Sample records for expressing human epidermal

  1. Barrier function, epidermal differentiation, and human beta-defensin 2 expression in tinea corporis.


    Jensen, Jens-Michael; Pfeiffer, Stephan; Akaki, Tatsuya; Schröder, Jens-Michael; Kleine, Michael; Neumann, Claudia; Proksch, Ehrhardt; Brasch, Jochen


    Tinea corporis is a superficial mycotic infection resulting in substantial epidermal changes. We determined skin barrier function, epidermal differentiation, and human-beta-defensin 2 (hBD-2) protein expression in 10 patients with tinea corporis caused by Trichophyton rubrum (T. rubrum). We found disturbed skin barrier function as shown by a significant increase in transepidermal water loss (TEWL) and specific ultrastructural changes including disturbed formation of extracellular lipid bilayers, lamellar body extrusion, and deposit of clotted material at the stratum granulosum/stratum corneum interface. Epidermal proliferation in tinea increased several fold and accordingly, proliferation and inflammation-associated keratins K6, K16, and K17 were expressed. Expression of basal keratins K5 and K14 increased, whereas differentiation-associated K10 was reduced. Reduction of the cornified envelope proteins involucrin, loricrin, and the S100 protein filaggrin was also seen. Reduced filaggrin expression correlated with reduced skin hydration; protein breakdown products of filaggrin have been shown to be important for water binding. Surprisingly, we found pronounced epidermal protein expression of hBD-2, which may be related to disturbed epidermal differentiation and inflammation. hBD-2 showed a weak, although significant, antifungal activity against T. rubrum in the turbidimetric assay and the immunohistological staining was somewhat less pronounced in areas directly underneath fungal hyphae in the stratum corneum. Together, we describe profound changes in skin barrier structure and function, epidermal proliferation, and differentiation including pronounced protein expression of hBD-2 in tinea corporis.

  2. Expression and functional role of Sox9 in human epidermal keratinocytes.


    Shi, Ge; Sohn, Kyung-Cheol; Li, Zhengjun; Choi, Dae-Kyoung; Park, Young Min; Kim, Jin-Hwa; Fan, Yi-Ming; Nam, Yong Hee; Kim, Sooyeon; Im, Myung; Lee, Young; Seo, Young-Joon; Kim, Chang Deok; Lee, Jeung-Hoon


    In this study, we investigated the expression and putative role of Sox9 in epidermal keratinocyte. Immunohistochemical staining showed that Sox9 is predominantly expressed in the basal layer of normal human skin epidermis, and highly expressed in several skin diseases including psoriasis, basal cell carcinoma, keratoacanthoma and squamous cell carcinoma. In calcium-induced keratinocyte differentiation model, the expression of Sox9 was decreased in a time dependent manner. When Sox9 was overexpressed using a recombinant adenovirus, cell growth was enhanced, while the expression of differentiation-related genes such as loricrin and involucrin was markedly decreased. Similarly, when rat skin was intradermally injected with the adenovirus expressing Sox9, the epidermis was thickened with increase of PCNA positive cells, while the epidermal differentiation was decreased. Finally, UVB irradiation induced Sox9 expression in cultured human epidermal keratinocytes, and keratinocytes are protected from UVB-induced apoptosis by Sox9 overexpression. Together, these results suggest that Sox9 is an important regulator of epidermal keratinocytes with putative pro-proliferation and/or pro-survival functions, and may be related to several cutaneous diseases that are characterized by abnormal differentiation and hyperproliferation.

  3. Transgenic expression of human amphiregulin in mouse skin: inflammatory epidermal hyperplasia and enlarged sebaceous glands.


    Li, Yong; Stoll, Stefan W; Sekhon, Sahil; Talsma, Caroline; Camhi, Maya I; Jones, Jennifer L; Lambert, Sylviane; Marley, Hue; Rittié, Laure; Grachtchouk, Marina; Fritz, Yi; Ward, Nicole L; Elder, James T


    To explore the role of amphiregulin in inflammatory epidermal hyperplasia, we overexpressed human AREG (hAREG) in FVB/N mice using a bovine K5 promoter. A construct containing AREG coding sequences flanked by 5' and 3' untranslated region sequences (AREG-UTR) led to a >10-fold increase in hAREG expression compared to an otherwise-identical construct containing only the coding region (AREG-CDR). AREG-UTR mice developed tousled, greasy fur as well as elongated nails and thickened, erythematous tail skin. No such phenotype was evident in AREG-CDR mice. Histologically, AREG-UTR mice presented with marked epidermal hyperplasia of tail skin (2.1-fold increase in epidermal thickness with a 9.5-fold increase in Ki-67(+) cells) accompanied by significantly increased CD4+ T-cell infiltration. Dorsal skin of AREG-UTR mice manifested lesser but still significant increases in epidermal thickness and keratinocyte hyperplasia. AREG-UTR mice also developed marked and significant sebaceous gland enlargement, with corresponding increases in Ki-67(+) cells. To determine the response of AREG-UTR animals to a pro-inflammatory skin challenge, topical imiquimod (IMQ) or vehicle cream was applied to dorsal and tail skin. IMQ increased dorsal skin thickness similarly in both AREG-UTR and wild type mice (1.7- and 2.2-fold vs vehicle, P < 0.001 each), but had no such effect on tail skin. These results confirm that keratinocyte expression of hAREG elicits inflammatory epidermal hyperplasia, and are consistent with prior reports of tail epidermal hyperplasia and increased sebaceous gland size in mice expressing human epigen.

  4. Transgenic expression of human amphiregulin in mouse skin: inflammatory epidermal hyperplasia and enlarged sebaceous glands

    PubMed Central

    Li, Yong; Stoll, Stefan W.; Sekhon, Sahil; Talsma, Caroline; Camhi, Maya I.; Jones, Jennifer L.; Lambert, Sylviane; Marley, Hue; Rittié, Laure; Grachtchouk, Marina; Fritz, Yi; Ward, Nicole L.; Elder, James T.


    To explore the role of amphiregulin in inflammatory epidermal hyperplasia, we overexpressed human AREG (hAREG) in FVB/N mice using a bovine K5 promoter. A construct containing AREG coding sequences flanked by 5′ and 3′ untranslated region sequences (AREG-UTR) led to a >10-fold increase in hAREG expression compared to an otherwise-identical construct containing only the coding region (AREG-CDR). AREG-UTR mice developed tousled, greasy fur as well as elongated nails and thickened, erythematous tail skin. No such phenotype was evident in AREG-CDR mice. Histologically, AREG-UTR mice presented with marked epidermal hyperplasia of tail skin (2.1-fold increase in epidermal thickness with a 9.5-fold increase in Ki-67+ cells) accompanied by significantly increased CD4+ T-cell infiltration. Dorsal skin of AREG-UTR mice manifested lesser but still significant increases in epidermal thickness and keratinocyte hyperplasia. AREG-UTR mice also developed marked and significant sebaceous gland enlargement, with corresponding increases in Ki-67+ cells. To determine the response of AREG-UTR animals to a pro-inflammatory skin challenge, topical imiquimod (IMQ) or vehicle cream was applied to dorsal and tail skin. IMQ increased dorsal skin thickness similarly in both AREG-UTR and wild type mice (1.7- and 2.2-fold vs vehicle, P < 0.001 each), but had no such effect on tail skin. These results confirm that keratinocyte expression of hAREG elicits inflammatory epidermal hyperplasia, and are consistent with prior reports of tail epidermal hyperplasia and increased sebaceous gland size in mice expressing human epigen. PMID:26519132

  5. Human epidermal T cells predominantly belong to the lineage expressing alpha/beta T cell receptor

    PubMed Central


    The epidermis of clinically normal-appearing human skin harbors a phenotypically heterogeneous population of T lymphocytes (TCs), the majority of which are CD2+/CD3+/CD5+ "memory" cells, but in an unactivated state, and express the TCR-alpha/beta. In contrast to murine skin, only a very minor subpopulation of CD3+ cells in the human epidermis bears the TCR-gamma/delta. Epidermal TCs primarily are distributed along the rete ridges in the basal keratinocyte layer and are often in close apposition to Langerhans cells (LCs). These TCs were propagated from epidermal cell suspensions after stimulation with TC activating agents (Con A, rIL-1, rIL-2), then evaluated for phenotypic features and TCR diversity. Similar to the in situ situation, most were CD4-/CD8+/TCR-alpha/beta+. In addition, two cultures contained TCR- gamma/delta+ cells; one of these determined to be an adherent CD4-/CD8+ population. Epidermal TCs were significantly (p less than 0.0001) more abundant in the sole than in the other body regions examined (i.e., 40 vs. 7 CD3+ cells/linear centimeter of epidermis) and seemed to have a particular affinity for the acrosyringial epithelium of eccrine sweat ducts. Moreover, the sole usually contained a greater number of CD8+ relative to CD4+ TCs, whereas the epidermal CD4/CD8 ratio in the trunk and extremities was quite variable, although the trend also was towards a slightly larger percentage of CD8+ cells. Collectively, our data suggest that the volar epidermis has a unique microenvironment which is responsible for both the higher density of TCs, preferentially CD8+, and lower number of LCs. This study has not only provided evidence for significant regional variability in the human epidermal TC population of normal skin, but also strengthens the concept for skin-associated lymphoid tissues (SALT), whereby memory TCs recirculate back to the epidermis and interact with resident antigen-presenting cells (i.e., LC). PMID:2182763

  6. Cloning, Expression, and Cost Effective Purification of Authentic Human Epidermal Growth Factor With High Activity

    PubMed Central

    Pouranvari, Sara; Ebrahimi, Firouz; Javadi, Gholamreza; Maddah, Bozorgmehr


    Background: Epidermal growth factor (EGF) plays a fundamental role in the healing of wounds relating to skin damage, the cornea, and the gastrointestinal tract. Objectives: The aim of this study is the cloning, expression, and purification of recombinant human EGF (rhEGF), and an assessment of its activity. Materials and Methods: In the present experimental study, a synthetic pET28a (+) -hEGF construct was prepared. In order to ligate hEGF into pET24a (+), the PCR technique was performed, using special primers that possess restriction enzyme sites, which are also located in appropriate sites in pET24a (+). After transferring this construct into E. coli cells, protein expression was performed under standard conditions. Protein solubilization was done by urea. hEGF purification and refolding were carried out using gradient dialysis against the urea. We used RP-HPLC to compare between rhEGF and commercial rhEGF as a control. Finally, an MTT assay was performed to assess the viability of the NIH 3T3 cells treated with various concentrations of rhEGF. Results: Dialysis after urea solubilization caused precipitation of unwanted proteins, resulting in achievement of purified EGF with > 90% purity, without the need for expensive and time-consuming process. The MTT assay results showed that our rhEGF activate significantly higher proliferation of NIH 3T3 cells in comparison to the control (P-values were < 0.0001), in total concentrations and times evaluated Conclusions: Via our purification protocol, a sufficient amount of bioactive recombinant human epidermal growth factor was obtained in just a few affordable steps, with superlative purity. PMID:27247796

  7. Slug regulates integrin expression and cell proliferation in human epidermal keratinocytes.


    Turner, Frances E; Broad, Simon; Khanim, Farhat L; Jeanes, Alexa; Talma, Sonia; Hughes, Sharon; Tselepis, Chris; Hotchin, Neil A


    The human epidermis is a self-renewing epithelial tissue composed of several layers of keratinocytes. Within the epidermis there exists a complex array of cell adhesion structures, and many of the cellular events within the epidermis (differentiation, proliferation, and migration) require that these adhesion structures be remodeled. The link between cell adhesion, proliferation, and differentiation within the epidermis is well established, and in particular, there is strong evidence to link the process of terminal differentiation to integrin adhesion molecule expression and function. In this paper, we have analyzed the role of a transcriptional repressor called Slug in the regulation of adhesion molecule expression and function in epidermal keratinocytes. We report that activation of Slug, which is expressed predominantly in the basal layer of the epidermis, results in down-regulation of a number of cell adhesion molecules, including E-cadherin, and several integrins, including alpha3, beta1, and beta4. We demonstrate that Slug binds to the alpha3 promoter and that repression of alpha3 transcription by Slug is dependent on an E-box sequence within the promoter. This reduction in integrin expression is reflected in decreased cell adhesion to fibronectin and laminin-5. Despite the reduction in integrin expression and function, we do not observe any increase in differentiation. We do, however, find that activation of Slug results in a significant reduction in keratinocyte proliferation.

  8. Differential expression of epidermal growth factor-related proteins in human colorectal tumors.

    PubMed Central

    Ciardiello, F; Kim, N; Saeki, T; Dono, R; Persico, M G; Plowman, G D; Garrigues, J; Radke, S; Todaro, G J; Salomon, D S


    Amphiregulin (AR) and cripto are proteins that are structurally related to epidermal growth factor (EGF) and transforming growth factor alpha (TGF-alpha). AR is also functionally related to this family of growth regulatory molecules and is able to bind and activate the 170-kDa EGF receptor (EGFR). Human EGFR-3 (HER3)/ERBB3 is a recently identified protein related to the EGFR that is widely expressed in breast carcinomas and is a candidate receptor for EGF-like growth factors. Differential expression of these putative ligands and receptors in transformed cells suggests that they may function in an autocrine manner to regulate tumor cell growth. Specific mRNA transcripts for TGF-alpha [4.8 kilobases (kb)], AR (1.4 kb), cripto (2.2 kb), and HER3 (6.2 kb) were expressed in a majority of human colon cancer cell lines. HER3 mRNA was detected in 55% of primary or metastatic human colorectal carcinomas but in only 22% of normal colon mucosa and 32% of normal liver samples. In contrast, cripto and AR mRNA were expressed in 60-70% of primary or metastatic human colorectal cancers but in only 2-7% of normal human colonic mucosa. Immunostaining also detected AR protein in primary and metastatic colorectal tumors but not in normal colon or uninvolved liver. These findings suggest that cripto and AR may be useful markers to discriminate between normal and malignant colonic epithelium and may provide a selective growth advantage for colorectal carcinomas. Images PMID:1715580

  9. Expression and effects of epidermal growth factor on human periodontal ligament cells.


    Teramatsu, Yoko; Maeda, Hidefumi; Sugii, Hideki; Tomokiyo, Atsushi; Hamano, Sayuri; Wada, Naohisa; Yuda, Asuka; Yamamoto, Naohide; Koori, Katsuaki; Akamine, Akifumi


    Repair of damaged periodontal ligament (PDL) tissue is an essential challenge in tooth preservation. Various researchers have attempted to develop efficient therapies for healing and regenerating PDL tissue based on tissue engineering methods focused on targeting signaling molecules in PDL stem cells and other mesenchymal stem cells. In this context, we investigated the expression of epidermal growth factor (EGF) in normal and surgically wounded PDL tissues and its effect on chemotaxis and expression of osteoinductive and angiogenic factors in human PDL cells (HPDLCs). EGF as well as EGF receptor (EGFR) expression was observed in HPDLCs and entire PDL tissue. In a PDL tissue-injured model of rat, EGF and IL-1β were found to be upregulated in a perilesional pattern. Interleukin-1β induced EGF expression in HPDLCs but not EGFR. It also increased transforming growth factor-α (TGF-α) and heparin-binding EGF-like growth factor (HB-EGF) expression. Transwell assays demonstrated the chemotactic activity of EGF on HPDLCs. In addition, EGF treatment significantly induced secretion of bone morphogenetic protein 2 and vascular endothelial growth factor, and gene expression of interleukin-8 (IL-8), and early growth response-1 and -2 (EGR-1/2). Human umbilical vein endothelial cells developed well-formed tube networks when cultured with the supernatant of EGF-treated HPDLCs. These results indicated that EGF upregulated under inflammatory conditions plays roles in the repair of wounded PDL tissue, suggesting its function as a prospective agent to allow the healing and regeneration of this tissue.

  10. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli.


    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin; Li, Shan; Wang, Jufang


    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development.

  11. High Efficient Expression, Purification, and Functional Characterization of Native Human Epidermal Growth Factor in Escherichia coli

    PubMed Central

    Ma, Yi; Yu, Jieying; Lin, Jinglian; Wu, Shaomin


    Human epidermal growth factor (hEGF) is a small, mitotic growth polypeptide that promotes the proliferation of various cells and is widely applied in clinical practices. However, high efficient expression of native hEGF in Escherichia coli has not been successful, since three disulfide bonds in monomer hEGF made it unable to fold into correct 3D structure using in vivo system. To tackle this problem, we fused Mxe GyrA intein (Mxe) at the C-terminal of hEGF followed by small ubiquitin-related modifier (SUMO) and 10x His-tag to construct a chimeric protein hEGF-Mxe-SUMO-H10. The fusion protein was highly expressed at the concentration of 281 mg/L and up to 59.5% of the total cellular soluble proteins. The fusion protein was purified by affinity chromatography and 29.4 mg/L of native hEGF can be released by thiol induced N-terminal cleavage without any proteases. The mitotic activity in Balb/c 3T3 cells is proliferated by commercial and recombinant hEGF measured with methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay which indicated that recombinant hEGF protein stimulates the cell proliferation similar to commercial protein. This study significantly improved the yield and reduced the cost of hEGF in the recombinant E. coli system and could be a better strategy to produce native hEGF for pharmaceutical development. PMID:27766259

  12. Human epidermal growth factor receptor 2/neu protein expression in meningiomas: An immunohistochemical study

    PubMed Central

    Telugu, Ramesh Babu; Chowhan, Amit Kumar; Rukmangadha, Nandyala; Patnayak, Rashmi; Phaneendra, Bobbidi Venkata; Prasad, Bodapati Chandra Mowliswara; Reddy, Mandyam Kumaraswamy


    Background: Meningiomas are common slow-growing primary central nervous system tumors that arise from the meningothelial cells of the arachnoid and spinal cord. Human epidermal growth factor receptor 2 (HER2) or HER2/neu (also known as c-erbB2) is a 185-kD transmembrane glycoprotein with tyrosine kinase activity expressed in meningiomas and various other tumors. It can be used in targeted therapy for HER2/neu positive meningiomas. Aim: To correlate the expression of HER2/neu protein in meningiomas with gender, location, histological subtypes, and grade. Materials and Methods: It was 3½ years prospective (March 2010–October 2011) and retrospective (May 2008–February 2010) study of histopathologically diagnosed intracranial and intraspinal meningiomas. Clinical details of all the cases were noted from the computerized hospital information system. Immunohistochemistry for HER2/neu protein was performed along with scoring. Statistical analysis was done using Chi-square test to look for any association of HER2/neu with gender, location, grade, and various histological subtypes of meningiomas at 5% level of significance. Results: A total of 100 cases of meningiomas were found during the study period. Of which, 80 were Grade I, 18 were Grade II, and 2 were Grade III meningiomas as per the World Health Organization 2007 criteria. The female-male ratio was 1.9:1 and the mean age was 47.8 years. HER2/neu protein was expressed in 75% of Grade I and 72.2% of Grade II and none of Grade III meningiomas. About 72.7% brain invasive meningiomas showed HER2/neu immunopositivity. Conclusion: HER2/neu protein was expressed in 73% of meningiomas. Statistically significant difference of HER2/neu expression was not seen between females and males of Grade I and Grade II/III meningiomas, intracranial and spinal tumors, Grade I and Grade II/III cases, and various histological subtypes of meningiomas. PMID:27695231

  13. Expression of T-Lymphocyte Markers in Human Epidermal Growth Factor Receptor 2-Positive Breast Cancer

    PubMed Central

    Lee, Changro; Kim, Joo Heung; Lim, Sung Mook; Park, Hyung Seok; Kim, Seung Il; Park, Byeong-Woo


    Purpose The present study aimed to examine the clinical implications of CD4, CD8, and FOXP3 expression on the prognosis of human epidermal growth factor receptor 2 (HER2)-positive breast cancer using a web-based database, and to compare the immunohistochemical expression of T-lymphocyte markers using primary and metastatic HER2-positive tumor tissues before and after HER2-targeted therapy. Methods Using the cBioPortal for Cancer Genomics and Kaplan-Meier plotter, the mRNA expression, association between T-lymphocyte markers, and survival in HER2-positive cancers were investigated according to various cutoff levels. Immunohistochemistry analysis was performed using paired primary and metastatic tissues of 29 HER2-positive tumors treated with systemic chemotherapy and HER2-directed therapy. Results HER2 mRNA was mutually exclusive of T-lymphocyte markers, and a significant correlation between T-cell markers was observed in the cBioPortal for Cancer Genomics. According to analysis of the Kaplan-Meier plotter, the impact of T-lymphocyte marker expression on survival was statistically insignificant in clinical HER2-positive tumors, irrespective of the cutoff levels. However, in the intrinsic HER2-positive subtype, the individual analyses of T-cell markers except for FOXP3 and combined analysis showed significantly favorable survival irrespective of cutoff points. Although the small clinical sample size made it difficult to show the statistical relevance of immunohistochemistry findings, good responses to neoadjuvant treatments might be associated with positive expression of combined T-lymphocyte markers, and approximately half of the samples showed discordance of combined markers between baseline and resistant tumors. Conclusion T-lymphocyte markers could be favorable prognostic factors in HER2-positive breast cancers; however, a consensus on patient section criteria, detection methods, and cutoff value could not be reached. The resistance to HER2-directed therapy might

  14. Expression of an Exogenous Growth Hormone Gene by Transplantable Human Epidermal Cells

    NASA Astrophysics Data System (ADS)

    Morgan, Jeffrey R.; Barrandon, Yann; Green, Howard; Mulligan, Richard C.


    Retrovirus-mediated gene transfer was used to introduce a recombinant human growth hormone gene into cultured human keratinocytes. The transduced keratinocytes secreted biologically active growth hormone into the culture medium. When grafted as an epithelial sheet onto athymic mice, these cultured keratinocytes reconstituted an epidermis that was similar in appearance to that resulting from normal cells, but from which human growth hormone could be extracted. Transduced epidermal cells may prove to be a general vehicle for the delivery of gene products by means of grafting.

  15. Expression of human group II PLA2 in transgenic mice results in epidermal hyperplasia in the absence of inflammatory infiltrate.

    PubMed Central

    Grass, D S; Felkner, R H; Chiang, M Y; Wallace, R E; Nevalainen, T J; Bennett, C F; Swanson, M E


    Group II PLA2 has been implicated in inflammatory processes in both man and other animals and has been shown to be involved in inflammatory conditions, such as arthritis and sepsis. Transgenic mice expressing the human group II PLA2 gene have been generated using a 6.2-kb genomic fragment. These mice express the group II PLA2 gene abundantly in liver, lung, kidney, and skin, and have serum PLA2 activity levels approximately eightfold higher than nontransgenic littermates. The group II PLA2 transgenic mice reported here exhibit epidermal and adnexal hyperplasia, hyperkeratosis, and almost total alopecia. The chronic epidermal hyperplasia and hyperkeratosis seen in these mice is similar to that seen in a variety of dermatopathies, including psoriasis. However, unlike what is seen with these dermatopathies, no significant inflammatory-cell influx was observed in the skin of these animals, or in any other tissue examined. These mice provide an important tool for examining group II PLA2 expression, and for determining the role of group II PLA2 in normal and disease physiology. They serve as an in vivo model for identifying inhibitors of group II PLA2 activity and gene expression. PMID:8636402

  16. Gene expression profiling of mouse p53-deficient epidermal carcinoma defines molecular determinants of human cancer malignancy

    PubMed Central


    Background The epidermal specific ablation of Trp53 gene leads to the spontaneous development of aggressive tumors in mice through a process that is accelerated by the simultaneous ablation of Rb gene. Since alterations of p53-dependent pathway are common hallmarks of aggressive, poor prognostic human cancers, these mouse models can recapitulate the molecular features of some of these human malignancies. Results To evaluate this possibility, gene expression microarray analysis was performed in mouse samples. The mouse tumors display increased expression of cell cycle and chromosomal instability associated genes. Remarkably, they are also enriched in human embryonic stem cell gene signatures, a characteristic feature of human aggressive tumors. Using cross-species comparison and meta-analytical approaches, we also observed that spontaneous mouse tumors display robust similarities with gene expression profiles of human tumors bearing mutated TP53, or displaying poor prognostic outcome, from multiple body tissues. We have obtained a 20-gene signature whose genes are overexpressed in mouse tumors and can identify human tumors with poor outcome from breast cancer, astrocytoma and multiple myeloma. This signature was consistently overexpressed in additional mouse tumors using microarray analysis. Two of the genes of this signature, AURKA and UBE2C, were validated in human breast and cervical cancer as potential biomarkers of malignancy. Conclusions Our analyses demonstrate that these mouse models are promising preclinical tools aimed to search for malignancy biomarkers and to test targeted therapies of prospective use in human aggressive tumors and/or with p53 mutation or inactivation. PMID:20630075

  17. Enhanced expression of epidermal growth factor receptor correlates with alterations of chromosome 7 in human pancreatic cancer.

    PubMed Central

    Korc, M; Meltzer, P; Trent, J


    Recently, the gene for the epidermal growth factor (EGF) receptor has been mapped to chromosome 7p, the short arm of chromosome 7 [Shimizu, N., Kondo, I., Gamou, M. A., Behzadian, A. & Shimizu, Y. (1984) Somatic Cell Mol. Genet. 10, 45-53]. Utilizing EGF binding in saturation studies, karyology, and cDNA hybridization experiments, we have sought to determine whether there is a correlation between dosage or alteration of chromosome 7 and enhanced expression of EGF receptor in cultured human pancreatic carcinoma cells. Saturation binding studies with 125I-labeled EGF were performed at 4 degrees C with four established human pancreatic cancer cell lines: T3M4, PANC-1, COLO 357, and UACC-462. Analysis of binding data revealed enhanced numbers of EGF receptors in all four cell lines. Chromosome banding analysis revealed clonal structural alterations of chromosome 7p in the cell lines T3M4, PANC-1, and COLO 357, whereas UACC-462 displayed multiple copies of chromosome 7. Hybridization studies using a radiolabeled EGF receptor cDNA probe failed to demonstrate DNA sequence amplification in any cell line but confirmed the presence of EGF receptor mRNA in these cells in approximate proportion to EGF receptor number. Our results suggest that enhanced expression of EGF receptor in human pancreatic cancer can be associated with either structural or numerical alterations of chromosome 7. Images PMID:3014534

  18. Epidermal growth factor receptor-dependent stimulation of amphiregulin expression in androgen-stimulated human prostate cancer cells.

    PubMed Central

    Sehgal, I; Bailey, J; Hitzemann, K; Pittelkow, M R; Maihle, N J


    Amphiregulin is a heparin-binding epidermal growth factor (EGF)-related peptide that binds to the EGF receptor (EGF-R) with high affinity. In this study, we report a role for amphiregulin in androgen-stimulated regulation of prostate cancer cell growth. Androgen is known to enhance EGF-R expression in the androgen-sensitive LNCaP human prostate carcinoma cell line, and it has been suggested that androgenic stimuli may regulate proliferation, in part, through autocrine mechanisms involving the EGF-R. In this study, we demonstrate that LNCaP cells express amphiregulin mRNA and peptide and that this expression is elevated by androgenic stimulation. We also show that ligand-dependent EGF-R stimulation induces amphiregulin expression and that androgenic effects on amphiregulin synthesis are mediated through this EGF-R pathway. Parallel studies using the estrogen-responsive breast carcinoma cell line, MCF-7, suggest that regulation of amphiregulin by estrogen may also be mediated via an EGF-R pathway. In addition, heparin treatment of LNCaP cells inhibits androgen-stimulated cell growth further suggesting that amphiregulin can mediate androgen-stimulated LNCaP proliferation. Together, these results implicate an androgen-regulated autocrine loop composed of amphiregulin and its receptor in prostate cancer cell growth and suggest that the mechanism of steroid hormone regulation of amphiregulin synthesis may occur through androgen upregulation of the EGF-R and subsequent receptor-dependent pathways. Images PMID:8049525

  19. NEU1 sialidase expressed in human airway epithelia regulates epidermal growth factor receptor (EGFR) and MUC1 protein signaling.


    Lillehoj, Erik P; Hyun, Sang Won; Feng, Chiguang; Zhang, Lei; Liu, Anguo; Guang, Wei; Nguyen, Chinh; Luzina, Irina G; Atamas, Sergei P; Passaniti, Antonino; Twaddell, William S; Puché, Adam C; Wang, Lai-Xi; Cross, Alan S; Goldblum, Simeon E


    Epithelial cells (ECs) lining the airways provide a protective barrier between the external environment and the internal host milieu. These same airway epithelia express receptors that respond to danger signals and initiate repair programs. Because the sialylation state of a receptor can influence its function and is dictated in part by sialidase activity, we asked whether airway epithelia express catalytically active sialidase(s). Human primary small airway and A549 ECs expressed NEU1 sialidase at the mRNA and protein levels, and NEU1 accounted for >70% of EC sialidase activity. Blotting with Maackia amurensis and peanut agglutinin lectins established epidermal growth factor receptor (EGFR) and MUC1 as in vivo substrates for NEU1. NEU1 associated with EGFR and MUC1, and NEU1-EGFR association was regulated by EGF stimulation. NEU1 overexpression diminished EGF-stimulated EGFR Tyr-1068 autophosphorylation by up to 44% but enhanced MUC1-dependent Pseudomonas aeruginosa adhesion by 1.6-1.7-fold and flagellin-stimulated ERK1/2 activation by 1.7-1.9-fold. In contrast, NEU1 depletion increased EGFR activation (1.5-fold) and diminished MUC1-mediated bacterial adhesion (38-56%) and signaling (73%). These data indicate for the first time that human airway epithelia express catalytically active NEU1 sialidase that regulates EGFR- and MUC1-dependent signaling and bacterial adhesion. NEU1 catalytic activity may offer an additional level of regulation over the airway epithelial response to ligands, pathogens, and injurious stimuli.

  20. Design, expression and evaluation of a novel humanized single chain antibody against epidermal growth factor receptor (EGFR).


    Akbari, Bahman; Farajnia, Safar; Zarghami, Nosratollah; Mahdieh, Nejat; Rahmati, Mohammad; Khosroshahi, Shiva Ahdi; Rahbarnia, Leila


    Various strategies have been attempted for targeting of epidermal growth factor receptor (EGFR), as an essential biomarker in a variety of cancers. Several anti-EGFR antibodies including cetuximab are used in clinics for treatment of EGFR-overexpressing colorectal and head and neck cancers but the efficiency of these antibodies is threatened by their large size and chimeric nature. Humanized single chains antibodies (huscFv) are smaller generation of antibodies with lower immunogenicity may overcome these limitations. This article reports production and evaluation of a novel humanized anti-EGFR scFv. The CDRs of cetuximab heavy and light chains were grafted onto human antibody frameworks as framework donors. To maintain the antigen binding affinity of murine antibody, the murine vernier zone residues were retained in framework regions of huscFv. Additionally, two point mutations in CDR-L1 and CDR-L3 and three point mutations in CDR-H2 and CDR-H3 loops of the humanized scFv (huscFv) were introduced to increase affinity of the huscFv to EGFR. Analysis of results demonstrated that the humanness degree of resultant huscFv was increased as 19%. HuscFv was expressed in BL21 (DE3) and affinity purified via Ni-NTA column. The reactivity of huscFv with EGFR was evaluated by ELISA and dot blot techniques. Analysis by ELISA and dot blot showed that the huscFv was able to recognize and react with EGFR. Toxicity analysis by MTT assay indicated an inhibitory effect on growth of EGFR-overexpressing A431 cells. In conclusion, the huscFv produced in this study revealed decreased immunogenicity while retained growth inhibitory effect on EGFR-overexpressing tumor cells.

  1. Expression of HLA-DR (Ia like) antigen on epidermal keratinocytes in human dermatoses.

    PubMed Central

    Lampert, I A


    Ia antigen (HLA-DR in man) has been demonstrated in keratinocytes in graft versus host disease. This study investigates the occurrence of HLA-DR in keratinocytes in the following dermatoses: eczematous dermatitis, discoid lupus erythematosus, with immunoglobulin and non-exposed skin from cases of systemic lupus erythematosus with immunoglobulin deposits, lichen planus, lichen simplex, bullous pemphigoid, pemphigus vulgaris, 'toxic erthema', tuberculid and chillblain. Keratinocyte staining was found in a variety of conditions. The unifying features of the instances of its occurrence was lymphoid infiltration and usually some focal evidence of keratinocyte damage. Thus in eczema the staining was mid-epidermal, while in discoid lupus erythematosus and lichen planus it was basal. HLA-DR staining was absent in bullous pemphigoid and pemphigus vulgaris, which is consistent with the hypothesis that in these conditions the damage is mediated by autoantibodies and complement in the absence of cellular immune attack. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:6204802

  2. Gene Expression of Normal Human Epidermal Keratinocytes Modulated by Trivalent Arsenicals

    EPA Science Inventory

    Chronic exposure to inorganic arsenic (iAs) is associated with the development of benign and malignant human skin lesions including nonmelanoma skin cancers. The precise arsenical form(s) responsible for this carcinogenic effect are unknown, although trivalent inorganic arsenic (...

  3. A-62176, a potent topoisomerase inhibitor, inhibits the expression of human epidermal growth factor receptor 2.


    Kim, Hye-Lin; Jeon, Kyung-Hwa; Jun, Kyu-Yeon; Choi, Yongmun; Kim, Dae-Kee; Na, Younghwa; Kwon, Youngjoo


    HER2 overexpression is observed in ∼6-35% of all gastric cancers, while co-amplification of topoisomerase IIα occurs in ∼32-90% of all cancers with HER2 amplification. The present study reports that HER2 expression is down-regulated by A-62176, a fluoroquinophenoxazine derivative that we previously demonstrated to inhibit topoisomerase I and IIα. The results suggest that A-62176 inhibits the interaction between the ESX, an ets transcription factor, and its co-activator Sur2, leading to the attenuation of HER2-mediated phosphorylation of MAPK/Akt. A-62176 arrests the cell cycle in the G1 phase via the down-regulation of cyclin D1 and the up-regulation of p27(Kip1) in NCI-N87 gastric cancer cells. The combination of A-62176 with doxorubicin provides a strong synergistic activity. We propose that A-62176 is a dual inhibitor that impairs the expression of HER2 and restrains the activity of topoisomerase IIα. Our results may lead to the rational design of anticancer molecules targeting a subgroup of gastric cancer cells overexpressing both HER2 and topoisomerase IIα.

  4. Feline epidermal nevi resembling human inflammatory linear verrucous epidermal nevus.


    Sato, Masafumi; Kariya, Kazuhiro; Matsumoto, Munetaka; Itoh, Miyuki; Kobayashi, Yoshiyasu; Nishifuji, Koji; Kamiie, Junichi; Shirota, Kinji


    Multiple, pigmented, verrucous, cutaneous lesions in a 2-year-old female cat were pathologically examined. The lesions were linearly arranged on the right side of the body, and had developed along with moderate pruritus since infancy. Histologically, prominent exophytic, papillomatous outgrowths of the epidermis and acanthosis with intense ortho and parakeratotic hyperkeratosis were characteristic of the lesions. Dermal inflammation with mononuclear cells, neutrophils, and eosinophils was also noted. Inclusion bodies, cellular degeneration, and intranuclear viral particles suggesting papillomavirus infection in the keratinocytes were not observed. Papillomavirus antigen and DNA were not detected in the lesions by immunohistochemistry and polymerase chain reaction, respectively. In accordance with these clinical and histopathological features, the cutaneous lesions of the present cat were diagnosed as epidermal nevi, which were consistent with human inflammatory linear verrucous epidermal nevi.

  5. Expression, purification, and characterization of recombinant human and murine milk fat globule-epidermal growth factor-factor 8.


    Castellanos, Erick R; Ciferri, Claudio; Phung, Wilson; Sandoval, Wendy; Matsumoto, Marissa L


    Milk fat globule-epidermal growth factor-factor 8 (MFG-E8), as its name suggests, is a major glycoprotein component of milk fat globules secreted by the mammary epithelium. Although its role in milk fat production is unclear, MFG-E8 has been shown to act as a bridge linking apoptotic cells to phagocytes for removal of these dying cells. MFG-E8 is capable of bridging these two very different cell types via interactions through both its epidermal growth factor (EGF)-like domain(s) and its lectin-type C domains. The EGF-like domain interacts with αVβ3 and αVβ5 integrins on the surface of phagocytes, whereas the C domains bind phosphatidylserine found on the surface of apoptotic cells. In an attempt to purify full-length, recombinant MFG-E8 expressed in either insect cells or CHO cells, we find that it is highly aggregated. Systematic truncation of the domain architecture of MFG-E8 indicates that the C domains are mainly responsible for the aggregation propensity. Addition of Triton X-100 to the conditioned cell culture media allowed partial recovery of non-aggregated, full-length MFG-E8. A more comprehensive detergent screen identified CHAPS as a stabilizer of MFG-E8 and allowed purification of a significant portion of non-aggregated, full-length protein. The CHAPS-stabilized recombinant MFG-E8 retained its natural ability to bind both αVβ3 and αVβ5 integrins and phosphatidylserine suggesting that it is properly folded and active. Herein we describe an efficient purification method for production of non-aggregated, full-length MFG-E8.

  6. [Effect of cetirizine hydrochloride on the expression of substance P receptor and cytokines production in human epidermal keratinocytes and dermal fibroblasts].


    Liu, Ji-Yong; Zhao, Yong-Zhe; Peng, Cheng; Li, Feng-Qian; Zhu, Quan-Gang; Hu, Jin-Hong


    To investigate the effect of cetirizine hydrochloride on the expression of neurokinin 1 receptor (NK-1R) and cytokines production induced by substance P (SP) in HaCaT cells (a human epidermal keratinocyte cell line) and dermal fibroblasts. The effect of cetirizine on the expression of NK-1R protein was detected by flow cytometry and Western blotting analysis. The modulation of cetirizine on the production of interferon (IFN)-gamma, interleukin (IL)-1beta, IL-6 and IL-8 in HaCaT cells and fibroblasts was measured by ELISA. The results showed that cetirizine significantly inhibited the expression of NK-1R in HaCaT cells and fibroblasts. SP induced the production of IFN-gamma, IL-1beta and IL-8 in both cell types. Cetirizine 1-100 micromol x L(-1) inhibited SP-induced IL-1beta and IL-8 production in HaCaT cells and fibroblasts, while had no effect on the production of IFN-gamma in both cells. Both SP and cetirizine had no effect on the secretion of IL-6 in HaCaT cells and fibroblasts. These findings suggest that cetirizine may be involved in the treatment of SP-induced skin inflammation by inhibiting the expression of substance P receptor and regulation the production of IL-1beta and IL-8 in epidermal keratinocyte and dermal fibroblasts.

  7. Aberrant Cytokeratin Expression During Arsenic-induced Acquired Malignant Phenotype in Human HaCaT Keratinocytes Consistent with Epidermal Carcinogenesis

    PubMed Central

    Sun, Yang; Pi, Jingbo; Wang, Xueqian; Tokar, Erik J.; Liu, Jie; Waalkes, Michael P.


    Inorganic arsenic is a known human skin carcinogen. Chronic arsenic exposure results in various human skin lesions, including hyperkeratosis and squamous cell carcinoma (SCC), both characterized by distorted cytokeratin (CK) production. Prior work shows the human skin keratinocyte HaCaT cell line, when exposed chronically for >25 weeks to a low level of inorganic arsenite (100 nM) results in cells able to produce aggressive SCC upon inoculation into nude mice. In the present study, CK expression analysis was performed in arsenic-exposed HaCaT cells during the progressive acquisition of this malignant phenotype (0 to 20 weeks) to further validate this model as relevant to epidermal carcinogenesis induced by arsenic in humans. Indeed, we observed clear evidence of acquired cancer phenotype by 20 weeks of arsenite exposure including the formation of giant cells, a >4-fold increase in colony formation in soft agar and a ∼2.5-fold increase in matrix metalloproteinase-9 secretion, an enzyme often secreted by cancer cells to help invade through the local extra-cellular matrix. During this acquired malignant phenotype, various CK genes showed markedly altered expression at the transcript and protein levels in a time-dependent manner. For example, CK1, a marker of hyperkeratosis, increased up to 34-fold during arsenic-induced transformation, while CK13, a marker for dermal cancer progression, increased up to 45-fold. The stem cell marker, CK15, increased up to 7-fold, particularly during the later stages of arsenic exposure, indicating a potential emergence of cancer stem-like cells with arsenic-induced acquired malignant phenotype. The expression of involucrin and loricrin, markers for keratinocyte differentiation, increased up to 9-fold. Thus, during arsenic-induced acquired cancer phenotype in human keratinocytes, dramatic and dynamic alterations in CK expression occur which are consistent with the process of epidermal carcinogenesis helping validate this as an

  8. Aberrant cytokeratin expression during arsenic-induced acquired malignant phenotype in human HaCaT keratinocytes consistent with epidermal carcinogenesis.


    Sun, Yang; Pi, Jingbo; Wang, Xueqian; Tokar, Erik J; Liu, Jie; Waalkes, Michael P


    Inorganic arsenic is a known human skin carcinogen. Chronic arsenic exposure results in various human skin lesions, including hyperkeratosis and squamous cell carcinoma (SCC), both characterized by distorted cytokeratin (CK) production. Prior work shows the human skin keratinocyte HaCaT cell line, when exposed chronically for >25 weeks to a low level of inorganic arsenite (100nM) results in cells able to produce aggressive SCC upon inoculation into nude mice. In the present study, CK expression analysis was performed in arsenic-exposed HaCaT cells during the progressive acquisition of this malignant phenotype (0-20 weeks) to further validate this model as relevant to epidermal carcinogenesis induced by arsenic in humans. Indeed, we observed clear evidence of acquired cancer phenotype by 20 weeks of arsenite exposure including the formation of giant cells, a >4-fold increase in colony formation in soft agar and a approximately 2.5-fold increase in matrix metalloproteinase-9 secretion, an enzyme often secreted by cancer cells to help invade through the local extra-cellular matrix. During this acquired malignant phenotype, various CK genes showed markedly altered expression at the transcript and protein levels in a time-dependent manner. For example, CK1, a marker of hyperkeratosis, increased up to 34-fold during arsenic-induced transformation, while CK13, a marker for dermal cancer progression, increased up to 45-fold. The stem cell marker, CK15, increased up to 7-fold, particularly during the later stages of arsenic exposure, indicating a potential emergence of cancer stem-like cells with arsenic-induced acquired malignant phenotype. The expression of involucrin and loricrin, markers for keratinocyte differentiation, increased up to 9-fold. Thus, during arsenic-induced acquired cancer phenotype in human keratinocytes, dramatic and dynamic alterations in CK expression occur which are consistent with the process of epidermal carcinogenesis helping validate this as an

  9. Epidemiologic Study of Human Epidermal Growth Factor Receptor 2 Expression in Advanced/Metastatic Gastric Cancer: an Assessment of Human Epidermal Growth Factor Receptor 2 Status in Tumor Tissue Samples of Gastric and Gastro-Esophageal Junction Cancer

    PubMed Central

    Seo, Kyung Won; Jeon, Taeyong; Kim, Sewon; Kim, Sung Soo; Kim, Kwanghee; Suh, Byoung-Jo; Hwang, Sunhwi; Choi, SeongHee; Ryu, Seungwan; Min, Jae Seok; Lee, Young-Joon; Jee, Ye Seob; Chae, Hyeondong


    Purpose The Trastuzumab for gastric cancer (GC) trial identified human epidermal growth factor receptor 2 (HER2) as a predictor of successful treatment with trastuzumab (HER2 receptor targeting agent) among patients with advanced/metastatic GC. To date, the prevalence of HER2 overexpression in the Korean population is unknown. The present study aimed to assess the incidence of HER2 positivity among GC and gastroesophageal (GE) junction cancer samples and the relationship between HER2 overexpression and clinicopathological characteristics in Korean patients. Materials and Methods Tumor samples collected from 1,695 patients with histologically proven GC or GE junction enrolled at 14 different hospitals in Korea were examined. After gathering clinicopathological data of all patients, HER2 status was assessed by immunohistochemistry (IHC) at each hospital, and IHC 2+ cases were subjected to silver-enhanced in situ hybridization at 3 central laboratories. Results A total of 182 specimens tested positive for HER2, whereas 1,505 tested negative. Therefore, the overall HER2-positive rate in this study was 10.8% (95% confidence interval=9.3%–12.3%). The HER2-positive rate was higher among intestinal-type cases (17.6%) than among other types, and was higher among patients older than 70 years and 50 years of age, compared to other age groups. Conclusions Our evaluation of the HER2 positivity rate (10.8%) among Korean patients with GC and GE junction indicated the necessity of epidemiological data when conducting studies related to HER2 expression in GC and GE junction. PMID:28337363

  10. Human epidermal plasminogen activator. Characterization, localization, and modulation.


    Morioka, S; Jensen, P J; Lazarus, G S


    Using biochemical and immunocytochemical approaches, we have investigated the plasminogen activator (PA) of primary human epidermal cell cultures. A rabbit antibody raised against human urinary PA (urokinase) inhibited greater than or equal to 96% of the PA activity in the keratinocyte cultures. Immunoblot and double immunodiffusion analyses of keratinocyte PA with anti-urokinase antibody confirmed that epidermal PA was of the urokinase type. Immunocytochemical investigation of human keratinocyte cultures with anti-urokinase antibody revealed two characteristic staining patterns for PA. First, cells at the advancing edge of subconfluent colonies were cytoplasmically stained in a granular pattern. Similar staining was observed at the migrating edges of confluent epidermal cell cultures that had been wounded by cutting with a blade. This induction of PA staining was independent of cell division. Secondly, differentiated epidermal cells located on the surface of colonies were stained either at the plasma membrane or homogeneously throughout the cell. The highly differentiated, spontaneously shed cells were usually very heavily stained by anti-urokinase antibody. These immunocytochemical experiments suggest that PA expression is highly regulated in human epidermal cells. Specifically, PA expression appears to be related to cellular differentiation and to cell movement in expanding or wounded keratinocyte colonies.

  11. Sodium arsenite-induced stress-related gene expression in normal human epidermal, HaCaT, and HEL30 keratinocytes.

    PubMed Central

    Trouba, Kevin J; Geisenhoffer, Kristen M; Germolec, Dori R


    Arsenic is a carcinogen that poses a significant health risk in humans. Based on evidence that arsenic has differential effects on human, rodent, normal, and transformed cells, these studies addressed the relative merits of using normal human epidermal keratinocytes (NHEK) and immortalized human (HaCaT) and mouse (HEL30) keratinocytes when examining stress-induced gene expression that may contribute to carcinogenesis. We hypothesize that redox-related gene expression is differentially modulated by arsenic in normal versus immortalized keratinocytes. To test the hypothesis, we exposed keratinocytes to sodium arsenite for 4 or 24 hr, at which time serine threonine kinase-25 (stk25) and nicotine adenine dinucleotide phosphate [nad(p)h] quinone oxidoreductase gene expression were measured. The effect of glutathione reduction on arsenite-induced cytotoxicity and gene expression in NHEK also was evaluated by addition of l-buthionine-[S,R]-sulfoximine (BSO) to culture media. Results indicate the term LC(50) for arsenite is approximately 10-15 microM in NHEK and HEL30 keratinocytes and 30 microM in HaCaT keratinocytes. Compared with HaCaT and HEL30 keratinocytes, a nontoxic concentration of arsenite (2.5 microM) increases stk25 and nad(p)h quinone oxidoreductase gene expression in NHEK, an effect partially attenuated by BSO. These data indicate that NHEK and HaCaT/HEL30 keratinocytes have similar sensitivities toward arsenite-induced cytotoxicity but unique gene expression responses. They also suggest that arsenite modulates gene expression in NHEK involved in cellular signaling and other aspects of intermediary metabolism that may contribute to the carcinogenic process. PMID:12426128

  12. VERO stable cell lines expressing full-length human epidermal growth factor receptors 2 and 3: platforms for subtractive phage display.


    Hedayatizadeh-Omran, Akbar; Valadan, Reza; Rafiei, Alireza; Tehrani, Mohsen; Alizadeh-Navaei, Reza


    Cross-talk between human epidermal growth factor receptor 2 and 3 (HER2 and HER3) may potentially contribute to therapeutic resistance in human breast cancer. Subtractive phage display allows highly specific selection for antibody fragments directed against cells surface HER2 and HER3. The strategies to select conformation- and activation-specific antibodies against HER2 and HER3 require tightly regulated HER2 and HER3 expressing cells that allow controlled activation/inactivation of these receptors during panning procedures. To achieve this, first, we found that the VERO cell line is an appropriate cell line for heterogeneous expression of HER2 and HER3, and then we established a panel of VERO stable cell lines expressing high levels of HER2 and HER3 alone and in combination. We also showed that HER2 and HER3 expressed in VERO cells were biologically active and could form heterodimer following neuregulin1 treatment. The cell line established here not only provided platforms for phage display-based methods but also could be used in any HER-related studies.

  13. Temporal variations in sirtuin expression under normal and ultraviolet B-induced conditions and their correlation to energy levels in normal human epidermal keratinocytes.


    Pelle, Edward; Dong, Kelly; Pernodet, Nadine


    Sirtuins are post-translational modifiers that affect transcriptional signaling, metabolism, and DNA repair. Although originally identified as gene silencers capable of extending cell lifespan, the involvement of sirtuins in many different areas of cell biology has now become widespread. Our approach has been to study the temporal variation and also the effect of environmental stressors, such as ultraviolet B (UVB) and ozone, on sirtuin expression in human epidermal keratinocytes. In this report, we measured the variation in expression of several sirtuins over time and also show how a low dose of UVB can affect this pattern of expression. Moreover, we correlated these changes to variations in hydrogen peroxide (H2O2) and ATP levels. Our data show significant variations in normal sirtuin expression, which may indicate a generalized response by sirtuins to cell cycle kinetics. These results also demonstrate that sirtuins as a family of molecules are sensitive to UVB-induced disruption and may suggest a new paradigm for determining environmental stress on aging and provide direction for the development of new cosmetic products.

  14. Hypoxia-inducible factor 1 alpha mediates epidermal growth factor-induced down-regulation of E-cadherin expression and cell invasion in human ovarian cancer cells.


    Cheng, Jung-Chien; Klausen, Christian; Leung, Peter C K


    Hypoxia-inducible factor 1α (HIF-1α) regulates the transcription of a number of genes under hypoxia and other extracellular stimulations. It has been shown that E-cadherin is down-regulated by epidermal growth factor receptor (EGF) stimulation, and that cells with low E-cadherin expression are more invasive. Our recent study demonstrated a novel mechanism by which EGF down-regulates E-cadherin expression through production of hydrogen peroxide (H(2)O(2)) and the activation of p38 MAPK in human ovarian cancer cells. In this study, we were interested in examining the potential role of HIF-1α in cell invasion under normoxic conditions, specifically when cells are treated with EGF, which is known to down-regulate E-cadherin and increase invasiveness. We show that EGF treatment induces HIF-1α expression in two human ovarian cancer cell lines (SKOV3 and OVCAR5), and that this effect is diminished by treatment with a membrane-permeable H(2)O(2) scavenger, PEG-catalase. However, the induction of HIF-1α by EGF did not require the activation of p38 MAPK. Treatment with siRNA targeting HIF-1α reduces both basal and EGF-induced HIF-1α levels. Importantly, treatment with HIF-1α siRNA diminishes the up-regulation of Snail and Slug as well as the down-regulation of E-cadherin by EGF. The involvement of HIF-1α in the down-regulation of E-cadherin was confirmed with cobalt chloride (CoCl(2)), a hypoxia-mimetic reagent. Finally, we also show that EGF-induced cell invasion is attenuated by treatment with HIF-1α siRNA. This study demonstrates an important role for HIF-1α in mediating the effects of EGF on Snail, Slug and E-cadherin expression as well as invasiveness in human ovarian cancer cells.

  15. Human epidermal Langerhans cells differ from monocyte-derived Langerhans cells in CD80 expression and in secretion of IL-12 after CD40 cross-linking.


    Peiser, Matthias; Wanner, Reinhard; Kolde, Gerhard


    Langerhans cells (LCs) represent an immature population of myeloid dendritic cells (DCs). As a result of their unique Birbeck granules (BGs), langerin expression, and heterogeneous maturation process, they differ from other immature DCs. Monocyte-derived LCs (MoLCs) mimic epidermal LCs. MoLCs with characteristic BGs are generated by culturing blood-derived monocytes with granulocyte macrophage-colony stimulating factor, interleukin (IL)-4, and transforming growth factor-beta1. Here, we compare maturation-induced antigen expression and cytokine release of LCs with MoLCs. To achieve comparable cell populations, LCs and MoLCs were isolated by CD1c cell sorting, resulting in high purity. In unstimulated cells, CD40 was expressed at equal levels. After stimulation with CD40 ligand (CD40L), LCs and MoLCs acquired CD83 and increased CD86. High CD80 expression was exclusively detected in CD1c-sorted MoLCs. Human leukocyte antigen-DR and CD54 expression was found in all cell populations, however, at different intensities. CD40 triggering increased the potency of LCs and MoLCs to stimulate CD4+ T cell proliferation. Activated MoLCs released IL-12p70 and simultaneously, anti-inflammatory IL-10. The application of the Toll-like receptor ligands peptidoglycan, flagellin, and in particular, lipopolysaccharide (LPS) increased the corelease of these cytokines. LCs secreted IL-10 at a comparable level with MoLCs but failed to produce high amounts of IL-12p70 after application of danger signals. These data indicate that MoLCs as well as LCs display no maturation arrest concerning CD83 and CD86 expression. In difference to MoLCs, LCs resisted activation by CD40L and LPS in terms of IL-12 production. This shows that natural and generated LCs share similar features but differ in relevant functions.

  16. Cloning and expression of the ccdA-associated thiol-disulfide oxidoreductase (catA) gene from Brevibacillus choshinensis: stimulation of human epidermal growth factor production.


    Tanaka, Ryoichi; Mizukami, Makoto; Ishibashi, Matsujiro; Tokunaga, Hiroko; Tokunaga, Masao


    Brevibacillus choshinensis (Bacillus brevis) is a protein-hyperproducing bacterium with a useful host-vector system for the production of recombinant proteins. Here, we cloned the ccdA-catA (cmacr;cdA āssociated thioredoxin-like tmacr;hiol-disulfide oxidoreductase) locus of B. choshinensis HPD31-S5. CatA protein (molecular weight, 19664) contains a thioredoxin-like motif, Cys-Gly-Pro-Cys. It was successfully expressed in B. choshinensis extracellularly ( approximately 100 microg x ml(-1) culture) using the secretion vector pNCMO2, and in Escherichia coli intracellularly ( approximately 350 microg x ml(-1) culture) with an amino-terminal His-tag. Both recombinant proteins showed thiol-disulfide oxidoreductase activity. Incubation of non-native human epidermal growth factor (hEGF) containing incorrect disulfide bonds with B. choshinensis cells secreting CatA protein resulted in the stimulation of the conversion of non-native hEGF to the native form. Furthermore, co-expression of CatA protein with recombinant hEGF in the B. choshinensis production system increased the yield of native hEGF.

  17. Upregulated epidermal growth factor receptor expression following near-infrared irradiation simulating solar radiation in a three-dimensional reconstructed human corneal epithelial tissue culture model

    PubMed Central

    Tanaka, Yohei; Nakayama, Jun


    Background and objective Humans are increasingly exposed to near-infrared (NIR) radiation from both natural (eg, solar) and artificial (eg, electrical appliances) sources. Although the biological effects of sun and ultraviolet (UV) exposure have been extensively investigated, the biological effect of NIR radiation is still unclear. We previously reported that NIR as well as UV induces photoaging and standard UV-blocking materials, such as sunglasses, do not sufficiently block NIR. The objective of this study was to investigate changes in gene expression in three-dimensional reconstructed corneal epithelial tissue culture exposed to broad-spectrum NIR irradiation to simulate solar NIR radiation that reaches human tissues. Materials and methods DNA microarray and quantitative real-time polymerase chain reaction analysis were used to assess gene expression levels in a three-dimensional reconstructed corneal epithelial model composed of normal human corneal epithelial cells exposed to water-filtered broad-spectrum NIR irradiation with a contact cooling (20°C). The water-filter allowed 1,000–1,800 nm wavelengths and excluded 1,400–1,500 nm wavelengths. Results A DNA microarray with >62,000 different probes showed 25 and 150 genes that were up- or downregulated by at least fourfold and twofold, respectively, after NIR irradiation. In particular, epidermal growth factor receptor (EGFR) was upregulated by 19.4-fold relative to control cells. Quantitative real-time polymerase chain reaction analysis revealed that two variants of EGFR in human corneal epithelial tissue were also significantly upregulated after five rounds of 10 J/cm2 irradiation (P<0.05). Conclusion We found that NIR irradiation induced the upregulated expression of EGFR in human corneal cells. Since over half of the solar energy reaching the Earth is in the NIR region, which cannot be adequately blocked by eyewear and thus can induce eye damage with intensive or long-term exposure, protection from both

  18. Human Epidermal Growth Factor Receptor-3 mRNA Expression as a Prognostic Marker for Invasive Duct Carcinoma not Otherwise Specified

    PubMed Central

    Hammoda, Ghada Ezat; El-Hefnawy, Sally Mohammed; Abdallah, Rania Abdallah


    Introduction Breast cancer is the most common cancer in women and the Erythroblastosis Oncogene B(ErbB) receptor family holds crucial role in its pathogenesis. Human Epidermal Growth Factor Receptor 3 (HER-3) gene over expression in breast tissue has been associated with aggressive clinical behaviour and bad prognosis. Aim To evaluate HER-3 mRNA expression level as a prognostic marker for breast cancer and to correlate its level with other established prognostic parameters. Materials and Methods This study was carried out on specimens of 100 cases that were divided into 40 patients presented with fibroadenoma and 60 patients presented with Invasive Ductal Carcinoma (IDC) not otherwise specified and underwent modified radical mastectomy. All specimens were investigated for HER-2/neu, ER and PR expression by Immunohistochemistry (IHC) and quantitative assay of HER-3 mRNA expression using real time PCR technique. Results There was a significant high HER3 mRNA level in carcinoma cases compared to fibroadenoma. In malignant cases, HER3 mRNA level was significantly associated with advanced T stage, advanced N stage, number of positive lymph nodes, large tumour size and cases associated with an adjacent in situ component. Moreover, HER-3 mRNA level was of highest values in Her-2/neu positive group followed by triple negative cases with the lowest level in luminal group (p<0.05). Conclusion HER-3 gene is upregulated in IDC especially those carrying poor prognostic features. HER-3 mRNA level may identify a subset of patients with a poor prognosis, and who could undergo further evaluation for the efficacy of HER3 targeted anticancer therapy. PMID:28384967

  19. Use of human epidermal cells in the study of carcinogenesis

    SciTech Connect

    Kuroki, T.; Chida, K.; Hosomi, J.; Kondo, S. )


    Because of the importance of human cells, particularly human epithelial cells, in cancer research, we have studied certain phases or events of carcinogenesis using human epidermal cells in primary culture. (1) We found that human epidermal cells are capable of metabolizing benzo(a)pyrene. Large inter-individual variations are found in the basal and induced arylhydrocarbon-hydroxylase activities. (2) UV-induced unscheduled DNA synthesis was demonstrated in human epidermal cells on autoradiographs. We also found that DNA repair is defective in epidermal cells isolated from xeroderma pigmentosum by a new explant-outgrowth culture. (3) Human epidermal cells are unique in that there is a large number of binding sites to phorbol esters compared with mouse epidermal cells, but there is no down-regulation. Further, human epidermal cells show essentially negative responses to tumor promoters, i.e., no stimulation of DNA synthesis, sugar uptake, and no induction of ornithine decarboxylase activity. (4) Human epidermal cells contain 1.5 x 10(5) binding sites per cell for epidermal growth factor (EGF), whereas squamous cell carcinomas of skin and oral cavity have larger amounts of EGF receptors in the order of 10(6) per cell. (5) Based on the above results, we attempted to transform human epidermal cells by the treatment with chemical carcinogens, but until now no transformation was obtained. 16 references.

  20. Dactylone inhibits epidermal growth factor-induced transformation and phenotype expression of human cancer cells and induces G1-S arrest and apoptosis.


    Fedorov, Sergey N; Shubina, Larisa K; Bode, Ann M; Stonik, Valentin A; Dong, Zigang


    The marine natural chamigrane-type sesquiterpenoid, dactylone, is closely related to secondary metabolites of some edible species of red algae. In the present study, the effect of dactylone was tested on the mouse skin epidermal JB6 P+ Cl41 cell line and its stable transfectants as well as on several human tumor cell lines, including lung (H460), colon (HCT-116), and skin melanomas (SK-MEL-5 and SK-MEL-28). This natural product was effective at nontoxic doses as a cancer-preventive agent, which exerted its actions, at least in part, through the inhibition of cyclin D3 and Cdk4 expression and retinoblastoma tumor suppressor protein (Rb) phosphorylation. The inhibition of these cell cycle components was followed by cell cycle arrest at the G1-S transition with subsequent p53-independent apoptosis. Therefore, these data showed that application of dactylone and related compounds may lead to decreased malignant cell transformation and/or decreased tumor cell proliferation.

  1. Coregulation of Epidermal Growth Factor Receptor/Human Epidermal Growth Factor Receptor 2 (HER2) Levels and Locations: Quantitative Analysis of HER2 Overexpression Effects

    SciTech Connect

    Hendriks, Bart S.; Opresko, Lee; Wiley, H. S.; Lauffenburger, Douglas A.


    Elevated expression of human epidermal growth factor receptor 2 (HER2) is know to alter cell signalilng and behavioral responses implicated in tumor progression. However, multiple diverse mechanisms may be involved in these overall effects, including signaling by HER2 itself, modulation of signalilng by epidermal growth factor receptor (EGFR) and modification of trafficking dynamics for both EGFR and HER2. Continued....

  2. Effects of Wnt3a on proliferation and differentiation of human epidermal stem cells

    SciTech Connect

    Jia Liwei; Zhou Jiaxi; Peng Sha; Li Juxue; Cao Yujing; Duan Enkui


    Epidermal stem cells maintain development and homeostasis of mammalian epidermis throughout life. However, the molecular mechanisms involved in the proliferation and differentiation of epidermal stem cells are far from clear. In this study, we investigated the effects of Wnt3a and Wnt/{beta}-catenin signaling on proliferation and differentiation of human fetal epidermal stem cells. We found both Wnt3a and active {beta}-catenin, two key members of the Wnt/{beta}-catenin signaling, were expressed in human fetal epidermis and epidermal stem cells. In addition, Wnt3a protein can promote proliferation and inhibit differentiation of epidermal stem cells in vitro culture. Our results suggest that Wnt/{beta}-catenin signaling plays important roles in human fetal skin development and homeostasis, which also provide new insights on the molecular mechanisms of oncogenesis in human epidermis.

  3. Epidermal Growth Factor Receptor Expression Modulates Antitumor Efficacy of Vandetanib or Cediranib Combined With Radiotherapy in Human Glioblastoma Xenografts

    SciTech Connect

    Wachsberger, Phyllis R.; Lawrence, Yaacov R.; Liu Yi; Daroczi, Borbala; Xu Xia; Dicker, Adam P.


    Purpose: The purpose of this study was to determine the ability of radiation therapy (RT) combined with the tyrosine kinase inhibitors (TKI) vandetanib (antiepidermal growth factor receptor [EGFR] plus antivascular endothelial growth factor receptor [anti-VEGFR]) and cediranib (anti-VEGFR) to inhibit glioblastoma multiforme (GBM) growth. A secondary aim was to investigate how this regimen is modulated by tumor EGFR expression. Methods and Materials: Radiosensitivity was assessed by clonogenic cell survival assay. VEGF secretion was quantified by enzyme-linked immunosorbent assay. GBM (U87MG wild-type EGFR [wtEGFR] and U87MG EGFR-null) xenografts were treated with vandetanib, cediranib, and RT, alone or in combinations. Excised tumor sections were stained for proliferative and survival biomarkers. Results: In vitro, U87MG wtEGFR and U87 EGFR-null cells had similar growth kinetics. Neither TKI affected clonogenic cell survival following RT. However, in vivo, exogenous overexpression of wtEGFR decreased tumor doubling time (T2x) in U87MG xenografts (2.70 vs. 4.41 days for U87MG wtEGFR vs. U87MG vector, respectively). In U87MG EGFR-null cells, TKI combined with radiation was no better than radiation therapy alone. In U87MG wtEGFR, RT in combination with vandetanib (but not with cediranib) significantly increased tumor T2x compared with RT alone (T2x, 10.4 days vs. 4.8 days; p < 0.001). In vivo, growth delay correlated with suppression of pAkt, survivin, and Ki67 expression in tumor samples. The presence of EGFR augmented RT-stimulated VEGF release; this effect was inhibited by vandetanib. Conclusions: EGFR expression promoted tumor growth in vivo but not in vitro, suggesting a microenvironmental effect. GBM xenografts expressing EGFR exhibited greater sensitivity to both cediranib and vandetanib than EGFR-null tumors. Hence EGFR status plays a major role in determining a tumor's in vivo response to radiation combined with TKI, supporting a 'personalized' approach to

  4. Production of human epidermal growth factor using adenoviral based system

    PubMed Central

    Negahdari, Babak; Shahosseini, Zahra; Baniasadi, Vahid


    Epidermal growth factor (EGF), a growth factor involved in cell growth and differentiation, is a small polypeptide with molecular weight of approximately 6 kDa known to be present in a number of different mammalian species. Experimental studies in animals and humans have demonstrated that the topical application of EGF accelerates the rate of epidermal regeneration of partial-thickness wounds and second-degree burns. Due to its commercial applications, Human EGF (hEGF) has been cloned in several forms. In the present study, adenoviral based expression system was used to produce biologically active recombinant hEGF. The presence of secreted recombinant hEGF was confirmed by a dot blot and its expression level was determined by enzyme-linked immuno-sorbent assay. Moreover, biological activity of secreted hEGF was evaluated by a proliferation assay performed on A549 cells. For production of hEGF in a secretory form, a chimeric gene coding for the hEGF fused to the signal peptide was expressed using adenoviral based method. This method enables the production of hEGF at the site of interest and moreover it could be used for cell proliferation and differentiation assays in tissue engineering research experiments instead of using commercially available EGF. PMID:27051431

  5. Polymeric membranes modulate human keratinocyte differentiation in specific epidermal layers.


    Salerno, Simona; Morelli, Sabrina; Giordano, Francesca; Gordano, Amalia; Bartolo, Loredana De


    In vitro models of human bioengineered skin substitutes are an alternative to animal experimentation for testing the effects and toxicity of drugs, cosmetics and pollutants. For the first time specific and distinct human epidermal strata were engineered by using membranes and keratinocytes. To this purpose, biodegradable membranes of chitosan (CHT), polycaprolactone (PCL) and a polymeric blend of CHT-PCL were prepared by phase-inversion technique and characterized in order to evaluate their morphological, physico-chemical and mechanical properties. The capability of membranes to modulate keratinocyte differentiation inducing specific interactions in epidermal membrane systems was investigated. The overall results demonstrated that the membrane properties strongly influence the cell morpho-functional behaviour of human keratinocytes, modulating their terminal differentiation, with the creation of specific epidermal strata or a fully proliferative epidermal multilayer system. In particular, human keratinocytes adhered on CHT and CHT-PCL membranes, forming the structure of the epidermal top layers, such as the corneum and granulosum strata, characterized by withdrawal or reduction from the cell cycle and cell proliferation. On the PCL membrane, keratinocytes developed an epidermal basal lamina, with high proliferating cells that stratified and migrated over time to form a complete differentiating epidermal multilayer system.

