthetic Gene1[W][OA

PubMed Central

Qi, Weiwei; Sun, Fan; Wang, Qianjie; Chen, Mingluan; Huang, Yunqing; Feng, Yu-Qi; Luo, Xiaojin; Yang, Jinshui

2011-01-01

Plant height is a decisive factor in plant architecture. Rice (Oryza sativa) plants have the potential for rapid internodal elongation, which determines plant height. A large body of physiological research has shown that ethylene and gibberellin are involved in this process. The APETALA2 (AP2)/Ethylene-Responsive Element Binding Factor (ERF) family of transcriptional factors is only present in the plant kingdom. This family has various developmental and physiological functions. A rice AP2/ERF gene, OsEATB (for ERF protein associated with tillering and panicle branching) was cloned from indica rice variety 9311. Bioinformatic analysis suggested that this ERF has a potential new function. Ectopic expression of OsEATB showed that the cross talk between ethylene and gibberellin, which is mediated by OsEATB, might underlie differences in rice internode elongation. Analyses of gene expression demonstrated that OsEATB restricts ethylene-induced enhancement of gibberellin responsiveness during the internode elongation process by down-regulating the gibberellin biosynthetic gene, ent-kaurene synthase A. Plant height is negatively correlated with tiller number, and higher yields are typically obtained from dwarf crops. OsEATB reduces rice plant height and panicle length at maturity, promoting the branching potential of both tillers and spikelets. These are useful traits for breeding high-yielding crops. PMID:21753115

Finasteride inhibited brain dopaminergic system and open-field behaviors in adolescent male rats.

PubMed

Li, Li; Kang, Yun-Xiao; Ji, Xiao-Ming; Li, Ying-Kun; Li, Shuang-Cheng; Zhang, Xiang-Jian; Cui, Hui-Xian; Shi, Ge-Ming

2018-02-01

Finasteride inhibits the conversion of testosterone to dihydrotestosterone. Because androgen regulates dopaminergic system in the brain, it could be hypothesized that finasteride may inhibit dopaminergic system. The present study therefore investigates the effects of finasteride in adolescent and early developmental rats on dopaminergic system, including contents of dopamine and its metabolites (dihydroxy phenyl acetic acid and homovanillic acid) and tyrosine hydroxylase expressions both at gene and protein levels. Meanwhile, open-field behaviors of the rats are examined because of the regulatory effect of dopaminergic system on the behaviors. Open-field behaviors were evaluated by exploratory and motor behaviors. Dopamine and its metabolites were assayed by liquid chromatography-mass spectrometry. Tyrosine hydroxylase mRNA and protein expressions were determined by real-time qRT-PCR and western blot, respectively. It was found that in adolescent male rats, administration of finasteride at doses of 25 and 50 mg/kg for 14 days dose dependently inhibited open-field behaviors, reduced contents of dopamine and its metabolites in frontal cortex, hippocampus, caudate putamen, nucleus accumbens, and down-regulated tyrosine hydroxylase mRNA and protein expressions in substantia nigra and ventral tegmental area. However, there was no significant change of these parameters in early developmental rats after finasteride treatment. These results suggest that finasteride inhibits dopaminergic system and open-field behaviors in adolescent male rats by inhibiting the conversion of testosterone to dihydrotestosterone, and imply finasteride as a potential therapeutic option for neuropsychiatric disorders associated with hyperactivities of dopaminergic system and androgen. © 2017 John Wiley & Sons Ltd.

Drp1 guarding of the mitochondrial network is important for glucose-stimulated insulin secretion in pancreatic beta cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reinhardt, Florian; Schultz, Julia; Waterstradt, Rica

Mitochondria form a tubular network in mammalian cells, and the mitochondrial life cycle is determined by fission, fusion and autophagy. Dynamin-related protein 1 (Drp1) has a pivotal role in these processes because it alone is able to constrict mitochondria. However, the regulation and function of Drp1 have been shown to vary between cell types. Mitochondrial morphology affects mitochondrial metabolism and function. In pancreatic beta cells mitochondrial metabolism is a key component of the glucose-induced cascade of insulin secretion. The goal of the present study was to investigate the action of Drp1 in pancreatic beta cells. For this purpose Drp1 wasmore » down-regulated by means of shDrp1 in insulin-secreting INS1 cells and mouse pancreatic islets. In INS1 cells reduced Drp1 expression resulted in diminished expression of proteins regulating mitochondrial fusion, namely mitofusin 1 and 2, and optic atrophy protein 1. Diminished mitochondrial dynamics can therefore be assumed. After down-regulation of Drp1 in INS1 cells and spread mouse islets the initially homogenous mitochondrial network characterised by a moderate level of interconnections shifted towards high heterogeneity with elongated, clustered and looped mitochondria. These morphological changes were found to correlate directly with functional alterations. Mitochondrial membrane potential and ATP generation were significantly reduced in INS1 cells after Drp1down-regulation. Finally, a significant loss of glucose-stimulated insulin secretion was demonstrated in INS1 cells and mouse pancreatic islets. In conclusion, Drp1 expression is important in pancreatic beta cells to maintain the regulation of insulin secretion. -- Highlights: •Down-regulation of Drp1 in INS1 cells reduces mitochondrial fusion protein expression. •Mitochondrial membrane potential in INS1 cells is diminished after Drp1 down-regulation. •Mitochondria become elongated after down-regulation of Drp1 in beta cells. •Down-regulation of Drp1 in islets evokes loss of glucose-stimulated insulin secretion.« less

Down-regulated RPS3a/nbl expression during retinoid-induced differentiation of HL-60 cells: a close association with diminished susceptibility to actinomycin D-stimulated apoptosis.

PubMed

Russell, L; Naora, H; Naora, H

2000-04-01

The efficacy of anticancer agents significantly depends on the differential susceptibility of undifferentiated cancer cells and differentiated normal cells to undergo apoptosis. We previously found that enhanced expression of RPS3a/nbl, which apparently encodes a ribosomal protein, seems to prime cells for apoptosis, while suppressing such enhanced expression triggers cell death. The present study found that HL-60 cells induced to differentiate by all-trans retinoic acid did not undergo apoptosis following treatment with actinomycin D whereas undifferentiated HL-60 cells were highly apoptosis-susceptible, confirming earlier suggestions that differentiated cells have diminished apoptosis-susceptibility. Undifferentiated HL-60 cells highly expressed RPS3a/nbl whereas all-trans retinoic acid -induced differentiated cells exhibited markedly reduced levels, suggesting that apoptosis-resistance of differentiated cells could be due to low RPS3a/nbl expression. Down-regulation of enhanced RPS3a/nbl expression was also observed in cells induced to differentiate with the retinoid 4-[(E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-napthalenyl)-1- propenyl]benzoic acid without any significant induction of cell death. While down-regulation of RPS3a/nbl expression during differentiation did not apparently induce apoptosis, RPS3a/nbl antisense oligomers triggered death of undifferentiated HL-60 cells, but not of retinoid-induced differentiated cells. It therefore seems that while down-regulation of enhanced RPS3a/nbl expression can induce apoptosis in undifferentiated cells, down-regulation of enhanced RPS3a/nbl expression during differentiation occurs independently of apoptosis, and could be regarded as reverting the primed condition to the unprimed (low RPS3a/nbl) state.

Expression of hsrω-RNAi transgene prior to heat shock specifically compromises accumulation of heat shock-induced Hsp70 in Drosophila melanogaster.

PubMed

Singh, Anand K; Lakhotia, Subhash C

2016-01-01

A delayed organismic lethality was reported in Drosophila following heat shock when developmentally active and stress-inducible noncoding hsrω-n transcripts were down-regulated during heat shock through hs-GAL4-driven expression of the hsrω-RNAi transgene, despite the characteristic elevation of all heat shock proteins (Hsp), including Hsp70. Here, we show that hsrω-RNAi transgene expression prior to heat shock singularly prevents accumulation of Hsp70 in all larval tissues without affecting transcriptional induction of hsp70 genes and stability of their transcripts. Absence of the stress-induced Hsp70 accumulation was not due to higher levels of Hsc70 in hsrω-RNAi transgene-expressing tissues. Inhibition of proteasomal activity during heat shock restored high levels of the induced Hsp70, suggesting very rapid degradation of the Hsp70 even during the stress when hsrω-RNAi transgene was expressed ahead of heat shock. Unexpectedly, while complete absence of hsrω transcripts in hsrω (66) homozygotes (hsrω-null) did not prevent high accumulation of heat shock-induced Hsp70, hsrω-RNAi transgene expression in hsrω-null background blocked Hsp70 accumulation. Nonspecific RNAi transgene expression did not affect Hsp70 induction. These observations reveal that, under certain conditions, the stress-induced Hsp70 can be selectively and rapidly targeted for proteasomal degradation even during heat shock. In the present case, the selective degradation of Hsp70 does not appear to be due to down-regulation of the hsrω-n transcripts per se; rather, this may be an indirect effect of the expression of hsrω-RNAi transgene whose RNA products may titrate away some RNA-binding proteins which may also be essential for stability of the induced Hsp70.

Perturbation in protein expression of the sterile salmonid hybrids between female brook trout Salvelinus fontinalis and male masu salmon Oncorhynchus masou during early spermatogenesis.

PubMed

Zheng, Liang; Senda, Yoshie; Abe, Syuiti

2013-05-01

Most males and females of intergeneric hybrid (BM) between female brook trout (Bt) Salvelinus fontinalis and male masu salmon (Ms) Oncorhynchus masou had undeveloped gonads, with abnormal germ cell development shown by histological examination. To understand the cause of this hybrid sterility, expression profiles of testicular proteins in the BM and parental species were examined with 2-DE coupled with MALDI-TOF/TOF MS. Compared with the parental species, more than 60% of differentially expressed protein spots were down-regulated in BM. A total of 16 up-regulated and 48 down-regulated proteins were identified in BM. Up-regulated were transferrin and other somatic cell-predominant proteins, whereas down-regulated were some germ cell-specific proteins such as DEAD box RNA helicase Vasa. Other pronouncedly down-regulated proteins included tubulins and heat shock proteins that are supposed to have roles in spermatogenesis. The present findings suggest direct association of the observed perturbation in protein expression with the failure of spermatogenesis and the sterility in the examined salmonid hybrids. Copyright © 2013 Elsevier B.V. All rights reserved.

Homologous recombination and non-homologous end-joining repair pathways in bovine embryos with different developmental competence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henrique Barreta, Marcos; Laboratorio de Biotecnologia e Reproducao Animal-BioRep, Universidade Federal de Santa Maria, Santa Maria, RS; Garziera Gasperin, Bernardo

2012-10-01

This study investigated the expression of genes controlling homologous recombination (HR), and non-homologous end-joining (NHEJ) DNA-repair pathways in bovine embryos of different developmental potential. It also evaluated whether bovine embryos can respond to DNA double-strand breaks (DSBs) induced with ultraviolet irradiation by regulating expression of genes involved in HR and NHEJ repair pathways. Embryos with high, intermediate or low developmental competence were selected based on the cleavage time after in vitro insemination and were removed from in vitro culture before (36 h), during (72 h) and after (96 h) the expected period of embryonic genome activation. All studied genes weremore » expressed before, during and after the genome activation period regardless the developmental competence of the embryos. Higher mRNA expression of 53BP1 and RAD52 was found before genome activation in embryos with low developmental competence. Expression of 53BP1, RAD51 and KU70 was downregulated at 72 h and upregulated at 168 h post-insemination in response to DSBs induced by ultraviolet irradiation. In conclusion, important genes controlling HR and NHEJ DNA-repair pathways are expressed in bovine embryos, however genes participating in these pathways are only regulated after the period of embryo genome activation in response to ultraviolet-induced DSBs.« less

The Ca2+/Calcineurin-Regulated cup Gene Family in Dictyostelium discoideum and Its Possible Involvement in Development

PubMed Central

Coukell, Barrie; Li, Yi; Moniakis, John; Cameron, Anne

2004-01-01

Changes in free intracellular Ca2+ are thought to regulate several major processes during Dictyostelium development, including cell aggregation and cell type-specific gene expression, but the mechanisms involved are unclear. To learn more about Ca2+ signaling and Ca2+ homeostasis in this organism, we used suppression subtractive hybridization to identify genes up-regulated by high extracellular Ca2+. Unexpectedly, many of the genes identified belong to a novel gene family (termed cup) with seven members. In vegetative cells, the cup genes were up-regulated by high Ca2+ but not by other ions or by heat, oxidative, or osmotic stress. cup induction by Ca2+ was blocked completely by inhibitors of calcineurin and protein synthesis. In developing cells, cup expression was high during aggregation and late development but low during the slug stage. This pattern correlates closely with reported levels of free intracellular Ca2+ during development. The cup gene products are highly homologous, acidic proteins possessing putative ricin domains. BLAST searches failed to reveal homologs in other organisms, but Western analyses suggested that Cup-like proteins might exist in certain other cellular slime mold species. Localization experiments indicated that Cup proteins are primarily cytoplasmic but become cell membrane-associated during Ca2+ stress and cell aggregation. When cup expression was down-regulated by antisense RNA, the cells failed to aggregate. However, this developmental block was overcome by partially up-regulating cup expression. Together, these results suggest that the Cup proteins in Dictyostelium might play an important role in stabilizing and/or regulating the cell membrane during Ca2+ stress and/or certain stages of development. PMID:14871937

An epigenetic view of developmental diseases: new targets, new therapies.

PubMed

Xie, Pei; Zang, Li-Qun; Li, Xue-Kun; Shu, Qiang

2016-08-01

Function of epigenetic modifications is one of the most competitive fields in life science. Over the past several decades, it has been revealed that epigenetic modifications play essential roles in development and diseases including developmental diseases. In the present review, we summarize the recent progress about the function of epigenetic regulation, especially DNA and RNA modifications in developmental diseases. Original research articles and literature reviews published in PubMed-indexed journals. DNA modifications including methylation and demethylation can regulate gene expression, and are involved in development and multiple diseases including Rett syndrome, Autism spectrum disorders, congenital heart disease and cancer, etc. RNA methylation and demethylation play important roles in RNA processing, reprogramming, circadian, and neuronal activity, and then modulate development. DNA and RNA modifications play important roles in development and diseases through regulating gene expression. Epigenetic components could serve as novel targets for the treatment of developmental diseases.

Transcriptional markers of sub-optimal nutrition in developing Apis mellifera nurse workers

PubMed Central

2014-01-01

Background Honey bees (Apis mellifera) contribute substantially to the worldwide economy and ecosystem health as pollinators. Pollen is essential to the bee’s diet, providing protein, lipids, and micronutrients. The dramatic shifts in physiology, anatomy, and behavior that accompany normal worker development are highly plastic and recent work demonstrates that development, particularly the transition from nurse to foraging roles, is greatly impacted by diet. However, the role that diet plays in the developmental transition of newly eclosed bees to nurse workers is poorly understood. To further understand honey bee nutrition and the role of diet in nurse development, we used a high-throughput screen of the transcriptome of 3 day and 8 day old worker bees fed either honey and stored pollen (rich diet) or honey alone (poor diet) within the hive. We employed a three factor (age, diet, age x diet) analysis of the transcriptome to determine whether diet affected nurse worker physiology and whether poor diet altered the developmental processes normally associated with aging. Results Substantial changes in gene expression occurred due to starvation. Diet-induced changes in gene transcription occurring in younger bees were largely a subset of those occurring in older bees, but certain signatures of starvation were only evident 8 day old workers. Of the 18,542 annotated transcripts in the A. mellifera genome, 150 transcripts exhibited differential expression due to poor diet at 3d of age compared with 17,226 transcripts that differed due to poor diet at 8d of age, and poor diet caused more frequent down-regulation of gene expression in younger bees compared to older bees. In addition, the age-related physiological changes that accompanied early adult development differed due to the diet these young adult bees were fed. More frequent down-regulation of gene expression was observed in developing bees fed a poor diet compared to those fed an adequate diet. Functional analyses also suggest that the physiological and developmental processes occurring in well-fed bees are vastly different than those occurring in pollen deprived bees. Our data support the hypothesis that poor diet causes normal age-related development to go awry. Conclusion Poor nutrition has major consequences for the expression of genes underlying the physiology and age-related development of nurse worker bees. More work is certainly needed to fully understand the consequences of starvation and the complex biology of nutrition and development in this system, but the genes identified in the present study provide a starting point for understanding the consequences of poor diet and for mitigating the economic costs of colony starvation. PMID:24529032

Palmitic acid suppresses apolipoprotein M gene expression via the pathway of PPAR{sub β/δ} in HepG2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, Guanghua; Shi, Yuanping; Zhang, Jun

Highlights: • Palmitic acid significantly inhibited APOM gene expression in HepG2 cells. • Palmitic acid could obviously increase PPARB/D mRNA levels in HepG2 cells. • PPAR{sub β/δ} antagonist, GSK3787, had no effect on APOM expression. • GSK3787 could reverse the palmitic acid-induced down-regulation of APOM expression. • Palmitic acid induced suppression of APOM expression is mediated via the PPAR{sub β/δ} pathway. - Abstract: It has been demonstrated that apolipoprotein M (APOM) is a vasculoprotective constituent of high density lipoprotein (HDL), which could be related to the anti-atherosclerotic property of HDL. Investigation of regulation of APOM expression is of important formore » further exploring its pathophysiological function in vivo. Our previous studies indicated that expression of APOM could be regulated by platelet activating factor (PAF), transforming growth factors (TGF), insulin-like growth factor (IGF), leptin, hyperglycemia and etc., in vivo and/or in vitro. In the present study, we demonstrated that palmitic acid could significantly inhibit APOM gene expression in HepG2 cells. Further study indicated neither PI-3 kinase (PI3K) inhibitor LY294002 nor protein kinase C (PKC) inhibitor GFX could abolish palmitic acid induced down-regulation of APOM expression. In contrast, the peroxisome proliferator-activated receptor beta/delta (PPAR{sub β/δ}) antagonist GSK3787 could totally reverse the palmitic acid-induced down-regulation of APOM expression, which clearly demonstrates that down-regulation of APOM expression induced by palmitic acid is mediated via the PPAR{sub β/δ} pathway.« less

CHIP mediates down-regulation of nucleobindin-1 in preosteoblast cell line models.

PubMed

Xue, Fuying; Wu, Yanping; Zhao, Xinghui; Zhao, Taoran; Meng, Ying; Zhao, Zhanzhong; Guo, Junwei; Chen, Wei

2016-08-01

Nucleobindin-1 (NUCB1), also known as Calnuc, is a highly conserved, multifunctional protein widely expressed in tissues and cells. It contains two EF-hand motifs which have been shown to play a crucial role in binding Ca(2+) ions. In this study, we applied comparative two-dimensional gel electrophoresis to characterize differentially expressed proteins in HA-CHIP over-expressed and endogenous CHIP depleted MC3T3-E1 stable cell lines, identifying NUCB1 as a novel CHIP/Stub1 targeted protein. NUCB1 interacts with and is down-regulated by CHIP by both proteasomal dependent and independent pathways, suggesting that CHIP-mediated down-regulation of nucleobindin-1 might play a role in osteoblast differentiation. The chaperone protein Hsp70 was found to be important for CHIP and NUCB1 interaction as well as CHIP-mediated NUCB1 down-regulation. Our findings provide new insights into understanding the stability regulation of NUCB1. Copyright © 2016 Elsevier Inc. All rights reserved.

MGOUN1 encodes an Arabidopsis type IB DNA topoisomerase required in stem cell regulation and to maintain developmentally regulated gene silencing.

PubMed

Graf, Philipp; Dolzblasz, Alicja; Würschum, Tobias; Lenhard, Michael; Pfreundt, Ulrike; Laux, Thomas

2010-03-01

Maintenance of stem cells in the Arabidopsis thaliana shoot meristem is regulated by signals from the underlying cells of the organizing center, provided through the transcription factor WUSCHEL (WUS). Here, we report the isolation of several independent mutants of MGOUN1 (MGO1) as genetic suppressors of ectopic WUS activity and enhancers of stem cell defects in hypomorphic wus alleles. mgo1 mutants have previously been reported to result in a delayed progression of meristem cells into differentiating organ primordia (Laufs et al., 1998). Genetic analyses indicate that MGO1 functions together with WUS in stem cell maintenance at all stages of shoot and floral meristems. Synergistic interactions of mgo1 with several chromatin mutants suggest that MGO1 affects gene expression together with chromatin remodeling pathways. In addition, the expression states of developmentally regulated genes are randomly switched in mgo1 in a mitotically inheritable way, indicating that MGO1 stabilizes epigenetic states against stochastically occurring changes. Positional cloning revealed that MGO1 encodes a putative type IB topoisomerase, which in animals and yeast has been shown to be required for regulation of DNA coiling during transcription and replication. The specific developmental defects in mgo1 mutants link topoisomerase IB function in Arabidopsis to stable propagation of developmentally regulated gene expression.

RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

PubMed Central

2011-01-01

Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

Thermotolerance and Heat-Shock Protein Gene Expression Patterns in Bemisia tabaci (Hemiptera: Aleyrodidae) Mediterranean in Relation to Developmental Stage.

PubMed

Jiang, Rui; Qi, Lan-Da; Du, Yu-Zhou; Li, Yuan-Xi

2017-10-01

Temperature plays an important role in the growth, development, and geographic distribution of insects. There is convincing evidence that heat-shock proteins (HSPs) play important roles in helping organisms adapt to thermal stress. To better understand the physiological and ecological influence of thermal stress on the different development stages of Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) Mediterranean species (MED), nymphs and adults were shocked with temperatures of 35, 38, and 41℃ for 1 and 2 h, respectively, and the survival rate, fecundity, and developmental duration were investigated in the laboratory. The expression levels of the hsp40, hsp70, and hsp90 genes were assessed using real-time PCR. The results indicate that the survival rates of the nymphs and adults decreased with increased temperature. A 2-h heat shock at 41℃ induced a significant reduction in fecundity in adults and an increase in developmental duration in young nymphs. Hsp90 showed higher temperature responses to thermal stress than hsp40 or hsp70. The expression levels of the hsps in the adults were significantly down-regulated by a 2-h heat shock at 41℃ compared with that by a 1-h treatment. A significant decrease in the expression levels of the hsps also occurred in the adults when the temperature increased from 38 to 41℃ for the 2-h treatment, whereas no significant decrease occurred in the nymphs. Compared with previous studies, we provide some evidence indicating that MED has the potential to adapt to a wider temperature range than the Middle East-Asia Minor 1 species. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

MicroRNA-302a suppresses influenza A virus-stimulated interferon regulatory factor-5 expression and cytokine storm induction.

PubMed

Chen, Xueyuan; Zhou, Li; Peng, Nanfang; Yu, Haisheng; Li, Mengqi; Cao, Zhongying; Lin, Yong; Wang, Xueyu; Li, Qian; Wang, Jun; She, Yinglong; Zhu, Chengliang; Lu, Mengji; Zhu, Ying; Liu, Shi

2017-12-29

During influenza A virus (IAV) infection, cytokine storms play a vital and critical role in clinical outcomes. We have previously reported that microRNA (miR)-302c regulates IAV-induced IFN expression by targeting the 3'-UTR of nuclear factor κB (NF-κB)-inducing kinase. In the current study, we found that miR-302a, another member of the miR-302 cluster, controls the IAV-induced cytokine storm. According to results from cell-based and knockout mouse models, IAV induces a cytokine storm via interferon regulatory factor-5 (IRF-5). We also found that IAV infection up-regulates IRF-5 expression and that IRF-5 in turn promotes IAV replication. Furthermore, we observed that IRF-5 is a direct target of miR-302a, which down-regulated IRF-5 expression by binding its 3'-UTR. Moreover, IAV increased IRF-5 expression by down-regulating miR-302a expression. Interestingly, miR-302a inhibited IAV replication. In IAV-infected patients, miR-302a expression was down-regulated, whereas IRF-5 expression was up-regulated. Taken together, our work uncovers and defines a signaling pathway implicated in an IAV-induced cytokine storm. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Fulvestrant (ICI 182,780) down-regulates androgen receptor expression and diminishes androgenic responses in LNCaP human prostate cancer cells.

PubMed

Bhattacharyya, Rumi S; Krishnan, Aruna V; Swami, Srilatha; Feldman, David

2006-06-01

The androgen receptor (AR) plays a key role in the development and progression of prostate cancer. Targeting the AR for down-regulation would be a useful strategy for treating prostate cancer, especially hormone-refractory or androgen-independent prostate cancer. In the present study, we showed that the antiestrogen fulvestrant [ICI 182,780 (ICI)] effectively suppressed AR expression in several human prostate cancer cells, including androgen-independent cells. In LNCaP cells, ICI (10 micromol/L) treatment decreased AR mRNA expression by 43% after 24 hours and AR protein expression by approximately 50% after 48 hours. We further examined the mechanism of AR down-regulation by ICI in LNCaP cells. ICI did not bind to the T877A-mutant AR present in the LNCaP cells nor did it promote proteasomal degradation of the AR. ICI did not affect AR mRNA or protein half-life. However, ICI decreased the activity of an AR promoter-luciferase reporter plasmid transfected into LNCaP cells, suggesting a direct repression of AR gene transcription. As a result of AR down-regulation by ICI, androgen induction of prostate-specific antigen mRNA and protein expression were substantially attenuated. Importantly, LNCaP cell proliferation was significantly inhibited by ICI treatment. Following 6 days of ICI treatment, a 70% growth inhibition was seen in androgen-stimulated LNCaP cells. These data show that the antiestrogen ICI is a potent AR down-regulator that causes significant inhibition of prostate cancer cell growth. Our study suggests that AR down-regulation by ICI would be an effective strategy for the treatment of all prostate cancer, especially AR-dependent androgen-independent prostate cancer.

Mechanical stress mediated by both endosperm softening and embryo growth underlies endosperm elimination in Arabidopsis seeds.

PubMed

Fourquin, Chloé; Beauzamy, Léna; Chamot, Sophy; Creff, Audrey; Goodrich, Justin; Boudaoud, Arezki; Ingram, Gwyneth

2016-09-15

Seed development in angiosperms demands the tightly coordinated development of three genetically distinct structures. The embryo is surrounded by the endosperm, which is in turn enclosed within the maternally derived seed coat. In Arabidopsis, final seed size is determined by early expansion of the coenocytic endosperm, which then cellularises and subsequently undergoes developmental programmed cell death, breaking down as the embryo grows. Endosperm breakdown requires the endosperm-specific basic helix-loop-helix transcription factor ZHOUPI. However, to date, the mechanism underlying the Arabidopsis endosperm breakdown process has not been elucidated. Here, we provide evidence that ZHOUPI does not induce the developmental programmed cell death of the endosperm directly. Instead ZHOUPI indirectly triggers cell death by regulating the expression of cell wall-modifying enzymes, thus altering the physical properties of the endosperm to condition a mechanical environment permitting the compression of the cellularised endosperm by the developing embryo. © 2016. Published by The Company of Biologists Ltd.

MicroRNA-20a is essential for normal embryogenesis by targeting vsx1 mRNA in fish

PubMed Central

Sun, Lei; Li, Heng; Xu, Xiaofeng; Xiao, Guanxiu; Luo, Chen

2015-01-01

MicroRNAs are major post-transcriptional regulators of gene expression and have essential roles in diverse developmental processes. In vertebrates, some regulatory genes play different roles at different developmental stages. These genes are initially transcribed in a wide embryonic region but restricted within distinct cell types at subsequent stages during development. Therefore, post-transcriptional regulation is required for the transition from one developmental stage to the next and the establishment of different cell identities. However, the regulation of many multiple functional genes at post-transcription level during development remains unknown. Here we show that miR-20a can target the mRNA of vsx1, a multiple functional gene, at the 3′-UTR and inhibit protein expression in both goldfish and zebrafish. The expression of miR-20a is initiated ubiquitously at late gastrula stage and exhibits a tissue-specific pattern in the developing retina. Inhibition of vsx1 3′-UTR mediated protein expression occurs when and where miR-20a is expressed. Decoying miR-20a resulted in severely impaired head, eye and trunk formation in association with excessive generation of vsx1 marked neurons in the spinal cord and defects of somites in the mesoderm region. These results demonstrate that miR-20a is essential for normal embryogenesis by restricting Vsx1 expression in goldfish and zebrafish, and that post-transcriptional regulation is an essential mechanism for Vsx1 playing different roles in diverse developmental processes. PMID:25833418

Free-Labeling Facial Expressions and Emotional Situations in Children Aged 3-7 Years: Developmental Trajectory and a Face Inferiority Effect

ERIC Educational Resources Information Center

Wang, Zhenhong; Lü, Wei; Zhang, Hui; Surina, Alyssa

2014-01-01

Chinese children (N = 185, aged 3-7 years) were assessed on their abilities to freely label facial expressions and emotional situations. Results indicated that the overall accuracy of free-labeling facial expressions increased relatively quickly in children aged 3-5 years, but slowed down in children aged 5-7 years. In contrast, the overall…

Celecoxib can suppress expression of genes associated with PGE2 pathway in chondrocytes under inflammatory conditions.

PubMed

Sun, Tian-Wen; Wu, Zhi-Hong; Weng, Xi-Sheng

2015-01-01

This study aimed to investigate the effect of a selective cyclooxygenase-2 (COX-2) inhibitor (celecoxib) on the expression of arachidonate-associated inflammatory genes in cultured human normal chondrocytes. Normal chondrocytes were obtained from the cartilage of three different amputated patients without osteoarthritis (OA). Affymetrix Human microarray was used to assess the alterations in gene expression in three groups of cells: untreated cells (negative control group), cells treated with interleukin-1β (IL-1β) (positive control group), and cells treated with IL-1β and celecoxib. The patterns of up-regulation and down-regulation of gene expression were further validated by real-time PCR. A total of 1091 up-regulated genes and 1252 down-regulated genes were identified in the positive control group compared with the negative control group. Among them, PTGS2, ADAMTS5, PTGER2, mPTGES and PTGER4 are known to be involved in chondrocyte inflammation, while VEGFA, BCL2, TRAF1, CYR61, BMP6, DAPK1, DUSP7, IL1RN, MMP13 and TNFSF10 were reported being associated with cytokine and chemokine signaling. 189 up-regulated genes and 177 down-regulated genes were identified in the positive control group compared with intervention group. PTGS1, PTGS2, ADAMTS5, PTGER2, mPTGES and PTGER4 were among the genes down-regulated upon the treatment with celecoxib. Our results demonstrated that the OA chondrocytes are the site of active eicosanoid production. IL-1β can activate inflammation in chondrocytes and trigger the production of various proteins involved in cyclooxygenase pathway. The expression of genes corresponding to these proteins can be down-regulated by celecoxib. The findings indicate that the therapy with prostaglandin E2 (PGE2)-blocking agents may decrease the PGE2 production not only by direct inhibition of COX-2 activity, but also by down-regulating the expression of genes encoding for COX-2, microsomal prostaglandin-endoperoxide synthase 1 (mPGES-1) and prostaglandin E receptors 4 (EP4) in the articular chondrocytes.

Identification of conserved drought stress responsive gene-network across tissues and developmental stages in rice.

PubMed

Smita, Shuchi; Katiyar, Amit; Pandey, Dev Mani; Chinnusamy, Viswanathan; Archak, Sunil; Bansal, Kailash Chander

2013-01-01

Identification of genes that are coexpressed across various tissues and environmental stresses is biologically interesting, since they may play coordinated role in similar biological processes. Genes with correlated expression patterns can be best identified by using coexpression network analysis of transcriptome data. In the present study, we analyzed the temporal-spatial coordination of gene expression in root, leaf and panicle of rice under drought stress and constructed network using WGCNA and Cytoscape. Total of 2199 differentially expressed genes (DEGs) were identified in at least three or more tissues, wherein 88 genes have coordinated expression profile among all the six tissues under drought stress. These 88 highly coordinated genes were further subjected to module identification in the coexpression network. Based on chief topological properties we identified 18 hub genes such as ABC transporter, ATP-binding protein, dehydrin, protein phosphatase 2C, LTPL153 - Protease inhibitor, phosphatidylethanolaminebinding protein, lactose permease-related, NADP-dependent malic enzyme, etc. Motif enrichment analysis showed the presence of ABRE cis-elements in the promoters of > 62% of the coordinately expressed genes. Our results suggest that drought stress mediated upregulated gene expression was coordinated through an ABA-dependent signaling pathway across tissues, at least for the subset of genes identified in this study, while down regulation appears to be regulated by tissue specific pathways in rice.

Down-regulation of Cyclooxygenase-2 by the Carboxyl Tail of the Angiotensin II Type 1 Receptor*

PubMed Central

Sood, Rapita; Minzel, Waleed; Rimon, Gilad; Tal, Sharon; Barki-Harrington, Liza

2014-01-01

The enzyme cyclooxygenase-2 (COX-2) plays an important role in the kidney by up-regulating the production of the vasoconstrictor hormone angiotensin II (AngII), which in turn down-regulates COX-2 expression via activation of the angiotensin II type 1 receptor (AT1) receptor. Chemical inhibition of the catalytic activity of COX-2 is a well-established strategy for treating inflammation but little is known of cellular mechanisms that dispose of the protein itself. Here we show that in addition to its indirect negative feedback on COX-2, AT1 also down-regulates the expression of the COX-2 protein via a pathway that does not involve G-protein or β-arrestin-dependent signaling. Instead, AT1 enhances the ubiquitination and subsequent degradation of the enzyme in the proteasome through elements in its cytosolic carboxyl tail (CT). We find that a mutant receptor that lacks the last 35 amino acids of its CT (Δ324) is devoid of its ability to reduce COX-2, and that expression of the CT sequence alone is sufficient to down-regulate COX-2. Collectively these results propose a new role for AT1 in regulating COX-2 expression in a mechanism that deviates from its canonical signaling pathways. Down-regulation of COX-2 by a short peptide that originates from AT1 may present as a basis for novel therapeutic means of eliminating excess COX-2 protein. PMID:25231994

Involvement of SIRT1 in hypoxic down-regulation of c-Myc and β-catenin and hypoxic preconditioning effect of polyphenols

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Kyung-Soo; Research Center for Ischemic Tissue regeneration, Pusan National University School of Medicine, Yangsan; Park, Jun-Ik

2012-03-01

SIRT1 has been found to function as a Class III deacetylase that affects the acetylation status of histones and other important cellular nonhistone proteins involved in various cellular pathways including stress responses and apoptosis. In this study, we investigated the role of SIRT1 signaling in the hypoxic down-regulations of c-Myc and β-catenin and hypoxic preconditioning effect of the red wine polyphenols such as piceatannol, myricetin, quercetin and resveratrol. We found that the expression of SIRT1 was significantly increased in hypoxia-exposed or hypoxic preconditioned HepG2 cells, which was closely associated with the up-regulation of HIF-1α and down-regulation of c-Myc and β-cateninmore » expression via deacetylation of these proteins. In addition, blockade of SIRT1 activation using siRNA or amurensin G, a new potent SIRT1 inhibitor, abolished hypoxia-induced HIF-1α expression but increased c-Myc and β-catenin expression. SIRT1 was also found to stabilize HIF-1α protein and destabilize c-Myc, β-catenin and PHD2 under hypoxia. We also found that myricetin, quercetin, piceatannol and resveratrol up-regulated HIF-1α and down-regulated c-Myc, PHD2 and β-catenin expressions via SIRT1 activation, in a manner that mimics hypoxic preconditioning. This study provides new insights of the molecular mechanisms of hypoxic preconditioning and suggests that polyphenolic SIRT1 activators could be used to mimic hypoxic/ischemic preconditioning. -- Graphical abstract: Polyphenols mimicked hypoxic preconditioning by up-regulating HIF-1α and SIRT1 and down-regulating c-Myc, PHD2, and β-catenin. HepG2 cells were pretreated with the indicated doses of myricetin (MYR; A), quercetin (QUR; B), or piceatannol (PIC; C) for 4 h and then exposed to hypoxia for 4 h. Levels of HIF-1α, SIRT1, c-Myc, β-catenin, and PHD2 were determined by western blot analysis. The data are representative of three individual experiments. Highlights: ► SIRT1 expression is increased in hypoxia-exposed or hypoxic preconditioned cells. ► SIRT1 deacetylates c-Myc and β-catenin ► HIF-1α is up-regulated by down-regulation of c-Myc and β-catenin expression. ► Polyphenolic SIRT1 activators mimics hypoxic preconditioning.« less

RNA-sequence analysis of gene expression from honeybees (Apis mellifera) infected with Nosema ceranae

PubMed Central

Fougeroux, André; Petit, Fabien; Anselmo, Anna; Gorni, Chiara; Cucurachi, Marco; Cersini, Antonella; Granato, Anna; Cardeti, Giusy; Formato, Giovanni; Mutinelli, Franco; Giuffra, Elisabetta; Williams, John L.; Botti, Sara

2017-01-01

Honeybees (Apis mellifera) are constantly subjected to many biotic stressors including parasites. This study examined honeybees infected with Nosema ceranae (N. ceranae). N. ceranae infection increases the bees energy requirements and may contribute to their decreased survival. RNA-seq was used to investigate gene expression at days 5, 10 and 15 Post Infection (P.I) with N. ceranae. The expression levels of genes, isoforms, alternative transcription start sites (TSS) and differential promoter usage revealed a complex pattern of transcriptional and post-transcriptional gene regulation suggesting that bees use a range of tactics to cope with the stress of N. ceranae infection. N. ceranae infection may cause reduced immune function in the bees by: (i)disturbing the host amino acids metabolism (ii) down-regulating expression of antimicrobial peptides (iii) down-regulation of cuticle coatings and (iv) down-regulation of odorant binding proteins. PMID:28350872

Adolescent social defeat increases adult amphetamine conditioned place preference and alters D2 dopamine receptor expression

PubMed Central

Burke, Andrew R.; Watt, Michael J.; Forster, Gina L.

2011-01-01

Components of the brain’s dopaminergic system, such as dopamine receptors, undergo final maturation in adolescence. Exposure to social stress during human adolescence contributes to substance abuse behaviors. We utilized a rat model of adolescent social stress to investigate the neural mechanisms underlying this correlation. Rats exposed to repeated social defeat in adolescence (P35–P39) exhibited increased conditioned place preference (CPP) for amphetamine (1 mg/kg) in adulthood (P70). In contrast, rats experiencing foot-shock during the same developmental period exhibited amphetamine CPP levels similar to non-stressed controls. Our previous experiments suggested adolescent defeat alters dopamine activity in the mesocorticolimbic system. Furthermore, dopamine receptors have been implicated in the expression of amphetamine CPP. Therefore, we hypothesized that alteration to dopamine receptor expression in the mesocorticolimbic system may be associated with to heightened amphetamine CPP of adult rats exposed to adolescence defeat. We measured D1 and D2 dopamine receptor protein content in the medial prefrontal cortex, nucleus accumbens (NAc) and dorsal striatum following either adolescent social defeat or foot-shock stress and then adult amphetamine CPP. In controls, amphetamine CPP training reduced D2 receptor protein content in the NAc core. However, this down-regulation of NAc core D2 receptors was blocked by exposure to social defeat but not foot-shock stress in adolescence. These results suggest social defeat stress in adolescence alters the manner in which later amphetamine exposure down-regulates D2 receptors. Furthermore, persistent alterations to adult D2 receptor expression and amphetamine responses may depend on the type of stress experienced in adolescence. PMID:21933700

Down-regulation of N-deacetylase-N-sulfotransferase-1 signaling in the developing diaphragmatic vasculature of nitrofen-induced congenital diaphragmatic hernia.

PubMed

Takahashi, Toshiaki; Friedmacher, Florian; Zimmer, Julia; Puri, Prem

2017-06-01

Congenital diaphragmatic hernia (CDH) has been attributed to various developmental abnormalities of the underlying tissue components. N-deacetylase-N-sulfotransferase-1 (Ndst1) is a strongly expressed biosynthetic enzyme in endothelial cells, which has recently been identified as an important factor during diaphragmatic vascularization. Loss of endothelial Ndst1 has been demonstrated to cause angiogenic defects in the developing diaphragm and disrupt normal diaphragmatic development. Furthermore, deficiency of Ndst1 diminishes the expression of slit homolog 3 (Slit3), a known CDH-related gene that has been associated with reduced vascular density and muscle defects in the diaphragm of Slit3 -/- mice. We hypothesized that expression of Ndst1 and Slit3 is decreased in the diaphragmatic vasculature of fetal rats with nitrofen-induced CDH. Time-mated rats received either nitrofen or vehicle on gestational day 9 (D9). Fetal diaphragms were microdissected on D13, D15 and D18, and divided into control and nitrofen-exposed specimens. Gene expression levels of Ndst1 and Slit3 were assessed using qRT-PCR. Immunofluorescence-double-staining for Ndst1 and Slit3 was performed to evaluate protein expression and localization. Relative mRNA expression of Ndst1 and Slit3 was significantly decreased in pleuroperitoneal folds (D13), developing diaphragms (D15) and fully muscularized diaphragms (D18) of nitrofen-exposed fetuses compared to controls. Confocal-laser-scanning-microscopy revealed markedly diminished Ndst1 and Slit3 expression in endothelial cells within the diaphragmatic vasculature on D13, D15 and D18 compared to controls. Down-regulation of Ndst1 signaling in the developing diaphragm may impair endothelial cell migration and angiogenesis, thus leading to defective diaphragmatic vascular development and CDH. Ib. Copyright © 2017 Elsevier Inc. All rights reserved.

Hepcidin suppression in β-thalassemia is associated with the down-regulation of atonal homolog 8.

PubMed

Upanan, Supranee; McKie, Andrew T; Latunde-Dada, Gladys O; Roytrakul, Sittiruk; Uthaipibull, Chairat; Pothacharoen, Peraphan; Kongtawelert, Prachya; Fucharoen, Suthat; Srichairatanakool, Somdet

2017-08-01

Atonal homolog 8 (ATOH8) is defined as a positive regulator of hepcidin transcription, which links erythropoietic activity with iron-sensing molecules. In the present study, we investigated the association between hepcidin and ATOH8 expression in β-thalassemia. We found that inhibition of hepcidin expression in β-thalassemia is correlated with reduced ATOH8 expression. Hepatic hepcidin 1 (Hamp1) and Atoh8 mRNA expression were down-regulated in β-thalassemic mice. Hepcidin (HAMP) and ATOH8 mRNA expression were consistently suppressed in Huh7 cells cultured in medium supplemented with β-thalassemia patient serum. The Huh7 cells, which were transfected with ATOH8-FLAG expression plasmid and cultured in the supplemented medium, exhibited increased levels of ATOH8 mRNA, ATOH8-FLAG protein, pSMAD1,5,8, and HAMP mRNA. Interestingly, over-expression of ATOH8 reversed the effects of hepcidin suppression induced by the β-thalassemia patient sera. In conclusion, hepcidin suppression in β-thalassemia is associated with the down-regulation of ATOH8 in response to anemia. We, therefore, suggest that ATOH8 is an important transcriptional regulator of hepcidin in β-thalassemia.

Transcriptional responses of Arabidopsis thaliana to chewing and sucking insect herbivores

DOE PAGES

Appel, Heidi M.; Fescemyer, Howard; Ehlting, Juergen; ...

2014-11-14

We tested the hypothesis that Arabidopsis can recognize and respond differentially to insect species at the transcriptional level using a genome wide microarray. Transcriptional reprogramming was characterized using co-expression analysis in damaged and undamaged leaves at two times in response to mechanical wounding and four insect species. In all, 2778 (10.6%) of annotated genes on the array were differentially expressed in at least one treatment. Responses differed mainly between aphid and caterpillar and sampling times. Responses to aphids and caterpillars shared only 10% of up-regulated and 8% of down-regulated genes. Responses to two caterpillars shared 21 and 12% of up-more » and down-regulated genes, whereas responses to the two aphids shared only 7 and 4% of up-regulated and down-regulated genes. Overlap in genes expressed between 6 and 24 h was 3–15%, and depended on the insect species. Responses in attacked and unattacked leaves differed at 6 h but converged by 24 h. Genes responding to the insects are also responsive to many stressors and included primary metabolism. Aphids down-regulated amino acid catabolism; caterpillars stimulated production of amino acids involved in glucosinolate synthesis. Co-expression analysis revealed 17 response networks. Transcription factors were a major portion of differentially expressed genes throughout and responsive genes shared most of the known or postulated binding sites. However, cis-element composition of genes down regulated by the aphid M. persicae was unique, as were those of genes down-regulated by caterpillars. As many as 20 cis-elements were over-represented in one or more treatments, including some from well-characterized classes and others as yet uncharacterized. We suggest that transcriptional changes elicited by wounding and insects are heavily influenced by transcription factors and involve both enrichment of a common set of cis-elements and a unique enrichment of a few cis-elements in responding genes.« less

Transcriptional responses of Arabidopsis thaliana to chewing and sucking insect herbivores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Appel, Heidi M.; Fescemyer, Howard; Ehlting, Juergen

We tested the hypothesis that Arabidopsis can recognize and respond differentially to insect species at the transcriptional level using a genome wide microarray. Transcriptional reprogramming was characterized using co-expression analysis in damaged and undamaged leaves at two times in response to mechanical wounding and four insect species. In all, 2778 (10.6%) of annotated genes on the array were differentially expressed in at least one treatment. Responses differed mainly between aphid and caterpillar and sampling times. Responses to aphids and caterpillars shared only 10% of up-regulated and 8% of down-regulated genes. Responses to two caterpillars shared 21 and 12% of up-more » and down-regulated genes, whereas responses to the two aphids shared only 7 and 4% of up-regulated and down-regulated genes. Overlap in genes expressed between 6 and 24 h was 3–15%, and depended on the insect species. Responses in attacked and unattacked leaves differed at 6 h but converged by 24 h. Genes responding to the insects are also responsive to many stressors and included primary metabolism. Aphids down-regulated amino acid catabolism; caterpillars stimulated production of amino acids involved in glucosinolate synthesis. Co-expression analysis revealed 17 response networks. Transcription factors were a major portion of differentially expressed genes throughout and responsive genes shared most of the known or postulated binding sites. However, cis-element composition of genes down regulated by the aphid M. persicae was unique, as were those of genes down-regulated by caterpillars. As many as 20 cis-elements were over-represented in one or more treatments, including some from well-characterized classes and others as yet uncharacterized. We suggest that transcriptional changes elicited by wounding and insects are heavily influenced by transcription factors and involve both enrichment of a common set of cis-elements and a unique enrichment of a few cis-elements in responding genes.« less

miR-137 regulates the constitutive androstane receptor and modulates doxorubicin sensitivity in parental and doxorubicin-resistant neuroblastoma cells

PubMed Central

Takwi, Apana A; Wang, Yue-Ming; Wu, Jing; Michaelis, Martin; Cinatl, Jindrich; Chen, Taosheng

2013-01-01

Chemotherapy is the most common treatment for cancer. However, multidrug resistance (MDR) remains a major obstacle to effective chemotherapy, limiting the efficacy of both conventional chemotherapeutic and novel biologic agents. The constitutive androstane receptor (CAR), a xenosensor, is a key regulator of MDR. It functions in xenobiotic detoxification by regulating the expression of phase I drug metabolizing enzymes and ATP-binding cassette (ABC) transporters, whose overexpression in cancers and whose role in drug resistance make them potential therapeutic targets for reducing MDR. MicroRNAs (miRNAs) are endogenous negative regulators of gene expression and have been implicated in most cellular processes, including drug resistance. Here we report the inversely related expression of miR-137 and CAR in parental and doxorubicin-resistant neuroblastoma cells, wherein miR-137 is down-regulated in resistant cells. miR-137 over-expression resulted in down-regulation of CAR protein and mRNA (via mRNA degradation); it sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and increased G2-phase cell cycle arrest) and reduced the in vivo growth rate of neuroblastoma xenografts. We observed similar results in cellular models of hepatocellular and colon cancers, indicating that the doxorubicin-sensitizing effect of miR-137 is not tumor type-specific. Finally, we show for the first time a negative feedback loop whereby miR-137 down-regulates CAR expression and CAR down-regulates miR-137 expression. Hypermethylation of the miR-137 promoter and negative regulation of miR-137 by CAR contribute in part to reduced miR-137 expression and increased CAR and MDR1 expression in doxorubicin-resistant neuroblastoma cells. These findings demonstrate that miR-137 is a crucial regulator of cancer response to doxorubicin treatment, and they identify miR-137 as a highly promising target to reduce CAR-driven doxorubicin resistance. PMID:23934188

Transcriptomic Profiling Analysis of Arabidopsis thaliana Treated with Exogenous Myo-Inositol

PubMed Central

Ye, Wenxing; Ren, Weibo; Kong, Lingqi; Zhang, Wanjun; Wang, Tao

2016-01-01

Myo-insositol (MI) is a crucial substance in the growth and developmental processes in plants. It is commonly added to the culture medium to promote adventitious shoot development. In our previous work, MI was found in influencing Agrobacterium-mediated transformation. In this report, a high-throughput RNA sequencing technique (RNA-Seq) was used to investigate differently expressed genes in one-month-old Arabidopsis seedling grown on MI free or MI supplemented culture medium. The results showed that 21,288 and 21,299 genes were detected with and without MI treatment, respectively. The detected genes included 184 new genes that were not annotated in the Arabidopsis thaliana reference genome. Additionally, 183 differentially expressed genes were identified (DEGs, FDR ≤0.05, log2 FC≥1), including 93 up-regulated genes and 90 down-regulated genes. The DEGs were involved in multiple pathways, such as cell wall biosynthesis, biotic and abiotic stress response, chromosome modification, and substrate transportation. Some significantly differently expressed genes provided us with valuable information for exploring the functions of exogenous MI. RNA-Seq results showed that exogenous MI could alter gene expression and signaling transduction in plant cells. These results provided a systematic understanding of the functions of exogenous MI in detail and provided a foundation for future studies. PMID:27603208

Cortex and hippocampus DNA epigenetic response to a long-term arsenic exposure via drinking water.

PubMed

Du, Xiaoyan; Tian, Meiping; Wang, Xiaoxue; Zhang, Jie; Huang, Qingyu; Liu, Liangpo; Shen, Heqing

2018-03-01

The neurotoxicity of arsenic is a serious health problem, especially for children. DNA epigenetic change may be an important pathogenic mechanism, but the molecular pathway remains obscure. In this study, the weaned male Sprague-Dawly (SD) rats were treated with arsenic trioxide via drinking water for 6 months, simulating real developmental exposure situation of children. Arsenic exposure impaired the cognitive abilities, and altered the expression of neuronal activity-regulated genes. Total arsenic concentrations of cortex and hippocampus tissues were significantly increased in a dose-dependent manner. The reduction in 5-methylcytosine (5 mC) and 5-hydroxymethylcytosine (5hmC) levels as well as the down-regulation of DNA methyltransferases (DNMTs) and ten-eleven translocations (TETs) expression suggested that DNA methylation/demethylation processes were significantly suppressed in brain tissues. S-adenosylmethionine (SAM) level wasn't changed, but the expression of the important indicators of oxidative/anti-oxidative balance and tricarboxylic acid (TCA) cycle was significantly deregulated. Overall, arsenic can disrupt oxidative/anti-oxidative balance, further inhibit TETs expression through TCA cycle and alpha-ketoglutarate (α-KG) pathway, and consequently cause DNA methylation/demethylation disruption. The present study implies oxidative stress but not SAM depletion may lead to DNA epigenetic alteration and arsenic neurotoxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Developmental Intestinal Regulator ELT-2 Controls p38-Dependent Immune Responses in Adult C. elegans

PubMed Central

Block, Dena H. S.; Twumasi-Boateng, Kwame; Kang, Hae Sung; Carlisle, Jolie A.; Hanganu, Alexandru; Lai, Ty Yu-Jen; Shapira, Michael

2015-01-01

GATA transcription factors play critical roles in cellular differentiation and development. However, their roles in mature tissues are less understood. In C. elegans larvae, the transcription factor ELT-2 regulates terminal differentiation of the intestine. It is also expressed in the adult intestine, where it was suggested to maintain intestinal structure and function, and where it was additionally shown to contribute to infection resistance. To study the function of elt-2 in adults we characterized elt-2-dependent gene expression following its knock-down specifically in adults. Microarray analysis identified two ELT-2-regulated gene subsets: one, enriched for hydrolytic enzymes, pointed at regulation of constitutive digestive functions as a dominant role of adult elt-2; the second was enriched for immune genes that are induced in response to Pseudomonas aeruginosa infection. Focusing on the latter, we used genetic analyses coupled to survival assays and quantitative RT-PCR to interrogate the mechanism(s) through which elt-2 contributes to immunity. We show that elt-2 controls p38-dependent gene induction, cooperating with two p38-activated transcription factors, ATF-7 and SKN-1. This demonstrates a mechanism through which the constitutively nuclear elt-2 can impact induced responses, and play a dominant role in C. elegans immunity. PMID:26016853

Eupafolin enhances TRAIL-mediated apoptosis through cathepsin S-induced down-regulation of Mcl-1 expression and AMPK-mediated Bim up-regulation in renal carcinoma Caki cells.

PubMed

Han, Min Ae; Min, Kyoung-Jin; Woo, Seon Min; Seo, Bo Ram; Kwon, Taeg Kyu

2016-10-04

Eupafolin, a flavone found in Artemisia princeps, has been reported for its anti-tumor activity in several cancer cells. In this study, we examined whether eupafolin could sensitize TRAIL-mediated apoptosis in human renal carcinoma Caki cells. We found that eupafolin alone and TRAIL alone had no effect on apoptosis. However, combined treatment with eupafolin and TRAIL markedly induced apoptosis in human renal carcinoma (Caki) cells, glioma cells (U251MG), and prostate cancer cells (DU145), but not normal cells [mesangial cells (MC) and normal mouse kidney cells (TCMK-1)]. Eupafolin induced down-regulation of Mcl-1 expression at the post-translational levels in cathepsin S-dependent manner, and over-expression of Mcl-1 markedly blocked apoptosis induced by combined treatment with eupafolin and TRAIL. In addition, eupafolin increased Bim expression at the post-translational levels via AMP-activated protein kinase (AMPK)-mediated inhibition of proteasome activity. Knock-down of Bim expression by siRNA inhibited eupafolin plus TRAIL-induced apoptosis. Furthermore, combined treatment with eupafolin and TRAIL reduced tumor growth in xenograft models. Taken together, these results suggest that eupafolin enhanced TRAIL-mediated apoptosis via down-regulation of Mcl-1 and up-regulation of Bim in renal carcinoma Caki cells.

Eupafolin enhances TRAIL-mediated apoptosis through cathepsin S-induced down-regulation of Mcl-1 expression and AMPK-mediated Bim up-regulation in renal carcinoma Caki cells

PubMed Central

Woo, Seon Min; Seo, Bo Ram; Kwon, Taeg Kyu

2016-01-01

Eupafolin, a flavone found in Artemisia princeps, has been reported for its anti-tumor activity in several cancer cells. In this study, we examined whether eupafolin could sensitize TRAIL-mediated apoptosis in human renal carcinoma Caki cells. We found that eupafolin alone and TRAIL alone had no effect on apoptosis. However, combined treatment with eupafolin and TRAIL markedly induced apoptosis in human renal carcinoma (Caki) cells, glioma cells (U251MG), and prostate cancer cells (DU145), but not normal cells [mesangial cells (MC) and normal mouse kidney cells (TCMK-1)]. Eupafolin induced down-regulation of Mcl-1 expression at the post-translational levels in cathepsin S-dependent manner, and over-expression of Mcl-1 markedly blocked apoptosis induced by combined treatment with eupafolin and TRAIL. In addition, eupafolin increased Bim expression at the post-translational levels via AMP-activated protein kinase (AMPK)-mediated inhibition of proteasome activity. Knock-down of Bim expression by siRNA inhibited eupafolin plus TRAIL-induced apoptosis. Furthermore, combined treatment with eupafolin and TRAIL reduced tumor growth in xenograft models. Taken together, these results suggest that eupafolin enhanced TRAIL-mediated apoptosis via down-regulation of Mcl-1 and up-regulation of Bim in renal carcinoma Caki cells. PMID:27582546

SKP2 siRNA inhibits the degradation of P27kip1 and down-regulates the expression of MRP in HL-60/A cells.

PubMed

Xiao, Jie; Yin, Songmei; Li, Yiqing; Xie, Shuangfeng; Nie, Danian; Ma, Liping; Wang, Xiuju; Wu, Yudan; Feng, Jianhong

2009-08-01

S-phase kinase-associated protein 2 (SKP2) gene is a tumor suppressor gene, and is involved in the ubiquitin-mediated degradation of P27kip1. SKP2 and P27kip1 affect the proceeding and prognosis of leukemia through regulating the proliferation, apoptosis and differentiation of leukemia cells. In this study, we explored the mechanism of reversing of HL-60/A drug resistance through SKP2 down-regulation. HL-60/A cells were nucleofected by Amaxa Nucleofector System with SKP2 siRNA. The gene and protein expression levels of Skp2, P27kip1, and multi-drug resistance associated protein (MRP) were determined by reverse transcription-polymerase chain reaction and western blot analysis, respectively. The cell cycle was analyzed by flow cytometry. The 50% inhibitory concentration value was calculated using cytotoxic analysis according to the death rate of these two kinds of cells under different concentrations of chemotherapeutics to compare the sensitivity of the cells. HL-60/A cells showed multi-drug resistance phenotype characteristic by cross-resistance to adriamycin, daunorubicin, and arabinosylcytosine, due to the expression of MRP. We found that the expression of SKP2 was higher in HL-60/A cells than in HL-60 cells, but the expression of P27kip1 was lower. The expression of SKP2 in HL-60/A cells nucleofected by SKP2 siRNA was down-regulated whereas the protein level of P27kip1 was up-regulated. Compared with the MRP expression level in the control group (nucleofected by control siRNA), the mRNA and protein expression levels of MRP in HL-60/A cells nucleofected by SKP2 siRNA were lower, and the latter cells were more sensitive to adriamycin, daunorubicin, and arabinosylcytosine. Down-regulating the SKP2 expression and arresting cells in the G0/G1 phase improve drug sensitivity of leukemia cells with down-regulated MRP expression.