  6. Nicotinic Acid Receptor Abnormalities in Human Skin Cancer: Implications for a Role in Epidermal Differentiation

    PubMed Central

    Bermudez, Yira; Benavente, Claudia A.; Meyer, Ralph G.; Coyle, W. Russell; Jacobson, Myron K.; Jacobson, Elaine L.


    Background Chronic UV skin exposure leads to epidermal differentiation defects in humans that can be largely restored by pharmacological doses of nicotinic acid. Nicotinic acid has been identified as a ligand for the human G-protein-coupled receptors GPR109A and GPR109B that signal through Gi-mediated inhibition of adenylyl cyclase. We have examined the expression, cellular distribution, and functionality of GPR109A/B in human skin and skin derived epidermal cells. Results Nicotinic acid increases epidermal differentiation in photodamaged human skin as judged by the terminal differentiation markers caspase 14 and filaggrin. Both GPR109A and GPR109B genes are transcribed in human skin and in epidermal keratinocytes, but expression in dermal fibroblasts is below limits of detection. Receptor transcripts are greatly over-expressed in squamous cell cancers. Receptor protein in normal skin is prominent from the basal through granular layers of the epidermis, with cellular localization more dispersive in the basal layer but predominantly localized at the plasma membrane in more differentiated epidermal layers. In normal human primary and immortalized keratinocytes, nicotinic acid receptors show plasma membrane localization and functional Gi-mediated signaling. In contrast, in a squamous cell carcinoma derived cell line, receptor protein shows a more diffuse cellular localization and the receptors are nearly non-functional. Conclusions The results of these studies justify future genetic and pharmacological intervention studies to define possible specific role(s) of nicotinic acid receptors in human skin homeostasis. PMID:21655214

  7. Improved epidermal barrier formation in human skin models by chitosan modulated dermal matrices

    PubMed Central

    Mieremet, Arnout; Rietveld, Marion; Absalah, Samira; van Smeden, Jeroen


    Full thickness human skin models (FTMs) contain an epidermal and a dermal equivalent. The latter is composed of a collagen dermal matrix which harbours fibroblasts. Current epidermal barrier properties of FTMs do not fully resemble that of native human skin (NHS), which makes these human skin models less suitable for barrier related studies. To further enhance the resemblance of NHS for epidermal morphogenesis and barrier formation, we modulated the collagen dermal matrix with the biocompatible polymer chitosan. Herein, we report that these collagen-chitosan FTMs (CC-FTMs) possess a well-organized epidermis and maintain both the early and late differentiation programs as in FTMs. Distinctively, the epidermal cell activation is reduced in CC-FTMs to levels observed in NHS. Dermal-epidermal interactions are functional in both FTM types, based on the formation of the basement membrane. Evaluation of the barrier structure by the organization of the extracellular lipid matrix of the stratum corneum revealed an elongated repeat distance of the long periodicity phase. The ceramide composition exhibited a higher resemblance of the NHS, based on the carbon chain-length distribution and subclass profile. The inside-out barrier functionality indicated by the transepidermal water loss is significantly improved in the CC-FTMs. The expression of epidermal barrier lipid processing enzymes is marginally affected, although more restricted to a single granular layer. The novel CC-FTM resembles the NHS more closely, which makes them a promising tool for epidermal barrier related studies. PMID:28333992

  8. CDK4 coexpression with Ras generates malignant human epidermal tumorigenesis.


    Lazarov, Mirella; Kubo, Yoshiaki; Cai, Ti; Dajee, Maya; Tarutani, Masahito; Lin, Qun; Fang, Min; Tao, Shiying; Green, Cheryl L; Khavari, Paul A


    Ras acts with other proteins to induce neoplasia. By itself, however, strong Ras signaling can suppress proliferation of normal cells. In primary epidermal cells, we found that oncogenic Ras transiently decreases cyclin-dependent kinase (CDK) 4 expression in association with cell cycle arrest in G1 phase. CDK4 co-expression circumvents Ras growth suppression and induces invasive human neoplasia resembling squamous cell carcinoma. Tumorigenesis is dependent on CDK4 kinase function, with cyclin D1 required but not sufficient for this process. In facilitating escape from G1 growth restraints, Ras and CDK4 alter the composition of cyclin D and cyclin E complexes and promote resistance to growth inhibition by INK4 cyclin-dependent kinase inhibitors. These data identify a new role for oncogenic Ras in CDK4 regulation and highlight the functional importance of CDK4 suppression in preventing uncontrolled growth.

  9. Egr-1 mediates epidermal growth factor-induced downregulation of E-cadherin expression via Slug in human ovarian cancer cells.


    Cheng, J-C; Chang, H-M; Leung, P C K


    Loss of the cell adhesion protein E-cadherin increases the invasive capability of ovarian cancer cells. We have previously shown that epidermal growth factor (EGF) downregulates E-cadherin and induces ovarian cancer cell invasion through the H(2)O(2)/p38 MAPK-mediated upregulation of the E-cadherin transcriptional repressor Snail. However, the molecular mechanisms underlying the EGF-induced downregulation of E-cadherin are not fully understood. In the current study, we demonstrated that treatment of two ovarian cancer cell lines, SKOV3 and OVCAR5, with EGF induced the expression of the transcription factor Egr-1, and this induction was abolished by small interfering RNA (siRNA)-mediated depletion of the EGF receptor. EGF-induced Egr-1 expression required the activation of the ERK1/2 and PI3K/Akt signaling pathways and was unrelated to EGF-induced H(2)O(2) production and activation of the p38 MAPK pathway. Moreover, depletion of Egr-1 with siRNA abolished the EGF-induced downregulation of E-cadherin and increased cell invasion. Interestingly, siRNA depletion of Egr-1 attenuated the EGF-induced expression of Slug, but not that of Snail. Moreover, chromatin immunoprecipitation (ChIP) analysis showed that Slug is a target gene of Egr-1. These results provide evidence that Egr-1 is a mediator that is involved in the EGF-induced downregulation of E-cadherin and increased cell invasion. Our results also demonstrate that EGF activates two independent signaling pathways, which are the H(2)O(2)/p38 MAPK-mediated upregulation of Snail expression and the Egr-1-mediated upregulation of Slug expression. These two signaling pathways contribute to the EGF-induced downregulation of E-cadherin, which subsequently increases the invasive capability of ovarian cancer cells.

  10. Hyaluronan Does Not Regulate Human Epidermal Keratinocyte Proliferation and Differentiation.


    Malaisse, Jérémy; Pendaries, Valérie; Hontoir, Fanny; De Glas, Valérie; Van Vlaender, Daniel; Simon, Michel; Lambert de Rouvroit, Catherine; Poumay, Yves; Flamion, Bruno


    Hyaluronan (HA) is synthesized by three HA synthases (HAS1, HAS2, and HAS3) and secreted in the extracellular matrix. In human skin, large amounts of HA are found in the dermis. HA is also synthesized by keratinocytes in the epidermis, although its epidermal functions are not clearly identified yet. To investigate HA functions, we studied the effects of HA depletion on human keratinocyte physiology within in vitro reconstructed human epidermis. Inhibition of HA synthesis with 4-methylumbelliferone (4MU) did not modify the expression profile of the epidermal differentiation markers involucrin, keratin 10, and filaggrin during tissue reconstruction. In contrast, when keratinocytes were incubated with 4MU, cell proliferation was decreased. In an attempt to rescue the proliferation function, HA samples of various mean molecular masses were added to keratinocyte cultures treated with 4MU. These samples were unable to rescue the initial proliferation rate. Furthermore, treatments with HA-specific hyaluronidase, although removing almost all HA from keratinocyte cultures, did not alter the differentiation or proliferation processes. The differences between 4MU and hyaluronidase effects did not result from differences in intracellular HA, sulfated glycosaminoglycan concentration, apoptosis, or levels of HA receptors, all of which remained unchanged. Similarly, knockdown of UDP-glucose 6-dehydrogenase (UGDH) using lentiviral shRNA effectively decreased HA production but did not affect proliferation rate. Overall, these data suggest that HA levels in the human epidermis are not directly correlated with keratinocyte proliferation and differentiation and that incubation of cells with 4MU cannot equate with HA removal.

  11. Genome-wide transcriptome analysis of human epidermal melanocytes

    PubMed Central

    Haltaufderhyde, Kirk D.; Oancea, Elena


    Because human epidermal melanocytes (HEMs) provide critical protection against skin cancer, sunburn, and photoaging, a genome-wide perspective of gene expression in these cells is vital to understanding human skin physiology. In this study we performed high throughput sequencing of HEMs to obtain a complete data set of transcript sizes, abundances, and splicing. As expected, we found that melanocyte specific genes that function in pigmentation were among the highest expressed genes. We analyzed receptor, ion channel and transcription factor gene families to get a better understanding of the cell signalling pathways used by melanocytes. We also performed a comparative transcriptomic analysis of lightly versus darkly pigmented HEMs and found 16 genes differentially expressed in the two pigmentation phenotypes; of those, only one putative melanosomal transporter (SLC45A2) has known function in pigmentation. In addition, we found 166 genes with splice isoforms expressed exclusively in one pigmentation phenotype, 17 of which are genes involved in signal transduction. Our melanocyte transcriptome study provides a comprehensive view and may help identify novel pigmentation genes and potential pharmacological targets. PMID:25451175

  12. Transcriptional responses of human epidermal keratinocytes to Oncostatin-M.


    Finelt, Nika; Gazel, Alix; Gorelick, Steven; Blumenberg, Miroslav


    Oncostatin-M (OsM) plays an important role in inflammatory and oncogenic processes in skin, including psoriasis and Kaposi sarcoma. However, the molecular responses to OsM in keratinocytes have not been explored in depth. Here we show the results of transcriptional profiling in OsM-treated primary human epidermal keratinocytes, using high-density DNA microarrays. We find that OsM strongly and specifically affects the expression of many genes, in particular those involved with innate immunity, angiogenesis, adhesion, motility, tissue remodeling, cell cycle and transcription. The timing of the responses to OsM comprises two waves, early at 1h, and late at 48 h, with much fewer genes regulated in the intervening time points. Secreted cytokines and growth factors and their receptors, as well as nuclear transcription factors, are primary targets of OsM regulation, and these, in turn, effect the secondary changes.

  13. Type IV collagen aggregates promote keratinocyte proliferation and formation of epidermal layer in human skin equivalents.


    Matsuura-Hachiya, Yuko; Arai, Koji Y; Muraguchi, Taichi; Sasaki, Tasuku; Nishiyama, Toshio


    Type IV collagen isolated from lens capsule without enzymatic treatment is known to form a gel under physiological condition and influences cellular activities. In case of human keratinocytes, the suppression of proliferation on reconstituted type IV collagen gels was reported in monolayer culture. In this study, we examined effects of type IV collagen isolated from porcine lens capsule on epidermal formation in human skin equivalents. Type IV collagen aggregates were prepared under the culture condition and the aggregates suppressed keratinocyte proliferation in monolayer culture as well as the culture on the gels. In human skin equivalents type IV collagen aggregates were reconstituted on the surface of contracted collagen gels containing human dermal fibroblasts and the keratinocytes were then cultured on the aggregates for 14 days. Interestingly, in human skin equivalents with type IV collagen aggregates, the BrdU-positive keratinocytes were increased and the thickness of the epidermal layer was around twice than that of control culture. Epidermal differentiation markers were expressed in the upper layer of the epidermis and the defined deposition of human basement membrane components were increased at the dermal-epidermal junction. These results indicate that the type IV collagen aggregates stimulate the proliferation of basal keratinocytes and improve the stratification of epidermal layers in human skin equivalents. This article is protected by copyright. All rights reserved.

  14. Knockdown of PKD1 in normal human epidermal keratinocytes increases mRNA expression of keratin 10 and involucrin: early markers of keratinocyte differentiation.


    Ivanova, Petya; Atanasova, Ganka; Poumay, Yves; Mitev, Vanyo


    Subconfluent normal human keratinocytes exhibit autonomous (autocrine growth factor driven) proliferation and express the specific markers for keratinocyte proliferation K5 (keratin 5) and K14 (keratin 14). Utilizing this model the effects of PKD1 (Protein kinase D1) knockdown on activation of differentiation was studied. siRNA approach was applied to achieve specific knockdown of PKD1 and the mRNA levels of different keratinocyte markers -- K14 and PCNA (markers of basal proliferating keratinocytes), involucrin and K10 (early differentiation markers) were analyzed. Treatment of cultured keratinocytes with siRNA for PKD1 resulted in reduction of mRNA levels of PKD1, altered cell phenotype and promotion of keratinocyte differentiation, demonstrated by increased expression of involucrin and K10 mRNAs. No significant changes in K14 mRNA expression levels were detected, but the expression of PCNA mRNA was markedly diminished. This study was the first to show that mRNA expression of PKD1 in subconfluent normal human keratinocytes is very low, the PKD1 mRNA levels were more than 8-fold lower than the same ones in hTert keratinocytes. These findings suggest antidifferentiative role of PKD1 in normal human keratinocytes, contrary to the prodiferentiative role of PKD1 in human hTert keratinocytes. We came to the conclusion that there are differences between transduction pathways involving PKD1 in primary human keratinocyte cultures and these in immortalized hTert keratinocytes.

  15. Activation of the Na+/H+ antiport is not required for epidermal growth factor-dependent gene expression, growth inhibition or proliferation in human breast cancer cells.

    PubMed Central

    Church, J G; Mills, G B; Buick, R N


    Mitogen interaction with specific receptors in many cell types leads to activation of the Na+/H+ antiport and a resultant cytoplasmic alkalinization. Since amiloride inhibits both Na+/H+ exchange and cell proliferation, it has been hypothesized that activation of the antiport is an obligatory requirement for mitogenesis. However, concentrations of amiloride which inhibit the antiport also inhibit other cellular processes, including protein synthesis and phosphorylation. We have used an epidermal growth factor (EGF) receptor gene-amplified human breast cancer cell line, the growth of which is inhibited by high levels of EGF in culture (MDA-468) and a variant, the growth of which is stimulated by EGF (MDA-468-S4), along with two potent amiloride analogues to examine whether activation of the Na+/H+ antiport and cytoplasmic alkalinization is necessary for both EGF-dependent effects to occur. At concentrations of the amiloride analogues which block Na+/H+ exchange in both cell types by 76-98%, the EGF-dependent alterations in [3H]thymidine incorporation or induction in c-myc or c-fos gene transcription were unaltered. These results were confirmed by a lack of effect of the amiloride analogues on both the growth-stimulatory and growth-inhibitory effects on EGF in an anchorage-independent growth assay. Similarly, in pH-altered media that prevented normal cytoplasmic alkalinization, the response of both MDA-468 and MDA-468-S4 to EGF activation was unaltered. In addition, activation of the Na+/H+ antiport alone was not sufficient to induce c-myc and c-fos transcription in either cell type. Taken together, these data suggest that neither the Na+/H+ antiport nor cytoplasmic alkalinization are necessary or sufficient for either EGF-dependent growth stimulation or growth inhibition in MDA-468 human breast cancer cells. Images Fig. 3. PMID:2537620

  16. Activation of the human keratinocyte B1 bradykinin receptor induces expression and secretion of metalloproteases 2 and 9 by transactivation of epidermal growth factor receptor.


    Matus, Carola E; Ehrenfeld, Pamela; Pavicic, Francisca; González, Carlos B; Concha, Miguel; Bhoola, Kanti D; Burgos, Rafael A; Figueroa, Carlos D


    The B1 bradykinin receptor (BDKRB1) is a component of the kinin cascade localized in the human skin. Some of the effects produced by stimulation of BDKRB1 depend on transactivation of epidermal growth factor receptor (EGFR), but the mechanisms involved in this process have not been clarified yet. The primary purpose of this study was to determine the effect of a BDKRB1 agonist on wound healing in a mouse model and the migration and secretion of metalloproteases 2 and 9 from human HaCaT keratinocytes and delineate the signalling pathways that triggered their secretion. Although stimulation of BDKRB1 induces weak chemotactic migration of keratinocytes and wound closure in an in vitro scratch-wound assay, the BDKRB1 agonist improved wound closure in a mouse model. BDKRB1 stimulation triggers synthesis and secretion of both metalloproteases, effects that depend on the activity of EGFR and subsequent phosphorylation of ERK1/2 and p38 mitogen-activated protein kinases and PI3K/Akt. In the mouse model, immunoreactivity for both gelatinases was concentrated around wound borders. EGFR transactivation by BDKRB1 agonist involves Src kinases family and ADAM17. In addition to extracellular matrix degradation, metalloproteases 2 and 9 regulate cell migration and differentiation, cell functions that are associated with the role of BDKRB1 in keratinocyte differentiation. Considering that BDKRB1 is up-regulated by inflammation and/or by cytokines that are abundant in the inflammatory milieu, more stable BDKRB1 agonists may be of therapeutic value to modulate wound healing.


    EPA Science Inventory

    Chronic exposure to arsenic is positively associated with skin, urinary bladder, lung, liver and kidney cancer development in humans. Elucidating the mode of action of arsenic carcinogenesis is a complicated issue as target cells are exposed to different toxic species of arsenic....

  18. Transgenic Soybean Production of Bioactive Human Epidermal Growth Factor (EGF)

    PubMed Central

    He, Yonghua; Schmidt, Monica A.; Erwin, Christopher; Guo, Jun; Sun, Raphael; Pendarvis, Ken; Warner, Brad W.; Herman, Eliot M.


    Necrotizing enterocolitis (NEC) is a devastating condition of premature infants that results from the gut microbiome invading immature intestinal tissues. This results in a life-threatening disease that is frequently treated with the surgical removal of diseased and dead tissues. Epidermal growth factor (EGF), typically found in bodily fluids, such as amniotic fluid, salvia and mother’s breast milk, is an intestinotrophic growth factor and may reduce the onset of NEC in premature infants. We have produced human EGF in soybean seeds to levels biologically relevant and demonstrated its comparable activity to commercially available EGF. Transgenic soybean seeds expressing a seed-specific codon optimized gene encoding of the human EGF protein with an added ER signal tag at the N’ terminal were produced. Seven independent lines were grown to homozygous and found to accumulate a range of 6.7 +/- 3.1 to 129.0 +/- 36.7 μg EGF/g of dry soybean seed. Proteomic and immunoblot analysis indicates that the inserted EGF is the same as the human EGF protein. Phosphorylation and immunohistochemical assays on the EGF receptor in HeLa cells indicate the EGF protein produced in soybean seed is bioactive and comparable to commercially available human EGF. This work demonstrates the feasibility of using soybean seeds as a biofactory to produce therapeutic agents in a soymilk delivery platform. PMID:27314851

  19. Meaning of relative gene expression in multilayered cultures of epidermal keratinocytes.


    Malaisse, Jérémy; Hermant, Maryse; Hayez, Aurélie; Poumay, Yves; Lambert de Rouvroit, Catherine


    Reconstructed human epidermis (RHE) has become an in vitro model of choice for studying cell and tissue functions. Analysis of gene expression over the course of reconstruction must take into account the heterogeneous differentiation states of keratinocytes reconstituting the typical epidermal layers. In monolayer cultures, relative mRNA expression levels of differentiation markers are usually expressed as a ratio versus a classical reference gene (also named house-keeping gene) tested to be expressed equally in certain experimental conditions. Applied to complex tissues in which the cell number increases over time together with differentiation, calculation of relative gene expression does not take enough into account a crucial phenomenon: epidermal morphogenesis results in progressive restriction of differentiation markers, such as involucrin, to a specific layer, or in the delayed onset of mRNA expression of filaggrin or TMEM45A for instance following stratification. Our study illustrates that comparing the relative expression level of mRNAs to that of a basal layer-specific gene (e.g. ITGA6) better illustrates the contribution of specific differentiation markers to the process of epidermal morphogenesis.

  20. Cell shape controls terminal differentiation of human epidermal keratinocytes.

    PubMed Central

    Watt, F M; Jordan, P W; O'Neill, C H


    Cultures of human epidermal keratinocytes provide a useful experimental model with which to study the factors that regulate cell proliferation and terminal differentiation. One situation that is known to trigger premature terminal differentiation is suspension culture, when keratinocytes are deprived of substratum and intercellular contact. We have now investigated whether area of substratum contact, and hence cell shape, can regulate terminal differentiation. Keratinocytes were grown on circular adhesive islands that prevented cell-cell contact. By varying island area we could vary cell shape from fully spread to almost spherical. We found that when substratum contact was restricted, DNA synthesis was inhibited and expression of involucrin, a marker of terminal differentiation, was stimulated. Inhibition of proliferation was not a sufficient stimulus for involucrin synthesis in fully spread cells. When DNA synthesis and involucrin expression were plotted against contact area, classic dose-response curves were obtained. Thus cell shape acts as a signal for the terminal differentiation of keratinocytes in culture. Images PMID:2456572

  1. Classification of epidermal keratins according to their immunoreactivity, isoelectric point, and mode of expression

    PubMed Central


    Human epidermal keratinocytes express under various growth conditions a total of at least nine keratins that can be divided into two subfamilies. Subfamily A comprises 40-, 46-, 48-, 50-/50'-, and 56.5- kilodalton (kd) keratins which are relatively acidic (pI less than 5.5) and, with the exception of 46-kd keratin, are recognized by AE1 monoclonal antibody. Subfamily B comprises 52-, 56-, 58-, and 65-67-kd keratins which are relatively basic (pI greater than 6) and are recognized by AE3 monoclonal antibody. Within each keratin subfamily, there is a constant member (50-/50'- and 58-kd keratins of the subfamilies A and B, respectively) that is always expressed. The other seven keratins of both subfamilies are variable members whose expression depends upon the cellular differentiated state, which is in turn modulated by the growth environment. The 56.5-kd keratin (subfamily A) and the 65-67-kd keratins (subfamily B) are coordinately expressed during keratinization. In contrast, the 40-, 46-, and 48-kd keratins (subfamily A) and the 52- and 56-kd keratins (subfamily B) are characteristic of cultured epidermal cells forming nonkeratinized colonies. These results demonstrate that human epidermal keratins can be classified according to their reactivity with monoclonal antikeratin antibodies, isoelectric point, and mode of expression. The classification of keratins into various subgroups may have important implications for the mechanisms of epidermal differentiation, the evolution of keratin heterogeneity, and the use of keratin markers for tumor diagnosis. PMID:6201491

  2. Arsenic Induces p62 Expression to Form a Positive Feedback Loop with Nrf2 in Human Epidermal Keratinocytes: Implications for Preventing Arsenic-Induced Skin Cancer

    PubMed Central

    Shah, Palak; Trinh, Elaine; Qiang, Lei; Xie, Lishi; Hu, Wen-Yang; Prins, Gail S.; Pi, Jingbo; He, Yu-Ying


    Exposure to inorganic arsenic in contaminated drinking water poses an environmental public health threat for hundreds of millions of people in the US and around the world. Arsenic is a known carcinogen for skin cancer. However, the mechanism by which arsenic induces skin cancer remains poorly understood. Here, we have shown that arsenic induces p62 expression in an autophagy-independent manner in human HaCaT keratinocytes. In mouse skin, chronic arsenic exposure through drinking water increases p62 protein levels in the epidermis. Nrf2 is required for basal and arsenic-induced p62 up-regulation. p62 knockdown reduces arsenic-induced Nrf2 activity, and induces sustained p21 up-regulation. p62 induction is associated with increased proliferation in mouse epidermis. p62 knockdown had little effect on arsenic-induced apoptosis, while it decreased cell proliferation following arsenic treatment. Our findings indicate that arsenic induces p62 expression to regulate the Nrf2 pathway in human keratinocytes and suggest that targeting p62 may help prevent arsenic-induced skin cancer. PMID:28125038

  3. Epidermal growth factor and its receptors in human pancreatic carcinoma

    SciTech Connect

    Chen, Y.F.; Pan, G.Z.; Hou, X.; Liu, T.H.; Chen, J.; Yanaihara, C.; Yanaihara, N. )


    The role of epidermal growth factor (EGF) in oncogenesis and progression of malignant tumors is a subject of vast interest. In this study, radioimmunoassay and radioreceptor assay of EGF were established. EGF contents in malignant and benign pancreatic tumors, in normal pancreas tissue, and in culture media of a human pancreatic carcinoma cell line were determined. EGF receptor binding studies were performed. It was shown that EGF contents in pancreatic carcinomas were significantly higher than those in normal pancreas or benign pancreatic tumors. EGF was also detected in the culture medium of a pancreatic carcinoma cell line. The binding of 125I-EGF to the pancreatic carcinoma cells was time and temperature dependent, reversible, competitive, and specific. Scatchard analysis showed that the dissociation constant of EGF receptor was 2.1 X 10(-9) M, number of binding sites was 1.3 X 10(5) cell. These results indicate that there is an over-expression of EGF/EGF receptors in pancreatic carcinomas, and that an autocrine regulatory mechanism may exist in the growth-promoting effect of EGF on tumor cells.

  4. Effects of ozone in normal human epidermal keratinocytes.


    McCarthy, James T; Pelle, Edward; Dong, Kelly; Brahmbhatt, Krupa; Yarosh, Dan; Pernodet, Nadine


    Ozone is a tropospheric pollutant that can form at ground level as a result of an interaction between sunlight and hydrocarbon engine emissions. As ozone is an extremely oxidative reaction product, epidermal cells are in the outer layer of defense against ozone. We exposed normal human epidermal keratinocytes (NHEK) to concentrations of ozone that have been measured in cities and assayed for its effects. Hydrogen peroxide and IL-1α levels both increased while ATP levels decreased. We found a decrease in the NAD-dependent histone deacetylase, sirtuin 3. Lastly, we found that ozone increased DNA damage as evaluated by Comet assay. Taken together, our results show increased damage to NHEK that will ultimately impair normal cellular function as a result of an environmentally relevant ozone exposure.

  5. HOXA9 regulates angiogenesis in human hypertrophic scars: induction of VEGF secretion by epidermal stem cells

    PubMed Central

    Cao, Peng-Fei; Xu, Ying-Bin; Tang, Jin-Ming; Yang, Rong-Hua; Liu, Xu-Sheng


    Hypertrophic scars are fibroproliferative disorders of excessive wound healing after skin injury. Vascular endothelial growth factor (VEGF)-induced angiogenesis plays a major role in fibrogenesis and hypertrophic scar formation. Over recent years, there has been a major interest in homeobox gene regulation of VEGF-VEGFR mediated angiogenesis in dermal tissue. In the current study, we investigated the role of homeobox genes in the epidermis, for their role in angiogenesis, with a focus on epidermal-mesenchymal interactions. As epidermal stem cells (ESCs) have a central role in epidermal homeostasis, we tested the hypothesis that these cells play a key role in the pathogenesis of hypertrophic scars through the HOXA9-VEGF/VEGFR signaling pathways. We found significant differences in the expression of homeobox A9 in hyperplastic scar tissue during different phases of development. These differences coincided with similar regulations in VEGF expression and with the distribution of ESCs. HOXA9 is expressed in cultured human ESCs in vitro. Antisense suppression of HOXA9 expression was found to suppress VEGF levels in ESCs. Together these findings indicate that homeobox A9 regulates the expression of VEGF in ESCs. PMID:25031718

  6. Expression of simple epithelial cytokeratins in mouse epidermal keratinocytes harboring Harvey ras gene alterations.


    Diaz-Guerra, M; Haddow, S; Bauluz, C; Jorcano, J L; Cano, A; Balmain, A; Quintanilla, M


    Activation of a Harvey ras (H-ras) protooncogene is a frequent event associated with mouse epidermal carcinogenesis. We report that the transfection of a human H-ras oncogene into an immortalized mouse epidermal cell line (MCA3D) induces the anomalous expression of cytokeratins (CKs) 8 and 18 characteristic of simple epithelia. The comparison of various transfectant cell clones indicated a direct correlation between the levels of CK8 expression and the mutated H-ras p21s. The expression of simple epithelial CKs is also described in cell lines derived from mouse skin carcinomas (HaCa4, CarC) and in keratinocytes transformed in vitro by a chemical carcinogen (PDV, PDVC57), all of which contain altered H-ras genes. The induction of CK8 and CK18 occurs at the mRNA level and, although both CK8 and CK18 mRNAs are expressed, CK18 protein does not accumulate whereas CK8 is incorporated into intermediate filaments. Immunofluorescence studies show that the pattern of CK8 protein expression is heterogeneous; some cells express very low amounts of CK8, whereas others synthesize relatively high levels of this protein. However, selection of strongly CK8-positive cells was found in one case where a more malignant population of cells (PDVC57) was derived by tumor transplantation of PDV. Our results suggest that activation of a H-ras gene can alter the normal differentiation program of epidermal cells and that the ability to synthesize CK8 and CK18 could be related to tumor progression.

  7. Expression profiles of cortisol-inactivating enzyme, 11β-hydroxysteroid dehydrogenase-2, in human epidermal tumors and its role in keratinocyte proliferation.


    Terao, Mika; Itoi, Saori; Murota, Hiroyuki; Katayama, Ichiro


    The enzyme 11β-hydroxysteroid dehydrogenase (11β-HSD) catalyzes the interconversion between hormonally active cortisol and inactive cortisone within cells. There are two isozymes: 11β-HSD1 activates cortisol from cortisone and 11β-HSD2 inactivates cortisol to cortisone. 11β-HSD1 was recently discovered in skin, and we subsequently found that the enzyme negatively regulates keratinocyte proliferation. We verified 11β-HSD1 and 11β-HSD2 expression in benign and malignant skin tumors and investigated the role of 11β-HSD in skin tumor pathogenesis. Randomly selected formalin-fixed sections of skin lesions of seborrheic keratosis (SK), squamous cell carcinoma (SCC), and basal cell carcinoma (BCC) were stained with 11β-HSD1 and 11β-HSD2 antibodies, and 11β-HSD expression was also evaluated in murine epidermis in which hyperproliferation was induced by 12-O-tetradecanoylphorbol-13 acetate (TPA). We observed that 11β-HSD1 expression was decreased in all SK, SCC, and BCC lesions compared with unaffected skin. Conversely, 11β-HSD2 expression was increased in SK and BCC but not in SCC. Overexpression of 11β-HSD2 in keratinocytes increased cell proliferation. In the murine model, 11β-HSD1 expression was decreased in TPA-treated hyperproliferative skin. Our findings suggest that 11β-HSD1 expression is decreased in keratinocyte proliferative conditions, and 11β-HSD2 expression is increased in basal cell proliferating conditions, such as BCC and SK. Assessing 11β-HSD1 and 11β-HSD2 expression could be a useful tool for diagnosing and characterizing skin tumors.

  8. Expression of messenger ribonucleic acid and presence of immunoreactive proteins for epidermal growth factor (EGF), transforming growth factor alpha (TGF alpha) and EGF/TGF alpha receptors and 125I-EGF binding sites in human fallopian tube.


    Chegini, N; Zhao, Y; McLean, F W


    Reverse transcription polymerase chain reaction (RT-PCR) revealed that the Fallopian tubes express epidermal growth factor (EGF), transforming growth factor (TGF alpha), and EGF receptor (EGF-R) mRNA. The RT-PCR product was verified by restriction enzyme digestion analysis. Immunohistochemically, EGF, TGF alpha, and EGF-R were localized in Fallopian tubes by use of specific antibodies to human EGF, mature fragments of human TGF alpha, and monoclonal antibodies to the extracellular binding domain of EGF-R. The tubal epithelial cells were the primary site of immunoreactive EGF, TGF alpha, and EGF-R, which were present to a lesser extent in the stromal cells, smooth muscle cell layers, fibroblasts of serosal tissue, and arterial endothelial and smooth muscle cells. Using antibodies generated against the amino and carboxy termini of TGF alpha precursor produced a similar cellular distribution to that observed for mature TGF alpha. The intensity of immunoreactive TGF alpha with these antibodies was similar to that seen with EGF. The ciliated and nonciliated epithelial cells in the ampullary and isthmus regions immunostained with similar intensity for EGF, TGF alpha, and EGF-R. The immunostaining for EGF, TGF alpha, and EGF-R was cycle-dependent, was considerably higher during late proliferative and early-to-mid-secretory phases than during early proliferative and late secretory phases of the menstrual cycle, and was reduced during the postmenopausal period. Specimens obtained 5-12 yr after tubal ligation immunostained for EGF, TGF alpha, and EGF-R similarly to sections from unligated tubes taken during the same phase of the cycle. Quantitative autoradiography of 125I-EGF binding generated a pattern similar to that of immunostaining for EGF-R binding. Net grain density/100 microns 2 calculated for different cell types indicated that the epithelial cells had a significantly higher grain density than did other tubal cell types (p < 0.05) without the cycle dependency seen

  9. Impact of estrogen receptor (ER) and human epidermal growth factor receptor-2 (HER2) co-expression on breast cancer disease characteristics: implications for tumor biology and research.


    Alqaisi, Abeer; Chen, Li; Romond, Edward; Chambers, Mara; Stevens, Mark; Pasley, Grace; Awasthi, Mukta; Massarweh, Suleiman


    ER and HER2 are critical drivers of breast cancer biology and can interact when co-expressed, but less data describe the impact of ER/HER2 co-expression on clinical disease characteristics. We studied the impact of ER and HER2 (co)-expression in a cohort of 1,187 patients with invasive breast cancer and compared disease characteristics among different groups according to ER and HER2 status. Age, tumor size, grade, nodal status, TNM stage, and metastatic sites were compared and significance determined using the appropriate t tests. All p values were two-tailed. Compared to ER-negative/HER2-negative disease as the control group, ER expression was associated with older age, smaller tumors, lower grade, earlier TNM stage, and increased bone involvement in de novo metastasis, while HER2 had no significant impact on these characteristics. ER and HER2 co-expression was associated with lower grade and higher bone involvement in de novo metastasis, reflecting a retained impact for ER. HER2 impact on ER-positive disease was reflected by younger age, higher grade and TNM stage, and increased frequency of visceral involvement in de novo metastasis. Within the ER-positive/HER2-positive group, triple positive breast cancer (ER+/PgR+/HER2+) was associated with younger age compared to ER+/PgR-/HER2+ disease (mean age of 50.8 vs. 56 years, p = 0.0226). PgR was also associated with younger age in ER+/HER2- disease with a mean age of 57.6 years in ER+/PgR+/HER2- disease vs. 63.4 years in ER+/PgR-/HER2- disease (p < 0.0001). In conclusion, ER has a profound impact on breast cancer characteristics, including a retained impact when co-expressed with HER2. Similarly, HER2 dramatically modulates ER-positive breast cancer making it more aggressive. PgR association with young age may be related to hormonal levels of the premenopausal state, with HER2 providing an earlier growth advantage in triple positive disease, suggesting a specific dependence for this subset on high estrogen

  10. Neuropilin 1 expression correlates with differentiation status of epidermal cells and cutaneous squamous cell carcinomas.


    Shahrabi-Farahani, Shokoufeh; Wang, Lili; Zwaans, Bernadette M M; Santana, Jeans M; Shimizu, Akio; Takashima, Seiji; Kreuter, Michael; Coultas, Leigh; D'Amore, Patricia A; Arbeit, Jeffrey M; Akslen, Lars A; Bielenberg, Diane R


    Neuropilins (NRPs) are cell surface receptors for vascular endothelial growth factor (VEGF) and SEMA3 (class 3 semaphorin) family members. The role of NRPs in neurons and endothelial cells has been investigated, but the expression and role of NRPs in epithelial cells is much less clear. Herein, the expression and localization of NRP1 was investigated in human and mouse skin and squamous cell carcinomas (SCCs). Results indicated that NRP1 mRNA and protein was expressed in the suprabasal epithelial layers of the skin sections. NRP1 staining did not overlap with that of keratin 14 (K14) or proliferating cell nuclear antigen, but did co-localize with staining for keratin 1, indicating that differentiated keratinocytes express NRP1. Similar to the expression of NRP1, VEGF-A was expressed in suprabasal epithelial cells, whereas Nrp2 and VEGFR2 were not detectable in the epidermis. The expression of NRP1 correlated with a high degree of differentiation in human SCC specimens, human SCC xenografts, and mouse K14-HPV16 transgenic SCC. UVB irradiation of mouse skin induced Nrp1 upregulation. In vitro, Nrp1 was upregulated in primary keratinocytes in response to differentiating media or epidermal growth factor-family growth factors. In conclusion, the expression of NRP1 is regulated in the skin and is selectively produced in differentiated epithelial cells. NRP1 may function as a reservoir to sequester VEGF ligand within the epithelial compartment, thereby modulating its bioactivity.

  11. Loss of epidermal hypoxia-inducible factor-1α accelerates epidermal aging and affects re-epithelialization in human and mouse.


    Rezvani, Hamid Reza; Ali, Nsrein; Serrano-Sanchez, Martin; Dubus, Pierre; Varon, Christine; Ged, Cécile; Pain, Catherine; Cario-André, Muriel; Seneschal, Julien; Taïeb, Alain; de Verneuil, Hubert; Mazurier, Frédéric


    In mouse and human skin, HIF-1α is constitutively expressed in the epidermis, mainly in the basal layer. HIF-1α has been shown to have crucial systemic functions: regulation of kidney erythropoietin production in mice with constitutive HIF-1α epidermal deletion, and hypervascularity following epidermal HIF-1α overexpression. However, its local role in keratinocyte physiology has not been clearly defined. To address the function of HIF-1α in the epidermis, we used the mouse model of HIF-1α knockout targeted to keratinocytes (K14-Cre/Hif1a(flox/flox)). These mice had a delayed skin phenotype characterized by skin atrophy and pruritic inflammation, partly mediated by basement membrane disturbances involving laminin-332 (Ln-332) and integrins. We also investigated the relevance of results of studies in mice to human skin using reconstructed epidermis and showed that HIF-1α knockdown in human keratinocytes impairs the formation of a viable reconstructed epidermis. A diminution of keratinocyte growth potential, following HIF-1α silencing, was associated with a decreased expression of Ln-322 and α6 integrin and β1 integrin. Overall, these results indicate a role of HIF-1α in skin homeostasis especially during epidermal aging.

  12. Corrective transduction of human epidermal stem cells in laminin-5-dependent junctional epidermolysis bullosa.


    Dellambra, E; Vailly, J; Pellegrini, G; Bondanza, S; Golisano, O; Macchia, C; Zambruno, G; Meneguzzi, G; De Luca, M


    Laminin-5 is composed of three distinct polypeptides, alpha3, beta3, and gamma2, which are encoded by three different genes, LAMA3, LAMB3, and LAMC2, respectively. We have isolated epidermal keratinocytes from a patient presenting with a lethal form of junctional epidermolysis bullosa characterized by a homozygous mutation of the LAMB3 gene, which led to complete absence of the beta3 polypeptide. In vitro, beta3-null keratinocytes were unable to synthesize laminin-5 and to assemble hemidesmosomes, maintained the impairment of their adhesive properties, and displayed a decrease of their colony-forming ability. A retroviral construct expressing a human beta3 cDNA was used to transduce primary beta3-null keratinocytes. Clonogenic beta3-null keratinocytes were transduced with an efficiency of 100%. Beta3-transduced keratinocytes were able to synthesize and secrete mature heterotrimeric laminin-5. Gene correction fully restored the keratinocyte adhesion machinery, including the capacity of proper hemidesmosomal assembly, and prevented the loss of the colony-forming ability, suggesting a direct link between adhesion to laminin-5 and keratinocyte proliferative capacity. Clonal analysis demonstrated that holoclones expressed the transgene permanently, suggesting stable correction of epidermal stem cells. Because cultured keratinocytes are used routinely to make autologous grafts for patients suffering from large skin or mucosal defects, the full phenotypic reversion of primary human epidermal stem cells defective for a structural protein opens new perspectives in the long-term treatment of genodermatoses.

  13. Imaging sulfur mustard lesions in human epidermal tissues and keratinocytes by confocal and multiphoton microscopy

    NASA Astrophysics Data System (ADS)

    Werrlein, Robert; Madren-Whalley, Janna S.


    Topical exposure to sulfur mustard (HD), a known theat agent, produces persistent and debilitating cutaneous blisters. The blisters occur at the dermal-epidermal junction following a dose-dependent latent period of 8-24 h, however, the primary lesions causing vesication remain uncertain. Immunofluorescent images reveal that a 5-min exposure to 400 (mu) M HD disrupts molecules that are also disrupted by epidermolysis bullosa-type blistering diseases of the skin. Using keratinocyte cultures and fluorochomes conjugated to two different keratin-14 (K14) antibodies (clones CKB1 and LL002), results have shown a statistically significant (p<0.1) 1-h decrease of 29.2% in expression of the CKB1 epitope, a nearly complete loss of CKB1 expression within 2 h, and progressive cytoskeletal (K14) collapse without loss in expression of the LL002 epitope. With human epidermal tissues, multi-photon images of (alpha) 6 integrin and laminin 5 showed disruptive changes in the cell-surface organization and integrity of these adhesion molecules. At 1 H postexposure, analyses showed a statistically significant (p<0.1) decrease of 27.3% in (alpha) 6 integrin emissions, and a 32% decrease in laminin 5 volume. Multi-photon imaging indicates that molecules essential for epidermal-dermal attachment are early targets in the alkylating events leading to HD-induced vesication.

  14. Mucin1 expression in focal epidermal dysplasia of actinic keratosis

    PubMed Central

    Carrillo, Luz Marina; Rojas, Héctor; Ramírez, Richard; Reyes, Oscar; Suárez, Ambar; Ortega, Fabiana


    Background Actinic keratoses (AKs) are generally considered as premalignant skin lesions that can progress into squamous cell carcinoma (SCC) in situ and invasive SCC. However, its progression to SCC is still matter of debate. A transmembrane glycoprotein that contributes to the progression of certain premalignant and malignant lesions is mucin1 (MUC1). Nevertheless, their functions in the skin lesions are not yet fully clear. Therefore, the aim of this study is to ascertain whether MUC1 is present in the focal epidermal dysplasia of AK. Methods Fourteen skin biopsies from patients diagnosed with AK were selected. They were classified according to the degree of dysplasia in keratinocyte intraepidermal neoplasia (KIN) I, KIN II, and KIN III. In five biopsies the three degrees were present, in two biopsies both KIN I and KIN II, in four biopsies only KIN I, and in three biopsies only KIN III. The presence of MUC1 was assessed by immunofluorescence staining using confocal laser scanning microscopy. Results Immunostaining revealed that MUC1 was present over the entire cell surface of only a few atypical basal keratinocytes confined to the lower third of the epidermis (KIN I). While in KIN II where atypical keratinocytes occupy the lower two thirds, MUC1 was localized at the apical surface of some atypical keratinocytes and over the entire cell surface of some of them. Interestingly, in KIN III where the atypical keratinocytes extend throughout the full thickness, MUC1 was localized at the apical surface and over the entire cell surface of many of these cells. Conversely, MUC1 expression was not detected in the epidermis of normal skin. Conclusions Our findings suggest that the expression of MUC1 in AK would be induced by alteration of keratinocyte stratification and differentiation and associated to the degree of dysplasia rather than the thickness of the epidermis. PMID:26605291

  15. Epidermal and hair follicle progenitor cells express melanoma-associated chondroitin sulfate proteoglycan core protein.


    Ghali, Lucy; Wong, Soon-Tee; Tidman, Nick; Quinn, Anthony; Philpott, Michael P; Leigh, Irene M


    Basal keratinocytes in the epidermis and hair follicle are biologically heterogeneous but must include a stable subpopulation of epidermal stem cells. In animal models these can be identified by their retention of radioactive label due to their slow cycle (label-retaining cells) but human studies largely depend on in vitro characterization of colony forming efficiency and clonogenicity. Differential integrin expression has been used to detect cells of increased proliferative potential but further stem cell markers are urgently required for in vivo and in vitro characterization. Using LHM2, a monoclonal antibody reacting with a high molecular weight melanoma-associated proteoglycan core protein, a subset of basal keratinocytes in both the interfollicular epidermis and the hair follicle has been identified. Coexpression of melanoma-associated chondroitin sulfate proteoglycan with keratins 15 and 19 as well as beta 1 and alpha 6 integrins has been examined in adult and fetal human skin from hair bearing, nonhair bearing, and palmoplantar regions. Although melanoma-associated chondroitin sulfate proteoglycan coexpression with a subset of beta 1 integrin bright basal keratinocytes within the epidermis suggests that melanoma-associated chondroitin sulfate proteoglycan colocalizes with epidermal stem cells, melanoma-associated chondroitin sulfate proteoglycan expression within the hair follicle was more complex and multiple subpopulations of basal outer root sheath keratinocytes are described. These data suggest that epithelial compartmentalization of the outer root sheath is more complex than interfollicular epidermis and further supports the hypothesis that more than one hair follicle stem cell compartment may exist.

  16. Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics

    SciTech Connect

    Ayyagari, R.R.; Khan-Dawood, F.S.


    Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol /sup 125/I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function.

  17. Staphylococcus aureus exploits epidermal barrier defects in atopic dermatitis to trigger cytokine expression

    PubMed Central

    Nakatsuji, Teruaki; Chen, Tiffany H.; Two, Aimee M.; Chun, Kimberly A.; Narala, Saisindhu; Geha, Raif S.; Hata, Tissa R.; Gallo, Richard L.


    Patients with atopic dermatitis (AD) have an abnormal skin barrier and are frequently colonized by S. aureus. In this study we investigated if S. aureus penetrates the epidermal barrier of subjects with AD and sought to understand the mechanism and functional significance of this entry. S. aureus was observed to be more abundant in the dermis of lesional skin from AD patients. Bacterial entry past the epidermis was observed in cultured human skin equivalents and in mice, but found to be increased in the skin of cathelicidin knockout (Camp−/−) and ovalbumin-sensitized filaggrin mutant (FLGft/ft) mice. S. aureus penetration through the epidermis was dependent on bacterial viability and protease activity as killed bacteria or a protease-null mutant strain of S. aureus was unable to penetrate. Entry of S. aureus directly correlated with increased expression of IL4, IL13, IL22, TSLP and other cytokines associated with AD, and with decreased expression of cathelicidin. These data illustrate how abnormalities of the epidermal barrier in AD can alter the balance of S. aureus entry into the dermis and provides an explanation for how such dermal dysbiosis results in increased inflammatory cytokines and exacerbation of disease. PMID:27381887

  18. Transcriptional profiling of epidermal keratinocytes: comparison of genes expressed in skin, cultured keratinocytes, and reconstituted epidermis, using large DNA microarrays.


    Gazel, Alix; Ramphal, Patricia; Rosdy, Martin; De Wever, Bart; Tornier, Carine; Hosein, Nadia; Lee, Brian; Tomic-Canic, Marjana; Blumenberg, Miroslav


    Epidermal keratinocytes are complex cells that create a unique three-dimensional (3-D) structure, differentiate through a multistage process, and respond to extracellular stimuli from nearby cells. Consequently, keratinocytes express many genes, i.e., have a relatively large "transcriptome." To determine which of the expressed genes are innate to keratinocytes, which are specific for the differentiation and 3-D architecture, and which are induced by other cell types, we compared the transcriptomes of skin from human subjects, differentiating 3-D reconstituted epidermis, cultured keratinocytes, and nonkeratinocyte cell types. Using large oligonucleotide microarrays, we analyzed five or more replicates of each, which yielded statistically consistent data and allowed identification of the differentially expressed genes. Epidermal keratinocytes, unlike other cells, express many proteases and protease inhibitors and genes that protect from UV light. Skin specifically expresses a higher number of receptors, secreted proteins, and transcription factors, perhaps influenced by the presence of nonkeratinocyte cell types. Surprisingly, mitochondrial proteins were significantly suppressed in skin, suggesting a low metabolic rate. Three-dimensional samples, skin and reconstituted epidermis, are similar to each other, expressing epidermal differentiation markers. Cultured keratinocytes express many cell-cycle and DNA replication genes, as well as integrins and extracellular matrix proteins. These results define innate, architecture-specific, and cell-type-regulated genes in epidermis.

  19. Low calcium culture condition induces mesenchymal cell-like phenotype in normal human epidermal keratinocytes

    SciTech Connect

    Takagi, Ryo; Yamato, Masayuki; Murakami, Daisuke; Sugiyama, Hiroaki; Okano, Teruo


    Highlights: {yields} Normal human epidermal keratinocytes serially cultured under low calcium concentration were cytokeratin and vimentin double positive cells. {yields} The human keratinocytes expressed some epithelial stem/progenitor cell makers, mesenchymal cell markers, and markers of epithelial-mesenchymal transition. {yields} Mesenchymal cell-like phenotype in the keratinocytes was suppressed under high-calcium condition. -- Abstract: Epithelial-mesenchymal transition (EMT) is an important cellular phenomenon in organ developments, cancer invasions, and wound healing, and many types of transformed cell lines are used for investigating for molecular mechanisms of EMT. However, there are few reports for EMT in normal human epithelial cells, which are non-transformed or non-immortalized cells, in vitro. Therefore, normal human epidermal keratinocytes (NHEK) serially cultured in low-calcium concentration medium (LCM) were used for investigating relations between differentiation and proliferation and mesenchymal-like phenotype in the present study, since long-term cultivation of NHEK is achieved in LCM. Interestingly, NHEK serially cultured in LCM consisted essentially of cytokeratin-vimentin double positive cells (98%), although the NHEK exhibited differentiation under high-calcium culture condition with 3T3 feeder layer. The vimentin expression was suppressed under high-calcium condition. These results may indicate the importance of mesenchymal-like phenotype for serially cultivation of NHEK in vitro.

  20. [Epidermal growth factor receptor expression and epidermal growth factor blood plasma content in simple and complex endometrial hyperplasia].


    Dznelashvili, N; Kasradze, D; Tavartkiladze, A; Mariamidze, A


    The goal of our study was to concurrently determine the prognostic significance of Epidermal Growth Factor Receptor (EGFR) expression in endometrium and Epidermal Growth Factor (EGF) blood content in simple and complex hyperplasia. In order to detect EGFR expression, immunohistochemical examination of endometrial scarp from 35 patients was done along with HPLC (High performance liquid chromatography) method, for measuring EGF blood plasma content. The numerical data obtained were processed statistically using computer program SPSS-12. According to the results: 1. A significant/marked increase in EGF blood plasma level together with pronounced EGFR expression in simple endometrial hyperplasia (without atypia) suggests that simple hyperplasia is likely to transform into complex form, while unchanged level of EGF against the background of mild EGFR expression is probably indicative of not very bad prognosis. 2. Normal indices of EGF blood plasma level in simple endometrial hyperplasia (without atypia), accompanied by mild EGFR expression is suggestive of good prognosis. 3. A sharp or extremely sharp increase in EGF blood plasma level with pronounced EGFR expression in complex endometrial hyperplasia (without atypia) is likely to indicate poor prognosis that may lead to the transformation into atypical form. However, unchanged EGF blood plasma level against the background of mild EGFR expression in complex endometrial hyperplasia (without atypia) is likely to point to not very bad prognosis. 4. A marked increase in EGF blood plasma level with a pronounced EGFR expression in complex endometrial hyperplasia (without atypia) is likely to indicate poor prognosis that may lead to the transformation into atypical form. Because it is evident that drastic increase in EGF blood plasma level is not necessary, other factor should be suspected to play the major role, i.e the substance that will (or will not) withstand neoplasia.

  1. Epidermal growth factor receptor expression in radiation-induced dog lung tumors by immunocytochemical localization

    SciTech Connect

    Leung, F.L.; Park, J.F.; Dagle, G.E.


    In studies to determine the role of growth factors in radiation-induced lung cancer, epidermal growth factor (EGFR) expression was examined by immunocytochemistry in 51 lung tumors from beagle dogs exposed to inhaled plutonium; 21 of 51 (41%) tumors were positive for EGFR. The traction of tumors positive for EGFR and the histological type of EGFR-positive tumors in the plutonium-exposed dogs were not different from spontaneous dog lung tumors, In which 36% were positive for EGFR. EGFR involvement in Pu-induced lung tumors appeared to be similar to that in spontaneous lung tumors. However, EGFR-positive staining was observed in only 1 of 16 tumors at the three lowest Pu exposure levels, compared to 20 of 35 tumors staining positive at the two highest Pu exposure levels. The results in dogs were in good agreement with the expression of EGFR reported in human non-small cell carcinoma of the lung, suggesting that Pu-induced lung tumors in the dog may be a suitable animal model to investigate the role of EGFR expression in lung carcinogenesis. In humans, EGFR expression in lung tumors has been primarily related to histological tumor types. In individual dogs with multiple primary lung tumors, the tumors were either all EGFR positive or EGFR negative, suggesting that EGFR expression may be related to the response of the individual dog as well as to the histological type of tumor.

  2. Reprogramming Postnatal Human Epidermal Keratinocytes toward Functional Neural Crest Fates.


    Bajpai, Vivek K; Kerosuo, Laura; Tseropoulos, Georgios; Cummings, Kirstie A; Wang, Xiaoyan; Lei, Pedro; Liu, Biao; Liu, Song; Popescu, Gabriela; Bronner, Marianne E; Andreadis, Stelios T


    During development, neural crest cells are induced by signaling events at the neural plate border of all vertebrate embryos. Initially arising within the central nervous system, neural crest cells subsequently undergo an epithelial to mesenchymal transition to migrate into the periphery, where they differentiate into diverse cell types. Here we provide evidence that postnatal human epidermal keratinocytes, in response to FGF2 and IGF1 signals, can be reprogrammed toward a neural crest fate. Genome-wide transcriptome analyses show that keratinocyte-derived neural crest cells are similar to those derived from human embryonic stem cells. Moreover, they give rise in vitro and in vivo to neural crest derivatives such as peripheral neurons, melanocytes, Schwann cells and mesenchymal cells (osteocytes, chondrocytes, adipocytes and smooth muscle). By demonstrating that human KRT14+ keratinocytes can form neural crest cells, even from clones of single cells, our results have important implications in stem cell biology and regenerative medicine. This article is protected by copyright. All rights reserved.

  3. TLR7-expressing cells comprise an interfollicular epidermal stem cell population in murine epidermis

    PubMed Central

    Yin, Chaoran; Zhang, Ting; Qiao, Liangjun; Du, Jia; Li, Shuang; Zhao, Hengguang; Wang, Fangfang; Huang, Qiaorong; Meng, Wentong; Zhu, Hongyan; Bu, Hong; Li, Hui; Xu, Hong; Mo, Xianming


    Normal interfollicular epidermis (IFE) homeostasis is maintained throughout the entire life by its own stem cells that self-renew and generate progeny that undergo terminal differentiation. However, the fine markers of the stem cells in interfollicular epidermis are not well defined yet. Here we found that TLR7 identified the existence of progenitors and interfollicular epidermal stem cells in murine skin. In vitro, TLR7-expressing cells comprised of two subpopulations that were competent to proliferate and exhibited distinct differentiation potentials. Three-dimensional (3D) organotypic culture and skin reconstitution assays showed that TLR7-expressing cells were able to reconstruct the interfollicular epidermis. Finally, TLR7-expressing cells maintained the intact interfollicular epidermal structures revealed in serial transplantation assays in vivo in mice. Taken together, our results suggest that TLR7-expressing cells comprise an interfollicular epidermal stem cell population. PMID:25060222

  4. Aqueous stability of human epidermal growth factor 1-48.


    Senderoff, R I; Wootton, S C; Boctor, A M; Chen, T M; Giordani, A B; Julian, T N; Radebaugh, G W


    Human epidermal growth factor 1-48 (hEGF 1-48, Des(49-53)hEGF) is a single chain polypeptide (48 amino acids; 3 disulfide bonds; 5445 Da) possessing a broad spectrum of biologic activity including the stimulation of cell proliferation and tissue growth. In this study, three primary aqueous degradation products of hEGF 1-48 were isolated using isocratic, reverse phase/ion-pair HPLC. The degradation products were characterized using amino acid sequencing, electrospray ionization mass spectrometry, isoelectric focusing, and degradation kinetics. Results indicate that hEGF 1-48 degrades via oxidation (Met21), deamidation (Asn1), and succinimide formation (Asp11). The relative contribution of each degradation pathway to the overall stability of hEGF 1-48 changes as a function of solution pH and storage condition. Succinimide formation at Asp11 is favored at pH < 6 in which aspartic acid is present mostly in its protonated form. Deamidation of Asn1 is favored at pH > 6. The relative contribution of Met21 oxidation is increased with decreasing temperature, storage as a frozen solution (-20 degrees C), and exposure to fluorescent light.

  5. Arsenite maintains germinative state in cultured human epidermal cells

    SciTech Connect

    Patterson, Timothy J.; Reznikova, Tatiana V.; Phillips, Marjorie A.; Rice, Robert H. . E-mail:


    Arsenic is a well-known carcinogen for human skin, but its mechanism of action and proximal macromolecular targets remain to be elucidated. In the present study, low micromolar concentrations of sodium arsenite maintained the proliferative potential of epidermal keratinocytes, decreasing their exit from the germinative compartment under conditions that promote differentiation of untreated cells. This effect was observed in suspension and in post-confluent surface cultures as measured by colony-forming ability and by proportion of rapidly adhering colony-forming cells. Arsenite-treated cultures exhibited elevated levels of {beta}1-integrin and {beta}-catenin, two proteins enriched in cells with high proliferative potential. Levels of phosphorylated (inactive) glycogen synthase kinase 3{beta} were higher in the treated cultures, likely accounting for the increased levels of transcriptionally available {beta}-catenin. These findings suggest that arsenic could have co-carcinogenic and tumor co-promoting activities in the epidermis as a result of increasing the population and persistence of germinative cells targeted by tumor initiators and promoters. These findings also identify a critical signal transduction pathway meriting further exploration in pursuit of this phenomenon.

  6. Effects of soap-water wash on human epidermal penetration.


    Zhu, Hanjiang; Jung, Eui-Chang; Phuong, Christina; Hui, Xiaoying; Maibach, Howard


    Skin decontamination is a primary interventional method used to decrease dermal absorption of hazardous contaminants, including chemical warfare agents, pesticides and industrial pollutants. Soap and water wash, the most common and readily available decontamination system, may enhance percutaneous absorption through the "wash-in effect." To understand better the effect of soap-water wash on percutaneous penetration, and provide insight to improving skin decontamination methods, in vitro human epidermal penetration rates of four C(14) -labeled model chemicals (hydroquinone, clonidine, benzoic acid and paraoxon) were assayed using flow-through diffusion cells. Stratum corneum (SC) absorption rates of these chemicals at various hydration levels (0-295% of the dry SC weights) were determined and compared with the results of the epidermal penetration study to clarify the effect of SC hydration on skin permeability. Results showed accelerated penetration curves of benzoic acid and paraoxon after surface wash at 30 min postdosing. Thirty minutes after washing (60 min postdosing), penetration rates of hydroquinone and benzoic acid decreased due to reduced amounts of chemical on the skin surface and in the SC. At the end of the experiment (90 min postdosing), a soap-water wash resulted in lower hydroquinone penetration, greater paraoxon penetration and similar levels of benzoic acid and clonidine penetration compared to penetration levels in the non-wash groups. The observed wash-in effect agrees with the enhancement effect of SC hydration on the SC chemical absorption rate. These results suggest SC hydration derived from surface wash to be one cause of the wash-in effect. Further, the occurrence of a wash-in effect is dependent on chemical identity and elapsed time between exposure and onset of decontamination. By reducing chemical residue quantity on skin surface and in the SC reservoir, the soap-water wash may decrease the total quantity of chemical absorbed in the

  7. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function.


    Boer, Magdalena; Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola


    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part - stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function.

  8. Structural and biophysical characteristics of human skin in maintaining proper epidermal barrier function

    PubMed Central

    Duchnik, Ewa; Maleszka, Romuald; Marchlewicz, Mariola


    The complex structure of human skin and its physicochemical properties turn it into an efficient outermost defence line against exogenous factors, and help maintain homeostasis of the human body. This role is played by the epidermal barrier with its major part – stratum corneum. The condition of the epidermal barrier depends on individual and environmental factors. The most important biophysical parameters characterizing the status of this barrier are the skin pH, epidermal hydration, transepidermal water loss and sebum excretion. The knowledge of biophysical skin processes may be useful for the implementation of prophylactic actions whose aim is to restore the barrier function. PMID:26985171

  9. Nifedipine prevents sodium caprate-induced barrier dysfunction in human epidermal keratinocyte cultures.


    Uchino, Yoshihiro; Matsumoto, Junichi; Watanabe, Takuya; Hamabashiri, Masato; Tsuchiya, Takashi; Kimura, Ikuya; Yamauchi, Atsushi; Kataoka, Yasufumi


    Tight junctions (TJs) of the epidermis play an important role in maintaining the epidermal barrier. TJ breakdown is associated with skin problems, such as wrinkles and transepidermal water loss (TEWL). Clinical studies have reported that topical nifedipine is effective in reducing the depth of wrinkles and improving TEWL. However, it remains unknown whether nifedipine influences the TJ function in the epidermis. In the present study, we investigated the effect of nifedipine on epidermal barrier dysfunction in normal human epidermal keratinocytes (NHEKs) treated with sodium caprate (C10), a TJ inhibitor. Nifedipine reversed the C10-decreased transepithelial electrical resistance values as a measure of disruption of the epidermal barrier. Immunocytochemical observations revealed that nifedipine improved the C10-induced irregular arrangement of claudin-1, a key protein in TJs. Taken together, these findings suggest that nifedipine prevents epidermal barrier dysfunction, at least in part, by reconstituting the irregular claudin-1 localization at TJs in C10-treated NHEKs.

  10. Epidermal growth factor receptor inhibitors trigger a type I interferon response in human skin

    PubMed Central

    Pastore, Saveria


    The Epidermal Growth Factor Receptor (EGFR) is centrally involved in the regulation of key processes of the epithelia, including cell proliferation, survival, differentiation, and also tumorigenesis. Humanized antibodies and small-molecule inhibitors targeting EGFR were developed to disrupt these functions in cancer cells and are currently used in the treatment of diverse metastatic epithelial cancers. By contrast, these drugs possess significant skin-specific toxic effects, comprising the establishment of a persistent inflammatory milieu. So far, the molecular mechanisms underlying these epiphenomena have been investigated rather poorly. Here we showed that keratinocytes respond to anti-EGFR drugs with the development of a type I interferon molecular signature. Upregulation of the transcription factor IRF1 is early implicated in the enhanced expression of interferon-kappa, leading to persistent activation of STAT1 and further amplification of downstream interferon-induced genes, including anti-viral effectors and chemokines. When anti-EGFR drugs are associated to TNF-α, whose expression is enhanced by the drugs themselves, all these molecular events undergo a dramatic enhancement by synergy mechanisms. Finally, high levels of interferon-kappa can be observed in epidermal keratinocytes and also in leukocytes infiltrating the upper dermis of cetuximab-driven skin lesions. Our data suggest that dysregulated activation of type I interferon innate immunity is implicated in the molecular processes triggered by anti-EGFR drugs and leading to persistent skin inflammation. PMID:27322144

  11. Oropharyngeal cancers: relationship between epidermal growth factor receptor alterations and human papillomavirus status.


    Mirghani, H; Amen, F; Moreau, F; Guigay, J; Hartl, D M; Lacau St Guily, J


    High-risk human papillomavirus (HR-HPV), particularly type 16, is now recognised as a causative agent in a subset of oropharyngeal squamous cell carcinomas (OPSCCs). These tumours are on the increase and generally have a better prognosis than their HPV negative counterparts. This raises the question of de escalation therapy to reduce long term consequences in a younger cohort of patients with a long life expectancy. Several clinical trials with anti-epidermal growth factor receptor (EGFR) therapies, particularly cetuximab, are ongoing. Few data exist on the relationship between EGFR and HPV induced oropharyngeal cancers. We summarise the main studies in relation to EGFR alterations (gene copy number, protein expression and mutations) and the impact on prognosis of HPV positive tumours that express high levels of EGFR. We also discuss the opportunity of targeting this pathway in light of recent studies.

  12. Loss of epidermal MMP-14 expression interferes with angiogenesis but not with re-epithelialization.


    Zigrino, Paola; Ayachi, Ouissam; Schild, Alexander; Kaltenberg, Jennifer; Zamek, Jan; Nischt, Roswitha; Koch, Manuel; Mauch, Cornelia


    Synthesis and activation of matrix metalloproteinases during wound healing are important for remodeling the extracellular matrix and modulating various cellular functions. The membrane-type 1 matrix metalloproteinase (MMP-14) has been shown to play a key role during these processes. To analyze the function of epidermal-derived MMP-14 during skin repair we generated mice lacking MMP-14 expression in the epidermis (MMP-14(ep-/-)). These mice displayed overall normal skin morphology and epidermal differentiation patterns. Wound repair in MMP-14(ep-/-) followed the same kinetics as in wild type mice (MMP-14(ep+/+)), and infiltration of neutrophils, leukocytes, and macrophages into the wound site was comparable. Microscopic analysis showed no altered re-epithelialization in the absence of epidermal MMP-14. Furthermore, epidermal differentiation at the end of the repair process and scar formation was normal. However, at day 14 post wounding, sustained angiogenesis was observed in MMP-14(ep-/-) mice in contrast to control mice. Interestingly, decreased levels of endostatin were detected in wound lysates of MMP-14(ep-/-) mice as well as in cultured keratinocytes. Taken together, these data indicate that MMP-14 expression in keratinocytes is dispensable for skin homeostasis and repair, but plays a crucial role in the epidermal-dermal crosstalk leading to modulation of vessel density.