Embryonic exposure to carbendazim induces the transcription of genes related to apoptosis, immunotoxicity and endocrine disruption in zebrafish (Danio rerio).

PubMed

Jiang, Jinhua; Wu, Shenggan; Wu, Changxing; An, Xuehua; Cai, Leiming; Zhao, Xueping

2014-12-01

Carbendazim is one of the most widespread environmental contaminant that can cause major concern to human and animal reproductive system. To date, very few studies have been conducted on the toxic effect of carbendazim in the non-target organism zebrafish (Danio rerio). The study presented here aimed to assess how carbendazim triggers apoptosis, immunotoxicity and endocrine disruption pathways in zebrafish during its embryo development. Our results demonstrated that the expression patterns of many key genes involved in cell apoptosis pathway (e.g. P53, Mdm2, Bbc3 and Cas8) were significantly up-regulated upon the exposure to carbendazim at the concentration of 500 μg/L, while the Bcl2 and Cas3 were down-regulated at the same concentration, interestingly, the expression level of Ogg1 decreased at all the exposure concentrations. It was also observed that the mRNA levels of CXCL-C1C, CCL1, IL-1b and TNFα which were closely related to the innate immune system, were affected in newly hatched zebrafish after exposed to different concentrations of carbendazim. Moreover, the expression of genes that are involved in the hypothalamic-pituitary-gonadal/thyroid (HPG/HPT) axis including VTG, ERα, ERβ2, Dio1, Dio2, Thraa and Thrb were all down-regulated significantly after the exposure to carbendazim. The expression levels of two cytochrome P450 aromatases CYP19a and CYP19b were increased significantly after 20 and 100 μg/L carbendazim exposure, respectively. Taken together, our results indicated that carbendazim had the potential to induce cell apoptosis and cause immune toxicity as well as endocrine disruption in zebrafish during the embryo developmental stage. The information presented here also help to elucidate the environmental risks caused by the carbendazim-induced toxicity in aquatic organisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

The PBDE metabolite 6-OH-BDE 47 affects melanin pigmentation and THRβ MRNA expression in the eye of zebrafish embryos

PubMed Central

Dong, Wu; Macaulay, Laura J; Kwok, Kevin WH; Hinton, David E; Ferguson, P Lee; Stapleton, Heather M

2015-01-01

Polybrominated diphenyl ethers and their hydroxyl-metabolites (OH-BDEs) are commonly detected contaminants in human serum in the US population. They are also considered to be endocrine disruptors, and are specifically known to affect thyroid hormone regulation. In this study, we investigated and compared the effects of a PBDE and its OH-BDE metabolite on developmental pathways regulated by thyroid hormones using zebrafish as a model. Exposure to 6-OHBDE 47 (10–100 nM), but not BDE 47 (1–50 μM), led to decreased melanin pigmentation and increased apoptosis in the retina of zebrafish embryos in a concentration-dependent manner in short-term exposures (4 – 30 hours). Six-OH-BDE 47 exposure also significantly decreased thyroid hormone receptor β (THRβ) mRNA expression, which was confirmed using both RT-PCR and in situ hybridization (whole mount and paraffin- section). Interestingly, exposure to the native thyroid hormone, triiodothyronine (T3) also led to similar responses: decreased THRβ mRNA expression, decreased melanin pigmentation and increased apoptosis, suggesting that 6-OH-BDE 47 may be acting as a T3 mimic. To further investigate short-term effects that may be regulated by THRβ, experiments using a morpholino gene knock down and THRβ mRNA over expression were conducted. Knock down of THRβ led to decreases in melanin pigmentation and increases in apoptotic cells in the eye of zebrafish embryos, similar to exposure to T3 and 6-OH-BDE 47, but THRβ mRNA overexpression rescued these effects. Histological analysis of eyes at 22 hpf from each group revealed that exposure to T3 or to 6-OH-BDE 47 was associated with a decrease of melanin and diminished proliferation of cells in layers of retina near the choroid. This study suggests that 6-OH-BDE 47 disrupts the activity of THRβ in early life stages of zebrafish, and warrants further studies on effects in developing humans. PMID:25767823

3,6-dihydroxyflavone suppresses the epithelial-mesenchymal transition in breast cancer cells by inhibiting the Notch signaling pathway.

PubMed

Chen, Junli; Chang, Hui; Peng, Xiaoli; Gu, Yeyun; Yi, Long; Zhang, Qianyong; Zhu, Jundong; Mi, Mantian

2016-06-27

The epithelial to mesenchymal transition (EMT) is a critical developmental program in cancer stem cell (CSC) maintenance and in cancer metastasis. Here, our study found that 3,6-DHF could effectively inhibit EMT in BC cells in vitro and in vivo. 3,6-DHF effectively inhibits the formation and proliferation of BCSCs, and consequently reduces the tumor-initiating capacity of tumor cells in NOD/SCID mice. Optical in vivo imaging of cancer metastasis showed that 3,6-DHF administration suppresses the lung metastasis of BC cells in vivo. Further studies indicated that 3,6-DHF down-regulates Notch1, NICD, Hes-1 and c-Myc, consequently decreasing the formation of the functional transcriptional unit of NICD-CSL-MAML, causing Notch signaling inactivation in BC cells. Over-expression of Notch1 or inhibition of miR-34a significantly reduced the inhibitory effects of 3,6-DHF on EMT, CSCs, as well as cells migration and invasion in BC cells. These data indicated that 3,6-DHF effectively inhibits EMT and CSCs, as well as cells migration and invasion in BC cells, in which miR-34a-mediated Notch1 down-regulation plays a crucial role.

Suppression of Akt/Foxp3-mediated miR-183 expression blocks Sp1-mediated ADAM17 expression and TNFα-mediated NFκB activation in piceatannol-treated human leukemia U937 cells.

PubMed

Liu, Wen-Hsin; Chang, Long-Sen

2012-09-01

To address the mechanism of piceatannol in inhibiting TNFα-mediated pathway, studies on piceatannol-treated human leukemia U937 cells were conducted. Piceatannol treatment reduced TNFα shedding and NFκB activation and decreased the release of soluble TNFα into the culture medium of U937 cells. Moreover, ADAM17 expression was down-regulated in piceatannol-treated cells. Over-expression of ADAM17 abrogated the ability of piceatannol to suppress TNFα-mediated NFκB activation. Piceatannol-evoked β-TrCP up-regulation promoted Sp1 degradation, thus reducing transcriptional level of ADAM17 gene in U937 cells. Piceatannol treatment induced p38 MAPK phosphorylation but inactivation of Akt and ERK. In contrast to p38 MAPK inhibitor or restoration of ERK activation, transfection of constitutive active Akt abolished the effect of piceatannol on β-TrCP, Sp1 and ADAM17 expression. Piceatannol-elicited down-regulation of miR-183 expression was found to cause β-TrCP up-regulation. Inactivation of Akt resulted in Foxp3 down-regulation and reduced miR-183 expression in piceatannol-treated cells. Knock-down of Foxp3 and chromatin immunoprecipitating revealed that Foxp3 genetically regulated transcription of miR-183 gene. Taken together, our data indicate that suppression of Akt/Foxp3-mediated miR-183 expression blocks Sp1-mediated ADAM17 expression in piceatannol-treated U937 cells. Consequently, piceatannol suppresses TNFα shedding, leading to inhibition of TNFα/NFκB pathway. Copyright © 2012 Elsevier Inc. All rights reserved.

MicroRNA-9 up-regulates E-cadherin through inhibition of NF-κB1-Snail1 pathway in melanoma.

PubMed

Liu, Shujing; Kumar, Suresh M; Lu, Hezhe; Liu, Aihua; Yang, Ruifeng; Pushparajan, Anitha; Guo, Wei; Xu, Xiaowei

2012-01-01

MicroRNAs (miRNAs) are short non-coding RNAs that post-transcriptionally regulate gene expression. Hsa-miR-9 has been shown to have opposite functions in different tumour types; however, the underlying mechanism is unclear. Here we show that hsa-miR-9 is down-regulated in metastatic melanomas compared to primary melanomas. Overexpression of miR-9 in melanoma cells resulted in significantly decreased cell proliferation and migratory capacity with decreased F-actin polymerization and down-regulation of multiple GTPases involved in cytoskeleton remodelling. miR-9 overexpression induced significant down-regulation of Snail1 with a concomitant increase in E-cadherin expression. In contrast, knockdown of miR-9 increased Snail1 expression as well as melanoma cell proliferation and migration capacity. Mechanistically, miR-9 expression down-regulated NF-κB1 in melanoma and the effect was abolished by mutations in the putative miR-9 binding sites within the 3'-untranslated region (UTR) of NF-κB1. Anti-miR-9 miRNA inhibitor also increased the expression of NF-κB1. The effects of miR-9 on Snail1 expression and melanoma cell proliferation and migration were rescued by overexpression of NF-κB1 in these cells. Furthermore, miR-9 overexpression resulted in significantly decreased melanoma growth and metastasis in vivo. In summary, miR-9 inhibits melanoma proliferation and metastasis through down-regulation of the NF-κB1-Snail1 pathway. This study finds a new mechanism that miR-9 utilizes to decrease E-cadherin expression and inhibit melanoma progression. The results suggest that function of microRNAs is context and tumour type-specific. Copyright © 2011 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Altered gene expression in tree shrew retina and retinal pigment epithelium produced by short periods of minus-lens wear.

PubMed

He, Li; Frost, Michael R; Siegwart, John T; Norton, Thomas T

2018-03-01

Hyperopic refractive error is detected by retinal neurons, which generate GO signals through a direct emmetropization signaling cascade: retinal pigment epithelium (RPE) into choroid and then into sclera, thereby increasing axial elongation. To examine signaling early in this cascade, we measured gene expression in the retina and RPE after short exposure to hyperopia produced by minus-lens wear. Gene expression in each tissue was compared with gene expression in combined retina + RPE. Starting 24 days after normal eye opening, three groups of juvenile tree shrews (n = 7 each) wore a monocular -5 D lens. The untreated fellow eye served as a control. The "6h" group wore the lens for 6 h; the "24h" group wore the lens for 24 h; each group provided separate retina and RPE tissues. Group "24hC" wore the lens for 24 h and provided combined retina + RPE tissue. Quantitative PCR was used to measure the relative differences (treated eye vs. control eye) in mRNA levels for 66 candidate genes. In the retina after 6 h, mRNA levels for seven genes were significantly regulated: EGR1 and FOS (early intermediate genes) were down-regulated in the treated eyes. Genes with secreted protein products, BMP2 and CTGF, were down-regulated, whilst FGF10, IL18, and SST were up-regulated. After 24 h the pattern changed; only one of the seven genes still showed differential expression; BMP2 was still down-regulated. Two new genes with secreted protein products, IGF2 and VIP, were up-regulated. In the RPE, consistent with its role in receiving, processing, and transmitting GO signaling, differential expression was found for genes whose protein products are at the cell surface, intracellular, in the nucleus, and are secreted. After 6 h, mRNA levels for 17 genes were down-regulated in the treated eyes, whilst four genes (GJA1, IGF2R, LRP2, and IL18) were up-regulated. After 24 h the pattern was similar; mRNA levels for 14 of the same genes were still down-regulated; only LRP2 remained up-regulated. mRNA levels for six genes no longer showed differential expression, whilst nine genes, not differentially expressed at 6 h, now showed differential expression. In the combined retina + RPE after 24 h, mRNA levels for only seven genes were differentially regulated despite the differential expression of many genes in the RPE. Four genes showed the same expression in combined tissue as in retina alone, including up-regulation of VIP despite significant VIP down-regulation in RPE. Thus, hyperopia-induced GO signaling, as measured by differential gene expression, differs in the retina and the RPE. Retinal gene expression changed between 6 h and 24 h of treatment, suggesting evolution of the retinal response. Gene expression in the RPE was similar at both time points, suggesting sustained signaling. The combined retina + RPE does not accurately represent gene expression in either retina or, especially, RPE. When gene expression signatures were compared with those in choroid and sclera, GO signaling, as encoded by differential gene expression, differs in each compartment of the direct emmetropization signaling cascade. Copyright © 2018 Elsevier Ltd. All rights reserved.

Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry Fragaria vesca

PubMed Central

Wei, Wei; Hu, Yang; Cui, Meng-Yuan; Han, Yong-Tao; Gao, Kuan; Feng, Jia-Yue

2016-01-01

Plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, and PROLIFERATING CELL FACTORS (TCP) transcription factors play versatile functions in multiple processes of plant growth and development. However, no systematic study has been performed in strawberry. In this study, 19 FvTCP genes were identified in the diploid woodland strawberry (Fragaria vesca) accession Heilongjiang-3. Phylogenetic analysis suggested that the FvTCP genes were classified into two main classes, with the second class further divided into two subclasses, which was supported by the exon-intron organizations and the conserved motif structures. Promoter analysis revealed various cis-acting elements related to growth and development, hormone and/or stress responses. We analyzed FvTCP gene transcript accumulation patterns in different tissues and fruit developmental stages. Among them, 12 FvTCP genes exhibited distinct tissue-specific transcript accumulation patterns. Eleven FvTCP genes were down-regulated in different fruit developmental stages, while five FvTCP genes were up-regulated. Transcripts of FvTCP genes also varied with different subcultural propagation periods and were induced by hormone treatments and biotic and abiotic stresses. Subcellular localization analysis showed that six FvTCP-GFP fusion proteins showed distinct localizations in Arabidopsis mesophyll protoplasts. Notably, transient over-expression of FvTCP9 in strawberry fruits dramatically affected the expression of a series of genes implicated in fruit development and ripening. Taken together, the present study may provide the basis for functional studies to reveal the role of this gene family in strawberry growth and development. PMID:28066489

Down-regulation of Wild-type p53-induced Phosphatase 1 (Wip1) Plays a Critical Role in Regulating Several p53-dependent Functions in Premature Senescent Tumor Cells*

PubMed Central

Crescenzi, Elvira; Raia, Zelinda; Pacifico, Francesco; Mellone, Stefano; Moscato, Fortunato; Palumbo, Giuseppe; Leonardi, Antonio

2013-01-01

Premature or drug-induced senescence is a major cellular response to chemotherapy in solid tumors. The senescent phenotype develops slowly and is associated with chronic DNA damage response. We found that expression of wild-type p53-induced phosphatase 1 (Wip1) is markedly down-regulated during persistent DNA damage and after drug release during the acquisition of the senescent phenotype in carcinoma cells. We demonstrate that down-regulation of Wip1 is required for maintenance of permanent G2 arrest. In fact, we show that forced expression of Wip1 in premature senescent tumor cells induces inappropriate re-initiation of mitosis, uncontrolled polyploid progression, and cell death by mitotic failure. Most of the effects of Wip1 may be attributed to its ability to dephosphorylate p53 at Ser15 and to inhibit DNA damage response. However, we also uncover a regulatory pathway whereby suppression of p53 Ser15 phosphorylation is associated with enhanced phosphorylation at Ser46, increased p53 protein levels, and induction of Noxa expression. On the whole, our data indicate that down-regulation of Wip1 expression during premature senescence plays a pivotal role in regulating several p53-dependent aspects of the senescent phenotype. PMID:23612976

Thiols decrease cytokine levels and down-regulate the expression of CD30 on human allergen-specific T helper (Th) 0 and Th2 cells

PubMed Central

Bengtsson, Å; Lundberg, M; Avila-Cariño, J; Jacobsson, G; Holmgren, A; Scheynius, A

2001-01-01

The thiol antioxidant N-acetyl-l-cysteine (NAC), known as a precursor of glutathione (GSH), is used in AIDS treatment trials, as a chemoprotectant in cancer chemotherapy and in treatment of chronic bronchitis. In vitro, GSH and NAC are known to enhance T cell proliferation, production of IL-2 and up-regulation of the IL-2 receptor. The 120-kD CD30 surface antigen belongs to the tumour necrosis factor (TNF) receptor superfamily. It is expressed by activated T helper (Th) cells and its expression is sustained in Th2 cells. We have analysed the effect of GSH and NAC on the cytokine profile and CD30 expression on human allergen-specific T cell clones (TCC). TCC were stimulated with anti-CD3 antibodies in the presence of different concentrations of GSH and NAC. Both thiols caused a dose dependent down-regulation of IL-4, IL-5 and IFN-γ levels in Th0 and Th2 clones, with the most pronounced decrease of IL-4. Furthermore, they down-regulated the surface expression of CD30, and the levels of soluble CD30 (sCD30) in the culture supernatants were decreased. In contrast, the surface expression of CD28 or CD40 ligand (CD40L) was not significantly changed after treatment with 20 mm NAC. These results indicate that GSH and NAC favour a Th1 response by a preferential down-regulation of IL-4. In addition, the expression of CD30 was down regulated by GSH and NAC, suggesting that CD30 expression is dependent on IL-4, or modified by NAC. In the likely event that CD30 and its soluble counterpart prove to contribute to the pathogenesis in Th2 related diseases such as allergy, NAC may be considered as a future therapeutic agent in the treatment of these diseases. PMID:11298119

Ethanol extracts of black pepper or turmeric down-regulated SIRT1 protein expression in Daudi culture cells.

PubMed

Nishimura, Yuri; Kitagishi, Yasuko; Yoshida, Hitomi; Okumura, Naoko; Matsuda, Satoru

2011-01-01

SIRT1 is a mammalian candidate molecule involved in longevity and diverse metabolic processes. The present study aimed to determine the effects of certain herbs and spices on SIRT1 expression. Human cell lines Daudi, Jurkat, U937 and K562 were cultured in RPMI-1640. Herb and spice powders were prepared and the supernatants were collected. RT-PCR was used to quantify the expression level of the gene. Protein samples were then analyzed by Western blotting. Western blotting revealed the down-regulation of SIRT1 protein expression in Daudi cells treated with extracts of black pepper or turmeric. On the other hand, the effect on the SIRT1 gene expression examined by reverse transcription polymerase chain reaction was unaltered. In conclusion, component(s) of certain herbs and spices may induce the down-regulation of SIRT1 protein.

Identification of vimentin- and elastin-like transcripts specifically expressed in developing notochord of Atlantic salmon (Salmo salar L.).

PubMed

Sagstad, Anita; Grotmol, Sindre; Kryvi, Harald; Krossøy, Christel; Totland, Geir K; Malde, Ketil; Wang, Shou; Hansen, Tom; Wargelius, Anna

2011-11-01

The notochord functions as the midline structural element of all vertebrate embryos, and allows movement and growth at early developmental stages. Moreover, during embryonic development, notochord cells produce secreted factors that provide positional and fate information to a broad variety of cells within adjacent tissues, for instance those of the vertebrae, central nervous system and somites. Due to the large size of the embryo, the salmon notochord is useful to study as a model for exploring notochord development. To investigate factors that might be involved in notochord development, a normalized cDNA library was constructed from a mix of notochords from ∼500 to ∼800 day°. From the 1968 Sanger-sequenced transcripts, 22 genes were identified to be predominantly expressed in the notochord compared to other organs of salmon. Twelve of these genes were found to show expressional regulation around mineralization of the notochord sheath; 11 genes were up-regulated and one gene was down-regulated. Two genes were found to be specifically expressed in the notochord; these genes showed similarity to vimentin (acc. no GT297094) and elastin (acc. no GT297478). In-situ results showed that the vimentin- like transcript was expressed in both chordocytes and chordoblasts, whereas the elastin- like transcript was uniquely expressed in the chordoblasts lining the notochordal sheath. In salmon aquaculture, vertebral deformities are a common problem, and some malformations have been linked to the notochord. The expression of identified transcripts provides further insight into processes taking place in the developing notochord, prior to and during the early mineralization period.

SEL1L Regulates Adhesion, Proliferation and Secretion of Insulin by Affecting Integrin Signaling

PubMed Central

Diaferia, Giuseppe R.; Cirulli, Vincenzo; Biunno, Ida

2013-01-01

SEL1L, a component of the endoplasmic reticulum associated degradation (ERAD) pathway, has been reported to regulate the (i) differentiation of the pancreatic endocrine and exocrine tissue during the second transition of mouse embryonic development, (ii) neural stem cell self-renewal and lineage commitment and (iii) cell cycle progression through regulation of genes related to cell-matrix interaction. Here we show that in the pancreas the expression of SEL1L is developmentally regulated, such that it is readily detected in developing islet cells and in nascent acinar clusters adjacent to basement membranes, and becomes progressively restricted to the islets of Langherans in post-natal life. This peculiar expression pattern and the presence of two inverse RGD motifs in the fibronectin type II domain of SEL1L protein indicate a possible interaction with cell adhesion molecules to regulate islets architecture. Co-immunoprecipitation studies revealed SEL1L and ß1-integrin interaction and, down-modulation of SEL1L in pancreatic ß-cells, negatively influences both cell adhesion on selected matrix components and cell proliferation likely due to altered ERK signaling. Furthermore, the absence of SEL1L protein strongly inhibits glucose-stimulated insulin secretion in isolated mouse pancreatic islets unveiling an important role of SEL1L in insulin trafficking. This phenotype can be rescued by the ectopic expression of the ß1-integrin subunit confirming the close interaction of these two proteins in regulating the cross-talk between extracellular matrix and insulin signalling to create a favourable micro-environment for ß-cell development and function. PMID:24324549

Inducible repression of multiple expansin genes leads to growth suppression during leaf development.

PubMed

Goh, Hoe-Han; Sloan, Jennifer; Dorca-Fornell, Carmen; Fleming, Andrew

2012-08-01

Expansins are cell wall proteins implicated in the control of plant growth via loosening of the extracellular matrix. They are encoded by a large gene family, and data linked to loss of single gene function to support a role of expansins in leaf growth remain limited. Here, we provide a quantitative growth analysis of transgenics containing an inducible artificial microRNA construct designed to down-regulate the expression of a number of expansin genes that an expression analysis indicated are expressed during the development of Arabidopsis (Arabidopsis thaliana) leaf 6. The results support the hypothesis that expansins are required for leaf growth and show that decreased expansin gene expression leads to a more marked repression of growth during the later stage of leaf development. In addition, a histological analysis of leaves in which expansin gene expression was suppressed indicates that, despite smaller leaves, mean cell size was increased. These data provide functional evidence for a role of expansins in leaf growth, indicate the importance of tissue/organ developmental context for the outcome of altered expansin gene expression, and highlight the separation of the outcome of expansin gene expression at the cellular and organ levels.

Regulatory states in the developmental control of gene expression.

PubMed

Peter, Isabelle S

2017-09-01

A growing body of evidence shows that gene expression in multicellular organisms is controlled by the combinatorial function of multiple transcription factors. This indicates that not the individual transcription factors or signaling molecules, but the combination of expressed regulatory molecules, the regulatory state, should be viewed as the functional unit in gene regulation. Here, I discuss the concept of the regulatory state and its proposed role in the genome-wide control of gene expression. Recent analyses of regulatory gene expression in sea urchin embryos have been instrumental for solving the genomic control of cell fate specification in this system. Some of the approaches that were used to determine the expression of regulatory states during sea urchin embryogenesis are reviewed. Significant developmental changes in regulatory state expression leading to the distinct specification of cell fates are regulated by gene regulatory network circuits. How these regulatory state transitions are encoded in the genome is illuminated using the sea urchin endoderm-mesoderms cell fate decision circuit as an example. These observations highlight the importance of considering developmental gene regulation, and the function of individual transcription factors, in the context of regulatory states. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Comprehensive analysis of lncRNAs microarray profile and mRNA-lncRNA co-expression in oncogenic HPV-positive cervical cancer cell lines.

PubMed

Yang, LingYun; Yi, Ke; Wang, HongJing; Zhao, YiQi; Xi, MingRong

2016-08-02

Long non-coding RNAs are emerging to be novel regulators in gene expression. In current study, lncRNAs microarray and lncRNA-mRNA co-expression analysis were performed to explore the alternation and function of lncRNAs in cervical cancer cells. We identified that 4750 lncRNAs (15.52%) were differentially expressed in SiHa (HPV-16 positive) (2127 up-regulated and 2623 down-regulated) compared with C-33A (HPV negative), while 5026 lncRNAs (16.43%) were differentially expressed in HeLa (HPV-18 positive) (2218 up-regulated and 2808 down-regulated) respectively. There were 5008 mRNAs differentially expressed in SiHa and 4993 in HeLa, which were all cataloged by GO terms and KEGG pathway. With the help of mRNA-lncRNA co-expression network, we found that ENST00000503812 was significantly negative correlated with RAD51B and IL-28A expression in SiHa, while ENST00000420168, ENST00000564977 and TCONS_00010232 had significant correlation with FOXQ1 and CASP3 expression in HeLa. Up-regulation of ENST00000503812 may inhibit RAD51B and IL-28A expression and result in deficiency of DNA repair pathway and immune responses in HPV-16 positive cervical cancer cell. Up-regulation of ENST00000420168, ENST00000564977 and down-regulation of TCONS_00010232 might stimulate FOXQ1 expression and suppress CASP3 expression in HPV-18 positive cervical cancer cell, which lead to HPV-induced proliferation and deficiency in apoptosis. These results indicate that changes of lncRNAs and related mRNAs might impact on several cellular pathways and involve in HPV-induced proliferation, which enriches our understanding of lncRNAs and coding transcripts anticipated in HPV oncogenesis of cervical cancer.

Spatial fluctuations in expression of the heterocyst differentiation regulatory gene hetR in Anabaena filaments.

PubMed

Corrales-Guerrero, Laura; Tal, Asaf; Arbel-Goren, Rinat; Mariscal, Vicente; Flores, Enrique; Herrero, Antonia; Stavans, Joel

2015-04-01

Under nitrogen deprivation, filaments of the cyanobacterium Anabaena undergo a process of development, resulting in a one-dimensional pattern of nitrogen-fixing heterocysts separated by about ten photosynthetic vegetative cells. Many aspects of gene expression before nitrogen deprivation and during the developmental process remain to be elucidated. Furthermore, the coupling of gene expression fluctuations between cells along a multicellular filament is unknown. We studied the statistics of fluctuations of gene expression of HetR, a transcription factor essential for heterocyst differentiation, both under steady-state growth in nitrogen-rich conditions and at different times following nitrogen deprivation, using a chromosomally-encoded translational hetR-gfp fusion. Statistical analysis of fluorescence at the individual cell level in wild-type and mutant filaments demonstrates that expression fluctuations of hetR in nearby cells are coupled, with a characteristic spatial range of circa two to three cells, setting the scale for cellular interactions along a filament. Correlations between cells predominantly arise from intercellular molecular transfer and less from cell division. Fluctuations after nitrogen step-down can build up on those under nitrogen-replete conditions. We found that under nitrogen-rich conditions, basal, steady-state expression of the HetR inhibitor PatS, cell-cell communication influenced by the septal protein SepJ and positive HetR auto-regulation are essential determinants of fluctuations in hetR expression and its distribution along filaments. A comparison between the expression of hetR-gfp under nitrogen-rich and nitrogen-poor conditions highlights the differences between the two HetR inhibitors PatS and HetN, as well as the differences in specificity between the septal proteins SepJ and FraC/FraD. Activation, inhibition and cell-cell communication lie at the heart of developmental processes. Our results show that proteins involved in these basic ingredients combine together in the presence of inevitable stochasticity in gene expression, to control the coupled fluctuations of gene expression that give rise to a one-dimensional developmental pattern in this organism.

Epigenomic Landscape of Human Fetal Brain, Heart, and Liver.

PubMed

Yan, Liying; Guo, Hongshan; Hu, Boqiang; Li, Rong; Yong, Jun; Zhao, Yangyu; Zhi, Xu; Fan, Xiaoying; Guo, Fan; Wang, Xiaoye; Wang, Wei; Wei, Yuan; Wang, Yan; Wen, Lu; Qiao, Jie; Tang, Fuchou

2016-02-26

The epigenetic regulation of spatiotemporal gene expression is crucial for human development. Here, we present whole-genome chromatin immunoprecipitation followed by high throughput DNA sequencing (ChIP-seq) analyses of a wide variety of histone markers in the brain, heart, and liver of early human embryos shortly after their formation. We identified 40,181 active enhancers, with a large portion showing tissue-specific and developmental stage-specific patterns, pointing to their roles in controlling the ordered spatiotemporal expression of the developmental genes in early human embryos. Moreover, using sequential ChIP-seq, we showed that all three organs have hundreds to thousands of bivalent domains that are marked by both H3K4me3 and H3K27me3, probably to keep the progenitor cells in these organs ready for immediate differentiation into diverse cell types during subsequent developmental processes. Our work illustrates the potentially critical roles of tissue-specific and developmental stage-specific epigenomes in regulating the spatiotemporal expression of developmental genes during early human embryonic development. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Endocrine regulation of predator-induced phenotypic plasticity.

PubMed

Dennis, Stuart R; LeBlanc, Gerald A; Beckerman, Andrew P

2014-11-01

Elucidating the developmental and genetic control of phenotypic plasticity remains a central agenda in evolutionary ecology. Here, we investigate the physiological regulation of phenotypic plasticity induced by another organism, specifically predator-induced phenotypic plasticity in the model ecological and evolutionary organism Daphnia pulex. Our research centres on using molecular tools to test among alternative mechanisms of developmental control tied to hormone titres, receptors and their timing in the life cycle. First, we synthesize detail about predator-induced defenses and the physiological regulation of arthropod somatic growth and morphology, leading to a clear prediction that morphological defences are regulated by juvenile hormone and life-history plasticity by ecdysone and juvenile hormone. We then show how a small network of genes can differentiate phenotype expression between the two primary developmental control pathways in arthropods: juvenoid and ecdysteroid hormone signalling. Then, by applying an experimental gradient of predation risk, we show dose-dependent gene expression linking predator-induced plasticity to the juvenoid hormone pathway. Our data support three conclusions: (1) the juvenoid signalling pathway regulates predator-induced phenotypic plasticity; (2) the hormone titre (ligand), rather than receptor, regulates predator-induced developmental plasticity; (3) evolution has favoured the harnessing of a major, highly conserved endocrine pathway in arthropod development to regulate the response to cues about changing environments (risk) from another organism (predator).

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

N-MYC down-regulated-like proteins regulate meristem initiation by modulating auxin transport and MAX2 expression.

PubMed

Mudgil, Yashwanti; Ghawana, Sanjay; Jones, Alan M

2013-01-01

N-MYC down-regulated-like (NDL) proteins interact with the Gβ subunit (AGB1) of the heterotrimeric G protein complex and play an important role in AGB1-dependent regulation of lateral root formation by affecting root auxin transport, auxin gradients and the steady-state levels of mRNA encoding the PIN-FORMED 2 and AUXIN 1 auxin transport facilitators. Auxin transport in aerial tissue follows different paths and utilizes different transporters than in roots; therefore, in the present study, we analyzed whether NDL proteins play an important role in AGB1-dependent, auxin-mediated meristem development. Expression levels of NDL gene family members need to be tightly regulated, and altered expression (both over-expression and down-regulation) confers ectopic growth. Over-expression of NDL1 disrupts vegetative and reproductive organ development. Reduced expression of the NDL gene family members results in asymmetric leaf emergence, twinning of rosette leaves, defects in leaf formation, and abnormal silique distribution. Reduced expression of the NDL genes in the agb1-2 (null allele) mutant rescues some of the abnormal phenotypes, such as silique morphology, silique distribution, and peduncle angle, suggesting that proper levels of NDL proteins are maintained by AGB1. We found that all of these abnormal aerial phenotypes due to altered NDL expression were associated with increases in basipetal auxin transport, altered auxin maxima and altered MAX2 expression within the inflorescence stem. NDL proteins, together with AGB1, act as positive regulators of meristem initiation and branching. AGB1 and NDL1 positively regulate basipetal inflorescence auxin transport and modulate MAX2 expression in shoots, which in turn regulates organ and lateral meristem formation by the establishment and maintenance of auxin gradients.

N-MYC DOWN-REGULATED-LIKE Proteins Regulate Meristem Initiation by Modulating Auxin Transport and MAX2 Expression

PubMed Central

Mudgil, Yashwanti; Ghawana, Sanjay; Jones, Alan M.

2013-01-01

Background N-MYC DOWN-REGULATED-LIKE (NDL) proteins interact with the Gβ subunit (AGB1) of the heterotrimeric G protein complex and play an important role in AGB1-dependent regulation of lateral root formation by affecting root auxin transport, auxin gradients and the steady-state levels of mRNA encoding the PIN-FORMED 2 and AUXIN 1 auxin transport facilitators. Auxin transport in aerial tissue follows different paths and utilizes different transporters than in roots; therefore, in the present study, we analyzed whether NDL proteins play an important role in AGB1-dependent, auxin-mediated meristem development. Methodology/Principal Findings Expression levels of NDL gene family members need to be tightly regulated, and altered expression (both over-expression and down-regulation) confers ectopic growth. Over-expression of NDL1 disrupts vegetative and reproductive organ development. Reduced expression of the NDL gene family members results in asymmetric leaf emergence, twinning of rosette leaves, defects in leaf formation, and abnormal silique distribution. Reduced expression of the NDL genes in the agb1-2 (null allele) mutant rescues some of the abnormal phenotypes, such as silique morphology, silique distribution, and peduncle angle, suggesting that proper levels of NDL proteins are maintained by AGB1. We found that all of these abnormal aerial phenotypes due to altered NDL expression were associated with increases in basipetal auxin transport, altered auxin maxima and altered MAX2 expression within the inflorescence stem. Conclusion/Significance NDL proteins, together with AGB1, act as positive regulators of meristem initiation and branching. AGB1 and NDL1 positively regulate basipetal inflorescence auxin transport and modulate MAX2 expression in shoots, which in turn regulates organ and lateral meristem formation by the establishment and maintenance of auxin gradients. PMID:24223735

Uterine NDRG2 expression is increased at implantation sites during early pregnancy in mice, and its down-regulation inhibits decidualization of mouse endometrial stromal cells.

PubMed

Gu, Yan; Zhang, Xuan; Yang, Qian; Wang, Jian-mei; He, Ya-ping; Sun, Zhao-gui; Zhang, Hui-qin; Wang, Jian

2015-05-27

N-myc down-regulated gene 2 (NDRG2) is a tumor suppressor involved in cell proliferation and differentiation. The aim of this study was to determine the uterine expression pattern of this gene during early pregnancy in mice. Uterine NDRG2 mRNA and protein expression levels were determined by RT-PCR and Western blot analyses, respectively, during the peri-implantation period in mice. Immunohistochemical (IHC) analysis was performed to examine the spatial localization of NDRG2 expression in mouse uterine tissues. The in vitro decidualization model of mouse endometrial stromal cells (ESCs) was used to evaluate decidualization of ESCs following NDRG2 knock down by small interfering RNA (siRNA). Statistical significance was analyzed by one-way ANOVA using SPSS 19.0 software. Uterine NDRG2 gene expression was significantly up-regulated and was predominantly localized to the secondary decidual zone on days 5 and 8 of pregnancy in mice. Its increased expression was associated with artificial decidualization as well as the activation of delayed implantation. Furthermore, uterine NDRG2 expression was induced by estrogen and progesterone treatments. The in vitro decidualization of mouse ESCs was accompanied by up-regulation of NDRG2 expression, and knock down of its expression in these cells by siRNA inhibited the decidualization process. These results suggest that NDRG2 might play an important role in the process of decidualization during early pregnancy.

The effects of whole ovarian perfusion and cryopreservation on endothelial cell-related gene expression in the ovarian medulla and pedicle.

PubMed

Onions, V J; Webb, R; Pincott-Allen, C; Picton, H M; Campbell, B K

2013-04-01

Fertility preservation by whole ovarian cryopreservation requires successful cryopreservation of both the ovary and its vascular supply. Previous work has indicated detrimental effects of both perfusion and cryopreservation on the ovarian vasculature. This study assessed the effects of blood perfusion, alone or in combination with cryopreservation, on functional effects in the follicle population and ovarian function in vivo following short-term autotransplantation of the tissue after vascular reanastomosis and measured acute changes in endothelial cell-related gene expression within the ovarian medulla and pedicle. Following autotransplantation for 7 days, primordial, transitional and primary follicle densities were significantly reduced (P < 0.05) and stromal Ki67 and caspase-3 expression significantly increased (P < 0.05) in cryopreserved but not fresh or perfused whole ovaries. There was evidence of clot formation and fluorescent microsphere (FMS) extravasation in the medulla of all cryopreserved ovaries, indicating vascular damage. Utilizing a customized RT-PCR array or conventional RT-PCR, we found that perfusion alone resulted in down-regulation in the expression of caspase 6 and thrombospondin 1 (THBS1) genes in the medulla. Following additional cryopreservation, endothelial nitric oxide synthase (eNOS), endothelin 1, endothelin receptor A and Bcl-2 expression were significantly (P < 0.05) down-regulated. In the pedicle, both perfusion and cryopreservation caused a (P < 0.05) down-regulation of eNOS and THBS1, and an up-regulation in Bax expression. Perfusion also caused a down-regulation of TNF and up-regulation of endothelin-2 expression (P < 0.05). In conclusion, this study has identified a number of endothelial cell-related genes expressed in the medulla which are acutely affected by both cryopreservation and perfusion, supporting the hypothesis that both interventions have deleterious effects on endothelial cell function.

Phenylpropanoid biosynthesis in leaves and glandular trichomes of basil (Ocimum basilicum L.).

PubMed

Deschamps, Cícero; Simon, James E

2010-01-01

Basil (Ocimum basilicum L.) essential oil phenylpropenes are synthesized and accumulate in peltate glandular trichomes and their content and composition depend on plant developmental stage. Studies on gene expression and enzymatic activity indicate that the phenylpropene biosynthetic genes are developmentally regulated. In this study, the methylchavicol accumulation in basil leaves and the enzyme activities and gene expression of both chavicol O-methyltransferase (CVOMT) and eugenol O-methyltransferase (EOMT) were investigated in all leaves at four plant developmental stages. Methylchavicol accumulation decreased over time as leaves matured. There was a significant correlation between methylchavicol accumulation and CVOMT (r(2) = 0.88) enzyme activity, suggesting that the levels of biosynthetic enzymes control the essential oil content. CVOMT and EOMT transcript expression levels, which decreased with leaf age, followed the same pattern in both whole leaves and isolated glandular trichomes, providing evidence that CVOMT transcript levels are developmentally regulated in basil glandular trichomes themselves and that differences in CVOMT expression observed in whole leaves are not solely the result of differences in glandular trichome density.

Proteomic Identification of Differentially Expressed Proteins during Alfalfa (Medicago sativa L.) Flower Development.

PubMed

Chen, Lingling; Chen, Quanzhu; Zhu, Yanqiao; Hou, Longyu; Mao, Peisheng

2016-01-01

Flower development, pollination, and fertilization are important stages in the sexual reproduction process of plants; they are also critical steps in the control of seed formation and development. During alfalfa ( Medicago sativa L.) seed production, some distinct phenomena such as a low seed setting ratio, serious flower falling, and seed abortion commonly occur. However, the causes of these phenomena are complicated and largely unknown. An understanding of the mechanisms that regulate alfalfa flowering is important in order to increase seed yield. Hence, proteomic technology was used to analyze changes in protein expression during the stages of alfalfa flower development. Flower samples were collected at pre-pollination (S1), pollination (S2), and the post-pollination senescence period (S3). Twenty-four differentially expressed proteins were successfully identified, including 17 down-regulated in pollinated flowers, one up-regulated in pollinated and senesced flowers, and six up-regulated in senesced flowers. The largest proportions of the identified proteins were involved in metabolism, signal transduction, defense response, oxidation reduction, cell death, and programmed cell death (PCD). Their expression profiles demonstrated that energy metabolism, carbohydrate metabolism, and amino acid metabolism provided the nutrient foundation for pollination in alfalfa. Furthermore, there were three proteins involved in multiple metabolic pathways: dual specificity kinase splA-like protein (kinase splALs), carbonic anhydrase, and NADPH: quinone oxidoreductase-like protein. Expression patterns of these proteins indicated that MAPK cascades regulated multiple processes, such as signal transduction, stress response, and cell death. PCD also played an important role in the alfalfa flower developmental process, and regulated both pollination and flower senescence. The current study sheds some light on protein expression profiles during alfalfa flower development and contributes to the understanding of the basic molecular mechanisms during the alfalfa flowering process. These results may offer insight into potential strategies for improving seed yield, quality, and stress tolerance in alfalfa.

Proteomic Identification of Differentially Expressed Proteins during Alfalfa (Medicago sativa L.) Flower Development

PubMed Central

Chen, Lingling; Chen, Quanzhu; Zhu, Yanqiao; Hou, Longyu; Mao, Peisheng

2016-01-01

Flower development, pollination, and fertilization are important stages in the sexual reproduction process of plants; they are also critical steps in the control of seed formation and development. During alfalfa (Medicago sativa L.) seed production, some distinct phenomena such as a low seed setting ratio, serious flower falling, and seed abortion commonly occur. However, the causes of these phenomena are complicated and largely unknown. An understanding of the mechanisms that regulate alfalfa flowering is important in order to increase seed yield. Hence, proteomic technology was used to analyze changes in protein expression during the stages of alfalfa flower development. Flower samples were collected at pre-pollination (S1), pollination (S2), and the post-pollination senescence period (S3). Twenty-four differentially expressed proteins were successfully identified, including 17 down-regulated in pollinated flowers, one up-regulated in pollinated and senesced flowers, and six up-regulated in senesced flowers. The largest proportions of the identified proteins were involved in metabolism, signal transduction, defense response, oxidation reduction, cell death, and programmed cell death (PCD). Their expression profiles demonstrated that energy metabolism, carbohydrate metabolism, and amino acid metabolism provided the nutrient foundation for pollination in alfalfa. Furthermore, there were three proteins involved in multiple metabolic pathways: dual specificity kinase splA-like protein (kinase splALs), carbonic anhydrase, and NADPH: quinone oxidoreductase-like protein. Expression patterns of these proteins indicated that MAPK cascades regulated multiple processes, such as signal transduction, stress response, and cell death. PCD also played an important role in the alfalfa flower developmental process, and regulated both pollination and flower senescence. The current study sheds some light on protein expression profiles during alfalfa flower development and contributes to the understanding of the basic molecular mechanisms during the alfalfa flowering process. These results may offer insight into potential strategies for improving seed yield, quality, and stress tolerance in alfalfa. PMID:27757120

Down-regulation of Glutathione S-transferase Pi in Asthma Contributes to Enhanced Oxidative Stress

PubMed Central

Schroer, Kathy T.; Gibson, Aaron M.; Sivaprasad, Umasundari; Bass, Stacey A.; Ericksen, Mark B.; Wills-Karp, Marsha; LeCras, Tim; Fitzpatrick, Anne M.; Brown, Lou Ann S.; Stringer, Keith F.; Khurana Hershey, Gurjit K.

2011-01-01

Background Glutathione S-transferase Pi (GSTPi) is the predominant redox regulator in the lung. While evidence implicates an important role for GSTPi in asthma, the mechanism for this has remained elusive. Objectives To determine how GSTPi is regulated in asthma and to elucidate its role in maintaining redox homeostasis. Methods We elucidated the regulation of GSTPi in children with asthma and utilized murine models of asthma to determine the role of GSTPi in redox homeostasis. Measurements and Main Results Our findings demonstrate that GSTPi transcript levels are markedly down-regulated in allergen and IL-13 treated mouse models of asthma via STAT6 dependent and independent pathways. Nuclear factor-erythroid 2 related factor 2 (Nrf2) was also down-regulated in these models. The decrease in GSTPi expression was associated with decreased total GST activity in the lungs of mice. Examination of cystine intermediates uncovered a functional role for GSTPi in regulating Cys oxidation, whereby GSTPi-deficient mice exhibited increased oxidative stress (increase in % cystine) compared with wild-type mice following allergen challenge. GSTPi expression was similarly down-regulated in children with asthma. Conclusions These data collectively suggest that down-regulation of GSTPi following allergen challenge may contribute to the asthma phenotype due to disruption of redox homeostasis and increased oxidative stress. Furthermore, GSTPi may be an important therapeutic target for asthma, and evaluation of GSTPi expression may prove beneficial in identifying individuals who would benefit from therapy targeting this pathway. PMID:21570714

Pax8 modulates the expression of Wnt4 that is necessary for the maintenance of the epithelial phenotype of thyroid cells

PubMed Central

2014-01-01

Background The transcription factor Pax8 is expressed during thyroid development and is involved in the morphogenesis of the thyroid gland and maintenance of the differentiated phenotype. In particular, Pax8 has been shown to regulate genes that are considered markers of thyroid differentiation. Recently, the analysis of the gene expression profile of FRTL-5 differentiated thyroid cells after the silencing of Pax8 identified Wnt4 as a novel target. Like the other members of the Wnt family, Wnt4 has been implicated in several developmental processes including regulation of cell fate and patterning during embryogenesis. To date, the only evidence on Wnt4 in thyroid concerns its down-regulation necessary for the progression of thyroid epithelial tumors. Results Here we demonstrate that Pax8 is involved in the transcriptional modulation of Wnt4 gene expression directly binding to its 5’-flanking region, and that Wnt4 expression in FRTL-5 cells is TSH-dependent. Interestingly, we also show that in thyroid cells a reduced expression of Wnt4 correlates with the alteration of the epithelial phenotype and that the overexpression of Wnt4 in thyroid cancer cells is able to inhibit cellular migration. Conclusions We have identified and characterized a functional Pax8 binding site in the 5’-flanking region of the Wnt4 gene and we show that Pax8 modulates the expression of Wnt4 in thyroid cells. Taken together, our results suggest that in thyroid cells Wnt4 expression correlates with the integrity of the epithelial phenotype and is reduced when this integrity is perturbed. In the end, we would like to suggest that the overexpression of Wnt4 in thyroid cancer cells is able to revert the mesenchymal phenotype. PMID:25270402

The Role of Sink Strength and Nitrogen Availability in the Down-Regulation of Photosynthetic Capacity in Field-Grown Nicotiana tabacum L. at Elevated CO2 Concentration.

PubMed

Ruiz-Vera, Ursula M; De Souza, Amanda P; Long, Stephen P; Ort, Donald R

2017-01-01

Down-regulation of photosynthesis is among the most common responses observed in C 3 plants grown under elevated atmospheric CO 2 concentration ([CO 2 ]). Down-regulation is often attributed to an insufficient capacity of sink organs to use or store the increased carbohydrate production that results from the stimulation of photosynthesis by elevated [CO 2 ]. Down-regulation can be accentuated by inadequate nitrogen (N) supply, which may limit sink development. While there is strong evidence for down-regulation of photosynthesis at elevated [CO 2 ] in enclosure studies most often involving potted plants, there is little evidence for this when [CO 2 ] is elevated fully under open-air field treatment conditions. To assess the importance of sink strength on the down-regulation of photosynthesis and on the potential of N to mitigate this down-regulation under agriculturally relevant field conditions, two tobacco cultivars ( Nicotiana tabacum L. cv. Petit Havana; cv. Mammoth) of strongly contrasting ability to produce the major sink of this crop, leaves, were grown under ambient and elevated [CO 2 ] and with two different N additions in a free air [CO 2 ] (FACE) facility. Photosynthetic down-regulation at elevated [CO 2 ] reached only 9% in cv. Mammoth late in the season likely reflecting sustained sink strength of the rapidly growing plant whereas down-regulation in cv. Petit Havana reached 25%. Increased N supply partially mitigated down-regulation of photosynthesis in cv. Petit Havana and this mitigation was dependent on plant developmental stage. Overall, these field results were consistent with the hypothesis that sustained sink strength, that is the ability to utilize photosynthate, and adequate N supply will allow C 3 crops in the field to maintain enhanced photosynthesis and therefore productivity as [CO 2 ] continues to rise.

Epigenetic down-regulated DDX10 promotes cell proliferation through Akt/NF-κB pathway in ovarian cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gai, Muhuizi; Bo, Qifang; Qi, Lixia, E-mail: lixiaqi_dph@sina.com

Ovarian cancer contributes to the majority of ovarian cancer, while the molecular mechanisms remain elusive. Recently, some DEAD box protein 1 has been reported play a tumor suppressor role in ovarian cancer progression. However, the functions of DEAD box protein (DDX) members in ovarian cancer development remain largely unknown. In current study, we retrieved GEO databases and surprisingly found that DDX10 is significantly down-regulated in ovarian cancer tissues compared with normal ovary. These findings suggest that DDX10 might also play a suppressive role in ovarian cancer. We then validated the down-regulated expression pattern of DDX10 in fresh ovarian cancer tissues.more » Furthermore, both loss- and gain-functions assays reveal that the down-regulated DDX10 could promote ovarian cancer proliferation in vitro and the xenograft subcutaneous tumor formation assays confirmed these findings in vivo. In addition, we found that DDX10 is epigenetic silenced by miR-155-5p in ovarian cancer. Moreover, we further preliminary illustrated that down-regulated DDX10 promotes ovarian cancer cell proliferation through Akt/NF-κB pathway. Taken together, in current study, we found a novel tumor suppressor, DDX10, is epigenetic silenced by miR-155-5p in ovarian cancer, and the down-regulated expression pattern of DDX10 promotes ovarian cancer proliferation through Akt/NF-κB pathway. Our findings shed the light that DDX families might be a novel for ovarian cancer treatment. - Highlights: • A novel DEAD box protein, DDX10 is significantly down-regulated in ovarian cancer tissues. • Down-regulated DDX10 promotes ovarian cancer cell proliferation and growth both in vitro and in vivo. • miR-155-5p is highly expressed in ovarian cancer tissues and epigenetically targets DDX10. • DDX10 and miR-155-5p regulates Akt/p65 axis in ovarian cancer cells.« less

Gene expression profile in mesenchymal stem cells derived from dental tissues and bone marrow

PubMed Central

Kim, Su-Hwan; Kim, Young-Sung; Lee, Su-Yeon; Kim, Kyoung-Hwa; Lee, Yong-Moo; Kim, Won-Kyung

2011-01-01

Purpose The aim of this study is to compare the gene expression profile in mesenchymal stem cells derived from dental tissues and bone marrow for characterization of dental stem cells. Methods We employed GeneChip analysis to the expression levels of approximately 32,321 kinds of transcripts in 5 samples of bone-marrow-derived mesenchymal stem cells (BMSCs) (n=1), periodontal ligament stem cells (PDLSCs) (n=2), and dental pulp stem cells (DPSCs) (n=2). Each cell was sorted by a FACS Vantage Sorter using immunocytochemical staining of the early mesenchymal stem cell surface marker STRO-1 before the microarray analysis. Results We identified 379 up-regulated and 133 down-regulated transcripts in BMSCs, 68 up-regulated and 64 down-regulated transcripts in PDLSCs, and 218 up-regulated and 231 down-regulated transcripts in DPSCs. In addition, anatomical structure development and anatomical structure morphogenesis gene ontology (GO) terms were over-represented in all three different mesenchymal stem cells and GO terms related to blood vessels, and neurons were over-represented only in DPSCs. Conclusions This study demonstrated the genome-wide gene expression patterns of STRO-1+ mesenchymal stem cells derived from dental tissues and bone marrow. The differences among the expression profiles of BMSCs, PDLSCs, and DPSCs were shown, and 999 candidate genes were found to be definitely up- or down-regulated. In addition, GOstat analyses of regulated gene products provided over-represented GO classes. These data provide a first step for discovering molecules key to the characteristics of dental stem cells. PMID:21954424

Transcriptome analysis of phosphorus stress responsiveness in the seedlings of Dongxiang wild rice (Oryza rufipogon Griff.).

PubMed

Deng, Qian-Wen; Luo, Xiang-Dong; Chen, Ya-Ling; Zhou, Yi; Zhang, Fan-Tao; Hu, Biao-Lin; Xie, Jian-Kun

2018-03-15

Low phosphorus availability is a major factor restricting rice growth. Dongxiang wild rice (Oryza rufipogon Griff.) has many useful genes lacking in cultivated rice, including stress resistance to phosphorus deficiency, cold, salt and drought, which is considered to be a precious germplasm resource for rice breeding. However, the molecular mechanism of regulation of phosphorus deficiency tolerance is not clear. In this study, cDNA libraries were constructed from the leaf and root tissues of phosphorus stressed and untreated Dongxiang wild rice seedlings, and transcriptome sequencing was performed with the goal of elucidating the molecular mechanisms involved in phosphorus stress response. The results indicated that 1184 transcripts were differentially expressed in the leaves (323 up-regulated and 861 down-regulated) and 986 transcripts were differentially expressed in the roots (756 up-regulated and 230 down-regulated). 43 genes were up-regulated both in leaves and roots, 38 genes were up-regulated in roots but down-regulated in leaves, and only 2 genes were down-regulated in roots but up-regulated in leaves. Among these differentially expressed genes, the detection of many transcription factors and functional genes demonstrated that multiple regulatory pathways were involved in phosphorus deficiency tolerance. Meanwhile, the differentially expressed genes were also annotated with gene ontology terms and key pathways via functional classification and Kyoto Encyclopedia of Gene and Genomes pathway mapping, respectively. A set of the most important candidate genes was then identified by combining the differentially expressed genes found in the present study with previously identified phosphorus deficiency tolerance quantitative trait loci. The present work provides abundant genomic information for functional dissection of the phosphorus deficiency resistance of Dongxiang wild rice, which will be help to understand the biological regulatory mechanisms of phosphorus deficiency tolerance in Dongxiang wild rice.

Effects of perfluorooctanoic acid (PFOA) on expression of peroxisome proliferator-activated receptors (PPAR) and nuclear receptor-regulated genes in fetal and postnatal CD-1 mouse tissues.

PubMed

Abbott, Barbara D; Wood, Carmen R; Watkins, Andrew M; Tatum-Gibbs, Katoria; Das, Kaberi P; Lau, Christopher

2012-07-01

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARα is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1 to 17 with water or 5mg PFOA/kg to examine PPARα, PPARβ, and PPARγ expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARα and PPARγ expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of CD-1 mouse neonates. Published by Elsevier Inc.

Oxidative stress gene expression profile in inbred mouse after ischemia/reperfusion small bowel injury.

PubMed

Bertoletto, Paulo Roberto; Ikejiri, Adauto Tsutomu; Somaio Neto, Frederico; Chaves, José Carlos; Teruya, Roberto; Bertoletto, Eduardo Rodrigues; Taha, Murched Omar; Fagundes, Djalma José

2012-11-01

To determine the profile of gene expressions associated with oxidative stress and thereby contribute to establish parameters about the role of enzyme clusters related to the ischemia/reperfusion intestinal injury. Twelve male inbred mice (C57BL/6) were randomly assigned: Control Group (CG) submitted to anesthesia, laparotomy and observed by 120 min; Ischemia/reperfusion Group (IRG) submitted to anesthesia, laparotomy, 60 min of small bowel ischemia and 60 min of reperfusion. A pool of six samples was submitted to the qPCR-RT protocol (six clusters) for mouse oxidative stress and antioxidant defense pathways. On the 84 genes investigated, 64 (76.2%) had statistic significant expression and 20 (23.8%) showed no statistical difference to the control group. From these 64 significantly expressed genes, 60 (93.7%) were up-regulated and 04 (6.3%) were down-regulated. From the group with no statistical significantly expression, 12 genes were up-regulated and 8 genes were down-regulated. Surprisingly, 37 (44.04%) showed a higher than threefold up-regulation and then arbitrarily the values was considered as a very significant. Thus, 37 genes (44.04%) were expressed very significantly up-regulated. The remained 47 (55.9%) genes were up-regulated less than three folds (35 genes - 41.6%) or down-regulated less than three folds (12 genes - 14.3%). The intestinal ischemia and reperfusion promote a global hyper-expression profile of six different clusters genes related to antioxidant defense and oxidative stress.

Expression of the SIN3 homologue from banana, MaSIN3, suppresses ABA responses globally during plant growth in Arabidopsis.

PubMed

Luxmi, Raj; Garg, Rashmi; Srivastava, Sudhakar; Sane, Aniruddha P

2017-11-01

The SIN3 family of co-repressors is a family of highly conserved eukaryotic repressor proteins that regulates diverse functions in yeasts and animals but remains largely uncharacterized functionally even in plants like Arabidopsis. The sole SIN3 homologue in banana, MaSIN3, was identified as a 1408 amino acids, nuclear localized protein conserved to other SIN3s in the PAH, HID and HCR domains. Interestingly, MaSIN3 over-expression in Arabidopsis mimics a state of reduced ABA responses throughout plant development affecting growth processes such as germination, root growth, stomatal closure and water loss, flowering and senescence. The reduction in ABA responses is not due to reduced ABA levels but due to suppression of expression of several transcription factors mediating ABA responses. Transcript levels of negative regulators of germination (ABI3, ABI5, PIL5, RGL2 and RGL3) are reduced post-imbibition while those responsible for GA biosynthesis are up-regulated in transgenic MaSIN3 over-expressers. ABA-associated transcription factors are also down-regulated in response to ABA treatment. The HDAC inhibitors, SAHA and sodium butyrate, in combination with ABA differentially suppress germination in control and transgenic lines suggesting the recruitment by MaSIN3 of HDACs involved in suppression of ABA responses in different processes. The studies provide an insight into the ability of MaSIN3 to specifically affect a subset of developmental processes governed largely by ABA. Copyright © 2017 Elsevier B.V. All rights reserved.

The effects of curcumin on proliferation, apoptosis, invasion, and NEDD4 expression in pancreatic cancer.

PubMed

Su, Jingna; Zhou, Xiuxia; Yin, Xuyuan; Wang, Lixia; Zhao, Zhe; Hou, Yingying; Zheng, Nana; Xia, Jun; Wang, Zhiwei

2017-09-15

Pancreatic cancer (PC) is one of the most fatal cancers worldwide. The incidence and death rates are still increasing for PC. Curcumin is the biologically active diarylheptanoid constituent of the spice turmeric, which exerts its anticancer properties in various human cancers including PC. In particular, accumulating evidence has proved that curcumin targets numerous therapeutically important proteins in cell signaling pathways. The neural precursor cell expressed developmentally down-regulated protein 4 (NEDD4) is an E3 HECT ubiquitin ligase and is frequently over-expressed in various cancers. It has reported that NEDD4 might facilitate tumorigenesis via targeting and degradation of multiple tumor suppressor proteins including PTEN. Hence, in the present study we explore whether curcumin inhibits NEDD4, resulting in the suppression of cell growth, migration and invasion in PC cells. We found that curcumin inhibited cell proliferation and triggered apoptosis in PC, which is associated with increased expression of PTEN and p73. These results suggested that inhibition of NEDD4 might be beneficial to the antitumor properties of curcumin on PC treatments. Copyright © 2017 Elsevier Inc. All rights reserved.

Stuxnet Recruits the Proteasome to Take Down Polycomb.

PubMed

Karch, François

2016-06-20

In this issue of Developmental Cell, Du et al. (2016) describe a gene named stuxnet that regulates Polycomb protein stability, thereby influencing the activity of the Polycomb-group repressive chromatin complexes. Copyright © 2016 Elsevier Inc. All rights reserved.

Conserved hemopoietic transcription factor Cg-SCL delineates hematopoiesis of Pacific oyster Crassostrea gigas.

PubMed

Song, Xiaorui; Wang, Hao; Chen, Hao; Sun, Mingzhe; Liang, Zhongxiu; Wang, Lingling; Song, Linsheng

2016-04-01

Hemocytes are the effective immunocytes in bivalves, which have been reported to be derived from stem-like cells in gill epithelium of oyster. In the present work, a conserved haematopoietic transcription factor Tal-1/Scl (Stem Cell Leukemia) was identified in Pacific oyster (Cg-SCL), and it was evolutionarily close to the orthologs in deuterostomes. Cg-SCL was highly distributed in the hemocytes as well as gill and mantle. The hemocyte specific genes Integrin, EcSOD and haematopoietic transcription factors GATA3, C-Myb, c-kit, were down-regulated when Cg-SCL was interfered by dsRNA. During the larval developmental stages, the mRNA transcripts of Cg-SCL gradually increased after fertilization and peaked at early trochophore larvae stage (10 hpf, hours post fertilization), then sharply decreased in late trochophore larvae stage (15 hpf) before resuming in umbo larvae (120 hpf). Whole-mount immunofluorescence assay further revealed that the immunoreactivity of Cg-SCL appeared in blastula larvae with two approximate symmetric spots, and this expression pattern lasted in gastrula larvae. By trochophore, the immunoreactivity formed a ring around the dorsal region and then separated into two remarkable spots at the dorsal side in D-veliger larvae. After bacterial challenge, the mRNA expression levels of Cg-SCL were significantly up-regulated in the D-veliger and umbo larvae, indicating the available hematopoietic regulation in oyster larvae. These results demonstrated that Cg-SCL could be used as haematopoietic specific marker to trace potential developmental events of hematopoiesis during ontogenesis of oyster, which occurred early in blastula stage and maintained until D-veliger larvae. Copyright © 2016 Elsevier Ltd. All rights reserved.

Development and validation of a gene expression oligo microarray for the gilthead sea bream (Sparus aurata).

PubMed

Ferraresso, Serena; Vitulo, Nicola; Mininni, Alba N; Romualdi, Chiara; Cardazzo, Barbara; Negrisolo, Enrico; Reinhardt, Richard; Canario, Adelino V M; Patarnello, Tomaso; Bargelloni, Luca

2008-12-03

Aquaculture represents the most sustainable alternative of seafood supply to substitute for the declining marine fisheries, but severe production bottlenecks remain to be solved. The application of genomic technologies offers much promise to rapidly increase our knowledge on biological processes in farmed species and overcome such bottlenecks. Here we present an integrated platform for mRNA expression profiling in the gilthead sea bream (Sparus aurata), a marine teleost of great importance for aquaculture. A public data base was constructed, consisting of 19,734 unique clusters (3,563 contigs and 16,171 singletons). Functional annotation was obtained for 8,021 clusters. Over 4,000 sequences were also associated with a GO entry. Two 60mer probes were designed for each gene and in-situ synthesized on glass slides using Agilent SurePrint technology. Platform reproducibility and accuracy were assessed on two early stages of sea bream development (one-day and four days old larvae). Correlation between technical replicates was always > 0.99, with strong positive correlation between paired probes. A two class SAM test identified 1,050 differentially expressed genes between the two developmental stages. Functional analysis suggested that down-regulated transcripts (407) in older larvae are mostly essential/housekeeping genes, whereas tissue-specific genes are up-regulated in parallel with the formation of key organs (eye, digestive system). Cross-validation of microarray data was carried out using quantitative qRT-PCR on 11 target genes, selected to reflect the whole range of fold-change and both up-regulated and down-regulated genes. A statistically significant positive correlation was obtained comparing expression levels for each target gene across all biological replicates. Good concordance between qRT-PCR and microarray data was observed between 2- and 7-fold change, while fold-change compression in the microarray was present for differences greater than 10-fold in the qRT-PCR. A highly reliable oligo-microarray platform was developed and validated for the gilthead sea bream despite the presently limited knowledge of the species transcriptome. Because of the flexible design this array will be able to accommodate additional probes as soon as novel unique transcripts are available.

Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

PubMed

Kohsokabe, Takahiro; Kaneko, Kunihiko

2016-01-01

Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

PubMed Central

Kohsokabe, Takahiro

2016-01-01

ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

DHA down-regulates phenobarbital-induced cytochrome P450 2B1 gene expression in rat primary hepatocytes by attenuating CAR translocation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, C.-C.; Lii, C.-K.; Liu, K.-L.

The constitutive androstane receptor (CAR) plays an important role in regulating the expression of detoxifying enzymes, including cytochrome P450 2B (CYP 2B). Phenobarbital (PB) induction of human CYP 2B6 and mouse CYP 2b10 has been shown to be mediated by CAR. Our previous study showed that PB-induced CYP 2B1 expression in rat primary hepatocytes is down-regulated by both n-6 and n-3 polyunsaturated fatty acids (PUFAs), especially docosahexaenoic acid (DHA); however, the mechanism for this down-regulation by DHA was previously unknown. The objective of the present study was to determine whether change in CAR translocation is involved in the down-regulation bymore » n-6 and n-3 PUFAs of PB-induced CYP 2B1 expression in rat primary hepatocytes. We used 100 {mu}M arachidonic acid, linoleic acid, eicosapentaenoic acid, and DHA to test this hypothesis. PB triggered the translocation of CAR from the cytosol into the nucleus in a dose-dependent and time-dependent manner in our hepatocyte system, and the CAR distribution in rat primary hepatocytes was significantly affected by DHA. DHA treatment decreased PB-inducible accumulation of CAR in the nuclear fraction and increased it in the cytosolic fraction in a dose-dependent manner. The down-regulation of CYP 2B1 expression by DHA occurred in a dose-dependent manner, and a similar pattern was found for the nuclear accumulation of CAR. The results of immunoprecipitation showed a CAR/RXR heterodimer bound to nuclear receptor binding site 1 (NR-1) of the PB-responsive enhancer module (PBREM) of the CYP 2B1gene. The EMSA results showed that PB-induced CAR binding to NR-1 was attenuated by DHA. Taken together, these results suggest that attenuation of CAR translocation and decreased subsequent binding to NR-1 are involved in DHA's down-regulation of PB-induced CYP 2B1 expression.« less

Requirements for cell rounding and surface protein down-regulation by Ebola virus glycoprotein.

PubMed

Francica, Joseph R; Matukonis, Meghan K; Bates, Paul

2009-01-20

Ebola virus causes an acute hemorrhagic fever that is associated with high morbidity and mortality. The viral glycoprotein is thought to contribute to pathogenesis, though precise mechanisms are unknown. Cellular pathogenesis can be modeled in vitro by expression of the Ebola viral glycoprotein (GP) in cells, which causes dramatic morphological changes, including cell rounding and surface protein down-regulation. These effects are known to be dependent on the presence of a highly glycosylated region of the glycoprotein, the mucin domain. Here we show that the mucin domain from the highly pathogenic Zaire subtype of Ebola virus is sufficient to cause characteristic cytopathology when expressed in the context of a foreign glycoprotein. Similarly to full length Ebola GP, expression of the mucin domain causes rounding, detachment from the extracellular matrix, and the down-regulation of cell surface levels of beta1 integrin and major histocompatibility complex class 1. These effects were not seen when the mucin domain was expressed in the context of a glycophosphatidylinositol-anchored isoform of the foreign glycoprotein. In contrast to earlier analysis of full length Ebola glycoproteins, chimeras carrying the mucin domains from the Zaire and Reston strains appear to cause similar levels of down-modulation and cell detachment. Cytopathology associated with Ebola glycoprotein expression does not occur when GP expression is restricted to the endoplasmic reticulum. In contrast to a previously published report, our results demonstrate that GP-induced surface protein down-regulation is not mediated through a dynamin-dependent pathway. Overall, these results support a model in which the mucin domain of Ebola GP acts at the cell surface to induce protein down modulation and cytopathic effects.

Global gene expression analyses of hematopoietic stem cell-like cell lines with inducible Lhx2 expression

PubMed Central

Richter, Karin; Wirta, Valtteri; Dahl, Lina; Bruce, Sara; Lundeberg, Joakim; Carlsson, Leif; Williams, Cecilia

2006-01-01

Background Expression of the LIM-homeobox gene Lhx2 in murine hematopoietic cells allows for the generation of hematopoietic stem cell (HSC)-like cell lines. To address the molecular basis of Lhx2 function, we generated HSC-like cell lines where Lhx2 expression is regulated by a tet-on system and hence dependent on the presence of doxycyclin (dox). These cell lines efficiently down-regulate Lhx2 expression upon dox withdrawal leading to a rapid differentiation into various myeloid cell types. Results Global gene expression of these cell lines cultured in dox was compared to different time points after dox withdrawal using microarray technology. We identified 267 differentially expressed genes. The majority of the genes overlapping with HSC-specific databases were those down-regulated after turning off Lhx2 expression and a majority of the genes overlapping with those defined as late progenitor-specific genes were the up-regulated genes, suggesting that these cell lines represent a relevant model system for normal HSCs also at the level of global gene expression. Moreover, in situ hybridisations of several genes down-regulated after dox withdrawal showed overlapping expression patterns with Lhx2 in various tissues during embryonic development. Conclusion Global gene expression analysis of HSC-like cell lines with inducible Lhx2 expression has identified genes putatively linked to self-renewal / differentiation of HSCs, and function of Lhx2 in organ development and stem / progenitor cells of non-hematopoietic origin. PMID:16600034

Quinacrine induces apoptosis in human leukemia K562 cells via p38 MAPK-elicited BCL2 down-regulation and suppression of ERK/c-Jun-mediated BCL2L1 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Changchien, Jung-Jung; Chen, Ying-Jung; Huang, Chia-Hui

2015-04-01

Although previous studies have revealed the anti-cancer activity of quinacrine, its effect on leukemia is not clearly resolved. We sought to explore the cytotoxic effect and mechanism of quinacrine action in human leukemia K562 cells. Quinacrine induced K562 cell apoptosis accompanied with ROS generation, mitochondrial depolarization, and down-regulation of BCL2L1 and BCL2. Upon exposure to quinacrine, ROS-mediated p38 MAPK activation and ERK inactivation were observed in K562 cells. Quinacrine-induced cell death and mitochondrial depolarization were suppressed by the p38MAPK inhibitor SB202190 and constitutively active MEK1 over-expression. Activation of p38 MAPK was shown to promote BCL2 degradation. Further, ERK inactivation suppressedmore » c-Jun-mediated transcriptional expression of BCL2L1. Over-expression of BCL2L1 and BCL2 attenuated quinacrine-evoked mitochondrial depolarization and rescued the viability of quinacrine-treated cells. Taken together, our data indicate that quinacrine-induced K562 cell apoptosis is mediated through mitochondrial alterations triggered by p38 MAPK-mediated BCL2 down-regulation and suppression of ERK/c-Jun-mediated BCL2L1 expression. - Highlights: • Quinacrine induces K562 cell apoptosis via down-regulation of BCL2 and BCL2L1. • Quinacrine induces p38 MAPK activation and ERK inactivation in K562 cells. • Quinacrine elicits p38 MAPK-mediated BCL2 down-regulation. • Quinacrine suppresses ERK/c-Jun-mediated BCL2L1 expression.« less

Berberine Inhibits Proliferation and Down-Regulates Epidermal Growth Factor Receptor through Activation of Cbl in Colon Tumor Cells

PubMed Central

Wang, Lihong; Cao, Hailong; Lu, Ning; Liu, Liping; Wang, Bangmao; Hu, Tianhui; Israel, Dawn A.; Peek, Richard M.; Polk, D. Brent; Yan, Fang

2013-01-01

Berberine, an isoquinoline alkaloid, is an active component of Ranunculaceae and Papaveraceae plant families. Berberine has been found to suppress growth of several tumor cell lines in vitro through the cell-type-dependent mechanism. Expression and activation of epidermal growth factor receptor (EGFR) is increased in colonic precancerous lesions and tumours, thus EGFR is considered a tumour promoter. The aim of this study was to investigate the effects and mechanisms of berberine on regulation of EGFR activity and proliferation in colonic tumor cell lines and in vivo. We reported that berberine significantly inhibited basal level and EGF-stimulated EGFR activation and proliferation in the immorto Min mouse colonic epithelial (IMCE) cells carrying the APC min mutation and human colonic carcinoma cell line, HT-29 cells. Berberine acted to inhibit proliferation through inducing G1/S and G2/M cell cycle arrest, which correlated with regulation of the checkpoint protein expression. In this study, we also showed that berberine stimulated ubiquitin ligase Cbl activation and Cbl's interaction with EGFR, and EGFR ubiquitinylation and down-regulation in these two cell lines in the presence or absence of EGF treatment. Knock-down Cbl expression blocked the effects of berberine on down-regulation of EGFR and inhibition of proliferation. Furthermore, berberine suppressed tumor growth in the HT-29 cell xenograft model. Cell proliferation and EGFR expression level was decreased by berberine treatment in this xenograft model and in colon epithelial cells of APC min/+ mice. Taken together, these data indicate that berberine enhances Cbl activity, resulting in down-regulation of EGFR expression and inhibition of proliferation in colon tumor cells. PMID:23457600

Cyclic stretch-induced the cytoskeleton rearrangement and gene expression of cytoskeletal regulators in human periodontal ligament cells.

PubMed

Wu, Yaqin; Zhuang, Jiabao; Zhao, Dan; Zhang, Fuqiang; Ma, Jiayin; Xu, Chun

2017-10-01

This study aimed to explore the mechanism of the stretch-induced cell realignment and cytoskeletal rearrangement by identifying several mechanoresponsive genes related to cytoskeletal regulators in human PDL cells. After the cells were stretched by 1, 10 and 20% strains for 0.5, 1, 2, 4, 6, 12 or 24 h, the changes of the morphology and content of microfilaments were recorded and calculated. Meanwhile, the expression of 84 key genes encoding cytoskeletal regulators after 6 and 24 h stretches with 20% strain was detected by using real-time PCR array. Western blot was applied to identify the protein expression level of several cytoskeletal regulators encoded by these differentially expressed genes. The confocal fluorescent staining results confirmed that stretch-induced realignment of cells and rearrangement of microfilaments. Among the 84 genes screened, one gene was up-regulated while two genes were down-regulated after 6 h stretch. Meanwhile, three genes were up-regulated while two genes were down-regulated after 24 h stretch. These genes displaying differential expression included genes regulating polymerization/depolymerization of microfilaments (CDC42EP2, FNBP1L, NCK2, PIKFYVE, WASL), polymerization/depolymerization of microtubules (STMN1), interacting between microfilaments and microtubules (MACF1), as well as a phosphatase (PPP1R12B). Among the proteins encoded by these genes, the protein expression level of Cdc42 effector protein-2 (encoded by CDC42EP2) and Stathmin-1 (encoded by STMN1) was down-regulated, while the protein expression level of N-WASP (encoded by WASL) was up-regulated. The present study confirmed the cyclic stretch-induced cellular realignment and rearrangement of microfilaments in the human PDL cells and indicated several force-sensitive genes with regard to cytoskeletal regulators.

miR-34a screened by miRNA profiling negatively regulates Wnt/β-catenin signaling pathway in Aflatoxin B1 induced hepatotoxicity

PubMed Central

Zhu, Liye; Gao, Jing; Huang, Kunlun; Luo, Yunbo; Zhang, Boyang; Xu, Wentao

2015-01-01

Aflatoxin-B1 (AFB1), a hepatocarcinogenic mycotoxin, was demonstrated to induce the high rate of hepatocellular carcinoma (HCC). MicroRNAs (miRNAs) participate in the regulation of several biological processes in HCC. However, the function of miRNAs in AFB1-induced HCC has received a little attention. Here, we applied Illumina deep sequencing technology for high-throughout profiling of microRNAs in HepG2 cells lines after treatment with AFB1. Analysis of the differential expression profile of miRNAs in two libraries, we identified 9 known miRNAs and 1 novel miRNA which exhibited abnormal expression. KEGG analysis indicated that predicted target genes of differentially expressed miRNAs are involved in cancer-related pathways. Down-regulated of Drosha, DGCR8 and Dicer 1 indicated an impairment of miRNA biogenesis in response to AFB1. miR-34a was up-regulated significantly, down-regulating the expression of Wnt/β-catenin signaling pathway by target gene β-catenin. Anti-miR-34a can significantly relieved the down-regulated β-catenin and its downstream genes, c-myc and Cyclin D1, and the S-phase arrest in cell cycle induced by AFB1 can also be relieved. These results suggested that AFB1 might down-regulate Wnt/β-catenin signaling pathway in HepG2 cells by up-regulating miR-34a, which may involve in the mechanism of liver tumorigenesis. PMID:26567713

CHIR99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Yongyan; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A and F University, Yangling 712100, Shaanxi; Ai, Zhiying

2013-10-15

Embryonic stem cells (ESCs) can proliferate indefinitely in vitro and differentiate into cells of all three germ layers. These unique properties make them exceptionally valuable for drug discovery and regenerative medicine. However, the practical application of ESCs is limited because it is difficult to derive and culture ESCs. It has been demonstrated that CHIR99021 (CHIR) promotes self-renewal and enhances the derivation efficiency of mouse (m)ESCs. However, the downstream targets of CHIR are not fully understood. In this study, we identified CHIR-regulated genes in mESCs using microarray analysis. Our microarray data demonstrated that CHIR not only influenced the Wnt/β-catenin pathway bymore » stabilizing β-catenin, but also modulated several other pluripotency-related signaling pathways such as TGF-β, Notch and MAPK signaling pathways. More detailed analysis demonstrated that CHIR inhibited Nodal signaling, while activating bone morphogenetic protein signaling in mESCs. In addition, we found that pluripotency-maintaining transcription factors were up-regulated by CHIR, while several developmental-related genes were down-regulated. Furthermore, we found that CHIR altered the expression of epigenetic regulatory genes and long intergenic non-coding RNAs. Quantitative real-time PCR results were consistent with microarray data, suggesting that CHIR alters the expression pattern of protein-encoding genes (especially transcription factors), epigenetic regulatory genes and non-coding RNAs to establish a relatively stable pluripotency-maintaining network. - Highlights: • Combined use of CHIR with LIF promotes self-renewal of J1 mESCs. • CHIR-regulated genes are involved in multiple pathways. • CHIR inhibits Nodal signaling and promotes Bmp4 expression to activate BMP signaling. • Expression of epigenetic regulatory genes and lincRNAs is altered by CHIR.« less

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Rapamycin up-regulates triglycerides in hepatocytes by down-regulating Prox1.

PubMed

Kwon, Sora; Jeon, Ji-Sook; Kim, Su Bin; Hong, Young-Kwon; Ahn, Curie; Sung, Jung-Suk; Choi, Inho

2016-02-27

Although the prolonged use of rapamycin may cause unwanted side effects such as hyperlipidemia, the underlying mechanism remains unknown. Prox1 is a transcription factor responsible for the development of several tissues including lymphatics and liver. There is growing evidences that Prox1 participates in metabolism in addition to embryogenesis. However, whether Prox1 is directly related to lipid metabolism is currently unknown. HepG2 human hepatoma cells were treated with rapamycin and total lipids were analyzed by thin layer chromatography. The effect of rapamycin on the expression of Prox1 was determined by western blotting. To investigate the role of Prox1 in triglycerides regulation, siRNA and overexpression system were employed. Rapamycin was injected into mice for 2 weeks and total lipids and proteins in liver were measured by thin layer chromatography and western blot analysis, respectively. Rapamycin up-regulated the amount of triglyceride and down-regulated the expression of Prox1 in HepG2 cells by reducing protein half-life but did not affect its transcript. The loss-of-function of Prox1 was coincident with the increase of triglycerides in HepG2 cells treated with rapamycin. The up-regulation of triglycerides by rapamycin in HepG2 cells reverted to normal levels by the compensation of Prox1 using the overexpression system. Rapamycin also down-regulated Prox1 expression but increased triglycerides in mouse liver. This study suggests that rapamycin can increase the amount of triglycerides by down-regulating Prox1 expression in hepatocytes, which means that the mammalian target of rapamycin (mTOR) signaling is important for the regulation of triglycerides by maintaining Prox1 expression.

Targeting genes in insulin-associated signalling pathway, DNA damage, cell proliferation and cell differentiation pathways by tocotrienol-rich fraction in preventing cellular senescence of human diploid fibroblasts.

PubMed

Durani, L W; Jaafar, F; Tan, J K; Tajul Arifin, K; Mohd Yusof, Y A; Wan Ngah, W Z; Makpol, S

2015-01-01

Tocotrienols have been known for their antioxidant properties besides their roles in cellular signalling, gene expression, immune response and apoptosis. This study aimed to determine the molecular mechanism of tocotrienol-rich fraction (TRF) in preventing cellular senescence of human diploid fibroblasts (HDFs) by targeting the genes in senescence-associated signalling pathways. Real time quantitative PCR (qRT-PCR) was utilized to evaluate the expression of genes involved in these pathways. Our findings showed that SOD1 and CCS-1 were significantly down-regulated in pre-senescent cells while CCS-1 and PRDX6 were up-regulated in senescent cells (p<0.05). Treatment with TRF significantly down-regulated SOD1 in pre-senescent and senescent HDFs, up-regulated SOD2 in senescent cells, CAT in young HDFs, GPX1 in young and pre-senescent HDFs, and CCS-1 in young, pre-senescent and senescent HDFs (p<0.05). TRF treatment also caused up-regulation of FOXO3A in all age groups of cells (p<0.05). The expression of TP53, PAK2 and CDKN2A was significantly increased in senescent HDFs and treatment with TRF significantly down-regulated TP53 in senescent cells (p<0.05). MAPK14 was significantly up-regulated (p<0.05) in senescent HDFs while no changes was observed on the expression of JUN. TRF treatment, however, down-regulated MAPK14 in young and senescent cells and up-regulated JUN in young and pre-senescent HDFs (p<0.05). TRF modulated the expression of genes involved in senescence-associated signalling pathways during replicative senescence of HDFs.

Decreased expression of microRNA-29 family in leiomyoma contributes to increased major fibrillar collagen production.

PubMed

Marsh, Erica E; Steinberg, Marissa L; Parker, J Brandon; Wu, Ju; Chakravarti, Debabrata; Bulun, Serdar E

2016-09-01

To determine the expression and function of the microRNA-29 family (miRNA-29a, miRNA-29b, miRNA-29c) in human leiomyoma and myometrium. Basic science experimental design. Academic medical center. Women undergoing surgery for symptomatic uterine fibroids. Overexpression and knockdown of miRNA-29a, miRNA-29b, and miRNA-29c in primary leiomyoma and myometrial cells. [1] Expression of the miRNA-29 family members in vivo in leiomyoma versus myometrium; [2] Major fibrillar collagen (I, II, III) expression in leiomyoma and myometrial cells with manipulation of miRNA-29 species. Members of the miRNA-29 family (29a, 29b, 29c) are all down-regulated in leiomyoma versus myometrium in vivo. The expression of the miRNA-29 family can be successfully modulated in primary leiomyoma and myometrial cells. Overexpression of the miRNA-29 family in leiomyoma cells results in down-regulation of the major fibrillar collagens. Down-regulation of the miRNA-29 species in myometrium results in an increase in collagen type III deposition. The miRNA-29 family is consistently down-regulated in leiomyoma compared to matched myometrial tissue. This down-regulation contributes to the increased collagen seen in leiomyomas versus myometrium. When miRNA-29 members are overexpressed in leiomyoma cells, protein levels of all of the major fibrillar collagens decrease. The miRNA-29 members are potential therapeutic targets in this highly prevalent condition. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

6-Shogaol enhances renal carcinoma Caki cells to TRAIL-induced apoptosis through reactive oxygen species-mediated cytochrome c release and down-regulation of c-FLIP(L) expression.

PubMed

Han, Min Ae; Woo, Seon Min; Min, Kyoung-jin; Kim, Shin; Park, Jong-Wook; Kim, Dong Eun; Kim, Sang Hyun; Choi, Yung Hyun; Kwon, Taeg Kyu

2015-02-25

6-Shogaol, a potent bioactive compound in ginger (Zingiber officinale Roscoe), has been reported for anti-inflammatory and anti-cancer activity. In this study, we investigated the effect of 6-shogaol to enhance tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated apoptosis. The combined treatment with 6-shogaol and TRAIL markedly induces apoptosis in various cancer cells (renal carcinoma Caki cells, breast carcinoma MDA-MB-231 cells and glioma U118MG cells), but not in normal mesangial cells and normal mouse kidney cells. 6-Shogaol reduced the mitochondrial membrane potential (MMP) and released cytochrome c from mitochondria to cytosol via Bax activation. Furthermore, we found that 6-shogaol induced down-regulation of c-FLIP(L) expression at the post-translational levels and the overexpression of c-FLIP(L) markedly inhibited 6-shogaol plus TRAIL-induced apoptosis. Moreover, 6-shogaol increased reactive oxygen species (ROS) production in Caki cells. Pretreatment with ROS scavengers attenuated 6-shogaol plus TRAIL-induced apoptosis through inhibition of MMP reduction and down-regulation of c-FLIP(L) expression. In addition, 6-gingerol, another phenolic alkanone isolated from ginger, did not enhance TRAIL-induced apoptosis and down-regulate c-FLIP(L) expression. Taken together, our results demonstrated that 6-shogaol enhances TRAIL-mediated apoptosis in renal carcinoma Caki cells via ROS-mediated cytochrome c release and down-regulation of c-FLIP(L) expression. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The Downregulation of MiR-182 Is Associated with the Growth and Invasion of Osteosarcoma Cells through the Regulation of TIAM1 Expression.

PubMed

Hu, Jun; Lv, Guohua; Zhou, Shuguang; Zhou, Yucheng; Nie, Bangxu; Duan, Hong; Zhang, Yunfeng; Yuan, Xiaofeng

2015-01-01

Osteosarcoma is the most common primary bone malignancy in children and young adults. Increasing results suggest that discovery of microRNAs (miRNAs) might provide a novel therapeutical target for osteosarcoma. MiR-182 expression level in osteosarcoma cell lines and tissues were assayed by qRT-PCR. MiRNA mimics or inhibitor were transfected for up-regulation or down-regulation of miR-182 expression. Cell function was assayed by CCK8, migration assay and invasion assay. The target genes of miR-182 were predicated by bioinformatics algorithm (TargetScan Human). MiR-182 was down-regulated in osteosarcoma tissues and cell lines. Overexpression of miR-182 inhibited tumor growth, migration and invasion. Subsequent investigation revealed that TIAM1 was a direct and functional target of miR-182 in osteosarcoma cells. Overexpression of miR-182 impaired TIAM1-induced inhibition of proliferation and invasion in osteosarcoma cells. Down-expression of miR-182 in osteosarcoma promoted tumor growth, migration and invasion by targeting TIAM1. MiR-182 might act as a tumor suppressor gene whose down-regulation contributes to the progression and metastasis of osteosarcoma, providing a potential therapy target for osteosarcoma patients.

Reexpression of a developmentally regulated antigen in Down syndrome and Alzheimer disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolozin, B.; Scicutella, A.; Davies, P.

1988-08-01

ALZ-50 is a monoclonal antibody that recognizes a protein of apparent molecular mass 68 kilodaltons (A68). The protein is present in the brains of patients with Alzheimer disease but is not detectable in normal adult brain tissue. The authors report that ALZ-50-reactive neurons are found in normal fetal and neonatal human brain and in brain tissue from neonatal individuals with Down syndrome. Reactive neurons decrease sharply in number after age 2 and reappear in older individuals with Down syndrome and in patients with Alzheimer disease.

Differential expression of calcium-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit

USDA-ARS?s Scientific Manuscript database

Calcium has been shown to increase stress tolerance, enhance fruit firmness and reduce decay. Previously we reported that seven tomato SlSRs encode calcium/calmodulin-regulated proteins, and that their expressions are developmentally regulated during fruit development and ripening, and are also resp...

Apigenin suppresses migration and invasion of transformed cells through down-regulation of C-X-C chemokine receptor 4 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lei; Kuang, Lisha; Hitron, John Andrew

Environmental exposure to arsenic is known to cause various cancers. There are some potential relationships between cell malignant transformation and C-X-C chemokine receptor type 4 (CXCR4) expressions. Metastasis, one of the major characteristics of malignantly transformed cells, contributes to the high mortality of cells. CXCR4 and its natural chemokine ligand C-X-C motif ligand 12 (CXCL12) play a critical role in metastasis. Therefore, identification of nutritional factors which are able to inhibit CXCR4 is important for protection from environmental arsenic-induced carcinogenesis and for abolishing metastasis of malignantly transformed cells. The present study demonstrates that apigenin (4′,5,7-trihydroxyflavone), a natural dietary flavonoid, suppressedmore » CXCR4 expression in arsenic-transformed Beas-2B cells (B-AsT) and several other types of transformed/cancer cells in a dose- and time-dependent manner. Neither proteasome nor lysosome inhibitor had any effect in reducing the apigenin-induced down-regulation of CXCR4, indicating that apigenin-induced down-regulation of CXCR4 is not due to proteolytic degradation. The down-regulation of CXCR4 is mainly due to the inhibition of nuclear factor κB (NF-κB) transcriptional activity. Apigenin also abolished migration and invasion of transformed cells induced by CXCL12. In a xenograft mouse model, apigenin down-regulated CXCR4 expression and suppressed tumor growth. Taken together, our results show that apigenin is a novel inhibitor of CXCR4 expression. This dietary flavonoid has the potential to suppress migration and invasion of transformed cells and prevent environmental arsenic-induced carcinogenesis. - Highlights: • Apigenin has a potential in preventing environmental arsenic induced carcinogenesis. • Apigenin suppresses CXCR4 in malignant transformed cells in vitro and in vivo. • The down-regulation of CXCR4 is mainly due to inhibition of NF-κB activity.« less

The tae-miR408-Mediated Control of TaTOC1 Genes Transcription Is Required for the Regulation of Heading Time in Wheat1[OPEN

PubMed Central

Zhao, Xiang Yu; Hong, Po; Chen, Xiang Bin; Ye, Xing Guo; Pan, Yan You; Wang, Jian

2016-01-01

Timing of flowering is not only an interesting topic in developmental biology, but it also plays a significant role in agriculture for its effects on the maturation time of seed. The hexaploid wheat (Triticum aestivum) is one of the most important crop species whose flowering time, i.e. heading time, greatly influences yield. However, it remains unclear whether and how microRNAs regulate heading time in it. In our current study, we identified the tae-miR408 in wheat and its targets in vivo, including Triticum aestivum TIMING OF CAB EXPRESSION-A1 (TaTOC-A1), TaTOC-B1, and TaTOC-D1. The tae-miR408 levels were reciprocal to those of TaTOC1s under long-day and short-day conditions. Wheat plants with a knockdown of TaTOC1s via RNA interference and overexpression of tae-miR408 showed early-heading phenotype. Furthermore, TaTOC1s expression was down-regulated by the tae-miR408 in the hexaploid wheat. In addition, other important agronomic traits in wheat, such as plant height and flag leaf angle, were regulated by both tae-miR408 and TaTOC1s. Thus, our results suggested that the tae-miR408 functions in the wheat heading time by mediating TaTOC1s expression, and the study provides important new information on the mechanism underlying heading time regulation in wheat. PMID:26768600

The tae-miR408-Mediated Control of TaTOC1 Genes Transcription Is Required for the Regulation of Heading Time in Wheat.

PubMed

Zhao, Xiang Yu; Hong, Po; Wu, Ji Yun; Chen, Xiang Bin; Ye, Xing Guo; Pan, Yan You; Wang, Jian; Zhang, Xian Sheng

2016-03-01

Timing of flowering is not only an interesting topic in developmental biology, but it also plays a significant role in agriculture for its effects on the maturation time of seed. The hexaploid wheat (Triticum aestivum) is one of the most important crop species whose flowering time, i.e. heading time, greatly influences yield. However, it remains unclear whether and how microRNAs regulate heading time in it. In our current study, we identified the tae-miR408 in wheat and its targets in vivo, including Triticum aestivum TIMING OF CAB EXPRESSION-A1 (TaTOC-A1), TaTOC-B1, and TaTOC-D1. The tae-miR408 levels were reciprocal to those of TaTOC1s under long-day and short-day conditions. Wheat plants with a knockdown of TaTOC1s via RNA interference and overexpression of tae-miR408 showed early-heading phenotype. Furthermore, TaTOC1s expression was down-regulated by the tae-miR408 in the hexaploid wheat. In addition, other important agronomic traits in wheat, such as plant height and flag leaf angle, were regulated by both tae-miR408 and TaTOC1s. Thus, our results suggested that the tae-miR408 functions in the wheat heading time by mediating TaTOC1s expression, and the study provides important new information on the mechanism underlying heading time regulation in wheat. © 2016 American Society of Plant Biologists. All Rights Reserved.

Developmental Changes is Expression of Beta-Adrenergic Receptors in Cultures of C2C12 Skeletal Muscle Cells

NASA Technical Reports Server (NTRS)

Young, Ronald B.; Bridge, K. Y.; Vaughn, J. R.

2000-01-01

beta-Adrenergic receptor (bAR) agonists have been reported to modulate growth in several mammalian and avian species, and bAR agonists presumably exert their physiological action on skeletal muscle cells through this receptor. Because of the importance of bAR regulation on muscle protein metabolism in muscle cells, the objectives of this study were to determine the developmental expression pattern of the bAR population in C2C12 skeletal muscle cells, and to analyze changes in both the quantity and isoform expression of the major muscle protein, myosin. The number of bAR in mononucleated C2C12 cells was approximately 8,000 bAR per cell, which is comparable with the population reported in several other nonmuscle cell types. However, the bar population increased after myoblast fusion to greater than 50,000 bAR per muscle cell equivalent. The reasons for this apparent over-expression of bAR in C2C12 cells is not known. The quantity of myosin also increased after C2C12 myoblast fusion, but the quantity of myosin was less than that reported in primary muscle cell cultures. Finally, at least five different isoforms of myosin heavy chain could be resolved in C2C12 cells, and three of these exhibited either increased or decreased developmental regulation relative to the others. Thus, C2C12 myoblasts undergo developmental regulation of bAR population and myosin heavy chain isoform expression.

Proteomic analyses reveal the key roles of BrlA and AbaA in biogenesis of gliotoxin in Aspergillus fumigatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Kwang-Soo, E-mail: shinks@dju.kr; Kim, Young Hwan; Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon, 305-764

2015-07-31

The opportunistic human pathogenic fungus Aspergillus fumigatus primarily reproduces by forming a large number of asexual spores (conidia). Sequential activation of the central regulators BrlA, AbaA and WetA is necessary for the fungus to undergo asexual development. In this study, to address the presumed roles of these key developmental regulators during proliferation of the fungus, we analyzed and compared the proteomes of vegetative cells of wild type (WT) and individual mutant strains. Approximately 1300 protein spots were detectable from 2-D electrophoresis gels. Among these, 13 proteins exhibiting significantly altered accumulation levels were further identified by ESI-MS/MS. Markedly, we found thatmore » the GliM and GliT proteins associated with gliotoxin (GT) biosynthesis and self-protection of the fungus from GT were significantly down-regulated in the ΔabaA and ΔbrlA mutants. Moreover, mRNA levels of other GT biosynthetic genes including gliM, gliP, gliT, and gliZ were significantly reduced in both mutant strains, and no and low levels of GT were detectable in the ΔbrlA and ΔabaA mutant strains, respectively. As GliT is required for the protection of the fungus from GT, growth of the ΔbrlA mutant with reduced levels of GliT was severely impaired by exogenous GT. Our studies demonstrate that AbaA and BrlA positively regulate expression of the GT biosynthetic gene cluster in actively growing vegetative cells, and likely bridge morphological and chemical development during the life-cycle of A. fumigatus. - Highlights: • Proteome analyses of WT and mutants reveal 13 differentially expressed proteins. • The GliT and GliM proteins are significantly down-regulated by ΔabaA and ΔbrlA. • Expression of other gliotoxin biosynthetic genes is lowered by ΔabaA and ΔbrlA. • Growth of ΔbrlA strain lacking GliT is completely inhibited by exogenous gliotoxin. • BrlA and AbaA play key roles in biogenesis of gliotoxin in Aspergillus fumigatus.« less

E-cadherin and beta-catenin are down-regulated in prostatic bone metastases.

PubMed

Bryden, A A G; Hoyland, J A; Freemont, A J; Clarke, N W; Schembri Wismayer, D; George, N J R

2002-03-01

To determine the E-cadherin and beta-catenin expression phenotype in untreated primary prostate cancer and corresponding bone metastases. Paired bone metastasis and primary prostate specimens were obtained from 14 men with untreated metastatic prostate carcinoma. The tumours were histologically graded by an independent pathologist. Expression of mRNA for E-cadherin and beta-catenin was detected within the tumour cells using in-situ hybridization with a 35S-labelled cDNA probe. The expression of E-cadherin and beta-catenin were graded as uniform, heterogeneous or negative. The mRNA for E-cadherin was expressed in 13 of 14 primary carcinomas and 11 bone metastases; beta-catenin was expressed by 13 and nine, respectively. Of the primary tumours, nine expressed E-cadherin and beta-catenin uniformly; in contrast, all metastases had down-regulated E-cadherin and/or beta-catenin. The down-regulation of E-cadherin and beta-catenin are a feature of the metastatic phenotype, which may be a significant factor in the genesis of bone metastases. However, this does not appear to be reflected in the expression of these molecules in the primary tumours.

Expression of host defense peptides in the intestine of Eimeria-challenged chickens.

PubMed

Su, S; Dwyer, D M; Miska, K B; Fetterer, R H; Jenkins, M C; Wong, E A

2017-07-01

Avian coccidiosis is caused by the intracellular protozoan Eimeria, which produces intestinal lesions leading to weight gain depression. Current control methods include vaccination and anticoccidial drugs. An alternative approach involves modulating the immune system. The objective of this study was to profile the expression of host defense peptides such as avian beta-defensins (AvBDs) and liver expressed antimicrobial peptide 2 (LEAP2), which are part of the innate immune system. The mRNA expression of AvBD family members 1, 6, 8, 10, 11, 12, and 13 and LEAP2 was examined in chickens challenged with either E. acervulina, E. maxima, or E. tenella. The duodenum, jejunum, ileum, and ceca were collected 7 d post challenge. In study 1, E. acervulina challenge resulted in down-regulation of AvBD1, AvBD6, AvBD10, AvBD11, AvBD12, and AvBD13 in the duodenum. E. maxima challenge caused down-regulation of AvBD6, AvBD10, and AvBD11 in the duodenum, down-regulation of AvBD10 in the jejunum, but up-regulation of AvBD8 and AvBD13 in the ceca. E. tenella challenge showed no change in AvBD expression in any tissue. In study 2, which involved challenge with only E. maxima, there was down-regulation of AvBD1 in the ileum, AvBD11 in the jejunum and ileum, and LEAP2 in all 3 segments of the small intestine. The expression of LEAP2 was further examined by in situ hybridization in the jejunum of chickens from study 2. LEAP2 mRNA was expressed similarly in the enterocytes lining the villi, but not in the crypts of control and Eimeria challenged chickens. The lengths of the villi in the Eimeria challenged chickens were less than those in the control chickens, which may in part account for the observed down-regulation of LEAP2 mRNA quantified by PCR. Overall, the AvBD response to Eimeria challenge was not consistent; whereas LEAP2 was consistently down-regulated, which suggests that LEAP2 plays an important role in modulating an Eimeria infection. Published by Oxford University Press on behalf of Poultry Science Association 2017.

Emotion Regulation in Children with Down Syndrome.

ERIC Educational Resources Information Center

Smith, Maureen C.; Walden, Tedra A.

This study presents a preliminary exploration of emotion regulation in a sample of 20 children (ages 3-18 years) with Down Syndrome. Three aspects of emotion regulation (modulation, organization, flexibility) were predicted from emotion variables (affect intensity, affective expression, and autonomy-curiosity and motivation) in backward regression…

miR-139-5p inhibits isoproterenol-induced cardiac hypertrophy by targetting c-Jun.

PubMed

Ming, Su; Shui-Yun, Wang; Wei, Qiu; Jian-Hui, Li; Ru-Tai, Hui; Lei, Song; Mei, Jia; Hui, Wang; Ji-Zheng, Wang

2018-04-27

Hypertrophic cardiomyopathy (HCM) is a serious monogenic disease characterized by cardiac hypertrophy, fibrosis, sudden cardiac death, and heart failure. Previously, we identified that miR-139-5p was down-regulated in HCM patients. However, the regulatory effects of miR-139-5p remain unclear. Thus, we investigated the role of miR-139-5p in the regulation of cardiac hypertrophy. The expression of miR-139-5p in left ventricular tissues in HCM patients and mice subjected to transverse aortic constriction (TAC) was significantly down-regulated. Knockdown of miR-139-5p expression in neonatal rat cardiomyocytes (NRCMs) induced cardiomyocyte enlargement and increased atrial natriuretic polypeptide (ANP) expression. Overexpression of miR-139-5p antagonized isoproterenol (ISO)-induced cardiomyocyte enlargement and ANP/brain natriuretic peptide (BNP) up-regulation. More importantly, we found that c-Jun expression was inhibited by miR-139-5p in NRCMs. Knockdown of c-Jun expression significantly attenuated cardiac hypertrophy induced by miR-139-5p deprivation. Our data indicated that miR-139-5p was down-regulated in the hearts of HCM patients and that it inhibited cardiac hypertrophy by targetting c-Jun expression. © 2018 The Author(s).

Molecular Determinants of Sporulation in Ashbya gossypii

PubMed Central

Wasserstrom, Lisa; Lengeler, Klaus B.; Walther, Andrea; Wendland, Jürgen

2013-01-01

Regulation of development and entry into sporulation is critical for fungi to ensure survival of unfavorable environmental conditions. Here we present an analysis of gene sets regulating sporulation in the homothallic ascomycete Ashbya gossypii. Deletion of components of the conserved pheromone/starvation MAP kinase cascades, e.g., STE11 and STE7, results in increased sporulation. In kar3 mutants sporulation is severely reduced, while deletion of KAR4 as well as of homologs of central Saccharomyces cerevisiae regulators of sporulation, IME1, IME2, IME4, and NDT80, abolishes sporulation in A. gossypii. Comparison of RNAseq transcript profiles of sporulation-deficient mutants identified a set of 67 down-regulated genes, most of which were up-regulated in the oversporulating ste12 mutant. One of these differentially expressed genes is an endoglucanase encoded by ENG2. We found that Eng2p promotes hyphal fragmentation as part of the developmental program of sporulation, which generates single-celled sporangia. Sporulation-deficient strains are arrested in their development but form sporangia. Supply of new nutrients enabled sporangia to return to hyphal growth, indicating that these cells are not locked in meiosis. Double-strand break (DSB) formation by Spo11 is apparently not required for sporulation; however, the absence of DMC1, which repairs DSBs in S. cerevisiae, results in very poor sporulation in A. gossypii. We present a comprehensive analysis of the gene repertoire governing sporulation in A. gossypii and suggest an altered regulation of IME1 expression compared to S. cerevisiae. PMID:23833180

Molecular determinants of sporulation in Ashbya gossypii.

PubMed

Wasserstrom, Lisa; Lengeler, Klaus B; Walther, Andrea; Wendland, Jürgen

2013-09-01

Regulation of development and entry into sporulation is critical for fungi to ensure survival of unfavorable environmental conditions. Here we present an analysis of gene sets regulating sporulation in the homothallic ascomycete Ashbya gossypii. Deletion of components of the conserved pheromone/starvation MAP kinase cascades, e.g., STE11 and STE7, results in increased sporulation. In kar3 mutants sporulation is severely reduced, while deletion of KAR4 as well as of homologs of central Saccharomyces cerevisiae regulators of sporulation, IME1, IME2, IME4, and NDT80, abolishes sporulation in A. gossypii. Comparison of RNAseq transcript profiles of sporulation-deficient mutants identified a set of 67 down-regulated genes, most of which were up-regulated in the oversporulating ste12 mutant. One of these differentially expressed genes is an endoglucanase encoded by ENG2. We found that Eng2p promotes hyphal fragmentation as part of the developmental program of sporulation, which generates single-celled sporangia. Sporulation-deficient strains are arrested in their development but form sporangia. Supply of new nutrients enabled sporangia to return to hyphal growth, indicating that these cells are not locked in meiosis. Double-strand break (DSB) formation by Spo11 is apparently not required for sporulation; however, the absence of DMC1, which repairs DSBs in S. cerevisiae, results in very poor sporulation in A. gossypii. We present a comprehensive analysis of the gene repertoire governing sporulation in A. gossypii and suggest an altered regulation of IME1 expression compared to S. cerevisiae.

Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

PubMed

Izard, Carroll E; Abe, Jo Ann A

2004-09-01

Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

Toxins, Butyric Acid, and Other Short-Chain Fatty Acids Are Coordinately Expressed and Down-Regulated by Cysteine in Clostridium difficile

PubMed Central

Karlsson, Sture; Lindberg, Anette; Norin, Elisabeth; Burman, Lars G.; Åkerlund, Thomas

2000-01-01

It was recently found that a mixture of nine amino acids down-regulate Clostridium difficile toxin production when added to peptone yeast extract (PY) cultures of strain VPI 10463 (S. Karlsson, L. G. Burman, and T. Åkerlund, Microbiology 145:1683–1693, 1999). In the present study, seven of these amino acids were found to exhibit a moderate suppression of toxin production, whereas proline and particularly cysteine had the greatest impact, on both reference strains (n = 6) and clinical isolates (n = 28) of C. difficile (>99% suppression by cysteine in the highest toxin-producing strain). Also, cysteine derivatives such as acetylcysteine, glutathione, and cystine effectively down-regulated toxin expression. An impact of both cysteine and cystine but not of thioglycolate on toxin yield indicated that toxin expression was not regulated by the oxidation-reduction potential. Several metabolic pathways, including butyric acid and butanol production, were coinduced with the toxins in PY and down-regulated by cysteine. The enzyme 3-hydroxybutyryl coenzyme A dehydrogenase, a key enzyme in solventogenesis in Clostridium acetobutylicum, was among the most up-regulated proteins during high toxin production. The addition of butyric acid to various growth media induced toxin production, whereas the addition of butanol had the opposite effect. The results indicate a coupling between specific metabolic processes and toxin expression in C. difficile and that certain amino acids can alter these pathways coordinately. We speculate that down-regulation of toxin production by the administration of such amino acids to the colon may become a novel approach to prophylaxis and therapy for C. difficile-associated diarrhea. PMID:10992498

MiR-217 is down-regulated in psoriasis and promotes keratinocyte differentiation via targeting GRHL2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Haigang; Hou, Liyue; Liu, Jingjing

MiR-217 is a well-known tumor suppressor, and its down-regulation has been shown in a wide range of solid and leukaemic cancers. However, the biological role of miR-217 in psoriasis pathogenesis, especially in keratinocyte hyperproliferation and differentiation, is not clearly understood. In this study, we found the expression of miR-217 was markedly down-regulated in psoriasis keratinocytes of psoriatic patients. In addition, overexpression of miR-217 inhibited the proliferation and promoted the differentiation of primary human keratinocytes. On the contrary, inhibition of endogenous miR-217 increased cell proliferation and delayed differentiation. Furthermore, Grainyhead-like 2 (GRHL2) was identified as a direct target of miR-217 bymore » luciferase reporter assay. The expression of miR-217 and GRHL2 was inversely correlated in both transfected keratinocytes and in psoriasis lesional skin. Moreover, knocking down GRHL2 expression by siRNA enhanced keratinocyte differentiation. Taken together, our results demonstrate a role for miR-217 in the regulation of keratinocyte differentiation, partially through the regulation of GRHL2. - Highlights: • miR-217 is down-regulated in psoriasis skin lesions. • miR-217 inhibits the proliferation and promotes differentiation of keratinocytes. • GRHL2 is a novel target of miR-217 in keratinocytes. • GRHL2 is up-regulated and inversely correlated with miR-217 in psoriasis skin lesions.« less

Thylakoid redox signals are integrated into organellar-gene-expression-dependent retrograde signaling in the prors1-1 mutant

PubMed Central

Tadini, Luca; Romani, Isidora; Pribil, Mathias; Jahns, Peter; Leister, Dario; Pesaresi, Paolo

2012-01-01

Perturbations in organellar gene expression (OGE) and the thylakoid redox state (TRS) activate retrograde signaling pathways that adaptively modify nuclear gene expression (NGE), according to developmental and metabolic needs. The prors1-1 mutation in Arabidopsis down-regulates the expression of the nuclear gene Prolyl-tRNA Synthetase1 (PRORS1) which acts in both plastids and mitochondria, thereby impairing protein synthesis in both organelles and triggering OGE-dependent retrograde signaling. Because the mutation also affects thylakoid electron transport, TRS-dependent signals may likewise have an impact on the changes in NGE observed in this genotype. In this study, we have investigated whether signals related to TRS are actually integrated into the OGE-dependent retrograde signaling pathway. To this end, the chaos mutation (for chlorophyll a/b binding protein harvesting-organelle specific), which shows a partial loss of PSII antennae proteins and thus a reduction in PSII light absorption capability, was introduced into the prors1-1 mutant background. The resulting double mutant displayed a prors1-1-like reduction in plastid translation rate and a chaos-like decrease in PSII antenna size, whereas the hyper-reduction of the thylakoid electron transport chain, caused by the prors1-1 mutation, was alleviated, as determined by monitoring chlorophyll (Chl) fluorescence and thylakoid phosphorylation. Interestingly, a substantial fraction of the nucleus-encoded photosynthesis genes down-regulated in the prors1-1 mutant are expressed at nearly wild-type rates in prors1-1 chaos leaves, and this recovery is reflected in the steady-state levels of their protein products in the chloroplast. We therefore conclude that signals related to photosynthetic electron transport and TRS, and indirectly to carbohydrate metabolism and energy balance, are indeed fed into the OGE-dependent retrograde pathway to modulate NGE and adjust the abundance of chloroplast proteins. PMID:23293642

Alteration of gene expression by alcohol exposure at early neurulation.

PubMed

Zhou, Feng C; Zhao, Qianqian; Liu, Yunlong; Goodlett, Charles R; Liang, Tiebing; McClintick, Jeanette N; Edenberg, Howard J; Li, Lang

2011-02-21

We have previously demonstrated that alcohol exposure at early neurulation induces growth retardation, neural tube abnormalities, and alteration of DNA methylation. To explore the global gene expression changes which may underline these developmental defects, microarray analyses were performed in a whole embryo mouse culture model that allows control over alcohol and embryonic variables. Alcohol caused teratogenesis in brain, heart, forelimb, and optic vesicle; a subset of the embryos also showed cranial neural tube defects. In microarray analysis (accession number GSM9545), adopting hypothesis-driven Gene Set Enrichment Analysis (GSEA) informatics and intersection analysis of two independent experiments, we found that there was a collective reduction in expression of neural specification genes (neurogenin, Sox5, Bhlhe22), neural growth factor genes [Igf1, Efemp1, Klf10 (Tieg), and Edil3], and alteration of genes involved in cell growth, apoptosis, histone variants, eye and heart development. There was also a reduction of retinol binding protein 1 (Rbp1), and de novo expression of aldehyde dehydrogenase 1B1 (Aldh1B1). Remarkably, four key hematopoiesis genes (glycophorin A, adducin 2, beta-2 microglobulin, and ceruloplasmin) were absent after alcohol treatment, and histone variant genes were reduced. The down-regulation of the neurospecification and the neurotrophic genes were further confirmed by quantitative RT-PCR. Furthermore, the gene expression profile demonstrated distinct subgroups which corresponded with two distinct alcohol-related neural tube phenotypes: an open (ALC-NTO) and a closed neural tube (ALC-NTC). Further, the epidermal growth factor signaling pathway and histone variants were specifically altered in ALC-NTO, and a greater number of neurotrophic/growth factor genes were down-regulated in the ALC-NTO than in the ALC-NTC embryos. This study revealed a set of genes vulnerable to alcohol exposure and genes that were associated with neural tube defects during early neurulation.

Development and regulation of chloride homeostasis in the central nervous system.

PubMed

Watanabe, Miho; Fukuda, Atsuo

2015-01-01

γ-Aminobutyric acid (GABA) is the main inhibitory neurotransmitter of the mature central nervous system (CNS). The developmental switch of GABAergic transmission from excitation to inhibition is induced by changes in Cl(-) gradients, which are generated by cation-Cl(-) co-transporters. An accumulation of Cl(-) by the Na(+)-K(+)-2Cl(-) co-transporter (NKCC1) increases the intracellular Cl(-) concentration ([Cl(-)]i) such that GABA depolarizes neuronal precursors and immature neurons. The subsequent ontogenetic switch, i.e., upregulation of the Cl(-)-extruder KCC2, which is a neuron-specific K(+)-Cl(-) co-transporter, with or without downregulation of NKCC1, results in low [Cl(-)]i levels and the hyperpolarizing action of GABA in mature neurons. Development of Cl(-) homeostasis depends on developmental changes in NKCC1 and KCC2 expression. Generally, developmental shifts (decreases) in [Cl(-)]i parallel the maturation of the nervous system, e.g., early in the spinal cord, hypothalamus and thalamus, followed by the limbic system, and last in the neocortex. There are several regulators of KCC2 and/or NKCC1 expression, including brain-derived neurotrophic factor (BDNF), insulin-like growth factor (IGF), and cystic fibrosis transmembrane conductance regulator (CFTR). Therefore, regionally different expression of these regulators may also contribute to the regional developmental shifts of Cl(-) homeostasis. KCC2 and NKCC1 functions are also regulated by phosphorylation by enzymes such as PKC, Src-family tyrosine kinases, and WNK1-4 and their downstream effectors STE20/SPS1-related proline/alanine-rich kinase (SPAK)-oxidative stress responsive kinase-1 (OSR1). In addition, activation of these kinases is modulated by humoral factors such as estrogen and taurine. Because these transporters use the electrochemical driving force of Na(+) and K(+) ions, topographical interaction with the Na(+)-K(+) ATPase and its modulators such as creatine kinase (CK) should modulate functions of Cl(-) transporters. Therefore, regional developmental regulation of these regulators and modulators of Cl(-) transporters may also play a pivotal role in the development of Cl(-) homeostasis.