  13. RNA interference mediated JAM-A gene silencing promotes human epidermal stem cell proliferation.


    Zhou, Tong; Wu, Minjuan; Guo, Xiaocan; Liu, Houqi


    The objective of the study was to explore the influence of junctional adhesion molecule A (JAM-A) gene decoration on proliferation and differentiation of human epidermal stem cells (hEpSCs). JAM-A gene and JAM-A interference gene lentivirus eukaryotic expression vectors were established. The recombinant lentivirus was introduced into hEpSCs to observe and detect viral transfection by fluorescence microscopy and Western blot, respectively. After confirmation of successful introduction of the target gene, cell growth curves were mapped out by cytometry to detect cell proliferation in different groups. The expression of hEpSCs labeled molecules was detected by immunofluorescence, and cell safety was detected by teratoma test in all groups. (1) Fluorescence microscopy showed that in the JAM-A over-expression (JAM-A(ov) EpSCs) group, the green fluorescence was mainly distributed in the cell membrane; in the JAM-A interference (JAM-A(kd) EpSCs) group and blank vector (GFP EpSCs) group, all cell bodies were luminous. Western blot showed that JAM-A protein was up-regulated in JAM-A(ov) EpSCs and down-regulated in JAM-A(kd) EpSCs. (2) Growth curves showed that hEpSCs entered the quick-growing phase 4 days after inoculation and reached the platform phase at day 7. JAM-A(ov) EpSCs proliferated more slowly than GFP EpSCs, while JAM-A(kd) EpSCs proliferated significantly faster than GFP EpSCs. (3) Immunofluorescence showed that the expression of transient amplification epidermal marker keratin 14, hEpSCs marker keratin I9 and β-integrin was down-regulated in JAM-A(kd) EpSCs group as compared to that in the GFP EpSCs group, and the expression of epidermal terminal differentiation marker K10 was negative in the JAM-A(kd) EpSCs group. There was no significant difference in the expression of specific molecules between JAM-A(ov) EpSCs and hEpSCs. (4) The result of teratoma test was negative in all groups. The proliferative ability of hEpSCs was increased markedly after down


    PubMed Central

    Slominski, Andrzej T.; Janjetovic, Zorica; Kim, Tae-Kang; Wasilewski, Piotr; Rosas, Sofia; Hanna, Sherie; Sayre, Robert M.; Dowdy, John C.; Li, Wei; Tuckey, Robert C.


    CYP11A1 hydroxylates the side chain of vitamin D3 (D3) in a sequential fashion [D3→20S(OH)D3→20,23(OH)2D3→ 17,20,23(OH)3D3], in an alternative to the classical pathway of activation [D3→25(OH)D3→1,25(OH)2D3]. The products/intermediates of the pathway can be further modified by the action of CYP27B1. The CYP11A1-derived products are biologically active with functions determined by the lineage of the target cells. This pathway can operate in epidermal keratinocytes. To further define the role of these novel secosteroids we tested them for protective effects against UVB-induced damage in human epidermal keratinocytes, melanocytes and HaCaT keratinocytes, cultured in vitro. The secosteroids attenuated ROS, H2O2 and NO production by UVB-irradiated keratinocytes and melanocytes, with an efficacy similar to 1,25(OH)2D3, while 25(OH)D3 had lower efficacy. These attenuations were also seen to some extent for the 20(OH)D3 precursor, 20S-hydroxy-7-dehydrocholesterol. These effects were accompanied by upregulation of genes encoding enzymes responsible for defence against oxidative stress. Using immunofluorescent staining we observed that the secosteroids reduced the generation cyclobutane pyrimidine dimers in response to UVB and enhanced expression of p53 phosphorylated at Ser-15, but not at Ser-46. Additional evidence for protection against DNA damage in cells exposed to UVB and treated with secosteroids was provided by the Comet assay where DNA fragmentation was markedly reduced by 20(OH)D3 and 20,23(OH)2D3. In conclusion, novel secosteroids that can be produced by the action of CYP11A1 in epidermal keratinocytes have protective effects against UVB radiation. PMID:25617667

  15. Large-scale identification of human genes implicated in epidermal barrier function

    PubMed Central

    Toulza, Eve; Mattiuzzo, Nicolas R; Galliano, Marie-Florence; Jonca, Nathalie; Dossat, Carole; Jacob, Daniel; de Daruvar, Antoine; Wincker, Patrick; Serre, Guy; Guerrin, Marina


    Background During epidermal differentiation, keratinocytes progressing through the suprabasal layers undergo complex and tightly regulated biochemical modifications leading to cornification and desquamation. The last living cells, the granular keratinocytes (GKs), produce almost all of the proteins and lipids required for the protective barrier function before their programmed cell death gives rise to corneocytes. We present here the first analysis of the transcriptome of human GKs, purified from healthy epidermis by an original approach. Results Using the ORESTES method, 22,585 expressed sequence tags (ESTs) were produced that matched 3,387 genes. Despite normalization provided by this method (mean 4.6 ORESTES per gene), some highly transcribed genes, including that encoding dermokine, were overrepresented. About 330 expressed genes displayed less than 100 ESTs in UniGene clusters and are most likely to be specific for GKs and potentially involved in barrier function. This hypothesis was tested by comparing the relative expression of 73 genes in the basal and granular layers of epidermis by quantitative RT-PCR. Among these, 33 were identified as new, highly specific markers of GKs, including those encoding a protease, protease inhibitors and proteins involved in lipid metabolism and transport. We identified filaggrin 2 (also called ifapsoriasin), a poorly characterized member of the epidermal differentiation complex, as well as three new lipase genes clustered with paralogous genes on chromosome 10q23.31. A new gene of unknown function, C1orf81, is specifically disrupted in the human genome by a frameshift mutation. Conclusion These data increase the present knowledge of genes responsible for the formation of the skin barrier and suggest new candidates for genodermatoses of unknown origin. PMID:17562024

  16. Expression of DKK1 and β-catenin in epidermal neoplasms and their correlation

    PubMed Central

    He, Xuan; Li, Shuang; Luo, Xiaoji; Hu, Dongyu; Cai, Tao; Huang, Kun; Zhou, Weikang; Chen, Jin


    Objective: To investigate the expression of Dickkopf-1 (DKK1) and β-catenin and their correlation in epidermal neoplasms. Methods: Immunohistochemical staining was applied to detect the expression of DKK1 and β-catenin in tissue samples of 19 cases of seborrheic keratosis (SK), 16 cases of actinic keratosis (AK), 24 cases of Bowen’s disease (BD), 25 cases of cutaneous squamous cell carcinoma (SCC), and 22 cases of normal epidermal tissue (NET). Results: DKK1 was expressed in cytoplasm in normal epidermis. The positive expression rates of DKK1 in SK, AK, BD and SCC were 63.16%, 50.00%, 12.50% and 8.00%, respectively. β-catenin was expressed in cell membrane in normal epidermis. The abnormal expression rates of β-catenin in SK, AK, BD and SCC were 15.79%, 56.25%, 91.67% and 96.00%, respectively. Additionally, significant negative correlation was observable between the expression of β-catenin and DKK1 (r=-0.692, P=0.000). Conclusion: The Wnt signaling pathway may play an important role in the process of epidermal neoplasms formation. The loss of DKK1 promotes the abnormal expression of β-catenin through Wnt signaling pathway. PMID:26770505

  17. Mechanical Stretch on Human Skin Equivalents Increases the Epidermal Thickness and Develops the Basement Membrane

    PubMed Central

    Tokuyama, Eijiro; Nagai, Yusuke; Takahashi, Ken; Kimata, Yoshihiro; Naruse, Keiji


    All previous reports concerning the effect of stretch on cultured skin cells dealt with experiments on epidermal keratinocytes or dermal fibroblasts alone. The aim of the present study was to develop a system that allows application of stretch stimuli to human skin equivalents (HSEs), prepared by coculturing of these two types of cells. In addition, this study aimed to analyze the effect of a stretch on keratinization of the epidermis and on the basement membrane. HSEs were prepared in a gutter-like structure created with a porous silicone sheet in a silicone chamber. After 5-day stimulation with stretching, HSEs were analyzed histologically and immunohistologically. Stretch-stimulated HSEs had a thicker epidermal layer and expressed significantly greater levels of laminin 5 and collagen IV/VII in the basal layer compared with HSEs not subjected to stretch stimulation. Transmission electron microscopy revealed that the structure of the basement membrane was more developed in HSEs subjected to stretching. Our model may be relevant for extrapolating the effect of a stretch on the skin in a state similar to an in vivo system. This experimental system may be useful for analysis of the effects of stretch stimuli on skin properties and wound healing and is also expected to be applicable to an in vitro model of a hypertrophic scar in the future. PMID:26528823

  18. Mechanical Stretch on Human Skin Equivalents Increases the Epidermal Thickness and Develops the Basement Membrane.


    Tokuyama, Eijiro; Nagai, Yusuke; Takahashi, Ken; Kimata, Yoshihiro; Naruse, Keiji


    All previous reports concerning the effect of stretch on cultured skin cells dealt with experiments on epidermal keratinocytes or dermal fibroblasts alone. The aim of the present study was to develop a system that allows application of stretch stimuli to human skin equivalents (HSEs), prepared by coculturing of these two types of cells. In addition, this study aimed to analyze the effect of a stretch on keratinization of the epidermis and on the basement membrane. HSEs were prepared in a gutter-like structure created with a porous silicone sheet in a silicone chamber. After 5-day stimulation with stretching, HSEs were analyzed histologically and immunohistologically. Stretch-stimulated HSEs had a thicker epidermal layer and expressed significantly greater levels of laminin 5 and collagen IV/VII in the basal layer compared with HSEs not subjected to stretch stimulation. Transmission electron microscopy revealed that the structure of the basement membrane was more developed in HSEs subjected to stretching. Our model may be relevant for extrapolating the effect of a stretch on the skin in a state similar to an in vivo system. This experimental system may be useful for analysis of the effects of stretch stimuli on skin properties and wound healing and is also expected to be applicable to an in vitro model of a hypertrophic scar in the future.

  19. Role for WNT16B in human epidermal keratinocyte proliferation and differentiation.


    Teh, Muy-Teck; Blaydon, Diana; Ghali, Lucy R; Briggs, Victoria; Edmunds, Scott; Pantazi, Eleni; Barnes, Michael R; Leigh, Irene M; Kelsell, David P; Philpott, Michael P


    WNT signalling regulates a variety of cell functions including cell fate, polarity, and differentiation via the canonical or beta-catenin stabilisation pathway and/or the planar cell polarity or non-canonical pathway. We have previously demonstrated that two isoforms (A and B) from the WNT16 locus have differential expression in various adult human tissues. In this study we show that WNT16B but not WNT16A isoform was upregulated in basal cell carcinomas compared with normal skin. We further investigated the cellular and molecular functions of WNT16B in primary human epidermal keratinocytes and a keratinocyte cell line. Cellular expression of WNT16B neither stabilised beta-catenin nor activated the lymphoid enhancer factor or T-cell factor transcriptional reporter in primary keratinocytes. WNT16B activated the Jun-N-terminal kinase cascade suggesting the activation of a non-canonical WNT signalling pathway. Constitutive expression of WNT16B significantly enhanced the rate of cell proliferation and prolonged clonogenicity in primary keratinocytes. Silencing WNT16B by RNA interference reduced keratinocyte proliferation. Furthermore, overexpression of WNT16B induced a hyperproliferation phenotype in an organotypical culture system. This work presents the first evidence that WNT16B activates human keratinocyte proliferation possibly via a beta-catenin-independent non-canonical WNT transduction pathway.

  20. Human Papilloma Viral DNA Replicates as a Stable Episome in Cultured Epidermal Keratinocytes

    NASA Astrophysics Data System (ADS)

    Laporta, Robert F.; Taichman, Lorne B.


    Human papilloma virus (HPV) is poorly understood because systems for its growth in tissue culture have not been developed. We report here that cultured human epidermal keratinocytes could be infected with HPV from plantar warts and that the viral DNA persisted and replicated as a stable episome. There were 50-200 copies of viral DNA per cell and there was no evidence to indicate integration of viral DNA into the cellular genome. There was also no evidence to suggest that viral DNA underwent productive replication. We conclude that cultured human epidermal keratinocytes may be a model for the study of certain aspects of HPV biology.

  1. Th22 cells represent a distinct human T cell subset involved in epidermal immunity and remodeling.


    Eyerich, Stefanie; Eyerich, Kilian; Pennino, Davide; Carbone, Teresa; Nasorri, Francesca; Pallotta, Sabatino; Cianfarani, Francesca; Odorisio, Teresa; Traidl-Hoffmann, Claudia; Behrendt, Heidrun; Durham, Stephen R; Schmidt-Weber, Carsten B; Cavani, Andrea


    Th subsets are defined according to their production of lineage-indicating cytokines and functions. In this study, we have identified a subset of human Th cells that infiltrates the epidermis in individuals with inflammatory skin disorders and is characterized by the secretion of IL-22 and TNF-alpha, but not IFN-gamma, IL-4, or IL-17. In analogy to the Th17 subset, cells with this cytokine profile have been named the Th22 subset. Th22 clones derived from patients with psoriasis were stable in culture and exhibited a transcriptome profile clearly separate from those of Th1, Th2, and Th17 cells; it included genes encoding proteins involved in tissue remodeling, such as FGFs, and chemokines involved in angiogenesis and fibrosis. Primary human keratinocytes exposed to Th22 supernatants expressed a transcriptome response profile that included genes involved in innate immune pathways and the induction and modulation of adaptive immunity. These proinflammatory Th22 responses were synergistically dependent on IL-22 and TNF-alpha. Furthermore, Th22 supernatants enhanced wound healing in an in vitro injury model, which was exclusively dependent on IL-22. In conclusion, the human Th22 subset may represent a separate T cell subset with a distinct identity with respect to gene expression and function, present within the epidermal layer in inflammatory skin diseases. Future strategies directed against the Th22 subset may be of value in chronic inflammatory skin disorders.

  2. Human epidermal neural crest stem cells as a source of Schwann cells

    PubMed Central

    Sakaue, Motoharu; Sieber-Blum, Maya


    We show that highly pure populations of human Schwann cells can be derived rapidly and in a straightforward way, without the need for genetic manipulation, from human epidermal neural crest stem cells [hEPI-NCSC(s)] present in the bulge of hair follicles. These human Schwann cells promise to be a useful tool for cell-based therapies, disease modelling and drug discovery. Schwann cells are glia that support axons of peripheral nerves and are direct descendants of the embryonic neural crest. Peripheral nerves are damaged in various conditions, including through trauma or tumour-related surgery, and Schwann cells are required for their repair and regeneration. Schwann cells also promise to be useful for treating spinal cord injuries. Ex vivo expansion of hEPI-NCSC isolated from hair bulge explants, manipulating the WNT, sonic hedgehog and TGFβ signalling pathways, and exposure of the cells to pertinent growth factors led to the expression of the Schwann cell markers SOX10, KROX20 (EGR2), p75NTR (NGFR), MBP and S100B by day 4 in virtually all cells, and maturation was completed by 2 weeks of differentiation. Gene expression profiling demonstrated expression of transcripts for neurotrophic and angiogenic factors, as well as JUN, all of which are essential for nerve regeneration. Co-culture of hEPI-NCSC-derived human Schwann cells with rodent dorsal root ganglia showed interaction of the Schwann cells with axons, providing evidence of Schwann cell functionality. We conclude that hEPI-NCSCs are a biologically relevant source for generating large and highly pure populations of human Schwann cells. PMID:26251357

  3. Human umbilical cord-derived mesenchymal stem cells differentiate into epidermal-like cells using a novel co-culture technique.


    Li, Dongjie; Chai, Jiake; Shen, Chuanan; Han, Yanfu; Sun, Tianjun


    Human umbilical cord-derived mesenchymal stem cells (hUCMSCs) isolated from human umbilical Wharton's Jelly are a population of primitive and pluripotent cells. In specific conditions, hUCMSCs can differentiate into various cells, including adipocytes, osteoblasts, chondrocytes, neurocytes, and endothelial cells. However, few studies have assessed their differentiation into epidermal cells in vitro. To assess the potential of hUCMSCs to differentiate into epidermal cells, a microporous membrane-based indirect co-culture system was developed in this study. Epidermal stem cells (ESCs) were seeded on the bottom of the microporous membrane, and hUCMSCs were seeded on the top of the microporous membrane. Cell morphology was assessed by phase contrast microscopy, and the expression of early markers of epidermal cell lineage, P63, cytokeratin19 (CK19), and β1-integrin, was determined by immunofluorescence, Western blot, and quantitative real-time PCR (Q-PCR) analyses. hUCMSC morphology changed from spindle-like to oblate or irregular with indirect co-culture with ESCs; they also expressed greater levels P63, CK19, and β1-integrin mRNA and protein compared to the controls (p < 0.01). As compared to normal co-cultures, indirect co-culture expressed significantly greater CK19 protein (p < 0.01). Thus, hUCMSCs may have the capability to differentiate into the epidermal lineage in vitro, which may be accomplished through this indirect co-culture model.

  4. Increased expression of epidermal growth factor receptor induces sequestration of extracellular signal-related kinases and selective attenuation of specific epidermal growth factor-mediated signal transduction pathways.


    Habib, Amyn A; Chun, Soo Jin; Neel, Benjamin G; Vartanian, Timothy


    Increased expression of the epidermal growth factor receptor (EGFR) is common in cancer and correlates with neoplastic progression. Although the biology of this receptor has been the subject of intense investigation, surprisingly little is known about how increased expression of the wild-type EGFR affects downstream signal transduction in cells. We show that increasing the expression of the receptor results in dramatic shifts in signaling with attenuation of EGF-induced Ras, extracellular signal-related kinases (ERKs), and Akt activation, as well as amplification of STAT1 and STAT3 signaling. In this study, we focus on the mechanism of attenuated ERK signaling and present evidence suggesting that the mechanism of attenuated ERK signaling in EGFR-overexpressing cells is a sequestration of ERKs at the cell membrane in EGFR-containing complexes. Increased expression of the EGFR results in an aberrant localization of ERKs to the cell membrane. Furthermore, ERKs become associated with the EGFR in a physical complex in EGFR-overexpressing cells but not in control cells. The EGFR-ERK association is detected in unstimulated cells or on exposure to a low concentration of EGF; under these conditions, ERK activation is minimal. Exposure of these cells to saturating concentrations of EGF results in a decreased membrane localization of ERKs, a concomitant dissociation of ERKs from the EGFR, and restores ERK activation. A similar association can be detected between the EGFR and MEK1 in receptor-overexpressing cells, suggesting that multiple components of the ERK signaling pathway may become trapped in complexes with the EGFR. These findings can be demonstrated in cells transfected to express high levels of the EGFR as well as in cancer cells which naturally overexpress the EGFR and, thus, may be representative of altered EGFR signaling in human cancer.

  5. Growth of melanocytes in human epidermal cell cultures

    SciTech Connect

    Staiano-Coico, L.; Hefton, J.M.; Amadeo, C.; Pagan-Charry, I.; Madden, M.R.; Cardon-Cardo, C. )


    Epidermal cell cultures were grown in keratinocyte-conditioned medium for use as burn wound grafts; the melanocyte composition of the grafts was studied under a variety of conditions. Melanocytes were identified by immunohistochemistry based on a monoclonal antibody (MEL-5) that has previously been shown to react specifically with melanocytes. During the first 7 days of growth in primary culture, the total number of melanocytes in the epidermal cultures decreased to 10% of the number present in normal skin. Beginning on day 2 of culture, bipolar melanocytes were present at a mean cell density of 116 +/- 2/mm2; the keratinocyte to melanocyte ratio was preserved during further primary culture and through three subpassages. Moreover, exposure of cultures to mild UVB irradiation stimulated the melanocytes to proliferate, suggesting that the melanocytes growing in culture maintained their responsiveness to external stimuli. When the sheets of cultured cells were enzymatically detached from the plastic culture flasks before grafting, melanocytes remained in the basal layer of cells as part of the graft applied to the patient.

  6. Parabens and Human Epidermal Growth Factor Receptor Ligand Cross-Talk in Breast Cancer Cells

    PubMed Central

    Pan, Shawn; Yuan, Chaoshen; Tagmount, Abderrahmane; Rudel, Ruthann A.; Ackerman, Janet M.; Yaswen, Paul; Vulpe, Chris D.; Leitman, Dale C.


    Background: Xenoestrogens are synthetic compounds that mimic endogenous estrogens by binding to and activating estrogen receptors. Exposure to estrogens and to some xenoestrogens has been associated with cell proliferation and an increased risk of breast cancer. Despite evidence of estrogenicity, parabens are among the most widely used xenoestrogens in cosmetics and personal-care products and are generally considered safe. However, previous cell-based studies with parabens do not take into account the signaling cross-talk between estrogen receptor α (ERα) and the human epidermal growth factor receptor (HER) family. Objectives: We investigated the hypothesis that the potency of parabens can be increased with HER ligands, such as heregulin (HRG). Methods: The effects of HER ligands on paraben activation of c-Myc expression and cell proliferation were determined by real-time polymerase chain reaction, Western blots, flow cytometry, and chromatin immunoprecipitation assays in ERα- and HER2-positive human BT-474 breast cancer cells. Results: Butylparaben (BP) and HRG produced a synergistic increase in c-Myc mRNA and protein levels in BT-474 cells. Estrogen receptor antagonists blocked the synergistic increase in c-Myc protein levels. The combination of BP and HRG also stimulated proliferation of BT-474 cells compared with the effects of BP alone. HRG decreased the dose required for BP-mediated stimulation of c-Myc mRNA expression and cell proliferation. HRG caused the phosphorylation of serine 167 in ERα. BP and HRG produced a synergistic increase in ERα recruitment to the c-Myc gene. Conclusion: Our results show that HER ligands enhanced the potency of BP to stimulate oncogene expression and breast cancer cell proliferation in vitro via ERα, suggesting that parabens might be active at exposure levels not previously considered toxicologically relevant from studies testing their effects in isolation. Citation: Pan S, Yuan C, Tagmount A, Rudel RA, Ackerman JM

  7. Mass production of human epidermal growth factor using fed-batch cultures of recombinant Escherichia coli.


    Shimizu, N; Fukuzono, S; Harada, Y; Fujimori, K; Gotoh, K; Yamazaki, Y


    Fed-batch cultures of recombinant E. coli HB101 harboring expression plasmid pTRLBT1 or pTREBT1, with acetate concentration monitoring, are investigated to obtain high cell density and large amounts of human epidermal growth factor (hEGF). The expression plasmid pTRlBT1 contains a synthetic hEGF gene attached downstream of the N-terminal fragment of the trp L gene preceded by the trp promoter. The expression plasmid pTREBT1 contains the same coding sequence attached downstream of the N-terminal fragment of the trp E gene preceded by the trp promoter, trp L gene, and attenuator region. E. coli harboring pTREBT1 produces 0.56 mg/L hEGE and immediately degrades it. On the other hand E. coli harboring pTRLBT1 produces 6.8 mg/L hEGF and does not decompose it. Prominent inclusion bodies are observed in E. coli cells harboring pTRLBT1 using an election microscope. To Cultivate E. coli harboring pTRLBT1, a fed-batch culture system, divided into a cell growth step and an hEGF production step, is carried out. The cells grow smoothly without acetate-induced inhibition. Cell concentration and hEGF quantity reach the high values of 21 g/L and 60 mg/L, respectively.

  8. Pharmacologic Induction of Epidermal Melanin and Protection Against Sunburn in a Humanized Mouse Model

    PubMed Central

    Amaro-Ortiz, Alexandra; Vanover, Jillian C.; Scott, Timothy L.; D'Orazio, John A.


    Fairness of skin, UV sensitivity and skin cancer risk all correlate with the physiologic function of the melanocortin 1 receptor, a Gs-coupled signaling protein found on the surface of melanocytes. Mc1r stimulates adenylyl cyclase and cAMP production which, in turn, up-regulates melanocytic production of melanin in the skin. In order to study the mechanisms by which Mc1r signaling protects the skin against UV injury, this study relies on a mouse model with "humanized skin" based on epidermal expression of stem cell factor (Scf). K14-Scf transgenic mice retain melanocytes in the epidermis and therefore have the ability to deposit melanin in the epidermis. In this animal model, wild type Mc1r status results in robust deposition of black eumelanin pigment and a UV-protected phenotype. In contrast, K14-Scf animals with defective Mc1r signaling ability exhibit a red/blonde pigmentation, very little eumelanin in the skin and a UV-sensitive phenotype. Reasoning that eumelanin deposition might be enhanced by topical agents that mimic Mc1r signaling, we found that direct application of forskolin extract to the skin of Mc1r-defective fair-skinned mice resulted in robust eumelanin induction and UV protection 1. Here we describe the method for preparing and applying a forskolin-containing natural root extract to K14-Scf fair-skinned mice and report a method for measuring UV sensitivity by determining minimal erythematous dose (MED). Using this animal model, it is possible to study how epidermal cAMP induction and melanization of the skin affect physiologic responses to UV exposure. PMID:24056496

  9. Upregulation of FOXM1 induces genomic instability in human epidermal keratinocytes

    PubMed Central


    Background The human cell cycle transcription factor FOXM1 is known to play a key role in regulating timely mitotic progression and accurate chromosomal segregation during cell division. Deregulation of FOXM1 has been linked to a majority of human cancers. We previously showed that FOXM1 was upregulated in basal cell carcinoma and recently reported that upregulation of FOXM1 precedes malignancy in a number of solid human cancer types including oral, oesophagus, lung, breast, kidney, bladder and uterus. This indicates that upregulation of FOXM1 may be an early molecular signal required for aberrant cell cycle and cancer initiation. Results The present study investigated the putative early mechanism of UVB and FOXM1 in skin cancer initiation. We have demonstrated that UVB dose-dependently increased FOXM1 protein levels through protein stabilisation and accumulation rather than de novo mRNA expression in human epidermal keratinocytes. FOXM1 upregulation in primary human keratinocytes triggered pro-apoptotic/DNA-damage checkpoint response genes such as p21, p38 MAPK, p53 and PARP, however, without causing significant cell cycle arrest or cell death. Using a high-resolution Affymetrix genome-wide single nucleotide polymorphism (SNP) mapping technique, we provided the evidence that FOXM1 upregulation in epidermal keratinocytes is sufficient to induce genomic instability, in the form of loss of heterozygosity (LOH) and copy number variations (CNV). FOXM1-induced genomic instability was significantly enhanced and accumulated with increasing cell passage and this instability was increased even further upon exposure to UVB resulting in whole chromosomal gain (7p21.3-7q36.3) and segmental LOH (6q25.1-6q25.3). Conclusion We hypothesise that prolonged and repeated UVB exposure selects for skin cells bearing stable FOXM1 protein causes aberrant cell cycle checkpoint thereby allowing ectopic cell cycle entry and subsequent genomic instability. The aberrant upregulation of FOXM1

  10. Increased epidermal cell proliferation in normal human skin in vivo following local administration of interferon-gamma.

    PubMed Central

    Barker, J. N.; Goodlad, J. R.; Ross, E. L.; Yu, C. C.; Groves, R. W.; MacDonald, D. M.


    Recombinant human interferon-gamma was administered intradermally (10 micrograms in 0.1 ml) to healthy adult human volunteers from day 1 to day 3, and epidermal cell proliferation was measured on whole skin biopsies at day 6. Three independent parameters were assessed, namely, a) epidermal keratin-16 expression, b) keratinocyte proliferating cell nuclear antigen expression, and c) keratinocyte silver nucleolar organizer region counts. Significantly increased scores for each parameter were observed after interferon-gamma injection (P < 0.01 in each case) compared to site-matched controls. Keratin-16 expression was confined to suprabasal epidermis, whereas proliferating cell nuclear antigen and silver nucleolar organizer region counts were particularly elevated in the basal epidermis. Taken together with previous findings, these studies indicate both proinflammatory and growth regulatory roles for interferon-gamma in human skin. These data are likely to be of particular importance to pathophysiological mechanisms of psoriasis and related cutaneous inflammatory diseases. Images Figure 1 Figure 2 Figure 3 PMID:7682760

  11. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model.


    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme


    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to "hot-wet" (40°C, 80% relative humidity [RH]) or "cold-dry" (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot-wet and cold-dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold-dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment.

  12. Repeated short climatic change affects the epidermal differentiation program and leads to matrix remodeling in a human organotypic skin model

    PubMed Central

    Boutrand, Laetitia-Barbollat; Thépot, Amélie; Muther, Charlotte; Boher, Aurélie; Robic, Julie; Guéré, Christelle; Vié, Katell; Damour, Odile; Lamartine, Jérôme


    Human skin is subject to frequent changes in ambient temperature and humidity and needs to cope with these environmental modifications. To decipher the molecular response of human skin to repeated climatic change, a versatile model of skin equivalent subject to “hot–wet” (40°C, 80% relative humidity [RH]) or “cold–dry” (10°C, 40% RH) climatic stress repeated daily was used. To obtain an exhaustive view of the molecular mechanisms elicited by climatic change, large-scale gene expression DNA microarray analysis was performed and modulated function was determined by bioinformatic annotation. This analysis revealed several functions, including epidermal differentiation and extracellular matrix, impacted by repeated variations in climatic conditions. Some of these molecular changes were confirmed by histological examination and protein expression. Both treatments (hot–wet and cold–dry) reduced the expression of genes encoding collagens, laminin, and proteoglycans, suggesting a profound remodeling of the extracellular matrix. Strong induction of the entire family of late cornified envelope genes after cold–dry exposure, confirmed at protein level, was also observed. These changes correlated with an increase in epidermal differentiation markers such as corneodesmosin and a thickening of the stratum corneum, indicating possible implementation of defense mechanisms against dehydration. This study for the first time reveals the complex pattern of molecular response allowing adaption of human skin to repeated change in its climatic environment. PMID:28243135

  13. Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes

    EPA Science Inventory

    Toxicity Assessment of Six Titanium Dioxide Nanoparticles in Human Epidermal Keratinocytes Nanoparticle uptake in cells may be an important determinant of their potential cytotoxic and inflammatory effects. Six commercial TiO2 NP (A=Alfa Aesar,10nm, A*=Alfa Aesar 32nm, B=P25 27...

  14. Molecular Mechanisms and Translational Therapies for Human Epidermal Receptor 2 Positive Breast Cancer

    PubMed Central

    Lv, Quanxia; Meng, Ziyuan; Yu, Yuanyuan; Jiang, Feng; Guan, Daogang; Liang, Chao; Zhou, Junwei; Lu, Aiping; Zhang, Ge


    Breast cancer is the second leading cause of cancer death among women. Human epidermal receptor 2 (HER2) positive breast cancer (HER2+ BC) is the most aggressive subtype of breast cancer, with poor prognosis and a high rate of recurrence. About one third of breast cancer is HER2+ BC with significantly high expression level of HER2 protein compared to other subtypes. Therefore, HER2 is an important biomarker and an ideal target for developing therapeutic strategies for the treatment HER2+ BC. In this review, HER2 structure and physiological and pathological roles in HER2+ BC are discussed. Two diagnostic tests, immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH), for evaluating HER2 expression levels are briefly introduced. The current mainstay targeted therapies for HER2+ BC include monoclonal antibodies, small molecule tyrosine kinase inhibitors, antibody–drug conjugates (ADC) and other emerging anti-HER2 agents. In clinical practice, combination therapies are commonly adopted in order to achieve synergistic drug response. This review will help to better understand the molecular mechanism of HER2+ BC and further facilitate the development of more effective therapeutic strategies against HER2+ BC. PMID:27983617

  15. Prevention of UVB Radiation-induced Epidermal Damage by Expression of Heat Shock Protein 70*

    PubMed Central

    Matsuda, Minoru; Hoshino, Tatsuya; Yamashita, Yasuhiro; Tanaka, Ken-ichiro; Maji, Daisuke; Sato, Keizo; Adachi, Hiroaki; Sobue, Gen; Ihn, Hironobu; Funasaka, Yoko; Mizushima, Tohru


    Irradiation with UV light, especially UVB, causes epidermal damage via the induction of apoptosis, inflammatory responses, and DNA damage. Various stressors, including UV light, induce heat shock proteins (HSPs) and the induction, particularly that of HSP70, provides cellular resistance to such stressors. The anti-inflammatory activity of HSP70, such as its inhibition of nuclear factor kappa B (NF-κB), was recently revealed. These in vitro results suggest that HSP70 protects against UVB-induced epidermal damage. Here we tested this idea by using transgenic mice expressing HSP70 and cultured keratinocytes. Irradiation of wild-type mice with UVB caused epidermal damage such as induction of apoptosis, which was suppressed in transgenic mice expressing HSP70. UVB-induced apoptosis in cultured keratinocytes was suppressed by overexpression of HSP70. Irradiation of wild-type mice with UVB decreased the cutaneous level of IκB-α (an inhibitor of NF-κB) and increased the infiltration of leukocytes and levels of pro-inflammatory cytokines and chemokines in the epidermis. These inflammatory responses were suppressed in transgenic mice expressing HSP70. In vitro, the overexpression of HSP70 suppressed the expression of pro-inflammatory cytokines and chemokines and increased the level of IκB-α in keratinocytes irradiated with UVB. UVB induced an increase in cutaneous levels of cyclobutane pyrimidine dimers and 8-hydroxy-2′-deoxyguanosine, both of which were suppressed in transgenic mice expressing HSP70. This study provides genetic evidence that HSP70 protects the epidermis from UVB-induced radiation damage. The findings here also suggest that the protective action of HSP70 is mediated by anti-apoptotic, anti-inflammatory, and anti-DNA damage effects. PMID:20018843

  16. High affinity nanobodies against human epidermal growth factor receptor selected on cells by E. coli display

    PubMed Central

    Salema, Valencio; Mañas, Carmen; Cerdán, Lidia; Piñero-Lambea, Carlos; Marín, Elvira; Roovers, Rob C.; Van Bergen en Henegouwen, Paul M.P.; Fernández, Luis Ángel


    ABSTRACT Most therapeutic antibodies (Abs) target cell surface proteins on tumor and immune cells. Cloning of Ab gene libraries in E. coli and their display on bacteriophages is commonly used to select novel therapeutic Abs binding target antigens, either purified or expressed on cells. However, the sticky nature of bacteriophages renders phage display selections on cells challenging. We previously reported an E. coli display system for expression of VHHs (i.e., nanobodies, Nbs) on the surface of bacteria and selection of high-affinity clones by magnetic cell sorting (MACS). Here, we demonstrate that E. coli display is also an attractive method for isolation of Nbs against cell surface antigens, such as the epidermal growth factor receptor (EGFR), upon direct selection and screening of Ab libraries on live cells. We employ a whole cell-based strategy using a VHH library obtained by immunization with human tumor cells over-expressing EGFR (i.e., A431), and selection of bacterial clones bound to murine fibroblast NIH-3T3 cells transfected with human EGFR, after depletion of non-specific clones on untransfected cells. This strategy resulted in the isolation of high-affinity Nbs binding distinct epitopes of EGFR, including Nbs competing with the ligand, EGF, as characterized by flow cytometry of bacteria displaying the Nbs and binding assays with purified Nbs using surface plasmon resonance. Hence, our study demonstrates that E. coli display of VHH libraries and selection on cells enables efficient isolation and characterization of high-affinity Nbs against cell surface antigens. PMID:27472381

  17. High affinity nanobodies against human epidermal growth factor receptor selected on cells by E. coli display.


    Salema, Valencio; Mañas, Carmen; Cerdán, Lidia; Piñero-Lambea, Carlos; Marín, Elvira; Roovers, Rob C; Van Bergen En Henegouwen, Paul M P; Fernández, Luis Ángel


    Most therapeutic antibodies (Abs) target cell surface proteins on tumor and immune cells. Cloning of Ab gene libraries in E. coli and their display on bacteriophages is commonly used to select novel therapeutic Abs binding target antigens, either purified or expressed on cells. However, the sticky nature of bacteriophages renders phage display selections on cells challenging. We previously reported an E. coli display system for expression of VHHs (i.e., nanobodies, Nbs) on the surface of bacteria and selection of high-affinity clones by magnetic cell sorting (MACS). Here, we demonstrate that E. coli display is also an attractive method for isolation of Nbs against cell surface antigens, such as the epidermal growth factor receptor (EGFR), upon direct selection and screening of Ab libraries on live cells. We employ a whole cell-based strategy using a VHH library obtained by immunization with human tumor cells over-expressing EGFR (i.e., A431), and selection of bacterial clones bound to murine fibroblast NIH-3T3 cells transfected with human EGFR, after depletion of non-specific clones on untransfected cells. This strategy resulted in the isolation of high-affinity Nbs binding distinct epitopes of EGFR, including Nbs competing with the ligand, EGF, as characterized by flow cytometry of bacteria displaying the Nbs and binding assays with purified Nbs using surface plasmon resonance. Hence, our study demonstrates that E. coli display of VHH libraries and selection on cells enables efficient isolation and characterization of high-affinity Nbs against cell surface antigens.

  18. The influence of Tribenoside on expression and deposition of epidermal laminins in HaCaT cells.


    Kikkawa, Yamato; Takaki, Shu; Matsuda, Yuji; Okabe, Koichi; Taniguchi, Masakazu; Oomachi, Kengo; Samejima, Teruyuki; Katagiri, Fumihiko; Hozumi, Kentaro; Nomizu, Motoyoshi


    Tribenoside has been used clinically for hemorrhoidal disease associated with coagulation, inflammation, and wounds. However, the pharmacological mechanism of tribenoside activity has never been clear. In this study we examined whether tribenoside affected expression and deposition of laminins that are required for reconstruction of basement membranes (BMs) during wound healing in hemorrhoidal disease. HaCaT cells, which are derived from human epidermis, were treated in growth media supplemented with tribenoside. Reverse transcriptase-polymerase chain reaction (RT-PCR) using primers specific for laminin chains showed that HaCaT cells constitutively expressed laminin alpha3, alpha5, beta1, beta3, gamma1, and gamma2 chains. Tribenoside treatment of HaCaT cells did not induce expression of other laminin chains. We also quantified the expression of laminin chains in tribenoside-treated cells using real-time PCR. The expression level of laminin alpha3, beta1, beta3, gamma1, and gamma2 chains was not affected. In contrast, the expression of laminin alpha5 in the tribenoside-treated cells was four times higher than that of control cells. Immunocytochemistry also showed that tribenoside accelerated the focal deposition of laminin-332 (alpha3, beta3, gamma2). These results suggest that tribenoside interacts with epidermal cells and regulates the expression and localization of laminins to help reconstruct BMs in wound healing of hemorrhoids.

  19. Claudin-1 Binder Enhances Epidermal Permeability in a Human Keratinocyte Model.


    Nakajima, Misaki; Nagase, Shotaro; Iida, Manami; Takeda, Shuji; Yamashita, Mayo; Watari, Akihiro; Shirasago, Yoshitaka; Fukasawa, Masayoshi; Takeda, Hiroyuki; Sawasaki, Tatsuya; Yagi, Kiyohito; Kondoh, Masuo


    Tight junctions (TJs) are complex biochemical structures that seal the intercellular space and prevent the free movement of solutes across epithelial cell sheets. Modulating the TJ seal is a promising option for increasing the transdermal absorption of drugs. Within TJs, the binding of the claudin (CLDN) family of tetratransmembrane proteins through cis- and trans-interactions is an integral part of seal formation. Because epidermal TJs contain CLDN-1 and CLDN-4, a binder for these CLDNs may be a useful modulator of the permeability of the epidermal barrier. Here, we investigated whether m19, which can bind to CLDN-1/-4 (also CLDN-2/-5), modulates the integrity of epidermal TJs and the permeability of cell sheets to solutes. Treatment of normal human epidermal keratinocytes (NHEKs) with the CLDN binder reduced the integrity of TJs. A CLDN-1-specific binder (a monoclonal antibody, clone 7A5) also weakened the TJ seal in NHEKs. Although m19 attenuated the TJ barrier in human intestinal epithelial cells (Caco-2), 7A5 did not. Treatment of NHEKs with 7A5 enhanced permeation of a paracellular permeation marker. These findings indicate that CLDN-1 is a potential target for modulating the permeability of the epidermis, and that our CLDN-1 binder is a promising candidate molecule for development as a dermal absorption enhancer.

  20. ZEB2-transgene expression in the epidermis compromises the integrity of the epidermal barrier through the repression of different tight junction proteins.


    Tatari, Marianthi N; De Craene, Bram; Soen, Bieke; Taminau, Joachim; Vermassen, Petra; Goossens, Steven; Haigh, Katharina; Cazzola, Silvia; Lambert, Jo; Huylebroeck, Danny; Haigh, Jody J; Berx, Geert


    Epithelial homeostasis within the epidermis is maintained by means of multiple cell-cell adhesion complexes such as adherens junctions, tight junctions, gap junctions, and desmosomes. These complexes co-operate in the formation and the regulation of the epidermal barrier. Disruption of the epidermal barrier through the deregulation of the above complexes is the cause behind a number of skin disorders such as psoriasis, dermatitis, keratosis, and others. During epithelial-to-mesenchymal transition (EMT), epithelial cells lose their adhesive capacities and gain mesenchymal properties. ZEB transcription factors are key inducers of EMT. In order to gain a better understanding of the functional role of ZEB2 in epidermal homeostasis, we generated a mouse model with conditional overexpression of Zeb2 in the epidermis. Our analysis revealed that Zeb2 expression in the epidermis leads to hyperproliferation due to the combined downregulation of different tight junction proteins compromising the epidermal barrier. Using two epidermis-specific in vivo models and in vitro promoter assays, we identified occludin as a new Zeb2 target gene. Immunohistological analysis performed on human skin biopsies covering various pathogeneses revealed ZEB2 expression in the epidermis of pemphigus vulgaris. Collectively, our data support the notion for a potential role of ZEB2 in intracellular signaling of this disease.

  1. Identifying subcellular protein localization with fluorescent protein fusions after transient expression in onion epidermal cells.


    Nebenführ, Andreas


    Most biochemical functions of plant cells are carried out by proteins which act at very specific places within these cells, for example, within different organelles. Identifying the subcellular localization of proteins is therefore a useful tool to narrow down the possible functions that a novel or unknown protein may carry out. The discovery of genetically encoded fluorescent markers has made it possible to tag specific proteins and visualize them in vivo under a variety of conditions. This chapter describes a simple method to use transient expression of such fluorescently tagged proteins in onion epidermal cells to determine their subcellular localization relative to known markers.

  2. Mediated exodus of L-dopa from human epidermal Langerhans cells.


    Falck, B; Bendsoe, N; Ronquist, G


    L-3,4-dihydroxyphenylalanine (L-dopa) is not metabolized within human epidermal Langerhans cells (LC); yet they can take up substantial amounts of this amino acid which subsequently can be released into the extracellular space. We recently reported that human epidermal energy metabolism is predominantly anaerobic and that the influx mechanism is a unidirectional L-dopa/proton counter-transport system and now we describe conditions for the mediated transport of L-dopa out of the LC. It is demonstrated that certain amino acids and one dipeptide can effectively trigger the efflux of L-dopa taken up by the LC.Thus, alpha-methyl-dopa (alpha-m-dopa), D-dopa and the dipeptide, met-ala at the outside of the plasma membrane stimulated the efflux of L-dopa from L-dopa loaded LC. Similar effects were achieved by a variety of other amino acids in the extracellular fluid while some other amino acids were inactive. The time required for 50% D-methionine-induced exodus of L-dopa from L-dopa loaded LC was in the range of 5-7 min and a complete exodus of L-dopa was attained at about 20 min of incubation. This dislocation of L-dopa to the extracellular fluid is interpreted as an expression of trans-stimulation. In the case of alpha-m-dopa, D-dopa and met-ala, which admittedly were not able to penetrate the plasma membrane of LC, the concept of trans-stimulation was given a new purport, since none of them were able to participate in an exchange reaction. Finally, it could be concluded that L-dopa escaped by a route different from the one responsible for L-dopa uptake in LC.Thus, while the influx of L-dopa supports extrusion of protons deriving from anaerobic glycolysis in the LC, L-dopa efflux can provide the cells with useful amino acids in an energy-saving way, altogether a remarkable biological process. From this follows that L-dopa has a biological function of its own, besides being a precursor in the catecholamine and pigment syntheses.

  3. Differential Activation of Signaling Pathways by UVA and UVB Radiation in Normal Human Epidermal Keratinocytes†

    PubMed Central

    Syed, Deeba N.; Afaq, Farrukh; Mukhtar, Hasan


    Ultraviolet (UV) radiation from the solar spectrum is a major etiological factor for many cutaneous pathologies including cancer. By understanding changes in cell signaling pathways induced by UVA and UVB, novel strategies for prevention and treatment of UV-related pathologies could be developed. However, much of the information in the literature from various laboratories cannot cross talk because of difficulties associated with the use of ill-defined light sources and physiologically irrelevant light dosimetry. Herein, we have assessed the effect of exposure of normal human epidermal keratinocytes (NHEK) to UVA (2 and 4 J cm−2) or UVB (20 and 40 mJ cm−2) radiation. Employing western blot analysis, we found that exposure of NHEK to UVB, but not UVA, phosphorylates JNK1/2 at Th183/Tyr185, STAT3 at Ser727, AKT at Ser473 and increases c-Fos expression, whereas exposure to UVA, but not UVB, phosphorylates AKT at Thr308. UVB as well as UVA exposure leads to increased phosphorylation of (1) ERK1/2 at Th202/Tyr204; (2) p38 at Th180/Tyr204; (3) STAT3 at Tyr705; (4) mTOR at Thr2448; and (v) p70S6k at Thr421/Ser424; enhanced expression of PI3K (p85) and c-jun; and nuclear translocation of NFκB proteins. These findings could be considered as a beginning for understanding the differential effects of UVA and UVB in the human skin and may have implications both with respect to risk assessment from exposure to solar UV radiation, and to target interventions against signaling events mediated by UVA and UVB. PMID:22335604

  4. Recurrent exposure to nicotine differentiates human bronchial epithelial cells via epidermal growth factor receptor activation

    SciTech Connect

    Martinez-Garcia, Eva; Irigoyen, Marta; Anso, Elena; Martinez-Irujo, Juan Jose; Rouzaut, Ana


    Cigarette smoking is the major preventable cause of lung cancer in developed countries. Nicotine (3-(1-methyl-2-pyrrolidinyl)-pyridine) is one of the major alkaloids present in tobacco. Besides its addictive properties, its effects have been described in panoply of cell types. In fact, recent studies have shown that nicotine behaves as a tumor promoter in transformed epithelial cells. This research focuses on the effects of acute repetitive nicotine exposure on normal human bronchial epithelial cells (NHBE cells). Here we show that treatment of NHBE cells with recurrent doses of nicotine up to 500 {mu}M triggered cell differentiation towards a neuronal-like phenotype: cells emitted filopodia and expressed neuronal markers such as neuronal cell adhesion molecule, neurofilament-M and the transcription factors neuronal N and Pax-3. We also demonstrate that nicotine treatment induced NF-kB translocation to the nucleus, phosphorylation of the epidermal growth factor receptor (EGFR), and accumulation of heparin binding-EGF in the extracellular medium. Moreover, addition of AG1478, an inhibitor of EGFR tyrosine phosphorylation, or cetuximab, a monoclonal antibody that precludes ligand binding to the same receptor, prevented cell differentiation by nicotine. Lastly, we show that differentiated cells increased their adhesion to the extracellular matrix and their protease activity. Given that several lung pathologies are strongly related to tobacco consumption, these results may help to better understand the damaging consequences of nicotine exposure.

  5. Genome-wide p63-regulated gene expression in differentiating epidermal keratinocytes

    PubMed Central

    Oti, Martin; Kouwenhoven, Evelyn N.; Zhou, Huiqing


    The transcription factor p63 is a key regulator in epidermal keratinocyte proliferation and differentiation. However, the role of p63 in gene regulation during these processes is not well understood. To investigate this, we recently generated genome-wide profiles of gene expression, p63 binding sites and active regulatory regions with the H3K27ac histone mark (Kouwenhoven et al., 2015). We showed that only a subset of p63 binding sites are active in keratinocytes, and that differentiation-associated gene expression dynamics correlate with the activity of p63 binding sites rather than with their occurrence per se. Here we describe in detail the generation and processing of the ChIP-seq and RNA-seq datasets used in this study. These data sets are deposited in the Gene Expression Omnibus (GEO) repository under the accession number GSE59827. PMID:26484246

  6. Epidermal changes in human skin following irradiation with either UVB or UVA

    SciTech Connect

    Pearse, A.D.; Gaskell, S.A.; Marks, R.


    We have demonstrated previously that following UVB irradiation to normal volunteers there is an increase in epidermal and stratum corneum thickness and an increase in the thymidine autoradiographic labeling index. These changes are coupled with alterations in epidermal glucose-6-phosphate dehydrogenase and succinic dehydrogenase activities, despite the absence of erythema clinically. The use of a sunscreen did not completely prevent these changes. In this study, we have examined the effects of repeated irradiation of human skin with either UVB or UVA alone in order to compare the changes produced in the epidermis and to ascertain whether UVA irradiation could cause these. Irradiation with either UVB or UVA alone was found to increase the mean epidermal thickness, the mean stratum corneum thickness, and mean keratinocyte height significantly. Glucose-6-phosphate dehydrogenase activity was significantly increased throughout the epidermis, and succinic dehydrogenase activity was significantly decreased. The autoradiographic labeling index was significantly increased following UVB irradiation but not following UVA irradiation. These results demonstrate that UVA alone can have a direct effect on epidermal morphology and metabolism, suggesting that protection of skin from UV radiation should include adequate protection from UVA.

  7. Hesperetin induces melanin production in adult human epidermal melanocytes.


    Usach, Iris; Taléns-Visconti, Raquel; Magraner-Pardo, Lorena; Peris, José-Esteban


    One of the major sources of flavonoids for humans are citrus fruits, hesperidin being the predominant flavonoid. Hesperetin (HSP), the aglycon of hesperidin, has been reported to provide health benefits such as antioxidant, anti-inflammatory and anticarcinogenic effects. However, the effect of HSP on skin pigmentation is not clear. Some authors have found that HSP induces melanogenesis in murine B16-F10 melanoma cells, which, if extrapolated to in vivo conditions, might protect skin against photodamage. Since the effect of HSP on normal melanocytes could be different to that observed on melanoma cells, the described effect of HSP on murine melanoma cells has been compared to the effect obtained using normal human melanocytes. HSP concentrations of 25 and 50 µM induced melanin synthesis and tyrosinase activity in human melanocytes in a concentration-dependent manner. Compared to control melanocytes, 25 µM HSP increased melanin production and tyrosinase activity 1.4-fold (p < 0.01) and 1.1-fold (p < 0.01), respectively, and the corresponding increases in the case of 50 µM HSP were 1.9-fold (p < 0.001) and 1.3-fold (p < 0.001). Therefore, HSP could be considered a valuable photoprotective substance if its capacity to increase melanin production in human melanocyte cultures could be reproduced on human skin.

  8. Characterization of human epidermal growth factor in human serum and urine under native conditions.


    Aybay, Cemalettin; Karakus, Resul; Yucel, Aysegul


    The objective of this study was to investigate the molecular nature of the human epidermal growth factor (EGF) in serum and urine samples of normal subjects. Recombinant EGF emerged as a single peak and did not interact with human IgG1 and albumin up to the concentration of 12 microg/ml. Freshly separated human serum contained only trace amounts of EGF. However, EGF appeared and increased in serum separated from blood after spontaneous overnight clotting. The authentic 6 kDa form of EGF made up nearly 40% of the total EGF in serum and revealed relatively homogeneous feature. The remaining immunoreactive fractions corresponded to 160 kDa proEGF. Immunoreactive EGF in blood seemed to be associated with the EGF release from platelets. TSKgel G3000SW chromatography of freshly-voided morning and day urines revealed that urine samples mainly contained two major form of EGF; a high-molecular-weight (HMW) and low-molecular-weight (LMW) forms. In the sense of molecular nature of EGF contents, morning urine was more heterogeneous than day urine of the same individuals. The LMW form of EGF in morning urine, in which its proportion was more than 90% of the total EGF, revealed further heterogeneous feature generally containing three to four different components.

  9. Expression of epidermal growth factor receptor in canine osteosarcoma: association with clinicopathological parameters and prognosis.


    Selvarajah, Gayathri T; Verheije, Monique H; Kik, Marja; Slob, Adri; Rottier, Peter J M; Mol, Jan A; Kirpensteijn, Jolle


    Expression of epidermal growth factor receptor (EGFR) is associated with aggressive growth and metastasis of a range of tumours, including osteosarcomas (OS), although some studies have reported no relevance to clinicopathological events or prognosis. The present study evaluated EGFR mRNA and protein expression in a panel of OS cell lines, normal bones, frozen primary OS and tissue microarrays. EGFR expression was significantly elevated in primary OS compared to normal bones and in metastases of OS to the lungs in comparison with extrapulmonary sites. However, there were no clinical or pathological associations with mRNA expression levels in frozen tumours. Tissue microarray analysis demonstrated that a subset of canine OS with high EGFR expression was associated with significantly shorter survival times and disease-free intervals. Cytoplasmic expression of EGFR was present in 75% of metastases and was similar to expression in primary tumours. EGFR expression alone is not a reliable predictor of outcome and other markers are necessary for further prognostic stratification of dogs with OS. However, these findings suggest that a subset of dogs may benefit from anti-EGFR adjuvant therapies.

  10. Iontophoresis and sonophoresis stimulate epidermal cytokine expression at energies that do not provoke a barrier abnormality: lamellar body secretion and cytokine expression are linked to altered epidermal calcium levels.


    Choi, Eung Ho; Kim, Min Jung; Yeh, Byung-Il; Ahn, Sung Ku; Lee, Seung Hun


    We performed this study to identify whether the expression of epidermal cytokines is altered by changes in epidermal calcium content, independent of skin barrier disruption. Iontophoresis and sonophoresis with the energies that do not disrupt the skin barrier, but induce changes in the epidermal calcium gradient, were applied to the skin of hairless mice. Immediately after iontophoresis and sonophoresis, immersion in a solution containing calcium was carried out, and iontophoresis in either high- or low-calcium solutions was performed. The biopsy specimens were taken for real-time quantitative RT-PCR to detect changes in mRNA level of interleukin-1alpha (IL-1alpha), tumor necrosis factor-alpha (TNF-alpha), and transforming growth factor-beta in the epidermis and for immunohistochemical stain with primary antibodies to IL-1alpha and TNF-alpha. The expression of each cytokine mRNA increased in the epidermis treated with iontophoresis and sonophoresis compared to a nontreated control as well as in tape-stripped skin used as a positive control and was lower after immersion in a high-calcium solution than in low-calcium solution. IL-1alpha and TNF-alpha immunohistochemical protein staining increased with iontophoresis at low calcium. These studies suggest that changes in epidermal calcium can directly signal expression of epidermal cytokines in vivo, independent of changes in barrier function.

  11. Murine peptidoglycan recognition proteins PglyrpIalpha and PglyrpIbeta are encoded in the epidermal differentiation complex and are expressed in epidermal and hematopoietic tissues.


    Mathur, Punam; Murray, Beth; Crowell, Thomas; Gardner, Humphrey; Allaire, Normand; Hsu, Yen-Ming; Thill, Greg; Carulli, John P


    Peptidoglycan recognition proteins (PGRPs or PGLYRPs) are pattern recognition molecules that are found in insects and mammals and are critical for innate immune responses. PGRPs bind peptidoglycan, a ubiquitous component of bacterial cell walls, and are involved in killing bacteria, degrading peptidoglycan, and initiating host defense reactions. Relatively little is known about the four mammalian PGRPs. In this article, we report the sequences of mouse PglyrpIalpha and PglyrpIbeta and provide details of their expression in wild-type mouse tissues. PglyrpIalpha and PglyrpIbeta are encoded within the epidermal differentiation complex on mouse chromosome 3F. Both genes are expressed in epidermal and hematopoietic tissues. PglyrpIbeta is expressed in each of 16 tissues tested, while PglyrpIalpha expression is limited to fewer tissues, including the lung and spleen as well as several tissues of the digestive system. Both proteins are expressed in epithelial cells throughout the gut, and immunohistochemical staining shows expression in salivary glands, the squamous epithelium of the stomach, and the villi of the jejunum. Immunohistochemical staining further shows expression of both PglyrpIalpha and PglyrpIbeta in macrophages in the spleen. PglyrpIalpha is not expressed in resting RAW264.7 macrophage-like cells, but is induced by stimulation with lipopolysaccharide. PglyrpIbeta is constitutively expressed in RAW264.7 cells and is unaffected by lipopolysaccharide or peptidoglycan stimulation. Computational and experimental data suggest that these proteins are secreted. This work provides a step toward understanding the roles of PglyrpIalpha and PglyrpIbeta in host defense and chronic inflammatory conditions induced by bacteria or their components.

  12. The CD44+ALDH+ Population of Human Keratinocytes Is Enriched for Epidermal Stem Cells with Long-Term Repopulating Ability

    PubMed Central

    Szabo, Akos Z.; Fong, Stephen; Yue, Lili; Zhang, Kai; Strachan, Lauren R.; Scalapino, Kenneth; Mancianti, Maria Laura; Ghadially, Ruby


    Like for other somatic tissues, isolation of a pure population of stem cells has been a primary goal in epidermal biology. We isolated discrete populations of freshly obtained human neonatal keratinocytes (HNKs) using previously untested candidate stem cell markers aldehyde dehydrogenase (ALDH) and CD44 as well as the previously studied combination of integrin α6 and CD71. An in vivo transplantation assay combined with limiting dilution analysis was used to quantify enrichment for long-term repopulating cells in the isolated populations. The ALDH+CD44+ population was enriched 12.6-fold for long-term repopulating epidermal stem cells (EpiSCs) and the integrin α6hiCD71lo population was enriched 5.6-fold, over unfractionated cells. In addition to long-term repopulation, CD44+ALDH+ keratinocytes exhibited other stem cell properties. CD44+ALDH+ keratinocytes had self-renewal ability, demonstrated by increased numbers of cells expressing nuclear Bmi-1, serial transplantation of CD44+ALDH+ cells, and holoclone formation in vitro. CD44+ALDH+ cells were multipotent, producing greater numbers of hair follicle-like structures than CD44−ALDH− cells. Furthermore, 58% ± 7% of CD44+ALDH+ cells exhibited label-retention. In vitro, CD44+ALDH+ cells showed enhanced colony formation, in both keratinocyte and embryonic stem cell growth media. In summary, the CD44+ALDH+ population exhibits stem cell properties including long-term epidermal regeneration, multipotency, label retention, and holoclone formation. This study shows that it is possible to quantify the relative number of EpiSCs in human keratinocyte populations using long-term repopulation as a functional test of stem cell nature. Future studies will combine isolation strategies as dictated by the results of quantitative transplantation assays, in order to achieve a nearly pure population of EpiSCs. PMID:23335266

  13. Dermal fibroblast expression of stromal cell-derived factor-1 (SDF-1) promotes epidermal keratinocyte proliferation in normal and diseased skin.


    Quan, Chunji; Cho, Moon Kyun; Shao, Yuan; Mianecki, Laurel E; Liao, Eric; Perry, Daniel; Quan, Taihao


    Stromal cells provide a crucial microenvironment for overlying epithelium. Here we investigated the expression and function of a stromal cell-specific protein, stromal cell-derived factor-1 (SDF-1), in normal human skin and in the tissues of diseased skin. Immunohistology and laser capture microdissection (LCM)-coupled quantitative real-time RT-PCR revealed that SDF-1 is constitutively and predominantly expressed in dermal stromal cells in normal human skin in vivo. To our surprise, an extremely high level of SDF-1 transcription was observed in the dermis of normal human skin in vivo, evidenced by much higher mRNA expression level than type I collagen, the most abundant and highly expressed protein in human skin. SDF-1 was also upregulated in the tissues of many human skin disorders including psoriasis, basal cell carcinoma (BCC), and squamous cell carcinoma (SCC). Double immunostaining for SDF-1 and HSP47 (heat shock protein 47), a marker of fibroblasts, revealed that fibroblasts were the major source of stroma-cell-derived SDF-1 in both normal and diseased skin. Functionally, SDF-1 activates the ERK (extracellular-signal-regulated kinases) pathway and functions as a mitogen to stimulate epidermal keratinocyte proliferation. Both overexpression of SDF-1 in dermal fibroblasts and treatment with rhSDF-1 to the skin equivalent cultures significantly increased the number of keratinocyte layers and epidermal thickness. Conversely, the stimulative function of SDF-1 on keratinocyte proliferation was nearly completely eliminated by interfering with CXCR4, a specific receptor of SDF-1, or by knock-down of SDF-1 in fibroblasts. Our data reveal that extremely high levels of SDF-1 provide a crucial microenvironment for epidermal keratinocyte proliferation in both physiologic and pathologic skin conditions.

  14. Isolating subpopulations of human epidermal basal cells based on polyclonal serum against trypsin-resistant CSPG4 epitopes.


    Gunnarsson, Anders Patrik; Christensen, Rikke; Praetorius, Jeppe; Jensen, Uffe Birk


    Chondroitin sulfate proteoglycan 4 (CSPG4) is highly expressed by human epidermal keratinocytes located at the tip of the dermal papilla where keratinocytes show characteristics of stem cells. However, since available antibodies to CSPG4 are directed against trypsin-sensitive epitopes we have been unable to study these keratinocytes isolated directly from skin samples by flow cytometry. By choosing epitopes of CSPG4 relatively close to the cell membrane we were able to generate a polyclonal antibody that successfully detects CSPG4 on keratinocytes after trypsinization. Although CSPG4-positive basal cells express higher levels of Itgβ1 the colony-forming efficiency is slightly lower than CSPG4-negative basal cells. Sorting the directly isolated keratinocytes based on Itgβ1 did not reveal differences in colony-forming efficiency between keratinocytes expressing high or low levels of Itgβ1. However, after the first passage Itgβ1 could be used to predict colony-forming efficiency whether the culture was established from CSPG4-positive or CSPG4-negative basal cell keratinocytes. Although we were unable to detect differences in the colony-forming assay, global gene expression profiling showed that CSPG4-positive basal cell keratinocytes are distinct from CSPG4-negative basal cell keratinocytes. Our study demonstrates that it is possible to generate antibodies against trypsin-resistant epitopes of CSPG4. Our study also documents a marked change in behaviour upon cell culturing and challenges the way we assess for stemness within the human epidermal basal layer.

  15. Patterning as a signature of human epidermal stem cell regulation

    PubMed Central

    Klein, Allon M.; Nikolaidou-Neokosmidou, Varvara; Doupé, David P.; Jones, Philip H.; Simons, Benjamin D.


    Understanding how stem cells are regulated in adult tissues is a major challenge in cell biology. In the basal layer of human epidermis, clusters of almost quiescent stem cells are interspersed with proliferating and differentiating cells. Previous studies have shown that the proliferating cells follow a pattern of balanced stochastic cell fate. This behaviour enables them to maintain homeostasis, while stem cells remain confined to their quiescent clusters. Intriguingly, these clusters reappear spontaneously in culture, suggesting that they may play a functional role in stem cell auto-regulation. We propose a model of pattern formation that explains how clustering could regulate stem cell activity in homeostatic tissue through contact inhibition and stem cell aggregation. PMID:21632613

  16. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation

    PubMed Central

    Cavazza, Alessia; Miccio, Annarita; Romano, Oriana; Petiti, Luca; Malagoli Tagliazucchi, Guidantonio; Peano, Clelia; Severgnini, Marco; Rizzi, Ermanno; De Bellis, Gianluca; Bicciato, Silvio; Mavilio, Fulvio


    Summary Human skin is maintained by the differentiation and maturation of interfollicular stem and progenitors cells. We used DeepCAGE, genome-wide profiling of histone modifications and retroviral integration analysis, to map transcripts, promoters, enhancers, and super-enhancers (SEs) in prospectively isolated keratinocytes and transit-amplifying progenitors, and retrospectively defined keratinocyte stem cells. We show that >95% of the active promoters are in common and differentially regulated in progenitors and differentiated keratinocytes, while approximately half of the enhancers and SEs are stage specific and account for most of the epigenetic changes occurring during differentiation. Transcription factor (TF) motif identification and correlation with TF binding site maps allowed the identification of TF circuitries acting on enhancers and SEs during differentiation. Overall, our study provides a broad, genome-wide description of chromatin dynamics and differential enhancer and promoter usage during epithelial differentiation, and describes a novel approach to identify active regulatory elements in rare stem cell populations. PMID:27050947

  17. Role of keratin 24 in human epidermal keratinocytes

    PubMed Central

    Min, Min; Chen, Xi-Bei; Wang, Ping; Landeck, Lilla; Chen, Jia-Qi; Li, Wei; Cai, Sui-Qing; Zheng, Min; Man, Xiao-Yong


    Keratin 24 (K24) is a new kind of keratin genes, which encodes a novel keratin protein, K24 that bears high similarity to the type I keratins and displays a unique expression profile. However, the role of K24 is incompletely understood. In our study, we investigated the localization of K24 within the epidermis and possible functions. Keratin 24 was found to be modestly overexpressed in senescent keratinocytes and was mainly restricted to the upper stratum spinosum of epidermis. The protein was required for terminal differentiation upon CaCl2-induced differentiation. In vitro results showed that increased K24 in keratinocytes dramatically changed the differentiation of primary keratinocytes. It also inhibited cell survival by G1/S phase cell cycle arrest and induced senescence, autophagy and apoptosis of keratinocytes. In addition, K24 activated PKCδ signal pathway involving in cellular survival. In summary, K24 may be suggested as a potential differentiation marker and anti-proliferative factor in the epidermis. PMID:28362807

  18. The peanut lectin-binding glycoproteins of human epidermal keratinocytes

    SciTech Connect

    Morrison, A.I. ); Keeble, S.; Watt, F.M. )


    The peanut lectin (PNA) is known to bind more strongly to keratinocytes that are undergoing terminal differentiation than to proliferating keratinocytes. In order to investigate the significance of this change in cell-surface carbohydrate authors have identified the PNA-binding glycoproteins of cultured human keratinocytes and antibodies against them. Two heavily glycosylated bands of 110 and 250 kDa were resolved by PAGE of ({sup 14}C)galactose- or ({sup 14}C)mannose- and ({sup 14}C)glucosamine-labeled cell extracts eluted with galactose from PNA affinity columns. The higher molecular weight band was also detected on PNA blots of unlabeled cell extracts transferred to nitrocellulose. Both bands were sensitive to pronase digestion, but only the 250-kDa band was digested with trypsin. A rabbit antiserum that we prepared (anti-PNA-gp) immunoprecipitated both bands from cell extracts. In contrast to PNA, anti-PNA-gp bound equally to proliferating and terminally differentiating cells, indicating that some epitope(s) of the PNA-binding glycoproteins is present on the cell surface prior to terminal differentiation. When keratinocytes grown as a monolayer in low-calcium medium were switched to medium containing 2 mM calcium ions in order to induce desmosome formation and stratification, there was a dramatic redistribution of the PNA-binding glycoproteins, which became concentrated at the boundaries between cells. This may suggest a role for the glycoproteins in cell-cell interactions during stratification.