Comparative gene expression analysis of bovine nuclear-transferred embryos with different developmental potential by cDNA microarray and real-time PCR to determine genes that might reflect calf normality.

PubMed

Kato, Yoko; Li, Xiangping; Amarnath, Dasari; Ushizawa, Koichi; Hashizume, Kazuyoshi; Tokunaga, Tomoyuki; Taniguchi, Masanori; Tsunoda, Yukio

2007-01-01

Placental abnormalities are the main factor in the high incidence of somatic cell clone abnormalities. The expression of several trophoblast cell-specific molecules is enhanced during gestational days 7 to 14. To determine the possible genes whose expression patterns might reflect calf normality, we first compared the gene expression profiles on day 15 between in vitro-fertilized (IVF) embryos and two types of somatic cell nuclear-transferred embryos with either a high (FNT) or low (CNT) incidence of neonatal abnormalities using a cDNA microarray containing 16 of 21 placenta-specific genes developed from tissues collected across gestation. To identify significant genes from the screening of day 15 embryos, genes with a less than two-fold difference in expression between IVF and CNT embryos, and those with a greater than two-fold difference between IVF and FNT and between CNT and FNT were considered to contribute to clone abnormalities. These two comparisons revealed 18 down-regulated and 18 upregulated genes of the 1722 genes examined. We then examined the expression levels of 10 genes with known functions in eight-cell and blastocyst-stage embryos by real-time PCR. The mRNA expression pattern of interferon (IFN)-tau, a trophectoderm-related gene, differed between IVF, CNT, and FNT eight-cell embryos; few or none of the IVF or CNT eight-cell embryos expressed IFN-tau mRNA, but all eight-cell FNT embryos expressed IFN-tau. IFN-tau mRNA expression was significantly higher in IVF blastocysts, however, than in nuclear-transferred blastocysts. Average IFN-tau mRNA expression in FNT blastocysts was not different from that in CNT blastocysts, due to one CNT blastocyst with high expression. The precise relation between early expression of IFN-tau mRNA and inferior developmental potential in cloned embryos should be examined further.

Genome-wide identification, isolation and expression analysis of auxin response factor (ARF) gene family in sweet orange (Citrus sinensis)

PubMed Central

Li, Si-Bei; OuYang, Wei-Zhi; Hou, Xiao-Jin; Xie, Liang-Liang; Hu, Chun-Gen; Zhang, Jin-Zhi

2015-01-01

Auxin response factors (ARFs) are an important family of proteins in auxin-mediated response, with key roles in various physiological and biochemical processes. To date, a genome-wide overview of the ARF gene family in citrus was not available. A systematic analysis of this gene family in citrus was begun by carrying out a genome-wide search for the homologs of ARFs. A total of 19 nonredundant ARF genes (CiARF) were found and validated from the sweet orange. A comprehensive overview of the CiARFs was undertaken, including the gene structures, phylogenetic analysis, chromosome locations, conserved motifs of proteins, and cis-elements in promoters of CiARF. Furthermore, expression profiling using real-time PCR revealed many CiARF genes, albeit with different patterns depending on types of tissues and/or developmental stages. Comprehensive expression analysis of these genes was also performed under two hormone treatments using real-time PCR. Indole-3-acetic acid (IAA) and N-1-napthylphthalamic acid (NPA) treatment experiments revealed differential up-regulation and down-regulation, respectively, of the 19 citrus ARF genes in the callus of sweet orange. Our comprehensive analysis of ARF genes further elucidates the roles of CiARF family members during citrus growth and development process. PMID:25870601

Integrated transcriptomic and proteomic profiling of white spruce stems during the transition from active growth to dormancy.

PubMed

Galindo González, Leonardo M; El Kayal, Walid; Ju, Chelsea J-T; Allen, Carmen C G; King-Jones, Susanne; Cooke, Janice E K

2012-04-01

In the autumn, stems of woody perennials such as forest trees undergo a transition from active growth to dormancy. We used microarray transcriptomic profiling in combination with a proteomics analysis to elucidate processes that occur during this growth-to-dormancy transition in a conifer, white spruce (Picea glauca[Moench] Voss). Several differentially expressed genes were likely associated with the developmental transition that occurs during growth cessation in the cambial zone and the concomitant completion of cell maturation in vascular tissues. Genes encoding for cell wall and membrane biosynthetic enzymes showed transcript abundance patterns consistent with completion of cell maturation, and also of cell wall and membrane modifications potentially enabling cells to withstand the harsh conditions of winter. Several differentially expressed genes were identified that encoded putative regulators of cambial activity, cell development and of the photoperiodic pathway. Reconfiguration of carbon allocation figured centrally in the tree's overwintering preparations. For example, genes associated with carbon-based defences such as terpenoids were down-regulated, while many genes associated with protein-based defences and other stress mitigation mechanisms were up-regulated. Several of these correspond to proteins that were accumulated during the growth-to-dormancy transition, emphasizing the importance of stress protection in the tree's adaptive response to overwintering. © 2011 Blackwell Publishing Ltd.

hZIP1 zinc uptake transporter down regulation and zinc depletion in prostate cancer

PubMed Central

Franklin, Renty B; Feng, Pei; Milon, B; Desouki, Mohamed M; Singh, Keshav K; Kajdacsy-Balla, André; Bagasra, Omar; Costello, Leslie C

2005-01-01

Background The genetic and molecular mechanisms responsible for and associated with the development and progression of prostate malignancy are largely unidentified. The peripheral zone is the major region of the human prostate gland where malignancy develops. The normal peripheral zone glandular epithelium has the unique function of accumulating high levels of zinc. In contrast, the ability to accumulate zinc is lost in the malignant cells. The lost ability of the neoplastic epithelial cells to accumulate zinc is a consistent factor in their development of malignancy. Recent studies identified ZIP1 (SLC39A1) as an important zinc transporter involved in zinc accumulation in prostate cells. Therefore, we investigated the possibility that down-regulation of hZIP1 gene expression might be involved in the inability of malignant prostate cells to accumulate zinc. To address this issue, the expression of hZIP1 and the depletion of zinc in malignant versus non-malignant prostate glands of prostate cancer tissue sections were analyzed. hZIP1 expression was also determined in malignant prostate cell lines. Results hZIP1 gene expression, ZIP1 transporter protein, and cellular zinc were prominent in normal peripheral zone glandular epithelium and in benign hyperplastic glands (also zinc accumulating glands). In contrast, hZIP1 gene expression and transporter protein were markedly down-regulated and zinc was depleted in adenocarcinomatous glands and in prostate intra-epithelial neoplastic foci (PIN). These changes occur early in malignancy and are sustained during its progression in the peripheral zone. hZIP1 is also expressed in the malignant cell lines LNCaP, PC-3, DU-145; and in the nonmalignant cell lines HPr-1 and BPH-1. Conclusion The studies clearly establish that hZIP1 gene expression is down regulated and zinc is depleted in adenocarcinomatous glands. The fact that all the malignant cell lines express hZIP1 indicates that the down-regulation in adenocarcinomatous glands is likely due to in situ gene silencing. These observations, coupled with the numerous and consistent reports of loss of zinc accumulation in malignant cells in prostate cancer, lead to the plausible proposal that down regulation of hZIP1 is a critical early event in the development prostate cancer. PMID:16153295

Role of Endogenous Cholecystokinin on Growth of Human Pancreatic Cancer

PubMed Central

Matters, Gail L.; McGovern, Christopher; Harms, John F.; Markovic, Kevin; Anson, Krystal; Jayakumar, Calpurnia; Martenis, Melissa; Awad, Christina; Smith, Jill P.

2012-01-01

Cholecystokinin (CCK) and gastrin stimulate growth of pancreatic cancer. Although down regulation of gastrin inhibits growth of pancreatic cancer, the contribution of endogenous CCK to tumor growth is unknown. The purpose of this study was to evaluate the role of endogenous CCK on autocrine growth of pancreatic cancer. Pancreatic cancer cell lines were analyzed for CCK mRNA and peptide expression by real time RT-PCR and radioimmunoassay, respectively. The effect of endogenous CCK on growth was evaluated by treating cancer cells with CCK neutralizing antibodies and by down regulating CCK mRNA by RNAi. Wild type pancreatic cancer cells expressed significantly lower CCK mRNA and peptide levels than gastrin. Neither treatment of pancreatic cancer cells with CCK antibodies nor the down regulation of CCK mRNA and peptide by shRNAs altered growth in vitro or in vivo. Conversely, when gastrin mRNA expression was down regulated, the same cells failed to produce tumors in spite of having sustained levels of endogenous CCK. Pancreatic cancer cells produce CCK and gastrin; however, the autocrine production of gastrin is more important for stimulating tumor growth. PMID:21186400

Gene Duplication and Evolutionary Innovations in Hemoglobin-Oxygen Transport

PubMed Central

2016-01-01

During vertebrate evolution, duplicated hemoglobin (Hb) genes diverged with respect to functional properties as well as the developmental timing of expression. For example, the subfamilies of genes that encode the different subunit chains of Hb are ontogenetically regulated such that functionally distinct Hb isoforms are expressed during different developmental stages. In some vertebrate taxa, functional differentiation between co-expressed Hb isoforms may also contribute to physiologically important divisions of labor. PMID:27053736

Microarray Analysis of Gene Expression Alteration in Human Middle Ear Epithelial Cells Induced by Asian Sand Dust.

PubMed

Go, Yoon Young; Park, Moo Kyun; Kwon, Jee Young; Seo, Young Rok; Chae, Sung-Won; Song, Jae-Jun

2015-12-01

The primary aim of this study is to evaluate the gene expression profile of Asian sand dust (ASD)-treated human middle ear epithelial cell (HMEEC) using microarray analysis. The HMEEC was treated with ASD (400 µg/mL) and total RNA was extracted for microarray analysis. Molecular pathways among differentially expressed genes were further analyzed. For selected genes, the changes in gene expression were confirmed by real-time polymerase chain reaction. A total of 1,274 genes were differentially expressed by ASD. Among them, 1,138 genes were 2 folds up-regulated, whereas 136 genes were 2 folds down-regulated. Up-regulated genes were mainly involved in cellular processes, including apoptosis, cell differentiation, and cell proliferation. Down-regulated genes affected cellular processes, including apoptosis, cell cycle, cell differentiation, and cell proliferation. The 10 genes including ADM, CCL5, EDN1, EGR1, FOS, GHRL, JUN, SOCS3, TNF, and TNFSF10 were identified as main modulators in up-regulated genes. A total of 11 genes including CSF3, DKK1, FOSL1, FST, TERT, MMP13, PTHLH, SPRY2, TGFBR2, THBS1, and TIMP1 acted as main components of pathway associated with 2-fold down regulated genes. We identified the differentially expressed genes in ASD-treated HMEEC. Our work indicates that air pollutant like ASD, may play an important role in the pathogenesis of otitis media.

Assembly and Analysis of Differential Transcriptome Responses of Hevea brasiliensis on Interaction with Microcyclus ulei

PubMed Central

Restrepo Restrepo, Silvia; Aristizábal Gutiérrez, Fabio Ancizar; Montoya Castaño, Dolly

2015-01-01

Natural rubber (Hevea brasiliensis) is a tropical tree used commercially for the production of latex, from which 40,000 products are generated. The fungus Microcyclus ulei infects this tree, causing South American leaf blight (SALB) disease. This disease causes developmental delays and significant crop losses, thereby decreasing the production of latex. Currently several groups are working on obtaining clones of rubber tree with durable resistance to SALB through the use of extensive molecular biology techniques. In this study, we used a secondary clone that was resistant to M. ulei isolate GCL012. This clone, FX 3864 was obtained by crossing between clones PB 86 and B 38 (H. brasiliensis x H. brasiliensis). RNA-Seq high-throughput sequencing technology was used to analyze the differential expression of the FX 3864 clone transcriptome at 0 and 48 h post infection (hpi) with the M. ulei isolate GCL012. A total of 158,134,220 reads were assembled using the de novo assembly strategy to generate 90,775 contigs with an N50 of 1672. Using a reference-based assembly, 76,278 contigs were generated with an N50 of 1324. We identified 86 differentially expressed genes associated with the defense response of FX 3864 to GCL012. Seven putative genes members of the AP2/ERF ethylene (ET)-dependent superfamily were found to be down-regulated. An increase in salicylic acid (SA) was associated with the up-regulation of three genes involved in cell wall synthesis and remodeling, as well as in the down-regulation of the putative gene CPR5. The defense response of FX 3864 against the GCL012 isolate was associated with the antagonistic SA, ET and jasmonic acid (JA) pathways. These responses are characteristic of plant resistance to biotrophic pathogens. PMID:26287380

Striatal FoxP2 Is Actively Regulated during Songbird Sensorimotor Learning

PubMed Central

Teramitsu, Ikuko; Poopatanapong, Amy; Torrisi, Salvatore; White, Stephanie A.

2010-01-01

Background Mutations in the FOXP2 transcription factor lead to language disorders with developmental onset. Accompanying structural abnormalities in cortico-striatal circuitry indicate that at least a portion of the behavioral phenotype is due to organizational deficits. We previously found parallel FoxP2 expression patterns in human and songbird cortico/pallio-striatal circuits important for learned vocalizations, suggesting that FoxP2's function in birdsong may generalize to speech. Methodology/Principal Findings We used zebra finches to address the question of whether FoxP2 is additionally important in the post-organizational function of these circuits. In both humans and songbirds, vocal learning depends on auditory guidance to achieve and maintain optimal vocal output. We tested whether deafening prior to or during the sensorimotor phase of song learning disrupted FoxP2 expression in song circuitry. As expected, the songs of deafened juveniles were abnormal, however basal FoxP2 levels were unaffected. In contrast, when hearing or deaf juveniles sang for two hours in the morning, FoxP2 was acutely down-regulated in the striatal song nucleus, area X. The extent of down-regulation was similar between hearing and deaf birds. Interestingly, levels of FoxP2 and singing were correlated only in hearing birds. Conclusions/Significance Hearing appears to link FoxP2 levels to the amount of vocal practice. As juvenile birds spent more time practicing than did adults, their FoxP2 levels are likely to be low more often. Behaviorally-driven reductions in the mRNA encoding this transcription factor could ultimately affect downstream molecules that function in vocal exploration, especially during sensorimotor learning. PMID:20062527

Identification of key microRNAs and genes in preeclampsia by bioinformatics analysis

PubMed Central

Luo, Shouling; Cao, Nannan; Tang, Yao; Gu, Weirong

2017-01-01

Preeclampsia is a leading cause of perinatal maternal–foetal mortality and morbidity. The aim of this study is to identify the key microRNAs and genes in preeclampsia and uncover their potential functions. We downloaded the miRNA expression profile of GSE84260 and the gene expression profile of GSE73374 from the Gene Expression Omnibus database. Differentially expressed miRNAs and genes were identified and compared to miRNA-target information from MiRWalk 2.0, and a total of 65 differentially expressed miRNAs (DEMIs), including 32 up-regulated miRNAs and 33 down-regulated miRNAs, and 91 differentially expressed genes (DEGs), including 83 up-regulated genes and 8 down-regulated genes, were identified. The pathway enrichment analyses of the DEMIs showed that the up-regulated DEMIs were enriched in the Hippo signalling pathway and MAPK signalling pathway, and the down-regulated DEMIs were enriched in HTLV-I infection and miRNAs in cancers. The gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) enrichment analyses of the DEGs were performed using Multifaceted Analysis Tool for Human Transcriptome. The up-regulated DEGs were enriched in biological processes (BPs), including the response to cAMP, response to hydrogen peroxide and cell-cell adhesion mediated by integrin; no enrichment of down-regulated DEGs was identified. KEGG analysis showed that the up-regulated DEGs were enriched in the Hippo signalling pathway and pathways in cancer. A PPI network of the DEGs was constructed by using Cytoscape software, and FOS, STAT1, MMP14, ITGB1, VCAN, DUSP1, LDHA, MCL1, MET, and ZFP36 were identified as the hub genes. The current study illustrates a characteristic microRNA profile and gene profile in preeclampsia, which may contribute to the interpretation of the progression of preeclampsia and provide novel biomarkers and therapeutic targets for preeclampsia. PMID:28594854

Regulation of SFRP-1 expression in the rat dental follicle.

PubMed

Liu, Dawen; Yao, Shaomian; Wise, Gary E

2012-01-01

Tooth eruption requires osteoclastogenesis and subsequent bone resorption. Secreted frizzled-related protein-1 (SFRP-1) negatively regulates osteoclastogenesis. Our previous studies indicated that SFRP-1 is expressed in the rat dental follicle (DF), with reduced expression at days 3 and 9 close to the times for the major and minor bursts of osteoclastogenesis, respectively; but it remains unclear as to what molecules contribute to its reduced expression at these critical times. Thus, it was the aim of this study to determine which molecules regulate the expression of SFRP-1 in the DF. To that end, the DF cells were treated with cytokines that are maximally expressed at days 3 or 9, and SFRP-1 expression was determined. Our study indicated that colony-stimulating factor-1 (CSF-1), a molecule maximally expressed in the DF at day 3, down-regulated SFRP-1 expression. As to endothelial monocyte-activating polypeptide II (EMAP-II), a highly expressed molecule in the DF at day 3, it had no effect on the expression of SFRP-1. However, when EMAP-II was knocked down by siRNA, the expression of SFRP-1 was elevated, and this elevated SFRP-1 expression could be reduced by adding recombinant EMAP-II protein. This suggests that EMAP-II maintained a lower level of SFRP-1 in the DF. TNF-α is a molecule maximally expressed at day 9, and this study indicated that it also down-regulated the expression of SFRP-1 in the DF cells. In conclusion, CSF-1 and EMAP-II may contribute to the reduced SFRP-1 expression seen on day 3, while TNF-α may contribute to the reduced SFRP-1 expression at day 9.

Role of Caspase-3 Cleaved IP3R1 on Ca2+ Homeostasis and Developmental Competence of Mouse Oocytes and Eggs

PubMed Central

Zhang, Nan; Fissore, Rafael. A.

2014-01-01

Apoptosis in most cell types is accompanied by altered Ca2+ homeostasis. During apoptosis, caspase-3 mediated cleavage of the type 1 inositol 1,4,5-trisphosphate receptor (IP3R1) generates a 95-kDa C-terminal fragment (C-IP3R1), which represents the channel domain of the receptor. Aged mouse eggs display abnormal Ca2+ homeostasis and express C-IP3R1, although whether or not C-IP3R1 expression contributes to Ca2+ misregulation or a decrease in developmental competency is unknown. We sought to answer these questions by injecting in mouse oocytes and eggs cRNAs encoding CIP3R1. We found that: 1) expression of C-IP3R1 in eggs lowered the Ca2+ content of the endoplasmic reticulum (ER), although, as C-IP3R1 is quickly degraded at this stage, its expression did not impair pre-implantation embryo development; 2) expression of CIP3R1 in eggs enhanced fragmentation associated with aging; 3) endogenous IP3R1 is required for aging associated apoptosis, as its down-regulation prevented fragmentation, and expression of C-IP3R1 in eggs with downregulated IP3R1 partly restored fragmentation; 4) C-IP3R1 expression in GV oocytes resulted in persistent levels of protein, which abolished the increase in the ER releasable Ca2+ pool that occurs during maturation, undermined the Ca2+ oscillatory ability of matured eggs and their activation potential. Collectively, this study supports a role for IP3R1 and C-IP3R1 in regulating Ca2+ homeostasis and the ER Ca2+ content during oocyte maturation. Nevertheless, the role of C-IP3R1 on Ca2+ homeostasis in aged eggs seems minor, as in MII eggs the majority of endogenous IP3R1 remains intact and C-IP3R1 undergoes rapid turnover. PMID:24692207

Function and regulation of heat shock factor 2 during mouse embryogenesis

PubMed Central

Rallu, M.; Loones, Mt.; Lallemand, Y.; Morimoto, R.; Morange, M.; Mezger, V.

1997-01-01

The spontaneous expression of heat shock genes during development is well documented in many animal species, but the mechanisms responsible for this developmental regulation are only poorly understood. In vertebrates, additional heat shock transcription factors, distinct from the heat shock factor 1 (HSF1) involved in the stress response, were suggested to be involved in this developmental control. In particular, the mouse HSF2 has been found to be active in testis and during preimplantation development. However, the role of HSF2 and its mechanism of activation have remained elusive due to the paucity of data on its expression during development. In this study, we have examined HSF2 expression during the postimplantation phase of mouse development. Our data show a developmental regulation of HSF2, which is expressed at least until 15.5 days of embryogenesis. It becomes restricted to the central nervous system during the second half of gestation. It is expressed in the ventricular layer of the neural tube which contains mitotically active cells but not in postmitotic neurons. Parallel results were obtained for mRNA, protein, and activity levels, demonstrating that the main level of control was transcriptional. The detailed analysis of the activity of a luciferase reporter gene under the control of the hsp70.1 promoter, as well as the description of the protein expression patterns of the major heat shock proteins in the central nervous system, show that HSF2 and heat shock protein expression domains do not coincide. This result suggests that HFS2 might be involved in other regulatory developmental pathways and paves the way to new functional approaches. PMID:9122205

Molecular cloning and expression profile of an abiotic stress and hormone responsive MYB transcription factor gene from Panax ginseng.

PubMed

Afrin, Sadia; Zhu, Jie; Cao, Hongzhe; Huang, Jingjia; Xiu, Hao; Luo, Tiao; Luo, Zhiyong

2015-04-01

The v-myb avian myeloblastosis viral oncogene homolog (MYB) family constitutes one of the most abundant groups of transcription factors and plays vital roles in developmental processes and defense responses in plants. A ginseng (Panax ginseng C.A. Meyer) MYB gene was cloned and designated as PgMYB1. The cDNA of PgMYB1 is 762 base pairs long and encodes the R2R3-type protein consisting 238 amino acids. Subcellular localization showed that PgMYB1-mGFP5 fusion protein was specifically localized in the nucleus. To understand the functional roles of PgMYB1, we investigated the expression patterns of PgMYB1 in different tissues and under various conditions. Quantitative real-time polymerase chain reaction and western blot analysis showed that PgMYB1 was expressed at higher level in roots, leaves, and lateral roots than in stems and seeds. The expression of PgMYB1 was up-regulated by abscisic acid, salicylic acid, NaCl, and cold (chilling), and down-regulated by methyl jasmonate. These results suggest that PgMYB1 might be involved in responding to environmental stresses and hormones. © The Author 2015. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

The Use of RNA Sequencing and Correlation Network Analysis to Study Potential Regulators of Crabapple Leaf Color Transformation.

PubMed

Yang, Tuo; Li, Keting; Hao, Suxiao; Zhang, Jie; Song, Tingting; Tian, Ji; Yao, Yuncong

2018-05-01

Anthocyanins are plant pigments that contribute to the color of leaves, flowers and fruits, and that are beneficial to human health in the form of dietary antioxidants. The study of a transformable crabapple cultivar, 'India magic', which has red buds and green mature leaves, using mRNA profiling of four leaf developmental stages, allowed us to characterize molecular mechanisms regulating red color formation in early leaf development and the subsequent rapid down-regulation of anthocyanin biosynthesis. This analysis of differential gene expression during leaf development revealed that ethylene signaling-responsive genes are up-regulated during leaf pigmentation. Genes in the ethylene response factor (ERF), SPL, NAC, WRKY and MADS-box transcription factor (TF) families were identified in two weighted gene co-expression network analysis (WGCNA) modules as having a close relationship to anthocyanin accumulation. Analyses of network hub genes indicated that SPL TFs are located in central positions within anthocyanin-related modules. Furthermore, cis-motif and yeast one-hybrid assays suggested that several anthocyanin biosynthetic or regulatory genes are potential targets of SPL8 and SPL13B. Transient silencing of these two genes confirmed that they play a role in co-ordinating anthocyanin biosynthesis and crabapple leaf development. We present a high-resolution method for identifying regulatory modules associated with leaf pigmentation, which provides a platform for functional genomic studies of anthocyanin biosynthesis.

Understanding the Broad Influence of Sex Hormones and Sex Differences in the Brain

PubMed Central

McEwen, Bruce S.; Milner, Teresa A.

2016-01-01

Sex hormones act throughout the entire brain of both males and females via both genomic and non-genomic receptors. Sex hormones can act through many cellular and molecular processes that alter structure and function of neural systems and influence behavior as well as providing neuroprotection. Within neurons, sex hormone receptors are found in nuclei and are also located near membranes where they are associated with presynaptic terminals, mitochondria, spine apparatus, post-synaptic densities. Sex hormone receptors also are found in glial cells. Hormonal regulation of a variety of signaling pathways as well as direct and indirect effects upon gene expression induce spine synapses, up- or down-regulate and alter the distribution of neurotransmitter receptors, regulate neuropeptide expression and cholinergic and GABAergic activity as well as calcium sequestration and oxidative stress. Many neural and behavioral functions are affected, including mood, cognitive function, blood pressure regulation, motor coordination, pain and opioid sensitivity. Subtle sex differences exist for many of these functions that are developmentally programmed by hormones and by not-yet-precisely-defined genetic factors including the mitochondrial genome. These sex differences and responses to sex hormones in brain regions, and upon functions not previously regarded as subject to such differences, indicates that we are entering a new era of our ability to understand and appreciate the diversity of gender-related behaviors and brain functions. PMID:27870427

Angiotensin II up-regulates PAX2 oncogene expression and activity in prostate cancer via the angiotensin II type I receptor.

PubMed

Bose, Sudeep K; Gibson, Willietta; Giri, Shailendra; Nath, Narender; Donald, Carlton D

2009-09-01

Paired homeobox 2 gene (PAX2) is a transcriptional regulator, aberrantly expressed in prostate cancer cells and its down-regulation promotes cell death in these cells. The molecular mechanisms of tumor progression by PAX2 over-expression are still unclear. However, it has been reported that angiotensin-II (A-II) induces cell growth in prostate cancer via A-II type 1 receptor (AT1R) and is mediated by the phosphorylation of mitogen activated protein kinase (MAPK) as well as signal transducer and activator of transcription 3 (STAT3). Here we have demonstrated that A-II up-regulates PAX2 expression in prostate epithelial cells and prostate cancer cell lines resulting in increased cell growth. Furthermore, AT1R receptor antagonist losartan was shown to inhibit A-II induced PAX2 expression in prostate cancer. Moreover, analysis using pharmacological inhibitors against MEK1/2, ERK1/2, JAK-II, and phospho-STAT3 demonstrated that AT1R-mediated stimulatory effect of A-II on PAX2 expression was regulated in part by the phosphorylation of ERK1/2, JAK II, and STAT3 pathways. In addition, we have showed that down-regulation of PAX2 by an AT1R antagonist as well as JAK-II and STAT3 inhibitors suppress prostate cancer cell growth. Collectively, these findings show for the first time that the renin-angiotensin system (RAS) may promote prostate tumorigenesis via up-regulation of PAX2 expression. Therefore, PAX2 may be a novel therapeutic target for the treatment of carcinomas such as prostate cancer via the down-regulation of its expression by targeting the AT1R signaling pathways.

AtMYB44 regulates WRKY70 expression and modulates antagonistic interaction between salicylic acid and jasmonic acid signaling.

PubMed

Shim, Jae Sung; Jung, Choonkyun; Lee, Sangjoon; Min, Kyunghun; Lee, Yin-Won; Choi, Yeonhee; Lee, Jong Seob; Song, Jong Tae; Kim, Ju-Kon; Choi, Yang Do

2013-02-01

The role of AtMYB44, an R2R3 MYB transcription factor, in signaling mediated by jasmonic acid (JA) and salicylic acid (SA) is examined. AtMYB44 is induced by JA through CORONATINE INSENSITIVE 1 (COI1). AtMYB44 over-expression down-regulated defense responses against the necrotrophic pathogen Alternaria brassicicola, but up-regulated WRKY70 and PR genes, leading to enhanced resistance to the biotrophic pathogen Pseudomonas syringae pv. tomato DC3000. The knockout mutant atmyb44 shows opposite effects. Induction of WRKY70 by SA is reduced in atmyb44 and npr1-1 mutants, and is totally abolished in atmyb44 npr1-1 double mutants, showing that WRKY70 is regulated independently through both NPR1 and AtMYB44. AtMYB44 over-expression does not change SA content, but AtMYB44 over-expression phenotypes, such as retarded growth, up-regulated PR1 and down-regulated PDF1.2 are reversed by SA depletion. The wrky70 mutation suppressed AtMYB44 over-expression phenotypes, including up-regulation of PR1 expression and down-regulation of PDF1.2 expression. β-estradiol-induced expression of AtMYB44 led to WRKY70 activation and thus PR1 activation. AtMYB44 binds to the WRKY70 promoter region, indicating that AtMYB44 acts as a transcriptional activator of WRKY70 by directly binding to a conserved sequence element in the WRKY70 promoter. These results demonstrate that AtMYB44 modulates antagonistic interaction by activating SA-mediated defenses and repressing JA-mediated defenses through direct control of WRKY70. © 2012 The Authors The Plant Journal © 2012 Blackwell Publishing Ltd.

Oxygen-glucose deprivation regulates BACE1 expression through induction of autophagy in Neuro-2a/APP695 cells

PubMed Central

Chen, Rong-fu; Zhang, Ting; Sun, Yin-yi; Sun, Ya-meng; Chen, Wen-qi; Shi, Nan; Shen, Fang; Zhang, Yan; Liu, Kang-yong; Sun, Xiao-jiang

2015-01-01

Our previous findings have demonstrated that autophagy regulation can alleviate the decline of learning and memory by eliminating deposition of extracellular beta-amyloid peptide (Aβ) in the brain after stroke, but the exact mechanism is unclear. It is presumed that the regulation of beta-site APP-cleaving enzyme 1 (BACE1), the rate-limiting enzyme in metabolism of Aβ, would be a key site. Neuro-2a/amyloid precursor protein 695 (APP695) cell models of cerebral ischemia were established by oxygen-glucose deprivation to investigate the effects of Rapamycin (an autophagy inducer) or 3-methyladenine (an autophagy inhibitor) on the expression of BACE1. Either oxygen-glucose deprivation or Rapamycin down-regulated the expression of BACE1 while 3-methyladenine up-regulated BACE1 expression. These results confirm that oxygen-glucose deprivation down-regulates BACE1 expression in Neuro-2a/APP695 cells through the introduction of autophagy. PMID:26604904

Down-regulation of BAX gene during carcinogenesis and acquisition of resistance to 5-FU in colorectal cancer.

PubMed

Manoochehri, Mehdi; Karbasi, Ashraf; Bandehpour, Mojgan; Kazemi, Bahram

2014-04-01

Carcinogenesis and resistance to chemotherapy could be as results of expression variations in apoptosis regulating genes. Changes in the expression of apoptosis interfering genes may contribute to colorectal carcinogenesis and resistance to 5-Flourouracil (5-FU) during treatment schedule period. The present study aimed to evaluate the expression of pro-apoptotic and anti-apoptotic genes in colorectal cancer tumor tissues, normal adjacent tissues, and tumor colorectal cancer cell line during acquiring resistance to 5-FU in HT-29 based on Bolus treatment protocol. The normal and tumor tissues were obtained from hospital after surgery and total RNA was extracted for expression analysis. The HT-29 colorectal cancer cell line was cultured and exposed with 5-FU in three stages based on Bolus protocol. The MTT assay and Real Time PCR were carried out to determine the sensitivity to the drug and expression of desired genes, respectively. The obtained data showed that Proapoptotic genes, BAX and BID, were down-regulated in resistant derivate cells compared to wild type HT-29 cells. On the other hand Antiapoptotic genes, CIAP1 and XIAP, showed upregulation in resistant cells compared to wild type ones. Furthermore, BAX and FAS genes showed down-regulation in tumor samples in comparison to normal adjacent tissues. In conclusion, the results of our study suggest that BAX down-regulation could contribute as an important factor during both colorectal carcinogenesis and cell resistance to 5-FU.

Comparisons of Transcriptional Profiles of Gut Genes between Cry1Ab-Resistant and Susceptible Strains of Ostrinia nubilalis Revealed Genes Possibly Related to the Adaptation of Resistant Larvae to Transgenic Cry1Ab Corn.

PubMed

Yao, Jianxiu; Zhu, Yu-Cheng; Lu, Nanyan; Buschman, Lawrent L; Zhu, Kun Yan

2017-01-30

A microarray developed on the basis of 2895 unique transcripts from larval gut was used to compare gut gene expression profiles between a laboratory-selected Cry1Ab-resistant (R) strain and its isoline susceptible (S) strain of the European corn borer (Ostrinia nubilalis) after the larvae were fed the leaves of transgenic corn (MON810) expressing Cry1Ab or its non-transgenic isoline for 6 h. We revealed 398 gut genes differentially expressed (i.e., either up- or down-regulated genes with expression ratio ≥2.0) in S-strain, but only 264 gut genes differentially expressed in R-strain after being fed transgenic corn leaves. Although the percentages of down-regulated genes among the total number of differentially expressed genes (50% in S-strain and 45% in R-strain) were similar between the R- and S-strains, the expression ratios of down-regulated genes were much higher in S-strain than in R-strain. We revealed that 17 and 9 significantly up- or down-regulated gut genes from S and R-strain, respectively, including serine proteases and aminopeptidases. These genes may be associated with Cry1Ab toxicity by degradation, binding, and cellular defense. Overall, our study suggests enhanced adaptation of Cry1Ab-resistant larvae on transgenic Cry1Ab corn as revealed by lower number and lower ratios of differentially expressed genes in R-strain than in S-strain of O. nubilalis.

Screening of lymph nodes metastasis associated lncRNAs in colorectal cancer patients

PubMed Central

Han, Jun; Rong, Long-Fei; Shi, Chuan-Bin; Dong, Xiao-Gang; Wang, Jie; Wang, Bao-Lin; Wen, Hao; He, Zhen-Yu

2014-01-01

AIM: To screen lymph nodes metastasis associated long noncoding RNAs (lncRNAs) in colorectal cancer through microarray analysis. METHODS: Metastatic lymph node (MLN), normal lymph node (NLN) and tumor tissues of 3 colorectal cancer (CRC) patients were collected during the operation and validated by pathological examinations. RNAs were extracted from MLN, NLN, and cancer tissues separately. RNA quantity and quality were measured with a NanoDrop ND-1000 spectrophotometer and RNA integrity was assessed by standard denaturing agarose electrophoresis. Agilent Feature Extraction Software (Version 11.0.1.1) was used to analyze acquired array images. Four differently expressed lncRNAs were confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) in 26 subsets of MLN, NLN, and tumor tissues. RESULTS: Of 33045 lncRNAs, 1133 were differentially expressed in MLN compared with NLN, of which 260 were up-regulated and 873 down-regulated (≥ 2 fold-change). Five hundred and forty-five lncRNAs were differentially expressed in MLN compared with tumor tissues, of which 460 were up-regulated and 85 down-regulated (≥ 2 fold-change). Compared with NLN and cancer tissues, 14 lncRNAs were specifically up-regulated and 5 specifically down-regulated in MLN. AK307796, ENST00000425785, and AK021444 were confirmed to be specifically up-regulated in MLN and ENST00000465846 specifically down-regulated in MLN by qRT-PCR in 26 CRC patients. CONCLUSION: The specifically expressed lncRNAs in MLN may exert a partial or key role in the progress of lymph nodes metastasis of CRC. PMID:25009386

HnRNP-like proteins as post-transcriptional regulators.

PubMed

Yeap, Wan-Chin; Namasivayam, Parameswari; Ho, Chai-Ling

2014-10-01

Plant cells contain a diverse repertoire of RNA-binding proteins (RBPs) that coordinate a network of post-transcriptional regulation. RBPs govern diverse developmental processes by modulating the gene expression of specific transcripts. Recent gene annotation and RNA sequencing clearly showed that heterogeneous nuclear ribonucleoprotein (hnRNP)-like proteins which form a family of RBPs, are also expressed in higher plants and serve specific plant functions. In addition to their involvement in post-transcriptional regulation from mRNA capping to translation, they are also involved in telomere regulation, gene silencing and regulation in chloroplast. Here, we review the involvement of plant hnRNP-like proteins in post-transcription regulation of RNA processes and their functional roles in control of plant developmental processes especially plant-specific functions including flowering, chloroplastic-specific mRNA regulation, long-distance phloem transportation and plant responses to environmental stresses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Daytime soybean transcriptome fluctuations during water deficit stress.

PubMed

Rodrigues, Fabiana Aparecida; Fuganti-Pagliarini, Renata; Marcolino-Gomes, Juliana; Nakayama, Thiago Jonas; Molinari, Hugo Bruno Correa; Lobo, Francisco Pereira; Harmon, Frank G; Nepomuceno, Alexandre Lima

2015-07-07

Since drought can seriously affect plant growth and development and little is known about how the oscillations of gene expression during the drought stress-acclimation response in soybean is affected, we applied Illumina technology to sequence 36 cDNA libraries synthesized from control and drought-stressed soybean plants to verify the dynamic changes in gene expression during a 24-h time course. Cycling variables were measured from the expression data to determine the putative circadian rhythm regulation of gene expression. We identified 4866 genes differentially expressed in soybean plants in response to water deficit. Of these genes, 3715 were differentially expressed during the light period, from which approximately 9.55% were observed in both light and darkness. We found 887 genes that were either up- or down-regulated in different periods of the day. Of 54,175 predicted soybean genes, 35.52% exhibited expression oscillations in a 24 h period. This number increased to 39.23% when plants were submitted to water deficit. Major differences in gene expression were observed in the control plants from late day (ZT16) until predawn (ZT20) periods, indicating that gene expression oscillates during the course of 24 h in normal development. Under water deficit, dissimilarity increased in all time-periods, indicating that the applied stress influenced gene expression. Such differences in plants under stress were primarily observed in ZT0 (early morning) to ZT8 (late day) and also from ZT4 to ZT12. Stress-related pathways were triggered in response to water deficit primarily during midday, when more genes were up-regulated compared to early morning. Additionally, genes known to be involved in secondary metabolism and hormone signaling were also expressed in the dark period. Gene expression networks can be dynamically shaped to acclimate plant metabolism under environmental stressful conditions. We have identified putative cycling genes that are expressed in soybean leaves under normal developmental conditions and genes whose expression oscillates under conditions of water deficit. These results suggest that time of day, as well as light and temperature oscillations that occur considerably affect the regulation of water deficit stress response in soybean plants.

Zyflamend Sensitizes Tumor Cells to TRAIL-Induced Apoptosis Through Up-Regulation of Death Receptors and Down-Regulation of Survival Proteins: Role of ROS-Dependent CCAAT/Enhancer-Binding Protein-Homologous Protein Pathway

PubMed Central

Kim, Ji Hye; Park, Byoungduck; Gupta, Subash C.; Kannappan, Ramaswamy; Sung, Bokyung

2012-01-01

Abstract Aim: TNF (tumor necrosis factor)-related apoptosis-inducing ligand (TRAIL), is a selective killer of tumor cells, although its potential is limited by the development of resistance. In this article, we investigated whether the polyherbal preparation Zyflamend® can sensitize tumor cells to TRAIL. Results: We found that Zyflamend potentiated TRAIL-induced apoptosis in human cancer cells. Zyflamend manifested its effects through several mechanisms. First, it down-regulated the expression of cell survival proteins known to be linked to resistance to TRAIL. Second, Zyflamend up-regulated the expression of pro-apoptotic protein, Bax. Third, Zyflamend up-regulated the expression of death receptors (DRs) for TRAIL. Up-regulation of DRs was critical as gene-silencing of these receptors significantly reduced the effect of Zyflamend on TRAIL-induced apoptosis. The up-regulation of DRs was dependent on CCAAT/enhancer-binding protein-homologous protein (CHOP), as Zyflamend induced CHOP, its gene-silencing abolished the induction of receptors, and mutation of the CHOP binding site on DR5 promoter abolished Zyflamend-mediated DR5 transactivation. Zyflamend mediated its effects through reactive oxygen species (ROS), as ROS quenching reduced its effect. Further, Zyflamend induced DR5 and CHOP and down-regulated the expression of cell survival proteins in nude mice bearing human pancreatic cancer cells. Innovation: Zyflamend can sensitize tumor cells to TRAIL through modulation of multiple cell signaling mechanisms that are linked to ROS. Conclusion: Zyflamend potentiates TRAIL-induced apoptosis through the ROS-CHOP-mediated up-regulation of DRs, increase in pro-apoptotic protein and down-regulation of cell survival proteins. Antioxid. Redox Signal. 16, 413–427. PMID:22004570

Dual Functions of ASCIZ in the DNA Base Damage Response and Pulmonary Organogenesis

PubMed Central

Tenis, Nora; Hammet, Andrew; Hewitt, Kimberly; Ng, Jane-Lee; McNees, Carolyn J.; Kozlov, Sergei V.; Oka, Hayato; Kobayashi, Masahiko; Conlan, Lindus A.; Cole, Timothy J.; Yamamoto, Ken-ichi; Taniguchi, Yoshihito; Takeda, Shunichi; Lavin, Martin F.; Heierhorst, Jörg

2010-01-01

Zn2+-finger proteins comprise one of the largest protein superfamilies with diverse biological functions. The ATM substrate Chk2-interacting Zn2+-finger protein (ASCIZ; also known as ATMIN and ZNF822) was originally linked to functions in the DNA base damage response and has also been proposed to be an essential cofactor of the ATM kinase. Here we show that absence of ASCIZ leads to p53-independent late-embryonic lethality in mice. Asciz-deficient primary fibroblasts exhibit increased sensitivity to DNA base damaging agents MMS and H2O2, but Asciz deletion or knock-down does not affect ATM levels and activation in mouse, chicken, or human cells. Unexpectedly, Asciz-deficient embryos also exhibit severe respiratory tract defects with complete pulmonary agenesis and severe tracheal atresia. Nkx2.1-expressing respiratory precursors are still specified in the absence of ASCIZ, but fail to segregate properly within the ventral foregut, and as a consequence lung buds never form and separation of the trachea from the oesophagus stalls early. Comparison of phenotypes suggests that ASCIZ functions between Wnt2-2b/ß-catenin and FGF10/FGF-receptor 2b signaling pathways in the mesodermal/endodermal crosstalk regulating early respiratory development. We also find that ASCIZ can activate expression of reporter genes via its SQ/TQ-cluster domain in vitro, suggesting that it may exert its developmental functions as a transcription factor. Altogether, the data indicate that, in addition to its role in the DNA base damage response, ASCIZ has separate developmental functions as an essential regulator of respiratory organogenesis. PMID:20975950

miR-504 mediated down-regulation of nuclear respiratory factor 1 leads to radio-resistance in nasopharyngeal carcinoma

PubMed Central

Zhao, Luqing; Tang, Min; Hu, Zheyu; Yan, Bin; Pi, Weiwei; Li, Zhi; Zhang, Jing; Zhang, Liqin; Jiang, Wuzhong; Li, Guo; Qiu, Yuanzheng; Hu, Fang; Liu, Feng; Lu, Jingchen; Chen, Xue; Xiao, Lanbo; Xu, Zhijie; Tao, Yongguang; Yang, Lifang; Bode, Ann M.; Dong, Zigang; Zhou, Jian; Fan, Jia; Sun, Lunquan; Cao, Ya

2015-01-01

microRNAs (miRNAs) are involved in the various processes of DNA damage repair and play crucial roles in regulating response of tumors to radiation therapy. Here, we used nasopharyngeal carcinoma (NPC) radio-resistant cell lines as models and found that the expression of miR-504 was significantly up-regulated. In contrast, the expression of nuclear respiratory factor 1 (NRF1) and other mitochondrial metabolism factors, including mitochondrial transcription factor A (TFAM) and oxidative phosphorylation (OXPHOS) complex III were down-regulated in these cell lines. At the same time, the Seahorse cell mitochondrial stress test results indicated that the mitochondrial respiratory capacity was impaired in NPC radio-resistant cell lines and in a miR-504 over-expressing cell line. We also conducted dual luciferase reporter assays and verified that miR-504 could directly target NRF1. Additionally, miR-504 could down-regulate the expression of TFAM and OXPHOS complexes I, III, and IV and impaired the mitochondrial respiratory function of NPC cells. Furthermore, serum from NPC patients showed that miR-504 was up-regulated during different weeks of radiotherapy and correlated with tumor, lymph nodes and metastasis (TNM) stages and total tumor volume. The radio-therapeutic effect at three months after radiotherapy was evaluated. Results indicated that patients with high expression of miR-504 exhibited a relatively lower therapeutic effect ratio of complete response (CR), but a higher ratio of partial response (PR), compared to patients with low expression of miR-504. Taken together, these results demonstrated that miR-504 affected the radio-resistance of NPC by down-regulating the expression of NRF1 and disturbing mitochondrial respiratory function. Thus, miR-504 might become a promising biomarker of NPC radio-resistance and targeting miR-504 might improve tumor radiation response. PMID:26201446

Changes in gene expression of DOR and other thyroid hormone receptors in rat liver during acute-phase response

PubMed Central

Baumgartner, Bernhard G.; Naz, Naila; Sheikh, Nadeem; Moriconi, Federico; Ramadori, Giuliano

2010-01-01

Non-thyroidal illness is characterized by low tri-iodothyronine (T3) serum level under acute-phase conditions. We studied hepatic gene expression of the newly identified thyroid hormone receptor (TR) cofactor DOR/TP53INP2 together with TRs in a rat model of aseptic abscesses induced by injecting intramuscular turpentine-oil into each hind limb. A fast (4-6 h) decrease in the serum level of free thyroxine and free T3 was observed. By immunohistology, abundant DOR protein expression was detected in the nuclei of hepatocytes and ED-1+ (mononuclear phagocytes), CK-19+ (biliary cells), and SMA+ (mesenchymal cells of the portal tract) cells. DOR signal was reduced with a minimum at 6-12 h after the acute-phase reaction (APR). Immunohistology also showed a similar pattern of protein expression in TRα1 but without a significant change during APR. Transcripts specific for DOR, nuclear receptor co-repressor 1 (NCoR-1), and TRβ1 were down-regulated with a minimum at 6-12 h, whereas expression for TRα1 and TRα2 was slightly and significantly up-regulated, respectively, with a maximum at 24 h after APR was initiated. In cultured hepatocytes, acute-phase cytokines interleukin-1β (IL-1β) and IL-6 down-regulated DOR and TRβ1 at the mRNA level. Moreover, gene expression of DOR and TRs (TRα1, TRα2, and TRβ1) was up-regulated in hepatocytes by adding T3 to the culture medium; this up-regulation was almost completely blocked by treating the cells with IL-6. Thus, TRβ1, NCoR-1, and the recently identified DOR/TP53INP2 are abundantly expressed and down-regulated in liver cells during APR. Their down-regulation is attributable to the decreased serum level of thyroid hormones and most probably also to the direct action of the main acute-phase cytokines. PMID:20949361

Changes in gene expression of DOR and other thyroid hormone receptors in rat liver during acute-phase response.

PubMed

Malik, Ihtzaz Ahmed; Baumgartner, Bernhard G; Naz, Naila; Sheikh, Nadeem; Moriconi, Federico; Ramadori, Giuliano

2010-11-01

Non-thyroidal illness is characterized by low tri-iodothyronine (T3) serum level under acute-phase conditions. We studied hepatic gene expression of the newly identified thyroid hormone receptor (TR) cofactor DOR/TP53INP2 together with TRs in a rat model of aseptic abscesses induced by injecting intramuscular turpentine-oil into each hind limb. A fast (4-6 h) decrease in the serum level of free thyroxine and free T3 was observed. By immunohistology, abundant DOR protein expression was detected in the nuclei of hepatocytes and ED-1(+) (mononuclear phagocytes), CK-19(+) (biliary cells), and SMA(+) (mesenchymal cells of the portal tract) cells. DOR signal was reduced with a minimum at 6-12 h after the acute-phase reaction (APR). Immunohistology also showed a similar pattern of protein expression in TRα1 but without a significant change during APR. Transcripts specific for DOR, nuclear receptor co-repressor 1 (NCoR-1), and TRβ1 were down-regulated with a minimum at 6-12 h, whereas expression for TRα1 and TRα2 was slightly and significantly up-regulated, respectively, with a maximum at 24 h after APR was initiated. In cultured hepatocytes, acute-phase cytokines interleukin-1β (IL-1β) and IL-6 down-regulated DOR and TRβ1 at the mRNA level. Moreover, gene expression of DOR and TRs (TRα1, TRα2, and TRβ1) was up-regulated in hepatocytes by adding T3 to the culture medium; this up-regulation was almost completely blocked by treating the cells with IL-6. Thus, TRβ1, NCoR-1, and the recently identified DOR/TP53INP2 are abundantly expressed and down-regulated in liver cells during APR. Their down-regulation is attributable to the decreased serum level of thyroid hormones and most probably also to the direct action of the main acute-phase cytokines.

Down-regulation of Wnt10a affects odontogenesis and proliferation in mesenchymal cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yang, E-mail: Ly10160624@163.com; Han, Dong, E-mail: Donghan@bjmu.edu.cn; Wang, Lei, E-mail: wanglei_dentist@163.com

Highlights: •Down-regulation of Wnt10a in dental mesenchymal cells impairs odontogenesis of reassociated tooth germs. •Dspp is down- and up-regulated after Wnt10a-knockdown and overexpression in dental mesenchymal cells. •Down-regulation of Wnt10a inhibits proliferation of dental mesenchymal cells. -- Abstract: The WNT10a mutation has been found in patients with abnormal odontogenesis. In mice, Wnt10a expression is found in the tooth germ, but its role has not yet been elucidated. We aimed to investigate the role of Wnt10a in odontogenesis. Mesenchymal cells of the first mandibular molar germ at the bell stage were isolated, transfected with Wnt10a SiRNA or plasmid, and reassociated withmore » epithelial part of the molar germ. Scrambled SiRNA or empty vector was used in the control group. The reassociated tooth germs were transplanted into mice subrenal capsules. After gene modification, dental mesenchymal cells cultured in vitro were checked for cell proliferation and the expression of Dspp was examined. All 12 reassociated tooth germs in the control group resumed odontogenesis, while only 5 of 12 in the Wnt10a knockdown group developed into teeth. After Wnt10a knockdown, the mesenchymal cells cultured in vitro presented repressed proliferation. Wnt10a knockdown and overexpression led to both down- and up-regulation of Dspp. We conclude that the down-regulation of Wnt10a impairs odontogensis and cell proliferation, and that Wnt10a regulates Dspp expression in mesenchymal cells. These findings help to elucidate the mechanism of abnormal tooth development in patients with the WNT10A mutation.« less

Phenotypic effects induced by knock-down of the period clock gene in Bombyx mori.

PubMed

Sandrelli, Federica; Cappellozza, Silvia; Benna, Clara; Saviane, Alessio; Mastella, Antonio; Mazzotta, Gabriella M; Moreau, Stephane; Pegoraro, Mirko; Piccin, Alberto; Zordan, Mauro A; Cappellozza, Luciano; Kyriacou, Charalambos P; Costa, Rodolfo

2007-04-01

The lepidopteran Bombyx mori is an insect of considerable scientific and economic importance. Recently, the B. mori circadian clock gene period has been molecularly characterized. We have transformed a B. mori strain with a construct encoding a period double-strand RNA in order to knock-down period gene expression. We observe that this post-transcriptional silencing produces a small but detectable disruption in the egg-hatching rhythm, as well as a reduction in egg-to-adult developmental time, without altering silk production parameters. Thus we show that both circadian and non-circadian phenotypes can be altered by changing per expression, and, at a practical level, these results suggest that per knock-down may provide a suitable strategy for improving the efficiency of rearing, without affecting silk productivity.

EFFECT OF HYPOXIA ON THE EXPRESSION OF GENES THAT ENCODE SOME IGFBP AND CCN PROTEINS IN U87 GLIOMA CELLS DEPENDS ON IRE1 SIGNALING.

PubMed

Minchenko, O H; Kharkova, A P; Minchenko, D O; Karbovskyi, L L

2015-01-01

We have studied hypoxic regulation of the expression of different insulin-like growth factor binding protein genes in U87 glioma cells in relation to inhibition of IRE1 (inositol requiring enzyme-1), a central mediator of endoplasmic reticulum stress, which controls cell proliferation and tumor growth. We have demonstrated that hypoxia leads to up-regulation of the expression of IGFBP6, IGFBP7, IGFBP10/CYR61, WISP1, and WISP2 genes and down-regulation--of IGFBP9/NOV gene at the mRNA level in control glioma cells, being more signifcant changes for IGFBP10/CYR61 and WISP2 genes. At the same time, inhibition of IRE1 modifies the effect of hypoxia on the expression of all studied genes: eliminates sensitivity to hypoxia the expression of IGFBP7 and IGFBP9/NOV genes, suppresses effect of hypoxia on IGFBP6, IGFBP10/CYR61, and WISP2 genes, and slightly enhances hypoxic regulation of WISP1 gene expression in glioma cells. We have also demonstrated that the expression of all studied genes in glioma cells is regulated by IRE1 signaling enzyme upon normoxic condition, because inhibition of IRE1 significantly up-regulates IGFBP7, IGFBP10/CYR61, WISP1, and WISP2 genes and down-regulates IGFBP6 and IGFBP9/NOV genes as compared to control glioma cells. The present study demonstrates that hypoxia, which contributes to tumor growth, affects all studied IGFBP and WISP gene expressions and that inhibition of IRE1 preferentially abolishes or suppresses the hypoxic regulation of these gene expressions and thus possibly contributes to slower glioma growth. Moreover, inhibition of IRE1, which correlates with suppression of cell proliferation and glioma growth, is down-regulated expression of pro-proliferative IGFBP genes, attesting to the fact that endoplasmic reticulum stress is a necessary component of malignant tumor growth.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Nurr1 overexpression exerts neuroprotective and anti-inflammatory roles via down-regulating CCL2 expression in both in vivo and in vitro Parkinson's disease models

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Wei; Gao, Yang; Chang, Na

The abnormality of nuclear receptor-related protein 1 (Nurr1) in expression and function can contribute to neurodegeneration of dopaminergic neurons and occurrence of Parkinson's disease (PD). However, its related mechanism in PD is still unknown. In this study, we found that Nurr1 was down-regulated and CCL2 was up-regulated in PD patients and PD mice. CCL2 promoted apoptosis and secretion of TNF-α and IL-1β in SH-SY5Y cells and inhibited cell viability while knockdown of CCL2 exerted the opposite effects. Nurr1 overexpression inhibited apoptosis, the release of TNF-α and IL-1β and promoted viability in α-Syn-treated SH-SY5Y cells, which was markedly promoted by CCL2more » antibody and dramatically reversed by CCL2. Nurr1 overexpression negatively regulated CCL2 expression in vivo and in vitro. Furthermore, Nurr1 overexpression remarkably relieved MPTP-induced movement disorder and spatial memory deficits and played neuroprotective and anti-inflammatory roles in MPTP-induced PD mice by down-regulating CCL2 in vivo. In conclusion, Nurr1 overexpression exerts neuroprotective and anti-inflammatory roles via down-regulating CCL2 in both in vivo and in vitro PD models, contributing to developing mechanism-based and neuroprotective strategies against PD. - Highlights: • Nurr1 was down-regulated and CCL2 was up-regulated in PD patients and PD mice. • Nurr1 overexpression inhibited apoptosis, release of TNF-α and IL-1β and promoted viability in α-Syn-treated SH-SY5Y cells. • CCL2 reversed the effect of Nurr1 overexpression on apoptosis, inflammatory cytokines secretion and viability. • Nurr1 overexpression negatively regulated CCL2 expression in vivo and in vitro. • Nurr1 overexpression remarkably relieved MPTP-induced movement disorder and spatial memory deficits.« less

Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

2015-09-01

Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

Cellular prion protein controls stem cell-like properties of human glioblastoma tumor-initiating cells.

PubMed

Corsaro, Alessandro; Bajetto, Adriana; Thellung, Stefano; Begani, Giulia; Villa, Valentina; Nizzari, Mario; Pattarozzi, Alessandra; Solari, Agnese; Gatti, Monica; Pagano, Aldo; Würth, Roberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

2016-06-21

Prion protein (PrPC) is a cell surface glycoprotein whose misfolding is responsible for prion diseases. Although its physiological role is not completely defined, several lines of evidence propose that PrPC is involved in self-renewal, pluripotency gene expression, proliferation and differentiation of neural stem cells. Moreover, PrPC regulates different biological functions in human tumors, including glioblastoma (GBM). We analyzed the role of PrPC in GBM cell pathogenicity focusing on tumor-initiating cells (TICs, or cancer stem cells, CSCs), the subpopulation responsible for development, progression and recurrence of most malignancies. Analyzing four GBM CSC-enriched cultures, we show that PrPC expression is directly correlated with the proliferation rate of the cells. To better define its role in CSC biology, we knocked-down PrPC expression in two of these GBM-derived CSC cultures by specific lentiviral-delivered shRNAs. We provide evidence that CSC proliferation rate, spherogenesis and in vivo tumorigenicity are significantly inhibited in PrPC down-regulated cells. Moreover, PrPC down-regulation caused loss of expression of the stemness and self-renewal markers (NANOG, Sox2) and the activation of differentiation pathways (i.e. increased GFAP expression). Our results suggest that PrPC controls the stemness properties of human GBM CSCs and that its down-regulation induces the acquisition of a more differentiated and less oncogenic phenotype.

Cellular prion protein controls stem cell-like properties of human glioblastoma tumor-initiating cells

PubMed Central

Corsaro, Alessandro; Bajetto, Adriana; Thellung, Stefano; Begani, Giulia; Villa, Valentina; Nizzari, Mario; Pattarozzi, Alessandra; Solari, Agnese; Gatti, Monica; Pagano, Aldo; Würth, Roberto; Daga, Antonio; Barbieri, Federica; Florio, Tullio

2016-01-01

Prion protein (PrPC) is a cell surface glycoprotein whose misfolding is responsible for prion diseases. Although its physiological role is not completely defined, several lines of evidence propose that PrPC is involved in self-renewal, pluripotency gene expression, proliferation and differentiation of neural stem cells. Moreover, PrPC regulates different biological functions in human tumors, including glioblastoma (GBM). We analyzed the role of PrPC in GBM cell pathogenicity focusing on tumor-initiating cells (TICs, or cancer stem cells, CSCs), the subpopulation responsible for development, progression and recurrence of most malignancies. Analyzing four GBM CSC-enriched cultures, we show that PrPC expression is directly correlated with the proliferation rate of the cells. To better define its role in CSC biology, we knocked-down PrPC expression in two of these GBM-derived CSC cultures by specific lentiviral-delivered shRNAs. We provide evidence that CSC proliferation rate, spherogenesis and in vivo tumorigenicity are significantly inhibited in PrPC down-regulated cells. Moreover, PrPC down-regulation caused loss of expression of the stemness and self-renewal markers (NANOG, Sox2) and the activation of differentiation pathways (i.e. increased GFAP expression). Our results suggest that PrPC controls the stemness properties of human GBM CSCs and that its down-regulation induces the acquisition of a more differentiated and less oncogenic phenotype. PMID:27229535

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

PubMed

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously unknown genes with important roles in sporulation. The transcriptomic data reported here should also serve as a basis for identification of further developmentally important genes in future functional studies.

Differential gene expression in Staphylococcus aureus exposed to Orange II and Sudan III azo dyes

PubMed Central

Pan, Hongmiao; Xu, Joshua; Kweon, Oh-Gew; Zou, Wen; Feng, Jinhui; He, Gui-Xin; Cerniglia, Carl E.

2018-01-01

We previously demonstrated the effects of azo dyes and their reduction metabolites on bacterial cell growth and cell viability. In this report, the effects of Orange II and Sudan III on gene expression profiling in Staphylococcus aureus ATCC BAA 1556 were analyzed using microarray and quantitative RT-PCR technology. Upon exposure to 6 μg/ml Orange II for 18 h, 21 genes were found to be differently expressed. Among them, 8 and 13 genes were up- and down-regulated, respectively. Most proteins encoded by these differentially expressed genes involve stress response caused by drug metabolism, oxidation, and alkaline shock indicating that S. aureus could adapt to Orange II exposure through a balance between up and down regulated gene expression. Whereas, after exposure to 6 μg/ml Sudan III for 18 h, 57 genes were differentially expressed. In which, 51 genes were up-regulated and 6 were down-regulated. Most proteins encoded by these differentially expressed genes involve in cell wall/membrane biogenesis and biosynthesis, nutrient uptake, transport and metabolite, and stress response, suggesting that Sudan III damages the bacterial cell wall or/and membrane due to binding of the dye. Further analysis indicated that all differentially expressed genes encoded membrane proteins were up-regulated and most of them serve as transporters. The result suggested that these genes might contribute to survival, persistence and growth in the presence of Sudan III. Only one gene msrA, which plays an important role in oxidative stress resistance, was found to be down-regulated after exposure to both Orange II and Sudan III. The present results suggested that both these two azo dyes can cause stress in S. aureus and the response of the bacterium to the stress is mainly related to characteristics of the azo dyes. PMID:25720844

Suppression of PLCβ2 by Endotoxin Plays a Role in the Adenosine A2A Receptor-Mediated Switch of Macrophages from an Inflammatory to an Angiogenic Phenotype

PubMed Central

Grinberg, Stan; Hasko, Gyorgy; Wu, Dianqing; Leibovich, Samuel Joseph

2009-01-01

Toll-like receptor (TLR) 2, 4, 7, and 9 agonists, together with adenosine A2A receptor (A2AR) agonists, switch macrophages from an inflammatory (M1) to an angiogenic (M2-like) phenotype. This switch involves induction of A2ARs by TLR agonists, down-regulation of tumor necrosis factor α (TNFα) and interleukin-12, and up-regulation of vascular endothelial growth factor (VEGF) and interleukin-10 expression. We show here that the TLR4 agonist lipopolysaccharide (LPS) induces rapid and specific post-transcriptional down-regulation of phospholipase C(PLC)β1 and β2 expression in macrophages by de-stabilizing their mRNAs. The PLCβ inhibitor U73122 down-regulates TNFα expression by macrophages, and in the presence of A2AR agonists, up-regulates VEGF, mimicking the synergistic action of LPS with A2AR agonists. Selective down-regulation of PLCβ2, but not PLCβ1, using small-interfering RNA resulted in increased VEGF expression in response to A2AR agonists, but did not suppress TNFα expression. Macrophages from PLCβ2−/− mice also expressed increased VEGF in response to A2AR agonists. LPS-mediated suppression of PLCβ1 and β2 is MyD88-dependent. In a model of endotoxic shock, LPS (35 μg/mouse, i.p.) suppressed PLCβ1 and β2 expression in spleen, liver, and lung of wild-type but not MyD88−/− mice. These studies indicate that LPS suppresses PLCβ1 and β2 expression in macrophages in vitro and in several tissues in vivo. These results suggest that suppression of PLCβ2 plays an important role in switching M1 macrophages into an M2-like state. PMID:19850892

Small interfering RNA-mediated down-regulation of caveolin-1 differentially modulates signaling pathways in endothelial cells.

PubMed

Gonzalez, Eva; Nagiel, Aaron; Lin, Alison J; Golan, David E; Michel, Thomas

2004-09-24

Caveolin-1 is a scaffolding/regulatory protein that interacts with diverse signaling molecules in endothelial cells. To explore the role of this protein in receptor-modulated signaling pathways, we transfected bovine aortic endothelial cells (BAEC) with small interfering RNA (siRNA) duplexes to down-regulate caveolin-1 expression. Transfection of BAEC with duplex siRNA targeted against caveolin-1 mRNA selectively "knocked-down" the expression of caveolin-1 by approximately 90%, as demonstrated by immunoblot analyses of BAEC lysates. We used discontinuous sucrose gradients to purify caveolin-containing lipid rafts from siRNA-treated endothelial cells. Despite the near-total down-regulation of caveolin-1 expression, the lipid raft targeting of diverse signaling proteins (including the endothelial isoform of nitric-oxide synthase, Src-family tyrosine kinases, Galphaq and the insulin receptor) was unchanged. We explored the consequences of caveolin-1 knockdown on kinase pathways modulated by the agonists sphingosine-1 phosphate (S1P) and vascular endothelial growth factor (VEGF). siRNA-mediated caveolin-1 knockdown enhanced basal as well as S1P- and VEGF-induced phosphorylation of the protein kinase Akt and did not modify the basal or agonist-induced phosphorylation of extracellular signal-regulated kinases 1/2. Caveolin-1 knock-down also significantly enhanced the basal and agonist-induced activity of the small GTPase Rac. We used siRNA to down-regulate Rac expression in BAEC, and we observed that Rac knockdown significantly reduced basal, S1P-, and VEGF-induced Akt phosphorylation, suggesting a role for Rac activation in the caveolin siRNA-mediated increase in Akt phosphorylation. By using siRNA to knockdown caveolin-1 and Rac expression in cultured endothelial cells, we have found that caveolin-1 does not seem to be required for the targeting of signaling molecules to caveolae/lipid rafts and that caveolin-1 differentially modulates specific kinase pathways in endothelial cells. Copyright 2004 American Society for Biochemistry and Molecular Biology, Inc.

Curcumin Significantly Enhances Dual PI3K/Akt and mTOR Inhibitor NVP-BEZ235-Induced Apoptosis in Human Renal Carcinoma Caki Cells through Down-Regulation of p53-Dependent Bcl-2 Expression and Inhibition of Mcl-1 Protein Stability

PubMed Central

Cho, Il Je; Kim, Sang Chan; Kwon, Taeg Kyu

2014-01-01

The PI3K/Akt and mTOR signaling pathways are important for cell survival and growth, and they are highly activated in cancer cells compared with normal cells. Therefore, these signaling pathways are targets for inducing cancer cell death. The dual PI3K/Akt and mTOR inhibitor NVP-BEZ235 completely inhibited both signaling pathways. However, NVP-BEZ235 had no effect on cell death in human renal carcinoma Caki cells. We tested whether combined treatment with natural compounds and NVP-BEZ235 could induce cell death. Among several chemopreventive agents, curcumin, a natural biologically active compound that is extracted from the rhizomes of Curcuma species, markedly induced apoptosis in NVP-BEZ235-treated cells. Co-treatment with curcumin and NVP-BEZ235 led to the down-regulation of Mcl-1 protein expression but not mRNA expression. Ectopic expression of Mcl-1 completely inhibited curcumin plus NVP-NEZ235-induced apoptosis. Furthermore, the down-regulation of Bcl-2 was involved in curcumin plus NVP-BEZ235-induced apoptosis. Curcumin or NVP-BEZ235 alone did not change Bcl-2 mRNA or protein expression, but co-treatment reduced Bcl-2 mRNA and protein expression. Combined treatment with NVP-BEZ235 and curcumin reduced Bcl-2 expression in wild-type p53 HCT116 human colon carcinoma cells but not p53-null HCT116 cells. Moreover, Bcl-2 expression was completely reversed by treatment with pifithrin-α, a p53-specific inhibitor. Ectopic expression of Bcl-2 also inhibited apoptosis in NVP-BE235 plus curcumin-treated cells. In contrast, NVP-BEZ235 combined with curcumin did not have a synergistic effect on normal human skin fibroblasts and normal human mesangial cells. Taken together, combined treatment with NVP-BEZ235 and curcumin induces apoptosis through p53-dependent Bcl-2 mRNA down-regulation at the transcriptional level and Mcl-1 protein down-regulation at the post-transcriptional level. PMID:24743574

The herpes simplex virus receptor nectin-1 is down-regulated after trans-interaction with glycoprotein D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stiles, Katie M.; Center for Oral Health Research, School of Dental Medicine University of Pennsylvania, Philadelphia, PA 19104; Milne, Richard S.B.

2008-03-30

During herpes simplex virus (HSV) entry, membrane fusion occurs either on the cell surface or after virus endocytosis. In both cases, binding of glycoprotein D (gD) to a receptor such as nectin-1 or HVEM is required. In this study, we co-cultured cells expressing gD with nectin-1 expressing cells to investigate the effects of gD on nectin-1 at cell contacts. After overnight co-cultures with gD expressing cells, there was a down-regulation of nectin-1 in B78H1-C10, SY5Y, A431 and HeLa cells, which HSV enters by endocytosis. In contrast, on Vero cells, which HSV enters at the plasma membrane, nectin-1 was not down-regulated.more » Further analysis of B78H1-derived cells showed that nectin-1 down-regulation corresponds to the ability of gD to bind nectin-1 and is achieved by internalization and low-pH-dependent degradation of nectin-1. Moreover, gD is necessary for virion internalization in B78H1 cells expressing nectin-1. These data suggest that the determinants of gD-mediated internalization of nectin-1 may direct HSV to an endocytic pathway during entry.« less

Shikonin, an ingredient of Lithospermum erythrorhizon, down-regulates the expression of steroid sulfatase genes in breast cancer cells.

PubMed

Zhang, Yi; Qian, Rui-Qin; Li, Ping-Ping

2009-10-18

Steroid sulfatase (STS) has an important role in regulating the biosynthesis of estrogen within breast tumors. We aimed to investigate whether shikonin, an ingredient of Lithospermum erythrorhizon, could modulate STS expression in breast cancer cells. By MTT assay, shikonin inhibited the cell proliferation of breast cancer cells MCF-7 and SK-BR-3. Moreover, by semi-quantitative/quantitative reverse transcription polymerase chain reaction and dual-luciferase reporter based bioluminescent measurements, the mRNA and enzymatic activity levels of STS were decreased after shikonin treatment. Concluding, shikonin could act as a selective estrogen enzyme modulator by down-regulating the STS expression.

RNA-Seq analysis and annotation of a draft blueberry genome assembly identifies candidate genes involved in fruit ripening, biosynthesis of bioactive compounds, and stage-specific alternative splicing.

PubMed

Gupta, Vikas; Estrada, April D; Blakley, Ivory; Reid, Rob; Patel, Ketan; Meyer, Mason D; Andersen, Stig Uggerhøj; Brown, Allan F; Lila, Mary Ann; Loraine, Ann E

2015-01-01

Blueberries are a rich source of antioxidants and other beneficial compounds that can protect against disease. Identifying genes involved in synthesis of bioactive compounds could enable the breeding of berry varieties with enhanced health benefits. Toward this end, we annotated a previously sequenced draft blueberry genome assembly using RNA-Seq data from five stages of berry fruit development and ripening. Genome-guided assembly of RNA-Seq read alignments combined with output from ab initio gene finders produced around 60,000 gene models, of which more than half were similar to proteins from other species, typically the grape Vitis vinifera. Comparison of gene models to the PlantCyc database of metabolic pathway enzymes identified candidate genes involved in synthesis of bioactive compounds, including bixin, an apocarotenoid with potential disease-fighting properties, and defense-related cyanogenic glycosides, which are toxic. Cyanogenic glycoside (CG) biosynthetic enzymes were highly expressed in green fruit, and a candidate CG detoxification enzyme was up-regulated during fruit ripening. Candidate genes for ethylene, anthocyanin, and 400 other biosynthetic pathways were also identified. Homology-based annotation using Blast2GO and InterPro assigned Gene Ontology terms to around 15,000 genes. RNA-Seq expression profiling showed that blueberry growth, maturation, and ripening involve dynamic gene expression changes, including coordinated up- and down-regulation of metabolic pathway enzymes and transcriptional regulators. Analysis of RNA-seq alignments identified developmentally regulated alternative splicing, promoter use, and 3' end formation. We report genome sequence, gene models, functional annotations, and RNA-Seq expression data that provide an important new resource enabling high throughput studies in blueberry.

Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function

PubMed Central

Xu, Huanbin; Wang, Xiaolei; Pahar, Bapi; Alvarez, Xavier; Rasmussen, Kelsi K.; Lackner, Andrew A.; Veazey, Ronald S.

2012-01-01

The common γc subunit molecule is shared among all γc cytokines and clearly involved in T-cell function, but its role in HIV infection and immunity is not well understood. Here, we examined expression and function of γc on T cells during SIV infection in Rhesus macaques. Surface γc distribution was differentially expressed on CD4+ and CD8+ T cells, and CD4+ naive/memory cell populations in various lymphoid tissues of normal macaques. However, surface γc expression was rapidly and significantly down-regulated on T cells in acute infection with pathogenic SIV, compared to infection with a less virulent SHIV or controls and did not recover on CD8+ T cells in the chronic stage. Moreover, the peripheral and CD4+T cell loss was inversely correlated with γc+ CD8+ T cells in individual tissues. γc+ T cells were mainly functional as evidenced by higher cytokine secretion and proliferative capacity. Further in vitro experiments found that surface γc expression could be down-regulated following high level of IL-7 treatment by both internalization and shedding. Down-regulation of γc during early HIV/SIV infection may inhibit T-cell function, particularly of CD8+ T cells, and, may be linked with immune failure and loss of viral containment.—Xu, H., Wang, X., Pahar, B., Alvarez, X., Rasmussen, K. K., Lackner, A. A., Veazey, R. S. Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function. PMID:22375017

Role for miR-204 in human pulmonary arterial hypertension

PubMed Central

Courboulin, Audrey; Paulin, Roxane; Giguère, Nellie J.; Saksouk, Nehmé; Perreault, Tanya; Meloche, Jolyane; Paquet, Eric R.; Biardel, Sabrina; Provencher, Steeve; Côté, Jacques; Simard, Martin J.

2011-01-01

Pulmonary arterial hypertension (PAH) is characterized by enhanced proliferation and reduced apoptosis of pulmonary artery smooth muscle cells (PASMCs). Because microRNAs have been recently implicated in the regulation of cell proliferation and apoptosis, we hypothesized that these regulatory molecules might be implicated in the etiology of PAH. In this study, we show that miR-204 expression in PASMCs is down-regulated in both human and rodent PAH. miR-204 down-regulation correlates with PAH severity and accounts for the proliferative and antiapoptotic phenotypes of PAH-PASMCs. STAT3 activation suppresses miR-204 expression, and miR-204 directly targets SHP2 expression, thereby SHP2 up-regulation, by miR-204 down-regulation, activates the Src kinase and nuclear factor of activated T cells (NFAT). STAT3 also directly induces NFATc2 expression. NFAT and SHP2 were needed to sustain PAH-PASMC proliferation and resistance to apoptosis. Finally, delivery of synthetic miR-204 to the lungs of animals with PAH significantly reduced disease severity. This study uncovers a new regulatory pathway involving miR-204 that is critical to the etiology of PAH and indicates that reestablishing miR-204 expression should be explored as a potential new therapy for this disease. PMID:21321078

Islet-1 is required for ventral neuron survival in Xenopus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Yu; Zhao, Shuhua; Li, Jiejing

Islet-1 is a LIM domain transcription factor involved in several processes of embryonic development. Xenopus Islet-1 (Xisl-1) has been shown to be crucial for proper heart development. Here we show that Xisl-1 and Xisl-2 are differentially expressed in the nervous system in Xenopus embryos. Knock-down of Xisl-1 by specific morpholino leads to severe developmental defects, including eye and heart failure. Staining with the neuronal markers N-tubulin and Xisl-1 itself reveals that the motor neurons and a group of ventral interneurons are lost in the Xisl-1 morphants. Terminal dUTP nick-end labeling (TUNEL) analysis shows that Xisl-1 morpholino injection induces extensive apoptosismore » in the ventral neural plate, which can be largely inhibited by the apoptosis inhibitor M50054. We also find that over-expression of Xisl-1 is able to promote cell proliferation and induce Xstat3 expression in the injected side, suggesting a potential role for Xisl-1 in the regulation of cell proliferation in co-operation with the Jak-Stat pathway.« less

Gill structural integrity changes in fish deficient or excessive in dietary isoleucine: Towards the modulation of tight junction protein, inflammation, apoptosis and antioxidant defense via NF-κB, TOR and Nrf2 signaling pathways.

PubMed

Feng, Lin; Gan, Lu; Jiang, Wei-Dan; Wu, Pei; Liu, Yang; Jiang, Jun; Tang, Ling; Kuang, Sheng-Yao; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

2017-04-01

This study firstly aimed to test the impact of dietary isoleucine (Ile) on tight junction protein, inflammation, apoptosis, antioxidant defense and related signaling molecule gene expression in the gill of fish. Young grass carp (Ctenopharyngodon idella) (weighing 256.8 ± 3.5 g) were fed six diets containing graded levels of Ile, namely, 3.8, 6.6, 9.3, 12.5, 15.2 and 18.5 g/kg diet for 8 weeks. The results firstly revealed that Ile deficiency down-regulated the mRNA expressions of claudin-3, claudin-b, claudin-c, occludin and zonula occludens-1 (ZO-1) and up-regulated the mRNA expression of claudin-12, which led to the intercellular structure damage of fish gill. These effects were partially ascribed to the up-regulation of pro-inflammatory cytokines [interleukin 1β (IL-1β), interleukin 8 (IL-8) and tumor necrosis factor-α (TNF-α)] mRNA expressions that referring to up-regulated nuclear factor κB P65 (NF-κB P65) mRNA expression and down-regulated inhibitor factor κBα (IκBα) mRNA expression, and the down-regulation of anti-inflammatory cytokines [interleukin 10 (IL-10) and transforming growth factor β1 (TGF-β1)] mRNA expressions that referring to the down-regulated TOR and S6K1 mRNA expression. Interestingly, no change in claudin 15 mRNA level was observed among every treatment. At the same time, the results firstly indicated that Ile deficiency also resulted in the cellular structure damage of fish gill: (1) DNA fragmentation partially due to the up-regulation of caspase-3, caspase-8 and caspase-9 mRNA expression; (2) increase in protein carbonyl (PC), malondialdehyde (MDA) and ROS contents, which may be partially attributed to the impaired antioxidant defense [indicated by decreased glutathione (GSH) level and depressed anti-superoxide anion (ASA), anti-hydroxyl radical (a-HR), copper/zinc superoxide dismutase (Cu/Zn-SOD), catalase (CAT) and glutathione peroxidase (GPx) activities] that referring to the down-regulation of corresponding antioxidant enzyme mRNA expressions and the related signaling molecules Nrf2 mRNA expression. Ile excess caused similar negative effects that observed in Ile-deficient group, whereas these negative effects were reversed with appropriate Ile supplementation. In conclusion, our results indicated that Ile deficiency or excess disrupted the structural integrity of fish gill, partially due to the trigger of apoptosis, the impairment of antioxidant defense, and the regulation of tight junction protein, inflammatory cytokines, apoptosis-related, antioxidant enzymes and related signaling molecules mRNA expressions in the fish gill. Copyright © 2017 Elsevier Ltd. All rights reserved.

Regulation of tomato fruit pericarp development by an interplay between CDKB and CDKA1 cell cycle genes

PubMed Central

Czerednik, Anna; Busscher, Marco; Bielen, Bram A.M.; Wolters-Arts, Mieke; de Maagd, Ruud A.; Angenent, Gerco C.

2012-01-01

Growth of tomato fruits is determined by cell division and cell expansion, which are tightly controlled by factors that drive the core cell cycle. The cyclin-dependent kinases (CDKs) and their interacting partners, the cyclins, play a key role in the progression of the cell cycle. In this study the role of CDKA1, CDKB1, and CDKB2 in fruit development was characterized by fruit-specific overexpression and down-regulation. CDKA1 is expressed in the pericarp throughout development, but is strongly up-regulated in the outer pericarp cell layers at the end of the growth period, when CDKB gene expression has ceased. Overexpression of the CDKB genes at later stages of development and the down-regulation of CDKA1 result in a very similar fruit phenotype, showing a reduction in the number of cell layers in the pericarp and alterations in the desiccation of the fruits. Expression studies revealed that CDKA1 is down-regulated by the expression of CDKB1/2 in CDKB1 and CDKB2 overexpression mutants, suggesting opposite roles for these types of CDK proteins in tomato pericarp development. PMID:22282536

SmATG7 is required for viability in the homothallic ascomycete Sordaria macrospora.

PubMed

Nolting, Nicole; Bernhards, Yasmine; Pöggeler, Stefanie

2009-08-01

In filamentous ascomycetes, autophagy is involved in several developmental processes. Nevertheless, until now little is known about its role in fruiting-body development. We therefore isolated a gene of the homothallic ascomycete Sordaria macrospora with high sequence similarity to the Saccharomyces cerevisiae autophagy-related gene ATG7, encoding a core autophagy regulator. This is the first characterization of an ATG7 homolog in filamentous ascomycetes. A S. cerevisiae complementation assay demonstrated that the S. macrospora Smatg7 gene functionally replaces the yeast homolog. We were not able to generate a homokaryotic knock-out mutant in S. macrospora, suggesting that Smatg7 is required for viability. However, a heterokaryotic DeltaSmatg7/Smatg7 strain and transformants generated by RNA interference showed considerable morphological phenotypes during fruiting-body development. Using real-time PCR, we demonstrated that in the wild type, the transcriptional expression of Smatg7 is markedly up-regulated under amino acid starvation conditions and at late stages during sexual development. Moreover, we showed that transcriptionally down-regulation of Smatg7 disturbs autophagy in S. macrospora.

LncRNA Expression Profile of Human Thoracic Aortic Dissection by High-Throughput Sequencing.

PubMed

Sun, Jie; Chen, Guojun; Jing, Yuanwen; He, Xiang; Dong, Jianting; Zheng, Junmeng; Zou, Meisheng; Li, Hairui; Wang, Shifei; Sun, Yili; Liao, Wangjun; Liao, Yulin; Feng, Li; Bin, Jianping

2018-01-01

In this study, the long non-coding RNA (lncRNA) expression profile in human thoracic aortic dissection (TAD), a highly lethal cardiovascular disease, was investigated. Human TAD (n=3) and normal aortic tissues (NA) (n=3) were examined by high-throughput sequencing. Bioinformatics analyses were performed to predict the roles of aberrantly expressed lncRNAs. Quantitative real-time polymerase chain reaction (qRT-PCR) was applied to validate the results. A total of 269 lncRNAs (159 up-regulated and 110 down-regulated) and 2, 255 mRNAs (1 294 up-regulated and 961 down-regulated) were aberrantly expressed in human TAD (fold-change> 1.5, P< 0.05). QRT-PCR results of five dysregulated genes were consistent with HTS data. A lncRNA-mRNA coexpression analysis showed positive correlations between the up-regulated lncRNA (ENSG00000269936) and its adjacent up-regulated mRNA (MAP2K6, R=0.940, P< 0.01), and between the down-regulated lncRNA_1421 and its down-regulated mRNAs (FBLN5, R=0.950, P< 0.01; ACTA2, R=0.96, P< 0.01; TIMP3, R=0.96, P< 0.05). The lncRNA-miRNA-mRNA network indicated that the up-regulated lncRNA XIST and p21 had similar sequences targeted by has-miR-17-5p. The results of luciferase assay and fluorescence immuno-cytochemistry were consistent with that. And qRT-PCR results showed that lncRNA XIST and p21 were expressed at a higher level and has-miR-17-5p was expressed at a lower level in TAD than in NA. The predicted binding motifs of three up-regulated lncRNAs (ENSG00000248508, ENSG00000226530, and EG00000259719) were correlated with up-regulated RUNX1 (R=0.982, P< 0.001; R=0.967, P< 0.01; R=0.960, P< 0.01, respectively). Our study revealed a set of dysregulated lncRNAs and predicted their multiple potential functions in human TAD. These findings suggest that lncRNAs are novel potential therapeutic targets for human TAD. © 2018 The Author(s). Published by S. Karger AG, Basel.

Signal Transducer and Activator of Transcription 1 (STAT1) Knock-down Induces Apoptosis in Malignant Pleural Mesothelioma.

PubMed

Arzt, Lisa; Halbwedl, Iris; Gogg-Kamerer, Margit; Popper, Helmut H

2017-07-01

Malignant pleural mesothelioma (MPM) is the most common primary tumor of the pleura. Its incidence is still increasing in Europe and the prognosis remains poor. We investigated the oncogenic function of signal transducer and activator of transcription 1 (STAT1) in MPM in more detail. A miRNA profiling was performed on 52 MPM tissue samples. Upregulated miRNAs (targeting SOCS1/3) were knocked-down using miRNA inhibitors. mRNA expression levels of STAT1/3, SOCS1/3 were detected in MPM cell lines. STAT1 has been knocked-down using siRNA and qPCR was used to detect mRNA expression levels of all JAK/STAT family members and genes that regulate them. An immunohistochemical staining was performed to detect the expression of caspases. STAT1 was upregulated and STAT3 was downregulated, SOCS1/3 protein was not detected but it was possible to detect SOCS1/3 mRNA in MPM cell lines. The upregulated miRNAs were successfully knocked-down, however the expected effect on SOCS1 expression was not detected. STAT1 knock-down had different effects on STAT3/5 expression. Caspase 3a and 8 expression was found to be increased after STAT1 knock-down. The physiologic regulation of STAT1 via SOCS1 is completely lost in MPM and it does not seem that the miRNAs identified by now, do inhibit the expression of SOCS1. MPM cell lines compensate STAT1 knock-down by increasing the expression of STAT3 or STAT5a, two genes which are generally considered to be oncogenes. And much more important, STAT1 knock-down induces apoptosis in MPM cell lines and STAT1 might therefore be a target for therapeutic intervention.

Surgical, medical and developmental outcomes in patients with Down syndrome and cataracts.

PubMed

Santoro, Stephanie L; Atoum, Dema; Hufnagel, Robert B; Motley, William W

2017-01-01

Individuals with Down syndrome have an increased risk for congenital cataracts, but descriptions of surgical, medical and developmental outcomes are sparse. Retrospective review of medical charts of patients with Down syndrome with visits to Cincinnati Children's Hospital from 1988 to 2013 was performed. A case series of five patients with Down syndrome and cataracts is presented. A total of 47 patients with Down syndrome without cataracts were used as a developmental control. Developmental quotients were compared using an independent-sample, unequal variance t-test. Post-operative cataract complication rates ranged from 20% to 60%. Visual outcomes were varied; significant associations between complication rate and visual outcome were not found. Developmental quotients did not show an association with number of complications, but were lower for children with Down syndrome with cataracts requiring surgery compared to children with Down syndrome without cataracts. In children with Down syndrome and congenital cataract, surgical intervention has risk for post-operative complications. Further investigation is needed to determine if there is an association between surgical complications and visual or developmental outcomes.

Profiling ethanol-targeted transcription factors in human carcinoma cell-derived embryoid bodies.

PubMed

Mandal, Chanchal; Halder, Debasish; Chai, Jin Choul; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu

2016-01-15

Fetal alcohol spectrum disorder is a collective term that represents fetal abnormalities associated with maternal alcohol consumption. Prenatal alcohol exposure and related anomalies are well characterized, but the molecular mechanism behind this phenomenon is not yet understood. Few insights have been gained from genetic and epigenetic studies of fetal alcohol spectrum disorder. Our aim was to profile the important molecular regulators of ethanol-related alterations of the genome. For this purpose, we have analyzed the gene expression pattern of human carcinoma cell-derived embryoid bodies in the absence or presence of ethanol. A cDNA microarray analysis was used to profile mRNA expression in embryoid bodies at day 7 with or without ethanol treatment. A total of 493 differentially expressed genes were identified in response to 50 mM ethanol exposure. Of these, 111 genes were up-regulated, and 382 were down-regulated. Gene ontology term enrichment analysis revealed that these genes are involved in important biological processes: neurological system processes, cognition, behavior, sensory perception of smell, taste and chemical stimuli and synaptic transmission. Similarly, the enrichment of disease-related genes included relevant categories such as neurological diseases, developmental disorders, skeletal and muscular disorders, and connective tissue disorders. Furthermore, we have identified a group of 26 genes that encode transcription factors. We validated the relative gene expression of several transcription factors using quantitative real time PCR. We hope that our study substantially contributes to the understanding of the molecular mechanisms underlying the pathology of alcohol-mediated anomalies and facilitates further research. Copyright © 2015 Elsevier B.V. All rights reserved.

The PI3K p110delta is required for down-regulation of RAG expression in immature B cells.

PubMed

Llorian, Miriam; Stamataki, Zania; Hill, Susan; Turner, Martin; Mårtensson, Inga-Lill

2007-02-15

At the immature B cell stage the BCR signals the down-regulation of the RAG genes and Ig L chain (LC) allelic and isotype exclusion. The signaling pathway that regulates these events is poorly characterized. We demonstrate that immature B cells from mice deficient in the PI3K catalytic subunit p110delta fail to suppress RAG expression and inappropriately recombine kappa and lambda LC loci. In addition, in the presence of the autoantigen, clonal deletion and receptor editing still takes place, demonstrating that these processes are independent of p110delta. These results demonstrate a role for p110delta in the regulation of RAG gene expression and thereby LC allelic/isotype exclusion.

Hepatic expression of transcription factors affecting developmental regulation of UGT1A1 in the Han Chinese population.

PubMed

Nie, Ya-Li; He, Hang; Li, Jiang-Feng; Meng, Xiang-Guang; Yan, Liang; Wang, Pei; Wang, Shu-Jie; Bi, Hong-Zheng; Zhang, Li-Rong; Kan, Quan-Cheng

2017-01-01

Complete or partial inactivity of UGT1A1, the unique enzyme responsible for bilirubin glucuronidation, is commonly associated with hyperbilirubinemia. We investigated the dynamic expression of UGT1A1, and that of the transcription factors (TFs) involved in its developmental regulation, during human hepatic growth in Han Chinese individuals. Eighty-eight prenatal, pediatric, and adult liver samples were obtained from Han Chinese individuals. Quantitative real-time polymerase chain reaction was used to evaluate mRNA expression of UGT1A1 and TFs including PXR, CAR, HNF1A, HNF4A, PPARA, etc. UGT1A1 protein levels and metabolic activity were determined by western blotting and high-performance liquid chromatography. Direct sequencing was employed to genotype UGT1A1*6 (211G˃A) and UGT1A1*28 (TA6˃TA7) polymorphisms. UGT1A1 expression was minimal in prenatal samples, but significantly elevated during pediatric and adult stages. mRNA and protein levels and metabolic activity were prominently increased (120-, 20-, and 10-fold, respectively) in pediatric and adult livers compared to prenatal samples. Furthermore, expression did not differ appreciably between pediatric and adult periods. Dynamic expression of TFs, including PXR, CAR, HNF1A, HNF4A, and PPARA, was consistent with UGT1A1 levels at each developmental stage. A pronounced correlation between expression of these TFs and that of UGT1A1 (P < 0.001) was observed. Moreover, UGT1A1*6 and UGT1A1*28 polymorphisms reduced levels of UGT1A1 by up to 40-60 %. Hepatic expression of transcription factors is associated with developmental regulation of UGT1A1 in the Han Chinese population. Moreover, UGT1A1 polymorphisms are associated with reduced expression of UGT1A1 mRNA and protein, as well as enzyme activity.

Transcription profiling provides insights into gene pathways involved in horn and scurs development in cattle

PubMed Central

2010-01-01

Background Two types of horns are evident in cattle - fixed horns attached to the skull and a variation called scurs, which refers to small loosely attached horns. Cattle lacking horns are referred to as polled. Although both the Poll and Scurs loci have been mapped to BTA1 and 19 respectively, the underlying genetic basis of these phenotypes is unknown, and so far, no candidate genes regulating these developmental processes have been described. This study is the first reported attempt at transcript profiling to identify genes and pathways contributing to horn and scurs development in Brahman cattle, relative to polled counterparts. Results Expression patterns in polled, horned and scurs tissues were obtained using the Agilent 44 k bovine array. The most notable feature when comparing transcriptional profiles of developing horn tissues against polled was the down regulation of genes coding for elements of the cadherin junction as well as those involved in epidermal development. We hypothesize this as a key event involved in keratinocyte migration and subsequent horn development. In the polled-scurs comparison, the most prevalent differentially expressed transcripts code for genes involved in extracellular matrix remodelling, which were up regulated in scurs tissues relative to polled. Conclusion For this first time we describe networks of genes involved in horn and scurs development. Interestingly, we did not observe differential expression in any of the genes present on the fine mapped region of BTA1 known to contain the Poll locus. PMID:20537189

Cold-Induced Changes in Gene Expression in Brown Adipose Tissue, White Adipose Tissue and Liver

PubMed Central

Shore, Andrew M.; Karamitri, Angeliki; Kemp, Paul; Speakman, John R.; Graham, Neil S.; Lomax, Michael A.

2013-01-01

Cold exposure imposes a metabolic challenge to mammals that is met by a coordinated response in different tissues to prevent hypothermia. This study reports a transcriptomic analysis in brown adipose tissue (BAT), white adipose (WAT) and liver of mice in response to 24 h cold exposure at 8°C. Expression of 1895 genes were significantly (P<0.05) up- or down-regulated more than two fold by cold exposure in all tissues but only 5 of these genes were shared by all three tissues, and only 19, 14 and 134 genes were common between WAT and BAT, WAT and liver, and BAT and liver, respectively. We confirmed using qRT-PCR, the increased expression of a number of characteristic BAT genes during cold exposure. In both BAT and the liver, the most common direction of change in gene expression was suppression (496 genes in BAT and 590 genes in liver). Gene ontology analysis revealed for the first time significant (P<0.05) down regulation in response to cold, of genes involved in oxidoreductase activity, lipid metabolic processes and protease inhibitor activity, in both BAT and liver, but not WAT. The results reveal an unexpected importance of down regulation of cytochrome P450 gene expression and apolipoprotein, in both BAT and liver, but not WAT, in response to cold exposure. Pathway analysis suggests a model in which down regulation of the nuclear transcription factors HNF4α and PPARα in both BAT and liver may orchestrate the down regulation of genes involved in lipoprotein and steroid metabolism as well as Phase I enzymes belonging to the cytochrome P450 group in response to cold stress in mice. We propose that the response to cold stress involves decreased gene expression in a range of cellular processes in order to maximise pathways involved in heat production. PMID:23894377

Developmental gene regulation during tomato fruit ripening and in-vitro sepal morphogenesis

PubMed Central

Bartley, Glenn E; Ishida, Betty K

2003-01-01

Background Red ripe tomatoes are the result of numerous physiological changes controlled by hormonal and developmental signals, causing maturation or differentiation of various fruit tissues simultaneously. These physiological changes affect visual, textural, flavor, and aroma characteristics, making the fruit more appealing to potential consumers for seed dispersal. Developmental regulation of tomato fruit ripening has, until recently, been lacking in rigorous investigation. We previously indicated the presence of up-regulated transcription factors in ripening tomato fruit by data mining in TIGR Tomato Gene Index. In our in-vitro system, green tomato sepals cultured at 16 to 22°C turn red and swell like ripening tomato fruit while those at 28°C remain green. Results Here, we have further examined regulation of putative developmental genes possibly involved in tomato fruit ripening and development. Using molecular biological methods, we have determined the relative abundance of various transcripts of genes during in vitro sepal ripening and in tomato fruit pericarp at three stages of development. A number of transcripts show similar expression in fruits to RIN and PSY1, ripening-associated genes, and others show quite different expression. Conclusions Our investigation has resulted in confirmation of some of our previous database mining results and has revealed differences in gene expression that may be important for tomato cultivar variation. We present new and intriguing information on genes that should now be studied in a more focused fashion. PMID:12906715

Hepatic Proteome Analysis of Atlantic Salmon (Salmo salar) After Exposure to Environmental Concentrations of Human Pharmaceuticals*

PubMed Central

Hampel, Miriam; Alonso, Esteban; Aparicio, Irene; Santos, Juan Luis; Leaver, Michael

2015-01-01

Pharmaceuticals are pseudopersistent aquatic pollutants with unknown effects at environmentally relevant concentrations. Atlantic salmon (Salmo salar) were exposed to Acetaminophen: 54.77 ± 34.67; Atenolol: 11.08 ± 7.98, and Carbamazepine: 7.85 ± 0.13 μg·L−1 for 5 days. After Acetaminophen treatment, 19 proteins were differently expressed, of which 11 were significant with respect to the control group (eight up-regulated and three down-regulated). After Atenolol treatment, seven differently expressed proteins were obtained in comparison with the control, of which six could be identified (four up-regulated and two down-regulated). Carbamazepine exposure resulted in 15 differently expressed proteins compared with the control, with 10 of them identified (seven up-regulated and three down-regulated). Out of these, three features were common between Acetaminophen and Carbamazepine and one between Carbamazepine and Atenolol. One feature was common across all treatments. Principal component analysis and heat map clustering showed a clear grouping of the variability caused by the applied treatments. The obtained data suggest (1) that exposure to environmentally relevant concentrations of the pharmaceuticals alters the hepatic protein expression profile of the Atlantic salmon; and (2) the existence of treatment specific processes that may be useful for biomarker development. PMID:25394398

A protective role of autophagy in TDCIPP-induced developmental neurotoxicity in zebrafish larvae.

PubMed

Li, Ruiwen; Zhang, Ling; Shi, Qipeng; Guo, Yongyong; Zhang, Wei; Zhou, Bingsheng

2018-06-01

Tris (1, 3-dichloro-2-propyl) phosphate (TDCIPP), an extensively used organophosphorus flame retardant, is frequently detected in various environmental media and biota, and has been demonstrated as neurotoxic. Autophagy has been proposed as a protective mechanism against toxicant-induced neurotoxicity. The purpose of the present study was to investigate the effect of TDCIPP exposure on autophagy, and its role in TDCIPP-induced developmental neurotoxicity. Zebrafish embryos (2-120 h post-fertilization [hpf]) were exposed to TDCIPP (0, 5, 50 and 500 μg/l) and a model neurotoxic chemical, chlorpyrifos (CPF, 100 μg/l). The developmental endpoints, locomotive behavior, cholinesterase activities, gene and protein expression related to neurodevelopment and autophagy were measured in the larvae. Our results demonstrate that exposure to TDCIPP (500 μg/l) and CPF causes developmental toxicity, including reduced hatching and survival rates and increased malformation rate (e.g., spinal curvature), as well as altered locomotor behavior. The expression of selected neurodevelopmental gene and protein markers (e.g., mbp, syn2a, and α1-tubulin) was significantly down-regulated in CPF and TDCIPP exposed zebrafish larvae. Treatment with CPF significantly inhibits AChE and BChE, while TDCIPP (0-500 μg/l) exerts no effects on these enzymes. Furthermore, the conversion of microtubule-associated protein I (LC3 I) to LC3 II was significantly increased in TDCIPP exposed zebrafish larvae. In addition, exposure to TDCIPP also activates transcription of several critical genes in autophagy (e.g. Becn1, atg3, atg5, map1lc3b and sqstm1). To further investigate the role of autophagy in TDCIPP induced developmental neurotoxicity, an autophagy inducer (rapamycin, Rapa, 1 nM) and inhibitor (chloroquine, CQ, 1 μM) were used. The results demonstrate that the hatching rate, survival rate, and the expression of mbp and а1-tubulin proteins were all significantly increased in larvae treated with TDCIPP (500 μg/l) and Rapa compared to TDCIPP alone. In contrast, co-treatment with the autophagy inhibitor CQ results in exacerbated neurodevelopmental toxicity. Taken together, our results confirm that exposure to TDCIPP induces autophagy, which plays a protective role in TDCIPP-induced developmental neurotoxicity in zebrafish embryos and larvae. Copyright © 2018. Published by Elsevier B.V.

Splitting of IVP bovine blastocyst affects morphology and gene expression of resulting demi-embryos during in vitro culture and in vivo elongation.

PubMed

Velasquez, Alejandra E; Castro, Fidel O; Veraguas, Daniel; Cox, Jose F; Lara, Evelyn; Briones, Mario; Rodriguez-Alvarez, Lleretny

2016-02-01

Embryo splitting might be used to increase offspring yield and for molecular analysis of embryo competence. How splitting affects developmental potential of embryos is unknown. This research aimed to study the effect of bovine blastocyst splitting on morphological and gene expression homogeneity of demi-embryos and on embryo competence during elongation. Grade I bovine blastocyst produced in vitro were split into halves and distributed in nine groups (3 × 3 setting according to age and stage before splitting; age: days 7-9; stage: early, expanded and hatched blastocysts). Homogeneity and survival rate in vitro after splitting (12 h, days 10 and 13) and the effect of splitting on embryo development at elongation after embryo transfer (day 17) were assessed morphologically and by RT-qPCR. The genes analysed were OCT4, SOX2, NANOG, CDX2, TP1, TKDP1, EOMES, and BAX. Approximately 90% of split embryos had a well conserved defined inner cell mass (ICM), 70% of the halves had similar size with no differences in gene expression 12 h after splitting. Split embryos cultured further conserved normal and comparable morphology at day 10 of development; this situation changes at day 13 when embryo morphology and gene expression differed markedly among demi-embryos. Split and non-split blastocysts were transferred to recipient cows and were recovered at day 17. Fifty per cent of non-split embryos were larger than 100 mm (33% for split embryos). OCT4, SOX2, TP1 and EOMES levels were down-regulated in elongated embryos derived from split blastocysts. In conclusion, splitting day-8 blastocysts yields homogenous demi-embryos in terms of developmental capability and gene expression, but the initiation of the filamentous stage seems to be affected by the splitting.

Quantitative PCR and immunohistochemical analyses of HMGB1 and RAGE expression in canine disseminated histiocytic sarcoma (malignant histiocytosis).

PubMed

Sterenczak, Katharina A; Kleinschmidt, Sven; Wefstaedt, Patrick; Eberle, Nina; Hewicker-Trautwein, Marion; Bullerdiek, Jörn; Nolte, Ingo; Murua Escobar, Hugo

2011-05-01

Disorders of histiocytic origin affecting humans and dogs share various similarities. Canine disseminated histiocytic sarcoma (DHS) (formerly known as malignant histiocytosis) is an aggressive neoplasm of interstitial dendritic cells (DCs). The receptor for glycation end products (RAGE) and the high mobility group box1 protein (HMGB1) have been shown to be required for the maturation and migration of DCs. Thus, deregulation of the expression of these genes could have a major effect on the progression of histiocytic disorders. Neoplastic canine DHS samples and non-neoplastic control samples were analysed immunohistochemically and via real-time PCR. Significant down-regulation of RAGE in the lung tumour samples and down-regulation of HMGB1 in the lung, lymph node and spleen tumour samples were detected compared to their non-neoplastic counterparts. RAGE and HMGB1 expression down-regulation in canine DHS points to a role in the progression of histiocytic disorders.

Gene expression during blow fly development: improving the precision of age estimates in forensic entomology.

PubMed

Tarone, Aaron M; Foran, David R

2011-01-01

Forensic entomologists use size and developmental stage to estimate blow fly age, and from those, a postmortem interval. Since such estimates are generally accurate but often lack precision, particularly in the older developmental stages, alternative aging methods would be advantageous. Presented here is a means of incorporating developmentally regulated gene expression levels into traditional stage and size data, with a goal of more precisely estimating developmental age of immature Lucilia sericata. Generalized additive models of development showed improved statistical support compared to models that did not include gene expression data, resulting in an increase in estimate precision, especially for postfeeding third instars and pupae. The models were then used to make blind estimates of development for 86 immature L. sericata raised on rat carcasses. Overall, inclusion of gene expression data resulted in increased precision in aging blow flies. © 2010 American Academy of Forensic Sciences.

The ESR1 and GPX1 gene expression level in human malignant and non-malignant breast tissues.

PubMed

Król, Magdalena B; Galicki, Michał; Grešner, Peter; Wieczorek, Edyta; Jabłońska, Ewa; Reszka, Edyta; Morawiec, Zbigniew; Wąsowicz, Wojciech; Gromadzińska, Jolanta

2018-01-01

The aim of this study was to establish whether the gene expression of estrogen receptor alpha (encoded by ESR1) correlates with the expression of glutathione peroxidase 1 (encoded by GPX1) in the tumor and adjacent tumor-free breast tissue, and whether this correlation is affected by breast cancer. Such relationships may give further insights into breast cancer pathology with respect to the status of estrogen receptor. We used the quantitative real-time PCR technique to analyze differences in the expression levels of the ESR1 and GPX1 genes in paired malignant and non-malignant tissues from breast cancer patients. ESR1 and GPX1 expression levels were found to be significantly down-regulated by 14.7% and 7.4% (respectively) in the tumorous breast tissue when compared to the non-malignant one. Down-regulation of these genes was independent of the tumor histopathology classification and clinicopathological factors, while the ESR1 mRNA level was reduced with increasing tumor grade (G1: 103% vs. G2: 85.8% vs. G3: 84.5%; p<0.05). In the non-malignant and malignant breast tissues, the expression levels of ESR1 and GPX1 were significantly correlated with each other (Rs=0.450 and Rs=0.360; respectively). Our data suggest that down-regulation of ESR1 and GPX1 was independent of clinicopathological factors. Down-regulation of ESR1 gene expression was enhanced by the development of the disease. Moreover, GPX1 and ESR1 gene expression was interdependent in the malignant breast tissue and further work is needed to determine the mechanism underlying this relationship.

Polo-like kinase 1 expression is suppressed by CCAAT/enhancer-binding protein α to mediate colon carcinoma cell differentiation and apoptosis.

PubMed

Dasgupta, Nirmalya; Thakur, Bhupesh Kumar; Ta, Atri; Das, Sayan; Banik, George; Das, Santasabuj

2017-07-01

Human polo-like kinase 1 (PLK1), a highly conserved serine/threonine kinase is a key player in several essential cell-cycle events. PLK1 is considered an oncogene and its overexpression often correlates with poor prognosis of cancers, including colorectal cancer (CRC). However, regulation of PLK1 expression in colorectal cells was never studied earlier and it is currently unknown if PLK1 regulates differentiation and apoptosis of CRC. PLK1 expression was analyzed by real-time PCR and western blotting. Transcriptional regulation was studied by reporter assay, gene knock-down, EMSA and ChIP. PLK1 expression was down-regulated during butyrate-induced differentiation of HT-29 and other CRC cells. Also, PLK1 down-regulation mediated the role of butyrate in CRC differentiation and apoptosis. We report here a novel transcriptional regulation of PLK1 by butyrate. Transcription factors CCAAT/enhancer-binding protein α (C/EBPα) and Oct-1 share an overlapping binding site over the PLK1 promoter. Elevated levels of C/EBPα by butyrate treatment of CRC cells competed out the activator protein Oct-1 from binding to the PLK1 promoter and sequestered it. Binding of C/EBPα was associated with increased deacetylation near the transcription start site (TSS) of the PLK1 promoter, which abrogated transcription through reduced recruitment of RNA polymerase II. We also found a synergistic role between the synthetic PLK1-inhibitor SBE13 and butyrate on the apoptosis of CRC cells. This study offered a novel p53-independent regulation of PLK1 during CRC differentiation and apoptosis. Down-regulation of PLK1 is one of the mechanisms underlying the anti-cancer role of dietary fibre-derived butyrate in CRC. Copyright © 2017 Elsevier B.V. All rights reserved.

Mechanisms of allele-selective down-regulation of HLA class I in Burkitt's lymphoma.

PubMed

Imreh, M P; Zhang, Q J; de Campos-Lima, P O; Imreh, S; Krausa, P; Browning, M; Klein, G; Masucci, M G

1995-07-04

Burkitt lymphomas (BL) that arise in HLA-AII-positive individuals are characterized by selective loss/down-regulation of the HLA AII polypeptide. We have investigated the molecular basis of such down-regulation by comparing 5 pairs of BL lines and Epstein-Barr virus (EBV)-transformed lymphoblastoid cell lines (LCL) derived from the normal B cells of the same individuals. The presence of apparently intact HLA AII genes was confirmed in all 5 BL/LCL pairs by polymerase chain reaction (PCR) typing and by Southern-blot hybridization with HLA A locus-specific probes. Northern-blot analysis with locus- and allele-specific probes revealed a significantly lower expression or absence of AII-specific mRNA in all 5 BL lines compared to the corresponding LCLs. Up-regulation of AII-specific mRNA was achieved by IFN alpha treatment of 2 BL lines with low HLA AII expression (BL-28 and BL-72) while the treatment had no effect in 3 BL lines (WWI-BL, WW2-BL and BL41) that did not express the endogenous gene. HLA AII expression was restored by transfection of the gene in WWI-BL whereas transfectants of BL-41 remained AII-negative. An HLA-AII-promoter-driven chloramphenicol acetyl transferase reporter gene (pAIICAT) was active in WWI-BL but not in BL-41. HLA-AII was expressed in hybrids of BL-41 with an AII-positive LCL, while expression of the endogenous HLA AII gene could not be restored by fusion of BL-41 with an AII-negative LCL, although an adequate set of transcription factors was present in the hybrid. Our results suggest that genetic defects and lack of transcription factors may contribute to the selective down-regulation of HLA AII in BL cells.

MiR-18a increased the permeability of BTB via RUNX1 mediated down-regulation of ZO-1, occludin and claudin-5.

PubMed

Miao, Yin-Sha; Zhao, Ying-Yu; Zhao, Li-Ni; Wang, Ping; Liu, Yun-Hui; Ma, Jun; Xue, Yi-Xue

2015-01-01

The purposes of this study were to investigate the possible molecular mechanisms of miR-18a regulating the permeability of blood-tumor barrier (BTB) via down-regulated expression and distribution of runt-related transcription factor 1 (RUNX1). An in vitro BTB model was established with hCMEC/D3 cells and U87MG cells to obtain glioma vascular endothelial cells (GECs). The endogenous expressions of miR-18a and RUNX1 were converse in GECs. The overexpression of miR-18a significantly impaired the integrity and increased the permeability of BTB, which respectively were detected by TEER and HRP flux assays, accompanied by down-regulated mRNA and protein expressions and distributions of ZO-1, occludin and claudin-5 in GECs. Dual-luciferase reporter assay was carried out and revealed RUNX1 is a target gene of miR-18a. Meanwhile, mRNA and protein expressions and distribution of RUNX1 were downregulated by miR-18a. Most important, miR-18a and RUNX1 could reversely regulate the permeability of BTB as well as the expressions and distributions of ZO-1, occludin and claudin-5. Finally, chromatin immunoprecipitation verified that RUNX1 interacted with "TGGGGT" DNA sequence in promoter region of ZO-1, occludin and claudin-5 respectively. Taken together, our present study indicated that miR-18a increased the permeability of BTB via RUNX1 mediated down-regulation of tight junction related proteins ZO-1, occludin and claudin-5, which would attract more attention to miR-18a and RUNX1 as potential targets of drug delivery across BTB and provide novel strategies for glioma treatment. Copyright © 2014 Elsevier Inc. All rights reserved.

Gene expression studies of developing bovine longissimus muscle from two different beef cattle breeds

PubMed Central

Lehnert, Sigrid A; Reverter, Antonio; Byrne, Keren A; Wang, Yonghong; Nattrass, Greg S; Hudson, Nicholas J; Greenwood, Paul L

2007-01-01

Background The muscle fiber number and fiber composition of muscle is largely determined during prenatal development. In order to discover genes that are involved in determining adult muscle phenotypes, we studied the gene expression profile of developing fetal bovine longissimus muscle from animals with two different genetic backgrounds using a bovine cDNA microarray. Fetal longissimus muscle was sampled at 4 stages of myogenesis and muscle maturation: primary myogenesis (d 60), secondary myogenesis (d 135), as well as beginning (d 195) and final stages (birth) of functional differentiation of muscle fibers. All fetuses and newborns (total n = 24) were from Hereford dams and crossed with either Wagyu (high intramuscular fat) or Piedmontese (GDF8 mutant) sires, genotypes that vary markedly in muscle and compositional characteristics later in postnatal life. Results We obtained expression profiles of three individuals for each time point and genotype to allow comparisons across time and between sire breeds. Quantitative reverse transcription-PCR analysis of RNA from developing longissimus muscle was able to validate the differential expression patterns observed for a selection of differentially expressed genes, with one exception. We detected large-scale changes in temporal gene expression between the four developmental stages in genes coding for extracellular matrix and for muscle fiber structural and metabolic proteins. FSTL1 and IGFBP5 were two genes implicated in growth and differentiation that showed developmentally regulated expression levels in fetal muscle. An abundantly expressed gene with no functional annotation was found to be developmentally regulated in the same manner as muscle structural proteins. We also observed differences in gene expression profiles between the two different sire breeds. Wagyu-sired calves showed higher expression of fatty acid binding protein 5 (FABP5) RNA at birth. The developing longissimus muscle of fetuses carrying the Piedmontese mutation shows an emphasis on glycolytic muscle biochemistry and a large-scale up-regulation of the translational machinery at birth. We also document evidence for timing differences in differentiation events between the two breeds. Conclusion Taken together, these findings provide a detailed description of molecular events accompanying skeletal muscle differentiation in the bovine, as well as gene expression differences that may underpin the phenotype differences between the two breeds. In addition, this study has highlighted a non-coding RNA, which is abundantly expressed and developmentally regulated in bovine fetal muscle. PMID:17697390

Transcriptome sequencing of Atlantic salmon (Salmo salar L.) notochord prior to development of the vertebrae provides clues to regulation of positional fate, chordoblast lineage and mineralisation.