  19. Designed ankyrin repeat proteins: a novel tool for testing epidermal growth factor receptor 2 expression in breast cancer.


    Theurillat, Jean-Philippe; Dreier, Birgit; Nagy-Davidescu, Gabriela; Seifert, Burkhardt; Behnke, Silvia; Zürrer-Härdi, Ursina; Ingold, Fabienne; Plückthun, Andreas; Moch, Holger


    Designed ankyrin repeat proteins are a novel class of specific binding molecules, which display increased thermodynamic stability, smaller size and at least equal target affinity compared to immunoglobulins, making them potentially powerful tools in diagnostic pathology and therapeutic oncology. Here, we investigated whether designed ankyrin repeat proteins can reliably identify the amplification status of the epidermal growth factor receptor 2 in breast cancer. Designed ankyrin repeat proteins specific for epidermal growth factor receptor 2 were tested in paraffin-embedded tissue sections. Detection using enzymatic biotinylation proved to be most specific and sensitive. The affinity of the designed ankyrin repeat proteins was found crucial, but for a picomolar binder no further gain was found by making it multivalent. The best designed ankyrin repeat protein, G3 (K(D) 90 pM) was compared on breast cancer tissue microarrays (n=792) to an FDA-approved rabbit monoclonal antibody against epidermal growth factor receptor 2 (clone 4B5; Ventana Medical Systems) and correlated with corresponding epidermal growth factor receptor 2 amplification status measured by fluorescent in situ hybridization. Amplification status and epidermal growth factor receptor 2 expression measured by designed ankyrin repeat protein and antibody correlated strongly with each other (P<0.0001 each), the correlation between designed ankyrin repeat protein and amplification status being the strongest (0.87 compared to 0.77 for the antibody, Kendall's tau-beta). Using a modified scoring system for the designed ankyrin repeat protein, we show that the designed ankyrin repeat protein detects a positive epidermal growth factor receptor 2 amplification status with similar sensitivity and significantly higher specificity than the antibody (P=0.0005). This study suggests that designed ankyrin repeat proteins provide a valuable alternative to antibodies for the detection of epidermal growth factor receptor

  20. Proliferation of human neuroblastomas mediated by the epidermal growth factor receptor.


    Ho, Ruth; Minturn, Jane E; Hishiki, Tomoro; Zhao, Huaqing; Wang, Qun; Cnaan, Avital; Maris, John; Evans, Audrey E; Brodeur, Garrett M


    Neuroblastoma is a common solid tumor of childhood that is derived from the neural crest. Expression of epidermal growth factor (EGF) receptors (EGFRs) has been associated with enhanced cell growth and aggressive behavior in other tumors. Here, we examined the expression profile of EGFRs in neuroblastoma cell lines and primary tumors. We found that all 13 neuroblastoma cell lines examined expressed EGFR1 (HER1), most at readily detectable levels. Low levels of other human EGFR family receptors were also detected in almost all cell lines. All primary tumors examined expressed readily detectable levels of HER1 and HER3 and lower levels of HER2 and HER4. EGF had a significant effect on the proliferation of neuroblastoma cell lines in vitro. EGF treatment (100 ng/mL) of the cell lines SY5Y and NLF significantly increased cell number (P < 0.01). EGF stimulated more cells to enter S and G2-M phase, as suggested by flow cytometry, indicating that EGF increases cell number by increasing proliferation, with no appreciable change in apoptosis. EGF exposure resulted in receptor autophosphorylation and activation of both the mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K)/AKT pathways. Exposure to 0.5 micromol/L ZD1839, a HER1-specific inhibitor, caused a 40% to 50% reduction in the number of SY5Y and NLF cells grown in medium containing 10% fetal bovine serum (P < 0.01). Even at 0.01 micromol/L, ZD1839 inhibited autophosphorylation of HER1 by EGF. At 0.1 micromol/L, it also blocked phosphorylation of AKT, but not MAPK, in NLF cells. Additional studies showed that the PI3K/AKT-specific inhibitor LY294002 had a more profound effect than the MAPK-specific inhibitor U0126 in blocking EGF-induced cell proliferation. This suggests that the PI3K/AKT pathway is the main signaling pathway responsible for the proliferation effects of EGF in neuroblastomas. Our results also indicate that ZD1839 is a potent inhibitor of neuroblastoma cell proliferation

  1. Epidermal growth factor receptor expression in different subtypes of oral lichenoid disease

    PubMed Central

    Cortés-Ramírez, Dionisio A.; Rodríguez-Tojo, María J.; Coca-Meneses, Juan C.; Marichalar-Mendia, Xabier


    The oral lichenoid disease (OLD) includes different chronic inflammatory processes such as oral lichen planus (OLP) and oral lichenoid lesions (OLL), both entities with controversial diagnosis and malignant potential. Epidermal growth factor receptor (EFGR) is an important oral carcinogenesis biomarker and overexpressed in several oral potentially malignant disorders. Objectives: To analyze the EGFR expression in the OLD to find differences between OLP and OLL, and to correlate it with the main clinical and pathological features. Material and Methods: Forty-four OLD cases were studied and classified according to their clinical (Group C1: only papular lesions / Group C2: papular and other lesions) and histopathological features (Group HT: OLP-typical / Group HC: OLP-compatible) based in previous published criteria. Standard immunohistochemical identification of EGFR protein was performed. Comparative and descriptive statistical analyses were performed. Results: Thirty-five cases (79.5%) showed EGFR overexpression without significant differences between clinical and histopathological groups (p<0.05). Histological groups showed significant differences in the EGFR expression pattern (p=0.016). Conlusions: All OLD samples showed high EGFR expression. The type of clinical lesion was not related with EGFR expression; however, there are differences in the EGFR expression pattern between histological groups that may be related with a different biological profile and malignant risk. Key words:Oral lichenoid disease, oral lichen planus, oral lichenoid lesion, oral carcinogenesis, EGFR. PMID:24880441

  2. Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells.


    Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang


    Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future.

  3. Dermal Contributions to Human Interfollicular Epidermal Architecture and Self-Renewal

    PubMed Central

    Lawlor, Kynan T.; Kaur, Pritinder


    The human interfollicular epidermis is renewed throughout life by populations of proliferating basal keratinocytes. Though interfollicular keratinocyte stem cells have been identified, it is not known how self-renewal in this compartment is spatially organized. At the epidermal-dermal junction, keratinocytes sit atop a heterogeneous mix of dermal cells that may regulate keratinocyte self-renewal by influencing local tissue architecture and signalling microenvironments. Focusing on the rete ridges and complementary dermal papillae in human skin, we review the identity and organisation of abundant dermal cells types and present evidence for interactions between the dermal microenvironment and the interfollicular keratinocytes. PMID:26602926

  4. Regulation of Srpr Expression by miR-330-5p Controls Proliferation of Mouse Epidermal Keratinocyte

    PubMed Central

    Kim, Bong-Kyu; Yoo, Hye-In; Choi, Keonwoo; Lee, Ah-Reum; Yoon, Sungjoo Kim


    Srpr is a gene encoding α subunit of the signal recognition particle receptor which is involved in the targeting and translocation of nascent secretory and membrane proteins to the endoplasmic reticulum. Previous studies showed aberrant expression of Srpr in several cell types with abnormal growth rate. Although Srpr is expressed in various tissues including skin, the role of Srpr in keratinocytes and regulation of its expression by miRNAs have not been studied. In this study, we investigated the role of SRPR and regulation of its expression by miRNA in skin keratinocytes. We found that SRPR was highly expressed in epidermal keratinocytes and regulated keratinocyte proliferation by affecting cell cycle progression. We also demonstrated that miR-330-5p directly inhibits Srpr expression. These data suggest that miR-330-5p-mediated regulation of the SRPR level is needed for the regulation of proliferation of epidermal keratinocytes. PMID:27768721

  5. Expression of paired-like homeodomain transcription factor 2c (PITX2c) in epidermal keratinocytes

    SciTech Connect

    Shi, Ge; Sohn, Kyung-Cheol; Choi, Tae-Young; Choi, Dae-Kyoung; Lee, Sang-Sin; Ou, Bai-sheng; Kim, Sooil; Lee, Young Ho; Yoon, Tae-Jin; Kim, Seong-Jin; Lee, Young; Seo, Young-Joon; Lee, Jeung-Hoon; Kim, Chang Deok


    Paired-like homeodomain transcription factor 2 (PITX2) has been implicated as one of the genes responsible for Rieger syndrome. It has been also shown to play a central role during development. In this study, we investigated the functional role of PITX2 in keratinocyte differentiation. RT-PCR analysis showed that PITX2c isoform was predominantly expressed in a differentiation-dependent manner. Consistent with, immunohistochemical staining showed that PITX2 expression was increased in the upper layer of epidermis. When PITX2c was overexpressed in cultured keratinocytes by a recombinant adenovirus, the differentiation markers such as involucrin and loricrin were significantly increased at both mRNA and protein levels. In addition, PITX2c overexpression led to the decrease of cell growth, concomitantly with the upregulation of cell cycle-related genes p21. To investigate the effect of PITX2c in vivo, we microinjected PITX2c expression vector into zebrafish embryo. Interestingly, overexpression of PITX2c in zebrafish embryo led to the formation of horn-like structure and thickening of epidermis, together with the increase of keratin 8 (K8) expression. These results suggest that PITX2c has a role in proliferation and differentiation of epidermal keratinocytes.

  6. Enhancement in gastric mucosal epidermal growth factor receptor expression by sulglycotide.


    Slomiany, B L; Piotrowski, J; Czajkowski, A; Murty, V L; Majka, J; Slomiany, A


    The effect of intragastric administration of sulglycotide, a cytoprotective sulfated glycopeptide, on the expression of gastric mucosal epidermal growth factor receptor was investigated. The experiments were conducted with groups of rats, one receiving twice daily for 5 consecutive days a dose of 200mg/kg sulglycotide, and the other only vehicle. Mucosal cell membranes were isolated from the stomachs at 16, 40 and 88h after the last dose, and used for EGF receptor assays. The binding assays revealed a marked increase in mucosal EGF receptor expression with sulglycotide. Compared to the controls, the sulglycotide-treated group showed a 4-fold increase in the EGF receptor expression at 16h after the last dose of sulglycotide, a 4.7-fold increase in the EGF receptor was observed by the 40h, and a 4.2-fold increase was still evident at 88h following the treatment. The results demonstrate that sulglycotide exhibits remarkable ability to enhance the gastric mucosal expression of EGF receptor.

  7. Epidermal growth factor receptor mutation enhances expression of vascular endothelial growth factor in lung cancer.


    Hung, Ming-Szu; Chen, I-Chuan; Lin, Paul-Yann; Lung, Jr-Hau; Li, Ya-Chin; Lin, Yu-Ching; Yang, Cheng-Ta; Tsai, Ying-Huang


    Epidermal growth factor receptor (EGFR) activation has been demonstrated to have a critical role in tumor angiogenesis. In the present study, the correlation between EGFR mutations and vascular endothelial growth factor (VEGF) was investigated in lung cancer cell lines and non-small-cell lung cancer (NSCLC) tumor tissues. VEGF levels were significantly increased in culture medium of lung cancer cells and NSCLC tissues with EGFR mutations (H1650 vs. A549, P=0.0399; H1975 vs. A549, P<0.0001). Stable lung cancer cell lines expressing mutant (exon 19 deletion, E746-A750; exon 21 missense mutation, L858R) and wild-type EGFR genes were established. Significantly increased expression of VEGF and stronger inhibitory effects of gefitinib to VEGF expression were observed in exon 19 deletion stable lung cancer cells (exon 19 deletion vs. wild-type EGFR, P=0.0005). The results of the present study may provide an insight into the association of mutant EGFR and VEGF expression in lung cancer, and may assist with further development of targeted therapy for NSCLC in the future.

  8. Analysis of Epidermal Growth Factor Receptor Related Gene Expression Changes in a Cellular and Animal Model of Parkinson’s Disease

    PubMed Central

    Kim, In-Su; Koppula, Sushruta; Park, Shin-Young; Choi, Dong-Kug


    We employed transcriptome analysis of epidermal growth factor receptor related gene expression changes in cellular and animal models of Parkinson’s disease (PD). We used a well-known Parkinsonian toxin 1-methyl-4-phenylpyridine (MPP+) to induce neuronal apoptosis in the human neuroblastoma SH-SY5Y cell line. The MPP+-treatment of SH-SY5Y cells was capable of inducing neuro-apoptosis, but it remains unclear what kinds of transcriptional genes are affected by MPP+ toxicity. Therefore the pathways that were significantly perturbed in MPP+ treated human neuroblastoma SH-SY5Y cells were identified based on genome-wide gene expression data at two time points (24 and 48 h). We found that the Epidermal Growth Factor Receptor (EGFR) pathway-related genes showed significantly differential expression at all time points. The EGFR pathway has been linked to diverse cellular events such as proliferation, differentiation, and apoptosis. Further, to evaluate the functional significance of the altered EGFR related gene expression observed in MPP+-treated SH-SY5Y cells, the EGFR related GJB2 (Cx26) gene expression was analyzed in an MPP+-intoxicated animal PD model. Our findings identify that the EGFR signaling pathway and its related genes, such as Cx26, might play a significant role in dopaminergic (DAergic) neuronal cell death during the process of neuro-apoptosis and therefore can be focused on as potential targets for therapeutic intervention. PMID:28212331


    EPA Science Inventory


  10. Expression of cyclin D1 in epithelial tissues of transgenic mice results in epidermal hyperproliferation and severe thymic hyperplasia.

    PubMed Central

    Robles, A I; Larcher, F; Whalin, R B; Murillas, R; Richie, E; Gimenez-Conti, I B; Jorcano, J L; Conti, C J


    To study the involvement of cyclin D1 in epithelial growth and differentiation and its putative role as an oncogene in skin, transgenic mice were developed carrying the human cyclin D1 gene driven by a bovine keratin 5 promoter. As expected, all squamous epithelia including skin, oral mucosa, trachea, vaginal epithelium, and the epithelial compartment of the thymus expressed aberrant levels of cyclin D1. The rate of epidermal proliferation increased dramatically in transgenic mice, which also showed basal cell hyperplasia. However, epidermal differentiation was unaffected, as shown by normal growth arrest of newborn primary keratinocytes in response to high extracellular calcium. Moreover, an unexpected phenotype was observed in the thymus. Transgenic mice developed a severe thymic hyperplasia that caused premature death due to cardio-respiratory failure within 4 months of age. By 14 weeks, the thymi of transgenic mice increased in weight up to 40-fold, representing 10% of total body weight. The hyperplastic thymi had normal histology revealing a well-differentiated cortex and medulla, which supported an apparently normal T-cell developmental program based on the distribution of thymocyte subsets. These results suggest that proliferation and differentiation of epithelial cells are under independent genetic controls in these organs and that cyclin D1 can modulate epithelial proliferation without altering the initiation of differentiation programs. No spontaneous development of epithelial tumors or thymic lymphomas was perceived in transgenic mice during their first 8 months of life, although they continue under observation. This model provides in vivo evidence of the action of cyclin D1 as a pure mediator of proliferation in epithelial cells. Images Fig. 1 Fig. 2 Fig. 3 PMID:8755527

  11. The Role of Epidermal Growth Factor-Like Module Containing Mucin-Like Hormone Receptor 2 in Human Cancers

    PubMed Central

    Safaee, Michael; Ivan, Michael E.; Oh, Michael C.; Oh, Taemin; Sayegh, Eli T.; Kaur, Gurvinder; Sun, Matthew Z.; Bloch, Orin; Parsa, Andrew T.


    G-protein coupled receptors (GPCRs) are among the most diverse and ubiquitous proteins in all of biology. The epidermal growth factor-seven span transmembrane (EGF-TM7) subfamily of adhesion GPCRs is a small subset whose members are mainly expressed on the surface of leukocytes. The EGF domains on the N-terminus add significant size to these receptors and they are considered to be among the largest members of the TM7 family. Although not all of their ligands or downstream targets have been identified, there is evidence implicating the EGF-TM7 family diverse processes such as cell adhesion, migration, inflammation, and autoimmune disease. Recent studies have identified expression of EGF-TM7 family members on human neoplasms including those of the thyroid, stomach, colon, and brain. Their presence on these tissues is not surprising given the ubiquity of GPCRs, but because their functional significance and pathways are not completely understood, they are of tremendous clinical and scientific interest. Current evidence suggests that expression of certain EGF-TM7 receptors is correlated with tumor grade, confers a more invasive phenotype, and increases the likelihood of metastatic disease. In this review, we will discuss the structure, function, and regulation of these receptors. We also describe the expression of these receptors in human cancers and explore their potential mechanistic significance. PMID:25992231

  12. Transcriptional profiling defines the effects of nickel in human epidermal keratinocytes.


    Gazel, Alix; Rosdy, Martin; Tornier, Carine; De Fraissinette, Anne De Brugerolle; Blumenberg, Miroslav


    Nickel is a ubiquitous and virtually unavoidable environmental pollutant and occupational hazard, but its molecular and cellular effects are not well understood. Human epidermal keratinocytes are the sentinel and the primary target for nickel. We treated with nickel salts skin equivalents containing differentiating epidermal keratinocytes grown on air-liquid interface in standard cell culture conditions. We identified the transcriptional profiles affected by nickel in reconstructed human epidermis (RHE) using DNA microarrays. The Ni-regulated genes were determined at two time points, immediate-early, 30 min after treatment, and late, at 6 h. Using in silico data analysis, we determined that 134 genes are regulated by nickel; of these, 97 are induced and 37 suppressed. Functional categories of regulated genes suggest that Ni inhibits apoptosis, promotes cell cycle and induces synthesis of extracellular matrix proteins and extracellular proteases. Importantly, Ni also regulates a set of secreted signaling proteins, inducing VEGF, amphiregulin, PGF, GDF15, and BST2, while suppressing IL-18, galectin-3, and LITAF. These secreted proteins may be important in Ni-caused allergic reactions. Ni induced inhibitors of the NFkappaB signaling pathway, and suppressed its activators. Correspondingly, NFkappaB binding sites were found to be overrepresented in the Ni-suppressed genes, whereas cFOS/AP1 binding sites were common in the Ni-induced genes. Significant parallels were found between the Ni-regulated genes and the genes regulated by TGFbeta, EGF, glucocorticoids, or Oncostatin-M. The comprehensive identification of Ni-regulated genes in human epidermal equivalents significantly advances our understanding of the molecular effects of nickel in skin.

  13. Transient gene expression in epidermal cells of plant leaves by biolistic DNA delivery.


    Ueki, Shoko; Magori, Shimpei; Lacroix, Benoît; Citovsky, Vitaly


    Transient gene expression is a useful approach for studying the functions of gene products. In the case of plants, Agrobacterium infiltration is a method of choice for transient introduction of genes for many species. However, this technique does not work efficiently in some species, such as Arabidopsis thaliana. Moreover, the infection of Agrobacterium is known to induce dynamic changes in gene expression patterns in the host plants, possibly affecting the function and localization of the proteins to be tested. These problems can be circumvented by biolistic delivery of the genes of interest. Here, we present an optimized protocol for biolistic delivery of plasmid DNA into epidermal cells of plant leaves, which can be easily performed using the Bio-Rad Helios gene gun system. This protocol allows efficient and reproducible transient expression of diverse genes in Arabidopsis, Nicotiana benthamiana and N. tabacum, and is suitable for studies of the biological function and subcellular localization of the gene products directly in planta. The protocol also can be easily adapted to other species by optimizing the delivery gas pressure.

  14. Protein Expression Signatures for Inhibition of Epidermal Growth Factor Receptor-mediated Signaling*

    PubMed Central

    Myers, Matthew V.; Manning, H. Charles; Coffey, Robert J.; Liebler, Daniel C.


    Analysis of cellular signaling networks typically involves targeted measurements of phosphorylated protein intermediates. However, phosphoproteomic analyses usually require affinity enrichment of phosphopeptides and can be complicated by artifactual changes in phosphorylation caused by uncontrolled preanalytical variables, particularly in the analysis of tissue specimens. We asked whether changes in protein expression, which are more stable and easily analyzed, could reflect network stimulation and inhibition. We employed this approach to analyze stimulation and inhibition of the epidermal growth factor receptor (EGFR) by EGF and selective EGFR inhibitors. Shotgun analysis of proteomes from proliferating A431 cells, EGF-stimulated cells, and cells co-treated with the EGFR inhibitors cetuximab or gefitinib identified groups of differentially expressed proteins. Comparisons of these protein groups identified 13 proteins whose EGF-induced expression changes were reversed by both EGFR inhibitors. Targeted multiple reaction monitoring analysis verified differential expression of 12 of these proteins, which comprise a candidate EGFR inhibition signature. We then tested these 12 proteins by multiple reaction monitoring analysis in three other models: 1) a comparison of DiFi (EGFR inhibitor-sensitive) and HCT116 (EGFR-insensitive) cell lines, 2) in formalin-fixed, paraffin-embedded mouse xenograft DiFi and HCT116 tumors, and 3) in tissue biopsies from a patient with the gastric hyperproliferative disorder Ménétrier's disease who was treated with cetuximab. Of the proteins in the candidate signature, a core group, including c-Jun, Jagged-1, and Claudin 4, were decreased by EGFR inhibitors in all three models. Although the goal of these studies was not to validate a clinically useful EGFR inhibition signature, the results confirm the hypothesis that clinically used EGFR inhibitors generate characteristic protein expression changes. This work further outlines a prototypical

  15. Benzoyl peroxide interferes with metabolic co-operation between cultured human epidermal keratinocytes

    SciTech Connect

    Lawrence, N.J.; Parkinson, E.K.; Emmerson, A.


    The ability of benzoyl peroxide to inhibit metabolic co-operation in rodent cell cultures may be relevant to its recently reported tumour promoting activity in mouse epidermis. We show here that non-toxic doses of this compound reduce metabolic co-operation between human epidermal keratinocytes to approximately 30% of that found in controls. The doses of benzoyl peroxide used did not affect keratinocyte morphology or their rate of attachment to the culture substratum. These results could be important as benzoyl peroxide is widely used in industry.

  16. Human papillomavirus E6/E7 oncogenes promote mouse ear regeneration by increasing the rate of wound re-epithelization and epidermal growth.


    Valencia, Concepción; Bonilla-Delgado, José; Oktaba, Katarzyna; Ocádiz-Delgado, Rodolfo; Gariglio, Patricio; Covarrubias, Luis


    Mammals have limited regeneration capacity. We report here that, in transgenic mice (Tg(bK6-E6/E7)), the expression of the E6/E7 oncogenes of human papilloma virus type 16 (HPV16) under the control of the bovine keratin 6 promoter markedly improves the mouse's capacity to repair portions of the ear after being wounded. Increased repair capacity correlates with an increased number of epidermal proliferating cells. In concordance with the expected effects of the E6 and E7 oncogenes, levels of p53 decreased and those of p16 in epidermal cells increased. In addition, we observed that wound re-epithelization proceeded faster in transgenic than in wild-type animals. After the initial re-epithelization, epidermal cell migration from the intact surrounding tissue appears to be a major contributor to the growing epidermis, especially in the repairing tissue of transgenic mice. We also found that there is a significantly higher number of putative epidermal stem cells in Tg(bK6-E6/E7) than in wild-type mice. Remarkably, hair follicles and cartilage regenerated within the repaired ear tissue, without evidence of tumor formation. We propose that the ability to regenerate ear portions is limited by the capacity of the epidermis to repair itself and grow.

  17. Transgenic expression of cyclin-dependent kinase 4 results in epidermal hyperplasia, hypertrophy, and severe dermal fibrosis.


    Miliani de Marval, P L; Gimenez-Conti, I B; LaCava, M; Martinez, L A; Conti, C J; Rodriguez-Puebla, M L


    In a previous report we have described the effects of expression of D-type cyclins in epithelial tissues of transgenic mice. To study the involvement of the D-type cyclin partner cyclin-dependent kinase 4 (CDK4) in epithelial growth and differentiation, transgenic mice were generated carrying the CDK4 gene under the control of a keratin 5 promoter. As expected, transgenic mice showed expression of CDK4 in the epidermal basal-cell layer. Epidermal proliferation increased dramatically and basal cell hyperplasia and hypertrophy were observed. The hyperproliferative phenotype of these transgenic mice was independent of D-type cyclin expression because no overexpression of these proteins was detected. CDK4 and CDK2 kinase activities increased in transgenic animals and were associated with elevated binding of p27(Kip1) to CDK4. Expression of CDK4 in the epidermis results in an increased spinous layer compared with normal epidermis, and a mild hyperkeratosis in the cornified layer. In addition to epidermal changes, severe dermal fibrosis was observed and part of the subcutaneous adipose tissue was replaced by connective tissue. Also, abnormal expression of keratin 6 associated with the hyperproliferative phenotype was observed in transgenic epidermis. This model provides in vivo evidence for the role of CDK4 as a mediator of proliferation in epithelial cells independent of D-type cyclin expression.

  18. Transient expression of minimum linear gene cassettes in onion epidermal cells via direct transformation.


    Cheng, Yun-Qing; Yang, Jun; Xu, Feng-Ping; An, Li-Jia; Liu, Jian-Feng; Chen, Zhi-Wen


    A new method without any special devices for direct transformation of linear gene cassettes was developed. Its feasibility was verified through 5'-fluorescent dye (fluorescein isothiocyanate, FITC)-labeled fluorescent tracing and transient expression of a gus reporter gene. Minimal linear gene cassettes, containing necessary regulation elements and a gus reporter gene, was prepared by polymerase chain reaction and dissolved in transformation buffer solution to 100 ng/mL. The basic transformation solution used was Murashige and Skoog basal salt mixture (MS) liquid medium. Hypertonic pretreatment of explants and transformation cofactors, including Ca(2+), surfactant assistants, Agrobacterium LBA4404 cell culture on transformation efficiency were evaluated. Prior to the incubation of the explants and target linear cassette in each designed transformation solution for 3 h, the onion low epidermal explants were pre-cultured in darkness at 27 degrees C for 48 h and then transferred to MS solid media for 72 h. FITC-labeled linear DNA was used to trace the delivery of DNA entry into the cell and the nuclei. By GUS staining and flow-cytometry-mediated fluorescent detection, a significant increase of the ratios of fluorescent nuclei as well as expression of the gus reporter gene was observed by each designed transformation solution. This potent and feasible method showed prospective applications in plant transgenic research.

  19. Proliferative response and oncogene expression induced by epidermal growth factor in EL2 rat fibroblasts.


    Liboi, E; Pelosi, E; Testa, U; Peschle, C; Rossi, G B


    Extensive evidence supports a two-step model for the control of fibroblast growth, which includes first the action of a competence factor (e.g., platelet-derived growth factor) followed by the stimulus of a progression factor (e.g., epidermal growth factor [EGF]). We investigated whether this model may be applied to the euploid EL2 fibroblast line recently isolated from rat embryos (E. Liboi, M. Caruso, and C. Basilico, Mol. Cell. Biol. 4:2925-2928, 1984). Our results clearly show that EGF alone leads EL2 cells to proliferate in serum-free conditions at a rate corresponding to 50 to 60% of that observed in the presence of 10% calf serum. It is of interest that, when resting EL2 cells were exposed to EGF, transcription of both c-myc and c-fos was markedly induced. Altogether, these observations suggest that, in contrast with the model of fibroblast growth mentioned above, EL2 cells require the presence of a single growth factor (EGF) for induction of DNA synthesis, and the expression of myc and fos proto-oncogenes may represent an obligatory step in the pathway of commitment of EL2 cells to proliferation. In addition, we showed that EGF may induce EL2 cells to acquire some properties of transformed cells, such as growth in agar and loss of contact inhibition. This suggests that the particular response to EGF of the EL2 line may be strictly connected with the expression of a transformed phenotype.

  20. Identification of bone morphogenetic protein 7 (BMP7) as an instructive factor for human epidermal Langerhans cell differentiation.


    Yasmin, Nighat; Bauer, Thomas; Modak, Madhura; Wagner, Karin; Schuster, Christopher; Köffel, Rene; Seyerl, Maria; Stöckl, Johannes; Elbe-Bürger, Adelheid; Graf, Daniel; Strobl, Herbert


    Human Langerhans cell (LC) precursors populate the epidermis early during prenatal development and thereafter undergo massive proliferation. The prototypic antiproliferative cytokine TGF-β1 is required for LC differentiation from human CD34(+) hematopoietic progenitor cells and blood monocytes in vitro. Similarly, TGF-β1 deficiency results in LC loss in vivo. However, immunohistology studies revealed that human LC niches in early prenatal epidermis and adult basal (germinal) keratinocyte layers lack detectable TGF-β1. Here we demonstrated that these LC niches express high levels of bone morphogenetic protein 7 (BMP7) and that Bmp7-deficient mice exhibit substantially diminished LC numbers, with the remaining cells appearing less dendritic. BMP7 induces LC differentiation and proliferation by activating the BMP type-I receptor ALK3 in the absence of canonical TGF-β1-ALK5 signaling. Conversely, TGF-β1-induced in vitro LC differentiation is mediated via ALK3; however, co-induction of ALK5 diminished TGF-β1-driven LC generation. Therefore, selective ALK3 signaling by BMP7 promotes high LC yields. Within epidermis, BMP7 shows an inverse expression pattern relative to TGF-β1, the latter induced in suprabasal layers and up-regulated in outer layers. We observed that TGF-β1 inhibits microbial activation of BMP7-generated LCs. Therefore, TGF-β1 in suprabasal/outer epidermal layers might inhibit LC activation, resulting in LC network maintenance.

  1. The mysterious human epidermal cell cycle, or an oncogene-induced differentiation checkpoint

    PubMed Central

    Gandarillas, Alberto


    Fifteen years ago, we reported that proto-oncogene MYC promoted differentiation of human epidermal stem cells, a finding that was surprising to the MYC and the skin research communities. MYC was one of the first human oncogenes identified, and it had been strongly associated with proliferation. However, it was later shown that MYC could induce apoptosis under low survival conditions. Currently, the notion that MYC promotes epidermal differentiation is widely accepted, but the cell cycle mechanisms that elicit this function remain unresolved. We have recently reported that keratinocytes respond to cell cycle deregulation and DNA damage by triggering terminal differentiation. This mechanism might constitute a homeostatic protection face to cell cycle insults. Here, I discuss recent and not-so-recent evidence suggesting the existence of a largely unexplored oncogene-induced differentiation response (OID) analogous to oncogene-induced apoptosis (OIA) or senescence (OIS). In addition, I propose a model for the role of the cell cycle in skin homeostasis maintenance and for the dual role of MYC in differentiation. PMID:23114621

  2. Regenerative and reparative effects of human chorion-derived stem cell conditioned medium on photo-aged epidermal cells.


    Li, Qiankun; Chen, Yan; Ma, Kui; Zhao, Along; Zhang, Cuiping; Fu, Xiaobing


    Epidermal cells are an important regenerative source for skin wound healing. Aged epidermal cells have a low ability to renew themselves and repair skin injury. Ultraviolet (UV) radiation, particularly UVB, can cause photo-aging of the skin by suppressing the viability of human epidermal cells. A chorion-derived stem cell conditioned medium (CDSC-CNM) is thought to have regenerative properties. This study aimed to determine the regenerative effects of CDSC-CNM on UVB-induced photo-aged epidermal cells. Epidermal cells were passaged four times and irradiated with quantitative UVB, and non-irradiated cells served as a control group. Cells were then treated with different concentrations of CDSC-CNM. Compared to the non-irradiated group, the proliferation rates and migration rates of UVB-induced photo-aged epidermal cells significantly decreased (p < 0.05) with increasing intracellular radical oxygen species (ROS) generation and DNA damage. After treatment with CDSC-CNM, photo-aged epidermal cells significantly improved their viability, and their ROS generation and DNA damage decreased. The secretory factors in CDSC-CNM, including epidermal growth factor (EGF), transforming growth factor-β (TGF-β), interleukin (IL)-6, and IL-8 and the related signaling pathway protein levels, increased compared to the control medium (CM). The potential regenerative and reparative effects of CDSC-CNM indicate that it may be a candidate material for the treatment of prematurely aged skin. The functions of the secretory factors and the mechanisms of CDSC-CNM therapy deserve further attention.

  3. Inverse relationship between estrogen receptor and epidermal growth factor receptor mRNA levels in human breast cancer cell lines.


    Lee, C S; Hall, R E; Alexander, I E; Koga, M; Shine, J; Sutherland, R L


    Epidermal growth factor receptors (EGF-R) are present in a number of human breast cancer cell lines and tumor biopsies. Furthermore, it has been suggested that EGF-R levels are higher in estrogen receptor negative (ER-) than in ER+ human breast tumors and that EGF-R status may be a prognostic indicator in breast cancer. The present study was undertaken to establish whether there is a quantitative relationship between EGF-R and ER mRNA concentrations in a series of 10 well-characterized human breast cancer cell lines. All cell lines expressed detectable quantities of EGF-R mRNA by Northern analysis but the relative abundance of EGF-R mRNA varied more than 50-fold. Two transcripts corresponding to the 10.5- and 5.8-kb mRNAs described in other cell types were present but in different relative proportions in different cell lines. When these lines were divided into an ER+ and an ER- group based on their ability to bind estradiol, ER- cell lines were shown to express significantly higher concentrations of EGF-R mRNA than did ER+ cell lines (p less than 0.005). Furthermore, linear-regression analysis revealed a significant inverse relationship between ER and EGF-R mRNA concentrations both within the group of 10 human breast cancer cell lines as a whole (r = 0.66) and within the 6 functionally ER + lines (r = 0.77). This demonstration of a significant (p less than 0.005) inverse relationship between the concentrations of ER and EGF-R mRNAs in ER + cell lines raises the possibility of reciprocal regulation of the expression of these genes in human breast cancer.

  4. Nerve growth factor and epidermal growth factor stimulate clusterin gene expression in PC12 cells.

    PubMed Central

    Gutacker, C; Klock, G; Diel, P; Koch-Brandt, C


    Clusterin (apolipoprotein J) is an extracellular glycoprotein that might exert functions in development, cell death and lipid transport. Clusterin gene expression is elevated at sites of tissue remodelling, such as differentiation and apoptosis; however, the signals responsible for this regulation have not been identified. We use here the clusterin gene as a model system to examine expression in PC12 cells under the control of differentiation and proliferation signals produced by nerve growth factor (NGF) and by epidermal growth factor (EGF) respectively. NGF induced clusterin mRNA, which preceded neurite outgrowth typical of neuronal differentiation. EGF also activated the clusterin mRNA, demonstrating that both proliferation and differentiation signals regulate the gene. To localize NGF- and EGF-responsive elements we isolated the clusterin promoter and tested it in PC12 cell transfections. A 2.5 kb promoter fragment and two 1.5 and 0.3 kb deletion mutants were inducible by NGF and EGF. The contribution to this response of a conserved activator protein 1 (AP-1) motif located in the 0.3 kb fragment was analysed by mutagenesis. The mutant promoter was not inducible by NGF or EGF, which identifies the AP-1 motif as an element responding to both factors. Binding studies with PC12 nuclear extracts showed that AP-1 binds to this sequence in the clusterin promoter. These findings suggest that NGF and EGF, which give differential gene regulation in PC12 cells, resulting in neuronal differentiation and proliferation respectively, use the common Ras/extracellular signal-regulated kinase/AP-1 signalling pathway to activate clusterin expression. PMID:10215617

  5. Cloning of human epidermal growth factor as a bacterial secretory protein, its properties and mutagenesis

    SciTech Connect

    Engler, D.A.; Matsunami, R.K.; Campion, S.R.; Foote, R.S.; Mural, R.J.; Larimer, F.W.; Stevens, A.; Niyogi, S.K.


    A chimeric gene, containing the DNA coding for the human epidermal growth factor (EGF) and that for the signal peptide of E. coli alkaline phosphatase, was constructed by the annealing and subsequent ligation of appropriate DNA oligonucleotides synthesized in an automated DNA synthesizer. The gene was then cloned into a bacterial plasmid under the transcriptional control of the E. coli trp-lac (tac) promoter, and then transformed into E. coli. Following induction with isopropylthiogalactoside, the secretion of EGF into the E. coli periplasmic space and some into the growth medium was confirmed by its specific binding to the EGF receptor and stimulation of the EGF receptor tyrosine kinase activity. The size and physicochemical properties of the purified protein mimicked those of authentic human EGF. Studies of structure/function relationships by specific alterations of targeted amino acid residues in the EGF molecule have been initiated by utilizing site-directed mutagenesis.

  6. Cellular and Tumor Radiosensitivity is Correlated to Epidermal Growth Factor Receptor Protein Expression Level in Tumors Without EGFR Amplification;Epidermal growth factor receptor; Radiotherapy; Squamous cell carcinoma; Biomarker; Local tumor control

    SciTech Connect

    Kasten-Pisula, Ulla; Saker, Jarob; Eicheler, Wolfgang; Krause, Mechthild; Yaromina, Ala; Meyer-Staeckling, Soenke; Scherkl, Benjamin; Kriegs, Malte; Brandt, Burkhard; Grenman, Reidar; Petersen, Cordula; Baumann, Michael; Dikomey, Ekkehard


    Purpose: There is conflicting evidence for whether the expression of epidermal growth factor receptor in human tumors can be used as a marker of radioresponse. Therefore, this association was studied in a systematic manner using squamous cell carcinoma (SCC) cell lines grown as cell cultures and xenografts. Methods and Materials: The study was performed with 24 tumor cell lines of different tumor types, including 10 SCC lines, which were also investigated as xenografts on nude mice. Egfr gene dose and the length of CA-repeats in intron 1 were determined by polymerase chain reaction, protein expression in vitro by Western blot and in vivo by enzyme-linked immunosorbent assay, and radiosensitivity in vitro by colony formation. Data were correlated with previously published tumor control dose 50% data after fractionated irradiation of xenografts of the 10 SCC. Results: EGFR protein expression varies considerably, with most tumor cell lines showing moderate and only few showing pronounced upregulation. EGFR upregulation could only be attributed to massive gene amplification in the latter. In the case of little or no amplification, in vitro EGFR expression correlated with both cellular and tumor radioresponse. In vivo EGFR expression did not show this correlation. Conclusions: Local tumor control after the fractionated irradiation of tumors with little or no gene amplification seems to be dependent on in vitro EGFR via its effect on cellular radiosensitivity.

  7. Epidermal growth factor controls smooth muscle alpha-isoactin expression in BC3H1 cells

    PubMed Central


    We have examined the effects of epidermal growth factor (EGF), platelet- derived growth factor, and insulin on the differentiation of a mouse vascular smooth muscle-like cell line, the BC3H1 cells. On the basis of cell morphology and smooth muscle alpha-isoactin synthesis, we demonstrate that EGF at physiological concentrations prevents the differentiation of these cells, whereas platelet-derived growth factor has no apparent effect. The induction of alpha-isoactin synthesis by serum deprivation is inhibited by EGF in a dose-dependent manner with a half-maximal effect at 3-5 ng/ml and a maximal inhibition at approximately 30 ng/ml. Northern analysis also shows that EGF blocks the accumulation of alpha-isoactin mRNA normally observed during cell differentiation. Addition of EGF to differentiated cells results in a repression of alpha-isoactin synthesis, a stimulation of beta- and gamma-isoactin synthesis, and the stabilization of the nonmuscle isoactins. The synthesis of creatine phosphokinase, a muscle-specific noncontractile protein, is also regulated by EGF in a similar fashion. Modulation by EGF of alpha-isoactin expression is not affected by aphidicolin and is therefore independent of its mitogenic effect on these cells. Insulin is not required for observation of the EGF- dependent effects but instead seems to promote differentiation. Our results show that EGF can replace serum in controlling the differentiation of BC3H1 cells. PMID:3279054

  8. Sister chromatid exchange frequency in human epidermal cells in culture treated with 8-methoxypsoralen and long-wave UV radiation

    SciTech Connect

    West, M.R.; Johansen, M.; Faed, M.J.


    The effects of 8-methoxypsoralen with long-wave ultraviolet radiation on the sister chromatid exchange frequency in human epidermal cells in culture was investigated. With a constant amount of radiation the number of exchanges increased in an approximately linear manner with increasing concentrations of 8-methoxypsoralen up to 0.3 micrograms/ml. Above this concentration there were fewer dividing cells and an apparent departure from linearity in the dose-response curve. These results show that 8-methoxypsoralen concentrations equivalent to those found in the serum of patients undergoing photochemotherapy, in conjunction with UVA radiation, cause striking increases in sister chromatid exchange frequency in human epidermal cells in vitro.

  9. Rectal 1% Tenofovir Gel Use Associates with Altered Epidermal Protein Expression

    PubMed Central

    Romas, Laura; Birse, Kenzie; Mayer, Kenneth H.; Abou, Max; Westmacott, Garrett; Giguere, Rebecca; Febo, Irma; Cranston, Ross D.; Carballo-Diéguez, Alex; McGowan, Ian


    Abstract Rectal use of a 1% tenofovir (TFV) gel is currently being evaluated for HIV prevention. While careful assessment of mucosal safety of candidate microbicides is a primary concern, tools to assess mucosal toxicity are limited. Mass spectrometry-based proteomics is a sensitive and high-throughput technique that can provide in-depth information on inflammation processes in biological systems. In this study, we utilized a proteomics approach to characterize mucosal responses in study participants involved in a phase 1 clinical trial of a rectal TFV-based gel. Project Gel was a phase 1 randomized (1:1), double-blind, multisite, placebo-controlled trial in which 24 participants received rectal TFV or a universal placebo [hydroxyethyl cellulose (HEC)] over a course of 8 daily doses. Rectal mucosal swabs were collected after 0, 1, and 8 doses and were analyzed by label-free tandem mass spectrometry. Differential protein expression was evaluated using a combination of paired (time-effects) and unpaired (across study arm) t-tests, and multivariate [least absolute shrinkage and selection operator (LASSO)] modeling. Within the TFV arm, 7% (17/249, p < .05) and 10% (25/249, p < .05) of total proteins changed after 1 and 8 daily applications of TFV gel, respectively, compared to 3% (7/249, p < .05) and 6% (16/249, p < .05) in the HEC arm. Biofunctional analysis associated TFV use with a decrease in epidermal barrier proteins (adj. p = 1.21 × 10−10). Multivariate modeling identified 13 proteins that confidently separated TFV gel users (100% calibration and 96% cross-validation accuracy), including the epithelial integrity factors (FLMNB, CRNN, CALM), serpins (SPB13, SPB5), and cytoskeletal proteins (VILI, VIME, WRD1). This study suggested that daily rectal applications of a 1% TFV gel may be associated with mucosal proteome changes involving epidermal development. Further assessment of more extended use of TFV-gel is recommended to validate

  10. Discovery of Novel Human Epidermal Growth Factor Receptor-2 Inhibitors by Structure-based Virtual Screening

    PubMed Central

    Shi, Zheng; Yu, Tian; Sun, Rong; Wang, Shan; Chen, Xiao-Qian; Cheng, Li-Jia; Liu, Rong


    Background: Human epidermal growth factor receptor-2 (HER2) is a trans-membrane receptor like protein, and aberrant signaling of HER2 is implicated in many human cancers, such as ovarian cancer, gastric cancer, and prostate cancer, most notably breast cancer. Moreover, it has been in the spotlight in the recent years as a promising new target for therapy of breast cancer. Objective: Since virtual screening has become an integral part of the drug discovery process, it is of great significant to identify novel HER2 inhibitors by structure-based virtual screening. Materials and Methods: In this study, we carried out a series of elegant bioinformatics approaches, such as virtual screening and molecular dynamics (MD) simulations to identify HER2 inhibitors from Food and Drug Administration-approved small molecule drug as potential “new use” drugs. Results: Molecular docking identified top 10 potential drugs which showed spectrum affinity to HER2. Moreover, MD simulations suggested that ZINC08214629 (Nonoxynol-9) and ZINC03830276 (Benzonatate) might exert potential inhibitory effects against HER2-targeted anti-breast cancer therapeutics. Conclusion: Together, our findings may provide successful application of virtual screening studies in the lead discovery process, and suggest that our discovered small molecules could be effective HER2 inhibitor candidates for further study. SUMMARY A series of elegant bioinformatics approaches, including virtual screening and molecular dynamics (MD) simulations were took advantage to identify human epidermal growth factor receptor-2 (HER2) inhibitors. Molecular docking recognized top 10 candidate compounds, which showed spectrum affinity to HER2. Further, MD simulations suggested that ZINC08214629 (Nonoxynol-9) and ZINC03830276 (Benzonatate) in candidate compounds were identified as potential “new use” drugs against HER2-targeted anti-breast cancer therapeutics. Abbreviations used: HER2: Human epidermal growth factor receptor-2

  11. New Whitening Constituents from Taiwan-Native Pyracantha koidzumii: Structures and Tyrosinase Inhibitory Analysis in Human Epidermal Melanocytes

    PubMed Central

    Lin, Rong-Dih; Chen, Mei-Chuan; Liu, Yan-Ling; Lin, Yi-Tzu; Lu, Mei-Kuang; Hsu, Feng-Lin; Lee, Mei-Hsien


    Nontoxic natural products useful in skin care cosmetics are of considerable interest. Tyrosinase is a rate-limiting enzyme for which its inhibitor is useful in developing whitening cosmetics. Pyracantha koidzumii (Hayata) Rehder is an endemic species in Taiwan that exhibits tyrosinase-inhibitory activity. To find new active natural compounds from P. koidzumii, we performed bioguided isolation and studied the related activity in human epidermal melanocytes. In total, 13 compounds were identified from P. koidzumii in the present study, including two new compounds, 3,6-dihydroxy-2,4-dimethoxy-dibenzofuran (9) and 3,4-dihydroxy-5-methoxybiphenyl-2ʹ-O-β-d-glucopyranoside (13), as well as 11 known compounds. The new compound 13 exhibited maximum potency in inhibiting cellular tyrosinase activity, the protein expression of cellular tyrosinase and tyrosinase-related protein-2, as well as the mRNA expression of Paired box 3 and microphthalmia-associated transcription factor in a concentration-dependent manner. In the enzyme kinetic assay, the new compound 13 acted as an uncompetitive mixed-type inhibitor against the substrate l-3,4-dihydroxyphenylalanine and had a Km value against this substrate of 0.262 mM, as calculated using the Lineweaver–Burk plots. Taken together, our findings show compound 13 exhibits tyrosinase inhibition in human melanocytes and compound 13 may be a potential candidate for use in cosmetics. PMID:26633381

  12. Neuropilin 1 expression correlates with differentiation status of epidermal cells and cutaneous squamous cell carcinomas

    PubMed Central

    Shahrabi-Farahani, Shokoufeh; Wang, Lili; Zwaans, Bernadette M. M.; Santana, Jeans M.; Shimizu, Akio; Takashima, Seiji; Kreuter, Michael; Coultas, Leigh; D'Amore, Patricia A.; Arbeit, Jeffrey M.; Akslen, Lars A.; Bielenberg, Diane R.


    Neuropilins (NRP) are cell surface receptors for VEGF and SEMA3 family members. The role of NRP in neurons and endothelial cells has been investigated, but the expression and role of NRP in epithelial cells is much less clear. Herein, the expression and localization of neuropilin 1 (NRP1) was investigated in human and mouse skin and squamous cell carcinomas (SCC). Results indicated that NRP1 mRNA and protein was expressed in the suprabasal epithelial layers of skin sections. NRP1 staining did not overlap with that of keratin 14 (K14) or proliferating cell nuclear antigen, but did colocalize with staining for keratin 1, indicating that differentiated keratinocytes express NRP1. Similar to the expression of NRP1, VEGF-A was expressed in suprabasal epithelial cells, whereas Nrp2 and VEGFR2 were not detectable in the epidermis. The expression of NRP1 correlated with a high degree of differentiation in human SCC specimens, human SCC xenografts, and mouse K14-HPV16 transgenic SCC. UVB irradiation of mouse skin induced Nrp1 upregulation. In vitro, Nrp1 was upregulated in primary keratinocytes in response to differentiating media or EGF-family growth factors. In conclusion, the expression of NRP1 is regulated in the skin and is selectively produced in differentiated epithelial cells. NRP1 may function as a reservoir to sequester VEGF ligand within the epithelial compartment, thereby modulating its bioactivity. PMID:24791743

  13. UV radiation induces CXCL5 expression in human skin.


    Reichert, Olga; Kolbe, Ludger; Terstegen, Lara; Staeb, Franz; Wenck, Horst; Schmelz, Martin; Genth, Harald; Kaever, Volkhard; Roggenkamp, Dennis; Neufang, Gitta


    CXCL5 has recently been identified as a mediator of UVB-induced pain in rodents. To compare and to extend previous knowledge of cutaneous CXCL5 regulation, we performed a comprehensive study on the effects of UV radiation on CXCL5 regulation in human skin. Our results show a dose-dependent increase in CXCL5 protein in human skin after UV radiation. CXCL5 can be released by different cell types in the skin. We presumed that, in addition to immune cells, non-immune skin cells also contribute to UV-induced increase in CXCL5 protein. Analysis of monocultured dermal fibroblasts and keratinocytes revealed that only fibroblasts but not keratinocytes displayed up regulated CXCL5 levels after UV stimulation. Whereas UV treatment of human skin equivalents, induced epidermal CXCL5 mRNA and protein expression. Up regulation of epidermal CXCL5 was independent of keratinocyte differentiation and keratinocyte-keratinocyte interactions in epidermal layers. Our findings provide first evidence on the release of CXCL5 in UV-radiated human skin and the essential role of fibroblast-keratinocyte interaction in the regulation of epidermal CXCL5.

  14. Aging affects epidermal Langerhans cell development and function and alters their miRNA gene expression profile.


    Xu, Ying-Ping; Qi, Rui-Qun; Chen, Wenbin; Shi, Yuling; Cui, Zhi-Zhong; Gao, Xing-Hua; Chen, Hong-Duo; Zhou, Li; Mi, Qing-Sheng


    Immunosenescence is a result of progressive decline in immune system function with advancing age. Epidermal Langerhans cells (LCs), belonging to the dendritic cell (DC) family, act as sentinels to play key roles in the skin immune responses. However, it has not been fully elucidated how aging affects development and function of LCs. Here, we systemically analyzed LC development and function during the aging process in C57BL/6J mice, and performed global microRNA (miRNA) gene expression profiles in aged and young LCs. We found that the frequency and maturation of epidermal LCs were significantly reduced in aged mice starting at 12 months of age, while the Langerin expression and ability to phagocytose Dextran in aged LCs were increased compared to LCs from < 6 month old mice. The migration of LCs to draining lymph nodes was comparable between aged and young mice. Functionally, aged LCs were impaired in their capacity to induce OVA-specific CD4+ and CD8+ T cell proliferation. Furthermore, the expression of miRNAs in aged epidermal LCs showed a distinct profile compared to young LCs. Most interestingly, aging-regulated miRNAs potentially target TGF-β-dependent and non- TGF-β-dependent signal pathways related to LCs. Overall, our data suggests that aging affects LCs development and function, and that age-regulated miRNAs may contribute to the LC developmental and functional changes in aging.

  15. Regulation of fos-lacZ fusion gene expression in primary mouse epidermal keratinocytes isolated from transgenic mice.

    PubMed Central

    Bollag, W B; Xiong, Y; Ducote, J; Harmon, C S


    The expression of a fos-lacZ fusion gene was studied in primary mouse epidermal keratinocytes obtained from transgenic mice. This gene construct contains the entire upstream regulatory sequence of c-fos, and expression of the endogenous and fusion gene was shown by Northern analysis to correlate upon induction with the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA). Using a chromogenic substrate of beta-galactosidase, we also demonstrated that expression of the fusion gene product, like that of Fos, was localized to the cell nucleus. In addition, we showed that epidermal keratinocytes responded to dialysed fetal bovine serum (FBS), TPA and high-calcium medium with enhanced Fos-lacZ expression and an inhibition of proliferation. The time course of induction of Fos-lacZ expression was similar for dialysed FBS and TPA, with a peak approximately 2 h after exposure. Exposure for approximately 24 h to an elevated extracellular calcium concentration was required to elicit an increase in Fos-lacZ expression. The lack of an immediate effect of raising medium calcium levels on Fos-lacZ expression contrasted with the rapidity of its effect on DNA synthesis, which was significantly inhibited within 6-8 h. In addition, we found that the protein kinase C inhibitor Ro 31-7549 blocked Fos-lacZ expression induced by TPA but had little or no effect on that elicited by high calcium levels. Thus, although our results indicate that the fos gene product may be involved in mediating epidermal keratinocyte growth arrest in response to differentiative agents such as FBS, TPA and high medium calcium levels, the exact role of this gene product remains unclear. Images Figure 1 Figure 2 PMID:8198544

  16. Regulation of fos-lacZ fusion gene expression in primary mouse epidermal keratinocytes isolated from transgenic mice.


    Bollag, W B; Xiong, Y; Ducote, J; Harmon, C S


    The expression of a fos-lacZ fusion gene was studied in primary mouse epidermal keratinocytes obtained from transgenic mice. This gene construct contains the entire upstream regulatory sequence of c-fos, and expression of the endogenous and fusion gene was shown by Northern analysis to correlate upon induction with the phorbol ester 12-O-tetradecanoylphorbol 13-acetate (TPA). Using a chromogenic substrate of beta-galactosidase, we also demonstrated that expression of the fusion gene product, like that of Fos, was localized to the cell nucleus. In addition, we showed that epidermal keratinocytes responded to dialysed fetal bovine serum (FBS), TPA and high-calcium medium with enhanced Fos-lacZ expression and an inhibition of proliferation. The time course of induction of Fos-lacZ expression was similar for dialysed FBS and TPA, with a peak approximately 2 h after exposure. Exposure for approximately 24 h to an elevated extracellular calcium concentration was required to elicit an increase in Fos-lacZ expression. The lack of an immediate effect of raising medium calcium levels on Fos-lacZ expression contrasted with the rapidity of its effect on DNA synthesis, which was significantly inhibited within 6-8 h. In addition, we found that the protein kinase C inhibitor Ro 31-7549 blocked Fos-lacZ expression induced by TPA but had little or no effect on that elicited by high calcium levels. Thus, although our results indicate that the fos gene product may be involved in mediating epidermal keratinocyte growth arrest in response to differentiative agents such as FBS, TPA and high medium calcium levels, the exact role of this gene product remains unclear.

  17. Transforming growth factor alpha and epidermal growth factor levels in normal human gastrointestinal mucosa.

    PubMed Central

    Cartlidge, S. A.; Elder, J. B.


    Acid soluble proteins from 23 samples of normal human gastrointestinal mucosa derived from four normal adult organ donors were extracted and subjected to specific radiommunoassays for transforming growth factor alpha (TGF alpha) and urogastrone epidermal growth factor (URO-EGF). All tissues were found to contain immunoreactive TGF alpha and levels ranged from 57 to 4,776 pg-1 wet weight of tissue. Although levels varied between tissue donors, the distribution of TGF alpha throughout the gastrointestinal tract appeared similar in all cases. URO-EGF levels were much lower (0-216 pg g-1 wet weight). TGF alpha levels in extracts of gastrointestinal mucosa from a 7-year-old female donor were higher and the observed distribution was markedly different from adult levels. URO-EGF was not detected in mucosal or submucosal tissue extracts from this patient. Further studies in juveniles are indicated. PMID:2803941

  18. Recycling of epidermal growth factor in a human pancreatic carcinoma cell line

    SciTech Connect

    Korc, M.; Magun, B.E.


    PANC-1 human pancreatic carcinoma cells readily bound and internalized /sup 125/I-labeled epidermal growth factor (EGF). Bound /sup 125/I-labeled EGF was then partially processed to a number of high molecular weight acidic species. Percoll gradient centrifugation of cell homogenates indicated that the majority of /sup 125/I activity localized to several intracellular vesicular compartments. Both intact EGF and its processed species were subsequently released into the incubation medium. A major portion of the released radioactivity was capable of rebinding to the cell. Only a small amount of bound /sup 125/I-labeled EGF was degraded to low molecular weight products, and this degradation was completely blocked by methylamine. These findings suggest that in PANC-1 cells, bound EGF undergoes only limited processing. Both intact EGF and its major processed species bypass the cellular degradative pathways, are slowly released from the cell, and then rebind to the cell.

  19. Epidermal surface antigen (MS17S1) is highly conserved between mouse and human

    SciTech Connect

    Cho, Y.J.; Chema, D.; Cho, M.


    A mouse monoclonal antibody ECS-1 raised to human keratinocytes detects a 35-kDa epidermal surface antigen (ESA) and causes keratinocyte dissociation in vitro. ECS-1 stains skin of 16-day mouse embryo and 8- to 9-week human fetus. Mouse Esa cDNA encodes a 379-amino-acid protein that is 99.2% identical to the human, differing at only 3 amino acids. The gene (M17S1) was mapped to mouse chromosome 11, highlighting the conserved linkage synteny existing between human chromosome 17 and mouse chromosome 11. Although the nude locus has been mapped to the same region of chromosome 11, no abnormalities in protein, mRNA, or cDNA or genomic sequences were detected in nude mice. However, both nude and control mice were found to have a second Esa mRNA transcript that conserves amino acid sequence and molecular weight. The mouse and human 5{prime} and 3{prime} untranslated sequences are conserved. Similar RNA folding patterns of the 5{prime} untranslated region are predicted despite a 91-bp insertion in the mouse. These data suggest that both the function and the regulation of ESA protein are of importance and that Esa (M17S1) is not the nude locus gene. 42 refs., 7 figs., 3 tabs.

  20. Progressive stages of "transdifferentiation" from epidermal to mesenchymal phenotype induced by MyoD1 transfection, 5-aza-2'- deoxycytidine treatment, and selection for reduced cell attachment in the human keratinocyte line HaCaT

    PubMed Central


    The ability of the myogenic determination gene (MyoD1) to convert differentiating human keratinocytes (HaCaT cell-line) to the myogenic pathway and the effect of MyoD1 on the epidermal phenotype was studied in culture and in surface transplants on nude mice. MyoD1 transfection induced the synthesis of myosin, desmin, and vimentin without substantially altering the epidermal differentiation properties (morphology, keratin profile) in vitro nor epidermal morphogenesis (formation of a complex stratified squamous epithelium) in surface transplants, demonstrating the stability of the keratinocyte phenotype. 5-Aza-CdR treatment of these MyoD1-transfected cells had little effect on the cultured cells but a morphologically unstructured epithelium was formed with no indications of typical cell layers including cornification. Since prevention of epidermal strata in transplants was not accompanied by blocked epidermal differentiation markers (keratins K1 and K10, involucrin, and filaggrin), the dissociation of morphogenesis and expression of these markers argues for independently controlled processes. A subpopulation of less adhesive cells, isolated from the 5-aza-CdR treated MyoD1-transfectants, had lost most epithelial characteristics in culture (epidermal keratins, desmosomal proteins, and surface-glycoprotein Gp90) and had shifted to a mesenchymal/myogenic phenotype (fibroblastic morphology, transactivation of Myf3 and myogenin, expression of myosin, desmin, vimentin, and Gp130). Moreover, the cells had lost the ability to stratify and remained as a monolayer of flat elongated cells in transplants. These subsequent changes from a fully differentiated keratinocyte to a mesenchymal/myogenic phenotype strongly argue for a complex "transdifferentiation" process which occurred in the original monoclonal human epidermal HaCaT cells. PMID:1371288

  1. Radiosensitizing effect of lapatinib in human epidermal growth factor receptor 2-positive breast cancer cells

    PubMed Central

    Park, Ji Min; Kim, Dan Hyo; Kim, In Ah


    Trastuzumab has been widely used for the treatment of human epidermal growth factor receptor 2 (HER2)-overexpressing breast cancer, however, it cannot easily cross the blood-brain barrier (BBB) and is known to increase the incidence of brain metastases. In contrast, lapatinib has a low molecular weight and can cross the BBB and it could be useful to treat brain metastases in patients with HER2-positive breast cancer. To explore the impact of lapatinib on radiation response, we conducted an in vitro experiment using SKBR3 and BT474 breast carcinoma cells exhibiting HER2/neu amplification. Lapatinib down-regulated phosphorylated (p)-HER2, p-epidermal growth factor receptor, p-AKT, and p-extracellular signal-regulated kinase. Pretreatment of lapatinib increased the radiosensitivity of SKBR3 (sensitizer enhancement ratio [SER]: 1.21 at a surviving fraction of 0.5) and BT474 (SER: 1.26 at a surviving fraction of 0.5) cells and hindered the repair of DNA damage, as suggested by the prolongation of radiation-induced γH2AX foci and the down-regulation of phosphorylated DNA-dependent protein kinase, catalytic subunit (p-DNAPKcs). Increases in radiation-induced apoptosis and senescence were suggested to be the major modes of cell death induced by the combination of lapatinib and radiation. Furthermore, lapatinib did not radiosensitize a HER2- negative breast cancer cell line or normal human astrocytes. These findings suggest that lapatinib can potentiate radiation-induced cell death in HER2-overexpressing breast cancer cells and may increase the efficacy of radiotherapy. A phase II clinical trial using lapatinib concurrently with whole-brain radiation therapy (WBRT) is currently being conducted. PMID:27738326

  2. Low-fluence CO2 laser irradiation: selective epidermal damage to human skin.


    Kamat, B R; Tang, S V; Arndt, K A; Stern, R S; Noe, J M; Rosen, S


    The interaction of normal human skin with low-fluence CO2 laser irradiation was studied using a three-phase approach. In phase one, freshly excised skin was observed immediately after impact. In phase two, skin irradiated 2 h prior to excision was studied. In phase three, human volunteers were irradiated and biopsied at time zero, 24 h and 48 h. Seventy-five sites were exposed and 60 biopsies were performed. The earliest histologic changes were observed in the 6-10 J/cm2 fluence (radiant exposure) range and these changes included spindle and vacuolar changes in the basal layer of the epidermis. Papillary dermal coagulation was present to a maximum of 0.03 mm. At fluences of 10-25 J/cm2, superficial dermal necrosis (0.06-0.08 mm) was observed. At fluences above 25 J/cm2, transepidermal necrosis was present with increasing papillary dermal necrosis that was in proportion to the energy density delivered. At 2h, basal vacuolar changes were accompanied by diffuse keratinocytic cell death where contact was maintained between the epidermis and dermis, while where separation occurred limited keratinocytic death was observed. The earliest changes occurred at lower threshold fluences (4-6 J/cm2). After 24 h, these doses resulted in extensive epidermal necrosis with focal acute inflammatory infiltrates. At 48 h, the degree of epidermal "slough" was proportional to the energy density delivered and was maximal with a fluence of 5.7 J/cm2 delivered whereas with a fluence of 3.8 J/cm2 thin slough (0.02 mm) was observed. These findings suggest that low-dose CO2 laser irradiation may provide a new approach to selectively damage the epidermis with minimal dermal damage.

  3. SLC24A5 encodes a trans-Golgi network protein with potassium-dependent sodium-calcium exchange activity that regulates human epidermal melanogenesis.


    Ginger, Rebecca S; Askew, Sarah E; Ogborne, Richard M; Wilson, Stephen; Ferdinando, Dudley; Dadd, Tony; Smith, Adrian M; Kazi, Shubana; Szerencsei, Robert T; Winkfein, Robert J; Schnetkamp, Paul P M; Green, Martin R


    A non-synonymous single nucleotide polymorphism in the human SLC24A5 gene is associated with natural human skin color variation. Multiple sequence alignments predict that this gene encodes a member of the potassium-dependent sodium-calcium exchanger family denoted NCKX5. In cultured human epidermal melanocytes we show using affinity-purified antisera that native human NCKX5 runs as a triplet of approximately 43 kDa on SDS-PAGE and is partially localized to the trans-Golgi network. Removal of the NCKX5 protein through small interfering RNA-mediated knockdown disrupts melanogenesis in human and murine melanocytes, causing a significant reduction in melanin pigment production. Using a heterologous expression system, we confirm for the first time that NCKX5 possesses the predicted exchanger activity. Site-directed mutagenesis of NCKX5 and NCKX2 in this system reveals that the non-synonymous single nucleotide polymorphism in SLC24A5 alters a residue that is important for NCKX5 and NCKX2 activity. We suggest that NCKX5 directly regulates human epidermal melanogenesis and natural skin color through its intracellular potassium-dependent exchanger activity.

  4. Human epidermal growth factor receptor 2 overexpression in breast cancer of patients with anti-Yo--associated paraneoplastic cerebellar degeneration.


    Rojas-Marcos, Iñigo; Picard, Geraldine; Chinchón, David; Gelpi, Ellen; Psimaras, Dimitri; Giometto, Bruno; Delattre, J Y; Honnorat, J; Graus, F


    Isolated case reports suggest that breast tumors from patients with paraneoplastic cerebellar degeneration (PCD) and Yo antibodies overexpress human epidermal growth factor receptor 2 (HER2). HER2 overexpression is present in 15%-25% of breast cancers and is associated with poor prognosis. We retrospectively analyzed the status of HER2 in breast tumors of 27 patients with anti-Yo-associated PCD to evaluate whether HER2 overexpression in this group of patients is higher than expected. In addition, we analyzed HER2 status of 19 breast tumors from patients with paraneoplastic neurological syndromes and Ri antibodies to see whether HER2 was specifically related to anti-Yo-associated PCD. We also assessed cdr2 expression (the onconeural antigen recognized by Yo antibodies) in 21 HER2-positive breast tumors from patients without paraneoplastic neurological syndromes. HER2 was overexpressed in 26 patients (96.3%) with anti-Yo-associated PCD but only in 2 patients (10.5%) with paraneoplastic neurological syndromes associated with Ri antibodies (P< .0001). Only 5 (23.8%) of the 21 HER2-positive breast tumors showed cdr2 immunoreactivity. This study shows a very high frequency of HER2 overexpression in breast cancers in patients with anti-Yo-associated PCD but not in those from patients with Ri antibodies. Although the expression of cdr2 onconeural antigen is not high in HER2-positive breast cancers, HER2 overexpression seems to be an important requirement to develop an anti-Yo-associated PCD.

  5. MicroRNA-181b negatively regulates the proliferation of human epidermal keratinocytes in psoriasis through targeting TLR4.


    Feng, Cheng; Bai, Ming; Yu, Nan-Ze; Wang, Xiao-Jun; Liu, Zeng


    Our study aims to explore the role of microRNA-181b (miR-181b) and TLR in the regulation of cell proliferation of human epidermal keratinocytes (HEKs) in psoriasis. Twenty-eight patients diagnosed with psoriasis vulgaris were selected as a case group with their lesional and non-lesional skin tissues collected. A control group consisted of 20 patients who underwent plastic surgery with their healthy skin tissues collected. Real-time quantitative fluorescence polymerase chain reaction (RT-qPCR), in situ hybridization and immunohistochemistry were used to detect the expressions of miR-181b and TLR4 in HEKs of healthy skin, psoriatic lesional skin and non-lesional skin respectively. The 3' untranslated region (3'UTR) of TLR4 combined with miR-181b was verified by a dual-luciferase reporter assay. Western blotting and bromodeoxyuridine were applied for corresponding detection of TLR4 expression and cell mitosis. The expression of miR-181b in HEKs of psoriatic lesional skin was less than healthy skin and psoriatic non-lesional skin. In psoriatic lesional and non-lesional skin, TLR4-positive cell rates and the number of positive cells per square millimetre were higher than healthy skin. The dual-luciferase reporter assay verified that miR-181b targets TLR4. HEKs transfected with miR-181b mimics had decreased expression of TLR4, along with the decrease of mitotic indexes and Brdu labelling indexes. However, HEKs transfected with miR-181b inhibitors showed increased TLR4 expression, mitotic indexes and Brdu labelling indexes. HEKs transfected with both miR-181b inhibitors and siTLR4 had decreased mitotic indexes and Brdu labelling indexes. These results indicate that miR-181b can negatively regulate the proliferation of HEKs in psoriasis by targeting TLR4.

  6. Human eccrine sweat gland cells turn into melanin-uptaking keratinocytes in dermo-epidermal skin substitutes.


    Böttcher-Haberzeth, Sophie; Biedermann, Thomas; Pontiggia, Luca; Braziulis, Erik; Schiestl, Clemens; Hendriks, Bart; Eichhoff, Ossia M; Widmer, Daniel S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst


    Recently, Biedermann et al. (2010) have demonstrated that human eccrine sweat gland cells can develop a multilayered epidermis. The question still remains whether these cells can fulfill exclusive and very specific functional properties of epidermal keratinocytes, such as the incorporation of melanin, a feature absent in sweat gland cells. We added human melanocytes to eccrine sweat gland cells to let them develop into an epidermal analog in vivo. The interaction between melanocytes and sweat gland-derived keratinocytes was investigated. The following results were gained: (1) macroscopically, a pigmentation of the substitutes was seen 2-3 weeks after transplantation; (2) we confirmed the development of a multilayered, stratified epidermis with melanocytes distributed evenly throughout the basal layer; (3) melanocytic dendrites projected to suprabasal layers; and (4) melanin was observed to be integrated into former eccrine sweat gland cells. These skin substitutes were similar or equal to skin substitutes cultured from human epidermal keratinocytes. The only differences observed were a delay in pigmentation and less melanin uptake. These data suggest that eccrine sweat gland cells can form a functional epidermal melanin unit, thereby providing striking evidence that they can assume one of the most characteristic keratinocyte properties.

  7. Enhancement of drug sensitivity of human malignancies by epidermal growth factor.

    PubMed Central

    Kröning, R.; Jones, J. A.; Hom, D. K.; Chuang, C. C.; Sanga, R.; Los, G.; Howell, S. B.; Christen, R. D.


    We have previously shown that epidermal growth factor (EGF) enhances the in vitro and in vivo sensitivity of human ovarian carcinoma 2008 cells to cisplatin. EGF was found to enhance selectively the in vivo toxicity of cisplatin to 2008 cell xenografts without altering the toxicity of cisplatin to non-malignant target tissues such as the kidney or bone marrow. We now show that recombinant human EGF (rhEGF) enhances the cisplatin sensitivity of cell lines representative of many other types of malignancies in addition to ovarian carcinoma, including cancers of the head and neck, cervix, colon, pancreas and prostate, as well as non-small-cell carcinoma of the lung. In addition, rhEGF was found to sensitise cells to other platinum-containing drugs and several other classes of chemotherapeutic agents. rhEGF sensitised 2008 cells not only to cisplatin, but also to carboplatin and tetraplatin, as well as taxol, melphalan and 5-fluorouracil. We conclude that modulation of drug sensitivity by rhEGF is observed in cell lines representative of many human malignancies and for multiple classes of chemotherapeutic agents, indicating that it alters one or more components of the cellular damage response that are both common between cell lines and classes of drugs and fundamental to survival. Images Figure 2 PMID:7669570

  8. Epidermal growth factor released in human dental pulp following orthodontic force.


    Derringer, Kathryn; Linden, Roger


    This study investigated the role of human epidermal growth factor (EGF) in the angiogenic response of the dental pulp to orthodontic force. The release of angiogenic growth factor EGF in human dental pulp following orthodontic force application was examined using neutralizing antibody anti-human (anti-h) EGF to block its effects. The dental pulps from 10 premolar teeth from 10 patients (equal numbers of males and females aged 11-14 years), treated with a straightwire fixed appliance for 2 weeks and extracted for orthodontic reasons, were divided vertically, and sections from each half-pulp were individually co-cultured with a section of rat aorta in collagen surrounded by growth media. Anti-h EGF was added to the media of the co-cultures from one-half of each pulp from each tooth from each patient; the remaining co-cultures from the other half of each pulp without anti-h EGF were used as the controls. Cultures were examined daily by light microscopy for angiogenic growth and number of microvessels. The addition of anti-h EGF to the growth media in the co-cultures resulted in a significant reduction (P < 0.05, Wilcoxon signed rank test) in pulpal and rat aorta microvessel numbers, compared with the control co-cultures. The results indicate that EGF released following orthodontic force application plays a part in the angiogenic response of the pulp.

  9. Transforming growth factor alpha induces collagen degradation and cell migration in differentiating human epidermal raft cultures.

    PubMed Central

    Turksen, K; Choi, Y; Fuchs, E


    When cultured on plastic and treated with transforming growth factor alpha (TGF alpha), human keratinocytes exhibit an increase in proliferation at the colony periphery, apparently as a consequence of enhanced cell migration (Barrandon and Green, 1987). To investigate the effects of TGF alpha on a differentiating stratified squamous epithelium and to begin to examine the molecular basis mediating this influence, we cultured human epidermal cells on a gelled lattice of collagen and fibroblasts, floating on the air-liquid interface. Under these conditions, raft cultures differentiate and exhibit morphological and biochemical features of human skin in vivo (Asselineau et al., 1986; Kopan et al., 1987). When 3-wk-old raft cultures were treated with TGF alpha, basal cells showed a marked increase in cell proliferation. At elevated concentrations of TGF alpha, the organization of cells within the artificial tissue changed and islands of basal cells entered the collagen matrix. Biochemical analysis of the response revealed that type I collagenase and gelatinase were induced by keratinocytes within 12 h after TGF alpha treatment. In contrast, invasion of basal cells into the collagen matrix was not significant until 48-72 h post-treatment, suggesting that collagenase and gelatinase production may be a prerequisite to this phenomenon. These results have important implications for the possible role of TGF alpha in squamous cell carcinoma and tumor invasion. Images PMID:1663788

  10. Induction of PD-L1 expression by epidermal growth factor receptor–mediated signaling in esophageal squamous cell carcinoma

    PubMed Central

    Zhang, Wencheng; Pang, Qingsong; Yan, Cihui; Wang, Qifeng; Yang, Jingsong; Yu, Shufei; Liu, Xiao; Yuan, Zhiyong; Wang, Ping; Xiao, Zefen


    Purpose The purpose of this study was to investigate the potential effect of activation of epidermal growth factor receptor (EGFR) signaling pathway on the expression of programmed death-ligand 1 (PD-L1) in esophageal squamous cell carcinoma (ESCC) cells with EGFR overexpression. Methods Flow cytometry and Western blot methods were used to assess PD-L1 expression on ESCC cells when EGFR signaling pathway was activated by epidermal growth factor (EGF) with or without EGFR-specific inhibitor AG-1478, and then EGFR signaling array was applied to analyze the potential signaling pathways involved. Results This study found that PD-L1 expression increased significantly in an EGFR-dependent manner by the activation of EGFR signaling and decreased sharply when EGFR signaling was blocked. The upregulated expression of PD-L1 was not associated with EGFR-STAT3 signaling pathway, but may be affected by EGFR–PI3K–AKT, EGFR–Ras–Raf–Erk, and EGR–PLC-γ signaling pathways. Conclusion The expression of PD-L1 can be regulated by EGFR signaling activation in ESCC, which indicates an important role for EGFR-mediated immune escape and potential molecular pathways for EGFR-targeted therapy and immunotherapy. PMID:28243112

  11. The expression of epidermal growth factor receptors and their ligands (epidermal growth factor, neuregulin, amphiregulin) in the bitch uterus during the estrus cycle.


    Sağsöz, Hakan; Liman, Narin; Saruhan, Berna Güney; Küçükaslan, İbrahim


    In order to study the possible role of EGFR receptors in the bitch reproductive process, we have analyzed the expression pattern and localization of EGFR receptors and some of their ligands epidermal growth factor (EGF), neuregulin (NRG), amphiregulin (AREG), in the uterus during the estrus cycle using immunohistochemistry. The immunostaining for receptors and ligands of EGFR/ligand system was confined to membrane and cytoplasm of the target cells. Variations were observed, not only at the different stages of the estrous cycle, but also in the different tissue compartments of the uterus. However, it was detected that the immunostainings for NRG and AREG in the different cells do not show important differences at stages of the estrus cycle. In the luminal epithelium, strong immunostaining for ErbB1/HER1, ErbB2/HER2, ErbB4/HER4 and EGF was found at estrus. In the glandular epithelium, strong immunostaining for ErbB4/HER4 was observed at diestrus, while strong immunostaining for EGF was detected in both of estrus and diestrus. ErbB3/HER3 immunoreactivity in the stromal cells was higher at diestrus and anestrus, while ErbB4/HER4 immunoreactivity was lower at anestrus. In the myometrium, the highest levels of immunoreactivity of ErbB2/HER2 were found at estrus, while ErbB3/HER3 immunoreactivity was higher at anestrus. EGF immunoreactivity was lower at anestrus compared to other stage of cycle. Altered EGFR/ligand system expression during the estrus cycle suggests this growth factor system is a potent regulator of proliferation and differentiation events during preparation for implantation of bitch uterus.

  12. Tryptophan hydroxylase expression in human skin cells.


    Slominski, Andrzej; Pisarchik, Alexander; Johansson, Olle; Jing, Chen; Semak, Igor; Slugocki, George; Wortsman, Jacobo


    We attempted to further characterize cutaneous serotoninergic and melatoninergic pathways evaluating the key biosynthetic enzyme tryptophan hydroxylase (TPH). There was wide expression of TPH mRNA in whole human skin, cultured melanocytes and melanoma cells, dermal fibroblasts, squamous cell carcinoma cells and keratinocytes. Gene expression was associated with detection of TPH immunoreactive species by Western blotting. Characterization of the TPH immunoreactive species performed with two different antibodies showed expression of the expected protein (55-60 kDa), and of forms with higher and lower molecular weights. This pattern of broad spectrum of TPH expression including presumed degradation products suggests rapid turnover of the enzyme, as previously reported in mastocytoma cells. RP-HPLC of skin extracts showed fluorescent species with the retention time of serotonin and N-acetylserotonin. Immunocytochemistry performed in skin biopsies localized TPH immunoreactivity to normal and malignant melanocytes. We conclude that while the TPH mRNA and protein are widely expressed in cultured normal and pathological epidermal and dermal skin cells, in vivo TPH expression is predominantly restricted to cells of melanocytic origin.

  13. Neutralization Effects of Interleukin-6 (IL-6) Antibodies on Sulfur Mustard (HD)-Induced IL-6 Secretion on Human Epidermal Keratinocytes

    DTIC Science & Technology


    epidermal necrolysis. Their observations con- inflammatory blister induction. Rhodes et al. examined the firm that different secretion-related...blisters in the immune-based inflammatory disorders concluded that individual cytokines have different actions depending on the cytokine microenvironment...human epidermal keratinocytes are reported. Fi- stimulation. No significant differences were observed when nally, a discussion in the light of their

  14. Effects of silver nanoparticles on human dermal fibroblasts and epidermal keratinocytes.


    Galandáková, A; Franková, J; Ambrožová, N; Habartová, K; Pivodová, V; Zálešák, B; Šafářová, K; Smékalová, M; Ulrichová, J


    Biomedical application of silver nanoparticles (AgNPs) has been rapidly increasing. Owing to their strong antimicrobial activity, AgNPs are used in dermatology in the treatment of wounds and burns. However, recent evidence for their cytotoxicity gives rise to safety concerns. This study was undertaken as a part of an ongoing programme in our laboratory to develop a topical agent for wound healing. Here, we investigated the potential toxicity of AgNPs using normal human dermal fibroblasts (NHDF) and normal human epidermal keratinocytes (NHEK) with the aim of comparing the effects of AgNPs and ionic silver (Ag-I). Besides the effect of AgNPs and Ag-I on cell viability, the inflammatory response and DNA damage in AgNPs and Ag-I-treated cells were examined. The results showed that Ag-I were significantly more toxic than AgNPs both on NHDF and NHEK. Non-cytotoxic concentrations of AgNPs and Ag-I did not induce DNA strand breaks and did not affect inflammatory markers, except for a transient increase in interleukin 6 levels in Ag-I-treated NHDF. The results showed that AgNPs are more suitable for the intended application as a topical agent for wound healing up to the concentration 25 µg/mL.

  15. Long-wave ultraviolet light induces phospholipase activation in cultured human epidermal keratinocytes

    SciTech Connect

    Hanson, D.; DeLeo, V. )


    Long wave ultraviolet radiation (UVA) has been shown to play an important role in the overall response of skin to solar radiation, including sunburn, tanning, premature aging, and non-melanoma skin cancer. UVA induction of inflammation in human skin is thought to be mediated by membrane lipid derived products. In order to investigate the mechanism of this response we examined the effect of UVA on phospholipid metabolism of human epidermal keratinocytes in culture. Keratinocytes were grown in serum free low calcium medium. The cells were prelabeled with (3H) arachidonic acid or (3H) choline and irradiated with UVA (Honle 2002-Hg vapor lamp). Identification and quantitation of specific membrane phospholipid-derived components was achieved using high-performance liquid chromatography, paper chromatography, and radioimmunoassay. UVA resulted in a linear dose dependent release of (3H) arachidonic acid into medium between 1 and 20 joule/cm2. This response was inhibited in an oxygen-reduced environment. The radiolabel released was predominantly free arachidonate and cyclooxygenase metabolites. Cyclooxygenase metabolites prostaglandin E2 and prostacyclin derivative, 6-keto-prostaglandin F1a, were stimulated following UVA irradiation, but the lipoxygenase metabolite, leukotriene B was not detected. Maximal release was measured immediately after irradiation and changed little over 24 h post-irradiation. UVA stimulated an increase of (3H) choline metabolites glycerophosphorylcholine and phosphorylcholine in media extracts suggesting UVA activation of phospholipase C and phospholipase A2 or diacylglyceride lipase.

  16. Ceramides are bound to structural proteins of the human foreskin epidermal cornified cell envelope.


    Marekov, L N; Steinert, P M


    An important component of barrier function in human epidermis is contributed by ceramides that are bound by ester linkages to undefined proteins of the cornified cell envelope (CE). In this paper, we have examined the protein targets for the ceramide attachment. By partial saponification of isolated foreskin epidermal CEs followed by limited proteolysis, we have recovered several lipopeptides. Biochemical and mass spectroscopic characterization revealed that all contained near stoichiometric amounts of ceramides of masses ranging from about 690 to 890 atomic mass units, of which six quantitatively major species were common. The array of ceramides was similar to that obtained from pig skin, the composition of which is known, thereby providing strong indirect data for their fatty acid and sphingosine compositions. The recovered peptides accounted for about 20% of the total foreskin CE ceramides. By amino acid sequencing, about 35% of the peptides were derived from ancestral glutamine-glutamate-rich regions of involucrin, an important CE structural protein. Another 18% derived from rod domain sequences of periplakin and envoplakin, which are also known or suspected CE proteins. Other peptides were too short for unequivocal identification. Together, these data indicate that involucrin, envoplakin, periplakin, and possibly other structural proteins serve as substrates for the attachment of ceramides by ester linkages to the CE for barrier function in human epidermis.

  17. Identification of human leukemia antigen A*0201-restricted epitopes derived from epidermal growth factor pathway substrate number 8.


    Tang, Baishan; Zhou, Weijun; Du, Jingwen; He, Yanjie; Li, Yuhua


    T-cell-mediated immunotherapy of hematological malignancies requires selection of targeted tumor-associated antigens and T-cell epitopes contained in these tumor proteins. Epidermal growth factor receptor pathway substrate 8 (EPS8), whose function is pivotal for tumor proliferation, progression and metastasis, has been found to be overexpressed in most human tumor types, while its expression in normal tissue is low. The aim of the present study was to identify human leukemia antigen (HLA)-A*0201-restricted epitopes of EPS8 by using a reverse immunology approach. To achieve this, computer algorithms were used to predict HLA-A*0201 molecular binding, proteasome cleavage patterns as well as translocation of transporters associated with antigen processing. Candidate peptides were experimentally validated by T2 binding affinity assay and brefeldin-A decay assay. The functional avidity of peptide-specific cytotoxic T lymphocytes (CTLs) induced from peripheral blood mononuclear cells of healthy volunteers were evaluated by using an enzyme-linked immunosorbent spot assay and a cytotoxicity assay. Four peptides, designated as P455, P92, P276 and P360, had high affinity and stability of binding towards the HLA-A*0201 molecule, and specific CTLs induced by them significantly responded to the corresponding peptides and secreted IFN-γ. At the same time, the CTLs were able to specifically lyse EPS8-expressing cell lines in an HLA-A*0201-restricted manner. The present study demonstrated that P455, P92, P276 and P360 were CTL epitopes of EPS8, and were able to be used for epitope-defined adoptive T-cell transfer and multi-epitope-based vaccine design.

  18. Structural Model for the Interaction of a Designed Ankyrin Repeat Protein with the Human Epidermal Growth Factor Receptor 2

    PubMed Central

    Epa, V. Chandana; Dolezal, Olan; Doughty, Larissa; Xiao, Xiaowen; Jost, Christian; Plückthun, Andreas; Adams, Timothy E.


    Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2). HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84–1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions. PMID:23527120

  19. Structural model for the interaction of a designed Ankyrin Repeat Protein with the human epidermal growth factor receptor 2.


    Epa, V Chandana; Dolezal, Olan; Doughty, Larissa; Xiao, Xiaowen; Jost, Christian; Plückthun, Andreas; Adams, Timothy E


    Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2). HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.

  20. Development of a new in vitro skin sensitization assay (Epidermal Sensitization Assay; EpiSensA) using reconstructed human epidermis.


    Saito, Kazutoshi; Nukada, Yuko; Takenouchi, Osamu; Miyazawa, Masaaki; Sakaguchi, Hitoshi; Nishiyama, Naohiro


    Recent changes in regulatory requirements and social views on animal testing have accelerated the development of reliable alternative tests for predicting skin sensitizing potential of chemicals. In this study, we aimed to develop a new in vitro skin sensitization assay using reconstructed human epidermis, RhE model, which is expected to have broader applicability domain rather than existing in vitro assays. Microarray analysis revealed that the expression of five genes (ATF3, DNAJB4, GCLM, HSPA6 and HSPH1) related to cellular stress response were significantly up-regulated in RhE model after 6h treatment with representative skin sensitizers, 1-fluoro-2,4-dinitrobenzene and oxazolone, but not a non-sensitizer, benzalkonium chloride. The predictive performance of five genes was examined with eight skin sensitizers (e.g., cinnamic aldehyde), four non-sensitizers (e.g., sodium lauryl sulfate) and four pre-/pro-haptens (e.g., p-phenylenediamine, isoeugenol). When the positive criteria were set to obtain the highest accuracy with the animal testing (LLNA), ATF3, DNAJB4 and GCLM exhibited a high predictive accuracy (100%, 93.8% and 87.5%, respectively). All tested pre-/pro-haptens were correctly predicted by both ATF3 and DNAJB4. These results suggested that the RhE-based assay, termed epidermal sensitization assay (EpiSensA), could be an useful skin sensitization assay with a broad applicability domain including pre-/pro-haptens.

  1. Effects of Asterias amurensis-derived Sphingoid Bases on the de novo Ceramide Synthesis in Cultured Normal Human Epidermal Keratinocytes.


    Mikami, Daisuke; Sakai, Shota; Sasaki, Shigefumi; Igarashi, Yasuyuki


    Asterias amurensis starfish provide several bioactive species in addition to being fishery waste. Glucosyl ceramides (GlcCers) were extracted from the viscera of these starfish and were isolated by silica gel column chromatography. Degraded GlcCers generated A. amurensis sphingoid bases (ASBs) that mainly consisted of the triene-type bases d18:3 and 9-methyl-d18:3. The effect of these bases on ceramide synthesis and content were analyzed using normal human epidermal keratinocytes (NHEKs). The bases significantly enhanced the de novo ceramide synthesis and gene expression in NHEKs for proteins, such as serine-palmitoyltransferase and ceramide synthase. Total ceramide, GlcCer, and sphingomyelin contents increased dramatically upon ASB treatment. In particular, GlcCer bearing very-long-chain fatty acids (≥C28) exhibited a significant content increase. These ASB-induced enhancements on de novo ceramide synthesis were only observed in undifferentiated NHEKs. This stimulation of the de novo sphingolipid synthesis may improve skin barrier functions.

  2. Neutrophil extracellular trap formation is increased in psoriasis and induces human β-defensin-2 production in epidermal keratinocytes

    PubMed Central

    Hu, Stephen Chu-Sung; Yu, Hsin-Su; Yen, Feng-Lin; Lin, Chi-Ling; Chen, Gwo-Shing; Lan, Cheng-Che E.


    Neutrophil extracellular traps (NETs) have been implicated in the development of certain immune-mediated diseases, but their role in psoriasis has not been clearly defined. Human β-defensin-2 (HBD-2) is an important antimicrobial peptide overexpressed in psoriasis epidermis. We evaluated whether the amount of NETs is increased in psoriasis and determined the effect of NETs on HBD-2 production in epidermal keratinocytes. Using fluorescent microscopy, we found that patients with psoriasis (n = 48) had higher amount of NETotic cells in their peripheral blood compared to healthy controls (n = 48) and patients with eczema (n = 35). Psoriasis sera showed increased ability to induce NET formation in control neutrophils but normal NET degradation ability. The amount of NETs in the peripheral blood correlated with psoriasis disease severity. NETosis was also observed in the majority (18 of 20) of psoriasis skin specimens. Furthermore, NETs induced HBD-2 mRNA and protein production in keratinocytes, and immunohistochemical analysis confirmed strong expression of HBD-2 in psoriasis lesional skin. In summary, NET formation is increased in peripheral blood and lesional skin of psoriasis patients and correlates with disease severity. Additionally, NET-induced HBD-2 production may provide a novel mechanism for the decreased susceptibility of psoriasis plaques to microbial infections. PMID:27493143

  3. Sirtuin 4 identification in normal human epidermal keratinocytes and its relation to sirtuin 3 and energy metabolism under normal conditions and UVB-induced stress.


    Dong, Kelly; Pelle, Edward; Yarosh, Daniel B; Pernodet, Nadine


    Sirtuins (SIRT) are NAD(+) -dependent deacetylases and ADP-ribosyltransferases that play a critical role in metabolism and epigenetics. SIRT3 and SIRT4 are of particular interest because they are localized in the mitochondria where energy is generated and their expression is inversely proportional to each other. Here, we report data, for the first time, demonstrating the presence of SIRT4 in normal human epidermal keratinocytes (NHEK) and confirm that its expression is inversely related to SIRT3 in these cells and that they follow a temporal cycle. Further, UVB radiation modified their expression, as well as ATP and H2 O2 levels. These deviations from the normal sirtuin cycles after UVB exposure can be an epigenetic indicator of lower metabolism levels.

  4. Epidermal growth factor-like domain 7 promotes migration and invasion of human trophoblast cells through activation of MAPK, PI3K and NOTCH signaling pathways.


    Massimiani, M; Vecchione, L; Piccirilli, D; Spitalieri, P; Amati, F; Salvi, S; Ferrazzani, S; Stuhlmann, H; Campagnolo, L


    Epidermal growth factor-like domain 7 (Egfl7) is a gene that encodes a partially secreted protein and whose expression is largely restricted to the endothelia. We recently reported that EGFL7 is also expressed by trophoblast cells in mouse and human placentas. Here, we investigated the molecular pathways that are regulated by EGFL7 in trophoblast cells. Stable EGFL7 overexpression in a Jeg3 human choriocarcinoma cell line resulted in significantly increased cell migration and invasiveness, while cell proliferation was unaffected. Analysis of mitogen-activated protein kinase (MAPK) and phosphatidylinositol 3-kinase (PI3K) pathways showed that EGFL7 promotes Jeg3 cell motility by activating both pathways. We show that EGFL7 activates the epidermal growth factor receptor (EGFR) in Jeg3 cells, resulting in downstream activation of extracellular regulated kinases (ERKs). In addition, we provide evidence that EGFL7-triggered migration of Jeg3 cells involves activation of NOTCH signaling. EGFL7 and NOTCH1 are co-expressed in Jeg3 cells, and blocking of NOTCH activation abrogates enhanced migration of Jeg3 cells overexpressing EGFL7. We also demonstrate that signaling through EGFR and NOTCH converged to mediate EGFL7 effects. Reduction of endogenous EGFL7 expression in Jeg3 cells significantly decreased cell migration. We further confirmed that EGFL7 stimulates cell migration by using primary human first trimester trophoblast (PTB) cells overexpressing EGFL7. In conclusion, our data suggest that in trophoblast cells, EGFL7 regulates cell migration and invasion by activating multiple signaling pathways. Our results provide a possible explanation for the correlation between reduced expression of EGFL7 and inadequate trophoblast invasion observed in placentopathies.

  5. Evaluation of cultured human dermal- and dermo-epidermal substitutes focusing on extracellular matrix components: Comparison of protein and RNA analysis.


    Oostendorp, Corien; Meyer, Sarah; Sobrio, Monia; van Arendonk, Joyce; Reichmann, Ernst; Daamen, Willeke F; van Kuppevelt, Toin H


    Treatment of full-thickness skin defects with split-thickness skin grafts is generally associated with contraction and scar formation and cellular skin substitutes have been developed to improve skin regeneration. The evaluation of cultured skin substitutes is generally based on qualitative parameters focusing on histology. In this study we focused on quantitative evaluation to provide a template for comparison of human bio-engineered skin substitutes between clinical and/or research centers, and to supplement histological data. We focused on extracellular matrix proteins since these components play an important role in skin regeneration. As a model we analyzed the human dermal substitute denovoDerm and the dermo-epidermal skin substitute denovoSkin. The quantification of the extracellular matrix proteins type III collagen and laminin 5 in tissue homogenates using western blotting analysis and ELISA was not successful. The same was true for assaying lysyl oxidase, an enzyme involved in crosslinking of matrix molecules. As an alternative, gene expression levels were measured using qPCR. Various RNA isolation procedures were probed. The gene expression profile for specific dermal and epidermal genes could be measured reliably and reproducibly. Differences caused by changes in the cell culture conditions could easily be detected. The number of cells in the skin substitutes was measured using the PicoGreen dsDNA assay, which was found highly quantitative and reproducible. The (dis) advantages of assays used for quantitative evaluation of skin substitutes are discussed.

  6. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor.


    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo


    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD.

  7. Phytosphingosine stimulates the differentiation of human keratinocytes and inhibits TPA-induced inflammatory epidermal hyperplasia in hairless mouse skin.


    Kim, Sujong; Hong, Il; Hwang, Jung Sun; Choi, Jin Kyu; Rho, Ho Sik; Kim, Duck Hee; Chang, Ihseop; Lee, Seung Hun; Lee, Mi-Ock; Hwang, Jae Sung


    The binding of sphingoid bases to peroxisome proliferator-activated receptor (PPAR) has been detected in a solid-phase binding assay. However, sphingoid base-induced changes in PPAR transactivation activity have not been examined. In this report, we show by reporter gene analyses that phytosphingosine (PS), a natural sphingoid base, activates the transcriptional activity of PPARs in the immortalized human keratinocyte, HaCaT. Real-time PCR analyses showed that the mRNA level of PPARgamma was increased after PS treatment in HaCaT cells in a dose- and time-dependent manner. Because PPARs play important roles in skin barrier homeostasis by regulating epidermal cell growth, terminal differentiation, and inflammatory response, we examined the effect of PS on normal human epidermal keratinocytes (NHEKs) and mouse skin. PS increased the production of cornified envelope in NHEKs by approximately 1.8-fold compared with controls. Epidermal differentiation marker proteins such as involucrin, loricrin, and keratin1 were also increased in PS-treated NHEKs, by ELISA or Western blotting analysis. A [(3)H]thymidine incorporation assay showed that PS inhibited DNA synthesis in NHEKs to 20% compared with controls. The antiproliferative and anti-inflammatory effects of PS were examined in a mouse model of irritant contact dermatitis produced by topical application of 12-O-tetradecanoylphorbol-13-acetate (TPA). PS blocked epidermal thickening and edema and the infiltration of inflammatory cells into the dermis in the skin of TPA-treated hairless mice. The anti-inflammatory effects of PS were confirmed by the observation that PS blocked the TPA-induced generation of prostaglandin E(2) in peripheral mononuclear leukocytes. Taken together, our results provide an insight into the multiple regulatory roles of PS in epidermal homeostasis, and furthermore point to the potential use of PS as a therapeutic agent in the treatment of inflammatory and proliferative cutaneous diseases.

  8. Phytosphingosine Stimulates the Differentiation of Human Keratinocytes and Inhibits TPA-Induced Inflammatory Epidermal Hyperplasia in Hairless Mouse Skin

    PubMed Central

    Kim, Sujong; Hong, Il; Hwang, Jung Sun; Choi, Jin Kyu; Rho, Ho Sik; Kim, Duck Hee; Chang, Ihseop; Lee, Seung Hun; Lee, Mi-Ock; Hwang, Jae Sung


    The binding of sphingoid bases to peroxisome proliferator-activated receptor (PPAR) has been detected in a solid-phase binding assay. However, sphingoid base–induced changes in PPAR transactivation activity have not been examined. In this report, we show by reporter gene analyses that phytosphingosine (PS), a natural sphingoid base, activates the transcriptional activity of PPARs in the immortalized human keratinocyte, HaCaT. Real-time PCR analyses showed that the mRNA level of PPARγ was increased after PS treatment in HaCaT cells in a dose- and time-dependent manner. Because PPARs play important roles in skin barrier homeostasis by regulating epidermal cell growth, terminal differentiation, and inflammatory response, we examined the effect of PS on normal human epidermal keratinocytes (NHEKs) and mouse skin. PS increased the production of cornified envelope in NHEKs by approximately 1.8-fold compared with controls. Epidermal differentiation marker proteins such as involucrin, loricrin, and keratin1 were also increased in PS-treated NHEKs, by ELISA or Western blotting analysis. A [3H]thymidine incorporation assay showed that PS inhibited DNA synthesis in NHEKs to 20% compared with controls. The antiproliferative and anti-inflammatory effects of PS were examined in a mouse model of irritant contact dermatitis produced by topical application of 12-O-tetradecanoylphorbol-13-acetate (TPA). PS blocked epidermal thickening and edema and the infiltration of inflammatory cells into the dermis in the skin of TPA-treated hairless mice. The anti-inflammatory effects of PS were confirmed by the observation that PS blocked the TPA-induced generation of prostaglandin E2 in peripheral mononuclear leukocytes. Taken together, our results provide an insight into the multiple regulatory roles of PS in epidermal homeostasis, and furthermore point to the potential use of PS as a therapeutic agent in the treatment of inflammatory and proliferative cutaneous diseases. PMID:16838068

  9. Relationship between expression of epidermal growth factor and simian virus 40 T antigen in a line of transgenic mice.


    Lafond, R E; Giammalvo, J T; Norkin, L C


    The pattern of expression of the simian virus 40 (SV40) T antigen gene and resultant dysplasia were re-examined in a line of transgenic mice in which the T antigen gene was under the control of the SV40 early promoter. We found that T antigen expression in the kidney, and resulting dysplastic lesions, occurred exclusively in the distal convoluted tubules and the ascending limbs of Henle. Epidermal growth factor (EGF) expression in the kidney of normal mice was similarly immunolocalized. The correlation between high EGF immunoreactivity in normal mouse tissues and T antigen expression in the transgenic counterpart was also seen in the choroid plexus epithelium and in the submandibular glands of male mice. T antigen was not found in the submandibular gland of transgenic females. Similarly, EGF was only rarely detected in the normal female submandibular gland. In contrast to the correlation between T antigen expression in the transgenic mice and EGF expression in the corresponding tissues of the normal mice, within the dysplastic lesions of the transgenic mice EGF expression was severely diminished. Adenocarcinomas of the male submandibular gland from another line of transgenic mice that expresses the Int-1 transgene, showed similarly reduced levels of immunostaining for EGF. Thus, reduced expression of EGF might be a general feature of dysplasia and tumorigenesis in those tissues that normally express EGF.

  10. Basis for the gain and subsequent dilution of epidermal pigmentation during human evolution: The barrier and metabolic conservation hypotheses revisited.


    Elias, Peter M; Williams, Mary L


    The evolution of human skin pigmentation must address both the initial evolution of intense epidermal pigmentation in hominins, and its subsequent dilution in modern humans. While many authorities believe that epidermal pigmentation evolved to protect against either ultraviolet B (UV-B) irradiation-induced mutagenesis or folic acid photolysis, we hypothesize that pigmentation augmented the epidermal barriers by shifting the UV-B dose-response curve from toxic to beneficial. Whereas erythemogenic UV-B doses produce apoptosis and cell death, suberythemogenic doses benefit permeability and antimicrobial function. Heavily melanized melanocytes acidify the outer epidermis and emit paracrine signals that augment barrier competence. Modern humans, residing in the cooler, wetter climes of south-central Europe and Asia, initially retained substantial pigmentation. While their outdoor lifestyles still permitted sufficient cutaneous vitamin D3 (VD3) synthesis, their marginal nutritional status, coupled with cold-induced caloric needs, selected for moderate pigment reductions that diverted limited nutritional resources towards more urgent priorities (=metabolic conservation). The further pigment-dilution that evolved as humans reached north-central Europe (i.e., northern France, Germany), likely facilitated cutaneous VD3 synthesis, while also supporting ongoing, nutritional requirements. But at still higher European latitudes where little UV-B breaches the atmosphere (i.e., present-day UK, Scandinavia, Baltic States), pigment dilution alone could not suffice. There, other nonpigment-related mutations evolved to facilitate VD3 production; for example, in the epidermal protein, filaggrin, resulting in reduced levels of its distal metabolite, trans-urocanic acid, a potent UV-B chromophore. Thus, changes in human pigmentation reflect a complex interplay between latitude, climate, diet, lifestyle, and shifting metabolic priorities.

  11. Brain metastasis in human epidermal growth factor receptor 2-positive breast cancer: from biology to treatment

    PubMed Central

    Koo, Taeryool


    Overexpression of human epidermal growth factor receptor 2 (HER2) is found in about 20% of breast cancer patients. With treatment using trastuzumab, an anti-HER2 monoclonal antibody, systemic control is improved. Nonetheless, the incidence of brain metastasis does not be improved, rather seems to be increased in HER2-positive breast cancer. The mainstay treatment for brain metastases is radiotherapy. According to the number of metastatic lesions and performance status of patients, radiosurgery or whole brain radiotherapy can be performed. The concurrent use of a radiosensitizer further improves intracranial control. Due to its large molecular weight, trastuzumab has a limited ability to cross the blood-brain barrier. However, small tyrosine kinase inhibitors such as lapatinib, has been noted to be a promising agent that can be used as a radiosensitizer to affect HER2-positive breast cancer. This review will outline general management of brain metastases and will focus on preclinical findings regarding the radiosensitizing effect of small molecule HER2 targeting agents. PMID:27104161

  12. Oak ellagitannins suppress the phosphorylation of the epidermal growth factor receptor in human colon carcinoma cells.


    Fridrich, Diana; Glabasnia, Arne; Fritz, Jessica; Esselen, Melanie; Pahlke, Gudrun; Hofmann, Thomas; Marko, Doris


    The ellagitannins castalagin and vescalagin, and the C-glycosides grandinin and roburin E as well as ellagic acid were found to potently inhibit the growth of human colon carcinoma cells (HT29) in vitro. In a cell-free system these compounds were identified as potent inhibitors of the protein tyrosine kinase activity of the epidermal growth factor receptor (EGFR) with IC 50 values in the low nanomolar range. To address the question of whether the interference with the activity of the isolated EGFR also plays a role within intact cells, effects on the phosphorylation status of the EGFR, as a measure for its activity, were determined in HT29 cells. As exemplified for castalagin and grandinin, both the nonglycosylated and the glycosylated ellagitannins effectively suppressed EGFR phosphorylation, but only at concentrations > or =10 microM, thus, in a concentration range where growth inhibition was observed. These results indicate that the suppression of EGFR-mediated signaling might contribute to the growth inhibitory effects of these compounds present in oak-matured wines and spirits such as whiskey. In contrast, despite substantial growth inhibitory properties, ellagic acid did not significantly affect EGFR phosphorylation in HT29 cells up to 100 microM.

  13. Synergistic Skin Penetration Enhancer and Nanoemulsion Formulations Promote the Human Epidermal Permeation of Caffeine and Naproxen.


    Abd, Eman; Namjoshi, Sarika; Mohammed, Yousuf H; Roberts, Michael S; Grice, Jeffrey E


    We examined the extent of skin permeation enhancement of the hydrophilic drug caffeine and lipophilic drug naproxen applied in nanoemulsions incorporating skin penetration enhancers. Infinite doses of fully characterized oil-in-water nanoemulsions containing the skin penetration enhancers oleic acid or eucalyptol as oil phases and caffeine (3%) or naproxen (2%) were applied to human epidermal membranes in Franz diffusion cells, along with aqueous control solutions. Caffeine and naproxen fluxes were determined over 8 h. Solute solubility in the formulations and in the stratum corneum (SC), as well as the uptake of product components into the SC were measured. The nanoemulsions significantly enhanced the skin penetration of caffeine and naproxen, compared to aqueous control solutions. Caffeine maximum flux enhancement was associated with a synergistic increase in both caffeine SC solubility and skin diffusivity, whereas a formulation-increased solubility in the SC was the dominant determinant for increased naproxen fluxes. Enhancements in SC solubility were related to the uptake of the formulation excipients containing the active compounds into the SC. Enhanced skin penetration in these systems is largely driven by uptake of formulation excipients containing the active compounds into the SC with impacts on SC solubility and diffusivity.

  14. Recombinant Human Epidermal Growth Factor Accelerates Recovery of Mouse Small Intestinal Mucosa After Radiation Damage

    SciTech Connect

    Lee, Kang Kyoo; Jo, Hyang Jeong; Hong, Joon Pio; Lee, Sang-wook Sohn, Jung Sook; Moon, Soo Young; Yang, Sei Hoon; Shim, Hyeok; Lee, Sang Ho; Ryu, Seung-Hee; Moon, Sun Rock


    Purpose: To determine whether systemically administered recombinant human epidermal growth factor (rhEGF) accelerates the recovery of mouse small intestinal mucosa after irradiation. Methods and Materials: A mouse mucosal damage model was established by administering radiation to male BALB/c mice with a single dose of 15 Gy applied to the abdomen. After irradiation, rhEGF was administered subcutaneously at various doses (0.04, 0.2, 1.0, and 5.0 mg/kg/day) eight times at 2- to 3-day intervals. The evaluation methods included histologic changes of small intestinal mucosa, change in body weight, frequency of diarrhea, and survival rate. Results: The recovery of small intestinal mucosa after irradiation was significantly improved in the mice treated with a high dose of rhEGF. In the mice that underwent irradiation without rhEGF treatment, intestinal mucosal ulceration, mucosal layer damage, and severe inflammation occurred. The regeneration of villi was noticeable in mice treated with more than 0.2 mg/kg rhEGF, and the villi recovered fully in mice given more than 1 mg/kg rhEGF. The frequency of diarrhea persisting for more than 3 days was significantly greater in the radiation control group than in the rhEGF-treated groups. Conclusions: Systemic administration of rhEGF accelerates recovery from mucosal damage induced by irradiation. We suggest that rhEGF treatment shows promise for the reduction of small intestinal damage after irradiation.

  15. Multiple oncogenic mutations and clonal relationship in spatially distinct benign human epidermal tumors

    PubMed Central

    Hafner, Christian; Toll, Agustí; Fernández-Casado, Alejandro; Earl, Julie; Marqués, Miriam; Acquadro, Francesco; Méndez-Pertuz, Marinela; Urioste, Miguel; Malats, Núria; Burns, Julie E.; Knowles, Margaret A.; Cigudosa, Juan C.; Hartmann, Arndt; Vogt, Thomas; Landthaler, Michael; Pujol, Ramón M.; Real, Francisco X.


    Malignant tumors result from the accumulation of genetic alterations in oncogenes and tumor suppressor genes. Much less is known about the genetic changes in benign tumors. Seborrheic keratoses (SK) are very frequent benign human epidermal tumors without malignant potential. We performed a comprehensive mutational screen of genes in the FGFR3-RAS-MAPK and phosphoinositide 3-kinase (PI3K)-AKT pathways from 175 SK, including multiple lesions from each patient. SK commonly harbored multiple bona fide oncogenic mutations in FGFR3, PIK3CA, KRAS, HRAS, EGFR, and AKT1 oncogenes but not in tumor suppressor genes TSC1 and PTEN. Despite the occurrence of oncogenic mutations and the evidence for downstream ERK/MAPK and PI3K pathway signaling, we did not find induction of senescence or a DNA damage response. Array comparative genomic hybridization (aCGH) analysis revealed that SK are genetically stable. The pattern of oncogenic mutations and X chromosome inactivation departs significantly from randomness and indicates that spatially independent lesions from a given patient share a clonal relationship. Our findings show that multiple oncogenic mutations in the major signaling pathways involved in cancer are not sufficient to drive malignant tumor progression. Furthermore, our data provide clues on the origin and spread of oncogenic mutations in tissues, suggesting that apparently independent (multicentric) adult benign tumors may have a clonal origin. PMID:21078999

  16. Epidermal growth factor receptor targeting alters gene expression and restores the adhesion function of cancerous cells as measured by single cell force spectroscopy.


    Azadi, Shohreh; Tafazzoli-Shadpour, Mohammad; Omidvar, Ramin; Moradi, Lida; Habibi-Anbouhi, Mahdi


    Loss of cell-cell adhesion function is a common characteristic of many human epithelial carcinomas that is frequently due to loss of E-cadherin expression. In cancer progression, loss of E-cadherin is associated with invasion and metastasis potential, hence restoration of its function may contribute to the metastasis inhibition. This study examined effect of Epidermal Growth Factor Receptor (EGFR/Her1) blockade on the E-cadherin expression, cellular adherence, and cell elasticity in two human epithelial cancer cell lines, MCF7 and A431. EGFR blocking agents as antibodies or small molecules target EGFR directly. Furthermore, due to intracellular signaling pathways they influence cell behavior and activities. The idea here is to investigate the effect of reduced activity of this signaling pathway using anti-EGFR Antibody (Cetuximab) and tyrosine kinase inhibitor (Lapatinib) on cell-cell adhesion and cell mechanical properties. Real-Time PCR analysis demonstrated that treatment of cells with considered drugs increased the expression of E-cadherin gene among samples. The atomic force microscopy-based single cell force spectroscopy technique was used to measure adhesive force of cancerous cells. Results indicated that inhibition of EGFR activity elevated cell-cell adhesion force, accompanied by stiffening of the cell bodies. In summary, Cetuximab and Lapatinib have been found to mediate cell-cell adhesion by restoration of E-cadherin expression and function. Our data suggest possible therapeutic potential for inhibition of metastasis via the blockade of EGFR signaling.

  17. Decorin gene expression and its regulation in human keratinocytes

    SciTech Connect

    Velez-DelValle, Cristina; Marsch-Moreno, Meytha; Castro-Munozledo, Federico; Kuri-Harcuch, Walid


    Highlights: {yields} We showed that cultured human diploid epidermal keratinocytes express and synthesize decorin. {yields} Decorin is found intracytoplasmic in suprabasal cells of cultures and in human epidermis. {yields} Decorin mRNA expression in cHEK is regulated by pro-inflammatory and proliferative cytokines. {yields} Decorin immunostaining of psoriatic lesions showed a lower intensity and altered intracytoplasmic arrangements. -- Abstract: In various cell types, including cancer cells, decorin is involved in regulation of cell attachment, migration and proliferation. In skin, decorin is seen in dermis, but not in keratinocytes. We show that decorin gene (DCN) is expressed in the cultured keratinocytes, and the protein is found in the cytoplasm of differentiating keratinocytes and in suprabasal layers of human epidermis. RT-PCR experiments showed that DCN expression is regulated by pro-inflammatory and proliferative cytokines. Our data suggest that decorin should play a significant role in keratinocyte terminal differentiation, cutaneous homeostasis and dermatological diseases.

  18. Epoc-1: a POU-domain gene expressed in murine epidermal basal cells and thymic stromal cells.


    Yukawa, K; Yasui, T; Yamamoto, A; Shiku, H; Kishimoto, T; Kikutani, H


    POU-domain transcription factors are known as developmental regulators which control organ development and cell phenotypes. In order to clarify the roles of POU-domain transcription factors in cell differentiation, we cloned a novel POU family gene, Epoc-1, from a murine thymus cDNA library. The amino acid (aa) sequence of the POU-specific domain of Epoc-1 is almost identical to those of Oct-1 and Oct-2. However, within the POU-homeodomain, 13 out of 60 aa differ between Epoc-1 and Oct-2. Recombinant Epoc-1 products were found to bind specifically to the octamer sequence. Epoc-1 was found to be expressed in skin, thymus, stomach and testis. In situ hybridization experiments and RNase protection assays indicated that Epoc-1 is expressed in the epidermal basal cells of the skin, which contain stem cells unipotent for keratinocyte differentiation and in thymic stromal elements. These results suggest that Epoc-1 might be one of the developmental regulators which controls epidermal development and thymic organogenesis.

  19. Possible involvement of ERK 1/2 in UVA-induced melanogenesis in cultured normal human epidermal melanocytes.


    Yanase, H; Ando, H; Horikawa, M; Watanabe, M; Mori, T; Matsuda, N


    UV-induced melanogenesis is a well known physiological response of human skin exposed to solar radiation; however, the signaling molecules involved in the stimulation of melanogenesis in melanocytes following UV exposure remain unclear. In this study we induced melanogenesis in vitro in normal human epidermal melanocytes using a single irradiation with UVA at 1 kJ/m2 and examined the potential involvement of mitogen-activated protein kinases (MAPK) as UVA-responsive signaling molecules in those cells. UVA irradiation did not affect the proliferation of melanocytes, but it did increase tyrosinase mRNA expression, which reached a maximum level 4 hr after UVA irradiation. The amount of tyrosinase protein, as quantitated by immunoblotting, was also increased at 24 hr following UVA irradiation. Among the MAPK examined, extracellular signal-related kinase (ERK) 1/2 was phosphorylated within 15 min of UVA irradiation, but no such phosphorylation was observed for c-Jun N-terminal kinases (JNK) or p38. Accordingly, the activity of ERK1/2 was also increased shortly after UVA irradiation. These responses of ERK1/2 to UVA irradiation were markedly inhibited when cells were pre-treated with N-acetyl-L-cysteine, an antioxidant, or with suramin, a tyrosine kinase receptor inhibitor. The formation of (6-4)photoproducts or cyclobutane pyrimidine dimers was not detected in cellular DNA after UVA irradiation. These findings suggest that a single UVA irradiation-induced melanogenesis is associated with the activation of ERK1/2 by upstream signals that originate from reactive oxygen species or from activated tyrosine kinase receptors, but not from damaged DNA.

  20. Chemical allergens stimulate human epidermal keratinocytes to produce lymphangiogenic vascular endothelial growth factor

    SciTech Connect

    Bae, Ok-Nam; Ahn, Seyeon; Jin, Sun Hee; Hong, Soo Hyun; Lee, Jinyoung; Kim, Eun-Sun; Jeong, Tae Cheon; Chun, Young-Jin; Lee, Ai-Young; Noh, Minsoo


    Allergic contact dermatitis (ACD) is a cell-mediated immune response that involves skin sensitization in response to contact with various allergens. Angiogenesis and lymphangiogenesis both play roles in the allergic sensitization process. Epidermal keratinocytes can produce vascular endothelial growth factor (VEGF) in response to UV irradiation and during wound healing. However, the effect of haptenic chemical allergens on the VEGF production of human keratinocytes, which is the primary contact site of toxic allergens, has not been thoroughly researched. We systematically investigated whether immune-regulatory cytokines and chemical allergens would lead to the production of VEGF in normal human keratinocytes (NHKs) in culture. VEGF production significantly increased when NHKs were treated with IFNγ, IL-1α, IL-4, IL-6, IL-17A, IL-22 or TNFα. Among the human sensitizers listed in the OECD Test Guideline (TG) 429, we found that CMI/MI, DNCB, 4-phenylenediamine, cobalt chloride, 2-mercaptobenzothiazole, citral, HCA, cinnamic alcohol, imidazolidinyl urea and nickel chloride all significantly upregulated VEGF production in NHKs. In addition, common human haptenic allergens such as avobenzone, formaldehyde and urushiol, also induced the keratinocyte-derived VEGF production. VEGF upregulation by pro-inflammatory stimuli, IFNγ, DNCB or formaldehyde is preceded by the production of IL-8, an acute inflammatory phase cytokine. Lymphangiogenic VEGF-C gene transcription was significantly increased when NHKs were treated with formaldehyde, DNCB or urushiol, while transcription of VEGF-A and VEGF-B did not change. Therefore, the chemical allergen-induced VEGF upregulation is mainly due to the increase in lymphangiogenic VEGF-C transcription in NHKs. These results suggest that keratinocyte-derived VEGF may regulate the lymphangiogenic process during the skin sensitization process of ACD. - Highlights: • Pro-inflammatory cytokines induced VEGF production in normal human

  1. Response to Therapy and Outcomes in Oropharyngeal Cancer Are Associated With Biomarkers Including Human Papillomavirus, Epidermal Growth Factor Receptor, Gender, and Smoking

    SciTech Connect

    Kumar, Bhavna; Cordell, Kitrina G.; Lee, Julia S.; Prince, Mark E.; Tran, Huong H.; Wolf, Gregory T.; Urba, Susan G.; Worden, Francis P.; Chepeha, Douglas B.; Teknos, Theodoros N.; Eisbruch, Avraham; Tsien, Christina I.; Taylor, Jeremy; D'Silva, Nisha J.; Yang, Kun; Kurnit, David M.; Bradford, Carol R.


    Induction chemotherapy and concurrent chemoradiation for responders or immediate surgery for non-responders is an effective treatment strategy head and neck squamous cell carcinoma (HNSCC) of the larynx and oropharynx. Biomarkers that predict outcome would be valuable in selecting patients for therapy. In this study, the presence and titer of high risk human papilloma virus (HPV) and expression of epidermal growth factor receptor (EGFR) in pre-treatment biopsies, as well as smoking and gender were examined in oropharynx cancer patients enrolled in an organ sparing trial. HPV16 copy number was positively associated with response to therapy and with overall and disease specific survival, whereas EGFR expression, current or former smoking behavior, and female gender (in this cohort) were associated with poor response and poor survival in multivariate analysis. Smoking cessation and strategies to target EGFR may be useful adjuncts for therapy to improve outcome in the cases with the poorest biomarker profile.

  2. Serotoninergic and melatoninergic systems are fully expressed in human skin.


    Slominski, Andrzej; Pisarchik, Alexander; Semak, Igor; Sweatman, Trevor; Wortsman, Jacobo; Szczesniewski, Andre; Slugocki, George; McNulty, John; Kauser, Söbia; Tobin, Desmond J; Jing, Chen; Johansson, Olle


    We investigated the cutaneous expression of genes and enzymes responsible for the multistep conversion of tryptophan to serotonin and further to melatonin. Samples tested were human skin, normal and pathologic (basal cell carcinoma and melanoma), cultured normal epidermal and follicular melanocytes, melanoma cell lines, normal neonatal and adult epidermal and follicular keratinocytes, squamous cell carcinoma cells, and fibroblasts from dermis and follicular papilla. The majority of the samples showed simultaneous expression of the genes for tryptophan hydroxylase, arylalkylamine N-acetyltransferase (AANAT), and hydroxyindole-O-methyltransferase (HIOMT). The products of AANAT activity were identified by RP-HPLC with fluorimetric detection in human skin and in cultured normal and malignant melanocytes and immortalized keratinocytes; HIOMT activity was detected in human skin, keratinocytes, and melanoma cells. N-acetylserotonin (NAS) was detected by RP-HPLC in human skin extracts. NAS identity was confirmed further by LC/MS in keratinocytes. In conclusion, we provide evidence that the human skin expresses intrinsic serotonin and melatonin biosynthetic pathways.

  3. Isolation and characterization of human and mouse ZIRTL, a member of the IRT1 family of transporters, mapping within the epidermal differentiation complex.


    Lioumi, M; Ferguson, C A; Sharpe, P T; Freeman, T; Marenholz, I; Mischke, D; Heizmann, C; Ragoussis, J


    We report the precise mapping and characterization of ZIRTL (zinc-iron regulated transporter-like) gene, the first mammalian member of an extensive family of divalent metal ion transporters, comprising IRT1 and ZIP1, ZIP2, ZIP3, and ZIP4 in plants and ZRT1 and ZRT2 in yeast. The human gene maps at the telomeric end of the epidermal differentiation complex (EDC), within chromosomal band 1q21, while the mouse gene maps within the mouse EDC, on mouse chromosome 3, between S100A9 and S100A13. The structure of the human gene has been determined, and message was detected in most adult and fetal tissues including the epidermis. The mouse gene is developmentally regulated and found expressed in fetal and adult suprabasal epidermis, osteoblasts, small intestine, and salivary gland.

  4. Dynamic changes in nicotinamide pyridine dinucleotide content in normal human epidermal keratinocytes and their effect on retinoic acid biosynthesis

    SciTech Connect

    Pinkas-Sarafova, Adriana . E-mail:; Markova, N.G. . E-mail:; Simon, M. . E-mail:


    The function of many enzymes that regulate metabolism and transcription depends critically on the nicotinamide pyridine dinucleotides. To understand the role of NAD(P)(H) in physiology and pathophysiology, it is imperative to estimate both their amount and ratios in a given cell type. In human epidermis and in cultured epidermal keratinocytes, we found that the total dinucleotide content is in the low millimolar range. The dinucleotide pattern changes during proliferation and maturation of keratinocytes in culture. Differences in the concentrations of NAD(P)(H) of 1.5- to 12-fold were observed. This resulted in alteration of the NAD(P)H/NAD(P) ratio, which could impact the differential regulation of both transcriptional and metabolic processes. In support of this notion, we provide evidence that the two-step oxidation of retinol to retinoic acid, a nuclear hormone critical for epidermal homeostasis, can be regulated by the relative physiological amounts of the pyridine dinucleotides.

  5. Biological interactions of quantum dot nanoparticles in skin and in human epidermal keratinocytes

    SciTech Connect

    Zhang, Leshuai W.; Yu, William W.; Colvin, Vicki L.; Monteiro-Riviere, Nancy A.


    Quantum dots nanoparticles have novel optical properties for biomedical applications and electronics, but little is known about their skin permeability and interaction with cells. QD621 are nail-shaped nanoparticles that contain a cadmium/selenide core with a cadmium sulfide shell coated with polyethylene glycol (PEG) and are soluble in water. QD were topically applied to porcine skin flow-through diffusion cells to assess penetration at 1 {mu}M, 2 {mu}M and 10 {mu}M for 24 h. QD were also studied in human epidermal keratinocytes (HEK) to determine cellular uptake, cytotoxicity and inflammatory potential. Confocal microscopy depicted the penetration of QD621 through the uppermost stratum corneum (SC) layers of the epidermis and fluorescence was found primarily in the SC and near hair follicles. QD were found in the intercellular lipid bilayers of the SC by transmission electron microscopy (TEM). Inductively coupled plasma-optical emission spectroscopy (ICP-OES) analysis for cadmium (Cd) and fluorescence for QD both did not detect Cd nor fluorescence signal in the perfusate at any time point or concentration. In HEK, viability decreased significantly (p < 0.05) from 1.25 nM to 10nM after 24 h and 48 h. There was a significant increase in IL-6 at 1.25 nM to 10 nM, while IL-8 increased from 2.5nM to 10nM after 24 h and 48 h. TEM of HEK treated with 10 nM of QD621 at 24 h depicted QD in cytoplasmic vacuoles and at the periphery of the cell membranes. These results indicate that porcine skin penetration of QD621 is minimal and limited primarily to the outer SC layers, yet if the skin were damaged allowing direct QD exposure to skin or keratinocytes, an inflammatory response could be initiated.

  6. UVB radiation induces an increase in intracellular zinc in human epidermal keratinocytes.


    Stork, Christian J; Martorano, Lisa M; Li, Yang V


    Ultraviolet (UV) radiation is known to cause oxidative stress, inflammation, DNA damage and apoptotic cell death; however, many details of these malign mechanism have yet to be elucidated. In this study, the exposure of adult human epidermal keratinocytes (HEKa) with UVB (>100 mJ/cm(2)) resulted in the significant increase of intracellular zinc that was released from its storage and was detected by fluorescent zinc indicators. Toxicity testing revealed that UVB-induced zinc release in HEKa is associated with HEKa cell death. Cells that showed elevated intracellular zinc fluorescence upon UVB exposure were also stained by propidium iodide (PI), a traditional viability indicator whose fluorescent signal is as a result of its intercalating with DNA fragments and is unaffected by zinc concentration, showing significant colocalization [Pearson's correlation coefficients r=0.956 (n=6)]. The cytotoxicity of zinc was also determined by an MTT assay after applying the exogenous zinc (ZnCl2) along with its ionophore pyrithione (20 microM) into HEKa culture medium. A significant reduction in cell viability as a function of both zinc concentration and exposure time was observed. The treatments of 1, 10 and 100 microM ZnCl2 with pyrithione demonstrated 2.3, 60 and 84% cell deaths, respectively (control 0.5%) after 30 min. ZnCl2 (100 microM) was also found to induce complete HEKa death after 1 h. Thus, the present study demonstrates that UVB irradiation-induced increased zinc is detrimental to HEKa viability, and zinc may be a necessary step in UVB-induced cell death signaling pathways.

  7. Pretreatment of human epidermal keratinocytes in vitro with ethacrynic Acid reduces sulfur mustard cytotoxicity.


    Gross, Clark L; Nipwoda, Mary T; Nealley, Eric W; Smith, William J


    Sulfur mustard (SM) is a potent alkylating agent, profoundly cytotoxic, and a powerful vesicant. SM reacts quite extensively with glutathione (GSH) and forms GSH conjugates, which are presumably excreted through the mercapturic acid pathway in mammals. It is unknown whether any enzymes, such as the glutathione-S-transferases (GST), are involved in this detoxification of SM by the formation of conjugates. A prototypic inhibitor (ethacrynic acid, EAA) and a prototypic inducer (Oltipraz, OLT) of GSH-S-transferase, have been used as pretreatment compounds in human epidermal keratinocytes (HEK) to investigate the effect of enzyme levels on cytotoxicity following SM challenge from 50 muM to 300 muM. Pretreatment of HEK for 24 h with EAA doubled survival against 200 muM SM (36% viability in non-pretreated cells vs. 81% in EAA-pretreated cells) and quadrupled survival (17% viability in non-pretreated controls vs. 71% in EAA-pretreated cells), while OLT pretreatment had no effect on cytotoxicity at either SM dose. The role of GST in SM cytotoxicity could not be tested because of the lack of an effect on modulation of GST activities by these 2 drugs. Cellular levels of GSH were increased 250-300% over control values using EAA pretreatment, while OLT pretreatment did not lead to any increase in GSH. Pretreatment of HEK with buthionine sulfoximine (BSO), a known depleter of glutathione levels, reduced glutathione levels and increased cytotoxicity. This large increase in GSH appears to be solely responsible for the enhanced survivability of EAA-pretreated HEK.

  8. Structural characterization and biological activity of recombinant human epidermal growth factor proteins with different N-terminal sequences.


    Svoboda, M; Bauhofer, A; Schwind, P; Bade, E; Rasched, I; Przybylski, M


    The primary structures and molecular homogeneity of recombinant human epidermal growth factors from different suppliers were characterized and their biological activities evaluated by a standard DNA synthesis assay. Molecular weight determinations using 252Cf-plasma-desorption and electrospray mass spectrometry in combination with N- and C-terminal sequence analysis and determination of intramolecular disulfide bridges revealed that one recombinant protein had the correct human-identical structure (54 aa residues; 6347 Da). In contrast, a second recombinant protein (7020 Da) was found to contain a pentapeptide (KKYPR) insert following its N-terminal methionine. This structural variant showed a significant reduction in its capacity to stimulate DNA synthesis.

  9. Epidermal gene expression and ethnic pigmentation variations among individuals of Asian, European and African ancestry.


    Yin, Lanlan; Coelho, Sergio G; Ebsen, Dominik; Smuda, Christoph; Mahns, Andre; Miller, Sharon A; Beer, Janusz Z; Kolbe, Ludger; Hearing, Vincent J


    Differences in visible skin pigmentation give rise to the wide variation of skin colours seen in racial/ethnic populations. Skin pigmentation is important not only from cosmetic and psychological points of view, but more importantly because of its implications for the risk of all types of skin cancers, on photoaging, etc. Despite differences in those parameters in Caucasian and Asian skin types, they are remarkably similar in their production and distribution of melanins, and the mechanism(s) underlying their different characteristics have remained obscure. In this study, we used microarray analysis of skin suction blisters to investigate molecular differences underlying the determination of pigmentation in various skin types, and we used immunohistochemistry to validate the expression patterns of several interesting targets that were identified. Intriguingly, Caucasian and Asian skins had highly similar gene expression patterns that differed significantly from the pattern of African skin. The results of this study suggest the dynamic interactions of different types of cells in human skin that regulate its pigmentation, reveal that the known pigmentation genes have a limited contribution and uncover a new array of genes, including NINL and S100A4, that might be involved in that regulation.

  10. c-fos sequence necessary for basal expression and induction by epidermal growth factor, 12-O-tetradecanoyl phorbol-13-acetate and the calcium ionophore.

    PubMed Central

    Fisch, T M; Prywes, R; Roeder, R G


    We have investigated the sequence requirements for induction of the human c-fos gene by epidermal growth factor (EGF), 12-O-tetradecanoyl-13-acetate (TPA), and the calcium ionophore A23187 by transfecting c-fos promoter mutants into HeLa and A431 cells. Induction by both EGF and TPA in HeLa cells required the presence of the c-fos enhancer located at -317 to -298 relative to the mRNA cap site. A23187, however, did not induce expression of the transfected gene, even though it strongly induced expression of the endogenous gene, suggesting that it has different requirements for induction than do EGF and TPA. We have also investigated the role of promoter sequences downstream of the enhancer in general expression and induction of c-fos. A sequence between -97 and -76, which includes an 8-base-pair perfect direct repeat, was needed for efficient general expression but not for induction of the gene. A factor in nuclear extracts that bound specifically to this sequence was detected by a gel mobility shift assay. A 7-base-pair sequence, located between -63 and -57 relative to the mRNA cap site and previously shown to be important for general expression of mouse c-fos, was also important for general expression of the human gene. In addition, this element was important for inducibility by EGF and TPA, since induction was significantly reduced when internal deletion mutants that retained the enhancer but lacked the -63 to -57 sequence element were analyzed in transfecting assays. Images PMID:3119989

  11. Heparin-Binding Epidermal Growth Factor-Like Growth Factor Enhances Aquaporin 3 Expression and Function During Mouse Embryo Implantation.


    Fang, Chuan-Xiang; Nong, Ying-Qi; Liu, Feng-Hua; Fan, Lin; Chen, Ye


    Aquaporin 3 (AQP3) is highly expressed in peri-implantation blastocyst trophoblastic cells, indicating its role in cytotrophoblast invasion during embryo implantation. However, the mechanism underlying the regulation of AQP3 expression during embryo implantation remains unclear. In this study, an in vitro co-culture system of blastocysts on a monolayer of uterine endometrial cells was used to mimic in vivo process of embryo attachment and invasion to uterine endometrium and treated with different concentrations of heparin-binding epidermal growth factor-like growth factor (HB-EGF). The results showed that HB-EGF enhanced AQP3 expression in blastocysts in a dose-dependent manner and promoted the attachment and outgrowth of blastocysts on the monolayer of uterine endometrial cells. When the AQP3 activity was inhibited by copper sulfate, both the attachment and outgrowth of blastocysts were inhibited. Furthermore, HB-EGF induced the phosphorylation of EGF receptor (EGFR) and extracellular signal-regulated kinase (ERK). PD153035 (EGFR inhibitor) and U0126 (ERK inhibitor) inhibited AQP3 expression and also the attachment and outgrowth of blastocysts. Collectively, our findings provide the first evidence that HB-EGF stimulates EGFR/ERK signaling to promote AQP3 expression in trophoblastic cells, and AQP3 plays a vital role in HB-EGF-induced embryo implantation.