PubMed

Wang, Shou; Furmanek, Tomasz; Kryvi, Harald; Krossøy, Christel; Totland, Geir K; Grotmol, Sindre; Wargelius, Anna

2014-02-19

In teleosts such as Atlantic salmon (Salmo salar L.), segmentation and subsequent mineralisation of the notochord during embryonic stages are essential for normal vertebrae formation. However, the molecular mechanisms leading to segmentation and mineralisation of the notochord are poorly understood. The aim of this study was to identify genes/pathways acting in gradients over time and along the anterior-posterior axis during notochord segmentation and immediately prior to mineralisation of the vertebral bodies in Atlantic salmon. Notochord samples were collected from unsegmented, pre-segmented and segmented developmental stages. In each stage, the cellular core of the notochord was cut into three pieces along the longitudinal axis (anterior, mid, posterior). RNA was sequenced (22 million pair-end 100 bp/ library) and mapped to the salmon genome. 66569 transcripts were predicted and 55775 were annotated. In order to identify possible gradients leading to segmentation of the notochord, all 71 notochord-expressed hox genes were investigated, most of them displaying a typical anterior-posterior expression pattern along the notochord axis. The clustering of hox genes revealed a pattern that could be related to notochord segmentation. We further investigated how mineralisation is initiated in the notochord, and several factors related to chondrogenic lineage were identified (sox9, sox5, sox6, tgfb3, ihhb and col2a1), suggesting a cartilage-like character of the notochord. KEGG analysis of differentially expressed genes between stages revealed down-regulation of pathways associated with ECM, cell division, metabolism and development at onset of notochord segmentation. This implies that inhibitory signals produce segmentation of the notochord. One such potential inhibitory signal was identified, col11a2, which was detected in segments of non-mineralising notochord. An incomplete salmon genome was successfully used to analyse RNA-seq data from the cellular core of the Atlantic salmon notochord. In transcriptome we found; hox gene patterns possibly linked to segmentation; down-regulation of pathways in the notochord at onset of segmentation; segmented expression of col11a2 in non-mineralised segments of the notochord; and a chondroblast-like footprint in the notochord.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zou, Chengcheng; Chen, Juan; Chen, Ke

The hepatitis B virus (HBV) is responsible for most of hepatocellular carcinoma (HCC). However, whether HBV plays an important role during hepatocarcinogenesis through effecting miRNAs remains unknown. Here, we reported that HBV up-regulated microRNA-181a (miR-181a) by enhancing its promoter activity. Simultaneously, we found that miR-181a inhibited apoptosis in vitro and promoted tumor cell growth in vivo. TNF receptor superfamily member 6 (Fas) was further identified as a target of miR-181a. We also found that Fas could reverse the apoptosis-inhibition effect induced by miR-181a. Moreover, HBV could inhibit cell apoptosis by down-regulating Fas expression, which could be reversed by miR-181a inhibitor.more » Our data demonstrated that HBV suppressed apoptosis of hepatoma cells by up-regulating miR-181a expression and down-regulating Fas expression, which may provide a new understanding of the mechanism in HBV-related HCC pathogenesis. - Highlights: • HBV could up-regulate miR-181a expression by interacting with nt−800 to +240 in its promoter region in HCC cell lines. • HBV could down-regulate Fas expression and suppress apoptosis of hepatoma cells, which could be reversed by miR-181a inhibitor. • Up-regulation of miR-181a promoted proliferation of hepatoma cells and repressed apoptosis, which could be reversed by Fas. • Our study provides a new understanding of the mechanism in HBV-related HCC pathogenesis.« less

The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

PubMed

Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

1998-06-01

We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

Gene expression profile differences in left and right liver lobes from mid-gestation fetal baboons: a cautionary tale

PubMed Central

Cox, Laura A; Schlabritz-Loutsevitch, Natalia; Hubbard, Gene B; Nijland, Mark J; McDonald, Thomas J; Nathanielsz, Peter W

2006-01-01

Interpretation of gene array data presents many potential pitfalls in adult tissues. Gene array techniques applied to fetal tissues present additional confounding pitfalls. The left lobe of the fetal liver is supplied with blood containing more oxygen than the right lobe. Since synthetic activity and cell function are oxygen dependent, we hypothesized major differences in mRNA expression between the fetal right and left liver lobes. Our aim was to demonstrate the need to evaluate RNA samples from both lobes. We performed whole genome expression profiling on left and right liver lobe RNA from six 90-day gestation baboon fetuses (term 180 days). Comparing right with left, we found 875 differentially expressed genes – 312 genes were up-regulated and 563 down-regulated. Pathways for damaged DNA binding, endonuclease activity, interleukin binding and receptor activity were up-regulated in right lobe; ontological pathways related to cell signalling, cell organization, cell biogenesis, development, intracellular transport, phospholipid metabolism, protein biosynthesis, protein localization, protein metabolism, translational regulation and vesicle mediated transport were down-regulated in right lobe. Molecular pathway analysis showed down-regulation of pathways related to heat shock protein binding, ion channel and transporter activities, oxygen binding and transporter activities, translation initiation and translation regulator activities. Genes involved in amino acid biosynthesis, lipid biosynthesis and oxygen transport were also differentially expressed. This is the first demonstration of RNA differences between the two lobes of the fetal liver. The data support the argument that a complete interpretation of gene expression in the developing liver requires data from both lobes. PMID:16484296

Transcriptomic Analysis Implies That GA Regulates Sex Expression via Ethylene-Dependent and Ethylene-Independent Pathways in Cucumber (Cucumis sativus L.).

PubMed

Zhang, Yan; Zhao, Guiye; Li, Yushun; Mo, Ning; Zhang, Jie; Liang, Yan

2017-01-01

Sex differentiation of flower buds is an important developmental process that directly affects fruit yield of cucumber ( Cucumis sativus L.). Plant hormones, such as gibberellins (GAs) and ethylene can promote development of male and female flowers, respectively, however, the regulatory mechanisms of GA-induced male flower formation and potential involvement of ethylene in this process still remain unknown. In this study, to unravel the genes and gene networks involved in GA-regulated cucumber sexual development, we performed high throughout RNA-Seq analyses that compared the transcriptomes of shoot tips between GA 3 treated and untreated gynoecious cucumber plants. Results showed that GA 3 application markedly induced male flowers but decreased ethylene production in shoot tips. Furthermore, the transcript levels of M ( CsACS2 ) gene, ethylene receptor CsETR1 and some ethylene-responsive transcription factors were dramatically changed after GA 3 treatment, suggesting a potential involvement of ethylene in GA-regulated sex expression of cucumber. Interestingly, GA 3 down-regulated transcript of a C-class floral homeotic gene, CAG2 , indicating that GA may also influence cucumber sex determination through an ethylene-independent process. These results suggest a novel model for hormone-mediated sex differentiation and provide a theoretical basis for further dissection of the regulatory mechanism of male flower formation in cucumber. Statement: We reveal that GA can regulate sex expression of cucumber via an ethylene-dependent manner, and the M ( CsACS2 ), CsETR1 , and ERFs are probably involved in this process. Moreover, CAG2 , a C-class floral homeotic gene, may also participate in GA-modulated cucumber sex determination, but this pathway is ethylene-independent.

The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

PubMed

Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

2018-05-01

Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

Differentially expressed genes of Tetrahymena thermophila in response to tributyltin (TBT) identified by suppression subtractive hybridization and real time quantitative PCR.

PubMed

Feng, Lifang; Miao, Wei; Wu, Yuxuan

2007-02-15

Tributyltin (TBT) is widely used as antifouling paints, agriculture biocides, and plastic stabilizers around the world, resulting in great pollution problem in aquatic environments. However, it has been short of the biomonitor to detect TBT in freshwater. We constructed the suppression subtractive hybridization library of Tetrahymena thermophila exposed to TBT, and screened out 101 Expressed Sequence Tags whose expressions were significantly up- or down-regulated with TBT treatment. From this, a series of genes related to the TBT toxicity were discovered, such as glutathione-S-transferase gene (down-regulated), plasma membrane Ca2+ ATPase isoforms 3 gene (up-regulated) and NgoA (up-regulated). Furthermore, their expressions under different concentrations of TBT treatment (0.5-40 ppb) were detected by real time fluorescent quantitative PCR. The differentially expressed genes of T. thermophila in response to TBT were identified, which provide the basic to make Tetrahymena as a sensitive, rapid and convenient TBT biomonitor in freshwater based on rDNA inducible expression system.

Molecular cloning, phylogenetic analysis, and expression profiling of endoplasmic reticulum molecular chaperone BiP genes from bread wheat (Triticum aestivum L.).

PubMed

Zhu, Jiantang; Hao, Pengchao; Chen, Guanxing; Han, Caixia; Li, Xiaohui; Zeller, Friedrich J; Hsam, Sai L K; Hu, Yingkao; Yan, Yueming

2014-10-01

The endoplasmic reticulum chaperone binding protein (BiP) is an important functional protein, which is involved in protein synthesis, folding assembly, and secretion. In order to study the role of BiP in the process of wheat seed development, we cloned three BiP homologous cDNA sequences in bread wheat (Triticum aestivum), completed by rapid amplification of cDNA ends (RACE), and examined the expression of wheat BiP in wheat tissues, particularly the relationship between BiP expression and the subunit types of HMW-GS using near-isogenic lines (NILs) of HMW-GS silencing, and under abiotic stress. Sequence analysis demonstrated that all BiPs contained three highly conserved domains present in plants, animals, and microorganisms, indicating their evolutionary conservation among different biological species. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) revealed that TaBiP (Triticum aestivum BiP) expression was not organ-specific, but was predominantly localized to seed endosperm. Furthermore, immunolocalization confirmed that TaBiP was primarily located within the protein bodies (PBs) in wheat endosperm. Three TaBiP genes exhibited significantly down-regulated expression following high molecular weight-glutenin subunit (HMW-GS) silencing. Drought stress induced significantly up-regulated expression of TaBiPs in wheat roots, leaves, and developing grains. The high conservation of BiP sequences suggests that BiP plays the same role, or has common mechanisms, in the folding and assembly of nascent polypeptides and protein synthesis across species. The expression of TaBiPs in different wheat tissue and under abiotic stress indicated that TaBiP is most abundant in tissues with high secretory activity and with high proportions of cells undergoing division, and that the expression level of BiP is associated with the subunit types of HMW-GS and synthesis. The expression of TaBiPs is developmentally regulated during seed development and early seedling growth, and under various abiotic stresses.

Mechanisms involved in epigenetic down-regulation of Gfap under maternal hypothyroidism.

PubMed

Kumar, Praveen; Godbole, Nachiket M; Chaturvedi, Chandra P; Singh, Ravi S; George, Nelson; Upadhyay, Aditya; Anjum, B; Godbole, Madan M; Sinha, Rohit A

2018-07-20

Thyroid hormones (TH) of maternal origin are crucial regulator of mammalian brain development during embryonic period. Although maternal TH deficiency during the critical periods of embryonic neo-cortical development often results in irreversible clinical outcomes, the fundamental basis of these abnormalities at a molecular level is still obscure. One of the key developmental process affected by maternal TH insufficiency is the delay in astrocyte maturation. Glial fibrillary acidic protein (Gfap) is a predominant cell marker of mature astrocyte and is regulated by TH status. Inspite, of being a TH responsive gene during neocortical development the mechanistic basis of Gfap transcriptional regulation by TH has remained elusive. In this study using rat model of maternal hypothyroidism, we provide evidence for an epigenetic silencing of Gfap under TH insufficiency and its recovery upon TH supplementation. Our results demonstrate increased DNA methylation coupled with decreased histone acetylation at the Gfap promoter leading to suppression of Gfap expression under maternal hypothyroidism. In concordance, we also observed a significant increase in histone deacetylase (HDAC) activity in neocortex of TH deficient embryos. Collectively, these results provide novel insight into the role of TH regulated epigenetic mechanisms, including DNA methylation, and histone modifications, which are critically important in mediating precise temporal neural gene regulation. Copyright © 2018 Elsevier Inc. All rights reserved.

Olfactory discrimination largely persists in mice with defects in odorant receptor expression and axon guidance.

PubMed

Knott, Thomas K; Madany, Pasil A; Faden, Ashley A; Xu, Mei; Strotmann, Jörg; Henion, Timothy R; Schwarting, Gerald A

2012-07-04

The defining feature of the main olfactory system in mice is that each olfactory sensory neuron expresses only one of more than a thousand different odorant receptor genes. Axons expressing the same odorant receptor converge onto a small number of targets in the olfactory bulb such that each glomerulus is made up of axon terminals expressing just one odorant receptor. It is thought that this precision in axon targeting is required to maintain highly refined odor discrimination. We previously showed that β3GnT2(-/-) mice have severe developmental and axon guidance defects. The phenotype of these mice is similar to adenylyl cyclase 3 (AC3) knockout mice largely due to the significant down-regulation of AC3 activity in β3GnT2(-/-) neurons. Microarray analysis reveals that nearly one quarter of all odorant receptor genes are down regulated in β3GnT2(-/-) mice compared to controls. Analysis of OR expression by quantitative PCR and in situ hybridization demonstrates that the number of neurons expressing some odorant receptors, such as mOR256-17, is increased by nearly 60% whereas for others such as mOR28 the number of neurons is decreased by more than 75% in β3GnT2(-/-) olfactory epithelia. Analysis of axon trajectories confirms that many axons track to inappropriate targets in β3GnT2(-/-) mice, and some glomeruli are populated by axons expressing more than one odorant receptor. Results show that mutant mice perform nearly as well as control mice in an odor discrimination task. In addition, in situ hybridization studies indicate that the expression of several activity dependent genes is unaffected in β3GnT2(-/-) olfactory neurons. Results presented here show that many odorant receptors are under-expressed in β3GnT2(-/-) mice and further demonstrate that additional axon subsets grow into inappropriate targets or minimally innervate glomeruli in the olfactory bulb. Odor evoked gene expression is unchanged and β3GnT2(-/-) mice exhibit a relatively small deficit in their ability to discriminate divergent odors. Results suggest that despite the fact that β3GnT2(-/-) mice have decreased AC3 activity, decreased expression of many ORs, and display many axon growth and guidance errors, odor-evoked activity in cilia of mutant olfactory neurons remains largely intact.

The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation

USDA-ARS?s Scientific Manuscript database

The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing ac...

The anti-apoptotic BAG3 protein is expressed in lung carcinomas and regulates small cell lung carcinoma (SCLC) tumor growth.

PubMed

Chiappetta, Gennaro; Basile, Anna; Barbieri, Antonio; Falco, Antonia; Rosati, Alessandra; Festa, Michelina; Pasquinelli, Rosa; Califano, Daniela; Palma, Giuseppe; Costanzo, Raffaele; Barcaroli, Daniela; Capunzo, Mario; Franco, Renato; Rocco, Gaetano; Pascale, Maria; Turco, Maria Caterina; De Laurenzi, Vincenzo; Arra, Claudio

2014-08-30

BAG3, member the HSP70 co-chaperones family, has been shown to play a relevant role in the survival, growth and invasiveness of different tumor types. In this study, we investigate the expression of BAG3 in 66 specimens from different lung tumors and the role of this protein in small cell lung cancer (SCLC) tumor growth. Normal lung tissue did not express BAG3 while we detected the expression of BAG3 by immunohistochemistry in all the 13 squamous cell carcinomas, 13 adenocarcinomas and 4 large cell carcinomas. Furthermore, we detected BAG3 expression in 22 of the 36 SCLCs analyzed. The role on SCLC cell survival was determined by down-regulating BAG3 levels in two human SCLC cell lines, i.e. H69 and H446, in vitro and measuring cisplatin induced apoptosis. Indeed down-regulation of BAG3 determines increased cell death and sensitizes cells to cisplatin treatment. The effect of BAG3 down-regulation on tumor growth was also investigated in an in vivo xenograft model by treating mice with an adenovirus expressing a specific bag3 siRNA. Treatment with bag3 siRNA-Ad significantly reduced tumor growth and improved animal survival. In conclusion we show that a subset of SCLCs over express BAG3 that exerts an anti-apoptotic effect resulting in resistance to chemotherapy.

Amyotrophic lateral sclerosis, gene deregulation in the anterior horn of the spinal cord and frontal cortex area 8: implications in frontotemporal lobar degeneration

PubMed Central

Andrés-Benito, Pol; Moreno, Jesús; Aso, Ester; Povedano, Mónica; Ferrer, Isidro

2017-01-01

Transcriptome arrays identifies 747 genes differentially expressed in the anterior horn of the spinal cord and 2,300 genes differentially expressed in frontal cortex area 8 in a single group of typical sALS cases without frontotemporal dementia compared with age-matched controls. Main up-regulated clusters in the anterior horn are related to inflammation and apoptosis; down-regulated clusters are linked to axoneme structures and protein synthesis. In contrast, up-regulated gene clusters in frontal cortex area 8 involve neurotransmission, synaptic proteins and vesicle trafficking, whereas main down-regulated genes cluster into oligodendrocyte function and myelin-related proteins. RT-qPCR validates the expression of 58 of 66 assessed genes from different clusters. The present results: a. reveal regional differences in de-regulated gene expression between the anterior horn of the spinal cord and frontal cortex area 8 in the same individuals suffering from sALS; b. validate and extend our knowledge about the complexity of the inflammatory response in the anterior horn of the spinal cord; and c. identify for the first time extensive gene up-regulation of neurotransmission and synaptic-related genes, together with significant down-regulation of oligodendrocyte- and myelin-related genes, as important contributors to the pathogenesis of frontal cortex alterations in the sALS/frontotemporal lobar degeneration spectrum complex at stages with no apparent cognitive impairment. PMID:28283675

Honey bee (Apis mellifera) transferrin-gene structure and the role of ecdysteroids in the developmental regulation of its expression.

PubMed

do Nascimento, Adriana Mendes; Cuvillier-Hot, Virginie; Barchuk, Angel Roberto; Simões, Zilá Luz Paulino; Hartfelder, Klaus

2004-05-01

Social life is prone to invasion by microorganisms, and binding of ferric ions by transferrin is an efficient strategy to restrict their access to iron. In this study, we isolated cDNA and genomic clones encoding an Apis mellifera transferrin (AmTRF) gene. It has an open reading frame (ORF) of 2136 bp spread over nine exons. The deduced protein sequence comprises 686 amino acid residues plus a 26 residues signal sequence, giving a predicted molecular mass of 76 kDa. Comparison of the deduced AmTRF amino acid sequence with known insect transferrins revealed significant similarity extending over the entire sequence. It clusters with monoferric transferrins, with which it shares putative iron-binding residues in the N-terminal lobe. In a functional analysis of AmTRF expression in honey bee development, we monitored its expression profile in the larval and pupal stages. The negative regulation of AmTRF by ecdysteroids deduced from the developmental expression profile was confirmed by experimental treatment of spinning-stage honey bee larvae with 20-hydroxyecdysone, and of fourth instar-larvae with juvenile hormone. A juvenile hormone application to spinning-stage larvae, in contrast, had only a minor effect on AmTRF transcript levels. This is the first study implicating ecdysteroids in the developmental regulation of transferrin expression in an insect species.

Effects of Liuwei Dihuang Granule ([symbols; see text]) on the outcomes of in vitro fertilization pre-embryo transfer in infertility women with Kidney-yin deficiency syndrome and the proteome expressions in the follicular fluid.

PubMed

Lian, Fang; Wu, Hai-cui; Sun, Zhen-gao; Guo, Ying; Shi, Lei; Xue, Ming-yue

2014-07-01

To observe the effects of Liuwei Dihuang Granule ([symbols; see text], LDG) for tonifying Kidney (Shen) on the outcomes of in vitro fertilization pre-embryo transfer (IVF-ET) of infertility women with Kidney-yin deficiency syndrome and to explore its mechanism by detecting the proteome expression in the follicular fluid. Sixty-six infertility patients of Kidney-yin deficiency syndrome who would undergo IVF-ET, were randomly assigned to a treatment group and a control group according to a random number table, 33 cases in each group. Another 33 cases of non-Kidney-yin deficiency syndrome was taken as a syndrome-control group. Besides Western routine therapy, LDG was given 3 menstrual cycles before IVF to the treatment group, and a placebo granule to the control and syndrome-control groups. The scores of Kidney-yin deficiency symptoms (sore waist and knees, dry vagina, dysphoria with feverish sensation in the chest, palms and soles, etc.) were assessed, the number of retrieved oocytes, rates of high quality oocytes and embryos, fertility rate and clinical pregnancy rate were recorded, and the follicular fluid was collected on the day when the ovum was picked up, the differential protein expression was detected using two-dimensional gel electrophoresis, and then, matrix assisted laser desorption ionization time-of flight mass spectrometry (MALDI-TOF-MS) was applied to identify the proteins. The syndrome score in the treatment group decreased significantly from 16.09±2.58 to 8.67±2.13, while it changed insignificantly in the control group, with a significant difference in the lowering score between the two groups (P<0.05); the high quality rates of oocytes and embryos and clinical pregnancy rate were all superior in the treatment group to the control group (82.29% vs 78.08%, 76.76% vs 68.79%, 63.64% vs 36.36%, all P<0.05). The protein expression map from the follicular fluid showed that compared with the control group, 33 differential protein expressions were found in the syndrome-control group, among which 18 were down-regulated, and 15 up-regulated; in the treatment group 28 differential protein expressions were found, among which 15 were down-regulated, and 13 up-regulated. Through MALDI-TOF-MS, 14 proteins were identified (P<0.05). For the infertility patients undergoing IVF, LDG could alleviate clinical symptoms, improve rates of high quality oocytes and embryos, so as to raise clinical pregnancy rate. The mechanism may be through regulating proteome expression in the follicular fluid to improve the developmental microenvironment for oocytes which would lead to a successful embryo implantation.

Effects of perfluorooctanoic acid (PFOA) on expression of ...

EPA Pesticide Factsheets

PPARs regulate metabolism and can be activated by environmental contaminants such as perfluorooctanoic acid (PFOA). PFOA induces neonatal mortality, developmental delay, and growth deficits in mice. Studies in genetically altered mice showed that PPARa is required for PFOA-induced developmental toxicity. In this study, pregnant CD-1 mice were dosed orally from GD1-17 with water or 5 mg PFO/kg to examine PPARa, PPARß, and PPARy expression and profile the effects of PFOA on PPAR-regulated genes. Prenatal and postnatal liver, heart, adrenal, kidney, intestine, stomach, lung, spleen, and thymus were collected at various developmental ages. RNA and protein were examined using qPCR and Western blot analysis. PPAR expression varied with age in all tissues, and in liver PPARa and PPARy expression correlated with nutritional changes as the pups matured. As early as GD14, PFOA affected expression of genes involved in lipid and glucose homeostatic control. The metabolic disruption produced by PFOA may contribute to poor postnatal survival and persistent weight deficits of neonates This paper represents the continuing efforts at ORD, in response to the call for assistance from OPPTS, to investigate the potential developmental toxicities of perfluoroalkyl acids (PFAA). Perfluorooctanoic acid (PFOA) is a compound which persists and is found ubiquitously in the environment, wildlife and humans. Studies in our laboratory using an in vitro transfected cell model showed that PFO

Effect of Morinda citrifolia (Noni)-Enriched Diet on Hepatic Heat Shock Protein and Lipid Metabolism-Related Genes in Heat Stressed Broiler Chickens.

PubMed

Flees, Joshua; Rajaei-Sharifabadi, Hossein; Greene, Elizabeth; Beer, Lesleigh; Hargis, Billy M; Ellestad, Laura; Porter, Tom; Donoghue, Annie; Bottje, Walter G; Dridi, Sami

2017-01-01

Heat stress (HS) has been reported to alter fat deposition in broilers, however the underlying molecular mechanisms are not well-defined. The objectives of the current study were, therefore: (1) to determine the effects of acute (2 h) and chronic (3 weeks) HS on the expression of key molecular signatures involved in hepatic lipogenic and lipolytic programs, and (2) to assess if diet supplementation with dried Noni medicinal plant (0.2% of the diet) modulates these effects. Broilers (480 males, 1 d) were randomly assigned to 12 environmental chambers, subjected to two environmental conditions (heat stress, HS, 35°C vs. thermoneutral condition, TN, 24°C) and fed two diets (control vs. Noni) in a 2 × 2 factorial design. Feed intake and body weights were recorded, and blood and liver samples were collected at 2 h and 3 weeks post-heat exposure. HS depressed feed intake, reduced body weight, and up regulated the hepatic expression of heat shock protein HSP60, HSP70, HSP90 as well as key lipogenic proteins (fatty acid synthase, FASN; acetyl co-A carboxylase alpha, ACCα and ATP citrate lyase, ACLY). HS down regulated the hepatic expression of lipoprotein lipase (LPL) and hepatic triacylglycerol lipase (LIPC), but up-regulated ATGL. Although it did not affect growth performance, Noni supplementation regulated the hepatic expression of lipogenic proteins in a time- and gene-specific manner. Prior to HS, Noni increased ACLY and FASN in the acute and chronic experimental conditions, respectively. During acute HS, Noni increased ACCα, but reduced FASN and ACLY expression. Under chronic HS, Noni up regulated ACCα and FASN but it down regulated ACLY. In vitro studies, using chicken hepatocyte cell lines, showed that HS down-regulated the expression of ACCα, FASN, and ACLY. Treatment with quercetin, one bioactive ingredient in Noni, up-regulated the expression of ACCα, FASN, and ACLY under TN conditions, but it appeared to down-regulate ACCα and increase ACLY levels under HS exposure. In conclusion, our findings indicate that HS induces hepatic lipogenesis in chickens and this effect is probably mediated via HSPs. The modulation of hepatic HSP expression suggest also that Noni might be involved in modulating the stress response in chicken liver.

Effect of Morinda citrifolia (Noni)-Enriched Diet on Hepatic Heat Shock Protein and Lipid Metabolism-Related Genes in Heat Stressed Broiler Chickens

PubMed Central

Flees, Joshua; Rajaei-Sharifabadi, Hossein; Greene, Elizabeth; Beer, Lesleigh; Hargis, Billy M.; Ellestad, Laura; Porter, Tom; Donoghue, Annie; Bottje, Walter G.; Dridi, Sami

2017-01-01

Heat stress (HS) has been reported to alter fat deposition in broilers, however the underlying molecular mechanisms are not well-defined. The objectives of the current study were, therefore: (1) to determine the effects of acute (2 h) and chronic (3 weeks) HS on the expression of key molecular signatures involved in hepatic lipogenic and lipolytic programs, and (2) to assess if diet supplementation with dried Noni medicinal plant (0.2% of the diet) modulates these effects. Broilers (480 males, 1 d) were randomly assigned to 12 environmental chambers, subjected to two environmental conditions (heat stress, HS, 35°C vs. thermoneutral condition, TN, 24°C) and fed two diets (control vs. Noni) in a 2 × 2 factorial design. Feed intake and body weights were recorded, and blood and liver samples were collected at 2 h and 3 weeks post-heat exposure. HS depressed feed intake, reduced body weight, and up regulated the hepatic expression of heat shock protein HSP60, HSP70, HSP90 as well as key lipogenic proteins (fatty acid synthase, FASN; acetyl co-A carboxylase alpha, ACCα and ATP citrate lyase, ACLY). HS down regulated the hepatic expression of lipoprotein lipase (LPL) and hepatic triacylglycerol lipase (LIPC), but up-regulated ATGL. Although it did not affect growth performance, Noni supplementation regulated the hepatic expression of lipogenic proteins in a time- and gene-specific manner. Prior to HS, Noni increased ACLY and FASN in the acute and chronic experimental conditions, respectively. During acute HS, Noni increased ACCα, but reduced FASN and ACLY expression. Under chronic HS, Noni up regulated ACCα and FASN but it down regulated ACLY. In vitro studies, using chicken hepatocyte cell lines, showed that HS down-regulated the expression of ACCα, FASN, and ACLY. Treatment with quercetin, one bioactive ingredient in Noni, up-regulated the expression of ACCα, FASN, and ACLY under TN conditions, but it appeared to down-regulate ACCα and increase ACLY levels under HS exposure. In conclusion, our findings indicate that HS induces hepatic lipogenesis in chickens and this effect is probably mediated via HSPs. The modulation of hepatic HSP expression suggest also that Noni might be involved in modulating the stress response in chicken liver. PMID:29230177

Developmentally regulated expression of APG-1, a member of heat shock protein 110 family in murine male germ cells.

PubMed

Kaneko, Y; Kimura, T; Nishiyama, H; Noda, Y; Fujita, J

1997-04-07

Apg-1 encodes a heat shock protein belonging to the heat shock protein 110 family, and is inducible by a 32 degrees C to 39 degrees C heat shock. Northern blot analysis of the testis from immature and adult mice, and of the purified germ cells revealed the quantitative change of the apg-1 transcripts during germ cell development. By in situ hybridization histochemistry the expressions of the apg-1 transcripts were detected in germ cells at specific stages of development including spermatocytes and spermatids. Although heat-induction of the apg-1 transcripts was observed in W/Wv mutant testis lacking germ cells, it was not detected in wild-type testis nor in the purified germ cells. Thus, the apg-1 expression is not heat-regulated but developmentally regulated in germ cells, suggesting that APG-1 plays a role in normal development of germ cells.

Transcriptomic analysis reveals the gene expression profile that specifically responds to IBA during adventitious rooting in mung bean seedlings.

PubMed

Li, Shi-Weng; Shi, Rui-Fang; Leng, Yan; Zhou, Yuan

2016-01-12

Auxin plays a critical role in inducing adventitious rooting in many plants. Indole-3-butyric acid (IBA) is the most widely employed auxin for adventitious rooting. However, the molecular mechanisms by which auxin regulate the process of adventitious rooting are less well known. The RNA-Seq data analysis indicated that IBA treatment greatly increased the amount of clean reads and the amount of expressed unigenes by 24.29 % and 27.42 % and by 4.3 % and 5.04 % at two time points, respectively, and significantly increased the numbers of unigenes numbered with RPKM = 10-100 and RPKM = 500-1000 by 13.04 % and 3.12 % and by 24.66 % and 108.2 % at two time points, respectively. Gene Ontology (GO) enrichment analysis indicated that the enrichment of down-regulated GOs was 2.87-fold higher than that of up-regulated GOs at stage 1, suggesting that IBA significantly down-regulated gene expression at 6 h. The GO functional category indicated that IBA significantly up- or down-regulated processes associated with auxin signaling, ribosome assembly and protein synthesis, photosynthesis, oxidoreductase activity and extracellular region, secondary cell wall biogenesis, and the cell wall during the development process. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment indicated that ribosome biogenesis, plant hormone signal transduction, pentose and glucuronate interconversions, photosynthesis, phenylpropanoid biosynthesis, sesquiterpenoid and triterpenoid biosynthesis, ribosome, cutin, flavonoid biosynthesis, and phenylalanine metabolism were the pathways most highly regulated by IBA. A total of 6369 differentially expressed (2-fold change > 2) unigenes (DEGs) with 3693 (58 %) that were up-regulated and 2676 (42 %) down-regulated, 5433 unigenes with 2208 (40.6 %) that were up-regulated and 3225 (59.4 %) down-regulated, and 7664 unigenes with 3187 (41.6 %) that were up-regulated and 4477 (58.4 %) down-regulated were detected at stage 1, stage 2, and between stage 1 and stage 2, respectively, suggesting that IBA treatment increased the number of DEGs. A total of 143 DEGs specifically involved in plant hormone signaling and 345 transcription factor (TF) genes were also regulated by IBA. qRT-PCR validation of the 36 genes with known functions indicated a strong correlation with the RNA-Seq data. The changes in GO functional categories, KEGG pathways, and global DEG profiling during adventitious rooting induced by IBA were analyzed. These results provide valuable information about the molecular traits of IBA regulation of adventitious rooting.

Facial emotion recognition in Williams syndrome and Down syndrome: A matching and developmental study.

PubMed

Martínez-Castilla, Pastora; Burt, Michael; Borgatti, Renato; Gagliardi, Chiara

2015-01-01

In this study both the matching and developmental trajectories approaches were used to clarify questions that remain open in the literature on facial emotion recognition in Williams syndrome (WS) and Down syndrome (DS). The matching approach showed that individuals with WS or DS exhibit neither proficiency for the expression of happiness nor specific impairments for negative emotions. Instead, they present the same pattern of emotion recognition as typically developing (TD) individuals. Thus, the better performance on the recognition of positive compared to negative emotions usually reported in WS and DS is not specific of these populations but seems to represent a typical pattern. Prior studies based on the matching approach suggested that the development of facial emotion recognition is delayed in WS and atypical in DS. Nevertheless, and even though performance levels were lower in DS than in WS, the developmental trajectories approach used in this study evidenced that not only individuals with DS but also those with WS present atypical development in facial emotion recognition. Unlike in the TD participants, where developmental changes were observed along with age, in the WS and DS groups, the development of facial emotion recognition was static. Both individuals with WS and those with DS reached an early maximum developmental level due to cognitive constraints.

HA117 endows HL60 cells with a stem-like signature by inhibiting the degradation of DNMT1 via its ability to down-regulate expression of the GGL domain of RGS6

PubMed Central

Li, Shuangshuang; Wu, Huan; Wang, Yi; Li, Xiaoqing; Guo, Yuxia; Liang, Shaoyan

2017-01-01

All-trans retinoic acid (ATRA) induces complete remission in almost all patients with acute promyelocytic leukemia (APL) via its ability to induce the in vivo differentiation of APL blasts. However, prolonged ATRA treatment can result in drug resistance. In previous studies, we generated a multi-drug-resistant HL60/ATRA cell line and found it to contain a new drug resistance-related gene segment, HA117. In this study, we demonstrate that ATRA induces multi-drug-resistant subpopulations of HL60 cells with a putative stem-like signature by up-regulating the expression of the new gene segment HA117. Western blot analysis and quantitative real-time PCR demonstrated that HA117 causes alternative splicing of regulator of G-protein signaling 6 (RGS6) and down-regulation of the expression of the GGL domain of RGS6, which plays an important role in DNA methyltransferase 1 (DNMT1) degradation. Moreover, DNMT1 expression was increased in multi-drug resistance HL60/ATRA cells. Knockdown of HA117 restored expression of the GGL domain and blocked DNMT1 expression. Moreover, resistant cells displayed a putative stem-like signature with increased expression of cancer steam cell markers CD133 and CD123. The stem cell marker, Nanog, was significantly up-regulated. In conclusion, our study shows that HA117 potentially promotes the stem-like signature of the HL60/ATRA cell line by inhibiting by the ubiquitination and degradation of DNMT1 and by down-regulating the expression of the GGL domain of RGS6. These results throw light on the cellular events associated with the ATRA-induced multi-drug resistance phenotype in acute leukemia. PMID:28665981

Thyroid Hormone Receptor β (THRB) Is a Major Target Gene for MicroRNAs Deregulated in Papillary Thyroid Carcinoma (PTC)

PubMed Central

Boguslawska, Joanna; Jendrzejewski, Jaroslaw; Liyanarachchi, Sandya; Pachucki, Janusz; Wardyn, Kazimierz A.; Nauman, Alicja

2011-01-01

Context: Loss of the thyroid hormone receptor is common in tumors. In mouse models, a truncated THRB gene leads to thyroid cancer. Previously, we observed up-regulation of the expression of eight microRNAs (miRs) in papillary thyroid carcinoma (PTC) tumors. Objective: Our objective was to determine whether THRB might be inhibited by miRs up-regulated in PTC. Design: The potential binding of miR to the 3′-untranslated region of THRB was analyzed in silico. Direct inhibition by miRs binding to the cloned 3′-untranslated region of THRB was evaluated using luciferase assays. Inhibition of endogenous THRB and its target genes (DIO1 and APP) was examined in cell lines transfected by pre-miRs. The impact on thyroid hormone response element (TRE) was evaluated in promoter assays. Correlations between the expression of THRB and miRs was evaluated in 13 PTC tumor/normal tissue pairs. Results: THRB contains binding sites for the top seven miRs up-regulated in PTC (P = 0.0000002). Direct interaction with THRB was shown for miR-21 and miR-146a. We observed lower levels of THRB transcripts in cell lines transfected with miR-21, -146a, and -221 (down-regulation of 37–48%; P < 0.0001), but not with miR-181a. THRB protein was suppressed down to 10–28% by each of four miRs. Concomitant expression of DIO1 and APP was affected (down-regulation of 32–66%, P < 0.0034 and up-regulation of 48–57%, P < 0.0002, respectively). All four miRs affected TRE activity in promoter assays. Down-regulation of luciferase occurred after transfection with pTRE-TK-Luc construct and each of four miRs. The analysis of tumor/normal tissue pairs revealed down-regulation of THRB in 11 of 13 pairs (1.3- to 9.1-fold), and up-regulation of miR-21, -146a, -181a, and -221 in almost all pairs. Conclusions: MiRs up-regulated in PTC tumors directly inhibit the expression of THRB, an important tumor suppressor gene. PMID:21159845

Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

2015-04-15

DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

Influence of nutrient signals and carbon allocation on the expression of phosphate and nitrogen transporter genes in winter wheat (Triticum aestivum L.) roots colonized by arbuscular mycorrhizal fungi

PubMed Central

Tian, Hui; Yuan, Xiaolei; Duan, Jianfeng; Li, Wenhu; Zhai, Bingnian; Gao, Yajun

2017-01-01

Arbuscular mycorrhizal (AM) colonization of plant roots causes the down-regulation of expression of phosphate (Pi) or nitrogen (N) transporter genes involved in direct nutrient uptake pathways. The mechanism of this effect remains unknown. In the present study, we sought to determine whether the expression of Pi or N transporter genes in roots of winter wheat colonized by AM fungus responded to (1) Pi or N nutrient signals transferred from the AM extra-radical hyphae, or (2) carbon allocation changes in the AM association. A three-compartment culture system, comprising a root compartment (RC), a root and AM hyphae compartment (RHC), and an AM hyphae compartment (HC), was used to test whether the expression of Pi or N transporter genes responded to nutrients (Pi, NH4+ and NO3-) added only to the HC. Different AM inoculation density treatments (roots were inoculated with 0, 20, 50 and 200 g AM inoculum) and light regime treatments (6 hours light and 18 hours light) were established to test the effects of carbon allocation on the expression of Pi or N transporter genes in wheat roots. The expression of two Pi transporter genes (TaPT4 and TaPHT1.2), five nitrate transporter genes (TaNRT1.1, TaNRT1.2, TaNRT2.1, TaNRT2.2, and TaNRT2.3), and an ammonium transporter gene (TaAMT1.2) was quantified using real-time polymerase chain reaction. The expression of TaPT4, TaNRT2.2, and TaAMT1.2 was down-regulated by AM colonization only when roots of host plants received Pi or N nutrient signals. However, the expression of TaPHT1.2, TaNRT2.1, and TaNRT2.3 was down-regulated by AM colonization, regardless of whether there was nutrient transfer from AM hyphae. The expression of TaNRT1.2 was also down-regulated by AM colonization even when there was no nutrient transfer from AM hyphae. The present study showed that an increase in carbon consumption by the AM fungi did not necessarily result in greater down-regulation of expression of Pi or N transporter genes. PMID:28207830

Influence of nutrient signals and carbon allocation on the expression of phosphate and nitrogen transporter genes in winter wheat (Triticum aestivum L.) roots colonized by arbuscular mycorrhizal fungi.

PubMed

Tian, Hui; Yuan, Xiaolei; Duan, Jianfeng; Li, Wenhu; Zhai, Bingnian; Gao, Yajun

2017-01-01

Arbuscular mycorrhizal (AM) colonization of plant roots causes the down-regulation of expression of phosphate (Pi) or nitrogen (N) transporter genes involved in direct nutrient uptake pathways. The mechanism of this effect remains unknown. In the present study, we sought to determine whether the expression of Pi or N transporter genes in roots of winter wheat colonized by AM fungus responded to (1) Pi or N nutrient signals transferred from the AM extra-radical hyphae, or (2) carbon allocation changes in the AM association. A three-compartment culture system, comprising a root compartment (RC), a root and AM hyphae compartment (RHC), and an AM hyphae compartment (HC), was used to test whether the expression of Pi or N transporter genes responded to nutrients (Pi, NH4+ and NO3-) added only to the HC. Different AM inoculation density treatments (roots were inoculated with 0, 20, 50 and 200 g AM inoculum) and light regime treatments (6 hours light and 18 hours light) were established to test the effects of carbon allocation on the expression of Pi or N transporter genes in wheat roots. The expression of two Pi transporter genes (TaPT4 and TaPHT1.2), five nitrate transporter genes (TaNRT1.1, TaNRT1.2, TaNRT2.1, TaNRT2.2, and TaNRT2.3), and an ammonium transporter gene (TaAMT1.2) was quantified using real-time polymerase chain reaction. The expression of TaPT4, TaNRT2.2, and TaAMT1.2 was down-regulated by AM colonization only when roots of host plants received Pi or N nutrient signals. However, the expression of TaPHT1.2, TaNRT2.1, and TaNRT2.3 was down-regulated by AM colonization, regardless of whether there was nutrient transfer from AM hyphae. The expression of TaNRT1.2 was also down-regulated by AM colonization even when there was no nutrient transfer from AM hyphae. The present study showed that an increase in carbon consumption by the AM fungi did not necessarily result in greater down-regulation of expression of Pi or N transporter genes.

HSF4 is required for normal cell growth and differentiation during mouse lens development

PubMed Central

Fujimoto, Mitsuaki; Izu, Hanae; Seki, Keisuke; Fukuda, Ken; Nishida, Teruo; Yamada, Shu-ichi; Kato, Kanefusa; Yonemura, Shigenobu; Inouye, Sachiye; Nakai, Akira

2004-01-01

The heat shock transcription factor (HSF) family consists of three members in mammals and regulates expression of heat shock genes via a heat shock element. HSF1 and HSF2 are required for some developmental processes, but it is unclear how they regulate these processes. To elucidate the mechanisms of developmental regulation by HSFs, we generated mice in which the HSF4 gene is mutated. HSF4-null mice had cataract with abnormal lens fiber cells containing inclusion-like structures, probably due to decreased expression of γ-crystallin, which maintains protein stability. Furthermore, we found increased proliferation and premature differentiation of the mutant lens epithelial cells, which is associated with increased expression of growth factors, FGF-1, FGF-4, and FGF-7. Unexpectedly, HSF1 competed with HSF4 for the expression of FGFs not only in the lens but also in other tissues. These findings reveal the lens-specific role of HSF4, which activates γ-crystallin genes, and also indicate that HSF1 and HSF4 are involved in regulating expression of growth factor genes, which are essential for cell growth and differentiation. PMID:15483628

Progranulin regulates neurogenesis in the developing vertebrate retina.

PubMed

Walsh, Caroline E; Hitchcock, Peter F

2017-09-01

We evaluated the expression and function of the microglia-specific growth factor, Progranulin-a (Pgrn-a) during developmental neurogenesis in the embryonic retina of zebrafish. At 24 hpf pgrn-a is expressed throughout the forebrain, but by 48 hpf pgrn-a is exclusively expressed by microglia and/or microglial precursors within the brain and retina. Knockdown of Pgrn-a does not alter the onset of neurogenic programs or increase cell death, however, in its absence, neurogenesis is significantly delayed-retinal progenitors fail to exit the cell cycle at the appropriate developmental time and postmitotic cells do not acquire markers of terminal differentiation, and microglial precursors do not colonize the retina. Given the link between Progranulin and cell cycle regulation in peripheral tissues and transformed cells, we analyzed cell cycle kinetics among retinal progenitors following Pgrn-a knockdown. Depleting Pgrn-a results in a significant lengthening of the cell cycle. These data suggest that Pgrn-a plays a dual role during nervous system development by governing the rate at which progenitors progress through the cell cycle and attracting microglial progenitors into the embryonic brain and retina. Collectively, these data show that Pgrn-a governs neurogenesis by regulating cell cycle kinetics and the transition from proliferation to cell cycle exit and differentiation. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc. Develop Neurobiol 77: 1114-1129, 2017. © 2017 The Authors. Developmental Neurobiology Published by Wiley Periodicals, Inc.

Rapid down-regulation of γc on T cells in early SIV infection correlates with impairment of T-cell function.

PubMed

Xu, Huanbin; Wang, Xiaolei; Pahar, Bapi; Alvarez, Xavier; Rasmussen, Kelsi K; Lackner, Andrew A; Veazey, Ronald S

2012-06-01

The common γ(c) subunit molecule is shared among all γ(c) cytokines and clearly involved in T-cell function, but its role in HIV infection and immunity is not well understood. Here, we examined expression and function of γ(c) on T cells during SIV infection in Rhesus macaques. Surface γ(c) distribution was differentially expressed on CD4(+) and CD8(+) T cells, and CD4(+) naive/memory cell populations in various lymphoid tissues of normal macaques. However, surface γ(c) expression was rapidly and significantly down-regulated on T cells in acute infection with pathogenic SIV, compared to infection with a less virulent SHIV or controls and did not recover on CD8(+) T cells in the chronic stage. Moreover, the peripheral and CD4(+)T cell loss was inversely correlated with γ(c)(+) CD8(+) T cells in individual tissues. γ(c)(+) T cells were mainly functional as evidenced by higher cytokine secretion and proliferative capacity. Further in vitro experiments found that surface γ(c) expression could be down-regulated following high level of IL-7 treatment by both internalization and shedding. Down-regulation of γ(c) during early HIV/SIV infection may inhibit T-cell function, particularly of CD8(+) T cells, and, may be linked with immune failure and loss of viral containment.

Regulation of root hair initiation and expansin gene expression in Arabidopsis

NASA Technical Reports Server (NTRS)

Cho, Hyung-Taeg; Cosgrove, Daniel J.

2002-01-01

The expression of two Arabidopsis expansin genes (AtEXP7 and AtEXP18) is tightly linked to root hair initiation; thus, the regulation of these genes was studied to elucidate how developmental, hormonal, and environmental factors orchestrate root hair formation. Exogenous ethylene and auxin, as well as separation of the root from the medium, stimulated root hair formation and the expression of these expansin genes. The effects of exogenous auxin and root separation on root hair formation required the ethylene signaling pathway. By contrast, blocking the endogenous ethylene pathway, either by genetic mutations or by a chemical inhibitor, did not affect normal root hair formation and expansin gene expression. These results indicate that the normal developmental pathway for root hair formation (i.e., not induced by external stimuli) is independent of the ethylene pathway. Promoter analyses of the expansin genes show that the same promoter elements that determine cell specificity also determine inducibility by ethylene, auxin, and root separation. Our study suggests that two distinctive signaling pathways, one developmental and the other environmental/hormonal, converge to modulate the initiation of the root hair and the expression of its specific expansin gene set.

Triazole induced concentration-related gene signatures in rat whole embryo culture.

PubMed

Robinson, Joshua F; Tonk, Elisa C M; Verhoef, Aart; Piersma, Aldert H

2012-09-01

Commonly used as antifungal agents in agriculture and medicine, triazoles have been shown to cause teratogenicity in a diverse set of animal models. Here, we evaluated the dose-dependent impacts of flusilazole, cyproconazole and triadimefon, on global gene expression in relation to effects on embryonic development using the rat whole embryo culture (WEC) model. After 4 h exposure, we identified changes in gene expression due to triazole exposure which preceded morphological alterations observed at 48 h. In general, across the three triazoles, we observed similar directionality of regulation in gene expression and the magnitude of effects on gene expression correlated with the degree of induced developmental toxicity. Significantly regulated genes included key members of steroid/cholesterol and retinoic acid metabolism and hindbrain developmental pathways. Direct comparisons with previous studies suggest that triazole-gene signatures identified in the WEC overlap with zebrafish and mouse, and furthermore, triazoles impact gene expression in a similar manner as retinoic acid exposures in rat embryos. In summary, we further differentiate pathways underlying triazole-developmental toxicity using WEC and demonstrate the conservation of these response-pathways across model systems. Copyright © 2012 Elsevier Inc. All rights reserved.

Characterization and Expression Patterns of microRNAs Involved in Rice Grain Filling

PubMed Central

Du, Yanxiu; Zhang, Jing; Li, Junzhou; Liu, Yanxia; Zhao, Yafan; Zhao, Quanzhi

2013-01-01

MicroRNAs (miRNAs) are upstream gene regulators of plant development and hormone homeostasis through their directed cleavage or translational repression of the target mRNAs, which may play crucial roles in rice grain filling and determining the final grain weight and yield. In this study, high-throughput sequencing was performed to survey the dynamic expressions of miRNAs and their corresponding target genes at five distinct developmental stages of grain filling. In total, 445 known miRNAs and 45 novel miRNAs were detected with most of them expressed in a developmental stage dependent manner, and the majority of known miRNAs, which increased gradually with rice grain filling, showed negatively related to the grain filling rate. Detailed expressional comparisons revealed a clear negative correlation between most miRNAs and their target genes. It was found that specific miRNA cohorts are expressed in a developmental stage dependent manner during grain filling and the known functions of these miRNAs are involved in plant hormone homeostasis and starch accumulation, indicating that the expression dynamics of these miRNAs might play key roles in regulating rice grain filling. PMID:23365650

[Expression and clinical significance of BCL6 corepressor-like 1 in non-small cell lung cancer].

PubMed

Zhao, Xu; Tuo, Hang; Si, Meili; Wang, Lei; Liang, Ping

2015-12-01

To detect the expression of BCL6 corepressor-like 1 (BCORL1) in tumor tissues of human non-small cell lung cancer (NSCLC) and determine the effect of BCORL1 on cell migration and invasion in A549 cells by knockdown of BCORL1. Sixty-eight pairs of NSCLC and nontumor tissues were collected and the expressions of BCORL1 and E-cadherin in them were detected using immunohistochemical staining. The expression of BCORL1 was knocked down by siRNA in A549 cells. Transwell(TM) assays were performed to test NSCLC cell migration and invasion in vitro. The expression of BCORL1 in NSCLC was significantly higher than that in paired noncancerous tissues, while E-cadherin was down-regulated in NSCLC as compared with nontumor tissues. Pearson correlation coefficient analysis suggested that BCORL1 was negatively correlated with E-cadherin expression in NSCLC tissues. Clinical association analysis suggested that the elevated expression of BCORL1 was evidently associated with the higher incidence of lymph node metastasis and more advanced TNM stage. When the expression of BCORL1 was down-regulated by a specific siRNA, E-cadherin was up-regulated, and BCORL1 knockdown obviously inhibited cell migration and invasion in A549 cells. BCORL1 is overexpressed in NSCLC tissues and it is negatively correlated with E-cadherin expression. Its high expression is correlated with poor prognostic features. BCORL1 knockdown up-regulates E-cadherin expression and subsequently inhibits cell migration and invasion of lung cancer cells.

MiR-29b inhibits collagen maturation in hepatic stellate cells through down-regulating the expression of HSP47 and lysyl oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yifei; Ghazwani, Mohammed; Li, Jiang

Highlights: • Enhanced HSP47 and LOX expression is associated with decreased miR-29b level in liver fibrosis. • miR-29b down-regulates HSP47 and LOX expression. • The suppression of HSP47 and LOX by miR-29b is mediated by putative sites at their 3′-UTRs. • miR-29b inhibits extracellular LOX activity and collagen maturation. - Abstract: Altered expression of miR-29b is implicated in the pathogenesis and progression of liver fibrosis. We and others previously demonstrated that miR-29b down-regulates the expression of several extracellular-matrix (ECM) genes including Col 1A1, Col 3A1 and Elastin via directly targeting their 3′-UTRs. However, whether or not miR-29b plays a rolemore » in the post-translational regulation of ECM biosynthesis has not been reported. Heat shock protein 47 (HSP47) and lysyl oxidase (LOX) are known to be essential for ECM maturation. In this study we have demonstrated that expression of HSP47 and LOX was significantly up-regulated in culture-activated primary rat hepatic stellate cells (HSCs), TGF-β stimulated LX-2 cells and liver tissue of CCl{sub 4}-treated mice, which was accompanied by a decrease of miR-29b level. In addition, over-expression of miR-29b in LX-2 cells resulted in significant inhibition on HSP47 and LOX expression. Mechanistically, miR-29b inhibited the expression of a reporter gene that contains the respective full-length 3′-UTR from HSP47 and LOX gene, and this inhibitory effect was abolished by the deletion of a putative miR-29b targeting sequence from the 3′-UTRs. Transfection of LX-2 cells with miR-29b led to abnormal collagen structure as shown by electron-microscopy, presumably through down-regulation of the expression of molecules involved in ECM maturation including HSP47 and LOX. These results demonstrated that miR-29b is involved in regulating the post-translational processing of ECM and fibril formation.« less

Molecular Genetic Traits Influencing Maize Endosperm Development and Value: Closeout Report for DOE Grant DE-FG02-96ER20242

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brian A. Larkins

2012-09-12

Development of the endosperm in cereal grasses entails different phases characterized by cell division, endoreduplication, accumulation of storage metabolites and cell death, which need to be carried out in an orderly fashion. While correct regulation of the cell cycle plays an essential role in endosperm development, the key regulatory factors and how the cell cycle interfaces with other pathways in this developmental context are largely unknown. We investigated the cyclin-dependent kinase (CDK)-retinoblastoma pathway and how it controls the cell cycle and coordinates it with other processes during maize endosperm development. Retinoblastoma-related (RBR) proteins may be inactivated through CDK-mediated phosphorylation, butmore » the identity of the responsible kinase in maize is unknown. We have previously shown that down-regulation of CDKA;1 severely inhibits the endoreduplication cell cycle and suggested that CDK may be an up-stream regulator of the retinoblastoma pathway. We discovered two types of maize RBR genes, RBR1 and RBR3, which differ in terms of structure, regulation and function. Phylogenetic analyses indicate that these genes may be distinctive features of the Poaceae. We found that RBR3 plays a positive rather than a negative role in DNA replication, cell transformation, and the expression of the minichromosome maintenance (MCM)2-7 family of DNA replication factors. These features are a paradigm shift in RBR gene function and appear to be unique within the RBR gene family. They suggest the existence in maize and related cereal crops of specific RBR/E2F-dependent pathways impinging on the cell cycle and development. RBR1 was down-regulated in transgenic endosperm using RNAi approaches. This resulted in the de-repression of a number of down-stream E2F targets, including RBR3, the MCM2-7 gene family, DNA methyltransferase (MET)1, CDKB;1, and the recently identified RBR4 gene. It also increased endosperm ploidy levels, stimulated the production of a larger number of cells, reduced the average cell size, and promoted programmed cell death. To test whether CDKA;1 inhibits RBR1 (through phosphorylation) in the pathway that leads to DNA synthesis and endoreduplication, the two CDKA;1 and RBR1 down-regulated mutants were crossed and their progeny analyzed. Our results indicate that CDKA;1 controls endoreduplication through an RBR1-dependent pathway. However, the ability of RBR1 to repress gene expression programs is independent from CDKA1, suggesting the presence of two differently regulated RBR1 activities in developing endosperm. One type of RBR1 activity controls E2F-dependent gene expression and is largely independent from CDKA;1, while another suppresses endoreduplication and can be inhibited by CDKA;1. In addition, RBR1 is part of a regulatory feedback loop that impinges on CDK activity. Together, these results indicate that the CDKA;1-RBR1 pathway integrates and controls different processes associated with endosperm development. Genome-wide analyses of the transcriptome, metabolome, and epigenetic mechanisms to understand how the cell cycle is coordinated with other pathways at a systems biology level are currently underway.« less

MUS81 is associated with cell proliferation and cisplatin sensitivity in serous ovarian cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Suhong; Zheng, Hui; Department of Oncology, Shanghai Medical College, Fudan University, Shanghai

The dysfunction of DNA damage repair (DDR) pathway contributes to tumorigenesis and drug-resistance in cancer. MUS81 is a member of the conserved xeroderma pigmentosum group F (XPF) family protein of endonucleases, which is important to the DDR pathway. However, the role of MUS81 in the development of ovarian cancer remains uncertain. To explore the expression of MUS81 and its association to serous ovarian cancer (SOC), 43 biopsies of SOC patients were detected by qRT-PCR, and 29 specimens were further performed by immunohistochemistry analysis. Here, we observed that MUS81 was over-expressed in SOC tissues at both transcript and protein levels, andmore » the expression level of MUS81 protein in ovarian cancer cell lines was also higher than that in human normal ovarian surface epithelial cell line (HOSEpiC). We also found that down-regulation of MUS81 expression in ovarian cancer cells inhibited cell proliferation and colony formation ability, and influenced cell cycle progression. Moreover, inhibition of MUS81 expression induced cellular senescence and enhanced the antitumor effect of cisplatin. Down-regulation of MUS81 expression could suppress the growth and development of SOC. These results indicate that MUS81 might play important roles in the progression of SOC and influence the antitumor effect of cisplatin. - Highlights: • MUS81 was overexpression in serous ovarian cancer (SOC). • Meanwhile down-regulation of inhibited cell proliferation and influenced cell cycle progression. • Inhibition of MUS81 induced cell cellular senescence and enhanced the antitumor effect of cisplatin. • Down-regulation of MUS81 expression could suppress the growth and development of SOC.« less

Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

PubMed

Baskar, Venkidasamy; Park, Se Won

2015-07-01

Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

Dose–response analysis of phthalate effects on gene expression in rat whole embryo culture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, Joshua F.; Department of Toxicogenomics, Maastricht University, Maastricht; Verhoef, Aart

2012-10-01

The rat postimplantation whole embryo culture (WEC) model serves as a potential screening tool for developmental toxicity. In this model, cultured rat embryos are exposed during early embryogenesis and evaluated for morphological effects. The integration of molecular-based markers may lead to improved objectivity, sensitivity and predictability of WEC in assessing developmental toxic properties of compounds. In this study, we investigated the concentration-dependent effects of two phthalates differing in potency, mono(2-ethylhexyl) phthalate (MEHP) and monomethyl phthalate (MMP, less toxic), on the transcriptome in WEC to examine gene expression in relation with dysmorphogenesis. MEHP was more potent than MMP in inducing genemore » expression changes as well as changes on morphology. MEHP induced significant enrichment of cholesterol/lipid/steroid (CLS) metabolism and apoptosis pathways which was associated with developmental toxicity. Regulation of genes within CLS metabolism pathways represented the most sensitive markers of MEHP exposure, more sensitive than classical morphological endpoints. As shown in direct comparisons with toxicogenomic in vivo studies, alterations in the regulation of CLS metabolism pathways has been previously identified to be associated with developmental toxicity due to phthalate exposure in utero. Our results support the application of WEC as a model to examine relative phthalate potency through gene expression and morphological responses. Additionally, our results further define the applicability domain of the WEC model for developmental toxicological investigations. -- Highlights: ► We examine the effect of two phthalates on gene expression and morphology in WEC. ► MEHP is more potent than MMP in inducing gene expression changes and dysmorphogenesis. ► MEHP significantly disrupts cholesterol metabolism pathways in a dose-dependent manner. ► Specific phthalate-related mechanisms in WEC are relevant to mechanisms in vivo.« less

Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus plantarum 423, monitored with real-time PCR.