  12. Epidermal Growth Factor Receptor Expression As Prognostic Marker in Patients With Anal Carcinoma Treated With Concurrent Chemoradiation Therapy

    SciTech Connect

    Fraunholz, Ingeborg; Falk, Stefan


    Purpose: To investigate the prognostic value of epidermal growth factor receptor (EGFR) expression in pretreatment tumor biopsy specimens of patients with anal cancer treated with concurrent 5-fluorouracil and mitomycin C-based chemoradiation therapy (CRT). Methods and Materials: Immunohistochemical staining for EGFR was performed in pretreatment biopsy specimens of 103 patients with anal carcinoma. EGFR expression was correlated with clinical and histopathologic characteristics and with clinical endpoints, including local failure-free survival (LFFS), colostomy-free survival (CFS), distant metastases-free survival (DMFS), cancer-specific survival (CSS), and overall survival (OS). Results: EGFR staining intensity was absent in 3%, weak in 23%, intermediate in 36% and intense in 38% of the patients. In univariate analysis, the level of EGFR staining was significantly correlated with CSS (absent/weak vs intermediate/intense expression: 5-year CSS, 70% vs 86%, P=.03). As a trend, this was also observed for DMFS (70% vs 86%, P=.06) and LFFS (70% vs 87%, P=.16). In multivariate analysis, N stage, tumor differentiation, and patients’ sex were independent prognostic factors for CSS, whereas EGFR expression only reached borderline significance (hazard ratio 2.75; P=.08). Conclusion: Our results suggest that elevated levels of pretreatment EGFR expression could be correlated with favorable clinical outcome in anal cancer patients treated with CRT. Further studies are warranted to elucidate how EGFR is involved in the response to CRT.

  13. Differences in epidermal thickness and expression of apoptosis regulatory proteins in the skin of patients with chronic renal failure and pruritus.


    Kovačević, Lina Mirić; Puizina-Ivić, Neira; Ljutić, Dragan; Brakus, Snježana Mardešić; Govorko, Danijela Kalibović; Jeličić, Ivo; Mirić, Dino; Rešić, Jasminka; Saraga-Babić, Mirna


    Chronic renal failure is often associated with skin itching (pruritus) in dialysis patients. In order to investigate the possible causes of pruritus, the epidermis of the thigh of 12 dialysis patients and 4 controls from patients without renal disease were examined. The sections of the epidermis were measured and immunohistochemically analyzed using antibodies to Bcl-2, Bax, caspase-3 proteins and TUNEL method. While the mean thickness of normal epidermis was 53 μm, in dialysis patients it ranged between 23 and 34 μm during the 3-5 year period on dialysis. Compared to normal skin, the fine balance between the Bcl-2 and Bax proteins did not greatly change in the epidermis of dialysis patients during the three years of dialysis. Following five-year dialysis, the epidermis displayed increased Bax and decreased Bcl-2 expression in the basal and intermediate epidermal layers, as well as the presence of apoptotic cells (TUNEL and caspase-3 positive) both in the superficial and intermediate epidermal layers. Our study demonstrated the predominant expression of cell death Bax proteins over cell survival Bcl-2 proteins, and apoptotic cells in the deeper layers of the epidermis in patients on long-term dialysis. We speculate that the thinning of the epidermis might be associated with the appearance of dead cells in the deeper epidermal layers, while the changed internal milieu of epidermal cells could possibly affect the intra-epidermal nerve endings thus leading to the sensation of pruritus.

  14. Expression of IL-22 in the Skin Causes Th2-Biased Immunity, Epidermal Barrier Dysfunction, and Pruritus via Stimulating Epithelial Th2 Cytokines and the GRP Pathway.


    Lou, Hongfei; Lu, Jingning; Choi, Eun Byul; Oh, Min Hee; Jeong, Mingeum; Barmettler, Sara; Zhu, Zhou; Zheng, Tao


    Increased expression of Th22 cytokine IL-22 is a characteristic finding in atopic dermatitis (AD). However, the specific role of IL-22 in the pathogenesis of AD in vivo has yet to be elucidated. Consistent with observations in human AD, IL-22 was significantly increased in the AD skin of mice after epicutaneous sensitization to house dust mite allergen. Utilizing a skin-specific inducible transgenic system, we show in the present study that expression of IL-22 in the skin of mice caused an AD-like phenotype characterized by chronic pruritic dermatitis associated with Th2-biased local and systemic immune responses, downregulation of epidermal differentiation complex genes, and enhanced dermatitis upon epicutaneous allergen exposure. IL-22 potently induced the expression of gastrin-releasing peptide (GRP), a neuropeptide pruritogen, in dermal immune cells and sensory afferents and in their skin-innervating sensory neurons. IL-22 also differentially upregulated the expression of GRP receptor (GRPR) on keratinocytes of AD skin. The number of GRP(+) cells in the skin correlated with the AD severity and the intensity of pruritus. IL-22 directly upregulated the expression of epithelial-derived type 2 cytokines (thymic stromal lymphopoietin and IL-33) and GRP in primary keratinocytes. Furthermore, GRP not only strongly induced thymic stromal lymphopoietin but it also increased the expression of IL-33 and GRPR synergistically with IL-22. Importantly, we found that the expression of GRP was strikingly increased in the skin of patients with AD. These results indicate that IL-22 plays important pathogenic roles in the initiation and development of AD, in part through inducing keratinocyte production of type 2 cytokines and activation of the GRP/GRPR pathway.

  15. Targeted expression of RALT in mouse skin inhibits epidermal growth factor receptor signalling and generates a Waved-like phenotype.


    Ballarò, Costanza; Ceccarelli, Sara; Tiveron, Cecilia; Tatangelo, Laura; Salvatore, Anna Maria; Segatto, Oreste; Alemà, Stefano


    Although it has been clearly established that negative feedback loops have a fundamental role in the regulation of epidermal growth factor receptor (EGFR) signalling in flies, their role in the regulation of mammalian EGFR has been inferred only recently from in vitro studies. Here, we report on the forced expression of RALT/MIG-6, a negative feedback regulator of ErbB receptors, in mouse skin. A RALT transgene driven by the K14 promoter generated a dose-dependent phenotype resembling that caused by hypomorphic and antimorphic Egfr alleles-that is, wavy coat, curly whiskers and open eyes at birth. Ex vivo keratinocytes from K14-RALT mice showed reduced biochemical and biological responses when stimulated by ErbB ligands. Conversely, knockdown of RALT by RNA interference enhanced ErbB mitogenic signalling. Thus, RALT behaves as a suppressor of EGFR signalling in mouse skin.

  16. Targeted expression of RALT in mouse skin inhibits epidermal growth factor receptor signalling and generates a Waved-like phenotype

    PubMed Central

    Ballarò, Costanza; Ceccarelli, Sara; Tiveron, Cecilia; Tatangelo, Laura; Salvatore, Anna Maria; Segatto, Oreste; Alemà, Stefano


    Although it has been clearly established that negative feedback loops have a fundamental role in the regulation of epidermal growth factor receptor (EGFR) signalling in flies, their role in the regulation of mammalian EGFR has been inferred only recently from in vitro studies. Here, we report on the forced expression of RALT/MIG-6, a negative feedback regulator of ErbB receptors, in mouse skin. A RALT transgene driven by the K14 promoter generated a dose-dependent phenotype resembling that caused by hypomorphic and antimorphic Egfr alleles—that is, wavy coat, curly whiskers and open eyes at birth. Ex vivo keratinocytes from K14-RALT mice showed reduced biochemical and biological responses when stimulated by ErbB ligands. Conversely, knockdown of RALT by RNA interference enhanced ErbB mitogenic signalling. Thus, RALT behaves as a suppressor of EGFR signalling in mouse skin. PMID:16007071

  17. 3D pharmacophore-based virtual screening, docking and density functional theory approach towards the discovery of novel human epidermal growth factor receptor-2 (HER2) inhibitors.


    Gogoi, Dhrubajyoti; Baruah, Vishwa Jyoti; Chaliha, Amrita Kashyap; Kakoti, Bibhuti Bhushan; Sarma, Diganta; Buragohain, Alak Kumar


    Human epidermal growth factor receptor 2 (HER2) is one of the four members of the epidermal growth factor receptor (EGFR) family and is expressed to facilitate cellular proliferation across various tissue types. Therapies targeting HER2, which is a transmembrane glycoprotein with tyrosine kinase activity, offer promising prospects especially in breast and gastric/gastroesophageal cancer patients. Persistence of both primary and acquired resistance to various routine drugs/antibodies is a disappointing outcome in the treatment of many HER2 positive cancer patients and is a challenge that requires formulation of new and improved strategies to overcome the same. Identification of novel HER2 inhibitors with improved therapeutics index was performed with a highly correlating (r=0.975) ligand-based pharmacophore model (Hypo1) in this study. Hypo1 was generated from a training set of 22 compounds with HER2 inhibitory activity and this well-validated hypothesis was subsequently used as a 3D query to screen compounds in a total of four databases of which two were natural product databases. Further, these compounds were analyzed for compliance with Veber's drug-likeness rule and optimum ADMET parameters. The selected compounds were then subjected to molecular docking and Density Functional Theory (DFT) analysis to discern their molecular interactions at the active site of HER2. The findings thus presented would be an important starting point towards the development of novel HER2 inhibitors using well-validated computational techniques.

  18. c-Jun/AP-1 pathway-mediated cyclin D1 expression participates in low dose arsenite-induced transformation in mouse epidermal JB6 Cl41 cells

    SciTech Connect

    Zhang Dongyun; Li Jingxia; Gao Jimin; Huang Chuanshu


    Arsenic is a well-documented human carcinogen associated with skin carcinogenesis. Our previous work reveals that arsenite exposure is able to induce cell transformation in mouse epidermal cell JB6 Cl41 through the activation of ERK, rather than JNK pathway. Our current studies further evaluate downstream pathway in low dose arsenite-induced cell transformation in JB6 Cl41 cells. Our results showed that treatment of cells with low dose arsenite induced activation of c-Jun/AP-1 pathway, and ectopic expression of dominant negative mutant of c-Jun (TAM67) blocked arsenite-induced transformation. Furthermore, our data indicated that cyclin D1 was an important downstream molecule involved in c-Jun/AP-1-mediated cell transformation upon low dose arsenite exposure, because inhibition of cyclin D1 expression by its specific siRNA in the JB6 Cl41 cells resulted in impairment of anchorage-independent growth of cells induced by low dose arsenite. Collectively, our results demonstrate that c-Jun/AP-1-mediated cyclin D1 expression is at least one of the key events implicated in cell transformation upon low dose arsenite exposure.

  19. The expression of epidermal growth factor (EGF) and its receptor (EGFR) during post-natal testes development in the yak.


    Pan, Y; Cui, Y; Yu, S; Zhang, Q; Fan, J; Abdul Rasheed, B; Yang, K


    Growth factors play critical role in cell proliferation, regulate tissue differentiation and modulate organogenesis. Several growth factors have been identified in the testes of various mammalian species in last few years. In present investigation, the objective was to determine the expression of epidermal growth factor (EGF) and the epidermal growth factor receptor (EGFR) in yak testicular tissue by relative quantitative real time polymerase chain reaction (RT-PCR), Western blot (WB) and immunohistochemistry (IHC) from mRNA and protein levels. The testicular tissues were collected from male yak at 6 and 24 months old. Results of RT-PCR and WB showed that the expression quantity of EGF and EGFR at 24 months of age was higher than at 6 months, and the increase rate of EGFR on mRNA and protein levels was higher than the increase rate EGF during post-natal testes development. Positive staining for EGF and EGFR was very low and mainly localized to Leydig cells testes at 6 months of age with immunohistochemistry, and seminiferous tubules were not observed. At 24 month of age, both the EGF and EGFR could be detected in Leydig cells, peritubular myoid cells, sertoli cells and germ cells of the yak testes. However, EGF and EGFR were localized to preferential adluminal compartment and basal compartment in the seminiferous tubules, respectively. In conclusion, the findings in present studies suggest that EGF and EGFR as important paracrine and/or autocrine regulators in yak testes development and spermatogenesis.

  20. Analysis of gene expression dynamics revealed delayed and abnormal epidermal repair process in aged compared to young skin.


    Sextius, Peggy; Marionnet, Claire; Tacheau, Charlotte; Bon, François-Xavier; Bastien, Philippe; Mauviel, Alain; Bernard, Bruno A; Bernerd, Françoise; Dubertret, Louis


    With aging, epidermal homeostasis and barrier function are disrupted. In a previous study, we analyzed the transcriptomic response of young skin epidermis after stratum corneum removal, and obtained a global kinetic view of the molecular processes involved in barrier function recovery. In the present study, the same analysis was performed in aged skin in order to better understand the defects which occur with aging. Thirty healthy male volunteers (67 ± 4 years old) were involved. Tape-strippings were carried out on the inner face of one forearm, the other unstripped forearm serving as control. At 2, 6, 18, 30 and 72 h after stripping, TEWL measurements were taken, and epidermis samples were collected. Total RNA was extracted and analyzed using DermArray(®) cDNA microarrays. The results highlighted that barrier function recovery and overall kinetics of gene expression were delayed following stripping in aged skin. Indeed, the TEWL measurements showed that barrier recovery in the young group appeared to be dramatically significant during the overall kinetics, while there were no significant evolution in the aged group until 30 h. Moreover, gene expression analysis revealed that the number of modulated genes following tape stripping increased as a function of time and reached a peak at 6 h after tape stripping in young skin, while it was at 30 h in aged skin, showing that cellular activity linked to the repair process may be engaged earlier in young epidermis than in aged epidermis. A total of 370 genes were modulated in the young group. In the aged group, 382 genes were modulated, whose 184 were also modulated in the young group. Only eight genes that were modulated in both groups were significantly differently modulated. The characterization of these genes into 15 functional families helped to draw a scenario for the aging process affecting epidermal repair capacity.

  1. Recombinant human epidermal growth factor accelerates the proliferation of irradiated human fibroblasts and keratinocytes in vitro and in vivo.


    Ryu, Seung-Hee; Moon, Soo Young; Yang, Youn-Joo; Moon, Sun Rock; Hong, Joon Pio; Choi, Jene; Lee, Sang-Wook


    Irradiation causes the impaired proliferation of cells lining mucosal membranes. Epidermal growth factor (EGF) facilitates proliferation of various skin cells; however, the wound healing effects of EGF on radiation-damaged cells is less well known. To evaluate the effects of recombinant human EGF (rhEGF) on the proliferation of cells following irradiation, we tested two types of fibroblast cell lines and one keratinocyte cell line. The viable cell numbers were significantly increased by rhEGF treatment for 24 h immediately after 8 Gy of irradiation. The most effective dose of rhEGF was 10 nM in all cell lines used in this study. The percentage of BrdU-labeled cells was also significantly increased by rhEGF treatment. To evaluate the effects of rhEGF on radiation-induced oral mucosal damage in BALB/c mice, we systematically injected 1 mg/kg/day EGF for three days after 17 Gy of irradiation. Administered rhEGF ameliorated radiation-induced mucosal damage in vivo. rhEGF significantly increased the epithelial cell layer thickness and the proliferation of basal layer cells as detected by Ki-67 staining. Our results suggest that rhEGF can be a therapeutic treatment for radiation-induced wounds by stimulating the proliferation of fibroblasts and keratinocytes following irradiation.

  2. Triggering Apoptotic Death of Human Epidermal Keratinocytes by Malic Acid: Involvement of Endoplasmic Reticulum Stress- and Mitochondria-Dependent Signaling Pathways

    PubMed Central

    Hsiao, Yu-Ping; Lai, Wan-Wen; Wu, Shi-Bei; Tsai, Chung-Hung; Tang, Sheau-Chung; Chung, Jing-Gung; Yang, Jen-Hung


    Malic acid (MA) has been commonly used in cosmetic products, but the safety reports in skin are sparse. To investigate the biological effects of MA in human skin keratinocytes, we investigated the potential cytotoxicity and apoptotic effects of MA in human keratinocyte cell lines (HaCaT). The data showed that MA induced apoptosis based on the observations of DAPI staining, DNA fragmentation, and sub-G1 phase in HaCaT cells and normal human epidermal keratinocytes (NHEKs). Flow cytometric assays also showed that MA increased the production of mitochondrial superoxide (mito-SOX) but decreased the mitochondrial membrane potential. Analysis of bioenergetics function with the XF 24 analyzer Seahorse extracellular flux analyzer demonstrated that oxygen consumption rate (OCR) was significantly decreased whereas extracellular acidification rate (ECAR) was increased in MA-treated keratinocytes. The occurrence of apoptosis was proved by the increased expressions of FasL, Fas, Bax, Bid, caspases-3, -8, -9, cytochrome c, and the declined expressions of Bcl-2, PARP. MA also induced endoplasmic reticulum stress associated protein expression such as GRP78, GADD153, and ATF6α. We demonstrated that MA had anti-proliferative effect in HaCaT cell through the inhibition of cell cycle progression at G0/G1, and the induction of programmed cell death through endoplasmic reticulum stress- and mitochondria-dependent pathways. PMID:25584429

  3. UTP Controls Cell Surface Distribution and Vasomotor Activity of the Human P2Y2 Receptor through an Epidermal Growth Factor Receptor-transregulated Mechanism*

    PubMed Central

    Norambuena, Andrés; Palma, Francisco; Poblete, M. Inés; Donoso, M. Verónica; Pardo, Evelyn; González, Alfonso; Huidobro-Toro, J. Pablo


    Extracellular nucleotides transmit signals into the cells through the P2 family of cell surface receptors. These receptors are amply expressed in human blood vessels and participate in vascular tone control; however, their signaling mechanisms remain unknown. Here we show that in smooth muscle cells of isolated human chorionic arteries, the activation of the P2Y2 receptor (P2Y2R) induces not only its partition into membrane rafts but also its rapid internalization. Cholesterol depletion with methyl-β-cyclodextrin reduced the association of the agonist-activated receptor into membrane rafts but did not affect either the UTP-mediated vasoconstrictions or the vasomotor responses elicited by both serotonin and KCl. Ex vivo perfusion of human chorionic artery segments with 1–10 μm UTP, a selective P2Y2R agonist, displaced the P2Y2R localization into membrane rafts within 1 min, a process preceded by the activation of both RhoA and Rac1 GTPases. AG1478, a selective and potent inhibitor of the epidermal growth factor receptor tyrosine kinase activity, not only blocked the UTP-induced vasomotor activity but also abrogated both RhoA and Rac1 activation, the P2Y2R association with membrane rafts, and its internalization. Altogether, these results show for the first time that the plasma membrane distribution of the P2Y2R is transregulated by the epidermal growth factor receptor, revealing an unsuspected functional interplay that controls both the membrane distribution and the vasomotor activity of the P2Y2R in intact human blood vessels. PMID:19996104

  4. Selective peroxidation and externalization of phosphatidylserine in normal human epidermal keratinocytes during oxidative stress induced by cumene hydroperoxide.


    Shvedova, Anna A; Tyurina, Julia Y; Kawai, Kazuaki; Tyurin, Vladimir A; Kommineni, Choudari; Castranova, Vincent; Fabisiak, James P; Kagan, Valerian E


    Reactive oxygen species not only modulate important signal transduction pathways, but also induce DNA damage and cytotoxicity in keratinocytes. Hydrogen peroxide and organic peroxides are particularly important as these chemicals are widely used in dermally applied cosmetics and pharmaceuticals, and also represent endogenous metabolic intermediates. Lipid peroxidation is of fundamental interest in the cellular response to peroxides, as lipids are extremely sensitive to oxidation and lipid-based signaling systems have been implicated in a number of cellular processes, including apoptosis. Oxidation of specific phospholipid classes was measured in normal human epidermal keratinocytes exposed to cumene hydroperoxide after metabolic incorporation of the fluorescent oxidation-sensitive fatty acid, cis-parinaric acid, using a fluorescence high-performance liquid chromatography assay. In addition, lipid oxidation was correlated with changes in membrane phospholipid asymmetry and other markers of apoptosis. Although cumene hydroperoxide produced significant oxidation of cis-parinaric acid in all phospholipid classes, one phospholipid, phosphatidylserine, appeared to be preferentially oxidized above all other species. Using fluorescamine derivatization and annexin V binding it was observed that specific oxidation of phosphatidylserine was accompanied by phosphatidylserine translocation from the inner to the outer plasma membrane surface where it may serve as a recognition signal for interaction with phagocytic macrophages. These effects occurred much earlier than any detectable changes in other apoptotic markers such as caspase-3 activation, DNA fragmentation, or changes in nuclear morphology. Thus, normal human epidermal keratinocytes undergo profound lipid oxidation with preference for phosphatidylserine followed by phosphatidylserine externalization upon exposure to cumene hydroperoxide. It is therefore likely that normal human epidermal keratinocytes exposed to similar

  5. Photoprotective Potential of Glycolic Acid by Reducing NLRC4 and AIM2 Inflammasome Complex Proteins in UVB Radiation-Induced Normal Human Epidermal Keratinocytes and Mice.


    Hung, Sung-Jen; Tang, Sheau-Chung; Liao, Pei-Yun; Ge, Jheng-Siang; Hsiao, Yu-Ping; Yang, Jen-Hung


    Exposure to UVB radiation induces inflammation and free radical-mediated oxidative stress through reactive oxygen species (ROS) that play a crucial role in the induction of skin cancer. Glycolic acid (GA) is frequently used in cosmetics and dermatology. The aim of the study was to analyze the photoprotective mechanisms through which GA retards UVB-induced ROS accumulation and inflammation in normal human epidermal keratinocytes (NHEKs) and mice skin, respectively. NHEK cell line and C57BL/6J mice were treated with GA (0.1 or 5 mM) for 24 h followed by UVB irradiation. ROS accumulation, DNA damage, and expression of inflammasome complexes (NLRP3, NLRC4, ASC, and AIM2) were measured in vitro. Epidermal thickness and inflammasome complex proteins were analyzed in vivo. GA significantly prevented UVB-induced loss of skin cell viability, ROS formation, and DNA damage (single and double strands DNA break). GA suppressed the mRNA expression levels of NLRC4 and AIM2 among the inflammasome complexes. GA also blocked interleukin (IL)-1β by reducing the activity of caspase-1 in the NHEKs. Treatment with GA (2%) inhibited UVB-induced inflammation marker NLRC4 protein levels in mouse dorsal skin. The photoprotective activity of GA was ascribed to the inhibition of ROS formation and DNA damage, as well as a reduction in the activities of inflammasome complexes and IL-1β. We propose that GA has anti-inflammatory and photoprotective effects against UVB irradiation. GA is potentially beneficial to the protection of human skin from UV damage.

  6. Photochemopreventive effect of pomegranate fruit extract on UVA-mediated activation of cellular pathways in normal human epidermal keratinocytes.


    Syed, Deeba N; Malik, Arshi; Hadi, Naghma; Sarfaraz, Sami; Afaq, Farrukh; Mukhtar, Hasan


    UVA is the major portion (90-99%) of solar radiation reaching the surface of the earth and has been described to lead to formation of benign and malignant tumors. UVA-mediated cellular damage occurs primarily through the release of reactive oxygen species and is responsible for immunosuppression, photodermatoses, photoaging and photocarcinogenesis. Pomegranate fruit extract (PFE) possesses strong antioxidant and anti-inflammatory properties. Our recent studies have shown that PFE treatment of normal human epidermal keratinocytes (NHEK) inhibits UVB-mediated activation of MAPK and NF-kappaB pathways. Signal transducers and activators of transcription 3 (STAT3), Protein Kinase B/AKT and Map Kinases (MAPKs), which are activated by a variety of factors, modulate cell proliferation, apoptosis and other biological activities. The goal of this study was to determine whether PFE affords protection against UVA-mediated activation of STAT3, AKT and extracellular signal-regulated kinase (ERK1/2). Immunoblot analysis demonstrated that 4 J/cm2 of UVA exposure to NHEK led to an increase in phosphorylation of STAT3 at Tyr705, AKT at Ser473 and ERK1/2. Pretreatment of NHEK with PFE (60-100 microg/mL) for 24 h before exposure to UVA resulted in a dose-dependent inhibition of UVA-mediated phosphorylation of STAT3 at Tyr705, AKT at Ser473 and ERK1/2. mTOR, structurally related to PI3K, is involved in the regulation of p70S6K, which in turn phosphorylates the S6 protein of the 40S ribosomal subunit. We found that UVA radiation of NHEK resulted in the phosphorylation of mTOR at Thr2448 and p70S6K at Thr421/Ser424. PFE pretreatment resulted in a dose-dependent inhibition in the phosphorylation of mTOR at Thr2448 and p70S6K at Thr421/Ser424. Our data further demonstrate that PFE pretreatment of NHEK resulted in significant inhibition of UVA exposure-mediated increases in Ki-67 and PCNA. PFE pretreatment of NHEK was found to increase the cell-cycle arrest induced by UVA in the G1 phase of

  7. Development of a bioengineered skin-humanized mouse model for psoriasis: dissecting epidermal-lymphocyte interacting pathways.


    Guerrero-Aspizua, Sara; García, Marta; Murillas, Rodolfo; Retamosa, Luisa; Illera, Nuria; Duarte, Blanca; Holguín, Almudena; Puig, Susana; Hernández, Maria Isabel; Meana, Alvaro; Jorcano, Jose Luis; Larcher, Fernando; Carretero, Marta; Del Río, Marcela


    Over the past few years, whole skin xenotransplantation models that mimic different aspects of psoriasis have become available. However, these models are strongly constrained by the lack of skin donor availability and homogeneity. We present in this study a bioengineering-based skin-humanized mouse model for psoriasis, either in an autologous version using samples derived from psoriatic patients or, more importantly, in an allogeneic context, starting from skin biopsies and blood samples from unrelated healthy donors. After engraftment, the regenerated human skin presents the typical architecture of normal human skin but, in both cases, immunological reconstitution through intradermal injection in the regenerated skin using in vitro-differentiated T1 subpopulations as well as recombinant IL-17 and IL-22 Th17 cytokines, together with removal of the stratum corneum barrier by a mild abrasive treatment, leads to the rapid conversion of the skin into a bona fide psoriatic phenotype. Major hallmarks of psoriasis were confirmed by the evaluation of specific epidermal differentiation and proliferation markers as well as the mesenchymal milieu, including angiogenesis and infiltrate. Our bioengineered skin-based system represents a robust platform to reliably assess the molecular and cellular mechanisms underlying the complex interdependence between epidermal cells and the immune system. The system may also prove suitable to assess preclinical studies that test the efficacy of novel therapeutic treatments and to predict individual patient response to therapy.

  8. Transcriptional profiling of epidermal differentiation.


    Radoja, Nada; Gazel, Alix; Banno, Tomohiro; Yano, Shoichiro; Blumenberg, Miroslav


    In epidermal differentiation basal keratinocytes detach from the basement membrane, stop proliferating, and express a new set of structural proteins and enzymes, which results in an impermeable protein/lipid barrier that protects us. To define the transcriptional changes essential for this process, we purified large quantities of basal and suprabasal cells from human epidermis, using the expression of beta4 integrin as the discriminating factor. The expected expression differences in cytoskeletal, cell cycle, and adhesion genes confirmed the effective separation of the cell populations. Using DNA microarray chips, we comprehensively identify the differences in genes expressed in basal and differentiating layers of the epidermis, including the ECM components produced by the basal cells, the proteases in both the basal and suprabasal cells, and the lipid and steroid metabolism enzymes in suprabasal cells responsible for the permeability barrier. We identified the signaling pathways specific for the two populations and found two previously unknown paracrine and one juxtacrine signaling pathway operating between the basal and suprabasal cells. Furthermore, using specific expression signatures, we identified a new set of late differentiation markers and mapped their chromosomal loci, as well as a new set of melanocyte-specific markers. The data represent a quantum jump in understanding the mechanisms of epidermal differentiation.

  9. Bystander killing effect of DS-8201a, a novel anti-human epidermal growth factor receptor 2 antibody-drug conjugate, in tumors with human epidermal growth factor receptor 2 heterogeneity.


    Ogitani, Yusuke; Hagihara, Katsunobu; Oitate, Masataka; Naito, Hiroyuki; Agatsuma, Toshinori


    Antibody-drug conjugates deliver anticancer agents selectively and efficiently to tumor tissue and have significant antitumor efficacy with a wide therapeutic window. DS-8201a is a human epidermal growth factor receptor 2 (HER2)-targeting antibody-drug conjugate prepared using a novel linker-payload system with a potent topoisomerase I inhibitor, exatecan derivative (DX-8951 derivative, DXd). It was effective against trastuzumab emtansine (T-DM1)-insensitive patient-derived xenograft models with both high and low HER2 expression. In this study, the bystander killing effect of DS-8201a was evaluated and compared with that of T-DM1. We confirmed that the payload of DS-8201a, DXd (1), was highly membrane-permeable whereas that of T-DM1, Lys-SMCC-DM1, had a low level of permeability. Under a coculture condition of HER2-positive KPL-4 cells and negative MDA-MB-468 cells in vitro, DS-8201a killed both cells, whereas T-DM1 and an antibody-drug conjugate with a low permeable payload, anti-HER2-DXd (2), did not. In vivo evaluation was carried out using mice inoculated with a mixture of HER2-positive NCI-N87 cells and HER2-negative MDA-MB-468-Luc cells by using an in vivo imaging system. In vivo, DS-8201a reduced the luciferase signal of the mice, indicating suppression of the MDA-MB-468-Luc population; however, T-DM1 and anti-HER2-DXd (2) did not. Furthermore, it was confirmed that DS-8201a was not effective against MDA-MB-468-Luc tumors inoculated at the opposite side of the NCI-N87 tumor, suggesting that the bystander killing effect of DS-8201a is observed only in cells neighboring HER2-positive cells, indicating low concern in terms of systemic toxicity. These results indicated that DS-8201a has a potent bystander effect due to a highly membrane-permeable payload and is beneficial in treating tumors with HER2 heterogeneity that are unresponsive to T-DM1.

  10. De novo epidermal regeneration using human eccrine sweat gland cells: higher competence of secretory over absorptive cells.


    Pontiggia, Luca; Biedermann, Thomas; Böttcher-Haberzeth, Sophie; Oliveira, Carol; Braziulis, Erik; Klar, Agnieszka S; Meuli-Simmen, Claudia; Meuli, Martin; Reichmann, Ernst


    In our previous work, we showed that human sweat gland-derived epithelial cells represent an alternative source of keratinocytes to grow a near normal autologous epidermis. The role of subtypes of sweat gland cells in epidermal regeneration and maintenance remained unclear. In this study, we compare the regenerative potential of both secretory and absorptive sweat gland cell subpopulations. We demonstrate the superiority of secretory over absorptive cells in forming a new epidermis on two levels: first, the proliferative and colony-forming efficiencies in vitro are significantly higher for secretory cells (SCs), and second, SCs show a higher frequency of successful epidermis formation as well as an increase in the thickness of the formed epidermis in the in vitro and in vivo functional analyses using a 3D dermo-epidermal skin model. However, the ability of forming functional skin substitutes is not limited to SCs, which supports the hypothesis that multiple subtypes of sweat gland epithelial cells hold regenerative properties, while the existence and exact localization of a keratinocyte stem cell population in the human eccrine sweat gland remain elusive.

  11. International prevalidation studies of the EpiDerm 3D human reconstructed skin micronucleus (RSMN) assay: transferability and reproducibility.


    Aardema, Marilyn J; Barnett, Brenda C; Khambatta, Zubin; Reisinger, Kerstin; Ouedraogo-Arras, Gladys; Faquet, Brigitte; Ginestet, Anne-Claire; Mun, Greg C; Dahl, Erica L; Hewitt, Nicola J; Corvi, Raffallea; Curren, Rodger D


    Recently, a novel in vitro reconstructed skin micronucleus (RSMN) assay incorporating the EpiDerm 3D human skin model (Curren et al., Mutat. Res. 607 (2006) 192-204; Mun et al., Mutat. Res. 673 (2009) 92-99) has been shown to produce comparable data when utilized in three different laboratories in the United States (Hu et al., Mutat. Res. 673 (2009) 100-108). As part of a project sponsored by the European cosmetics companies trade association (COLIPA), with a contribution from the European Center for the Validation of Alternative Methods (ECVAM), international prevalidation studies of the RSMN assay have been initiated. The assay was transferred and optimized in two laboratories in Europe, where dose-dependent, reproducibly positive results for mitomycin C and vinblastine sulfate were obtained. Further intra- and inter-laboratory reproducibility of the RSMN assay was established by testing three coded chemicals, N-ethyl-N-nitrosourea, cyclohexanone, and mitomycin C. All chemicals were correctly identified by all laboratories as either positive or negative. These results support the international inter-laboratory and inter-experimental reproducibility of the assay and reinforce the conclusion that the RSMN assay in the EpiDerm 3D human skin model is a valuable in vitro method for assessment of genotoxicity of dermally applied chemicals.

  12. Connexin expression in epidermal cell lines from SENCAR mouse skin tumors.


    Budunova, I V; Carbajal, S; Viaje, A; Slaga, T J


    Alteration of gap-junctional intercellular communication (GJIC) has long been proposed to be involved in carcinogenesis. Previously, we reported that the level of gap junctional intercellular communication in mouse skin carcinoma cell lines is significantly lower than in papilloma cell lines and normal mouse keratinocytes Klann et al., Cancer Res 49:699-705, 1989). Here, we present data on expression of the gap-junctional protein connexins (Cx) 26, Cx31.1, and Cx43 in a comprehensive panel of keratinocyte cell lines representing different stages of mouse skin carcinogenesis and the effect of different conditions of propagation on Cx phenotype. Northern and western blot analyses and immunostaining showed that all cell lines studied in vitro expressed Cx43 but most did not express Cx31.1 or Cx26. The abundance of Cx43 expression on plasma membranes correlated well with the level of GJIC. In vivo expression of Cx43 and Cx26 was strongly increased. Whereas none of tumorigenic cell lines expressed Cx26 gap junctions in culture, those growing as tumors in nude mice began to express Cx26 protein. The comparison of Cx expression on the keratinocyte membranes in three different groups of tumors (papillomas and squamous cell and spindle cell carcinomas) clearly revealed that the abundance of Cx43 and Cx26 expression directly correlated with the level of tumor differentiation. All studied tumors were Cx31.1 negative. These results suggest that both Cx expression and gap-junction permeability are gradually reduced during the tumor progression stage of mouse skin carcinogenesis.

  13. Human keratinocyte growth factor effects in a porcine model of epidermal wound healing

    PubMed Central

    Staiano-Coico, L.; Krueger, J. G.; Rubin, J. S.; D'limi, S.; Vallat, V. P.; Valentino, L.; Fahey, T.; Hawes, A.; Kingston, G.; Madden, M. R.; Mathwich, M.; Gottlieb, A.; Aaronson, S. A.


    Keratinocyte growth factor (KGF) is a member of the fibroblast growth factor (FGF) family (hence the alternative designation FGF-7). It is produced by stromal cells, but acts as a mitogen for epithelial cells. We examined the effects of topically applied KGF on healing of wounds in a porcine model. In partial-thickness wounds, KGF stimulated the rate of reepithelialization (p < 0.0002), associated with a thickening of the epidermis (p < 0.0001). Epidermis from KGF-treated full-thickness wound sites was significantly thicker (0.31 +/- 0.22 mm) compared with mirror image control sites (0.18 +/- 0.12 mm) (p < 0.0001). Moreover, the majority (77%) of KGF-treated wounds exhibited epidermis with a deep rete ridge pattern as compared with control sites. These effects were observed as early as 14 d and persisted for at least 4 wk. KGF treatment also increased the number of serrated basal cells associated with increased deposition of collagen fibers in the superficial dermis adjacent to the acanthotic epidermis. Electron microscopy revealed better developed hemidesmosomes associated with thicker bundles of tonofilaments in the serrated cells. The pattern of epidermal thickening observed in KGF-treated wounds resembled psoriasis. Psoriasis is a disease associated with epidermal thickening, parakeratosis as well as hyperproliferation that extends beyond the basal layer. In striking contrast to psoriasis, KGF-treated wounds exhibited normal orthokeratotic maturation, and proliferation was localized to the basal cells. Our present findings have significant implications concerning the role of KGF as a paracrine modulator of epidermal proliferation and differentiation. PMID:8350059

  14. Epidermal growth factor regulates Mcl-1 expression through the MAPK-Elk-1 signalling pathway contributing to cell survival in breast cancer.


    Booy, E P; Henson, E S; Gibson, S B


    Myeloid cell leukaemia-1 (Mcl-1) is an anti-apoptotic member of the Bcl-2 family that is elevated in a variety of tumour types including breast cancer. In breast tumours, increased Mcl-1 expression correlates with high tumour grade and poor patient survival. We have previously demonstrated that Her-2 levels correspond to increased Mcl-1 expression in breast tumours. Epidermal growth factor (EGF) receptor signalling is frequently deregulated in breast cancer and leads to increased proliferation and survival. Herein, we determined the critical downstream signals responsible for the EGF mediated increase of Mcl-1 and their role in cell survival. We found that both Mcl-1 mRNA and protein levels are rapidly induced upon stimulation with EGF. Promoter analysis revealed that an Elk-1 transcription factor-binding site is critical for EGF activation of the Mcl-1 promoter. Furthermore, we found that knockdown of Elk-1 or inhibition of the Erk signalling pathway was sufficient to block EGF upregulation of Mcl-1 and EGF mediated cell survival. Using chromatin immunoprecipitation and biotin labelled probes of the Mcl-1 promoter, we found that Elk-1 and serum response factor are bound to the promoter after EGF stimulation. To determine whether Mcl-1 confers a survival advantage, we found that knockdown of Mcl-1 expression increased apoptosis whereas overexpression of Mcl-1 inhibited drug induced cell death. In human breast tumours, we found a correlation between phosphorylated Elk-1 and Mcl-1 protein levels. These results indicate that the EGF induced activation of Elk-1 is an important mediator of Mcl-1 expression and cell survival and therefore a potential therapeutic target in breast cancer.

  15. Effects of dietary supplementation with epidermal growth factor-expressing Saccharomyces cerevisiae on duodenal development in weaned piglets.


    Wang, Shujin; Guo, Chunhua; Zhou, Lin; Zhong, Zhendong; Zhu, Wuzheng; Huang, Yanling; Zhang, Zhengfan; Gorgels, Theo G M F; Berendschot, Tos T J M


    The aim of the present study was to assess the effects of dietary supplementation with epidermal growth factor (EGF)-expressing Saccharomyces cerevisiae on duodenal development in weaned piglets. In total, forty piglets weaned at 21-26 d of age were assigned to one of the five groups that were provided basic diet (control group) or diet supplemented with S. cerevisiae expressing either empty-vector (INVSc1(EV) group), tagged EGF (T-EGF) (INVSc1-TE(-) group), extracellular EGF (EE-EGF) (INVSc1-EE(+) group) or intracellular EGF (IE-EGF) (INVSc1-IE(+) group). All treatments were delivered as 60·00 μg/kg body weight EGF/d. On 0, 7, 14 and 21 d, eight piglets per treatment were sacrificed to analyse the morphology, activities and mRNA expressions of digestive enzymes, as well as Ig levels (IgA, IgM, IgG) in duodenal mucosa. The results showed significant improvement on 7, 14 and 21 d, with respect to average daily gain (P<0·05), mucosa morphology (villus height and crypt depth) (P<0·05), Ig levels (P<0·01), activities and mRNA expressions of digestive enzymes (creatine kinase, alkaline phosphatase, lactate dehydrogenase and sucrase) (P<0·05) and the mRNA expression of EGF-receptor (P<0·01) in NVSc1-TE(-), INVSc1-EE(+) and INVSc1-IE(+) groups compared with control and INVSc1(EV) groups. In addition, a trend was observed in which the INVSc1-IE(+) group showed an improvement in Ig levels (0·05expressions of digestive enzymes and EGF-receptor (P<0·05) compared with NVSc1-TE(-) and INVSc1-EE(+) groups. These results indicate that supplementing recombinant EGF-expressing S. cerevisiae to the diet of weaned piglets enhanced duodenal development. Moreover, biological activity (Ig levels, mRNA expressions of digestive enzymes and EGF-receptor) of IE-EGF was better than either EE-EGF or T-EGF.

  16. GATA3 Expression in Normal Skin and in Benign and Malignant Epidermal and Cutaneous Adnexal Neoplasms.


    Mertens, Richard B; de Peralta-Venturina, Mariza N; Balzer, Bonnie L; Frishberg, David P


    Initial investigations reported GATA3 to be a sensitive and relatively specific marker for mammary and urothelial carcinomas. Recently, GATA3 expression has been described in several other epithelial tumors. However, there has been only limited investigation of GATA3 expression in cutaneous epithelial tumors. The objective of this study was to examine the immunohistochemical expression of GATA3 in a wide variety of cutaneous epithelial neoplasms. GATA3 expression was evaluated in 99 benign and 63 malignant cutaneous epithelial tumors. GATA3 was consistently and usually strongly expressed in clear cell acanthoma, trichofolliculoma, trichoepithelioma, trichilemmoma, sebaceous adenoma, sebaceoma, apocrine hidrocystoma, apocrine tubular papillary adenoma, hidradenoma papilliferum, and syringocystadenoma papilliferum. Hidradenomas exhibited variable positive staining. Most poromas, syringomas, chondroid syringomas, cylindromas, and spiradenomas were negative or only focally and weakly positive. Focal staining was present in all pilomatrixomas. Thirteen of 14 basal cell carcinomas, 21 of 24 squamous carcinomas, and all 6 sebaceous carcinomas exhibited positive staining. The 1 apocrine carcinoma, both mucinous carcinomas, and 2 of 3 microcystic adnexal carcinomas also exhibited positive staining, whereas the 1 eccrine porocarcinoma and the 1 adenoid cystic carcinoma were negative. One of 11 Merkel cell carcinomas exhibited focal weak staining. Our findings demonstrate that GATA3 is expressed in a wide variety of benign and malignant cutaneous epithelial neoplasms. In addition to carcinomas of breast and urothelial origin and other more recently described GATA3-positive tumors, the differential diagnosis of a metastatic tumor of unknown primary origin that expresses GATA3 should also include a carcinoma of cutaneous epithelial origin.

  17. Malignant progression of an SV40-transformed human epidermal keratinocyte cell line.

    PubMed Central

    Brown, K. W.; Gallimore, P. H.


    Human foetal keratinocytes were transfected with a recombinant plasmid (pSV6-1) which contained an origin defective SV40 genome. The resulting transformed cell line had many properties in common with previously described SV40-transformed keratinocytes, including expression of simple epithelial-type keratins. It was non-tumourigenic in nude mice at early passages, forming small benign cysts, however, after approximately 46 in vitro passages, these transformed keratinocytes formed invasive squamous cell carcinomas in athymic nude mice. Several in vitro changes were associated with this acquisition of tumourigenicity (a) an alteration in cellular morphology, (b) development of a cytogenetically marked clone and (c) loss of cell surface fibronectin. The loss of fibronectin was also observed in vivo; cysts formed by SV6-1 Bam/HFK produced human fibronectin whereas tumours did not, although both tumours and cysts were laminin- and keratin-positive. These results indicate that the spontaneous development of secondary events in immortalised human cells may lead to the acquisition of a malignant phenotype. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:2447927

  18. Human Cytomegalovirus Requires Epidermal Growth Factor Receptor Signaling To Enter and Initiate the Early Steps in the Establishment of Latency in CD34(+) Human Progenitor Cells.


    Kim, Jung Heon; Collins-McMillen, Donna; Buehler, Jason C; Goodrum, Felicia D; Yurochko, Andrew D


    The establishment of human cytomegalovirus (HCMV) latency and persistence relies on the successful infection of hematopoietic cells, which serve as sites of viral persistence and contribute to viral spread. Here, using blocking antibodies and pharmacological inhibitors, we document that HCMV activation of the epidermal growth factor receptor (EGFR) and downstream phosphatidylinositol 3-kinase (PI3K) mediates viral entry into CD34(+) human progenitor cells (HPCs), resulting in distinct cellular trafficking and nuclear translocation of the virus compared to that in other immune cells, such as we have documented in monocytes. We argue that the EGFR allows HCMV to regulate the cellular functions of these replication-restricted cells via its signaling activity following viral binding. In addition to regulating HCMV entry/trafficking, EGFR signaling may also shape the early steps required for the successful establishment of viral latency in CD34(+) cells, as pharmacological inhibition of EGFR increases the transcription of lytic IE1/IE2 mRNA while curbing the expression of latency-associated UL138 mRNA. EGFR signaling following infection of CD34(+) HPCs may also contribute to changes in hematopoietic potential, as treatment with the EGFR kinase (EGFRK) inhibitor AG1478 alters the expression of the cellular hematopoietic cytokine interleukin 12 (IL-12) in HCMV-infected cells but not in mock-infected cells. These findings, along with our previous work with monocytes, suggest that EGFR likely serves as an important determinant of HCMV tropism for select subsets of hematopoietic cells. Moreover, our new data suggest that EGFR is a key receptor for efficient viral entry and that the ensuing signaling regulates important early events required for successful infection of CD34(+) HPCs by HCMV.IMPORTANCE HCMV establishes lifelong persistence within the majority of the human population without causing overt pathogenesis in healthy individuals. Despite this, reactivation of HCMV

  19. Dnmt3a and Dnmt3b Associate with Enhancers to Regulate Human Epidermal Stem Cell Homeostasis.


    Rinaldi, Lorenzo; Datta, Debayan; Serrat, Judit; Morey, Lluis; Solanas, Guiomar; Avgustinova, Alexandra; Blanco, Enrique; Pons, José Ignacio; Matallanas, David; Von Kriegsheim, Alex; Di Croce, Luciano; Benitah, Salvador Aznar


    The genome-wide localization and function of endogenous Dnmt3a and Dnmt3b in adult stem cells are unknown. Here, we show that in human epidermal stem cells, the two proteins bind in a histone H3K36me3-dependent manner to the most active enhancers and are required to produce their associated enhancer RNAs. Both proteins prefer super-enhancers associated to genes that either define the ectodermal lineage or establish the stem cell and differentiated states. However, Dnmt3a and Dnmt3b differ in their mechanisms of enhancer regulation: Dnmt3a associates with p63 to maintain high levels of DNA hydroxymethylation at the center of enhancers in a Tet2-dependent manner, whereas Dnmt3b promotes DNA methylation along the body of the enhancer. Depletion of either protein inactivates their target enhancers and profoundly affects epidermal stem cell function. Altogether, we reveal novel functions for Dnmt3a and Dnmt3b at enhancers that could contribute to their roles in disease and tumorigenesis.

  20. Effects of low frequency electromagnetic field on proliferation of human epidermal stem cells: An in vitro study.


    Zhang, Mingsheng; Li, Xinping; Bai, Liming; Uchida, Kenzo; Bai, Wenfang; Wu, Bo; Xu, Weicheng; Zhu, Hongxiang; Huang, Hong


    To investigate the effects of low frequency electromagnetic fields (EMF) on the proliferation of epidermal stem cells, human epidermal stem cells (hESC) were isolated, expanded ex vivo, and then exposed to a low frequency EMF. The test and control cells were placed under the same environment. The test cells were exposed for 30 min/day to a 5 mT low frequency EMF at 1, 10, and 50 Hz for 3, 5, or 7 days. The effects of low frequency EMF on cell proliferation, cell cycle, and cell-surface antigen phenotype were investigated. Low frequency EMF significantly enhanced the proliferation of hESC in the culture medium in a frequency-dependent manner, with the highest cell proliferation rate at 50 Hz (P < 0.05). Exposure to a low frequency EMF significantly increased the percentage of cells at the S phase of the cell cycle, coupled with a decrease in the percentage of cells in the G1 phase (P < 0.05) but the effect was not frequency dependent. The percentage of CD29(+) /CD71(-) cells remained unchanged in the low frequency EMF-exposed hESC. The results suggested that low frequency EMF influenced hESC proliferation in vitro, and this effect was related to the increased proportion of cells at the S phase.

  1. Proteomic assessment of sulfur mustard-induced protein adducts and other protein modifications in human epidermal keratinocytes

    SciTech Connect

    Mol, Marijke A.E. Berg, Roland M. van den; Benschop, Henk P.


    Although some toxicological mechanisms of sulfur mustard (HD) have been uncovered, new knowledge will allow for advanced insight in the pathways that lead towards epidermal-dermal separation in skin. In the present investigation, we aimed to survey events that occur at the protein level in human epidermal keratinocytes (HEK) during 24 h after exposure to HD. By using radiolabeled {sup 14}C-HD, it was found that proteins in cultured HEK are significant targets for alkylation by HD. HD-adducted proteins were visualized by two-dimensional gel electrophoresis and analyzed by mass spectrometry. Several type I and II cytokeratins, actin, stratifin (14-3-3{sigma}) and galectin-7 were identified. These proteins are involved in the maintenance of the cellular cytoskeleton. Their alkylation may cause changes in the cellular architecture and, in direct line with that, be determinative for the onset of vesication. Furthermore, differential proteomic analysis was applied to search for novel features of the cellular response to HD. Partial breakdown of type I cytokeratins K14, K16 and K17 as well as the emergence of new charge variants of the proteins heat shock protein 27 and ribosomal protein P0 were observed. Studies with caspase inhibitors showed that caspase-6 is probably responsible for the breakdown of type I cytokeratins in HEK. The significance of the results is discussed in terms of toxicological relevance and possible clues for therapeutic intervention.

  2. In vitro invasion of small-cell lung cancer cell lines correlates with expression of epidermal growth factor receptor.

    PubMed Central

    Damstrup, L.; Rude Voldborg, B.; Spang-Thomsen, M.; Brünner, N.; Skovgaard Poulsen, H.


    Formation of metastasis is a multistep process involving attachment to the basement membrane, local proteolysis and migration into surrounding tissues, lymph or bloodstream. In the present study, we have analysed the correlation between in vitro invasion and presence of the epidermal growth factor receptor (EGFR) in a panel of 21 small-cell lung cancer (SCLC) cell lines. We have previously reported that ten of these cell lines expressed EGFR protein detected by radioreceptor and affinity labelling assays. In 11 small-cell lung cancer (SCLC) cell lines, EGFR mRNA was detected by Northern blot analysis. In vitro invasion in a Boyden chamber assay was found in all EGFR-positive cell lines, whereas no invasion was detected in the EGFR-negative cell lines. Quantification of the in vitro invasion in 12 selected SCLC cell lines demonstrated that, in the EGFR-positive cell lines, between 5% and 16% of the cells added to the upper chamber were able to traverse the Matrigel membrane. Expression of several matrix metalloproteases (MMP), of tissue inhibitor of MMP (TIMP) and of cathepsin B was evaluated by immunoprecipitation, Western blot analysis and reverse transcriptase polymerase chain reaction (RT-PCR). However, in vitro invasive SCLC cell lines could not be distinguished from non-invasive cell lines based on the expression pattern of these molecules. In six SCLC cell lines, in vitro invasion was also determined in the presence of the EGFR-neutralizing monoclonal antibody mAb528. The addition of this antibody resulted in a significant reduction of the in vitro invasion in three selected EGFR-positive cell lines. Our results show that only EGFR-positive SCLC cell lines had the in vitro invasive phenotype, and it is therefore suggested that the EGFR might play an important role for the invasion potential of SCLC cell lines. Images Figure 1 Figure 3 Figure 4 PMID:9744504

  3. Epidermal CD147 expression plays a key role in IL-22-induced psoriatic dermatitis

    PubMed Central

    Peng, Cong; Zhang, ShengXi; Lei, Li; Zhang, Xu; Jia, Xuekun; Luo, Zhongling; Huang, Xiaoyan; Kuang, Yanhong; Zeng, Weiqi; Su, Juan; Chen, Xiang


    Psoriasis is a chronic inflammatory skin disease characterized by abnormal keratinocyte proliferation and terminal differentiation. Interleukin-22 (IL-22) and the transcription factor Stat3 play pivotal roles in the pathogenesis of psoriasis. CD147 is a transmembrane glycosylation protein that belongs to the immunoglobulin superfamily. Our previous studies have shown that CD147 is a marker of high keratinocyte proliferation and poor keratinocyte differentiation as well as a psoriasis susceptibility gene. The current study demonstrates that CD147 is highly expressed in psoriatic skin lesions. Specific CD147 over-expression in the epidermis of K5-promoter transgenic mice promotes imiquimod (IMQ)-induced psoriasis-like inflammation characterized by acanthosis, granular layer loss and inflammatory cell infiltration. We also found that IL-22 increases CD147 transcription in vitro and in vivo and that Stat3 binds directly to the CD147 promoter between positions −854 and −440, suggesting that CD147 expression is up-regulated in patients with psoriasis through Stat3 activation. In addition, CD147 knockdown dramatically blocks IL-22-mediated Stat3 activation as well as IL-22-induced cytokine, chemokine and antimicrobial factor expression. Together, these findings show that CD147 is a novel and key mediator of IL-22-induced psoriatic alterations in the epidermis and might be a therapeutic target in patients with psoriasis. PMID:28272440

  4. Epidermal growth factor receptor gene amplification and protein expression in glioblastoma multiforme: prognostic significance and relationship to other prognostic factors.


    Layfield, Lester J; Willmore, Carlynn; Tripp, Sheryl; Jones, Claudia; Jensen, Randy L


    Epidermal growth factor receptor (EGFR) overexpression occurs in a significant percentage of cases of glioblastoma multiforme (GBM), and amplification has been found in approximately 40% of these neoplasms. Controversy exists as to the prognostic significance of EGFR gene amplification: some reports have indicated that amplification is associated with a poor prognosis, while other authors have reported no relationship between gene amplification and prognosis. Some reports have found a poor prognosis to be associated with amplification of the EGFR gene in patients of all ages with GBM, while other authors have found EGFR amplification to be an independent predictor of prolonged survival in patients with GBM who are older than 60 years of age. The authors studied a series of 34 specimens (32 patients) with histologically proven GBM by immunohistochemistry for the presence of EGFR overexpression and by fluorescence in situ hybridization (FISH) for gene amplification of the EGFR gene. Results of these studies and data on patient age, sex, functional status, therapy, and survival were correlated to determine which variables were predictive of survival. p53 expression was also determined by immunohistochemistry and correlated with the other variables and survival.

  5. Synergistic and multidimensional regulation of plasminogen activator inhibitor type 1 expression by transforming growth factor type β and epidermal growth factor

    SciTech Connect

    Song, Xiaoling; Thalacker, F.W.; Nilsen-Hamilton, Marit


    The major physiological inhibitor of plasminogen activator, type I plasminogen activator inhibitor (PAI-1), controls blood clotting and tissue remodeling events that involve cell migration. Transforming growth factor type β (TGFβ) and epidermal growth factor (EGF) interact synergistically to increase PAI-1 mRNA and protein levels in human HepG2 and mink Mv1Lu cells. Other growth factors that activate tyrosine kinase receptors can substitute for EGF. EGF and TGFβ regulate PAI-1 by synergistically activating transcription, which is further amplified by a decrease in the rate of mRNA degradation, the latter being regulated only by EGF. The combined effect of transcriptional activation and mRNA stabilization results in a rapid 2-order of magnitude increase in the level of PAI-1. TGFβ also increases the sensitivity of the cells to EGF, thereby recruiting the cooperation of EGF at lower than normally effective concentrations. The contribution of EGF to the regulation of PAI-1 involves the MAPK pathway, and the synergistic interface with the TGFβ pathway is downstream of MEK1/2 and involves phosphorylation of neither ERK1/2 nor Smad2/3. Synergism requires the presence of both Smad and AP-1 recognition sites in the promoter. This work demonstrates the existence of a multidimensional cellular mechanism by which EGF and TGFβ are able to promote large and rapid changes in PAI-1 expression.

  6. Human Lacrimal Gland Gene Expression

    PubMed Central

    Aakalu, Vinay Kumar; Parameswaran, Sowmya; Maienschein-Cline, Mark; Bahroos, Neil; Shah, Dhara; Ali, Marwan; Krishnakumar, Subramanian


    Background The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development. Methods We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium. Results The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described. Conclusions Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas. PMID:28081151


    EPA Science Inventory

    Chronic arsenic exposure in humans is associated with cancers of the skin, lung, and bladder. There is evidence that folate deficiency may increase susceptibility to arsenic¿s effects, including arsenic-induced skin lesions. K6/ODC mice develop skin tumors when exposed to 10 ppm ...

  8. The role of keratin subfamilies and keratin pairs in the formation of human epidermal intermediate filaments

    PubMed Central


    The four major keratins of normal human epidermis (molecular mass 50, 56.5, 58, and 65-67 kD) can be subdivided on the basis of charge into two subfamilies (acidic 50-kD and 56.5-kD keratins vs. relatively basic 58-kD and 65-67-kD keratins) or subdivided on the basis of co- expression into two "pairs" (50-kD/58-kD keratin pair synthesized by basal cells vs. 56.5-kD/65-67-kD keratin pair expressed in suprabasal cells). Acidic and basic subfamilies were separated by ion exchange chromatography in 8.5 M urea and tested for their ability to reassemble into 10-nm filaments in vitro. The two keratins in either subfamily did not reassemble into 10-nm filaments unless combined with members of the other subfamily. While electron microscopy of acidic and basic keratins equilibrated in 4.5 M urea showed that keratins within each subfamily formed distinct oligomeric structures, possibly representing precursors in filament assembly, chemical cross-linking followed by gel analysis revealed dimers and larger oligomers only when subfamilies were combined. In addition, among the four major keratins, the acidic 50-kD and basic 58-kD keratins showed preferential association even in 8.5 M urea, enabling us to isolate a 50-kD/58-kD keratin complex by gel filtration. This isolated 50-kD/58-kD keratin pair readily formed 10-nm filaments in vitro. These results demonstrate that in tissues containing multiple keratins, two keratins are sufficient for filament assembly, but one keratin from each subfamily is required. More importantly, these data provide the first evidence for the structural significance of specific co-expressed acidic/basic keratin pairs in the formation of epithelial 10-nm filaments. PMID:2422179

  9. Expression of Epidermal c-Kit+ of Vitiligo Lesions Is Related to Responses to Excimer Laser

    PubMed Central

    Park, Oun Jae; Han, Ji Su; Lee, Sang Hyung; Park, Chan-Sik; Won, Chong Hyun; Lee, Mi Woo; Choi, Jee Ho


    Background The survival and growth of melanocytes are controlled by the binding of stem cell factor to its cell surface receptor c-kit+ (CD117). We have observed that c-kit+ melanocytes existed in some lesions of vitiligo, while Melan A+ cells were absent. Objective To verify possible relation between c-kit+ expression and treatment response in non-segmental vitiligo lesions Methods Skin biopsies were done from the center of the 47 lesions from the 47 patients with non-segmental vitiligo. Expression of c-kit+ and Melan A, and amounts of melanin in the epidermis were assessed in each lesion, and treatment responses to excimer laser were evaluated. Results Thirty-five of the 47 lesions (74.5%) had c-kit+ phenotypes. There was significant difference of c-kit staining value between good responders in 3 months of excimer laser treatment (average of 24 sessions) and the others. Conclusion c-Kit expression in vitiliginous epidermis may be related to better treatment responses to excimer laser. PMID:27489428

  10. Knuckle pads, in an epidermal palmoplantar keratoderma patient with Keratin 9 R163W transgrediens expression.


    Codispoti, Andrea; Colombo, Enrico; Zocchi, Loredana; Serra, Valeria; Pertusi, Ginevra; Leigheb, Giorgio; Tiberio, Rossana; Bornacina, Guido; Zuccoli, Riccardo; Ramponi, Antonio; Campione, Elena; Melino, Gerry; Terrinoni, Alessandro


    Epidermolytic PalmoPlantar keratoderma (EPPK) Vörner-type is an autosomal dominantly inherited skin disease, characterized by severe thickening of the palms and soles, caused by mutations in the keratin K9 (KRT9) gene. To date, a number of KRT9 mutations have been detected, most of which affect the highly conserved 1A region of the central alpha-helical domain, important for keratin heterodimerization. The most common mutation is the substitution of the arginine in position 163 with a tryptophan (R163W), which has been reported in North American, European, and Japanese populations. In a small number of cases, EPPK is associated with knuckle pad keratosis, but no correlation between this additional phenotype and a specific mutation has been found. Moreover, K9 is not normally expressed in knuckle skin, raising the question of the pathogenic mechanism leading to this additional phenotype. Here we show that in a family affected by EPPK and knuckle pad keratosis, carrying the R163W substitution, wild type (wt) and mutated K9 are strongly expressed in knuckle pads. These results suggest that the knuckle pad phenotype is due to ectopical expression of K9.

  11. Cloning and sequence analysis of human breast epithelial antigen BA46 reveals an RGD cell adhesion sequence presented on an epidermal growth factor-like domain.


    Couto, J R; Taylor, M R; Godwin, S G; Ceriani, R L; Peterson, J A


    The BA46 antigen of the human milk fat globule (HMFG) membrane is expressed in human breast carcinomas and has been used successfully as a target for experimental breast cancer radioimmunotherapy. To characterize this antigen further, we obtained the entire cDNA sequence and focused on its possible role in cell adhesion. The derived protein sequence of BA46 encodes a 387-residue precursor composed of a putative signal peptide, an amino-terminal epidermal growth factor (EGF)-like domain containing the cell adhesion tripeptide arginine-glycine-aspartic acid (RGD), and human factor V and factor VIII C1/C2-like domains. The EGF-like domain of BA46 is similar to the calcium-binding EGF-like domains of several coagulation factors, but the BA46 domain lacks a residue required for calcium binding and the coagulation factor domains do not include an RGD sequence. Assuming that all EGF-like domains fold into a similar structure, the RGD-containing sequence in BA46 is inserted between two antiparallel beta strands. This positioning suggests a novel function for the EGF-like domain as a scaffold for RGD presentation.

  12. Mammary phenotypic expression induced in epidermal cells by embryonic mammary mesenchyme.


    Cunha, G R; Young, P; Christov, K; Guzman, R; Nandi, S; Talamantes, F; Thordarson, G


    The goal of this research was to establish methods for inducing mammary epithelial differentiation from nonmammary epithelium. For this purpose, mid-ventral or dorsal epidermis (skin epithelium; SKE) from 13-day rat or mouse embryos was associated with 13-day embryonic mouse mammary mesenchyme (mammary gland mesenchyme; MGM) (mouse MGM+rat or mouse SKE). The resultant MGM+SKE recombinants as well as controls (homotypic mouse mammary recombinants, homotypic mouse skin recombinants and mouse mammary mesenchyme by itself) were grafted under the renal capsule of syngeneic or athymic female nude mouse hosts. Most female hosts were induced to undergo lactogenesis by grafting an adult pituitary which elicited a state of hyperprolactinemia. Tissue recombinants of mouse MGM+rat or mouse SKE grown for 1 month in vivo formed a hair-bearing keratinized skin from which mammary ductal structures extended into the mesenchyme. The ducts were composed of columnar luminal epithelial cells as well as basal, actin-positive myoepithelial cells. When grown in pituitary-grafted hosts, the ductal epithelial cells expressed casein and alpha-lactalbumin as judged by immunocytochemistry. The expression of caseins in MGM+SKE recombinants was confirmed by Western blot. The epithelial cells in mouse MGM+rat SKE recombinants expressing milk proteins were shown to be rat cells while the surrounding connective tissue was composed of mouse cells based upon staining with Hoechst dye 33258. Using mammary-specific markers, these studies confirmed the earlier morphological studies of Propper and unequivocally demonstrated for the first time that embryonic mammary mesenchyme can induce morphological and functional mammary differentiation from nonmammary epithelium.

  13. Quantification of epidermal growth factor receptor expression level and binding kinetics on cell surfaces by surface plasmon resonance imaging.


    Zhang, Fenni; Wang, Shaopeng; Yin, Linliang; Yang, Yunze; Guan, Yan; Wang, Wei; Xu, Han; Tao, Nongjian


    Epidermal growth factor receptor (EGFR, also known as ErbB-1 or HER-1) is a membrane bound protein that has been associated with a variety of solid tumors and the control of cell survival, proliferation, and metabolism. Quantification of the EGFR expression level in cell membranes and the interaction kinetics with drugs are thus important for cancer diagnosis and treatment. Here we report mapping of the distribution and interaction kinetics of EGFR in their native environment with the surface plasmon resonance imaging (SPRi) technique. The monoclonal anti-EGFR antibody was used as a model drug in this study. The binding of the antibody to EGFR overexpressed A431 cells was monitored in real time, which was found to follow the first-order kinetics with an association rate constant (ka) and dissociation rate constant (kd) of (2.7 ± 0.6) × 10(5) M(-1) s(-1) and (1.4 ± 0.5) × 10(-4) s(-1), respectively. The dissociation constant (KD) was determined to be 0.53 ± 0.26 nM with up to seven-fold variation among different individual A431 cells. In addition, the averaged A431 cell surface EGFR density was found to be 636/μm(2) with an estimation of 5 × 10(5) EGFR per cell. Additional measurement also revealed that different EGFR positive cell lines (A431, HeLa, and A549) show receptor density dependent anti-EGFR binding kinetics. The results demonstrate that SPRi is a valuable tool for direct quantification of membrane protein expression level and ligand binding kinetics at single cell resolution. Our findings show that the local environment affects the drug-receptor interactions, and in situ measurement of membrane protein binding kinetics is important.

  14. Heparin-binding epidermal growth factor-like growth factor/diphtheria toxin receptor expression by acute myeloid leukemia cells.


    Vinante, F; Rigo, A; Papini, E; Cassatella, M A; Pizzolo, G


    Heparin-binding epidermal growth factor-like growth factor (HB-EGF) is an EGF family member expressed by numerous cell types that binds to EGF receptor 1 (HER-1) or 4 (HER-4) inducing mitogenic and/or chemotactic activities. Membrane-bound HB-EGF retains growth activity and adhesion capabilities and the unique property of being the receptor for diphtheria toxin (DT). The interest in studying HB-EGF in acute leukemia stems from these mitogenic, chemotactic, and receptor functions. We analyzed the expression of HB-EGF in L428, Raji, Jurkat, Karpas 299, L540, 2C8, HL-60, U937, THP-1, ML-3, and K562 cell lines and in primary blasts from 12 acute myeloid leukemia (AML) cases, by reverse-transcriptase polymerase chain reaction (RT-PCR) and Northern blot and by the evaluation of sensitivity to DT. The release of functional HB-EGF was assessed by evaluation of its proliferative effects on the HB-EGF-sensitive Balb/c 3T3 cell line. HB-EGF was expressed by all myeloid and T, but not B (L428, Raji), lymphoid cell lines tested, as well as by the majority (8 of 12) of ex vivo AML blasts. Cell lines (except for the K562 cell line) and AML blasts expressing HB-EGF mRNA underwent apoptotic death following exposure to DT, thus demonstrating the presence of the HB-EGF molecule on their membrane. Leukemic cells also released a fully functional HB-EGF molecule that was mitogenic for the Balb/c 3T3 cell line. Factors relevant to the biology of leukemic growth, such as tumor necrosis factor-alpha (TNF-alpha), 1alpha,25-(OH)2D3, and especially all-trans retinoic acid (ATRA), upregulated HB-EGF mRNA in HL-60 or ML-3 cells. Granulocyte-macrophage colony-stimulating factor (GM-CSF) induced HB-EGF mRNA and acquisition of sensitivity to DT in one previously HB-EGF-negative leukemia case. Moreover, the U937 and Karpas 299 cell lines expressed HER-4 mRNA. This work shows that HB-EGF is a growth factor produced by primary leukemic cells and regulated by ATRA, 1alpha, 25-(OH)2D3, and GM-CSF.

  15. Current status of anti-human epidermal growth factor receptor 2 therapies: predicting and overcoming herceptin resistance.


    Chung, Alice; Cui, Xiaojiang; Audeh, William; Giuliano, Armando


    Human epidermal growth factor receptor 2-overexpressing (HER2+) breast cancer occurs in 20% to 25% of cases and is associated with poor prognosis. Trastuzumab (Herceptin; Genentech, South San Francisco, CA) is a monoclonal antibody targeting the HER2 extracellular domain that has been shown to significantly reduce relapse rates. However, some patients with HER2+ tumors do not respond to Herceptin, and 60% to 85% of patients with HER2+ metastatic breast cancer acquire resistance within a short time period. In this review, we discuss proposed mechanisms of action of trastuzumab and trastuzumab resistance and various drugs that have been developed to overcome drug resistance. We introduce the basal molecular subtype as a predictor of increased risk in HER2+ breast cancer and a possible alternative cause of drug resistance.

  16. Structural conversion from non-native to native form of recombinant human epidermal growth factor by Brevibacillus choshinensis.


    Miyauchi, A; Ozawa, M; Mizukami, M; Yashiro, K; Ebisu, S; Tojo, T; Fujii, T; Takagi, H


    Brevibacillus choshinensis (Bacillus brevis) HPD31 is a very efficient producer of recombinant human epidermal growth factor (EGF). The produced EGF is secreted into the medium with high efficiency. However part of the EGF that accumulates in the medium, exists as multimeric forms which are biologically inactive. We found the bacterium has the activity to structurally convert multimeric forms to the monomeric, native ones. Optimal temperature and pH for the conversion were 40 degrees C and pH 9, respectively. The reaction was promoted in the presence of reduced glutathione or cysteine. But the cells which had been sonicated or exposed to moderate heat treatment completely lost the activity. Thus, it was presumed that the activity might be due to the enzyme(s) that catalyze the protein disulfide exchanging reaction, and that they resides on the surface of viable cells.

  17. Receptor-purified, Bolton-Hunter radioiodinated, recombinant, human epidermal growth factor: An improved radioligand for receptor studies

    SciTech Connect

    Kermode, J.C.; Tritton, T.R. )


    We report an assessment of the applicability of the Bolton-Hunter method to the radioiodination of epidermal growth factor (EGF). Recombinant human EGF (hEGF) could be radioiodinated successfully by this method, whereas murine EGF could not. Bolton-Hunter {sup 125}I-labeled hEGF was compared with commercial 125I-labeled hEGF prepared by the chloramine-T radioiodination method. Neither radioligand was sufficiently pure for a detailed characterization of the purportedly heterogeneous pattern of binding of EGF to its receptors. A procedure based on receptor adsorption was thus developed for repurification of the Bolton-Hunter 125I-labeled hEGF. This provided a much purer radioligand suitable for detailed studies of receptor-binding heterogeneity.

  18. Expression Levels of Some Antioxidant and Epidermal Growth Factor Receptor Genes in Patients with Early-Stage Non-Small Cell Lung Cancer

    PubMed Central

    De Palma, Giuseppe; Mozzoni, Paola; Acampa, Olga; Internullo, Eveline; Carbognani, Paolo; Rusca, Michele; Goldoni, Matteo; Corradi, Massimo; Tiseo, Marcello; Apostoli, Pietro; Mutti, Antonio


    This study was aimed at: (i) investigating the expression profiles of some antioxidant and epidermal growth factor receptor genes in cancerous and unaffected tissues of patients undergoing lung resection for non-small cell lung cancer (NSCLC) (cross-sectional phase), (ii) evaluating if gene expression levels at the time of surgery may be associated to patients' survival (prospective phase). Antioxidant genes included heme oxygenase 1 (HO-1), superoxide dismutase-1 (SOD-1), and -2 (SOD-2), whereas epidermal growth factor receptor genes consisted of epidermal growth factor receptor (EGFR) and v-erb-b2 erythroblastic leukaemia viral oncogene homolog 2 (HER-2). Twenty-eight couples of lung biopsies were obtained and gene transcripts were quantified by Real Time RT-PCR. The average follow-up of patients lasted about 60 months. In the cancerous tissues, antioxidant genes were significantly hypo-expressed than in unaffected tissues. The HER-2 transcript levels prevailed in adenocarcinomas, whereas EGFR in squamocellular carcinomas. Patients overexpressing HER-2 in the cancerous tissues showed significantly lower 5-year survival than the others. PMID:20700416


    EPA Science Inventory

    Matrix Metalloproteinase (MMP)-Mediated Phosphorylation of The Epidermal Growth Factor Receptor (EGFR) in Human Airway Epithelial Cells (HAEC) Exposed to Zinc (Zn)
    Weidong Wu, James M. Samet, Robert Silbajoris, Lisa A. Dailey, Lee M. Graves, and Philip A. Bromberg
    Center fo...

  20. Blockade of Ets-1 attenuates epidermal growth factor-dependent collagen loss in human carotid plaque smooth muscle cells.


    Rao, Velidi H; Rai, Vikrant; Stoupa, Samantha; Agrawal, Devendra K


    Although degradation of extracellular matrix by matrix metalloproteinases (MMPs) is thought to be involved in symptomatic (S) carotid plaques in atherosclerosis, the mechanisms of MMP expression are poorly understood. Here, we demonstrate that collagen loss in vascular smooth vessel cells (VSMCs) isolated from S plaques was induced by epidermal growth factor (EGF) through the activation of p38-MAPK and JNK-MAPK pathways. Inhibitors of p38-MAPK and JNK-MAPK signaling pathways downregulated the expression of MMP-1 and MMP-9. In addition, we examined whether v-ets erythroblastosis virus E26 oncogene homologue 1 (Ets-1), an important regulator of different genes, is involved in destabilizing S plaques in patients with carotid stenosis. We demonstrate that EGF induces Ets-1 expression and decreases interstitial and basement membrane collagen in vascular smooth muscle cells (VSMCs) from patients with carotid stenosis. Increased expression of MMP-1 and -9 and decreased collagen mRNA transcripts were also found in Ets-1-overexpressed VSMCs. Transfection with both dominant-negative form of Ets-1 and small interfering RNA blocked EGF-induced MMP-1 and -9 expressions and increased the mRNA transcripts for collagen I (α1) and collagen III (α1) in S compared with asymptomatic (AS) carotid plaques. Inhibitors of p38-MAPK (SB202190) and JNK-MAPK (SP600125) signaling pathways decreased the expression of Ets-1, MMP-1, and MMP-9 and increased collagen type I and III expression in EGF-treated VSMCs. This study provides a mechanistic insight into the role of Ets-1 in the plaque destabilization in patients with carotid stenosis involving p38-MAPK and JNK signaling pathways.

  1. Characterization of human and mouse peroxiredoxin IV: evidence for inhibition by Prx-IV of epidermal growth factor- and p53-induced reactive oxygen species.


    Wong, C M; Chun, A C; Kok, K H; Zhou, Y; Fung, P C; Kung, H F; Jeang, K T; Jin, D Y


    The aim of this study was to identify and characterize human and mouse Prx-IV. We identified mouse peroxiredoxin IV (Prx-IV) by virtue of sequence homology to its human ortholog previously called AOE372. Mouse Prx-IV conserves an amino-terminal presequence coding for signal peptide. The amino acid sequences of mature mouse and human Prx-IV share 97.5% identity. Phylogenetic analysis demonstrates that Prx-IV is more closely related to Prx-I/-II/-III than to Prx-V/-VI. Previously, we mapped the mouse Prx-IV gene to chromosome X by analyzing two sets of multiloci genetic crosses. Here we performed further comparative analysis of mouse and human Prx-IV genomic loci. Consistent with the mouse results, human Prx-IV gene localized to chromosome Xp22.135-136, in close proximity to SAT and DXS7178. A bacterial artificial chromosome (BAC) clone containing the complete human Prx-IV locus was identified. The size of 7 exons and the sequences of the splice junctions were confirmed by PCR analysis. We conclude that mouse Prx-IV is abundantly expressed in many tissues. However, we could not detect Prx-IV in the conditioned media of NIH-3T3 and Jurkat cells. Mouse Prx-IV was specifically found in the nucleus-excluded region of cultured mouse cells. Intracellularly, overexpression of mouse Prx-IV prevented the production of reactive oxygen species induced by epidermal growth factor or p53. Taken together, mouse Prx-IV is likely a cytoplasmic or organellar peroxiredoxin involved in intracellular redox signaling.

  2. Effect of Standardized Boesenbergia pandurata Extract and Its Active Compound Panduratin A on Skin Hydration and Barrier Function in Human Epidermal Keratinocytes

    PubMed Central

    Woo, Seon Wook; Rhim, Dong-Bin; Kim, Changhee; Hwang, Jae-Kwan


    The skin plays a key role in protecting the body from the environment and from water loss. Cornified envelope (CE) and natural moisturizing factor (NMF) are considered as the primary regulators of skin hydration and barrier function. The CE prevents loss of water from the body and is formed by cross-linking of several proteins. Among these proteins, filaggrin is an important protein because NMF is produced by the degradation of filaggrin. Proteases, including matriptase and prostasin, stimulate the generation of filaggrin from profilaggrin and caspase-14 plays a role in the degradation of filaggrin. This study elucidated the effects of an ethanol extract of Boesenbergia pandurata (Roxb.) Schltr., known as fingerroot, and its active compound panduratin A on CE formation and filaggrin processing in HaCaT, human epidermal keratinocytes. B. pandurata extract (BPE) and panduratin A significantly stimulated not only CE formation but also the expression of CE proteins, such as loricrin, involucrin, and transglutaminase, which were associated with PPARα expression. The mRNA and protein levels of filaggrin and filaggrin-related enzymes, such as matriptase, prostasin, and caspase-14 were also up-regulated by BPE and panduratin A treatment. These results suggest that BPE and panduratin A are potential nutraceuticals which can enhance skin hydration and barrier function based on their CE formation and filaggrin processing. PMID:25866745

  3. Novel epidermal growth factor receptor pathway mediates release of human β-defensin 3 from Helicobacter pylori-infected gastric epithelial cells.


    Muhammad, Jibran S; Zaidi, Syed F; Zhou, Yue; Sakurai, Hiroaki; Sugiyama, Toshiro


    Persistent Helicobacter pylori (H. pylori) infection in hostile gastric mucosa can result in gastric diseases. Helicobacter pylori induces to express antimicrobial peptides from gastric epithelial cells, especially human β-defensin 3 (hBD3), as an innate immune response, and this expression of hBD3 is mediated by epidermal growth factor receptor (EGFR) activation. In this study, we found that phosphorylation of a serine residue of EGFR via transforming growth factor β-activated kinase-1 (TAK1), and subsequent p38α activation is essential for H. pylori-induced hBD3 release from gastric epithelial cells. We showed that this pathway was dependent on H. pylori type IV secretion system and was independent of H. pylori-derived CagA or peptidoglycan. H. pylori infection induced phosphorylation of serine residue of EGFR, and this phosphorylation was followed by internalization of EGFR; consequently, hBD3 was released at an early phase of the infection. In the presence of TAK1 or p38α inhibitors, synthesis of hBD3 was completely inhibited. Similar results were observed in EGFR-, TAK1- or p38α-knockdown cells. However, NOD1 knockdown in gastric epithelial cells did not inhibit hBD3 induction. Our study has firstly demonstrated that this novel EGFR activating pathway functioned to induce hBD3 at an early phase of H. pylori infection.

  4. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    PubMed Central

    Dang, N.N.; Pang, S.G.; Song, H.Y.; An, L.G.; Ma, X.L.


    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response. PMID:25493381

  5. Growth suppression of human hepatocellular carcinoma xenografts by a monoclonal antibody CH12 directed to epidermal growth factor receptor variant III.


    Jiang, Hua; Wang, Huamao; Tan, Zhonghua; Hu, Suwen; Wang, Hai; Shi, Bizhi; Yang, Lin; Li, Peiyong; Gu, Jianren; Wang, Hongyang; Li, Zonghai


    Human hepatocellular carcinoma (HCC) is considered difficult to cure because it is resistant to radio- and chemotherapy and has a high recurrence rate after curative liver resection. Epidermal growth factor receptor variant III (EGFRvIII) has been reported to express in HCC tissues and cell lines. This article describes the efficacy of an anti-EGFRvIII monoclonal antibody (mAb CH12) in the treatment of HCC xenografts with EGFRvIII expression and the underlying mechanism of EGFRvIII as an oncogene in HCC. The results demonstrated that CH12 bound preferentially to EGFRvIII with a dissociation constant (K(d)) of 1.346 nm/liter. In addition, CH12 induces strong antibody-dependent cellular cytotoxicity and complement-dependent cytotoxicity in Huh7-EGFRvIII (with exogenous expression of EGFRvIII) and SMMC-7721 (with endogenous expression of EGFRvIII) cells. Notably, CH12 significantly inhibited the growth of Huh7-EGFRvIII and SMMC-7721 xenografts in vivo with a growth inhibition ratio much higher than C225, a U. S. Food and Drug Administration-approved anti-EGFR antibody. Treatment of the two HCC xenografts with CH12 significantly suppressed tumor proliferation and angiogenesis. Mechanistically, in vivo treatment with CH12 reduced the phosphorylation of constitutively active EGFRvIII, Akt, and ERK. Down-regulation of the apoptotic protectors Bcl-x(L), Bcl-2, and the cell cycle regulator cyclin D1, as well as up-regulation of the cell-cycle inhibitor p27, were also observed after in vivo CH12 treatment. Collectively, these results indicate that the monoclonal antibody CH12 is a promising therapeutic agent for HCC with EGFRvIII expression.

  6. Growth Suppression of Human Hepatocellular Carcinoma Xenografts by a Monoclonal Antibody CH12 Directed to Epidermal Growth Factor Receptor Variant III*

    PubMed Central

    Jiang, Hua; Wang, Huamao; Tan, Zhonghua; Hu, Suwen; Wang, Hai; Shi, Bizhi; Yang, Lin; Li, Peiyong; Gu, Jianren; Wang, Hongyang; Li, Zonghai


    Human hepatocellular carcinoma (HCC) is considered difficult to cure because it is resistant to radio- and chemotherapy and has a high recurrence rate after curative liver resection. Epidermal growth factor receptor variant III (EGFRvIII) has been reported to express in HCC tissues and cell lines. This article describes the efficacy of an anti-EGFRvIII monoclonal antibody (mAb CH12) in the treatment of HCC xenografts with EGFRvIII expression and the underlying mechanism of EGFRvIII as an oncogene in HCC. The results demonstrated that CH12 bound preferentially to EGFRvIII with a dissociation constant (Kd) of 1.346 nm/liter. In addition, CH12 induces strong antibody-dependent cellular cytotoxicity and complement-dependent cytotoxicity in Huh7-EGFRvIII (with exogenous expression of EGFRvIII) and SMMC-7721 (with endogenous expression of EGFRvIII) cells. Notably, CH12 significantly inhibited the growth of Huh7-EGFRvIII and SMMC-7721 xenografts in vivo with a growth inhibition ratio much higher than C225, a U. S. Food and Drug Administration-approved anti-EGFR antibody. Treatment of the two HCC xenografts with CH12 significantly suppressed tumor proliferation and angiogenesis. Mechanistically, in vivo treatment with CH12 reduced the phosphorylation of constitutively active EGFRvIII, Akt, and ERK. Down-regulation of the apoptotic protectors Bcl-xL, Bcl-2, and the cell cycle regulator cyclin D1, as well as up-regulation of the cell-cycle inhibitor p27, were also observed after in vivo CH12 treatment. Collectively, these results indicate that the monoclonal antibody CH12 is a promising therapeutic agent for HCC with EGFRvIII expression. PMID:21163950

  7. Role of iron in inactivation of epidermal growth factor receptor after asbestos treatment of human lung and pleural target cells.


    Baldys, Aleksander; Aust, Ann E


    Although the mechanism by which asbestos causes cancer remains unknown, iron associated with asbestos is thought to play a role in the pathogenic effects of fibers. Here, we examined the effects of asbestos on the epidermal growth factor receptor (EGFR) in human lung epithelial (A549) cells, human pleural mesothelial (MET5A) cells, and normal human small airway epithelial (SAEC) cells. Treatment of A549, MET5A, and SAEC cells with asbestos caused a significant reduction of EGFR tyrosine phosphorylation. This was both time- (15 min to 24 h) and concentration-dependent (1.5, 3, and 6 mug/cm(2)) in A549 cells. Also, treatment with 6 mug/cm(2) crocidolite for 24 h diminished the phosphorylation levels of human EGFR 2 (HER2). Exposure of A549 cells to 6 mug/cm(2) crocidolite for 3-24 h resulted in no detectable Y1045 phosphorylation and no apparent degradation of the EGFR. Inhibition of fiber endocytosis resulted in a considerable inhibition of EGFR dephosphorylation. Removal of iron from asbestos by desferrioxamine B or phytic acid inhibited asbestos-induced decreases in EGFR phosphorylation. The effects of crocidolite, amosite, and chrysotile on the EGFR phosphorylation state appeared to be directly related to the amount of iron mobilized from these fibers. These results strongly suggest that iron plays an important role in asbestos-induced inactivation of EGFR.

  8. Temozolomide induces the production of epidermal growth factor to regulate MDR1 expression in glioblastoma cells.


    Munoz, Jessian L; Rodriguez-Cruz, Vivian; Greco, Steven J; Nagula, Vipul; Scotto, Kathleen W; Rameshwar, Pranela


    Glioblastoma multiforme (GBM) commonly resists the frontline chemotherapy treatment temozolomide. The multidrug resistance gene (MDR1) and its protein, P-glycoprotein (P-gp), are associated with chemoresistance. This study investigated the mechanisms underlying MDR1-mediated resistance by GBM to temozolomide. P-gp trafficking was studied by flow cytometry and Western blot analysis. MDR1 expression was analyzed by real-time PCR and reporter gene assays. AP-1 interaction with MDR1 was studied by chromatin immunoprecipitation assay. EGF production was analyzed by ELISA, EGFR signaling was determined by Western blot analysis, and in vivo response to erlotinib and/or temozolomide was studied in nude mice. During the early phase of temozolomide treatment, intracellular P-gp was trafficked to the cell membrane, followed by conformational change into active P-gp. At the later phase, gene transcription of MDR1 was induced by temozolomide-mediated production of EGF. EGF activated ERK1/2-JNK-AP-1 cofactors (c-jun and c-fos). An inhibitor of EGFR kinase (erlotinib) given to nude mice with GBM prevented temozolomide-induced resistance. The results identified an essential role for activated EGFR in the resistance of GBM to temozolomide. Temozolomide resistance occurred through a biphasic response; first, by a conformational change in P-gp into the active form and, second, by releasing EGF, which caused autocrine stimulation of GBM cells to induce MDR1. Pharmacologic inhibition of EGFR kinase blunted the ability of GBM cells to resist temozolomide. These findings may explain reports on the common occurrence of mutant EGFR (EGFRvIII) and EGFR expansion in the resistance of GBM cells.

  9. Antitumor activity of a combination of trastuzumab (Herceptin) and oral fluoropyrimidine S-1 on human epidermal growth factor receptor 2-overexpressing pancreatic cancer.


    Saeki, Hiroyuki; Yanoma, Shunsuke; Takemiya, Shouji; Sugimasa, Yukio; Akaike, Makoto; Yukawa, Norio; Rino, Yasushi; Imada, Toshio


    The cytotoxic effect of trastuzumab in combination with oral fluoropyrimidine S-1 on human epidermal growth factor receptor 2 (HER2)-overexpressing human pancreatic cancer cell line TRG in vitro and in vivo was investigated. HER2 expression in TRG was analyzed by RT-PCR and flow cytometry. For in vitro experiments, 5-fluorouracil (5-FU) was used instead of S-1. In vivo studies were conducted with TRG xenografts in athymic mice. Trastuzumab (10 mg/kg) was administered intraperitoneally once a week for 4 weeks. S-1 (10 mg/kg) was administered orally 5 days a week for 4 weeks. The results showed that TRG cells were positive for HER2 mRNA and overexpressed HER2 protein. Either trastuzumab or 5-FU concentration-dependently inhibited the growth of TRG cells. The combination of trastuzumab and 5-FU resulted in a significant inhibition of growth of TRG cells compared to either agent alone (P<0.001). Incubation of TRG cells with peripheral blood mononuclear cells after treatment with trastuzumab enhanced the antiproliferative effect of trastuzumab, which could be the result of antibody-dependent cellular cytotoxicity. The combination of trastuzumab and S-1 resulted in a significant reduction in xenograft volume compared to each agent alone (P<0.0001). In conclusion, this study showed that combination therapy with trastuzumab and S-1 may be effective for HER2-overexpressing pancreatic cancer patients.

  10. Potentiation of epidermal growth factor receptor-mediated oncogenesis by c-Src: implications for the etiology of multiple human cancers.

    PubMed Central

    Maa, M C; Leu, T H; McCarley, D J; Schatzman, R C; Parsons, S J


    c-Src is a nontransforming tyrosine kinase that participates in signaling events mediated by a variety of polypeptide growth factor receptors, including the epidermal growth factor receptor (EGFR). Overexpression and continual ligand stimulation of the EGFR results in morphological transformation of cells in vitro and tumor development in vivo. Elevated levels of c-Src and the EGFR are found in a variety of human malignancies, raising the question of whether c-Src can functionally cooperate with the EGFR during tumorigenesis. To address this issue, we generated c-Src/EGFR double overexpressors and compared their proliferative and biochemical characteristics to those of single overexpressors and control cells. We found that in cells expressing high levels of receptor, c-Src potentiated DNA synthesis, growth in soft agar, and tumor formation in nude mice. Growth potentiation was associated with the formation of a heterocomplex between c-Src and activated EGFR, the appearance of a distinct tyrosyl phosphorylation on the receptor, and an enhancement of receptor substrate phosphorylation. These findings indicate that c-Src is capable of potentiating receptor-mediated tumorigenesis and suggest that synergism between c-Src and the EGFR may contribute to a more aggressive phenotype in multiple human tumors. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7542783

  11. Eicosopentaneoic Acid and Other Free Fatty Acid Receptor Agonists Inhibit Lysophosphatidic Acid- and Epidermal Growth Factor-Induced Proliferation of Human Breast Cancer Cells

    PubMed Central

    Hopkins, Mandi M.; Zhang, Zhihong; Liu, Ze; Meier, Kathryn E.


    Many key actions of ω-3 (n-3) fatty acids have recently been shown to be mediated by two G protein-coupled receptors (GPCRs) in the free fatty acid receptor (FFAR) family, FFA1 (GPR40) and FFA4 (GPR120). n-3 Fatty acids inhibit proliferation of human breast cancer cells in culture and in animals. In the current study, the roles of FFA1 and FFA4 were investigated. In addition, the role of cross-talk between GPCRs activated by lysophosphatidic acid (LPA), and the tyrosine kinase receptor activated by epidermal growth factor (EGF), was examined. In MCF-7 and MDA-MB-231 human breast cancer cell lines, both LPA and EGF stimulated proliferation, Erk activation, Akt activation, and CCN1 induction. LPA antagonists blocked effects of LPA and EGF on proliferation in MCF-7 and MDA-MB-231, and on cell migration in MCF-7. The n-3 fatty acid eicosopentaneoic acid inhibited LPA- and EGF-induced proliferation in both cell lines. Two synthetic FFAR agonists, GW9508 and TUG-891, likewise inhibited LPA- and EGF-induced proliferation. The data suggest a major role for FFA1, which was expressed by both cell lines. The results indicate that n-3 fatty acids inhibit breast cancer cell proliferation via FFARs, and suggest a mechanism involving negative cross-talk between FFARS, LPA receptors, and EGF receptor. PMID:26821052

  12. Eicosopentaneoic Acid and Other Free Fatty Acid Receptor Agonists Inhibit Lysophosphatidic Acid- and Epidermal Growth Factor-Induced Proliferation of Human Breast Cancer Cells.


    Hopkins, Mandi M; Zhang, Zhihong; Liu, Ze; Meier, Kathryn E


    Many key actions of ω-3 (n-3) fatty acids have recently been shown to be mediated by two G protein-coupled receptors (GPCRs) in the free fatty acid receptor (FFAR) family, FFA1 (GPR40) and FFA4 (GPR120). n-3 Fatty acids inhibit proliferation of human breast cancer cells in culture and in animals. In the current study, the roles of FFA1 and FFA4 were investigated. In addition, the role of cross-talk between GPCRs activated by lysophosphatidic acid (LPA), and the tyrosine kinase receptor activated by epidermal growth factor (EGF), was examined. In MCF-7 and MDA-MB-231 human breast cancer cell lines, both LPA and EGF stimulated proliferation, Erk activation, Akt activation, and CCN1 induction. LPA antagonists blocked effects of LPA and EGF on proliferation in MCF-7 and MDA-MB-231, and on cell migration in MCF-7. The n-3 fatty acid eicosopentaneoic acid inhibited LPA- and EGF-induced proliferation in both cell lines. Two synthetic FFAR agonists, GW9508 and TUG-891, likewise inhibited LPA- and EGF-induced proliferation. The data suggest a major role for FFA1, which was expressed by both cell lines. The results indicate that n-3 fatty acids inhibit breast cancer cell proliferation via FFARs, and suggest a mechanism involving negative cross-talk between FFARS, LPA receptors, and EGF receptor.

  13. Human epidermal Langerhans cells cointernalize by receptor-mediated endocytosis "nonclassical" major histocompatibility complex class I molecules (T6 antigens) and class II molecules (HLA-DR antigens).

    PubMed Central

    Hanau, D; Fabre, M; Schmitt, D A; Garaud, J C; Pauly, G; Tongio, M M; Mayer, S; Cazenave, J P


    HLA-DR and T6 surface antigens are expressed only by Langerhans cells and indeterminate cells in normal human epidermis. We have previously demonstrated that T6 antigens are internalized in Langerhans cells and indeterminate cells by receptor-mediated endocytosis. This process is induced by the binding of BL6, a monoclonal antibody directed against T6 antigens. In the present study, using a monoclonal antibody directed against HLA-DR antigens, on human epidermal cells in suspension, we show that the surface HLA-DR antigens are also internalized by receptor-mediated endocytosis in Langerhans and indeterminate cells. Moreover, using immunogold double labeling, we demonstrate that T6 and HLA-DR antigens are internalized through common coated regions of the membrane of Langerhans or indeterminate cells. The receptor-mediated endocytosis that is induced involves coated pits and vesicles, receptosomes, lysosomes, and also, in Langerhans cells, the Birbeck granules. Thus, T6 antigens, which are considered to be "unusual" or "nonclassical" major histocompatibility complex class I molecules, and the major histocompatibility complex class II molecules, HLA-DR, are internalized in Langerhans and indeterminate cells through common receptor-mediated endocytosis organelles. Images PMID:3106979

  14. Expression of epidermal growth factor receptor sequences as E. coli fusion proteins: applications in the study of tyrosine kinase function.


    Koland, J G; O'Brien, K M; Cerione, R A


    To investigate the functions of key domains of the epidermal growth factor receptor (EGFR), various EGFR-derived peptide sequences were expressed in Escherichia coli as glutathione S-transferase (GST) fusion proteins. The purified fusion proteins (GST-TK0-8) were tested as substrates for the tyrosine kinase activities of the EGFR and c-src. Both the GST-TK4 fusion protein, which contains the major C-terminal tyrosine autophosphorylation sites of the EGFR, and GST-TK7, which contains the connecting sequence between the EGFR kinase domain and the C-terminal autophosphorylation domain, were strongly phosphorylated by the EGFR and c-src. Hence the candidate tyrosine phosphorylation sites present in the connecting sequences of the EGFR, as well as the known autophosphorylation sites of the EGFR, can be phosphorylated by the two tyrosine kinases. The protein GST-TK7 was phosphorylated by c-src with a KM of 5-10 microM, which indicated a potential interaction between the connecting segment of the EGFR and the c-src kinase. The GST fusion proteins were also used to map the sites recognized by two anti-EGFR monoclonal antibodies and a polyclonal serum raised against an EGFR tyrosine kinase domain fragment. The recognition site of one monoclonal antibody was determined to be in a short sequence surrounding tyr1068, a primary site of autophosphorylation in the C-terminal domain of the receptor. The anti-peptide polyclonal serum recognized only sequences in the GST-TK7 fusion protein, and hence binds to the connecting sequence between the kinase core and the C-terminal domain. These antibodies will therefore be useful reagents for studying the function of two key structural elements of the EGFR tyrosine kinase. The GST-TK fusion proteins should have many other applications in the study of EGFR catalysis and mitogenic signalling.

  15. Growth performance of early-weaned pigs is enhanced by feeding epidermal growth factor-expressing Lactococcus lactis fermentation product.


    Bedford, Andrea; Huynh, Evanna; Fu, Molei; Zhu, Cuilan; Wey, Doug; de Lange, Cornelis; Li, Julang


    We have previously generated epidermal growth factor expressing Lactococcus lactis (EGF-LL) using bioengineering approach, and shown that feeding newly-weaned piglets EGF-LL improves digestive function. To address concerns over the use of genetically modified organisms (GMO), the objective of the current study was to investigate the effect of feeding the EGF-LL fermentation product, after removal of the genetically modified EGF-LL, on growth performance and intestine development of newly-weaned piglets. One hundred and twenty newly-weaned piglets were fed ad libitum according to a 2-phase feeding program. Four pens were assigned to each of three treatments: (1) complete EGF-LL fermentation product (Ferm), (2) supernatant of EGF-LL fermentation product, after removal of EGF-LL (Supern), or (3) blank M17GE media (Control). EGF-LL or its fermented supernatant was administrated to piglets in the first 3 weeks post-weaning; their growth performance was monitored throughout treatment, and for the following week. Daily body weight gain (254.8g vs. 200.5g) and Gain:Feed (0.541kg/kg vs. 0.454kg/kg) of pigs on the Supern group were significantly improved compared to that of Control, although no difference was observed between the Ferm and Control pigs. Intestinal sucrase activity was increased in Supern- compared to Control group (166.3±62.1 vs. 81.4±56.5nmol glucose released/mg protein; P<0.05). The lack of growth response with Ferm pigs may be attributed to an overload of bacteria (daily dose included 4.56×10(10)CFU/kg BW/day EGF-LL). These results suggest that GMO-free EGF-LL fermentation product is effective in increasing growth performance of early-weaned piglets.

  16. The effect of indomethacin on the secretion of human salivary epidermal growth factor.


    Gilchrist, W; Burkhalter, E; Eaton, C; Schaudies, R P; Maydonovitch, C; Andrada, F; Maged, A R; Wong, R K


    Ulceration associated with nonsteroidal anti-inflammatory drug (NSAID) use is a common problem in elderly patients. The postulated cause of NSAID ulceration is multifactorial but is probably related to the inhibition of the cyclo-oxygenase pathway and a subsequent decrease in mucosal prostaglandin levels. Epidermal growth factor (EGF), on the other hand, has been shown to be gastroprotective, stimulating DNA synthesis, and preventing ASA-induced gastric ulceration. Since EGF is important in gastric mucosal protection, we questioned whether the potential ulcerogenic properties of indomethacin were related in part to decreasing salivary EGF. Twenty healthy male volunteers with no gastrointestinal complaints received indomethacin 50 mg P.O. t.i.d. for 3 consecutive days. Saliva and serum were collected before indomethacin treatment and repeated 2 h after the last indomethacin dose. Stimulated salivary samples were collected for 15 min in fasted subjects and assayed for EGF, whereas serum indomethacin levels were determined by high-performance liquid chromatography. EGF levels significantly decreased by 33% after indomethacin (p < 0.03), and this decrement was linearly related to serum indomethacin concentrations (r = 0.58; p < 0.048). Salivary output did not change after indomethacin treatment. Based on this data, we concluded that indomethacin's ulcerogenic properties may be related to its prostaglandin inhibitory properties as well as its ability to decrease salivary EGF output.

  17. Platelet Derived Growth Factor-B and Human Epidermal Growth Factor Receptor-2 Polymorphisms in Gall Bladder Cancer.


    Mishra, Kumudesh; Behari, Anu; Kapoor, Vinay Kumar; Khan, M Salman; Prakash, Swayam; Agrawal, Suraksha


    Gall bladder cancer (GBC) is a gastro-intestinal cancer with high prevalence among north Indian women. Platelet derived growth factor-B (PDGFB) and human epidermal growth factor receptor-2 (HER2) may play roles in the etiology of GBC through the inflammation-hyperplasia-dysplasia-carcinoma pathway. To study the association of PDGFB and HER2 polymorphisms with risk of GBC, 200 cases and 300 controls were considered. PDGFB +286A>G and +1135A>C polymorphisms were investigated with an amplification refractory mutation system and the HER2 Ile655Val polymorphism by restriction fragment length polymorphism. Significant risk associations for PDGFB +286 GG (OR=5.25) and PDGFB +1135 CC (OR=3.19) genotypes were observed for GBC. Gender wise stratification revealed susceptibility for recessive models of PDGFB +1135A>C (OR=3.00) and HER2 Ile655Val (OR=2.52) polymorphisms among female GBC cases. GBC cases with gall stones were predisposed to homozygous +286 GG and +1135 CC genotypes. Significant risk associations were found for ACIle (OR=1.48), GAVal (OR=1.70), GAIle (OR=2.00) haplotypes with GBC cases and GCIle haplotype with female GBC cases (OR=10.37, P=<0.0001). Pair-wise linkage disequilibrium revealed negative associations among variant alleles. On multi-dimensional reduction analysis, a three factor model revealed significant gene-gene interaction for PDGFB +286A>G, PDGFB +1135A>C and HER2 Ile165Val SNPs with GBC. Protein-protein interaction showed significant association of PDGFB and HER2 with the epidermal growth factor receptor signaling pathway.

  18. Effects of epidermal growth factor and platelet-derived growth factor on c-fos and c-myc mRNA levels in normal human fibroblasts

    SciTech Connect

    Paulsson, Y.; Bywater, M.; Westermark, B. ); Heldin, C.H. )


    The mRNA levels of two proto-oncogenes, c-fos and c-myc, were determined in human foreskin fibroblasts exposed to epidermal growth factor (EGF) or platelet-derived growth factor (PDGF) in a serum-free, defined medium (MCDB 104). Untreated, quiescent cells were found to have low or undetectable levels of c-fos and c-myc mRNA. Within 10 min after the addition of EGF or PDGF the c-fos mRNA level increased, reached a peak at 30 min, and then declined to the control level after 60 min. The level of c-myc mRNA increased somewhat later and peaked after 8 h in cultures treated with either of the growth factors. The c-myc mRNA level remained elevated throughout the 24 h of investigation. The concentrations of EGF and PDGF required for a maximal effect on c-fos or c-myc expression were found to be similar to those that give maximal effect on cell proliferation. Both c-fos and c-myc mRNA expression were superinduced by the addition of cycloheximide. The present results conform to the view that the c-fos and c-myc proto-oncogenes may be important (or necessary) but not sufficient for the initiation of DNA synthesis. Moreover, the finding that both EGF and PDGF increase c-fos and c-myc expression supports the previous suggestion that these two growth factors may in part act via a common intracellular pathway in the prereplicative phase of human fibroblasts.

  19. Tumor-promoting phorbol diesters cause the phosphorylation of epidermal growth factor receptors in normal human fibroblasts at threonine-654.

    PubMed Central

    Davis, R J; Czech, M P


    The effect of tumor-promoting phorbol diesters to potentiate the action of epidermal growth factor (EGF) on cell proliferation is associated with phosphorylation of EGF receptors, acute depression of EGF binding, and inhibition of EGF receptor tyrosine kinase activity. In the present studies, normal human fibroblasts and A431 carcinoma cells were labeled with [32P]phosphate and treated with and without 10 nM 4 beta-phorbol 12 beta-myristate 13 alpha-acetate (PMA). The EGF receptors then were isolated by immunoprecipitation and digested with trypsin. Analysis of the labeled receptor phosphopeptides by reversed-phase HPLC revealed that PMA induces the phosphorylation of a unique phosphopeptide containing [32P]phosphothreonine. Comparison of several chemical and physical properties of the 32P-labeled phosphopeptide with the primary structure of the EGF receptor suggested the identify Lys-Arg-Thr(P)-Leu-Arg. This was confirmed by direct demonstration that a synthetic peptide of this structure comigrates during HPLC and electrophoresis with the 32P-labeled phosphopeptide isolated from the EGF receptors of normal human fibroblasts. The phosphorylated site on the peptide corresponds to threonine-654 of the EGF receptor, which is located on the cytoplasmic side of the plasma membrane nine residues distant from the transmembrane domain. These data indicate that phosphorylation of the EGF receptor in human fibroblasts and A431 cells at threonine-654 may regulate the EGF receptor tyrosine kinase activity and the binding of EGF. Images PMID:2984676

  20. Highly sensitive detection of cancer antigen human epidermal growth factor receptor 2 using novel chicken egg yolk immunoglobulin.


    Sun, Yong; Yang, Yiheng; Wang, Lifen; Lv, Li; Zhu, Jie; Han, Wenqi; Wang, Enxia; Guo, Xin; Zhen, Yuhong


    Human epidermal growth factor receptor 2 (HER2) is an important biomarker that plays a crucial role in therapeutic decision-making for breast cancer patients. Ensuring the accuracy and reproducibility of HER2 assays by enzyme-linked immunosorbent assay (ELISA), western blot and immunohistochemistry (IHC) requires high sensitive and specific antibodies. Immunoglobulin Y (IgY) is a kind of avian antibody usually isolated from chicken egg yolks. Generation and use of IgY is of increasing interest in a wide variety of applications within the life sciences. In this study, IgY antibodies against two different truncated proteins of the extracellular domain (ECD) of human HER2 were produced, their sensitivity and specificity were evaluated. Specific IgYs were produced by hens immunized with the ECD proteins of human HER2 in long-standing immunization response and were isolated from yolks with a purity of 90% by water dilution, salt precipitations and ultrafiltration. The anti-HER2 IgYs were analytically validated for specificity by ELISA, western blot, immunocytochemistry and IHC. The IgYs bound desired targets in cells and fixed tissues and showed high affinity to HER2. The results demonstrated the viability of detection of HER2 with IgYs and showed promise for the using of IgYs in strict clinical validation.

  1. Amphiregulin induces human ovarian cancer cell invasion by down-regulating E-cadherin expression.


    So, Wai-Kin; Fan, Qianlan; Lau, Man-Tat; Qiu, Xin; Cheng, Jung-Chien; Leung, Peter C K


    Aberrant epidermal growth factor receptor (EGFR) activation is associated with ovarian cancer progression. In this study, we report that the EGFR ligand amphiregulin (AREG) stimulates cell invasion and down-regulates E-cadherin expression in two human ovarian cancer cell lines, SKOV3 and OVCAR5. In addition, AREG increases the expression of transcriptional repressors of E-cadherin including SNAIL, SLUG and ZEB1. siRNA targeting SNAIL or SLUG abolishes AREG-induced cell invasion. Moreover, ERK1/2 and AKT pathways are involved in AREG-induced E-cadherin down-regulation and cell invasion. Finally, we show that three EGFR ligands, AREG, epidermal growth factor (EGF) and transforming growth factor-α (TGF-α), exhibit comparable effects in down-regulating E-cadherin and promoting cell invasion. This study demonstrates that AREG induces ovarian cancer cell invasion by down-regulating E-cadherin expression.

  2. Loss of BRCA1 leads to an increase in epidermal growth factor receptor expression in mammary epithelial cells, and epidermal growth factor receptor inhibition prevents estrogen receptor-negative cancers in BRCA1-mutant mice

    PubMed Central


    Introduction Women who carry a BRCA1 mutation typically develop "triple-negative" breast cancers (TNBC), defined by the absence of estrogen receptor (ER), progesterone receptor and Her2/neu. In contrast to ER-positive tumors, TNBCs frequently express high levels of epidermal growth factor receptor (EGFR). Previously, we found a disproportionate fraction of progenitor cells in BRCA1 mutation carriers with EGFR overexpression. Here we examine the role of EGFR in mammary epithelial cells (MECs) in the emergence of BRCA1-related tumors and as a potential target for the prevention of TNBC. Methods Cultures of MECs were used to examine EGFR protein levels and promoter activity in response to BRCA1 suppression with inhibitory RNA. EGFR was assessed by immunoblot and immunofluorescence analysis, real-time reverse transcriptase-polymerase chain reaction assay (RT-PCR) and flow cytometry. Binding of epidermal growth factor (EGF) to subpopulations of MECs was examined by Scatchard analysis. The responsiveness of MECs to the EGFR inhibitor erlotinib was assessed in vitro in three-dimensional cultures and in vivo. Mouse mammary tumor virus-Cre recombinase (MMTV-Cre) BRCA1flox/flox p53+/- mice were treated daily with erlotinib or vehicle control, and breast cancer-free survival was analyzed using the Kaplan-Meier method. Results Inhibition of BRCA1 in MECs led to upregulation of EGFR with an inverse correlation of BRCA1 with cellular EGFR protein levels (r2 = 0.87) and to an increase in cell surface-expressed EGFR. EGFR upregulation in response to BRCA1 suppression was mediated by transcriptional and posttranslational mechanisms. Aldehyde dehydrogenase 1 (ALDH1)-positive MECs expressed higher levels of EGFR than ALDH1-negative MECs and were expanded two- to threefold in the BRCA1-inhibited MEC population. All MECs were exquisitely sensitive to EGFR inhibition with erlotinib in vitro. EGFR inhibition in MMTV-Cre BRCA1flox/flox p53+/- female mice starting at age 3 months increased

  3. Epidermal Expression of Intercellular Adhesion Molecule 1 is Not a Primary Inducer of Cutaneous Inflammation in Transgenic Mice

    NASA Astrophysics Data System (ADS)

    Williams, Ifor R.; Kupper, Thomas S.


    Keratinocytes at sites of cutaneous inflammation have increased expression of intercellular adhesion molecule 1 (ICAM-1), a cytokine-inducible adhesion molecule which binds the leukocyte integrins LFA-1 and Mac-1. Transgenic mice were prepared in which the expression of mouse ICAM-1 was targeted to basal keratinocytes by using the human K14 keratin promoter. The level of constitutive expression attained in the transgenic mice exceeded the peak level of ICAM-1 expression induced on nontransgenic mouse keratinocytes in vitro by optimal combinations of interferon γ and tumor necrosis factor α or in vivo by proinflammatory stimuli such as phorbol 12-myristate 13-acetate. In vitro adhesion assays demonstrated that cultured transgenic keratinocytes were superior to normal keratinocytes as a substrate for the LFA-1-dependent binding of mouse T cells, confirming that the transgene-encoded ICAM-1 was expressed in a functional form. However, the high level of constitutive ICAM-1 expression achieved on keratinocytes in vivo in these transgenic mice did not result in additional recruitment of CD45^+ leukocytes into transgenic epidermis, nor did it elicit dermal inflammation. Keratinocyte ICAM-1 expression also did not potentiate contact-hypersensitivity reactions to epicutaneous application of haptens. The absence of a spontaneous phenotype in these transgenic mice was not the result of increased levels of soluble ICAM-1, since serum levels of soluble ICAM-1 were equal in transgenic mice and controls. We conclude that elevated ICAM-1 expression on keratinocytes cannot act independently to influence leukocyte trafficking and elicit cutaneous inflammation.

  4. Trichloroethylene-mediated cytotoxicity in human epidermal keratinocytes is mediated by the rapid accumulation of intracellular calcium: Interception by naringenin.


    Ali, F; Khan, A Q; Khan, R; Sultana, S


    Industrial solvents pose a significant threat to the humankind. The mechanisms of their toxicity still remain in debate. Trichloroethylene (TCE) is a widespread industrial solvent responsible for severe liver dysfunction, cutaneous toxicity in occupationally exposed humans. We utilized an in vitro system of human epidermal keratinocyte (HaCaT) cells in this study to avoid complex cell and extracellular interactions. We report the cytotoxicity of organic solvent TCE in HaCaT and its reversal by a natural flavanone, naringenin (Nar). The cytotoxicity was attributed to the rapid intracellular free calcium (Ca(2+)) release, which might lead to the elevation of protein kinase C along with robust free radical generation, instability due to energy depletion, and sensitization of intracellular stress signal transducer nuclear factor κB. These effects were actually seen to induce significant amount of genomic DNA fragmentation. Furthermore, all these effects of TCE were effectively reversed by the treatment of Nar, a natural flavanone. Our studies identify intracellular Ca as a unique target used by organic solvents in the cytotoxicity and highlight the Ca(2+) ion stabilizer properties of Nar.

  5. Intratumoral Heterogeneity for Expression of Tyrosine Kinase Growth Factor Receptors in Human Colon Cancer Surgical Specimens and Orthotopic Tumors

    PubMed Central

    Kuwai, Toshio; Nakamura, Toru; Kim, Sun-Jin; Sasaki, Takamitsu; Kitadai, Yasuhiko; Langley, Robert R.; Fan, Dominic; Hamilton, Stanley R.; Fidler, Isaiah J.


    The design of targeted therapy, particularly patient-specific targeted therapy, requires knowledge of the presence and intratumoral distribution of tyrosine kinase receptors. To determine whether the expression of such receptors is constant or varies between and within individual colon cancer neoplasms, we examined the pattern of expression of the ligands, epidermal growth factor, vascular endothelial growth factor, and platelet-derived growth factor-B as well as their respective receptors in human colon cancer surgical specimens and orthotopic human colon cancers growing in the cecal wall of nude mice. The expression of the epidermal growth factor receptor and the vascular endothelial growth factor receptor on tumor cells and stromal cells, including tumor-associated endothelial cells, was heterogeneous in surgical specimens and orthotopic tumors. In some tumors, the receptor was expressed on both tumor cells and stromal cells, and in other tumors the receptor was expressed only on tumor cells or only on stromal cells. In contrast, the platelet-derived growth factor receptor was expressed only on stromal cells in both surgical specimens and orthotopic tumors. Examination of receptor expression in both individual surgical specimens and orthotopic tumors revealed that the platelet-derived growth factor receptor was expressed only on stromal cells and that the patterns of epidermal growth factor receptor and vascular endothelial growth factor receptor 2 expression differed between tumor cells. This heterogeneity in receptor expression among different tumor cells suggests that targeting a single tyrosine kinase may not yield eradication of the disease. PMID:18202197

  6. Role of acylglycerol kinase in LPA-induced IL-8 secretion and transactivation of epidermal growth factor-receptor in human bronchial epithelial cells

    PubMed Central

    Kalari, Satish; Zhao, Yutong; Spannhake, Ernst Wm.; Berdyshev, Evgeny V.; Natarajan, Viswanathan


    LPA (lysophosphatidic acid) is a potent bioactive phospholipid, which regulates a number of diverse cellular responses through G protein-coupled LPA receptors. Intracellular LPA is generated by the phosphorylation of monoacylglycerol by acylglycerol kinase (AGK); however, the role of intracellular LPA in signaling and cellular responses remains to be elucidated. Here, we investigated signaling pathways of IL-8 secretion mediated by AGK and intracellular LPA in human bronchial epithelial cells (HBEpCs). Expression of AGK in HBEpCs was detected by real-time PCR, and overexpressed AGK was mainly localized in mitochondria as determined by immunofluorescence and confocal microscopy. Overexpression of lentiviral AGK wild type increased intracellular LPA production (∼1.8-fold), enhanced LPA-mediated IL-8 secretion, and stimulated tyrosine phosphorylation epidermal growth factor-receptor (EGF-R). Furthermore, downregulation of native AGK by AGK small interfering RNA decreased intracellular LPA levels (∼2-fold) and attenuated LPA-induced p38 MAPK, JNK, and NF-κB activation, tyrosine phosphorylation of EGF-R, and IL-8 secretion. These results suggest that native AGK regulates LPA-mediated IL-8 secretion involving MAPKs, NF-κB, and transactivation of EGF-R. Thus AGK may play an important role in innate immunity and airway remodeling during inflammation. PMID:19112101

  7. micro RNA 172 (miR172) signals epidermal infection and is expressed in cells primed for bacterial invasion in Lotus japonicus roots and nodules.


    Holt, Dennis B; Gupta, Vikas; Meyer, Dörte; Abel, Nikolaj B; Andersen, Stig U; Stougaard, Jens; Markmann, Katharina


    Legumes interact with rhizobial bacteria to form nitrogen-fixing root nodules. Host signalling following mutual recognition ensures a specific response, but is only partially understood. Focusing on the stage of epidermal infection with Mesorhizobium loti, we analysed endogenous small RNAs (sRNAs) of the model legume Lotus japonicus to investigate their involvement in host response regulation. We used Illumina sequencing to annotate the L. japonicus sRNA-ome and isolate infection-responsive sRNAs, followed by candidate-based functional characterization. Sequences from four libraries revealed 219 novel L. japonicus micro RNAs (miRNAs) from 114 newly assigned families, and 76 infection-responsive sRNAs. Unlike infection-associated coding genes such as NODULE INCEPTION (NIN), a micro RNA 172 (miR172) isoform showed strong accumulation in dependency of both Nodulation (Nod) factor and compatible rhizobia. The genetics of miR172 induction support the existence of distinct epidermal and cortical signalling events. MIR172a promoter activity followed a previously unseen pattern preceding infection thread progression in epidermal and cortical cells. Nodule-associated miR172a expression was infection-independent, representing the second of two genetically separable activity waves. The combined data provide a valuable resource for further study, and identify miR172 as an sRNA marking successful epidermal infection. We show that miR172 acts upstream of several APETALA2-type (AP2) transcription factors, and suggest that it has a role in fine-tuning AP2 levels during bacterial symbiosis.

  8. Functioning methionine sulfoxide reductases A and B are present in human epidermal melanocytes in the cytosol and in the nucleus

    SciTech Connect

    Schallreuter, Karin U.; Chavan, Bhaven; Gillbro, Johanna M.


    Oxidation of methionine residues by reactive oxygen (ROS) in protein structures leads to the formation of methionine sulfoxide which can consequently lead to a plethora of impaired functionality. The generation of methionine sulfoxide yields ultimately a diastereomeric mixture of the S and R sulfoxides. So far two distinct enzyme families have been identified. MSRA reduces methionine S-sulfoxide, while MSRB reduces the R-diastereomer. It has been shown that these enzymes are involved in regulation of protein function and in elimination of ROS via reversible methionine formation besides protein repair. Importantly, both enzymes require coupling to the NADPH/thioredoxin reductase/thioredoxin electron donor system. In this report, we show for First time the expression and function of both sulfoxide reductases together with thioredoxin reductase in the cytosol as well as in the nucleus of epidermal melanocytes which are especially sensitive to ROS. Since this cell resides in the basal layer of the epidermis and its numbers and functions are reduced upon ageing and for instance also in depigmentation processes, we believe that this discovery adds an intricate repair mechanism to melanocyte homeostasis and survival.

  9. Solution structure and backbone dynamics of human epidermal-type fatty acid-binding protein (E-FABP).

    PubMed Central

    Gutiérrez-González, Luis H; Ludwig, Christian; Hohoff, Carsten; Rademacher, Martin; Hanhoff, Thorsten; Rüterjans, Heinz; Spener, Friedrich; Lücke, Christian


    Human epidermal-type fatty acid-binding protein (E-FABP) belongs to a family of intracellular 14-15 kDa lipid-binding proteins, whose functions have been associated with fatty acid signalling, cell growth, regulation and differentiation. As a contribution to understanding the structure-function relationship, we report in the present study features of its solution structure and backbone dynamics determined by NMR spectroscopy. Applying multi-dimensional high-resolution NMR techniques on unlabelled and 15N-enriched recombinant human E-FABP, the 1H and 15N resonance assignments were completed. On the basis of 2008 distance restraints, the three-dimensional solution structure of human E-FABP was subsequently obtained (backbone atom root-mean-square deviation of 0.92+/-0.11 A; where 1 A=0.1 nm), consisting mainly of 10 anti-parallel beta-strands that form a beta-barrel structure. 15N relaxation experiments (T1, T2 and heteronuclear nuclear Overhauser effects) at 500, 600 and 800 MHz provided information on the internal dynamics of the protein backbone. Nearly all non-terminal backbone amide groups showed order parameters S(2)>0.8, with an average value of 0.88+/-0.04, suggesting a uniformly low backbone mobility in the nanosecond-to-picosecond time range. Moreover, hydrogen/deuterium exchange experiments indicated a direct correlation between the stability of the hydrogen-bonding network in the beta-sheet structure and the conformational exchange in the millisecond-to-microsecond time range. The features of E-FABP backbone dynamics elaborated in the present study differ markedly from those of the phylogenetically closely related heart-type FABP and the more distantly related ileal lipid-binding protein, implying a strong interdependence with the overall protein stability and possibly also with the ligand-binding affinity for members of the lipid-binding protein family. PMID:12049637

  10. The Alteration of the Epidermal Basement Membrane Complex of Human Nevus Tissue and Keratinocyte Attachment after High Hydrostatic Pressurization

    PubMed Central

    Jinno, Chizuru; Sakamoto, Michiharu; Kakudo, Natsuko; Inoie, Masukazu; Fujisato, Toshia; Suzuki, Shigehiko; Kusumoto, Kenji; Yamaoka, Tetsuji


    We previously reported that human nevus tissue was inactivated after high hydrostatic pressure (HHP) higher than 200 MPa and that human cultured epidermis (hCE) engrafted on the pressurized nevus at 200 MPa but not at 1000 MPa. In this study, we explore the changes to the epidermal basement membrane in detail and elucidate the cause of the difference in hCE engraftment. Nevus specimens of 8 mm in diameter were divided into five groups (control and 100, 200, 500, and 1000 MPa). Immediately after HHP, immunohistochemical staining was performed to detect the presence of laminin-332 and type VII collagen, and the specimens were observed by transmission electron microscopy (TEM). hCE was placed on the pressurized nevus specimens in the 200, 500, and 1000 MPa groups and implanted into the subcutis of nude mice; the specimens were harvested at 14 days after implantation. Then, human keratinocytes were seeded on the pressurized nevus and the attachment was evaluated. The immunohistochemical staining results revealed that the control and 100 MPa, 200 MPa, and 500 MPa groups were positive for type VII collagen and laminin-332 immediately after HHP. TEM showed that, in all of the groups, the lamina densa existed; however, anchoring fibrils were not clearly observed in the 500 or 1000 MPa groups. Although the hCE took in the 200 and 500 MPa groups, keratinocyte attachment was only confirmed in the 200 MPa group. This result indicates that HHP at 200 MPa is preferable for inactivating nevus tissue to allow its reuse for skin reconstruction in the clinical setting. PMID:27747221

  11. Phytosphingosine-1-phosphate and epidermal growth factor synergistically restore extracellular matrix in human dermal fibroblasts in vitro and in vivo.


    Kwon, Seung Bin; An, Sungkwan; Kim, Min Jung; Kim, Ka Ram; Choi, Young Min; Ahn, Kyu Joong; An, In-Sook; Cha, Hwa Jun


    Phytosphingosine-1-phosphate (PhS1P), which is found in plants and fungi, is generated by the phosphorylation of phytosphingosine and is structurally similar to molecules that promote cellular growth and proliferation. The aim of this study was to ascertain whether PhS1P displays synergistic effects together with epidermal growth factor (EGF), which is also critical for activating proliferation, migration and survival pathways. We utilized cultured human dermal fibroblasts (HDFs) and a number of assays, including western blotting, cell migration assays, quantitative (real-time) PCR, and viability assays. We found that PhS1P promoted the activity of EGF in vitro. We then conducted a clinical trial in females over 35 years of age, with visible signs of skin aging. By evaluating skin hydration, dermal density and thickness, length of fine wrinkles, and skin elasticity, we verified the clinical efficacy of a combined treatment of PhS1P and EGF in vivo. On the whole, our data suggest that PhS1P displays a synergistic anti-aging effect together with EGF, both in vitro and in vivo.

  12. Phytosphingosine-1-phosphate and epidermal growth factor synergistically restore extracellular matrix in human dermal fibroblasts in vitro and in vivo.


    Kwon, Seung Bin; An, Sungkwan; Kim, Min Jung; Kim, Ka Ram; Choi, Young Min; Ahn, Kyu Joong; An, In-Sook; Cha, Hwa Jun


    Phytosphingosine-1-phosphate (PhS1P), which is found in plants and fungi, is generated by the phosphorylation of phytosphingosine and is structurally similar to molecules that promote cellular growth and proliferation. The aim of this study was to ascertain whether PhS1P displays synergistic effects together with epidermal growth factor (EGF), which is also critical for activating proliferation, migration and survival pathways. We utilized cultured human dermal fibroblasts (HDFs) and a number of assays, including western blotting, cell migration assays, quantitative (real-time) PCR, and viability assays. We found that PhS1P promoted the activity of EGF in vitro. We then conducted a clinical trial in females over 35 years of age, with visible signs of skin aging. By evaluating skin hydration, dermal density and thickness, length of fine wrinkles, and skin elasticity, we verified the clinical efficacy of a combined treatment of PhS1P and EGF in vivo. On the whole, our data suggest that PhS1P displays a synergistic anti-aging effect together with EGF, both in vitro and in vivo.

  13. Effects of oxygen-containing terpenes as skin permeation enhancers on the lipoidal pathways of human epidermal membrane.


    Chantasart, Doungdaw; Pongjanyakul, Thaned; Higuchi, William I; Li, S Kevin


    The present study investigated the effects of oxygen-containing terpenes as skin permeation enhancers on the lipoidal pathways of human epidermal membrane (HEM). The enhancement (E(HEM)) effects of menthol, thymol, carvacrol, menthone, and cineole on the transport of a probe permeant, corticosterone, across HEM were determined. It was found that the enhancer potencies of menthol, thymol, carvacrol, and menthone were essentially the same and higher than that of cineole based on their aqueous concentration in the diffusion cell chamber at E(HEM) = 4. Thymol and carvacrol also had the same E(HEM) = 10 concentration further supporting that they had the same enhancer potency based on the aqueous concentration. The uptake amounts of terpene into the HEM stratum corneum (SC) intercellular lipid under the same conditions indicate that the intrinsic potencies of the studied terpenes are the same based on their concentration in the SC and similar to those of n-alkanol and n-alkylphenyl alcohol. Moreover, they are all better enhancers compared to branched-chain alkanol. The approximately same uptake enhancement of beta-estradiol induced by the studied terpenes and alcohols at E(HEM) conditions into the SC intercellular lipids suggests that the mechanism of enhancement action for the terpenes and those of alcohols are essentially the same.

  14. Evolving landscape of human epidermal growth factor receptor 2-positive breast cancer treatment and the future of biosimilars.


    Jackisch, Christian; Lammers, Philip; Jacobs, Ira


    Human epidermal growth factor receptor 2-positive (HER2+) breast cancer comprises approximately 15%-20% of all breast cancers and is associated with a poor prognosis. The introduction of anti-HER2 therapy has significantly improved clinical outcomes for patients with HER2+ breast cancer, and multiple HER2-directed agents (ie, trastuzumab, pertuzumab, lapatinib, and ado-trastuzumab emtansine [T-DM1]) are approved for clinical use in various settings. The treatment landscape for patients with HER2+ breast cancer is continuing to evolve. While novel agents and therapeutic strategies are emerging, biologic therapies, particularly trastuzumab, are likely to remain a mainstay of treatment. However, access issues create barriers to the use of biologics, and there is evidence for underuse of trastuzumab worldwide. A biosimilar is a biologic product that is highly similar to a licensed biologic in terms of product safety and effectiveness. Biosimilars of trastuzumab are in development and may soon become available. The introduction of biosimilars may improve access to anti-HER2 therapies by providing additional treatment options and lower-cost alternatives. Because HER2-targeted drugs may be administered for extended periods of time and in combination with other systemic therapies, biosimilars have the potential to result in significant savings for healthcare systems. Herein we review current and emerging treatment options for, and discuss the possible role of biosimilars in, treating patients with HER2+ breast cancer.

  15. Cyclooxygenases in human and mouse skin and cultured human keratinocytes: association of COX-2 expression with human keratinocyte differentiation

    NASA Technical Reports Server (NTRS)

    Leong, J.; Hughes-Fulford, M.; Rakhlin, N.; Habib, A.; Maclouf, J.; Goldyne, M. E.


    Epidermal expression of the two isoforms of the prostaglandin H-generating cyclooxygenase (COX-1 and COX-2) was evaluated both by immunohistochemistry performed on human and mouse skin biopsy sections and by Western blotting of protein extracts from cultured human neonatal foreskin keratinocytes. In normal human skin, COX-1 immunostaining is observed throughout the epidermis whereas COX-2 immunostaining increases in the more differentiated, suprabasilar keratinocytes. Basal cell carcinomas express little if any COX-1 or COX-2 immunostaining whereas both isozymes are strongly expressed in squamous cell carcinomas deriving from a more differentiated layer of the epidermis. In human keratinocyte cultures, raising the extracellular calcium concentration, a recognized stimulus for keratinocyte differentiation, leads to an increased expression of both COX-2 protein and mRNA; expression of COX-1 protein, however, shows no significant alteration in response to calcium. Because of a recent report that failed to show COX-2 in normal mouse epidermis, we also looked for COX-1 and COX-2 immunostaining in sections of normal and acetone-treated mouse skin. In agreement with a previous report, some COX-1, but no COX-2, immunostaining is seen in normal murine epidermis. However, following acetone treatment, there is a marked increase in COX-1 expression as well as the appearance of significant COX-2 immunostaining in the basal layer. These data suggest that in human epidermis as well as in human keratinocyte cultures, the expression of COX-2 occurs as a part of normal keratinocyte differentiation whereas in murine epidermis, its constitutive expression is absent, but inducible as previously published.

  16. Materials and optimized designs for human-machine interfaces via epidermal electronics.


    Jeong, Jae-Woong; Yeo, Woon-Hong; Akhtar, Aadeel; Norton, James J S; Kwack, Young-Jin; Li, Shuo; Jung, Sung-Young; Su, Yewang; Lee, Woosik; Xia, Jing; Cheng, Huanyu; Huang, Yonggang; Choi, Woon-Seop; Bretl, Timothy; Rogers, John A


    Thin, soft, and elastic electronics with physical properties well matched to the epidermis can be conformally and robustly integrated with the skin. Materials and optimized designs for such devices are presented for surface electromyography (sEMG). The findings enable sEMG from wide ranging areas of the body. The measurements have quality sufficient for advanced forms of human-machine interface.

  17. Proteomic Analysis of Arsenic-Induced Oxidative Stress in Human Epidermal Keratinocytes

    EPA Science Inventory

    Chronic exposure to inorganic arsenic (IAs) has been associated with the development of several human cancers, including those found in the skin, lung, urinary bladder, liver, prostate and kidney. The precise mechanisms by which arsenic causes cancer are unknown. Defining the mod...

  18. Racially restricted contribution of immunoglobulin Fcγ and Fcγ receptor genotypes to humoral immunity to human epidermal growth factor receptor 2 in breast cancer.


    Pandey, J P; Namboodiri, A M; Kistner-Griffin, E; Iwasaki, M; Kasuga, Y; Hamada, G S; Tsugane, S


    Tumour-associated antigen human epidermal growth factor receptor 2 (HER2) is over-expressed in 25-30% of breast cancer patients and is associated with poor prognosis. Naturally occurring anti-HER2 antibody responses have been described in patients with HER2 over-expressing tumours. There is significant interindividual variability in antibody responsiveness, but the host genetic factors responsible for this variability are poorly understood. The aim of the present investigation was to determine whether immunoglobulin genetic markers [GM (genetic determinants of γ chains)] and Fcγ receptor (FcγR) alleles contribute to the magnitude of natural antibody responsiveness to HER2 in patients with breast cancer. A total of 855 breast cancer patients from Japan and Brazil were genotyped for several GM and FcγR alleles. They were also characterized for immunoglobulin (Ig)G antibodies to HER2. In white subjects (n = 263), GM 23-carriers had higher levels of anti-HER2 antibodies than non-carriers of this allele (p = 0·004). At the GM 5/21 locus, the homozygotes for the GM 5 allele had higher levels of anti-HER2 antibodies than the other two genotypes (P = 0·0067). In black subjects (n = 42), FcγRIIa-histidine/histidine homozygotes and FcγRIIIa-phenylalanine/valine heterozygotes were associated with high antibody responses (P = 0·0071 and 0·0275, respectively). FcγR genotypes in white subjects and GM genotypes in black subjects were not associated with anti-HER2 antibody responses. No significant associations were found in other study groups. These racially restricted contributions of GM and FcγR genotypes to humoral immunity to HER2 have potential implications for immunotherapy of breast cancer.