PubMed

Ramiah, K; van Reenen, C A; Dicks, L M T

2007-05-30

Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA by Lactobacillus plantarum 423, grown in the presence of bile, pancreatin and at low pH, was studied by real-time PCR. Mub, MapA and EF-Tu were up-regulated in the presence of mucus, proportional to increasing concentrations. Expression of MapA was up-regulated in the presence of 3.0 g/l bile and 3.0 g/l pancreatin at pH 6.5. Similar results were recorded in the presence of 10.0 g/l bile and 10.0 g/l pancreatin at pH 6.5. Expression of Mub was down-regulated in the presence of bile and pancreatin, whilst the expression of EF-Tu and plaA remained unchanged. Expression of Mub and MapA remained unchanged at pH 4.0, whilst expression of EF-Tu and plaA were up-regulated. Expression of MapA was down-regulated in the presence of 1.0 g/l l-cysteine HCl, suggesting that the gene is regulated by transcription attenuation that involves cysteine.

HIV turns plasmacytoid dendritic cells (pDC) into TRAIL-expressing killer pDC and down-regulates HIV coreceptors by Toll-like receptor 7-induced IFN-alpha.

PubMed

Hardy, Andrew W; Graham, David R; Shearer, Gene M; Herbeuval, Jean-Philippe

2007-10-30

Plasmacytoid dendritic cells (pDC) are key players in viral immunity and produce IFN-alpha after HIV-1 exposure, which in turn regulates TNF-related apoptosis-inducing ligand (TRAIL) expression by CD4(+) T cells. We show here that infectious and noninfectious HIV-1 virions induce activation of pDC into TRAIL-expressing IFN-producing killer pDC (IKpDC). IKpDC expressed high levels of activation markers (HLA-DR, CD80, CD83, and CD86) and the migration marker CCR7. Surprisingly, CXCR4 and CCR5 were down-regulated on IKpDC. We also show that HIV-1-induced IKpDC depended on Toll-like receptor 7 (TLR7) activation. HIV-1 or TLR7 agonistexposed IKpDC induced apoptosis of the CD4(+) T cell line SupT1 via the TRAIL pathway. Furthermore, IFN-alpha produced after HIV-induced TLR7 stimulation was responsible for TRAIL expression and the down-regulation of both CXCR4 and CCR5 by IKpDC. In contrast, activation and migration markers were not regulated by IFN-alpha. Finally, IFN-alpha increased the survival of IKpDC. We characterized a subset of pDC with a killer activity that is activated by endosomal-associated viral RNA and not by infection.

Silk Gland Gene Expression during Larval-Pupal Transition in the Cotton Leaf Roller Sylepta derogata (Lepidoptera: Pyralidae)

PubMed Central

Su, Honghua; Cheng, Yuming; Wang, Zhongyang; Li, Zhong; Stanley, David; Yang, Yizhong

2015-01-01

The cotton leaf roller, Sylepta derogata, is a silk-producing insect pest. While young larvae feed on the underside of leaves, the older ones roll cotton leaves and feed on the leaf edges, which defoliates cotton plants. The larvae produce silk to stabilize the rolled leaf and to balloon from used to new leaves. Despite the significance of silk in the biology of pest insect species, there is virtually no information on the genes involved in their silk production. This is a substantial knowledge gap because some of these genes may be valuable targets for developing molecular pest management technologies. We addressed the gap by posing the hypothesis that silk gland gene expression changes during the transition from larvae to pupae. We tested our hypothesis using RNA-seq to investigate changes in silk gland gene expression at three developmental stages, 5th instar larvae (silk producing; 15,445,926 clean reads), prepupae (reduced silk producing; 13,758,154) and pupae (beyond silk producing; 16,787,792). We recorded 60,298 unigenes and mapped 50,158 (larvae), 48,415 (prepupae) and 46,623 (pupae) of them to the NCBI database. Most differentially expressed genes in the 5th instar larvae/prepupae libraries were relevant to nucleotide synthesis and maintenance of silk gland function. We identified down-regulated transcriptional factors and several genes involved in silk formation in the three libraries and verified the expression pattern of eight genes by qPCR. The developmental- and tissue-specific expression patterns of the fibroin light chain gene showed it was highly expressed during the larval silk-producing stage. We recorded highest expression of this gene in the larval silk gland, compared to other tissues, including midgut, hindgut, epidermis, Malpighian tubes, hemolymph and fat body. These data are a genetic resource to guide selection of key genes that may be targeted for in planta and other gene-silencing technologies for sustainable cotton agriculture. PMID:26352931

Silk Gland Gene Expression during Larval-Pupal Transition in the Cotton Leaf Roller Sylepta derogata (Lepidoptera: Pyralidae).

PubMed

Su, Honghua; Cheng, Yuming; Wang, Zhongyang; Li, Zhong; Stanley, David; Yang, Yizhong

2015-01-01

The cotton leaf roller, Sylepta derogata, is a silk-producing insect pest. While young larvae feed on the underside of leaves, the older ones roll cotton leaves and feed on the leaf edges, which defoliates cotton plants. The larvae produce silk to stabilize the rolled leaf and to balloon from used to new leaves. Despite the significance of silk in the biology of pest insect species, there is virtually no information on the genes involved in their silk production. This is a substantial knowledge gap because some of these genes may be valuable targets for developing molecular pest management technologies. We addressed the gap by posing the hypothesis that silk gland gene expression changes during the transition from larvae to pupae. We tested our hypothesis using RNA-seq to investigate changes in silk gland gene expression at three developmental stages, 5th instar larvae (silk producing; 15,445,926 clean reads), prepupae (reduced silk producing; 13,758,154) and pupae (beyond silk producing; 16,787,792). We recorded 60,298 unigenes and mapped 50,158 (larvae), 48,415 (prepupae) and 46,623 (pupae) of them to the NCBI database. Most differentially expressed genes in the 5th instar larvae/prepupae libraries were relevant to nucleotide synthesis and maintenance of silk gland function. We identified down-regulated transcriptional factors and several genes involved in silk formation in the three libraries and verified the expression pattern of eight genes by qPCR. The developmental- and tissue-specific expression patterns of the fibroin light chain gene showed it was highly expressed during the larval silk-producing stage. We recorded highest expression of this gene in the larval silk gland, compared to other tissues, including midgut, hindgut, epidermis, Malpighian tubes, hemolymph and fat body. These data are a genetic resource to guide selection of key genes that may be targeted for in planta and other gene-silencing technologies for sustainable cotton agriculture.

Effect of human cytomegalovirus infection on the expression of Hoxb2 and Hoxb4 genes in the developmental process of cord blood erythroid progenitors.

PubMed

Liu, Wen-Jun; Huang, Mei-Xian; Guo, Qu-Lian; Chen, Jun-Hong; Shi, Han

2011-01-01

The aim of the present study was to investigate the role of Hoxb2 and Hoxb4 gene expression induced by human cytomegalovirus (HCMV) and/or all-trans retinoic acid (ATRA) on the proliferation and committed differentiation process of human cord blood hematopoietic stem cells (HSCs) to colony-forming erythroid progenitor cells (CFU-Es) in vitro. Cord blood was collected from the fetal placenta umbilical vein in 12 cases and cultured using hematopoietic stem cell culture technique in vitro. The proliferation and differentiation of cord blood HSCs to CFU-Es were continuously disrupted with HCMV-AD169 and/or 6 x 10⁻⁸ mol/l of ATRA. Expression levels of the Hoxb2 and Hoxb4 genes in the blank, ATRA, HCMV-AD169 and ATRA + HCMV treatment groups of CFU-Es were detected on day 3, 7 and 10 of culture by fluorescent quantitative reverse transcriptase-polymerase chain reaction method. Hoxb2 and Hoxb4 gene expression in each group began on day 3, obviously increased on day 7 and reached a peak on day 10. The expression levels of the Hoxb2 and Hoxb4 genes in the HCMV group were obviously down-regulated compared with the level in the blank group. However, expression levels of the Hoxb2 and Hoxb4 genes were significantly up-regulated in the HCMV + ATRA group compared with the HCMV group (P<0.05). Abnormal expression of the Hoxb2 and Hoxb4 genes induced by HCMV may play important roles in abnormal hematopoietic damage. They were also correlated with the process of erythroid hematopoiesis. ATRA (6 x 10⁻⁸ mol/l) significantly up-regulated expression of the Hoxb2 and Hoxb4 genes in the normal erythroid progenitor cells and in those cells infected with HCMV as well.

Fisetin Induces Apoptosis Through p53-Mediated Up-Regulation of DR5 Expression in Human Renal Carcinoma Caki Cells.

PubMed

Min, Kyoung-Jin; Nam, Ju-Ock; Kwon, Taeg Kyu

2017-08-02

Fisetin is a natural compound found in fruits and vegetables such as strawberries, apples, cucumbers, and onions. Since fisetin can elicit anti-cancer effects, including anti-proliferation and anti-migration, we investigated whether fisetin induced apoptosis in human renal carcinoma (Caki) cells. Fisetin markedly induced sub-G1 population and cleavage of poly (ADP-ribose) polymerase (PARP), which is a marker of apoptosis, and increased caspase activation. We found that pan-caspase inhibitor (z-VAD-fmk) inhibited fisetin-induced apoptosis. In addition, fisetin induced death receptor 5 (DR5) expression at the transcriptional level, and down-regulation of DR5 by siRNA blocked fisetin-induced apoptosis. Furthermore, fisetin induced p53 protein expression through up-regulation of protein stability, whereas down-regulation of p53 by siRNA markedly inhibited fisetin-induced DR5 expression. In contrast, fisetin induced up-regulation of CHOP expression and reactive oxygen species production, which had no effect on fisetin-induced apoptosis. Taken together, our study demonstrates that fisetin induced apoptosis through p53 mediated up-regulation of DR5 expression at the transcriptional level.

Contributions of mRNA abundance, ribosome loading, and post- or peri-translational effects to temporal repression of C. elegans heterochronic miRNA targets

PubMed Central

Stadler, Michael; Artiles, Karen; Pak, Julia; Fire, Andrew

2012-01-01

miRNAs are post-transcriptional regulators of gene activity that reduce protein accumulation from target mRNAs. Elucidating precise molecular effects that animal miRNAs have on target transcripts has proven complex, with varied evidence indicating that miRNA regulation may produce different molecular outcomes in different species, systems, and/or physiological conditions. Here we use high-throughput ribosome profiling to analyze detailed translational parameters for five well-studied targets of miRNAs that regulate C. elegans developmental timing. For two targets of the miRNA lin-4 (lin-14 and lin-28), functional down-regulation was associated with decreases in both overall mRNA abundance and ribosome loading; however, these changes were of substantially smaller magnitude than corresponding changes observed in protein abundance. For three functional targets of the let-7 miRNA family for which down-regulation is critical in temporal progression of the animal (daf-12, hbl-1, and lin-41), we observed only modest changes in mRNA abundance and ribosome loading. lin-41 provides a striking example in that populations of ribosome-protected fragments from this gene remained essentially unchanged during the L3–L4 time interval when lin-41 activity is substantially down-regulated by let-7. Spectra of ribosomal positions were also examined for the five lin-4 and let-7 target mRNAs as a function of developmental time, with no indication of miRNA-induced ribosomal drop-off or significant pauses in translation. These data are consistent with models in which physiological regulation by this set of C. elegans miRNAs derives from combinatorial effects including suppressed recruitment/activation of translational machinery, compromised stability of target messages, and post- or peri-translational effects on lifetimes of polypeptide products. PMID:22855835

Whole-Genome Analysis of the SHORT-ROOT Developmental Pathway in Arabidopsis

PubMed Central

Busch, Wolfgang; Cui, Hongchang; Wang, Jean Y; Blilou, Ikram; Hassan, Hala; Nakajima, Keiji; Matsumoto, Noritaka; Lohmann, Jan U; Scheres, Ben

2006-01-01

Stem cell function during organogenesis is a key issue in developmental biology. The transcription factor SHORT-ROOT (SHR) is a critical component in a developmental pathway regulating both the specification of the root stem cell niche and the differentiation potential of a subset of stem cells in the Arabidopsis root. To obtain a comprehensive view of the SHR pathway, we used a statistical method called meta-analysis to combine the results of several microarray experiments measuring the changes in global expression profiles after modulating SHR activity. Meta-analysis was first used to identify the direct targets of SHR by combining results from an inducible form of SHR driven by its endogenous promoter, ectopic expression, followed by cell sorting and comparisons of mutant to wild-type roots. Eight putative direct targets of SHR were identified, all with expression patterns encompassing subsets of the native SHR expression domain. Further evidence for direct regulation by SHR came from binding of SHR in vivo to the promoter regions of four of the eight putative targets. A new role for SHR in the vascular cylinder was predicted from the expression pattern of several direct targets and confirmed with independent markers. The meta-analysis approach was then used to perform a global survey of the SHR indirect targets. Our analysis suggests that the SHR pathway regulates root development not only through a large transcription regulatory network but also through hormonal pathways and signaling pathways using receptor-like kinases. Taken together, our results not only identify the first nodes in the SHR pathway and a new function for SHR in the development of the vascular tissue but also reveal the global architecture of this developmental pathway. PMID:16640459

Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway.

PubMed

Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi

2012-05-01

Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome

PubMed Central

Gunewardena, Sumedha S.; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D.; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome. PMID:26496202

Deciphering the Developmental Dynamics of the Mouse Liver Transcriptome.

PubMed

Gunewardena, Sumedha S; Yoo, Byunggil; Peng, Lai; Lu, Hong; Zhong, Xiaobo; Klaassen, Curtis D; Cui, Julia Yue

2015-01-01

During development, liver undergoes a rapid transition from a hematopoietic organ to a major organ for drug metabolism and nutrient homeostasis. However, little is known on a transcriptome level of the genes and RNA-splicing variants that are differentially regulated with age, and which up-stream regulators orchestrate age-specific biological functions in liver. We used RNA-Seq to interrogate the developmental dynamics of the liver transcriptome in mice at 12 ages from late embryonic stage (2-days before birth) to maturity (60-days after birth). Among 21,889 unique NCBI RefSeq-annotated genes, 9,641 were significantly expressed in at least one age, 7,289 were differently regulated with age, and 859 had multiple (> = 2) RNA splicing-variants. Factor analysis showed that the dynamics of hepatic genes fall into six distinct groups based on their temporal expression. The average expression of cytokines, ion channels, kinases, phosphatases, transcription regulators and translation regulators decreased with age, whereas the average expression of peptidases, enzymes and transmembrane receptors increased with age. The average expression of growth factors peak between Day-3 and Day-10, and decrease thereafter. We identified critical biological functions, upstream regulators, and putative transcription modules that seem to govern age-specific gene expression. We also observed differential ontogenic expression of known splicing variants of certain genes, and 1,455 novel splicing isoform candidates. In conclusion, the hepatic ontogeny of the transcriptome ontogeny has unveiled critical networks and up-stream regulators that orchestrate age-specific biological functions in liver, and suggest that age contributes to the complexity of the alternative splicing landscape of the hepatic transcriptome.

Screening of differentially expressed genes between multiple trauma patients with and without sepsis.

PubMed

Ji, S C; Pan, Y T; Lu, Q Y; Sun, Z Y; Liu, Y Z

2014-03-17

The purpose of this study was to identify critical genes associated with septic multiple trauma by comparing peripheral whole blood samples from multiple trauma patients with and without sepsis. A microarray data set was downloaded from the Gene Expression Omnibus (GEO) database. This data set included 70 samples, 36 from multiple trauma patients with sepsis and 34 from multiple trauma patients without sepsis (as a control set). The data were preprocessed, and differentially expressed genes (DEGs) were then screened for using packages of the R language. Functional analysis of DEGs was performed with DAVID. Interaction networks were then established for the most up- and down-regulated genes using HitPredict. Pathway-enrichment analysis was conducted for genes in the networks using WebGestalt. Fifty-eight DEGs were identified. The expression levels of PLAU (down-regulated) and MMP8 (up-regulated) presented the largest fold-changes, and interaction networks were established for these genes. Further analysis revealed that PLAT (plasminogen activator, tissue) and SERPINF2 (serpin peptidase inhibitor, clade F, member 2), which interact with PLAU, play important roles in the pathway of the component and coagulation cascade. We hypothesize that PLAU is a major regulator of the component and coagulation cascade, and down-regulation of PLAU results in dysfunction of the pathway, causing sepsis.

EMX2 gene expression predicts liver metastasis and survival in colorectal cancer.

PubMed

Aykut, Berk; Ochs, Markus; Radhakrishnan, Praveen; Brill, Adrian; Höcker, Hermine; Schwarz, Sandra; Weissinger, Daniel; Kehm, Roland; Kulu, Yakup; Ulrich, Alexis; Schneider, Martin

2017-08-22

The Empty Spiracles Homeobox (EMX-) 2 gene has been associated with regulation of growth and differentiation in neuronal development. While recent studies provide evidence that EMX2 regulates tumorigenesis of various solid tumors, its role in colorectal cancer remains unknown. We aimed to assess the prognostic significance of EMX2 expression in stage III colorectal adenocarcinoma. Expression levels of EMX2 in human colorectal cancer and adjacent mucosa were assessed by qRT-PCR technology, and results were correlated with clinical and survival data. siRNA-mediated knockdown and adenoviral delivery-mediated overexpression of EMX2 were performed in order to investigate its effects on the migration of colorectal cancer cells in vitro. Compared to corresponding healthy mucosa, colorectal tumor samples had decreased EMX2 expression levels. Furthermore, EMX2 down-regulation in colorectal cancer tissue was associated with distant metastasis (M1) and impaired overall patient survival. In vitro knockdown of EMX2 resulted in increased tumor cell migration. Conversely, overexpression of EMX2 led to an inhibition of tumor cell migration. EMX2 is frequently down-regulated in human colorectal cancer, and down-regulation of EMX2 is a prognostic marker for disease-free and overall survival. EMX2 might thus represent a promising therapeutic target in colorectal cancer.

Differential gene expression by 1,25(OH)2D3 in an endometriosis stromal cell line.

PubMed

Ingles, Sue Ann; Wu, Liang; Liu, Benjamin T; Chen, Yibu; Wang, Chun-Yeh; Templeman, Claire; Brueggmann, Doerthe

2017-10-01

Endometriosis is a common female reproductive disease characterized by invasion of endometrial cells into other organs, frequently causing pelvic pain and infertility. Alterations of the vitamin D system have been linked to endometriosis incidence and severity. To shed light on the potential mechanism for these associations, we examined the effects of 1,25(OH) 2 D 3 on gene expression in endometriosis cells. Stromal cell lines derived from endometriosis tissue were treated with 1,25(OH) 2 D 3 , and RNA-seq was used to identify genes differentially expressed between treated and untreated cells. Gene ontology and pathway analyses were carried out using Partek Flow and Ingenuity software suites, respectively. We identified 1627 genes that were differentially expressed (886 down-regulated and 741 up-regulated) by 1,25(OH) 2 D 3 . Only one gene, CYP24A1, was strongly up-regulated (369-fold). Many genes were strongly down-regulated. 1,25(OH) 2 D 3 treatment down-regulated several genetic pathways related to neuroangiogenesis, cellular motility, and invasion, including pathways for axonal guidance, Rho GDP signaling, and matrix metalloprotease inhibition. These findings support a role for vitamin D in the pathophysiology of endometriosis, and provide new targets for investigation into possible causes and treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Knockdown of dopamine receptor D2 upregulates the expression of adiogenic genes in mouse primary mesencephalic neurons].

PubMed

Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi

2018-01-01

Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.

Arabidopsis whole-transcriptome profiling defines the features of coordinated regulations that occur during secondary growth.

PubMed

Ko, Jae-Heung; Han, Kyung-Hwan

2004-05-01

Secondary growth in the inflorescence stems of Arabidopsis plants was induced by a combination of short-day and long-day treatments. The induced stems were divided into three different stem developmental stages (i.e., immature, intermediate, and mature) with regard to secondary growth. Whole transcriptome microarrays were used to examine the changes in global gene expression occurring at the different stem developmental stages. Over 70% of the Arabidopsis transcriptome was expressed in the stem tissues. In the mature stems with secondary growth, 567 genes were upregulated 5-fold or higher and 530 were downregulated, when compared to immature stems (with no secondary growth) and 10-day old seedlings (with no inflorescence stem). The transcription phenotypes obtained from the stems at different developmental stages largely confirm the existing insights into the biochemical processes involved in the sequential events that lead to wood formation. The major difference found between the stems undergoing secondary growth and only primary growth was in the expression profiles of transcriptional regulation-and signal transduction-related genes. An analysis of several shoot apical meristem (SAM) activity-related gene expression patterns in the stems indicated that the genetic control of secondary meristem activity might be governed by a different mechanism from that of SAM. The current study established the expression patterns of many unknown genes and identified candidate genes that are involved in the genetic regulation of secondary growth. The findings described in this report should improve our understanding of the molecular mechanisms that regulate the growth and development of the stem.

Can lncRNAs be indicators for the diagnosis of early onset or acute schizophrenia and distinguish major depressive disorder and generalized anxiety disorder?-A cross validation analysis.

PubMed

Cui, Xuelian; Niu, Wei; Kong, Lingming; He, Mingjun; Jiang, Kunhong; Chen, Shengdong; Zhong, Aifang; Li, Wanshuai; Lu, Jim; Zhang, Liyi

2017-06-01

Depression and anxiety are apparent symptoms in the early onset or acute phase of schizophrenia (SZ), which complicate timely diagnosis and treatment. It is imperative to seek an indicator to distinguish schizophrenia from depressive and anxiety disorders. Using lncRNA microarray profiling and RT-PCR, three up-regulated lncRNAs in SZ, six down-regulated lncRNAs in major depressive disorder (MDD), and three up-regulated lncRNAs in generalized anxiety disorder (GAD) had been identified as potential biomarkers. All the lncRNAs were, then, cross-validated in 40 SZ patients, 40 MDD patients, 40 GAD patients, and 40 normal controls. Compared with controls, three up-regulated SZ lncRNAs had a significantly down-regulated expression in GAD, and no remarkable differences existed between MDD and the controls. Additionally, the six down-regulated MDD lncRNAs were expressed in an opposite fashion in SZ, and the expression of the three up-regulated GAD lncRNAs were significantly different between SZ and GAD. These results indicate that the expression patterns of the three up-regulated SZ lncRNAs could not be completely replicated in MDD and GAD, and vice versa. Thus, these three SZ lncRNAs seem to be established as potential indicators for diagnosis of schizophrenia and distinguishing it from MDD and GAD. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Mesodermal expression of the C. elegans HMX homolog mls-2 requires the PBC homolog CEH-20

PubMed Central

Jiang, Yuan; Shi, Herong; Amin, Nirav M.; Sultan, Ibrahim; Liu, Jun

2008-01-01

Metazoan development proceeds primarily through the regulated expression of genes encoding transcription factors and components of cell signaling pathways. One way to decipher the complex developmental programs is to assemble the underlying gene regulatory networks by dissecting the cis-regulatory modules that direct temporal-spatial expression of developmental genes and identify corresponding trans-regulatory factors. Here, we focus on the regulation of a HMX homoebox gene called mls-2, which functions at the intersection of a network that regulates cleavage orientation, cell proliferation and fate specification in the C. elegans postembryonic mesoderm. In addition to its transient expression in the postembryonic mesodermal lineage, the M lineage, mls-2 expression is detected in a subset of embryonic cells, in three pairs of head neurons and transiently in the somatic gonad. Through mutational analysis of the mls-2 promoter, we identified two elements (E1 and E2) involved in regulating the temporal-spatial expression of mls-2. In particular, we showed that one of the elements (E1) required for mls-2 expression in the M lineage contains two critical putative PBC-Hox binding sites that are evolutionarily conserved in C. briggsae and C. remanei. Furthermore, the C. elegans PBC homolog CEH-20 is required for mls-2 expression in the M lineage. Our data suggests that mls-2 might be a direct target of CEH-20 in the M lineage and that the regulation of CEH-20 on mls-2 is likely Hox-independent. PMID:18316179

Developmentally Regulated Expression of the Nerve Growth Factor Receptor Gene in the Periphery and Brain

NASA Astrophysics Data System (ADS)

Buck, C. R.; Martinez, Humberto J.; Black, Ira B.; Chao, Moses V.

1987-05-01

Nerve growth factor (NGF) regulates development and maintenance of function of peripheral sympathetic and sensory neurons. A potential role for the trophic factor in brain has been detected only recently. The ability of a cell to respond to NGF is due, in part, to expression of specific receptors on the cell surface. To study tissue-specific expression of the NGF receptor gene, we have used sensitive cRNA probes for detection of NGF receptor mRNA. Our studies indicate that the receptor gene is selectively and specifically expressed in sympathetic (superior cervical) and sensory (dorsal root) ganglia in the periphery, and by the septum-basal forebrain centrally, in the neonatal rat in vivo. Moreover, examination of tissues from neonatal and adult rats reveals a marked reduction in steady-state NGF receptor mRNA levels in sensory ganglia. In contrast, a 2- to 4-fold increase was observed in the basal forebrain and in the sympathetic ganglia over the same time period. Our observations suggest that NGF receptor mRNA expression is developmentally regulated in specific areas of the nervous system in a differential fashion.

Executive Functions in Intellectual Disabilities: A Comparison between Williams Syndrome and Down Syndrome

ERIC Educational Resources Information Center

Costanzo, Floriana; Varuzza, Cristiana; Menghini, Deny; Addona, Francesca; Gianesini, Tiziana; Vicari, Stefano

2013-01-01

Executive functions are a set of high cognitive abilities that control and regulate other functions and behaviors and are crucial for successful adaptation. Deficits in executive functions are frequently described in developmental disorders, which are characterized by disadaptive behavior. However, executive functions are not widely examined in…

Systematic analysis of gene expression pattern in has-miR-197 over-expressed human uterine leiomyoma cells.

PubMed

Ling, Jing; Wu, Xiaoli; Fu, Ziyi; Tan, Jie; Xu, Qing

2015-10-01

Our previous study showed that the expression of miR-197 in leiomyoma was down-regulated compared with myometrium. Further, miR-197 has been identified to affect uterine leiomyoma cell proliferation, apoptosis, and metastasis ability, though the responsible molecular mechanism has not been well elucidated. In this study, we sought to determine the expression patterns of miR-197 targeted genes and to explore their potential functions, participating Pathways and the networks that are involved in the biological behavior of human uterine leiomyoma. After transfection of human uterine leiomyoma cells with miR-197, we confirmed the expression level of miR-197 using quantitative real-time PCR (qRT-PCR), and we detected the gene expression profiles after miR-197 over-expression through DNA microarray analysis. Further, we performed GO and Pathway analysis. The dominantly dys-regulated genes, which were up- or down-regulated by more than 10-fold, compared with parental cells, were confirmed using qRT-PCR technology. Compared with the control group, miR-197 was up-regulated by 30-fold after miR-197 lentiviral transfection. The microarray data showed that 872 genes were dys-regulated by more than 2-fold in human uterine leiomyoma cells after miR-197 overexpression, including 537 up-regulated and 335 down-regulated genes. The GO analysis indicated that the dys-regulated genes were primarily involved in response to stimuli, multicellular organ processes, and the signaling of biological progression. Further, Pathway analysis data showed that these genes participated in regulating several signaling Pathways, including the JAK/STAT signaling Pathway, the Toll-like receptor signaling Pathway, and cytokine-cytokine receptor interaction. The qRT-PCR results confirmed that 17 of the 66 selected genes, which were up- or down-regulated more than 10-fold by miR-197, were consistent with the microarray results, including tumorigenesis-related genes, such as DRT7, SLC549, SFMBT2, FLJ37956, FBLN2, C10orf35, HOXD12, CACNG7, and LOC100134279. Our study explored gene expression patterns after miR-197 overexpression and confirmed 17 dominantly dys-regulated genes, which could expand the insights into the function of miR-197 and the molecular mechanisms during the development and progression of uterine leiomyomas. This study might afford new clues for understanding the pathogenesis of uterine leiomyomas, and it could likely provide a unique method for diagnosing or predicting prognosis in the clinical treatment of leiomyoma. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

[Impact of siRNA-mediated down-regulation of CD147 on human breast cancer cells].

PubMed

Li, Zhenqian; Li, Daoming; Li, Jiangwei; Huang, Pei; Qin, Hui

2015-10-01

To investigate the influence of siRNA-mediated down-regulation of CD147 on growth, proliferation and movement of human breast cancer cell line MDA-MB-231. The protein expression of CD147, MMP-2 and TIMP-2 of the MDA-MB-231 cells were analyzed by ABC. Lentiviral expression vector of CD147 gene was constructed and transfected into MDA-MB-231 cells. RT-PCR and Western blot were used to detect the mRNA and protein level changes of CD147 genes to identify the optimal time point, followed by detection of changes of mRNA and protein expression of MMP-2 and TIMP-2 genes. CCK-8 reagent method and cell scratch test were used to detect the proliferation and migration change of MDA-MB-231 cells. The nude mouse model of breast cancer by hypodermic injection with MDA-MB-231 cells was established to document the effect of CD147 siRNA on the tumor transplants. After transfection of lentiviral expression vector of CD147 gene, protein of CD147, MMP-2 and TIMP-2 were weakly or negative expressed, significantly weaker than those of control group (P < 0.01). After 72 hours of transfection, average down-regulation rate of CD147 and MMP-2 were 96.03% ± 0.84% and 96.03% ± 0.84%, respectively. Both CD147 mRNA and MMP-2 mRNA expression were down-regulated (P < 0.05), while TIMP-2 mRNA expression showed no significant deference (P > 0.05). No less than 2 days after transfection, cell growth of MDA-MB-231 cell line was found significantly inhibited (P < 0.05). After 24 hours of transection, average migration distance of MDA-MB-231 cell line and control group were (0.64 ± 0.12) mm and (4.69 ± 0.85) mm, respectively, which indicated a lower migrate speed. Down regulation of CD147 led to reduction of volume and mass of nude mouses. The growth of the carcinoma transplant was inhibited upon siRNA-mediated down-regulation of CD147 (P < 0.05), with an average tumor mass of (1.85 ± 0.98) g and both reduction of tumor size and tumor mass. CD147 may alter the MMP-2/TIMP-2 balance in MDA-MB-231 cells. CD147 gene silencing inhibits the proliferation and migration of MDA-MB-231 cells and the growth of carcinoma transplants in nude mice.

ERECTA signaling controls Arabidopsis inflorescence architecture through chromatin-mediated activation of PRE1 expression.

PubMed

Cai, Hanyang; Zhao, Lihua; Wang, Lulu; Zhang, Man; Su, Zhenxia; Cheng, Yan; Zhao, Heming; Qin, Yuan

2017-06-01

Flowering plants display a remarkable diversity in inflorescence architecture, and pedicel length is one of the key contributors to this diversity. In Arabidopsis thaliana, the receptor-like kinase ERECTA (ER) mediated signaling pathway plays important roles in regulating inflorescence architecture by promoting cell proliferation. However, the regulating mechanism remains elusive in the pedicel. Genetic interactions between ERECTA signaling and the chromatin remodeling complex SWR1 in the control of inflorescence architecture were studied. Comparative transcriptome analysis was applied to identify downstream components. Chromatin immunoprecipitation and nucleosome occupancy was further investigated. The results indicated that the chromatin remodeler SWR1 coordinates with ERECTA signaling in regulating inflorescence architecture by activating the expression of PRE1 family genes and promoting pedicel elongation. It was found that SWR1 is required for the incorporation of the H2A.Z histone variant into nucleosomes of the whole PRE1 gene family and the ERECTA controlled expression of PRE1 gene family through regulating nucleosome dynamics. We propose that utilization of a chromatin remodeling complex to regulate gene expression is a common theme in developmental control across kingdoms. These findings shed light on the mechanisms through which chromatin remodelers orchestrate complex transcriptional regulation of gene expression in coordination with a developmental cue. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Ascaroside expression in Caenorhabditis elegans is strongly dependent on diet and developmental stage

USDA-ARS?s Scientific Manuscript database

A group of small signaling molecules called ascarosides, associated with dauer formation, male attraction and social behavior in the nematode Caenorhabditis elegans, are shown to be regulated by developmental stage and environmental factors. The concentration of dauer-inducing ascaroside, ascr#2, i...

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Zhijie; Jiang, Hequn; Liu, Ying

MicroRNAs (miRNAs) are a class of small non-coding RNAs that function as critical gene regulators by targeting mRNAs for translational repression or degradation. In this study, we showed that the expression level of miR-133b was decreased, while Sirt1 mRNA expression levels were increased in hepatocellular carcinoma (HCC) and cell lines, and we identified Sirt1 as a novel direct target of miR-133b. The over-expression of miR-133b suppressed Sirt1 expression. In addition, miR-133b over-expression resulted in attenuating HCC cell proliferation and invasion together with apoptosis increase in vitro. HepG2 cell transplantation revealed that up-regulation of miR-133b could inhibit HCC tumor genesis inmore » vivo. Forced expression of Sirt1 partly rescued the effect of miR-133b in vitro. Furthermore, our study showed that miR-133b over-expression or Sirt1 down-regulation elevated E-cadherin expression, and repressed glypican-3 (GPC3) and the anti-apoptotic proteins (Bcl-2, Bcl-xL, and Mcl-1) expression. The inhibition of GPC3 expression repressed Bcl-2, Bcl-xL, and Mcl-1 expression, and elevated E-cadherin expression. Moreover, the Sirt1 up-regulation resulted in increases in HCC cell proliferation and invasion together with decreases apoptosis, and increases in the cytosolic accumulation and nuclear translocation of the transcription factor β-catenin in vitro. But the effect of Sirt1 up-regulation was partly reversed by GPC3 down-regulation in vitro. Taken together, these findings provide insight into the role and mechanism of miR-133b in regulating HCC cell proliferation, invasion and apoptosis via the miR-133b/Sirt1/GPC3/Wnt β-catenin axis, and miR-133b may serve as a potential therapeutic target in HCC in the future. - Highlights: • Sirt1 is a direct target of miR-133b in HCC. • miR-133b over-expression suppresses HCC progression in vitro and in vivo. • Sirt1 restoration reverses the effect of miR-133b over-expression on HCC cells. • GPC3 down-regulation reverses the effect of Sirt1 up-regulation on HCC cells. • Sirt1 activates Wnt β-catenin signaling by GPC3 in vitro.« less

A short-term intervention with selenium affects expression of genes implicated in the epithelial-to-mesenchymal transition in the prostate

PubMed Central

Kok, Dieuwertje E.G.; Kiemeney, Lambertus A.L.M.; Verhaegh, Gerald W.; Schalken, Jack A.; van Lin, Emile N.J.T.; Michiel Sedelaar, J.P.; Alfred Witjes, J.; Hulsbergen - van de Kaa, Christina A.; van't Veer, Pieter; Kampman, Ellen; Afman, Lydia A.

2017-01-01

In parallel with the inconsistency in observational studies and chemoprevention trials, the mechanisms by which selenium affects prostate cancer risk have not been elucidated. We conducted a randomized, placebo-controlled trial to examine the effects of a short-term intervention with selenium on gene expression in non-malignant prostate tissue. Twenty-three men received 300 μg selenium per day in the form of selenized yeast (n=12) or a placebo (n=11) during 5 weeks. Prostate biopsies collected from the transition zone before and after intervention were analysed for 15 participants (n=8 selenium, n=7 placebo). Pathway analyses revealed that the intervention with selenium was associated with down-regulated expression of genes involved in cellular migration, invasion, remodeling and immune responses. Specifically, expression of well-established epithelial markers, such as E-cadherin and epithelial cell adhesion molecule EPCAM, was up-regulated, while the mesenchymal markers vimentin and fibronectin were down-regulated after intervention with selenium. This implies an inhibitory effect of selenium on the epithelial-to-mesenchymal transition (EMT). Moreover, selenium was associated with down-regulated expression of genes involved in wound healing and inflammation; processes which are both related to EMT. In conclusion, our explorative data showed that selenium affected expression of genes implicated in EMT in the transition zone of the prostate. PMID:28076331

A short-term intervention with selenium affects expression of genes implicated in the epithelial-to-mesenchymal transition in the prostate.

PubMed

Kok, Dieuwertje E G; Kiemeney, Lambertus A L M; Verhaegh, Gerald W; Schalken, Jack A; van Lin, Emile N J T; Sedelaar, J P Michiel; Witjes, J Alfred; Hulsbergen-van de Kaa, Christina A; van 't Veer, Pieter; Kampman, Ellen; Afman, Lydia A

2017-02-07

In parallel with the inconsistency in observational studies and chemoprevention trials, the mechanisms by which selenium affects prostate cancer risk have not been elucidated. We conducted a randomized, placebo-controlled trial to examine the effects of a short-term intervention with selenium on gene expression in non-malignant prostate tissue. Twenty-three men received 300 µg selenium per day in the form of selenized yeast (n=12) or a placebo (n=11) during 5 weeks. Prostate biopsies collected from the transition zone before and after intervention were analysed for 15 participants (n=8 selenium, n=7 placebo). Pathway analyses revealed that the intervention with selenium was associated with down-regulated expression of genes involved in cellular migration, invasion, remodeling and immune responses. Specifically, expression of well-established epithelial markers, such as E-cadherin and epithelial cell adhesion molecule EPCAM, was up-regulated, while the mesenchymal markers vimentin and fibronectin were down-regulated after intervention with selenium. This implies an inhibitory effect of selenium on the epithelial-to-mesenchymal transition (EMT). Moreover, selenium was associated with down-regulated expression of genes involved in wound healing and inflammation; processes which are both related to EMT. In conclusion, our explorative data showed that selenium affected expression of genes implicated in EMT in the transition zone of the prostate.

Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning

Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABCmore » gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.« less

Control of asgE Expression during Growth and Development of Myxococcus xanthus

PubMed Central

Garza, Anthony G.; Harris, Baruch Z.; Greenberg, Brandon M.; Singer, Mitchell

2000-01-01

One of the earliest events in the Myxococcus xanthus developmental cycle is production of an extracellular cell density signal called A-signal (or A-factor). Previously, we showed that cells carrying an insertion in the asgE gene fail to produce normal levels of this cell-cell signal. In this study we found that expression of asgE is growth phase regulated and developmentally regulated. Several lines of evidence indicate that asgE is cotranscribed with an upstream gene during development. Using primer extension analyses, we identified two 5′ ends for this developmental transcript. The DNA sequence upstream of one 5′ end has similarity to the promoter regions of several genes that are A-signal dependent, whereas sequences located upstream of the second 5′ end show similarity to promoter elements identified for genes that are C-signal dependent. Consistent with this result is our finding that mutants failing to produce A-signal or C-signal are defective for developmental expression of asgE. In contrast to developing cells, the large majority of the asgE transcript found in vegetative cells appears to be monocistronic. This finding suggests that asgE uses different promoters for expression during vegetative growth and development. Growth phase regulation of asgE is abolished in a relA mutant, indicating that this vegetative promoter is induced by starvation. The data presented here, in combination with our previous results, indicate that the level of AsgE in vegetative cells is sufficient for this protein to carry out its function during development. PMID:11073904

Analyzing Gene Expression Profiles with Preliminary Validations in Cardiac Hypertrophy Induced by Pressure-overload.

PubMed

Gao, Jing; Li, Yuhong; Wang, Tongmei; Shi, Zhuo; Zhang, Yiqi; Liu, Shuang; Wen, Pushuai; Ma, Chunyan

2018-03-06

The aim of this study was to identify the key genes involved in the cardiac hypertrophy (CH) induced by pressure overload. mRNA microarray dataset GSE5500 and GSE18801 were downloaded from GEO database, and differentially expressed genes (DEGs) were screened using Limma package; then, functional and pathway enrichment analysis were performed for common DEGs using DAVID database. Furthermore, the top DEGs were further validated using qPCR in the hypertrophic heart tissue induced by Isoprenaline (ISO). A total of 113 common DEGs with absolute fold change >0.5, including 60 significantly up-regulated DEGs and 53 down-regulated DEGs were obtained. GO term enrichment analysis suggested that common up-regulated DEG mainly enriched in neutrophil chemotaxis, extracellular fibril organization and cell proliferation, and the common down-regulated genes were significantly enriched in ion transport, endoplasmic reticulum and dendritic spine. KEGG pathway analysis found that the common DEGs were mainly enriched in ECM-receptor interaction, phagosome, and focal adhesion. Additionally, the expression of Mfap4, Ltbp2, Aspn, Serpina3n, and Cnksr1 were up-regulated in the model of cardiac hypertrophy, while the expression of Anp32a was down-regulated. The current study identified the key deregulated genes and pathways involved in the CH, which could shed new light to understand the mechanism of CH.

[Identification of candidate genes and expression profiles, as doping biomarkers].

PubMed

Paparini, A; Impagnatiello, F; Pistilli, A; Rinaldi, M; Gianfranceschi, G; Signori, E; Stabile, A M; Fazio, V; Rende, M; Romano Spica, V

2007-01-01

Administration of prohibited substances to enhance athletic performance represents an emerging medical, social, ethical and legal issue. Traditional controls are based on direct detection of substances or their catabolites. However out-of-competition doping may not be easily revealed by standard analytical methods. Alternative indirect control strategies are based on the evaluation of mid- and long-term effects of doping in tissues. Drug-induced long-lasting changes of gene expression may be taken as effective indicators of doping exposure. To validate this approach, we used real-time PCR to monitor the expression pattern of selected genes in human haematopoietic cells exposed to nandrolone, insulin-like growth factor I (IGF-I) or growth hormone (GH). Some candidate genes were found significantly and consistently modulated by treatments. Nandrolone up-regulated AR, ESR2 and PGR in K562 cells, and SRD5A1, PPARA and JAK2 in Jurkat cells; IGF-I up-regulated EPOR and PGR in HL60 cells, and SRD5A1 in Jurkat; GH up-regulated SRD5A1 and GHR in K562. GATA1 expression was down-regulated in IGF-1-treated HL60, ESR2 was down-regulated in nandrolone-treated Jurkat, and AR and PGR were down-regulated in GH-treated Jurkat. This pilot study shows the potential of molecular biology-based strategies in anti-doping controls.

Suppression of human fibrosarcoma cell growth by transcription factor, Egr-1, involves down-regulation of Bcl-2.

PubMed

Huang, R P; Fan, Y; Peng, A; Zeng, Z L; Reed, J C; Adamson, E D; Boynton, A L

1998-09-11

Previously, we showed that the transcription factor Egr-1 suppressed the proliferation of v-sis transformed NIH3T3 cells and also a number of human tumor cells. Here, we investigate the possible mechanisms responsible for this function. We show that transfected Egr-1 in human fibrosarcoma cells HT1080 leads to down-regulation of Bcl-2. Transient CAT transfection assays reveal that expression of Egr-1 suppresses Bcl-2 promoter activity in a dose-dependent manner. Furthermore, overexpression of Bcl-2 in Egr-1-expressing HT1080 cells enhanced cell proliferation in monolayer culture and increased anchorage-independent growth. Our results suggest that suppression of tumor cell proliferation by Egr-1 may be at least partially mediated through the down-regulation of Bcl-2.

Transcriptome profiling and cataloging differential gene expression in floral buds of fertile and sterile lines of cotton (Gossypium hirsutum L.).

PubMed

Hamid, Rasmieh; Tomar, Rukam S; Marashi, Hassan; Shafaroudi, Saeid Malekzadeh; Golakiya, Balaji A; Mohsenpour, Motahhareh

2018-06-20

Cytoplasmic Male Sterility is maternally inherited trait in plants, characterized by failure to produce functional pollen during anther development. Anther development is modulated through the interaction of nuclear and mitochondrial genes. In the present study, differential gene expression of floral buds at the sporogenous stage (SS) and microsporocyte stage (MS) between CGMS and its fertile maintainer line of cotton plants was studied. A total of 320 significantly differentially expressed genes, including 20 down-regulated and 37 up-regulated in CGMS comparing with its maintainer line at the SS stage, as well as and 89 down-regulated and 4 up-regulated in CGMS compared to the fertile line at MS stage. Comparing the two stages in the same line, there were 6 down-regulated differentially expressed genes only induced in CGMS and 9 up-regulated differentially expressed gene only induced in its maintainer. GO analysis revealed essential genes responsible for pollen development, and cytoskeleton category show differential expression between the fertile and CGMS lines. Validation studies by qRT-PCR shows concordance with RNA-seq result. A set of novel SSRs identified in this study can be used in evaluating genetic relationships among cultivars, QTL mapping, and marker-assisted breeding. We reported aberrant expression of genes related to pollen exine formation, and synthesis of pectin lyase, myosine heavy chain, tubulin, actin-beta, heat shock protein and myeloblastosis (MYB) protein as targets for CMS in cotton. The results of this study contribute to basic information for future screening of genes and identification of molecular portraits responsible for CMS as well as to elucidate molecular mechanisms that lead to CMS in cotton. Copyright © 2018 Elsevier B.V. All rights reserved.

NOX4-mediated ROS production induces apoptotic cell death via down-regulation of c-FLIP and Mcl-1 expression in combined treatment with thioridazine and curcumin.

PubMed

Seo, Seung Un; Kim, Tae Hwan; Kim, Dong Eun; Min, Kyoung-Jin; Kwon, Taeg Kyu

2017-10-01

Thioridazine is known to have anti-tumor effects by inhibiting PI3K/Akt signaling, which is an important signaling pathway in cell survival. However, thioridazine alone does not induce apoptosis in head and neck squamous cell carcinoma (AMC-HN4), human breast carcinoma (MDA-MB231), and human glioma (U87MG) cells. Therefore, we investigated whether combined treatment with thioridazine and curcumin induces apoptosis. Combined treatment with thioridazine and curcumin markedly induced apoptosis in cancer cells without inducing apoptosis in human normal mesangial cells and human normal umbilical vein cells (EA.hy926). We found that combined treatment with thioridazine and curcumin had synergistic effects in AMC-HN4 cells. Among apoptosis-related proteins, thioridazine plus curcumin induced down-regulation of c-FLIP and Mcl-1 expression at the post-translational levels in a proteasome-dependent manner. Augmentation of proteasome activity was related to the up-regulation of proteasome subunit alpha 5 (PSMA5) expression in curcumin plus thioridazine-treated cells. Combined treatment with curcumin and thioridazine produced intracellular ROS in a NOX4-dependent manner, and ROS-mediated activation of Nrf2/ARE signaling played a critical role in the up-regulation of PSMA5 expression. Furthermore, ectopic expression of c-FLIP and Mcl-1 inhibited apoptosis in thioridazine and curcumin-treated cells. Therefore, we demonstrated that thioridazine plus curcumin induces proteasome activity by up-regulating PSMA5 expression via NOX4-mediated ROS production and that down-regulation of c-FLIP and Mcl-1 expression post-translationally is involved in apoptosis. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Down-Regulation of MicroRNA-210 Confers Sensitivity towards 1’S-1’-Acetoxychavicol Acetate (ACA) in Cervical Cancer Cells by Targeting SMAD4

PubMed Central

Phuah, Neoh Hun; Azmi, Mohamad Nurul; Awang, Khalijah; Nagoor, Noor Hasima

2017-01-01

MicroRNAs (miRNAs) are short non-coding RNAs that regulate genes posttranscriptionally. Past studies have reported that miR-210 is up-regulated in many cancers including cervical cancer, and plays a pleiotropic role in carcinogenesis. However, its role in regulating response towards anti-cancer agents has not been fully elucidated. We have previously reported that the natural compound 1’S-1’-acetoxychavicol acetate (ACA) is able to induce cytotoxicity in various cancer cells including cervical cancer cells. Hence, this study aims to investigate the mechanistic role of miR-210 in regulating response towards ACA in cervical cancer cells. In the present study, we found that ACA down-regulated miR-210 expression in cervical cancer cells, and suppression of miR-210 expression enhanced sensitivity towards ACA by inhibiting cell proliferation and promoting apoptosis. Western blot analysis showed increased expression of mothers against decapentaplegic homolog 4 (SMAD4), which was predicted as a target of miR-210 by target prediction programs, following treatment with ACA. Luciferase reporter assay confirmed that miR-210 binds to sequences in 3′UTR of SMAD4. Furthermore, decreased in SMAD4 protein expression was observed when miR-210 was overexpressed. Conversely, SMAD4 protein expression increased when miR-210 expression was suppressed. Lastly, we demonstrated that overexpression of SMAD4 augmented the anti-proliferative and apoptosis-inducing effects of ACA. Taken together, our results demonstrated that down-regulation of miR-210 conferred sensitivity towards ACA in cervical cancer cells by targeting SMAD4. These findings suggest that combination of miRNAs and natural compounds could provide new strategies in treating cervical cancer. PMID:28401751

Down-Regulation of MicroRNA-210 Confers Sensitivity towards 1'S-1'-Acetoxychavicol Acetate (ACA) in Cervical Cancer Cells by Targeting SMAD4.

PubMed

Phuah, Neoh Hun; Azmi, Mohamad Nurul; Awang, Khalijah; Nagoor, Noor Hasima

2017-04-01

MicroRNAs (miRNAs) are short non-coding RNAs that regulate genes posttranscriptionally. Past studies have reported that miR-210 is up-regulated in many cancers including cervical cancer, and plays a pleiotropic role in carcinogenesis. However, its role in regulating response towards anti-cancer agents has not been fully elucidated. We have previously reported that the natural compound 1'S-1'-acetoxychavicol acetate (ACA) is able to induce cytotoxicity in various cancer cells including cervical cancer cells. Hence, this study aims to investigate the mechanistic role of miR-210 in regulating response towards ACA in cervical cancer cells. In the present study, we found that ACA down-regulated miR-210 expression in cervical cancer cells, and suppression of miR-210 expression enhanced sensitivity towards ACA by inhibiting cell proliferation and promoting apoptosis. Western blot analysis showed increased expression of mothers against decapentaplegic homolog 4 (SMAD4), which was predicted as a target of miR-210 by target prediction programs, following treatment with ACA. Luciferase reporter assay confirmed that miR-210 binds to sequences in 3'UTR of SMAD4. Furthermore, decreased in SMAD4 protein expression was observed when miR-210 was overexpressed. Conversely, SMAD4 protein expression increased when miR-210 expression was suppressed. Lastly, we demonstrated that overexpression of SMAD4 augmented the anti-proliferative and apoptosis-inducing effects of ACA. Taken together, our results demonstrated that down-regulation of miR-210 conferred sensitivity towards ACA in cervical cancer cells by targeting SMAD4. These findings suggest that combination of miRNAs and natural compounds could provide new strategies in treating cervical cancer.

Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke

PubMed Central

Izzotti, Alberto; Calin, George A.; Arrigo, Patrizio; Steele, Vernon E.; Croce, Carlo M.; De Flora, Silvio

2009-01-01

Although microRNAs have been investigated extensively in cancer research, little is known regarding their response to noxious agents in apparently healthy tissues. We analyzed the expression of 484 miRNAs in the lungs of rats exposed to environmental cigarette smoke (ECS) for 28 days. ECS down-regulated 126 miRNAs (26.0%) at least 2-fold and 24 miRNAs more than 3-fold. We previously demonstrated that 107 of 4858 genes (2.9%) and 50 of 518 proteins (9.7%) were up-regulated by ECS in the same tissue, which is consistent with the role of microRNAs as negative regulators of gene expression. The most remarkably down-regulated microRNAs belonged to the families of let-7, miR-10, miR-26, miR-30, miR-34, miR-99, miR-122, miR-123, miR-124, miR-125, miR-140, miR-145, miR-146, miR-191, miR-192, miR-219, miR-222, and miR-223, which regulate stress response, apoptosis, proliferation, angiogenesis, and expression of genes. In contrast, miR-294, an inhibitor of transcriptional repressor genes, was up-regulated by ECS. There was a strong parallelism in dysregulation of rodent microRNAs and their human homologues, which are often transcribed from genes localized in fragile sites deleted in lung cancer. Five ECS-down-regulated microRNAs are known to be affected by single nucleotide polymorphisms. Thus, changes in microRNA expression are an early event following exposure to cigarette smoke.—Izzotti, A., Calin, G. A., Arrigo, P., Steele, V. E., Croce, C. M., De Flora, S. Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke. PMID:18952709

Dexamethasone but not indomethacin inhibits human phagocyte nicotinamide adenine dinucleotide phosphate oxidase activity by down-regulating expression of genes encoding oxidase components.

PubMed

Condino-Neto, A; Whitney, C; Newburger, P E

1998-11-01

We investigated the effects of dexamethasone or indomethacin on the NADPH oxidase activity, cytochrome b558 content, and expression of genes encoding the components gp91-phox and p47-phox of the NADPH oxidase system in the human monocytic THP-1 cell line, differentiated with IFN-gamma and TNF-alpha, alone or in combination, for up to 7 days. IFN-gamma and TNF-alpha, alone or in combination, caused a significant up-regulation of the NADPH oxidase system as reflected by an enhancement of the PMA-stimulated superoxide release, cytochrome b558 content, and expression of gp91-phox and p47-phox genes on both days 2 and 7 of cell culture. Noteworthy was the tremendous synergism between IFN-gamma and TNF-alpha for all studied parameters. Dexamethasone down-regulated the NADPH oxidase system of cytokine-differentiated THP-1 cells as assessed by an inhibition on the PMA-stimulated superoxide release, cytochrome b558 content, and expression of the gp91-phox and p47-phox genes. The nuclear run-on assays indicated that dexamethasone down-regulated the NADPH oxidase system at least in part by inhibiting the transcription of gp91-phox and p47-phox genes. Indomethacin inhibited only the PMA-stimulated superoxide release of THP-1 cells differentiated with IFN-gamma and TNF-alpha during 7 days. None of the other parameters was affected by indomethacin. We conclude that dexamethasone down-regulates the NADPH oxidase system at least in part by inhibiting the expression of genes encoding the gp91-phox and p47-phox components of the NADPH oxidase system.

Developmental and seasonal expression of PtaHB1, a Populus gene encoding a class III HD-Zip protein, is closely associated with secondary growth and inversely correlated with the level of microRNA (miR166).

PubMed

Ko, Jae-Heung; Prassinos, Constantinos; Han, Kyung-Hwan

2006-01-01

In contrast to our knowledge of the shoot apical meristem, our understanding of cambium meristem differentiation and maintenance is limited. Class III homeodomain leucine-zipper (HD-Zip) proteins have been shown to play a regulatory role in vascular differentiation. The hybrid aspen (Populus tremulaxPopulus alba) class III HD-Zip transcription factor (PtaHB1) and microRNA 166 (Pta-miR166) family were cloned from hybrid aspen using a combination of in silico and polymerase chain reaction methods. Expression analyses of PtaHB1 and Pta-miR166 were performed by Northern blot analysis. The expression of PtaHB1 was closely associated with wood formation and regulated both developmentally and seasonally, with the highest expression during the active growing season. Also, its expression was inversely correlated with the level of Pta-miR166. Pta-miR166-directed cleavage of PtaHB1 in vivo was confirmed using modified 5'-rapid amplification of cDNA ends (RACE). The expression of Pta-miR166 was much higher in the winter than in the growing seasons, suggesting seasonal and developmental regulation of microRNA in this perennial plant species.

RepSox improves viability and regulates gene expression in rhesus monkey-pig interspecies cloned embryos.

PubMed

Zhu, Hai-Ying; Jin, Long; Guo, Qing; Luo, Zhao-Bo; Li, Xiao-Chen; Zhang, Yu-Chen; Xing, Xiao-Xu; Xuan, Mei-Fu; Zhang, Guang-Lei; Luo, Qi-Rong; Wang, Jun-Xia; Cui, Cheng-Du; Li, Wen-Xue; Cui, Zheng-Yun; Yin, Xi-Jun; Kang, Jin-Dan

2017-05-01

To investigate the effect of the small molecule, RepSox, on the expression of developmentally important genes and the pre-implantation development of rhesus monkey-pig interspecies somatic cell nuclear transfer (iSCNT) embryos. Rhesus monkey cells expressing the monomeric red fluorescent protein 1 which have a normal (42) chromosome complement, were used as donor cells to generate iSCNT embryos. RepSox increased the expression levels of the pluripotency-related genes, Oct4 and Nanog (p < 0.05), but not of Sox2 compared with untreated embryos at the 2-4-cell stage. Expression of the anti-apoptotic gene, Bcl2, and the pro-apoptotic gene Bax was also affected at the 2-4-cell stage. RepSox treatment also increased the immunostaining intensity of Oct4 at the blastocyst stage (p < 0.05). Although the blastocyst developmental rate was higher in the group treated with 25 µM RepSox for 24 h than in the untreated control group (2.4 vs. 1.2%, p > 0.05), this was not significant. RepSox can improve the developmental potential of rhesus monkey-pig iSCNT embryos by regulating the expression of pluripotency-related genes.

Decreased expression of serum- and glucocorticoid-inducible kinase 1 (SGK1) promotes alpha-synuclein increase related with down-regulation of dopaminergic cell in the Substantia Nigra of chronic MPTP-induced Parkinsonism mice and in SH-SY5Y cells.

PubMed

Yeo, Sujung; Sung, Backil; Hong, Yeon-Mi; van den Noort, Maurits; Bosch, Peggy; Lee, Sook-Hyun; Song, Jongbeom; Park, Sang-Kyun; Lim, Sabina

2018-06-30

Parkinson's disease (PD) is a chronically progressive neurodegenerative disease, with its main pathological hallmarks being a dramatic loss of dopaminergic neurons predominantly in the Substantia Nigra (SN), and the formations of intracytoplasmic Lewy bodies and dystrophic neurites. Alpha-synuclein (α-syn), widely recognized as the most prominent element of the Lewy body, is one of the representative hallmarks in PD. However, the mechanisms behind the increased α-syn expression and aggregation have not yet been clarified. To examine what causes α-syn expression to increase, we analyzed the pattern of gene expression in the SN of mice intoxicated with 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), where down-regulation of dopaminergic cells occurred. We identified serum- and glucocorticoid-dependent kinase 1 (SGK1) as one of the genes that is evidently downregulated in chronic MPTP-intoxication. The results of Western blot analyses showed that, together with the down-regulation of dopaminergic cells, the decrease in SGK1 expression increased α-syn expression in the SN in a chronic MPTP-induced Parkinsonism mouse. For an examination of the expression correlation between SGK1 and α-syn, SH-5YSY cells were knocked down with SGK1 siRNA then, the downregulation of dopaminergic cells and the increase in the expression of α-syn were observed. These results suggest that decreased expression of SGK1 may play a critical role in increasing the expression of α-syn, which is related with dopaminergic cell death in the SN of chronic MPTP-induced Parkinsonism mice and in SH-SY5Y cells. Copyright © 2018. Published by Elsevier B.V.

Effects of MicroRNA-23a on Differentiation and Gene Expression Profiles in 3T3-L1 Adipocytes

PubMed Central

Huang, Yong; Huang, Jinxiu; Qi, Renli; Wang, Qi; Wu, Yongjiang; Wang, Jing

2016-01-01

MicroRNAs (miRNAs) are small non-coding RNA molecules that regulate growth, development, and programmed death of cells. A newly-published study has shown that miRNA-23a could regulate 3T3-L1 adipocyte differentiation. Here, we identified miRNA-23a as a negative regulator of 3T3-L1 adipocyte differentiation again. Over-expression of miRNA-23a inhibited differentiation and decreased lipogenesis as well as down-regulated mRNA and protein expression of both peroxisome proliferator-activated receptor (PPAR) γ and fatty acid binding protein (FABP) 4, whereas knock down of miRNA-23a showed the opposite effects on differentiation as well as increasing the number of apoptotic cells. Additionally, digital gene expression profiling sequencing (DGE-Seq) was used to assay changes in gene expression profiles following alterations in the level of miR-23a. In total, over-expression or knock down of miRNA-23a significantly changed the expression of 313 and 425 genes, respectively. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses indicated that these genes were mainly involved in the stress response, immune system, metabolism, cell cycle, among other pathways. Additionally, the signal transducer and activator of transcription 1 (Stat1) was shown to be a target of miRNA-23a by computational and dual-luciferase reporter assays that indicated Janus Kinase (Jak)-Stat signal pathway was implicated in regulating adipogenesis mediated by miRNA-23a in adipocytes. PMID:27783036

Alantolactone suppresses APOC3 expression and alters lipid homeostasis in L02 liver cells.

PubMed

Yang, Meiting; Zhao, Hanhan; Ai, Huihan; Zhu, Hongbin; Wang, Shuyue; Bao, Yongli; Li, Yuxin

2018-06-05

A high level of APOC3 expression is an independent risk factor for some lipid metabolism-related diseases, such as cardiovascular disease (CVD), nonalcoholic fatty liver disease (NAFLD) and atherosclerosis (AS). This suggests that down-regulating APOC3 expression is a potential way of regulating lipid levels. In this study, we used luciferase reporter screening to identify a natural compound, alantolactone (ALA), that can inhibit the promoter activity of APOC3. ALA decreased APOC3 expression at both mRNA and protein levels. Then we pretreated L02 liver cells with oxLDL to investigate the function of ALA in lipid homeostasis. Intriguingly, ALA attenuated oxLDL-induced foam cell formation by reducing total cholesterol (TC) and triglyceride (TG) contents. Furthermore, these results could be reversed by overexpressing APOC3 protein. ALA inhibited tyrosine phosphorylation (Tyr705pho) of STAT3 to down-regulate APOC3 expression. Intriguingly, overexpression of a wild-type STAT3 or a constitutively active form of STAT3 (STAT3-C) up-regulated APOC3 expression and partly reversed the effect of ALA in oxLDL-induced L02 cells. Overexpression of wild-type STAT3 also increased TC but not TG contents in L02 cells. However, overexpression of STAT3-C significantly increased TC and TG contents, and the effect of ALA was partly attenuated by STAT3-C, although this was not statistically significant. These results suggest that ALA attenuates lipid accumulation through down-regulation of APOC3 expression, at least in part by inhibiting STAT3 signaling. Copyright © 2018 Elsevier B.V. All rights reserved.

Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

NASA Technical Reports Server (NTRS)

Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

1995-01-01

Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

ER stress upregulated PGE2/IFNγ-induced IL-6 expression and down-regulated iNOS expression in glial cells

NASA Astrophysics Data System (ADS)

Hosoi, Toru; Honda, Miya; Oba, Tatsuya; Ozawa, Koichiro

2013-12-01

The disruption of endoplasmic reticulum (ER) function can lead to neurodegenerative disorders, in which inflammation has also been implicated. We investigated the possible correlation between ER stress and immune function using glial cells. We demonstrated that ER stress synergistically enhanced prostaglandin (PG) E2 + interferon (IFN) γ-induced interleukin (IL)-6 production. This effect was mediated through cAMP. Immune-activated glial cells produced inducible nitric oxide synthase (iNOS). Interestingly, ER stress inhibited PGE2 + IFNγ-induced iNOS expression. Similar results were obtained when cells were treated with dbcAMP + IFNγ. Thus, cAMP has a dual effect on immune reactions; cAMP up-regulated IL-6 expression, but down-regulated iNOS expression under ER stress. Therefore, our results suggest a link between ER stress and immune reactions in neurodegenerative diseases.

Gene expression profile in cerebrum in the filial imprinting of domestic chicks (Gallus gallus domesticus).

PubMed

Yamaguchi, Shinji; Fujii-Taira, Ikuko; Katagiri, Sachiko; Izawa, Ei-Ichi; Fujimoto, Yasuyuki; Takeuchi, Hideaki; Takano, Tatsuya; Matsushima, Toshiya; Homma, Koichi J

2008-06-15

In newly hatched chicks, gene expression in the brain has previously been shown to be up-regulated following filial imprinting. By applying cDNA microarrays containing 13,007 expressed sequence tags, we examined the comprehensive gene expression profiling of the intermediate medial mesopallium in the chick cerebrum, which has been shown to play a key role in filial imprinting. We found 52 up-regulated genes and 6 down-regulated genes of at least 2.0-fold changes 3h after the training of filial imprinting, compared to the gene expression of the dark-reared chick brain. The up-regulated genes are known to be involved in a variety of pathways, including signal transduction, cytoskeletal organization, nuclear function, cell metabolism, RNA binding, endoplasmic reticulum or Golgi function, synaptic function, ion channel, and transporter. In contrast, fewer genes were down-regulated in the imprinting, coinciding with the previous data that the total RNA synthesis increased associated with filial imprinting. Our data suggests that the filial imprinting involves the modulation of multiple signaling pathways.

Amyloid precursor protein controls cholesterol turnover needed for neuronal activity

PubMed Central

Pierrot, Nathalie; Tyteca, Donatienne; D'auria, Ludovic; Dewachter, Ilse; Gailly, Philippe; Hendrickx, Aurélie; Tasiaux, Bernadette; Haylani, Laetitia El; Muls, Nathalie; N'Kuli, Francisca; Laquerrière, Annie; Demoulin, Jean-Baptiste; Campion, Dominique; Brion, Jean-Pierre; Courtoy, Pierre J; Kienlen-Campard, Pascal; Octave, Jean-Noël

2013-01-01

Perturbation of lipid metabolism favours progression of Alzheimer disease, in which processing of Amyloid Precursor Protein (APP) has important implications. APP cleavage is tightly regulated by cholesterol and APP fragments regulate lipid homeostasis. Here, we investigated whether up or down regulation of full-length APP expression affected neuronal lipid metabolism. Expression of APP decreased HMG-CoA reductase (HMGCR)-mediated cholesterol biosynthesis and SREBP mRNA levels, while its down regulation had opposite effects. APP and SREBP1 co-immunoprecipitated and co-localized in the Golgi. This interaction prevented Site-2 protease-mediated processing of SREBP1, leading to inhibition of transcription of its target genes. A GXXXG motif in APP sequence was critical for regulation of HMGCR expression. In astrocytes, APP and SREBP1 did not interact nor did APP affect cholesterol biosynthesis. Neuronal expression of APP decreased both HMGCR and cholesterol 24-hydroxylase mRNA levels and consequently cholesterol turnover, leading to inhibition of neuronal activity, which was rescued by geranylgeraniol, generated in the mevalonate pathway, in both APP expressing and mevastatin treated neurons. We conclude that APP controls cholesterol turnover needed for neuronal activity. PMID:23554170

Investigating the Control of Chlorophyll Degradation by Genomic Correlation Mining.

PubMed

Ghandchi, Frederick P; Caetano-Anolles, Gustavo; Clough, Steven J; Ort, Donald R

2016-01-01

Chlorophyll degradation is an intricate process that is critical in a variety of plant tissues at different times during the plant life cycle. Many of the photoactive chlorophyll degradation intermediates are exceptionally cytotoxic necessitating that the pathway be carefully coordinated and regulated. The primary regulatory step in the chlorophyll degradation pathway involves the enzyme pheophorbide a oxygenase (PAO), which oxidizes the chlorophyll intermediate pheophorbide a, that is eventually converted to non-fluorescent chlorophyll catabolites. There is evidence that PAO is differentially regulated across different environmental and developmental conditions with both transcriptional and post-transcriptional components, but the involved regulatory elements are uncertain or unknown. We hypothesized that transcription factors modulate PAO expression across different environmental conditions, such as cold and drought, as well as during developmental transitions to leaf senescence and maturation of green seeds. To test these hypotheses, several sets of Arabidopsis genomic and bioinformatic experiments were investigated and re-analyzed using computational approaches. PAO expression was compared across varied environmental conditions in the three separate datasets using regression modeling and correlation mining to identify gene elements co-expressed with PAO. Their functions were investigated as candidate upstream transcription factors or other regulatory elements that may regulate PAO expression. PAO transcript expression was found to be significantly up-regulated in warm conditions, during leaf senescence, and in drought conditions, and in all three conditions significantly positively correlated with expression of transcription factor Arabidopsis thaliana activating factor 1 (ATAF1), suggesting that ATAF1 is triggered in the plant response to these processes or abiotic stresses and in result up-regulates PAO expression. The proposed regulatory network includes the freezing, senescence, and drought stresses modulating factor ATAF1 and various other transcription factors and pathways, which in turn act to regulate chlorophyll degradation by up-regulating PAO expression.

Comparative genomic analysis and expression of the APETALA2-like genes from barley, wheat, and barley-wheat amphiploids

PubMed Central

Gil-Humanes, Javier; Pistón, Fernando; Martín, Antonio; Barro, Francisco

2009-01-01

Background The APETALA2-like genes form a large multi-gene family of transcription factors which play an important role during the plant life cycle, being key regulators of many developmental processes. Many studies in Arabidopsis have revealed that the APETALA2 (AP2) gene is implicated in the establishment of floral meristem and floral organ identity as well as temporal and spatial regulation of flower homeotic gene expression. Results In this work, we have cloned and characterised the AP2-like gene from accessions of Hordeum chilense and Hordeum vulgare, wild and domesticated barley, respectively, and compared with other AP2 homoeologous genes, including the Q gene in wheat. The Hordeum AP2-like genes contain two plant-specific DNA binding motifs called AP2 domains, as does the Q gene of wheat. We confirm that the H. chilense AP2-like gene is located on chromosome 5Hch. Patterns of expression of the AP2-like genes were examined in floral organs and other tissues in barley, wheat and in tritordeum amphiploids (barley × wheat hybrids). In tritordeum amphiploids, the level of transcription of the barley AP2-like gene was lower than in its barley parental and the chromosome substitutions 1D/1Hch and 2D/2Hch were seen to modify AP2 gene expression levels. Conclusion The results are of interest in order to understand the role of the AP2-like gene in the spike morphology of barley and wheat, and to understand the regulation of this gene in the amphiploids obtained from barley-wheat crossing. This information may have application in cereal breeding programs to up- or down-regulate the expression of AP2-like genes in order to modify spike characteristics and to obtain free-threshing plants. PMID:19480686

Developmental expression of VGF mRNA in the prenatal and postnatal rat.

PubMed

Snyder, S E; Pintar, J E; Salton, S R

1998-04-27

VGF is a developmentally regulated, secretory peptide precursor that is expressed by neurons and neuroendocrine cells and that has its transcription and secretion induced rapidly by neurotrophins and by depolarization. To gain insight into the possible functions and regulation of VGF in vivo, we have characterized the distribution of VGF mRNA in the developing rat nervous system. VGF expression was first detectable at embryonic day 11.5 in the primordia of cranial, sympathetic, and dorsal root ganglia, and its distribution expanded throughout development to include significant expression throughout the brain, spinal cord, and retina of the adult rat. The earliest expression of VGF, therefore, appeared in the peripheral nervous system as developing neurons settled in their designated ganglia. In many regions of the brain, VGF mRNA levels were found to be highest during periods when axonal outgrowth and synaptogenesis predominate. Areas of the central nervous system that contain predominantly dividing cells never displayed any VGF mRNA expression, nor did the vast majority of nonneural tissues.

Effects of rhynchophylline on GluN1 and GluN2B expressions in primary cultured hippocampal neurons.

PubMed

He, Yan; Zeng, Sheng-Ya; Zhou, Shi-Wen; Qian, Gui-Sheng; Peng, Kang; Mo, Zhi-Xian; Zhou, Ji-Yin

2014-10-01

N-methyl-d-aspartate (NMDA) receptor subunits GluN1 and GluN2B in hippocampal neurons play key roles in anxiety. Our previous studies show that rhynchophylline, an active component of the Uncaria species, down-regulates GluN2B expression in the hippocampal CA1 area of amphetamine-induced rat. The effects of rhynchophylline on expressions of GluN1 and GluN2B in primary hippocampal neurons in neonatal rats in vitro were investigated. Neonatal hippocampal neurons were cultured with neurobasal-A medium. After incubation for 6h or 48 h with rhynchophylline (non-competitive NMDAR antagonist) and MK-801 (non-competitive NMDAR antagonist with anxiolytic effect, as the control drug) from day 6, neuron toxicity, mRNA and protein expressions of GluN1 and GluN2B were analyzed. GluN1 is mainly distributed on neuronal axons and dendritic trunks, cytoplasm and cell membrane near axons and dendrites. GluN2B is mainly distributed on the membrane, dendrites, and axon membranes. GluN1 and GluN2B are codistributed on dendritic trunks and dendritic spines. After 48 h incubation, a lower concentration of rhynchophylline (lower than 400 μmol/L) and MK-801 (lower than 200 μmol/L) have no toxicity on neonatal hippocampal neurons. Rhynchophylline up-regulated GluN1 mRNA expression at 6h and mRNA and protein expressions at 48h, but down-regulated GluN2B mRNA and protein expressions at 48 h. However, GluN1 and GluN2B mRNA expressions were down-regulated at 6h, and mRNA and protein expressions were both up-regulated by MK-801 at 48h. These findings show that rhynchophylline reciprocally regulates GluN1 and GluN2B expressions in hippocampal neurons, indicating a potential anxiolytic property for rhynchophylline. Copyright © 2014 Elsevier B.V. All rights reserved.

Distinct role of p38 and c-Jun N-terminal kinases in IL-10-dependent and IL-10-independent regulation of the costimulatory molecule B7.2 in lipopolysaccharide-stimulated human monocytic cells.

PubMed

Lim, Wilfred; Ma, Wei; Gee, Katrina; Aucoin, Susan; Nandan, Devki; Diaz-Mitoma, Francisco; Kozlowski, Maya; Kumar, Ashok

2002-02-15

The costimulatory molecule B7.2 (CD86) plays a vital role in immune activation and development of Th responses. The molecular mechanisms by which B7.2 expression is regulated are not understood. We investigated the role of mitogen-activated protein kinases (MAPK) in the regulation of B7.2 expression in LPS-stimulated human monocytic cells. LPS stimulation of human monocytes resulted in the down-regulation of B7.2 expression that could be abrogated by anti-IL-10 Abs. Furthermore, SB202190, a specific inhibitor of p38 MAPK, inhibited LPS-induced IL-10 production and reversed B7.2 down-regulation, suggesting that LPS-induced B7.2 down-regulation may be mediated, at least in part, via regulation of IL-10 production by p38 MAPK. In contrast to human promonocytic THP-1 cells that are refractory to the inhibitory effects of IL-10, LPS stimulation enhanced B7.2 expression. This IL-10-independent B7.2 induction was not influenced by specific inhibitors of either p38 or p42/44 MAPK. To ascertain the role of the c-Jun N-terminal kinase (JNK) MAPK, dexamethasone, an inhibitor of JNK activation, was used, which inhibited LPS-induced B7.2 expression. Transfection of THP-1 cells with a plasmid expressing a dominant-negative stress-activated protein/extracellular signal-regulated kinase kinase 1 significantly reduced LPS-induced B7.2 expression, thus confirming the involvement of JNK. To study the signaling events downstream of JNK activation, we show that dexamethasone did not inhibit LPS-induced NF-kappaB activation in THP-1 cells, suggesting that JNK may not be involved in NF-kappaB activation leading to B7.2 expression. Taken together, our results reveal the distinct involvement of p38 in IL-10-dependent, and JNK in IL-10-independent regulation of B7.2 expression in LPS-stimulated monocytic cells.

Molecular profiles of Quadriceps muscle in myostatin-null mice reveal PI3K and apoptotic pathways as myostatin targets

PubMed Central

Chelh, Ilham; Meunier, Bruno; Picard, Brigitte; Reecy, Mark James; Chevalier, Catherine; Hocquette, Jean-François; Cassar-Malek, Isabelle

2009-01-01

Background Myostatin (MSTN), a member of the TGF-β superfamily, has been identified as a negative regulator of skeletal muscle mass. Inactivating mutations in the MSTN gene are responsible for the development of a hypermuscular phenotype. In this study, we performed transcriptomic and proteomic analyses to detect altered expression/abundance of genes and proteins. These differentially expressed genes and proteins may represent new molecular targets of MSTN and could be involved in the regulation of skeletal muscle mass. Results Transcriptomic analysis of the Quadriceps muscles of 5-week-old MSTN-null mice (n = 4) and their controls (n = 4) was carried out using microarray (human and murine oligonucleotide sequences) of 6,473 genes expressed in muscle. Proteomic profiles were analysed using two-dimensional gel electrophoresis coupled with mass spectrometry. Comparison of the transcriptomic profiles revealed 192 up- and 245 down- regulated genes. Genes involved in the PI3K pathway, insulin/IGF pathway, carbohydrate metabolism and apoptosis regulation were up-regulated. Genes belonging to canonical Wnt, calcium signalling pathways and cytokine-receptor cytokine interaction were down-regulated. Comparison of the protein profiles revealed 20 up- and 18 down-regulated proteins spots. Knockout of the MSTN gene was associated with up-regulation of proteins involved in glycolytic shift of the muscles and down-regulation of proteins involved in oxidative energy metabolism. In addition, an increased abundance of survival/anti-apoptotic factors were observed. Conclusion All together, these results showed a differential expression of genes and proteins related to the muscle energy metabolism and cell survival/anti-apoptotic pathway (e.g. DJ-1, PINK1, 14-3-3ε protein, TCTP/GSK-3β). They revealed the PI3K and apoptotic pathways as MSTN targets and are in favour of a role of MSTN as a modulator of cell survival in vivo. PMID:19397818

Cyclic AMP Affects Oocyte Maturation and Embryo Development in Prepubertal and Adult Cattle

PubMed Central

Bernal-Ulloa, Sandra Milena; Heinzmann, Julia; Herrmann, Doris; Hadeler, Klaus-Gerd; Aldag, Patrick; Winkler, Sylke; Pache, Dorit; Baulain, Ulrich; Lucas-Hahn, Andrea; Niemann, Heiner

2016-01-01

High cAMP levels during in vitro maturation (IVM) have been related to improved blastocyst yields. Here, we employed the cAMP/cGMP modulators, forskolin, IBMX, and cilostamide, during IVM to unravel the role of high cAMP in early embryonic development produced from prepubertal and adult bovine oocytes. Oocytes were collected via transvaginal aspiration and randomly assigned to three experimental groups: TCM24 (24h IVM/control), cAMP30 (2h pre-IVM (forskolin-IBMX), 30h IVM-cilostamide), and DMSO30 (Dimethyl Sulfoxide/vehicle control). After IVM, oocytes were fertilized in vitro and zygotes were cultured in vitro to blastocysts. Meiotic progression, cAMP levels, mRNA abundance of selected genes and DNA methylation were evaluated in oocytes. Blastocysts were used for gene expression or DNA methylation analyses. Blastocysts from the cAMP30 groups were transferred to recipients. The cAMP elevation delayed meiotic progression, but developmental rates were not increased. In immature oocytes, mRNA abundance of PRKACA was higher for cAMP30 protocol and no differences were found for PDE3A, SMAD2, ZAR1, PRDX1 and SLC2A8. EGR1 gene was up-regulated in prepubertal cAMP30 immature oocytes and down-regulated in blastocysts from all in vitro treatments. A similar gene expression profile was observed for DNMT3b, BCL2L1, PRDX1 and SLC2A8 in blastocysts. Satellite DNA methylation profiles were different between prepubertal and adult oocytes and blastocysts derived from the TCM24 and DMSO30 groups. Blastocysts obtained from prepubertal and adult oocytes in the cAMP30 treatment displayed normal methylation profiles and produced offspring. These data indicate that cAMP regulates IVM in prepubertal and adult oocytes in a similar manner, with impact on the establishment of epigenetic marks and acquisition of full developmental competency. PMID:26926596

Primary and Secondary Abscission in Pisum sativum and Euphorbia pulcherrima—How Do They Compare and How Do They Differ?

PubMed Central

Hvoslef-Eide, Anne K.; Munster, Cristel M.; Mathiesen, Cecilie A.; Ayeh, Kwadwo O.; Melby, Tone I.; Rasolomanana, Paoly; Lee, YeonKyeong

2016-01-01

Abscission is a highly regulated and coordinated developmental process in plants. It is important to understand the processes leading up to the event, in order to better control abscission in crop plants. This has the potential to reduce yield losses in the field and increase the ornamental value of flowers and potted plants. A reliable method of abscission induction in poinsettia (Euphorbia pulcherrima) flowers has been established to study the process in a comprehensive manner. By correctly decapitating buds of the third order, abscission can be induced in 1 week. AFLP differential display (DD) was used to search for genes regulating abscission. Through validation using qRT-PCR, more information of the genes involved during induced secondary abscission have been obtained. A study using two pea (Pisum sativum) mutants in the def (Developmental funiculus) gene, which was compared with wild type peas (tall and dwarf in both cases) was performed. The def mutant results in a deformed, abscission-less zone instead of normal primary abscission at the funiculus. RNA in situ hybridization studies using gene sequences from the poinsettia differential display, resulted in six genes differentially expressed for abscission specific genes in both poinsettia and pea. Two of these genes are associated with gene up- or down-regulation during the first 2 days after decapitation in poinsettia. Present and previous results in poinsettia (biochemically and gene expressions), enables a more detailed division of the secondary abscission phases in poinsettia than what has previously been described from primary abscission in Arabidopsis. This study compares the inducible secondary abscission in poinsettia and the non-abscising mutants/wild types in pea demonstrating primary abscission zones. The results may have wide implications on the understanding of abscission, since pea and poinsettia have been separated for 94–98 million years in evolution, hence any genes or processes in common are bound to be widespread in the plant kingdom. PMID:26858724

Static compression down-regulates N-cadherin expression and facilitates loss of cell phenotype of nucleus pulposus cells in a disc perfusion culture.

PubMed

Zhou, Haibo; Shi, Jianmin; Zhang, Chao; Li, Pei

2018-02-28

Mechanical compression often induces degenerative changes of disc nucleus pulposus (NP) tissue. It has been indicated that N-cadherin (N-CDH)-mediated signaling helps to preserve the NP cell phenotype. However, N-CDH expression and the resulting NP-specific phenotype alteration under the static compression and dynamic compression remain unclear. To study the effects of static compression and dynamic compression on N-CDH expression and NP-specific phenotype in an in vitro disc organ culture. Porcine discs were organ cultured in a self-developed mechanically active bioreactor for 7 days and subjected to static or dynamic compression (0.4 MPa for 2 h once per day). The noncompressed discs were used as controls. Compared with the dynamic compression, static compression significantly down-regulated the expression of N-CDH and NP-specific markers (laminin, brachyury, and keratin 19); decreased the Alcian Blue staining intensity, glycosaminoglycan and hydroxyproline contents; and declined the matrix macromolecule (aggrecan and collagen II) expression. Compared with the dynamic compression, static compression causes N-CDH down-regulation, loss of NP-specific phenotype, and the resulting decrease in NP matrix synthesis. © 2018 The Author(s).

Down-regulation of WAVE2, WASP family verprolin-homologous protein 2, in gastric cancer indicates lymph node metastasis and cell migration.

PubMed

Jia, Shuqin; Jia, Yongning; Weeks, Hoi Ping; Ruge, Fiona; Feng, Xuemin; Ma, Ruiting; Ji, Jiafu; Ren, Jianjun; Jiang, Wen G

2014-05-01

WAVE2 plays a crucial role in actin polymerisation and cell migration. We aimed to investigate the expression and cellular functions of WAVE2 in human gastric cancer (GC). The level of WAVE2 was determined using quantitative PCR (Q-PCR) in a cohort of human gastric tissues. Expression of WAVE2, ARP2, NWASP, ROCK1 and ROCK2 was examined using RT-PCR in paired tissues. WAVE2 and ARP2 protein co-expression was examined. Anti-WAVE2 transgene ribozymes were constructed and transiently transfected into human GC cells. Down-regulation of WAVE2 expression in GC was significantly correlated with lymph node metastasis. WAVE2 was positively correlated with E-cadherin and negatively with TWIST. Immunohistochemically, WAVE2 and ARP2 were not co-expressed in serial mirror sections. In vitro, WAVE2 knockdown was shown to increase cell motility, whilst ROCK inhibitor treatment reduced this effect in HGC27 cells. WAVE2 is down-regulated in GC and loses its metastatic role in GC. Knockdown of WAVE2 could increase metastatic potential by promoting the growth, invasiveness, motility, adhesiveness and suppressing EMT (epithelial-mesenchymal transition) of GC cells.

[Effect of Jianpi Yangzheng Xiaozheng Recipe on Apoptosis and Autophagy of Subcutaneous Transplanted Tumor in Nude Mice: an Experimental Study on Mechanism].

PubMed

Wu, Jian; Liu, Shen-lin; Zhang, Xing-xing; Chen, Min; Zou, Xi

2015-09-01

To observe the effect of Jianpi Yangzheng Xiaozheng Recipe (JYXR) on the tumor inhibition rate of subcutaneous transplanted tumor gastric cancer cell line MGC-803 in BALB/c nude mice, and to study its molecular mechanism of apoptosis and autophagy. Gastric cancer cell line MGC-803 was subcutaneously inoculated to nude mice for preparing transplanted gastric cancer models. Totally 32 BALB/c nude mice were randomly divided into 4 groups according to random digit table, i.e., the negative control group, the positive control group, the high dose JYXR group, the low dose JYXR group, 8 in each group. Normal saline was administered to mice in the negative control group by gastrogavage. 5-fluorouracil (5-Fu) at 2. 5 mg/kg was administered to mice in the positive control group by gastrogavage. JYXR at 85 and 43 g/kg was administered to mice in the high dose JYXR group and the low dose JYXR group by gastrogavage, once per day for 10 successive days. The effect of JYXR on the tumor inhibition rate of subcutaneous transplanted tumor was observed. Effects of JYXR on gene expression levels of Bax, Bcl-2, Fas, Cyclin D1, Cyclin D2, and Cyclin D3 in transplanted tumor were observed by real-time PCR. Effects of JYXR on protein expression levels of Procaspase-3, Procaspase-8, Procaspase-9, cleaved-PARP, Beclin-1, and LC3B were detected using Western blot. (1) Compared with the negative control group, the tumor weight was obviously reduced in the rest three groups (P <0. 05). The tumor weight was higher in the high dose JYXR group and the low dose JYXR group than in the positive control group (P <0. 05). (2) Results of RT-PCR indicated that, compared with the negative control group, expression levels of Bax were up-regulated, but expression levels of Bcl-2, Cyclin D1, Cyclin D2, and Cyclin D3 were down-regulated in the positive control group and JYXR groups (P <0. 05). The expression level of Fas was up-regulated in the positive control group and the high dose JYXR group (P <0. 05). Compared with the positive control group, expression levels of Fas, and Bax were all down-regulated, but expression levels of Bcl-2, Cyclin D2, and Cyclin D3 were all up-regulated in the high dose JYXR group and the low dose JYXR group (all P <0. 05). The expression level of Cyclin D1 was down-regulated in the high dose JYXR group, but it was up-regulated in the low dose JYXR group ( both P <0. 05). (3) Results of Western blot showed, compared with the negative control group, expression levels of Procaspase-3, Procaspase-8, and Procaspase-9 were down-regulated, but expression levels of cleaved-PARP, Beclin-1, and LC3B II were up-regulated in the high dose JYXR group and the low dose JYXR group (all P <0.05). Compared with the negative control group, expression levels of Procaspase-3, Procaspase-8, Procaspase-9, and LC3B II were down-regulated, but expression levels of cleaved-PARP, Beclin-1, and LC3B I were up-regulated in the positive control group (all P <0. 05). JYXR showed significant inhibition on subcutaneous transplanted tumor gastric cancer cell line MGC-803 in BALB/c nude mice. Its mechanism might be associated with activating apoptosis and autophagy correlated factors.

Down-regulation of MutS homolog 3 by hypoxia in human colorectal cancer

PubMed Central

Li, Jie; Koike, Junichi; Kugoh, Hiroyuki; Arita, Michitsune; Ohhira, Takahito; Kikuchi, Yoshinori; Funahashi, Kimihiko; Takamatsu, Ken; Boland, C. Richard; Koi, Minoru; Hemmi, Hiromichi

2013-01-01

Down-regulation of hMSH3 is associated with elevated microsatellite alterations at selected tetranucleotide repeats and low levels of microsatellite instability in colorectal cancer (CRC). However, the mechanism that down-regulates hMSH3 in CRC is not known. In this study, a significant association between over-expression of glucose transporter 1, a marker for hypoxia, and down-regulation of hMSH3 in CRC tissues was observed. Therefore, we examined the effect of hypoxia on the expression of hMSH3 in human cell lines. When cells with wild type p53 (wt-p53) were exposed to hypoxia, rapid down-regulation of both hMSH2 and hMSH3 occurred. In contrast, when null or mutated p53 (null/mut-p53) cells were exposed to hypoxia, only hMSH3 was down-regulated, and at slower rate than wt-p53 cells. Using a reporter assay, we found that disruption of the two putative hypoxia response elements (HREs) located within the promoter region of the hMSH3 abrogated the suppressive effect of hypoxia on reporter activity regardless of p53 status. In an EMSA, two different forms of HIF-1α complexes that specifically bind to these HREs were detected. A larger complex containing HIF-1α predominantly bound to the HREs in hypoxic null/mut-p53 cells whereas a smaller complex predominated in wt-p53 cells. Finally, HIF-1α knockdown by siRNA significantly inhibited down-regulation of hMSH3 by hypoxia in both wt-p53 and mut-p53 cells. Taken together, our results suggest that the binding of HIF-1α complexes to HRE sites is necessary for down-regulation of hMSH3 in both wt-p53 and mut-p53 cells. PMID:22343000

Low-dose irradiation promotes Rad51 expression by down-regulating miR-193b-3p in hepatocytes

NASA Astrophysics Data System (ADS)

Lee, Eon-Seok; Won, Yeo Jin; Kim, Byoung-Chul; Park, Daeui; Bae, Jin-Han; Park, Seong-Joon; Noh, Sung Jin; Kang, Yeong-Rok; Choi, Si Ho; Yoon, Je-Hyun; Heo, Kyu; Yang, Kwangmo; Son, Tae Gen

2016-05-01

Current evidence indicates that there is a relationship between microRNA (miRNA)-mediated gene silencing and low-dose irradiation (LDIR) responses. Here, alterations of miRNA expression in response to LDIR exposure in male BALB/c mice and three different types of hepatocytes were investigated. The miRNome of the LDIR-exposed mouse spleens (0.01 Gy, 6.5 mGy/h) was analyzed, and the expression of miRNA and mRNA was validated by qRT-PCR. Western blotting, chromatin immunoprecipitation (ChIP), and luciferase assays were also performed to evaluate the interaction between miRNAs and their target genes and to gain insight into the regulation of miRNA expression. The expression of miRNA-193b-3p was down-regulated in the mouse spleen and liver and in various hepatocytes (NCTC, Hepa, and HepG2 cell lines) in response to LDIR. The down-regulation of miR-193b-3p expression was caused by histone deacetylation on the miR-193b-3p promoter in the HepG2 cells irradiated with 0.01 Gy. However, the alteration of histone deacetylation and miR-193b-3p and Rad51 expression in response to LDIR was restored by pretreatment with N-acetyl-cyctein. In conclusion, we provide evidence that miRNA responses to LDIR include the modulation of cellular stress responses and repair mechanisms.

Identification of microRNAs in the Toxigenic Dinoflagellate Alexandrium catenella by High-Throughput Illumina Sequencing and Bioinformatic Analysis

PubMed Central

Geng, Huili; Sui, Zhenghong; Zhang, Shu; Du, Qingwei; Ren, Yuanyuan; Liu, Yuan; Kong, Fanna; Zhong, Jie; Ma, Qingxia

2015-01-01

Micro-ribonucleic acids (miRNAs) are a large group of endogenous, tiny, non-coding RNAs consisting of 19–25 nucleotides that regulate gene expression at either the transcriptional or post-transcriptional level by mediating gene silencing in eukaryotes. They are considered to be important regulators that affect growth, development, and response to various stresses in plants. Alexandrium catenella is an important marine toxic phytoplankton species that can cause harmful algal blooms (HABs). To date, identification and function analysis of miRNAs in A. catenella remain largely unexamined. In this study, high-throughput sequencing was performed on A. catenella to identify and quantitatively profile the repertoire of small RNAs from two different growth phases. A total of 38,092,056 and 32,969,156 raw reads were obtained from the two small RNA libraries, respectively. In total, 88 mature miRNAs belonging to 32 miRNA families were identified. Significant differences were found in the member number, expression level of various families, and expression abundance of each member within a family. A total of 15 potentially novel miRNAs were identified. Comparative profiling showed that 12 known miRNAs exhibited differential expression between the lag phase and the logarithmic phase. Real-time quantitative RT-PCR (qPCR) was performed to confirm the expression of two differentially expressed miRNAs that were one up-regulated novel miRNA (aca-miR-3p-456915), and one down-regulated conserved miRNA (tae-miR159a). The expression trend of the qPCR assay was generally consistent with the deep sequencing result. Target predictions of the 12 differentially expressed miRNAs resulted in 1813target genes. Gene ontology (GO) analysis and the Kyoto Encyclopedia of Genes and Genomes pathway database (KEGG) annotations revealed that some miRNAs were associated with growth and developmental processes of the alga. These results provide insights into the roles that miRNAs play in the growth of A. catenella, and they provide the basis for further studies of the molecular mechanisms that underlie bloom growth in red tides species. PMID:26398216

IL-10-dependent down-regulation of MHC class II expression level on monocytes by peritoneal fluid from endometriosis patients.

PubMed

Lee, Kyu-Sup; Baek, Dae-Won; Kim, Ki-Hyung; Shin, Byoung-Sub; Lee, Dong-Hyung; Kim, Ja-Woong; Hong, Young-Seoub; Bae, Yoe-Sik; Kwak, Jong-Young

2005-11-01

Endometriosis is a gynecologic disorder characterized by the ectopic growth of misplaced endometrial cells. Moreover, immunological abnormalities of cell-mediated and humoral immunity may be associated with the pathogenesis of endometriosis. The effects of peritoneal fluid (PF) from endometriosis patients on the expression levels of MHC class II and costimulatory molecules on the cell surfaces of monocytes were investigated. Compared to the PF of controls, the addition of 10% PF (n=10) from patients with endometriosis to culture medium significantly reduced the percentage of MHC class II-positive cells in cultures of a THP-1, monocytic cell line at 48 h. The effect of endometriosis patient PF (EPF) was dose-dependent, and similar effect was observed in peripheral blood monocytes. An inverse correlation was found between MHC class II expression level and IL-10 concentration in EPF (r=-0.518; p=0.019) and in the supernatant of peripheral blood monocyte cultured in EPF (r=-0.459; p=0.042) (n=20). The expression levels of costimulatory molecules (CD80 and CD86), but not of CD54 and B7-H1, were down-regulated by EPF. The mRNA level of HLA-DR was unaffected by EPF but protein level was reduced by EPF. Neutralizing IL-10 antibody abrogated MHC class II down-regulation on monocytes, which had been induced by EPF. However, in a functional assay, monocytes treated with EPF failed to stimulate T cell in mixed leukocyte reaction, although T cell proliferation was increased with EPF-treated monocytes and Staphylococcus enterotoxin B. These results suggest that MHC class II expression level on monocytes is down-regulated by EPF, but the cell stimulatory ability of monocytes does not coincide with MHC class II expression level.

MicroRNA-187, down-regulated in clear cell renal cell carcinoma and associated with lower survival, inhibits cell growth and migration though targeting B7-H3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Jun; Lei, Ting; Xu, Congjie

2013-08-23

Highlights: •miR-187 is down-regulated in clear cell renal cell carcinoma (ccRCC). •Down-regulation of miR-187 is associated with poor outcomes in patients with ccRCC. •miR-187 inhibits cell growth and migration though targeting B7-H3 in ccRCC. -- Abstract: Aberrantly expressed microRNAs (miRNAs) are frequently associated with the aggressive malignant behavior of human cancers, including clear cell renal cell carcinoma (ccRCC). Based on the preliminary deep sequencing data, we hypothesized that miR-187 may play an important role in ccRCC development. In this study, we found that miR-187 was down-regulated in both tumor tissue and plasma of ccRCC patients. Lower miR-187 expression levels weremore » associated with higher tumor grade and stage. All patients with high miR-187 expression survived 5 years, while with low miR-187 expression, only 42% survived. Suppressed in vitro proliferation, inhibited in vivo tumor growth, and decreased motility were observed in cells treated with the miR-187 expression vector. Further studies showed that B7 homolog 3 (B7-H3) is a direct target of miR-187. Over-expression of miR-187 decreased B7-H3 mRNA level and repressed B7-H3-3′-UTR reporter activity. Knockdown of B7-H3 using siRNA resulted in similar phenotype changes as that observed for overexpression of miR-187. Our data suggest that miR-187 is emerging as a novel player in the disease state of ccRCC. miR-187 plays a tumor suppressor role in ccRCC.« less

An RNA Sequencing Transcriptome Analysis Reveals Novel Insights into Molecular Aspects of the Nitrate Impact on the Nodule Activity of Medicago truncatula1[W

PubMed Central

Cabeza, Ricardo; Koester, Beke; Liese, Rebecca; Lingner, Annika; Baumgarten, Vanessa; Dirks, Jan; Salinas-Riester, Gabriela; Pommerenke, Claudia; Dittert, Klaus; Schulze, Joachim

2014-01-01

The mechanism through which nitrate reduces the activity of legume nodules is controversial. The objective of the study was to follow Medicago truncatula nodule activity after nitrate provision continuously and to identify molecular mechanisms, which down-regulate the activity of the nodules. Nodule H2 evolution started to decline after about 4 h of nitrate application. At that point in time, a strong shift in nodule gene expression (RNA sequencing) had occurred (1,120 differentially expressed genes). The most pronounced effect was the down-regulation of 127 genes for nodule-specific cysteine-rich peptides. Various other nodulins were also strongly down-regulated, in particular all the genes for leghemoglobins. In addition, shifts in the expression of genes involved in cellular iron allocation and mitochondrial ATP synthesis were observed. Furthermore, the expression of numerous genes for the formation of proteins and glycoproteins with no obvious function in nodules (e.g. germins, patatin, and thaumatin) was strongly increased. This occurred in conjunction with an up-regulation of genes for proteinase inhibitors, in particular those containing the Kunitz domain. The additionally formed proteins might possibly be involved in reducing nodule oxygen permeability. Between 4 and 28 h of nitrate exposure, a further reduction in nodule activity occurred, and the number of differentially expressed genes almost tripled. In particular, there was a differential expression of genes connected with emerging senescence. It is concluded that nitrate exerts rapid and manifold effects on nitrogenase activity. A certain degree of nitrate tolerance might be achieved when the down-regulatory effect on late nodulins can be alleviated. PMID:24285852

Silencing NPAS2 promotes cell growth and invasion in DLD-1 cells and correlated with poor prognosis of colorectal cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xue, Xiaofeng; Liu, Fei; Han, Ye

2014-07-25

Highlights: • NPAS2 mRNA was down-regulated in clinical colorectal cancer tissues. • Low NPAS2 level was associated with the tumor size, TNM stage and distance metastasis in CRC. • Silencing NPAS2 promoted cell proliferation, the wound healing and cell invasion abilities. - Abstract: Emerging evidences show that circadian rhythm disorder is an important factor of tumor initiation and development. Neuronal PAS domain protein2 (NPAS2), which is the largest circadian gene, has been proved to be a novel prognostic biomarker in breast cancer and non-Hodgkin’s lymphoma. However, the potential functions of NPAS2 in colorectal cancer are still unknown. In our presentmore » study, we detected the mRNA expressions of NPAS2 in 108 CRC patients by RT-PCR, and found that NPAS2 expression was significantly down-regulated in tumor tissues than that in NATs. Clinicopathologic analysis revealed that low expression of NPAS2 was associated with the tumor size, TNM stage and tumor distance metastasis in colorectal cancer (p < 0.05). Furthermore, we effectively down-regulated NPAS2 mRNA expression by transfecting RNA interfere fragments into DLD-1 cells, and our results in vitro demonstrated that silencing NPAS2 expression could promote cell proliferation, cell invasion and increase the wound healing ability (p < 0.05). However, down-regulating NPAS2 expression did not influence the apoptotic rate in DLD-1 cells (p > 0.05). In conclusion, our study suggested that NPAS2, functioned as a potential tumor suppressor gene, could serve as a promising target and potential prognostic indicator for colorectal cancer.« less

Vascular endothelial growth factor A (VEGF-A) decreases expression and secretion of pleiotrophin in a VEGF receptor-independent manner.

PubMed

Poimenidi, Evangelia; Theodoropoulou, Christina; Koutsioumpa, Marina; Skondra, Lamprini; Droggiti, Eirini; van den Broek, Marloes; Koolwijk, Pieter; Papadimitriou, Evangelia

2016-05-01

Vascular endothelial growth factor A (VEGF-A) is a key molecule in angiogenesis acting through VEGF receptors (VEGFRs), ανβ3 integrin, receptor protein tyrosine phosphatase beta/zeta (RPTPβ/ζ) and cell surface nucleolin (NCL). Pleiotrophin (PTN) stimulates endothelial cell migration and limits the angiogenic effects of VEGF-A165 to the levels of its own effect, possibly acting as a VEGF-A165 modifier. Since PTN and VEGF-A165 share receptors and actions on endothelial cells, in the present work we studied whether and how VEGF-A165 affects PTN expression or secretion. VEGF-A165 decreased PTN mRNA and protein levels acting at the transcriptional level. Bevacizumab, a selective VEGFR2 tyrosine kinase inhibitor and down-regulation of VEGFR2 expression by siRNA did not affect this decrease, suggesting that it is VEGFR-independent. VEGF-A121 also decreased PTN mRNA and protein levels, suggesting that heparin binding of VEGF-A165 is not involved. Blockage of cell surface NCL, lack of expression or mutation of β3 integrin and down-regulation of RPTPβ/ζ abolished the inhibitory effect of VEGF-A165 on PTN expression and secretion. Down-regulation of endogenous PTN in endothelial cells enhanced VEGF-A165-induced increase in migration and tube formation on matrigel. Collectively, these data suggest that VEGF-A down-regulates PTN expression and secretion through the RPTPβ/ζ-ανβ3-NCL axis to enhance its own effect on cell migration and further highlight the role of RPTPβ/ζ in VEGF-A actions. Copyright © 2016 Elsevier Inc. All rights reserved.

Variation in relative water content, proline accumulation and stress gene expression in two cowpea landraces under drought.

PubMed

Zegaoui, Zahia; Planchais, Séverine; Cabassa, Cécile; Djebbar, Reda; Abrous Belbachir, Ouzna; Carol, Pierre

2017-11-01

Many landraces of cowpea [Vigna unguiculata (L.) Walp.] are adapted to particular geographical and climatic conditions. Here we describe two landraces grown respectively in arid and temperate areas of Algeria and assess their physiological and molecular responses to drought stress. As expected, when deprived of water cowpea plants lose water over time with a gradual reduction in transpiration rate. The landraces differed in their relative water content (RWC) and whole plant transpiration rate. The landrace from Menia, an arid area, retained more water in adult leaves. Both landraces responded to drought stress at the molecular level by increasing expression of stress-related genes in aerial parts, including proline metabolism genes. Expression of gene(s) encoding proline synthesis enzyme P5CS was up regulated and gene expression of ProDH, a proline catabolism enzyme, was down regulated. Relatively low amounts of proline accumulated in adult leaves with slight differences between the two landraces. During drought stress the most apical part of plants stayed relatively turgid with a high RWC compared to distal parts that wilted. Expression of key stress genes was higher and more proline accumulated at the apex than in distal leaves indicating that cowpea has a non-uniform stress response at the whole plant level. Our study reveals a developmental control of water stress through preferential proline accumulation in the upper tier of the cowpea plant. We also conclude that cowpea landraces display physiological adaptations to water stress suited to the arid and temperate climates in which they are cultivated. Copyright © 2017 Elsevier GmbH. All rights reserved.

Long non-coding RNAs and mRNAs profiling during spleen development in pig.

PubMed

Che, Tiandong; Li, Diyan; Jin, Long; Fu, Yuhua; Liu, Yingkai; Liu, Pengliang; Wang, Yixin; Tang, Qianzi; Ma, Jideng; Wang, Xun; Jiang, Anan; Li, Xuewei; Li, Mingzhou

2018-01-01

Genome-wide transcriptomic studies in humans and mice have become extensive and mature. However, a comprehensive and systematic understanding of protein-coding genes and long non-coding RNAs (lncRNAs) expressed during pig spleen development has not been achieved. LncRNAs are known to participate in regulatory networks for an array of biological processes. Here, we constructed 18 RNA libraries from developing fetal pig spleen (55 days before birth), postnatal pig spleens (0, 30, 180 days and 2 years after birth), and the samples from the 2-year-old Wild Boar. A total of 15,040 lncRNA transcripts were identified among these samples. We found that the temporal expression pattern of lncRNAs was more restricted than observed for protein-coding genes. Time-series analysis showed two large modules for protein-coding genes and lncRNAs. The up-regulated module was enriched for genes related to immune and inflammatory function, while the down-regulated module was enriched for cell proliferation processes such as cell division and DNA replication. Co-expression networks indicated the functional relatedness between protein-coding genes and lncRNAs, which were enriched for similar functions over the series of time points examined. We identified numerous differentially expressed protein-coding genes and lncRNAs in all five developmental stages. Notably, ceruloplasmin precursor (CP), a protein-coding gene participating in antioxidant and iron transport processes, was differentially expressed in all stages. This study provides the first catalog of the developing pig spleen, and contributes to a fuller understanding of the molecular mechanisms underpinning mammalian spleen development.

Protein Kinase C- ɛ Regulates the Apoptosis and Survival of Glioma Cells

PubMed Central

Okhrimenko, Hana; Lu, Wei; Xiang, Cunli; Hamburger, Nathan; Kazimirsky, Gila; Brodie, Chaya

2005-01-01

In this study, we examined the role of protein kinase C (PKC)-ɛ in the apoptosis and survival of glioma cells using tumor necrosis factor–related apoptosis inducing ligand (TRAIL)- stimulated cells and silencing of PKCɛ expression. Treatment of glioma cells with TRAIL induced activation, caspase-dependent cleavage, and down-regulation of PKCɛ within 3 to 5 hours of treatment. Overexpression of PKCɛ inhibited the apoptosis induced by TRAIL, acting downstream of caspase 8 and upstream of Bid cleavage and cytochrome c release from the mitochondria. A caspase-resistant PKCɛ mutant (D383A) was more protective than PKCɛ, suggesting that both the cleavage of PKCɛ and its down-regulation contributed to the apoptotic effect of TRAIL. To further study the role of PKCɛ in glioma cell apoptosis, we employed short interfering RNAs directed against the mRNA of PKCɛ and found that silencing of PKCɛ expression induced apoptosis of various glioma cell lines and primary glioma cultures. To delineate the molecular mechanisms involved in the apoptosis induced by silencing of PKCɛ, we examined the expression and phosphorylation of various apoptosis-related proteins. We found that knockdown of PKCɛ did not affect the expression of Bcl2 and Bax or the phosphorylation and expression of Erk1/2, c-Jun-NH2-kinase, p38, or STAT, whereas it selectively reduced the expression of AKT. Similarly, TRAIL reduced the expression of AKT in glioma cells and this decrease was abolished in cells overexpressing PKCɛ. Our results suggest that the cleavage of PKCɛ and its down-regulation play important roles in the apoptotic effect of TRAIL. Moreover, PKCɛ regulates AKT expression and is essential for the survival of glioma cells. PMID:16103081

Transcriptome changes associated with delayed flower senescence on transgenic petunia by inducing expression of etr1-1, a mutant ethylene receptor.

PubMed

Wang, Hong; Stier, Genevieve; Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, 'the regulation of transcription' was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death.

Transcriptome Changes Associated with Delayed Flower Senescence on Transgenic Petunia by Inducing Expression of etr1-1, a Mutant Ethylene Receptor

PubMed Central

Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S.; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, ‘the regulation of transcription’ was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death. PMID:23874385

Identification of Differentially Expressed Genes in Chilling-Induced Potato (Solanum tuberosum L.); a Data Analysis Study.

PubMed

Koc, I; Vatansever, R; Ozyigit, I I; Filiz, E

2015-10-01

Cold stress, as chilling (<20 °C) or freezing (<0 °C), is one of the frequently exposed stresses in cultivated plants like potato. Under cold stress, plants differentially modulate their gene expression to develop a cold tolerance/acclimation. In the present study, we aimed to identify the overall gene expression profile of chilling-stressed (+4 °C) potato at four time points (4, 8, 12, and 48 h), with a particular emphasis on the genes related with transcription factors (TFs), phytohormones, lipid metabolism, signaling pathway, and photosynthesis. A total of 3504 differentially expressed genes (DEGs) were identified at four time points of chilling-induced potato, of which 1397 were found to be up-regulated while 2107 were down-regulated. Heatmap showed that genes were mainly up-regulated at 4-, 8-, and 12-h time points; however, at 48-h time point, they inclined to down-regulate. Seventy five up-regulated TF genes were identified from 37 different families/groups, including mainly from bHLH, WRKY, CCAAT-binding, HAP3, and bZIP families. Protein kinases and calcium were major signaling molecules in cold-induced signaling pathway. A collaborated regulation of phytohormones was observed in chilling-stressed potato. Lipid metabolisms were regulated in a way, highly probably, to change membrane composition to avoid cold damage and render in signaling. A down-regulated gene expression profile was observed in photosynthesis pathway, probably resulting from chilling-induced reduced enzyme activity or light-triggered ROSs damage. The findings of this study will be a valuable theoretical knowledge in terms of understanding the chilling-induced tolerance mechanisms in cultivated potato plants as well as in other Solanum species.

Microarray analysis of gene expression alteration in human middle ear epithelial cells induced by micro particle.

PubMed

Song, Jae-Jun; Kwon, Jee Young; Park, Moo Kyun; Seo, Young Rok

2013-10-01

The primary aim of this study is to reveal the effect of particulate matter (PM) on the human middle ear epithelial cell (HMEEC). The HMEEC was treated with PM (300 μg/ml) for 24 h. Total RNA was extracted and used for microarray analysis. Molecular pathways among differentially expressed genes were further analyzed by using Pathway Studio 9.0 software. For selected genes, the changes in gene expression were confirmed by real-time PCR. A total of 611 genes were regulated by PM. Among them, 366 genes were up-regulated, whereas 245 genes were down-regulated. Up-regulated genes were mainly involved in cellular processes, including reactive oxygen species generation, cell proliferation, apoptosis, cell differentiation, inflammatory response and immune response. Down-regulated genes affected several cellular processes, including cell differentiation, cell cycle, proliferation, apoptosis and cell migration. A total of 21 genes were discovered as crucial components in potential signaling networks containing 2-fold up regulated genes. Four genes, VEGFA, IL1B, CSF2 and HMOX1 were revealed as key mediator genes among the up-regulated genes. A total of 25 genes were revealed as key modulators in the signaling pathway associated with 2-fold down regulated genes. Four genes, including IGF1R, TIMP1, IL6 and FN1, were identified as the main modulator genes. We identified the differentially expressed genes in PM-treated HMEEC, whose expression profile may provide a useful clue for the understanding of environmental pathophysiology of otitis media. Our work indicates that air pollution, like PM, plays an important role in the pathogenesis of otitis media. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

miR-140-5p regulates hypoxia-mediated human pulmonary artery smooth muscle cell proliferation, apoptosis and differentiation by targeting Dnmt1 and promoting SOD2 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanwei; Xu, Jing, E-mail: xujingdoc@163.com

miR-140-5p is down-regulated in patients with pulmonary arterial hypertension (PAH) and experimental models of PAH, and inhibits hypoxia-mediated pulmonary artery smooth muscle cell (PASMC) proliferation in vitro. Delivery of synthetic miR-140-5p prevents and treats established, experimental PAH. DNA methyltransferase 1 (Dnmt1) is up-regulated in PAH associated human PASMCs (HPASMCs), which promotes the development of PAH by hypermethylation of CpG islands within the promoter for superoxide dismutase 2 (SOD2) and down-regulating SOD2 expression. We searched for miR-140-5p targets using TargetScan, PicTar and MiRanda tools, and found that Dnmt1 is a potential target of miR-140-5p. Based on these findings, we speculated that miR-140-5pmore » might target Dnmt1 and regulate SOD2 expression to regulate hypoxia-mediated HPASMC proliferation, apoptosis and differentiation. We detected the expression of miR-140-5p, Dnmt1 and SOD2 by quantitative real-time polymerase chain reaction (qRT-PCR) and western blot assays, respectively, and found down-regulation of miR-140-5p and SOD2 and up-regulation of Dnmt1 exist in PAH tissues and hypoxia-mediated HPASMCs. Cell proliferation, apoptosis and differentiation detection showed that miR-140-5p inhibits proliferation and promotes apoptosis and differentiation of HPASMCs in hypoxia, while the effect of Dnmt1 on hypoxia-mediated HPASMCs is reversed. Luciferase assay confirmed that miR-140-5p targets Dnmt1 directly. An inverse correlation is also found between miR-140-5p and Dnmt1 in HPASMCs. In addition, we further investigated whether miR-140-5p and Dnmt1 regulate HPASMC proliferation, apoptosis and differentiation by regulating SOD2 expression, and the results confirmed our speculation. Taken together, these results indicated that miR-140-5p at least partly targets Dnmt1 and regulates SOD2 expression to inhibit proliferation and promote apoptosis and differentiation of HPASMCs in hypoxia. - Highlights: • miR-140-5p and SOD2 are down-regulated in PAH tissues and hypoxia-mediated HPASMCs. • Dnmt1 is up-regulated in PAH tissues and hypoxia-mediated HPASMCs. • miR-140-5p regulates HPASMC proliferation, apoptosis and differentiation. • Dnmt1 and SOD2 regulates HPASMC proliferation, apoptosis and differentiation. • miR-140-5p targets Dnmt1 and regulates SOD2 expression.« less