  19. Brain metastases in gastro-oesophageal adenocarcinoma: insights into the role of the human epidermal growth factor receptor 2 (HER2)

    PubMed Central

    Feilchenfeldt, J; Varga, Z; Siano, M; Grabsch, H I; Held, U; Schuknecht, B; Trip, A; Hamaguchi, T; Gut, P; Balague, O; Khanfir, K; Diebold, J; Jochum, W; Shoji, H; Kushima, R; Wagner, D; Shimada, Y; Cats, A; Knuth, A; Moch, H; Aebi, S; Hofer, S


    Background: Gastro-oesophageal adenocarcinomas rarely metastasize to the central nervous system (CNS). The role of the human epidermal growth factor receptor 2 (HER2) in patients with these cancers and CNS involvement is presently unknown. Patients and Methods: A multicentre registry was established to collect data from patients with gastro-oesophageal adenocarcinomas and CNS involvement both retrospectively and prospectively. Inclusion in the study required a predefined clinical data set, a central neuro-radiological or histopathological confirmation of metastatic CNS involvement and central assessment of HER2 by immunohistochemistry (IHC) and in situ hybridisation (ISH). In addition, expression of E-cadherin and DNA mismatch repair (MMR) proteins were assessed by IHC. Results: One hundred patients fulfilled the inclusion criteria. The population's median age was 59 years (interquartile range: 54–68), of which 85 (85%) were male. Twenty-five patients were of Asian and 75 of Caucasian origin. HER2 status was positive in 36% (95% CI: 26.6–46.2) of cases. Median time from initial diagnosis to the development of brain metastases (BMets) or leptomeningeal carcinomatosis (LC) was 9.9 months (95% CI: 8.5–15.0). Median overall survival from diagnosis was 16.9 months (95% CI: 14.0–20.7) and was not related to the HER2 status. E-cadherin loss was observed in 9% of cases and loss of expression in at least one DNA MMR proteins in 6%. Conclusions: The proportion of a positive HER2 status in patients with gastro-oesophageal adenocarcinoma and CNS involvement was higher than expected. The impact of anti-HER2 therapies should be studied prospectively. PMID:26313663

  20. Lipid raft localization of epidermal growth factor receptor alters matrix metalloproteinase-1 expression in SiHa cells via the MAPK/ERK signaling pathway

    PubMed Central

    Zhang, Zongfeng; Wang, Lina; Du, Juan; Li, Yuanbo; Yang, Huilun; Li, Chenxi; Li, Hui; Hu, Haiyang


    Matrix metalloproteinase-1 (MMP-1) has been identified as an important participant in tumor invasion, metastasis and angiogenesis. The purpose of the present study was to investigate the effects of epidermal growth factor receptor (EGFR) localization to lipid rafts on signaling pathways involved in the regulation of MMP-1 expression in SiHa cells, a cervical cancer cell line. EGFR activation by EGF specifically induced MMP-1 expression at both the messenger RNA and protein levels. Additionally, it was observed that EGFR localized to lipid rafts, and that the redistribution of EGFR induced by lipid raft disruption strengthened EGF-induced MMP-1 expression. MMP-1 induction was blocked by the mitogen-activated protein kinase (MAPK) kinase inhibitors PD98059 and U0126. Our results suggested that lipid rafts provide a platform to inhibit EGFR regulation of MMP-1 in SiHa cells through the MAPK/extracellular signal-regulated kinase signaling pathway. PMID:28101233

  1. Purification and some characteristics of the human epidermal SH-protease inhibitor.


    Järvinen, M


    An inhibitor of papain and other SH-proteases was purified 520-fold from human epidermis extracts by acetone fractionation, heat treatment, papain-Sepharose affinity chromatography, and Sephadex G-50 chromatography. The purified inhibitor had a molecular weight of 12,600 and contained no hexose, as tested by the anthrone reaction. The inhibitor survived in a boiling water bath, in 5% trichloroacetic acid, 20 mM Na3PO4 (pH 12.1) and 4 M NH4OH (pH 11.9). By isoelectric focusing 2 major activity peaks with pI's of 4.6 and 4.8, and a minor peak with a pI of 4.9 was fractioned, and 3 corresponding protein bands were seen after analytical isoelectric focusing. Immunization of rabbits with the purified inhibitor yielded a highly specific anti-inhibitor serum. The purified inhibitor inhibited papain, ficin, human cathepsins B and C, and slightly inhibited bromelain. No inhibition of serine proteases (bovine trypsin and chymotrypsin A, porcine elastase) or an acid protease (human cathepsin D) was observed. Evidence was obtained that the inhibitor formed a complex with both dithiothreitol-activated papain and enzymatically inactive mercuripapain.

  2. Involvement of interleukin-21 in the epidermal hyperplasia of psoriasis.


    Caruso, Roberta; Botti, Elisabetta; Sarra, Massimiliano; Esposito, Maria; Stolfi, Carmine; Diluvio, Laura; Giustizieri, Maria Laura; Pacciani, Valentina; Mazzotta, Annamaria; Campione, Elena; Macdonald, Thomas T; Chimenti, Sergio; Pallone, Francesco; Costanzo, Antonio; Monteleone, Giovanni


    T cells are crucial mediators of the skin damage in psoriasis. We here show that interleukin-21 (IL-21), a T cell-derived cytokine, is highly expressed in the skin of individuals with psoriasis, stimulates human keratinocytes to proliferate and causes epidermal hyperplasia when injected intradermally into mice. In the human psoriasis xenograft mouse model, blockade of IL-21 activity resolves inflammation and reduces keratinocyte proliferation. Blocking IL-21 may represent a new therapeutic strategy in psoriasis.

  3. Efficacy of 50 Hz electromagnetic fields on human epidermal stem cell transplantation seeded in collagen sponge scaffolds for wound healing in a murine model.


    Bai, Wen-Fang; Xu, Wei-Cheng; Zhu, Hong-Xiang; Huang, Hong; Wu, Bo; Zhang, Ming-Sheng


    To explore the possible efficacy of electromagnetic fields (EMF) for skin tissue engineering, effects of EMF exposure on epidermal stem cells (ESC) seeded in collagen sponge scaffolds for wound healing in a murine model were investigated. The wound models of a full-thickness defect established with 36 7 ∼ 8-week-old nude mice were randomly divided into three groups: a control group, an ESC-only group, and an ESC with EMF exposure group (frequency of 50 Hz, magnetic induction of 5 mT, 60 min per day for 20 days). ESC were separated from human foreskin and cultured in vitro, and then transplanted with collagen sponge scaffolds as a delivery vehicle to wounds of the ESC-only group, and ESC with EMF exposure group was exposed to EMF after ESC transplantation. Effects of EMF on morphological changes and expression of β1 integrin in regenerated skins were observed. Wound healing rates and healing times were collected to evaluate the efficacy of repairment. Results showed that human ESC were successfully transplanted to nude mice, which facilitated the formation of intact skin on nude mice. In contrast to other groups, the wound healing of ESC with EMF exposure group was the fastest (P < 0.05), the structure of regenerated skins was more mature, and it contained more continuity in the number of viable cell layers and rich hair follicles' structure. These results suggest that the use of 50 Hz EMF as a non-invasive treatment can accelerate wound healing of ESC transplantation, and restore structural integrity of regenerated skin. Bioelectromagnetics. 38:204-212,2017. © 2017 Wiley Periodicals, Inc.

  4. Positive and Negative Cross-Talk between Lysophosphatidic Acid Receptor 1, Free Fatty Acid Receptor 4, and Epidermal Growth Factor Receptor in Human Prostate Cancer Cells.


    Hopkins, Mandi M; Liu, Ze; Meier, Kathryn E


    Lysophosphatidic acid (LPA) is a lipid mediator that mediates cellular effects via G protein-coupled receptors (GPCRs). Epidermal growth factor (EGF) is a peptide that acts via a receptor tyrosine kinase. LPA and EGF both induce proliferation of prostate cancer cells and can transactivate each other's receptors. The LPA receptor LPA1 is particularly important for LPA response in human prostate cancer cells. Previous work in our laboratory has demonstrated that free fatty acid 4 (FFA4), a GPCR activated by ω-3 fatty acids, inhibits responses to both LPA and EGF in these cells. One potential mechanism for the inhibition involves negative interactions between FFA4 and LPA1, thereby suppressing responses to EGF that require LPA1 In the current study, we examined the role of LPA1 in mediating EGF and FFA4 agonist responses in two human prostate cancer cell lines, DU145 and PC-3. The results show that an LPA1-selective antagonist inhibits proliferation and migration to both LPA and EGF. Knockdown of LPA1 expression, using silencing RNA, blocks responses to LPA and significantly inhibits responses to EGF. The partial response to EGF that is observed after LPA1 knockdown is not inhibited by FFA4 agonists. Finally, the role of arrestin-3, a GPCR-binding protein that mediates many actions of activated GPCRs, was tested. Knockdown of arrestin-3 completely inhibits responses to both LPA and EGF in prostate cancer cells. Taken together, these results suggest that LPA1 plays a critical role in EGF responses and that FFA4 agonists inhibit proliferation by suppressing positive cross-talk between LPA1 and the EGF receptor.

  5. Modifying effect of intravenous laser therapy on the protein expression of arginase and epidermal growth factor receptor in type 2 diabetic patients.


    Kazemikhoo, N; Sarafnejad, A F; Ansari, F; Mehdipour, P


    The epidermal growth factor receptor (EGFR) signaling pathway may be involved in cell activation and may influence the neuronal microenvironment, microglia activation, and production of proinflammatory cytokines. Arginase and nitric oxide synthase (NOS) both use L-arginine as a common substrate. Decreasing the arginase expression may increase L-arginine consumption by NOS and increase nitric oxide (NO) synthesis. Intravenous laser blood irradiation (ILBI) is an effective systemic treatment for different pathologies including diabetes mellitus. Previous studies have shown that low-level laser therapy can have an effect on the release of certain cytokines and growth factors. The aim of this study was to evaluate the effects of ILBI on the expression of arginase and epidermal growth factor receptor in type 2 diabetic patients. We used 630 nm red laser light, 1.5 mW, continuous mode, intravenously for 30 min in 13 type 2 diabetic patients and compared their blood samples using the flow cytometry technique, before and after ILBI. The difference between the percentage of cells before and after therapy was analyzed using repeated-measures ANOVA, and the relationship between EGFR and arginase expression in blood and tissue was evaluated by calculating the Pearson correlation coefficient. We found a significant decrease in the expression of both arginase- and EGFR-positive cells after laser therapy (P < 0.01). In conclusion, laser therapy may have a beneficial effect for diabetic patients via decreasing arginase expression and activation of the NOS/NO pathway which increases NO production and vasodilation, and decreasing EGFR expression which may reduce neuroinflammation and its secondary damages.

  6. Human epidermal growth factor receptor 2 (HER2) immunoreactivity: specificity of three pharmacodiagnostic antibodies

    PubMed Central

    Schrohl, Anne-Sofie; Pedersen, Hans Christian; Jensen, Sussie Steen; Nielsen, Signe Lykke; Brünner, Nils


    Aims The availability of specific antibody-based test systems is essential to testing of HER2 protein expression. Here, we mapped epitopes recognized by three pharmacodiagnostic HER2 antibodies and investigated their specificity towards peptides and fusion proteins homologous to the intracellular domains of HER1, HER2, HER3 and HER4. The investigated antibodies were PATHWAY® HER2 (clone 4B5; Ventana Medical Systems Inc., Tucson, AZ, USA), HercepTest™ (Dako Denmark A/S, Glostrup, Denmark), and Oracle® HER2 (clone CB11; Leica Microsystems GmbH, Wetzlar, Germany). Methods and results Epitopes were mapped using the alanine scanning method. Specificity was investigated in immunohistochemical stainings, competitive enzyme-linked immunosorbent assay (ELISA) and immunoblotting. All three antibodies reacted with HER2 proteins and peptides in immunohistochemical stainings, ELISA and immunoblotting. PATHWAY® HER2 also stained HER4-expressing cells, reacted with HER4 peptide in ELISA and detected HER4 fusion protein in an immunoblot. Oracle® HER2 weakly detected HER4 in immunohistochemical stainings, whereas the HercepTest™ antibody showed no cross-reactivity with other HER proteins. Conclusion Our study shows that the PATHWAY® HER2 antibody can bind HER4 peptides and fusion proteins in three different experimental settings. This should be investigated further to determine whether binding of HER4 also occurs in tissue samples and if such binding would have implications for therapy decisions for breast cancer patients. PMID:22092409

  7. Amygdalin analogues inhibit IFN-γ signalling and reduce the inflammatory response in human epidermal keratinocytes.


    Paoletti, Iole; De Gregorio, Vincenza; Baroni, Adone; Tufano, Maria Antonietta; Donnarumma, Giovanna; Perez, Juan Jesus


    Peptide T (PT), an octapeptide fragment located in the V2 region of the HIV-1 gp120-coating protein, appears to be beneficial in the treatment of psoriasis. Our previous investigations suggest that keratinocytes play a key role in conditioning the therapeutic effects of PT in psoriasis. The aim of this study was to explore the effects of PT and the peptidomimetic natural products, Dhurrin and Prunasin, on the expression of the IL-6, IL-8, IL-23, HSP70 and ICAM-1 on IFN-γ and TNF-α-NHEK activated cells. Moreover, we analysed the interference of PT and its analogues through STAT-3 activation. Our results show that the analogues tested exhibit the beneficial biological effects of PT, suggesting the primary role of keratinocytes upon which PT and the peptidomimetics act directly, by reducing proinflammatory responses. Its reduction appears to be important for therapeutic approach in psoriasis pathogenesis.

  8. A new hair follicle-derived human epidermal model for the evaluation of sunscreen genoprotection.


    Bacqueville, D; Douki, T; Duprat, L; Rebelo-Moreira, S; Guiraud, B; Dromigny, H; Perier, V; Bessou-Touya, S; Duplan, H


    Induction of skin cancer is the most deleterious effect of excessive exposure to sunlight. Accurate evaluation of sunscreens to protect the genome is thus of major importance. In particular, the ability of suncare products to prevent the formation of DNA damage should be evaluated more directly since the Sun Protection Factor is only related to erythema induction. For this purpose, we developed an in vitro approach using a recently characterized reconstituted human epidermis (RHE) model engineered from hair follicle. The relevance of this skin substitute in terms of UV-induced genotoxicity was compared to ex vivo explants exposed to solar-simulated radiation (SSR). The yield of bipyrimidine photoproducts, their rate of repair, and the induction of apoptosis were very similar in both types of skin samples. In order to evaluate the protection afforded by sunscreen against DNA damage, bipyrimidine photoproducts were quantified in tissue models following SSR exposure in the presence or absence of a SPF50+ formula. A rather high DNA protection factor of approximately 20 was found in RHE, very similar to that determined for explants. Thus, RHE is a good surrogate to human skin, and also a convenient and useful tool for investigation of the genoprotection of sunscreens.

  9. Epidermal mechano-acoustic sensing electronics for cardiovascular diagnostics and human-machine interfaces.


    Liu, Yuhao; Norton, James J S; Qazi, Raza; Zou, Zhanan; Ammann, Kaitlyn R; Liu, Hank; Yan, Lingqing; Tran, Phat L; Jang, Kyung-In; Lee, Jung Woo; Zhang, Douglas; Kilian, Kristopher A; Jung, Sung Hee; Bretl, Timothy; Xiao, Jianliang; Slepian, Marvin J; Huang, Yonggang; Jeong, Jae-Woong; Rogers, John A


    Physiological mechano-acoustic signals, often with frequencies and intensities that are beyond those associated with the audible range, provide information of great clinical utility. Stethoscopes and digital accelerometers in conventional packages can capture some relevant data, but neither is suitable for use in a continuous, wearable mode, and both have shortcomings associated with mechanical transduction of signals through the skin. We report a soft, conformal class of device configured specifically for mechano-acoustic recording from the skin, capable of being used on nearly any part of the body, in forms that maximize detectable signals and allow for multimodal operation, such as electrophysiological recording. Experimental and computational studies highlight the key roles of low effective modulus and low areal mass density for effective operation in this type of measurement mode on the skin. Demonstrations involving seismocardiography and heart murmur detection in a series of cardiac patients illustrate utility in advanced clinical diagnostics. Monitoring of pump thrombosis in ventricular assist devices provides an example in characterization of mechanical implants. Speech recognition and human-machine interfaces represent additional demonstrated applications. These and other possibilities suggest broad-ranging uses for soft, skin-integrated digital technologies that can capture human body acoustics.

  10. Epidermal mechano-acoustic sensing electronics for cardiovascular diagnostics and human-machine interfaces

    PubMed Central

    Liu, Yuhao; Norton, James J. S.; Qazi, Raza; Zou, Zhanan; Ammann, Kaitlyn R.; Liu, Hank; Yan, Lingqing; Tran, Phat L.; Jang, Kyung-In; Lee, Jung Woo; Zhang, Douglas; Kilian, Kristopher A.; Jung, Sung Hee; Bretl, Timothy; Xiao, Jianliang; Slepian, Marvin J.; Huang, Yonggang; Jeong, Jae-Woong; Rogers, John A.


    Physiological mechano-acoustic signals, often with frequencies and intensities that are beyond those associated with the audible range, provide information of great clinical utility. Stethoscopes and digital accelerometers in conventional packages can capture some relevant data, but neither is suitable for use in a continuous, wearable mode, and both have shortcomings associated with mechanical transduction of signals through the skin. We report a soft, conformal class of device configured specifically for mechano-acoustic recording from the skin, capable of being used on nearly any part of the body, in forms that maximize detectable signals and allow for multimodal operation, such as electrophysiological recording. Experimental and computational studies highlight the key roles of low effective modulus and low areal mass density for effective operation in this type of measurement mode on the skin. Demonstrations involving seismocardiography and heart murmur detection in a series of cardiac patients illustrate utility in advanced clinical diagnostics. Monitoring of pump thrombosis in ventricular assist devices provides an example in characterization of mechanical implants. Speech recognition and human-machine interfaces represent additional demonstrated applications. These and other possibilities suggest broad-ranging uses for soft, skin-integrated digital technologies that can capture human body acoustics. PMID:28138529

  11. An "ice-cold" TR(i)P to skin biology: the role of TRPA1 in human epidermal keratinocytes.


    Bíró, Tamás; Kovács, László


    Recent studies have suggested the expression of numerous heat-sensitive transient receptor potential (TRP) ion channels in non-neuronal cell populations of the skin. In this issue, Atoyan et al. provide evidence that the noxious cold-activated TRPA1 is widely expressed in various human cutaneous cells and that it may be directly involved in the regulation of keratinocyte proliferation and differentiation and in cutaneous inflammatory responses.

  12. Enhancing Mitochondrial Respiration Suppresses Tumor Promoter TPA-Induced PKM2 Expression and Cell Transformation in Skin Epidermal JB6 Cells

    PubMed Central

    Wittwer, Jennifer A.; Robbins, Delira; Wang, Fei; Codarin, Sarah; Shen, Xinggui; Kevil, Christopher G.; Huang, Ting-Ting; Van Remmen, Holly; Richardson, Arlan; Zhao, Yunfeng


    Differentiated cells primarily metabolize glucose for energy via the tricarboxylic acid cycle and oxidative phosphorylation, but cancer cells thrive on a different mechanism to produce energy, characterized as the Warburg effect, which describes the increased dependence on aerobic glycolysis. The M2 isoform of pyruvate kinase (PKM2), which is responsible for catalyzing the final step of aerobic glycolysis, is highly expressed in cancer cells and may contribute to the Warburg effect. However, whether PKM2 plays a contributing role during early cancer development is unclear. In our studies, we have made an attempt to elucidate the effects of varying mitochondrial respiration substrates on skin cell transformation and expression of PKM2. Tumorigenicity in murine skin epidermal JB6 P+ (promotable) cells was measured in a soft agar assay using 12-O-tetradecanoylphorbol-13-acetate (TPA) as a tumor promoter. We observed a significant reduction in cell transformation upon pretreatment with the mitochondrial respiration substrate succinate or malate/pyruvate. We observed that increased expression and activity of PKM2 in TPA-treated JB6 P+ cells and pretreatment with succinate or malate/pyruvate suppressed the effects. In addition, TPA treatment also induced PKM2 whereas PKM1 expression was suppressed in mouse skin epidermal tissues in vivo. In comparison with JB6 P+ cells, the nonpromotable JB6 P− cells showed no increase in PKM2 expression or activity upon TPA treatment. Knockdown of PKM2 using a siRNA approach significantly reduced skin cell transformation. Thus, our results suggest that PKM2 activation could be an early event and play a contributing role in skin tumorigenesis. PMID:21673231

  13. Follicle-stimulating hormone regulates expression and activity of epidermal growth factor receptor in the murine ovarian follicle.


    El-Hayek, Stephany; Demeestere, Isabelle; Clarke, Hugh J


    Fertility depends on the precise coordination of multiple events within the ovarian follicle to ensure ovulation of a fertilizable egg. FSH promotes late follicular development, including expression of luteinizing hormone (LH) receptor by the granulosa cells. Expression of its receptor permits the subsequent LH surge to trigger the release of ligands that activate EGF receptors (EGFR) on the granulosa, thereby initiating the ovulatory events. Here we identify a previously unknown role for FSH in this signaling cascade. We show that follicles of Fshb(-/-) mice, which cannot produce FSH, have a severely impaired ability to support two essential EGFR-regulated events: expansion of the cumulus granulosa cell layer that encloses the oocyte and meiotic maturation of the oocyte. These defects are not caused by an inability of Fshb(-/-) oocytes to produce essential oocyte-secreted factors or of Fshb(-/-) cumulus cells to respond. In contrast, although expression of both Egfr and EGFR increases during late folliculogenesis in Fshb(+/-) females, these increases fail to occur in Fshb(-/-) females. Remarkably, supplying a single dose of exogenous FSH activity to Fshb(-/-) females is sufficient to increase Egfr and EGFR expression and to restore EGFR-dependent cumulus expansion and oocyte maturation. These studies show that FSH induces an increase in EGFR expression during late folliculogenesis and provide evidence that the FSH-dependent increase is necessary for EGFR physiological function. Our results demonstrate an unanticipated role for FSH in establishing the signaling axis that coordinates ovulatory events and may contribute to the diagnosis and treatment of some types of human infertility.

  14. Follicle-stimulating hormone regulates expression and activity of epidermal growth factor receptor in the murine ovarian follicle

    PubMed Central

    El-Hayek, Stephany; Demeestere, Isabelle; Clarke, Hugh J.


    Fertility depends on the precise coordination of multiple events within the ovarian follicle to ensure ovulation of a fertilizable egg. FSH promotes late follicular development, including expression of luteinizing hormone (LH) receptor by the granulosa cells. Expression of its receptor permits the subsequent LH surge to trigger the release of ligands that activate EGF receptors (EGFR) on the granulosa, thereby initiating the ovulatory events. Here we identify a previously unknown role for FSH in this signaling cascade. We show that follicles of Fshb−/− mice, which cannot produce FSH, have a severely impaired ability to support two essential EGFR-regulated events: expansion of the cumulus granulosa cell layer that encloses the oocyte and meiotic maturation of the oocyte. These defects are not caused by an inability of Fshb−/− oocytes to produce essential oocyte-secreted factors or of Fshb−/− cumulus cells to respond. In contrast, although expression of both Egfr and EGFR increases during late folliculogenesis in Fshb+/− females, these increases fail to occur in Fshb−/− females. Remarkably, supplying a single dose of exogenous FSH activity to Fshb−/− females is sufficient to increase Egfr and EGFR expression and to restore EGFR-dependent cumulus expansion and oocyte maturation. These studies show that FSH induces an increase in EGFR expression during late folliculogenesis and provide evidence that the FSH-dependent increase is necessary for EGFR physiological function. Our results demonstrate an unanticipated role for FSH in establishing the signaling axis that coordinates ovulatory events and may contribute to the diagnosis and treatment of some types of human infertility. PMID:25385589

  15. Anti-synthetic peptide antibody reacting at the fusion junction of deletion-mutant epidermal growth factor receptors in human glioblastoma

    SciTech Connect

    Humphrey, P.A.; Zalutsky, M.R.; Fuller, G.N.; Archer, G.E.; Friedman, H.S.; Kwatra, M.M.; Bigner, S.H.; Bigner, D.D. ); Wong, A.J. ); Vogelstein, B. )


    The authors have investigated human gliomas that amplify and rearrange the epidermal growth factor receptor gene, with generation of an in-frame deletion mutation of 802 nucleotides in the external domain. This in-frame deletion mutation generates a local amino acid sequence at the fusion junction of what normally were distant polypeptide sequences in the intact epidermal growth factor receptor. This 14-amino acid peptide was chemically synthesized, coupled to keyhole limpet hemocyanin, and used as an immunogen in rabbits. The elicited antibody reacted specifically with the fusion peptide in ELISA. The anti-fusion junction peptide antibody was purified by passage of the antiserum over a peptide affinity column with acidic elution. The purified antibody selectively bound the glioma deletion mutant as compared to the intact epidermal growth factor receptor as assessed by immunocytochemistry, immunofluorescence, immunoprecipitation with gel electrophoresis, and binding experiments using radioiodinated antibody. These data indicate that it is feasible to generate site-specific anti-peptide antibodies that are highly selective for mutant proteins in human tumors. The anti-peptide antibody described here, and other mutation site-specific antibodies, should be ideal candidates for tumor immunoimaging and immunotherapy.

  16. Expression and clinical value of EGFR in human meningiomas

    PubMed Central

    Backer-Grøndahl, Thomas; Ytterhus, Borgny; Granli, Unn S.; Lydersen, Stian; Gulati, Sasha; Torp, Sverre H.


    Background Meningiomas are common intracranial tumors in humans that frequently recur despite having a predominantly benign nature. Even though these tumors have been shown to commonly express EGFR/c-erbB1 (epidermal growth factor receptor), results from previous studies are uncertain regarding the expression of either intracellular or extracellular domains, cellular localization, activation state, relations to malignancy grade, and prognosis. Aims This study was designed to investigate the expression of the intracellular and extracellular domains of EGFR and of the activated receptor as well as its ligands EGF and TGFα in a large series of meningiomas with long follow-up data, and investigate if there exists an association between antibody expression and clinical and histological data. Methods A series of 186 meningiomas consecutively operated within a 10-year period was included. Tissue microarrays were constructed and immunohistochemically analyzed with antibodies targeting intracellular and extracellular domains of EGFR, phosphorylated receptor, and EGF and TGFα. Expression levels were recorded as a staining index (SI). Results Positive immunoreactivity was observed for all antibodies in most cases. There was in general high SIs for the intracellular domain of EGFR, phosphorylated EGFR, EGF, and TGFα but lower for the extracellular domain. Normal meninges were negative for all antibodies. Higher SIs for the phosphorylated EGFR were observed in grade II tumors compared with grade I (p = 0.018). Survival or recurrence was significantly decreased in the time to recurrence analysis (TTR) with high SI-scores of the extracellular domain in a univariable survival analysis (HR 1.152, CI (1.036–1.280, p = 0.009)). This was not significant in a multivariable analysis. Expression of the other antigens did not affect survival. Conclusion EGFR is overexpressed and in an activated state in human meningiomas. High levels of ligands also support this growth factor

  17. Phospholipid scramblase 1 is secreted by a lipid raft-dependent pathway and interacts with the extracellular matrix protein 1 in the dermal epidermal junction zone of human skin.


    Merregaert, Joseph; Van Langen, Johanna; Hansen, Uwe; Ponsaerts, Peter; El Ghalbzouri, Abdoelwaheb; Steenackers, Ellen; Van Ostade, Xaveer; Sercu, Sandy


    We examined the interaction of ECM1 (extracellular matrix protein 1) using yeast two-hybrid screening and identified the type II transmembrane protein, PLSCR1 (phospholipid scramblase 1), as a binding partner. This interaction was then confirmed by in vitro and in vivo co-immunoprecipitation experiments, and additional pull-down experiments with GST-tagged ECM1a fragments localized this interaction to occur within the tandem repeat region of ECM1a. Furthermore, immunohistochemical staining revealed a partial overlap of ECM1 and PLSCR1 in human skin at the basal epidermal cell layer. Moreover, in human skin equivalents, both proteins are expressed at the basal membrane in a dermal fibroblast-dependent manner. Next, immunogold electron microscopy of ultrathin human skin sections showed that ECM1 and PLSCR1 co-localize in the extracellular matrix, and using antibodies against ECM1 or PLSCR1 cross-linked to magnetic immunobeads, we were able to demonstrate PLSCR1-ECM1 interaction in human skin extracts. Furthermore, whereas ECM1 is secreted by the endoplasmic/Golgi-dependent pathway, PLSCR1 release from HaCaT keratinocytes occurs via a lipid raft-dependent mechanism, and is deposited in the extracellular matrix. In summary, we here demonstrate that PLSCR1 interacts with the tandem repeat region of ECM1a in the dermal epidermal junction zone of human skin and provide for the first time experimental evidence that PLSCR1 is secreted by an unconventional secretion pathway. These data suggest that PLSCR1 is a multifunctional protein that can function both inside and outside of the cell and together with ECM1 may play a regulatory role in human skin.

  18. Pertuzumab for the treatment of patients with human epidermal growth factor receptor 2-positive breast cancer in Japan.


    Osako, Tomofumi; Nishimura, Reiki; Nishiyama, Yasuyuki; Fujisue, Mamiko


    Pertuzumab, a novel anti-human epidermal growth factor receptor 2 (HER2) agent, is effective for metastatic HER2-positive breast cancer when used in combination with taxane and trastuzumab. The aim of the present study was to describe the use of pertuzumab in Japan. A phase I clinical trial of pertuzumab for HER2-positive metastatic breast cancer was first conducted in the United States in 2001 (study ID no. TOC2297g) and for HER2-positive solid cancers in Japan in 2004 (study ID no. JO17076). However, Japanese patients were not enrolled in a global phase II trial for metastatic breast cancer (study ID no. BO17929) and no phase II trial of pertuzumab for Japanese patients has yet been conducted. A phase III trial on pertuzumab for metastatic breast cancer (CLEOPATRA study), which included 53 Japanese patients, revealed that pertuzumab significantly prolonged progression-free and overall survival. However, the superiority of the pertuzumab group was not verified in the subgroup analysis of Japanese patients, which was not a preplanned analysis. Therefore, a postmarketing clinical trial for Japanese patients with HER2-positive metastatic breast cancer (COMACHI study) was initiated in November, 2013, to investigate the clinical effectiveness of pertuzumab in Japanese patients. As of December, 2014, global trials on pertuzumab in the metastatic and adjuvant settings are currently ongoing. These trials included Japanese patients with HER2-positive breast cancer. Pertuzumab was approved in Japan in August, 2013 due to the positive findings of the CLEOPATRA study. Unlike the United States and Europe, the Japanes Pharmaceutical and Medical Devices Agency approved the administration of pertuzumab as second- or later-line treatment for HER2-positive metastatic breast cancer, as well as first-line treatment. Furthermore, pertuzumab may be used in combination with other chemotherapeutic agents, with the exception of docetaxel. The approval of the expanded use of pertuzumab is

  19. Active post-marketing surveillance of the intralesional administration of human recombinant epidermal growth factor in diabetic foot ulcers

    PubMed Central


    Background After several exploratory and confirmatory clinical trials, the intralesional administration of human recombinant epidermal growth factor (hrEGF) has been approved for the treatment of advanced diabetic foot ulcers (DFU). The aim of this work was to evaluate the effectiveness and safety of this procedure in medical practice. Methods A prospective, post-marketing active pharmacosurveillance was conducted in 41 hospitals and 19 primary care polyclinics. Patients with DFU received hrEGF, 25 or 75 μg, intralesionally 3 times per week until complete granulation of the ulcer or 8 weeks maximum, adjuvant to standard wound care. Outcomes measured were complete granulation, amputations, and adverse events (AE) during treatment; complete lesion re-epithelization and relapses in follow-up (median: 1.2; maximum 4.2 years). Results The study included 1788 patients with 1835 DFU (81% Wagner’s grades 3 or 4; 43% ischemic) treated from May 2007 to April 2010. Complete granulation was observed in 76% of the ulcers in 5 weeks (median). Ulcer non-ischemic etiology (OR: 3.6; 95% CI: 2.8-4.7) and age (1.02; 1.01-1.03, for each younger year) were the main variables with influence on this outcome. During treatment, 220 (12%) amputations (171 major) were required in 214 patients, mostly in ischemic or Wagner’s grade 3 to 5 ulcers. Re-epithelization was documented in 61% of the 1659 followed-up cases; 5% relapsed per year. AE (4171) were reported in 47% of the subjects. Mild or moderate local pain and burning sensation, shivering and chills, were 87% of the events. Serious events, not related to treatment, occurred in 1.7% of the patients. Conclusions The favorable benefit/risk balance, confirms the beneficial clinical profile of intralesional hrEGF in the treatment of DFUs. PMID:24004460

  20. The Human Papillomavirus Type 16 E5 Oncoprotein Inhibits Epidermal Growth Factor Trafficking Independently of Endosome Acidification ▿

    PubMed Central

    Suprynowicz, Frank A.; Krawczyk, Ewa; Hebert, Jess D.; Sudarshan, Sawali R.; Simic, Vera; Kamonjoh, Christopher M.; Schlegel, Richard


    The human papillomavirus type 16 E5 oncoprotein (16E5) enhances acute, ligand-dependent activation of the epidermal growth factor receptor (EGFR) and concomitantly alkalinizes endosomes, presumably by binding to the 16-kDa “c” subunit of the V-ATPase proton pump (16K) and inhibiting V-ATPase function. However, the relationship between 16K binding, endosome alkalinization, and altered EGFR signaling remains unclear. Using an antibody that we generated against 16K, we found that 16E5 associated with only a small fraction of endogenous 16K in keratinocytes, suggesting that it was unlikely that E5 could significantly affect V-ATPase function by direct inhibition. Nevertheless, E5 inhibited the acidification of endosomes, as determined by a new assay using a biologically active, pH-sensitive fluorescent EGF conjugate. Since we also found that 16E5 did not alter cell surface EGF binding, the number of EGFRs on the cell surface, or the endocytosis of prebound EGF, we postulated that it might be blocking the fusion of early endosomes with acidified vesicles. Our studies with pH-sensitive and -insensitive fluorescent EGF conjugates and fluorescent dextran confirmed that E5 prevented endosome maturation (acidification and enlargement) by inhibiting endosome fusion. The E5-dependent defect in vesicle fusion was not due to detectable disruption of actin, tubulin, vimentin, or cytokeratin filaments, suggesting that membrane fusion was being directly affected rather than vesicle transport. Perhaps most importantly, while bafilomycin A1 (like E5) binds to 16K and inhibits endosome acidification, it did not mimic the ability of E5 to inhibit endosome enlargement or the trafficking of EGF. Thus, 16E5 alters EGF endocytic trafficking via a pH-independent inhibition of vesicle fusion. PMID:20686024

  1. Impact of palbociclib combinations on treatment of advanced estrogen receptor-positive/human epidermal growth factor 2-negative breast cancer

    PubMed Central

    Boér, Katalin


    Breast cancer is a heterogeneous disease with multiple subgroups based on clinical and molecular characteristics. For the largest subgroup of breast cancers, hormone receptor-positive/human epidermal growth factor 2 (HER2)-negative tumors, hormone treatment is the mainstay of therapy and is likely to result in significant improvement in disease outcomes. However, some of these cancers demonstrate de novo or acquired resistance to endocrine therapy. Despite intensive research to develop new strategies to enhance the efficacy of currently available treatment options for hormone receptor-positive breast cancer, progress has been slow, and there were few advances for a period of 10 years. In 2012, a new molecularly targeted therapeutic strategy, inhibition of mammalian target of rapamycin with everolimus, was introduced into clinical practice. Everolimus, in combination with a steroidal aromatase inhibitor, exemestane, resulted in an increase in progression-free survival, but not overall survival in patients with estrogen receptor (ER)+ve advanced disease who had progressed on hormone therapy. In 2015, the first cyclin-dependent kinases 4/6 (CDK4/6) inhibitor, palbociclib, received accelerated US Food and Drug Administration approval for use in combination with letrozole for the treatment of postmenopausal ER+ve/HER2−ve advanced breast cancer as initial, endocrine-based therapy. The addition of palbociclib to endocrine therapy resulted in longer progression-free survival than letrozole alone. One year later, palbociclib received a new indication, use in combination with fulvestrant, in both premenopausal and postmenopausal females with advanced breast cancer of the same subtype with disease progression following endocrine therapy. Adding palbociclib to fulvestrant resulted in a significantly increased median progression-free survival compared to fulvestrant monotherapy. These new combination regimens of palbociclib with endocrine agents represent an important

  2. Nanotechnology promotes the full-thickness diabetic wound healing effect of recombinant human epidermal growth factor in diabetic rats.


    Chu, Yuejie; Yu, Demin; Wang, Penghua; Xu, Jun; Li, Daiqing; Ding, Min


    We utilized a modified double-emulsion method with poly(lactic-co-glycolic acid) as the carrier to prepare recombinant human epidermal growth factor (rhEGF) nanoparticles. The morphology of the nanoparticles was detected by a transmission electron microscope. The particle size distribution was measured by a laser analyzer with a zeta potential meter. Enzyme-linked immunosorbent assays were performed to determine the rhEGF encapsulation efficiency and release model, and the proliferation of the mouse fibroblasts was analyzed by the MTT method. Diabetic rats with full-thickness wounds were divided into four groups according to different treatments: rhEGF nanoparticles, rhEGF stock solution, empty nanoparticles, and phosphate-buffered saline. Photographs were taken after the treatments to calculate the wound healing rates, and the granulation tissue of the wounds was sampled for pathologic slides. Proliferating cell nuclear antigen was assayed by immunohistochemistry. Our results showed that the rhEGF nanoparticles were around 193.5 nm (diameter), and the particle size distribution was uniform and dispersible. The encapsulation efficiency was 85.6% and rhEGF release lasted 24 hours. Compared with other groups, the rhEGF nanoparticles promoted the highest level of fibroblast proliferation, and this group showed the fastest healing rate. The number of proliferating cell nuclear antigen positive cells in the rhEGF nanoparticles group was higher than the other groups. We concluded that controlled release of rhEGF encapsulated in the nanoparticles enhanced rhEGF effects to stimulate cell proliferation and shorten the wound healing time.

  3. Toxic effects of several types of antifouling paints in human and rat hepatic or epidermal cells.


    de Sousa, G; Delescluse, C; Pralavorio, M; Perichaud, M; Avon, M; Lafaurie, M; Rahmani, R


    Fouling is the successive development of marine organisms on immersed surfaces, a process which has heavy negative economic impacts. Several antifouling technologies, generally based on the leaching of biocides from painted surfaces, have been developed, but these biocides are toxic to the environment. Hence, we compared the toxicity of several currently used paint lixiviats in rat hepatocytes, human HepG2 and HaCaT cells. Acute toxicity was assessed by the Neutral Red and MTT assays. Chronic effect was tested using induction of the 7-ethoxyresorufin-O-deethylase (EROD) activity as a marker. Large variations were observed among the various cell types or the antifouling formulations, both in terms of IC50 values (from approximately 0.5 to approximately 10%, v/v) and EROD induction (from approximately 1 to 10-fold over control). These differences appear to be related to variable biocide (copper compounds, organotins, etc...) concentrations in the different paint formulations, or to the specific metabolic capabilities of the cell system used.

  4. Aging decreases collagen IV expression in vivo in the dermo-epidermal junction and in vitro in dermal fibroblasts: possible involvement of TGF-β1.


    Feru, Jezabel; Delobbe, Etienne; Ramont, Laurent; Brassart, Bertrand; Terryn, Christine; Dupont-Deshorgue, Aurelie; Garbar, Christian; Monboisse, Jean-Claude; Maquart, Francois-Xavier; Brassart-Pasco, Sylvie


    Collagen IV is a major component of the dermo-epidermal junction (DEJ). To study expression of collagen IV upon aging in the DEJ and dermal fibroblasts isolated from the same patients. A model of senescent fibroblasts was developed in order to identify biological compounds that might restore the level of collagen IV. Skin fragments of women (30 to 70 years old) were collected. Localisation of collagen IV expression in the DEJ was studied by immunofluorescence. Fibroblast collagen IV expression was studied by real-time PCR, ELISA, and western blotting. Premature senescence was simulated by exposing fibroblasts to subcytotoxic H2O2 concentrations. Collagen IV decreased in the DEJ and fibroblasts relative to age. TGF-β1 treatment significantly increased collagen IV gene and protein expression in fibroblasts and restored expression in the model of senescence. Addition of TGF-β1-neutralizing antibody to fibroblast cultures decreased collagen IV expression. Taken together, the results suggest that the decrease in collagen IV in the DEJ, relative to age, could be due to a decrease in collagen IV expression by senescent dermal fibroblasts and may involve TGF-β1 signalling.

  5. Fundamental analysis of recombinant human epidermal growth factor in solution with biophysical methods.


    Kim, Nam Ah; Lim, Dae Gon; Lim, Jun Yeul; Kim, Ki Hyun; Jeong, Seong Hoon


    Correlation of thermodynamic and secondary structural stability of proteins at various buffer pHs was investigated using differential scanning calorimetry (DSC), dynamic light scattering (DLS) and attenuated total reflection Fourier-transform infrared spectroscopy (ATR FT-IR). Recombinant human epithelial growth factor (rhEGF) was selected as a model protein at various pHs and in different buffers, including phosphate, histidine, citrate, HEPES and Tris. Particle size and zeta potential of rhEGF at each selected pH of buffer were observed by DLS. Four factors were used to characterize the biophysical stability of rhEGF in solution: temperature at maximum heat flux (Tm), intermolecular β-sheet contents, zeta size and zeta potential. It was possible to predict the apparent isoelectric point (pI) of rhEGF as 4.43 by plotting pH against zeta potential. When the pH of the rhEGF solution increased or decreased from pI, the absolute zeta potential increased indicating a reduced possibility of protein aggregation, since Tm increased and β-sheet contents decreased. The contents of induced intermolecular β-sheet in Tris and HEPES buffers were the lowest. Thermodynamic stability of rhEGF markedly increased when pH is higher than 6.2 in histidine buffer where Tm of first transition was all above 70 °C. Moreover, rhEGF in Tris buffer was more thermodynamically stable than in HEPES with higher zeta potential. Tris buffer at pH 7.2 was concluded to be the most favorable.

  6. Expression of Human Skin-Specific Genes Defined by Transcriptomics and Antibody-Based Profiling

    PubMed Central

    Edqvist, Per-Henrik D.; Fagerberg, Linn; Hallström, Björn M.; Danielsson, Angelika; Edlund, Karolina; Uhlén, Mathias


    To increase our understanding of skin, it is important to define the molecular constituents of the cell types and epidermal layers that signify normal skin. We have combined a genome-wide transcriptomics analysis, using deep sequencing of mRNA from skin biopsies, with immunohistochemistry-based protein profiling to characterize the landscape of gene and protein expression in normal human skin. The transcriptomics and protein expression data of skin were compared to 26 (RNA) and 44 (protein) other normal tissue types. All 20,050 putative protein-coding genes were classified into categories based on patterns of expression. We found that 417 genes showed elevated expression in skin, with 106 genes expressed at least five-fold higher than that in other tissues. The 106 genes categorized as skin enriched encoded for well-known proteins involved in epidermal differentiation and proteins with unknown functions and expression patterns in skin, including the C1orf68 protein, which showed the highest relative enrichment in skin. In conclusion, we have applied a genome-wide analysis to identify the human skin-specific proteome and map the precise localization of the corresponding proteins in different compartments of the skin, to facilitate further functional studies to explore the molecular repertoire of normal skin and to identify biomarkers related to various skin diseases. PMID:25411189

  7. TNF-α and Th2 cytokines induce atopic dermatitis-like features on epidermal differentiation proteins and stratum corneum lipids in human skin equivalents.


    Danso, Mogbekeloluwa O; van Drongelen, Vincent; Mulder, Aat; van Esch, Jeltje; Scott, Hannah; van Smeden, Jeroen; El Ghalbzouri, Abdoelwaheb; Bouwstra, Joke A


    Atopic dermatitis (AD) is a chronic inflammatory skin disease in which the skin barrier function is disrupted. In this inflammatory AD environment, cytokines are upregulated, but the cytokine effect on the AD skin barrier is not fully understood. We aimed to investigate the influence of Th2 (IL-4, IL-13, IL-31) and pro-inflammatory (tumor necrosis factor alpha (TNF-α)) cytokines on epidermal morphogenesis, proliferation, differentiation, and stratum corneum lipid properties. For this purpose, we used the Leiden epidermal model (LEM) in which the medium was supplemented with these cytokines. Our results show that IL-4, IL-13, IL-31, and TNF-α induce spongiosis, augment TSLP secretion by keratinocytes, and alter early and terminal differentiation-protein expression in LEMs. TNF-α alone or in combination with Th2 cytokines decreases the level of long chain free fatty acids (FFAs) and ester linked ω-hydroxy (EO) ceramides, consequently affecting the lipid organization. IL-31 increases long chain FFAs in LEMs but decreases relative abundance of EO ceramides. These findings clearly show that supplementation with TNF-α and Th2 cytokines influence epidermal morphogenesis and barrier function. As a result, these LEMs show similar characteristics as found in AD skin and can be used as an excellent tool for screening formulations and drugs for the treatment of AD.

  8. Human Epidermal Growth Factor Receptor 2 (HER2) –Specific Chimeric Antigen Receptor–Modified T Cells for the Immunotherapy of HER2-Positive Sarcoma

    PubMed Central

    Ahmed, Nabil; Brawley, Vita S.; Hegde, Meenakshi; Robertson, Catherine; Ghazi, Alexia; Gerken, Claudia; Liu, Enli; Dakhova, Olga; Ashoori, Aidin; Corder, Amanda; Gray, Tara; Wu, Meng-Fen; Liu, Hao; Hicks, John; Rainusso, Nino; Dotti, Gianpietro; Mei, Zhuyong; Grilley, Bambi; Gee, Adrian; Rooney, Cliona M.; Brenner, Malcolm K.; Heslop, Helen E.; Wels, Winfried S.; Wang, Lisa L.; Anderson, Peter; Gottschalk, Stephen


    Purpose The outcome for patients with metastatic or recurrent sarcoma remains poor. Adoptive therapy with tumor-directed T cells is an attractive therapeutic option but has never been evaluated in sarcoma. Patients and Methods We conducted a phase I/II clinical study in which patients with recurrent/refractory human epidermal growth factor receptor 2 (HER2) –positive sarcoma received escalating doses (1 × 104/m2 to 1 × 108/m2) of T cells expressing an HER2-specific chimeric antigen receptor with a CD28.ζ signaling domain (HER2-CAR T cells). Results We enrolled 19 patients with HER2-positive tumors (16 osteosarcomas, one Ewing sarcoma, one primitive neuroectodermal tumor, and one desmoplastic small round cell tumor). HER2-CAR T-cell infusions were well tolerated with no dose-limiting toxicity. At dose level 3 (1 × 105/m2) and above, we detected HER2-CAR T cells 3 hours after infusion by quantitative polymerase chain reaction in 14 of 16 patients. HER2-CAR T cells persisted for at least 6 weeks in seven of the nine evaluable patients who received greater than 1 × 106/m2 HER2-CAR T cells (P = .005). HER2-CAR T cells were detected at tumor sites of two of two patients examined. Of 17 evaluable patients, four had stable disease for 12 weeks to 14 months. Three of these patients had their tumor removed, with one showing ≥ 90% necrosis. The median overall survival of all 19 infused patients was 10.3 months (range, 5.1 to 29.1 months). Conclusion This first evaluation of the safety and efficacy of HER2-CAR T cells in patients with cancer shows the cells can persist for 6 weeks without evident toxicities, setting the stage for studies that combine HER2-CAR T cells with other immunomodulatory approaches to enhance their expansion and persistence. PMID:25800760

  9. Urine acidification has no effect on peroxisome proliferator-activated receptor (PPAR) signaling or epidermal growth factor (EGF) expression in rat urinary bladder urothelium

    SciTech Connect

    Achanzar, William E. Moyer, Carolyn F.; Marthaler, Laura T.; Gullo, Russell; Chen, Shen-Jue; French, Michele H.; Watson, Linda M.; Rhodes, James W.; Kozlosky, John C.; White, Melvin R.; Foster, William R.; Burgun, James J.; Car, Bruce D.; Cosma, Gregory N.; Dominick, Mark A.


    We previously reported prevention of urolithiasis and associated rat urinary bladder tumors by urine acidification (via diet acidification) in male rats treated with the dual peroxisome proliferator-activated receptor (PPAR){alpha}/{gamma} agonist muraglitazar. Because urine acidification could potentially alter PPAR signaling and/or cellular proliferation in urothelium, we evaluated urothelial cell PPAR{alpha}, PPAR{delta}, PPAR{gamma}, and epidermal growth factor receptor (EGFR) expression, PPAR signaling, and urothelial cell proliferation in rats fed either a normal or an acidified diet for 5, 18, or 33 days. A subset of rats in the 18-day study also received 63 mg/kg of the PPAR{gamma} agonist pioglitazone daily for the final 3 days to directly assess the effects of diet acidification on responsiveness to PPAR{gamma} agonism. Urothelial cell PPAR{alpha} and {gamma} expression and signaling were evaluated in the 18- and 33-day studies by immunohistochemical assessment of PPAR protein (33-day study only) and quantitative real-time polymerase chain reaction (qRT-PCR) measurement of PPAR-regulated gene expression. In the 5-day study, EGFR expression and phosphorylation status were evaluated by immunohistochemical staining and egfr and akt2 mRNA levels were assessed by qRT-PCR. Diet acidification did not alter PPAR{alpha}, {delta}, or {gamma} mRNA or protein expression, PPAR{alpha}- or {gamma}-regulated gene expression, total or phosphorylated EGFR protein, egfr or akt2 gene expression, or proliferation in urothelium. Moreover, diet acidification had no effect on pioglitazone-induced changes in urothelial PPAR{gamma}-regulated gene expression. These results support the contention that urine acidification does not prevent PPAR{gamma} agonist-induced bladder tumors by altering PPAR{alpha}, {gamma}, or EGFR expression or PPAR signaling in rat bladder urothelium.

  10. Protective Effect of Tropical Highland Blackberry Juice (Rubus adenotrichos Schltdl.) Against UVB-Mediated Damage in Human Epidermal Keratinocytes and in a Reconstituted Skin Equivalent Model

    PubMed Central

    Calvo-Castro, Laura; Syed, Deeba N.; Chamcheu, Jean C.; Vilela, Fernanda M. P.; Pérez, Ana M.; Vaillant, Fabrice; Rojas, Miguel; Mukhtar, Hasan


    Solar ultraviolet (UV) radiation, particularly its UVB (280–320 nm) spectrum, is the primary environmental stimulus leading to skin carcinogenesis. Several botanical species with antioxidant properties have shown photochemopreventive effects against UVB damage. Costa Rica’s tropical highland blackberry (Rubus adenotrichos) contains important levels of phenolic compounds, mainly ellagitannins and anthocyanins, with strong antioxidant properties. In this study, we examined the photochemopreventive effect of R. adenotrichos blackberry juice (BBJ) on UVB-mediated responses in human epidermal keratinocytes and in a three-dimensional (3D) reconstituted normal human skin equivalent (SE). Pretreatment (2 h) and posttreatment (24 h) of normal human epidermal keratinocytes (NHEKs) with BBJ reduced UVB (25 mJ cm−2)-mediated (1) cyclobutane pyrimidine dimers (CPDs) and (2) 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) formation. Furthermore, treatment of NHEKs with BBJ increased UVB-mediated (1) poly(ADP-ribose) polymerase cleavage and (2) activation of caspases 3, 8 and 9. Thus, BBJ seems to alleviate UVB-induced effects by reducing DNA damage and increasing apoptosis of damaged cells. To establish the in vivo significance of these findings to human skin, immunohistochemistry studies were performed in a 3D SE model, where BBJ was also found to decrease CPDs formation. These data suggest that BBJ may be developed as an agent to ameliorate UV-induced skin damage. PMID:23711186

  11. Protective effect of tropical highland blackberry juice (Rubus adenotrichos Schltdl.) against UVB-mediated damage in human epidermal keratinocytes and in a reconstituted skin equivalent model.


    Calvo-Castro, Laura; Syed, Deeba N; Chamcheu, Jean C; Vilela, Fernanda M P; Pérez, Ana M; Vaillant, Fabrice; Rojas, Miguel; Mukhtar, Hasan


    Solar ultraviolet (UV) radiation, particularly its UVB (280-320 nm) spectrum, is the primary environmental stimulus leading to skin carcinogenesis. Several botanical species with antioxidant properties have shown photochemopreventive effects against UVB damage. Costa Rica's tropical highland blackberry (Rubus adenotrichos) contains important levels of phenolic compounds, mainly ellagitannins and anthocyanins, with strong antioxidant properties. In this study, we examined the photochemopreventive effect of R. adenotrichos blackberry juice (BBJ) on UVB-mediated responses in human epidermal keratinocytes and in a three-dimensional (3D) reconstituted normal human skin equivalent (SE). Pretreatment (2 h) and posttreatment (24 h) of normal human epidermal keratinocytes (NHEKs) with BBJ reduced UVB (25 mJ cm(-2))-mediated (1) cyclobutane pyrimidine dimers (CPDs) and (2) 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) formation. Furthermore, treatment of NHEKs with BBJ increased UVB-mediated (1) poly(ADP-ribose) polymerase cleavage and (2) activation of caspases 3, 8 and 9. Thus, BBJ seems to alleviate UVB-induced effects by reducing DNA damage and increasing apoptosis of damaged cells. To establish the in vivo significance of these findings to human skin, immunohistochemistry studies were performed in a 3D SE model, where BBJ was also found to decrease CPDs formation. These data suggest that BBJ may be developed as an agent to ameliorate UV-induced skin damage.

  12. TPRV-1 expression in human preeclamptic placenta.


    Martínez, Nora; Abán, Cyntia E; Leguizamón, Gustavo F; Damiano, Alicia E; Farina, Mariana G


    Preeclampsia is a multisystem disorder unique to human pregnancy, characterized by abnormal placentation. Although its causes remain unclear, it is known that the expression of several transporters is altered. Transient receptor potential vanilloid 1 (TRPV-1) is a nonselective cation channel, present in human placenta. Here, we evaluated the expression of TRPV-1 in preeclamptic placentas. We observed a deregulation in TRPV-1 expression in these placentas which may explain the impaired Ca(2+) homeostasis found in preeclampsia.

  13. Epidermal RelA specifically restricts contact allergen-induced inflammation and apoptosis in skin.


    Kumari, Snehlata; Herzberg, Benjamin; Pofahl, Ruth; Krieg, Thomas; Haase, Ingo


    Strong inhibition of NF-κB signaling in the epidermis results in spontaneous skin inflammation in mice and men. As there is evidence for linkage between polymorphisms within the NF-κB signaling pathway and human inflammatory skin phenotypes, we asked whether partial functional inhibition of NF-κB signaling in epidermal keratinocytes can modulate clinically relevant skin inflammation. We therefore mutated rela specifically in the epidermis of mice (RelA(E-MUT) mice). These mice show no inflammatory phenotype. Induction of contact allergy, but not croton oil-induced irritant dermatitis, resulted in stronger ear swelling and increased epidermal thickness in RelA(E-MUT) mice. Both contact allergen and croton oil treatment led to increased expression of calgranulins A and B (S100A8/A9) in RelA(E-MUT) mice. Epidermal hyperproliferation in RelA(E-MUT) mice was non-cell autonomous as cultured primary epidermal keratinocytes from RelA(E-MUT) mice showed reduced proliferation compared with controls. These results demonstrate that epidermal RelA specifically regulates delayed-type hypersensitivity-induced skin inflammation. In addition, we describe here an essential but nonspecific function of RelA in the protection of epidermal keratinocytes from apoptosis. Our study identifies functions of NF-κB signaling in the epidermis and corroborates a specific role of epidermal keratinocytes in the regulation of skin inflammation.

  14. Impact of Cell-surface Antigen Expression on Target Engagement and Function of an Epidermal Growth Factor Receptor × c-MET Bispecific Antibody*

    PubMed Central

    Jarantow, Stephen W.; Bushey, Barbara S.; Pardinas, Jose R.; Boakye, Ken; Lacy, Eilyn R.; Sanders, Renouard; Sepulveda, Manuel A.; Moores, Sheri L.; Chiu, Mark L.


    The efficacy of engaging multiple drug targets using bispecific antibodies (BsAbs) is affected by the relative cell-surface protein levels of the respective targets. In this work, the receptor density values were correlated to the in vitro activity of a BsAb (JNJ-61186372) targeting epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor (c-MET). Simultaneous binding of the BsAb to both receptors was confirmed in vitro. By using controlled Fab-arm exchange, a set of BsAbs targeting EGFR and c-MET was generated to establish an accurate receptor quantitation of a panel of lung and gastric cancer cell lines expressing heterogeneous levels of EGFR and c-MET. EGFR and c-MET receptor density levels were correlated to the respective gene expression levels as well as to the respective receptor phosphorylation inhibition values. We observed a bias in BsAb binding toward the more highly expressed of the two receptors, EGFR or c-MET, which resulted in the enhanced in vitro potency of JNJ-61186372 against the less highly expressed target. On the basis of these observations, we propose an avidity model of how JNJ-61186372 engages EGFR and c-MET with potentially broad implications for bispecific drug efficacy and design. PMID:26260789

  15. Impact of Cell-surface Antigen Expression on Target Engagement and Function of an Epidermal Growth Factor Receptor × c-MET Bispecific Antibody.


    Jarantow, Stephen W; Bushey, Barbara S; Pardinas, Jose R; Boakye, Ken; Lacy, Eilyn R; Sanders, Renouard; Sepulveda, Manuel A; Moores, Sheri L; Chiu, Mark L


    The efficacy of engaging multiple drug targets using bispecific antibodies (BsAbs) is affected by the relative cell-surface protein levels of the respective targets. In this work, the receptor density values were correlated to the in vitro activity of a BsAb (JNJ-61186372) targeting epidermal growth factor receptor (EGFR) and hepatocyte growth factor receptor (c-MET). Simultaneous binding of the BsAb to both receptors was confirmed in vitro. By using controlled Fab-arm exchange, a set of BsAbs targeting EGFR and c-MET was generated to establish an accurate receptor quantitation of a panel of lung and gastric cancer cell lines expressing heterogeneous levels of EGFR and c-MET. EGFR and c-MET receptor density levels were correlated to the respective gene expression levels as well as to the respective receptor phosphorylation inhibition values. We observed a bias in BsAb binding toward the more highly expressed of the two receptors, EGFR or c-MET, which resulted in the enhanced in vitro potency of JNJ-61186372 against the less highly expressed target. On the basis of these observations, we propose an avidity model of how JNJ-61186372 engages EGFR and c-MET with potentially broad implications for bispecific drug efficacy and design.

  16. Activation of TLR3 in keratinocytes increases expression of genes involved in formation of the epidermis, lipid accumulation and epidermal organelles

    PubMed Central

    Borkowski, Andrew W.; Park, Kyungho; Uchida, Yoshikazu; Gallo, Richard L.


    Injury to the skin, and the subsequent release of non-coding double-stranded RNA from necrotic keratinocytes, has been identified as an endogenous activator of Toll-like receptor 3 (TLR3). Since changes in keratinocyte growth and differentiation follow injury, we hypothesized that TLR3 might trigger some elements of the barrier repair program in keratinocytes. Double-stranded RNA was observed to induce TLR3-dependent increases in human keratinocyte mRNA abundance for ABCA12 (ATP-binding cassette, sub-family A, member 12), glucocerebrosidase, acid sphingomyelinase, and transglutaminase 1. Additionally, treatment with double-stranded RNA resulted in increases in sphingomyelin and morphologic changes including increased epidermal lipid staining by oil-red O and TLR3-dependent increases in lamellar bodies and keratohyalin granules. These observations show that double-stranded RNA can stimulate some events in keratinocytes that are important for skin barrier repair and maintenance. PMID:23353987

  17. In vitro and in vivo comparison of dermal irritancy of jet fuel exposure using EpiDerm (EPI-200) cultured human skin and hairless rats.


    Chatterjee, Abhijit; Babu, R Jayachandra; Klausner, M; Singh, Mandip


    The purpose of this study was to evaluate an in vitro EpiDerm human skin model (EPI-200) to study the irritation potential of jet fuels (JP-8 and JP-8+100). Parallel in vivo studies on hairless rats on the dermal irritancy of jet fuels were also conducted. Cytokines are an important part of an irritation and inflammatory cascade, which are expressed in upon dermal exposures of irritant chemicals even when there are no obvious visible marks of irritation on the skin. We have chosen two primary cytokines (IL-1alpha and TNF-1alpha) as markers of irritation response of jet fuels. Initially, the EPI-200 was treated with different quantities of JP-8 and JP-8+100 to determine quantities which did not cause significant cytotoxicity, as monitored using the MTT assay and paraffin embedded histological cross-sections. Volumes of 2.5-50 microl/tissue (approximately 4.0-78 microl/cm2) of JP-8 and JP-8+100 showed a dose dependent loss of tissue viability and morphological alterations of the tissue. At a quantity of 1.25 microl/tissue (approximately 2.0 microl/cm2), no significant change in tissue viability or morphology was observed for exposure time extending to 48 h. Nonetheless, this dose induced significant increase in IL-1alpha and TNF-alpha release versus non-treated controls after 24 and 48 h. In addition, IL-1alpha release for JP-8+100 was significantly higher than that observed for JP-8, but TNF-alpha release after 48 h exposure to these two jet fuels was the same. These findings parallel in vivo studies on hairless rats, which indicated higher irritation levels due to JP-8+100 versus JP-8. In vivo, transepidermal water loss (TEWL) and IL-1alpha expression levels followed the order JP-8+100 > JP-8 > control. Further, in vivo TNF-alpha levels for JP-8 and JP-8+100 were also elevated but not significantly different from one another. In aggregate, these findings indicate that EPI-200 tissue model can be utilized as an alternative to the use of animals in evaluating dermal

  18. Effect of topically applied dexpanthenol on epidermal barrier function and stratum corneum hydration. Results of a human in vivo study.


    Gehring, W; Gloor, M


    In a randomized, double-blind, placebo-controlled study the effect of topical dexpanthenol (CAS 81-13-0) formulated in two different lipophilic vehicles on epidermal barrier function in vivo was carried out. Seven days' treatment with dexpanthenol improved stratum corneum hydration and reduced transepidermal water loss. Active treatment was statistically different from the vehicle control on both measures. Our results suggest that topical dexpanthenol formulated in either lipophilic vehicle stabilizes the skin barrier function.

  19. Expressed miRNAs target feather related mRNAs involved in cell signaling, cell adhesion and structure during chicken epidermal development.


    Bao, Weier; Greenwold, Matthew J; Sawyer, Roger H


    MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression at the post-transcriptional level. Previous studies have shown that miRNA regulation contributes to a diverse set of processes including cellular differentiation and morphogenesis which leads to the creation of different cell types in multicellular organisms and is thus key to animal development. Feathers are one of the most distinctive features of extant birds and are important for multiple functions including flight, thermal regulation, and sexual selection. However, the role of miRNAs in feather development has been woefully understudied despite the identification of cell signaling pathways, cell adhesion molecules and structural genes involved in feather development. In this study, we performed a microarray experiment comparing the expression of miRNAs and mRNAs among three embryonic stages of development and two tissues (scutate scale and feather) of the chicken. We combined this expression data with miRNA target prediction tools and a curated list of feather related genes to produce a set of 19 miRNA-mRNA duplexes. These targeted mRNAs have been previously identified as important cell signaling and cell adhesion genes as well as structural genes involved in feather and scale morphogenesis. Interestingly, the miRNA target site of the cell signaling pathway gene, Aldehyde Dehydrogenase 1 Family, Member A3 (ALDH1A3), is unique to birds indicating a novel role in Aves. The identified miRNA target site of the cell adhesion gene, Tenascin C (TNC), is only found in specific chicken TNC splice variants that are differentially expressed in developing scutate scale and feather tissue indicating an important role of miRNA regulation in epidermal differentiation. Additionally, we found that β-keratins, a major structural component of avian and reptilian epidermal appendages, are targeted by multiple miRNA genes. In conclusion, our work provides quantitative expression data on miRNAs and m

  20. Zinc pyrithione impairs zinc homeostasis and upregulates stress response gene expression in reconstructed human epidermis

    PubMed Central

    Lamore, Sarah D.


    Zinc ion homeostasis plays an important role in human cutaneous biology where it is involved in epidermal differentiation and barrier function, inflammatory and antimicrobial regulation, and wound healing. Zinc-based compounds designed for topical delivery therefore represent an important class of cutaneous therapeutics. Zinc pyrithione (ZnPT) is an FDA-approved microbicidal agent used worldwide in over-the-counter topical antimicrobials, and has also been examined as an investigational therapeutic targeting psoriasis and UVB-induced epidermal hyperplasia. Recently, we have demonstrated that cultured primary human skin keratinocytes display an exquisite sensitivity to nanomolar ZnPT concentrations causing induction of heat shock response gene expression and poly(ADP-ribose) polymerase (PARP)-dependent cell death (Cell Stress Chaperones 15:309–322, 2010). Here we demonstrate that ZnPT causes rapid accumulation of intracellular zinc in primary keratinocytes as observed by quantitative fluorescence microscopy and inductively coupled plasma mass spectrometry (ICP-MS), and that PARP activation, energy crisis, and genomic impairment are all antagonized by zinc chelation. In epidermal reconstructs (EpiDerm™) exposed to topical ZnPT (0.1–2% in Vanicream™), ICP-MS demonstrated rapid zinc accumulation, and expression array analysis demonstrated upregulation of stress response genes encoding metallothionein-2A (MT2A), heat shock proteins (HSPA6, HSPA1A, HSPB5, HSPA1L, DNAJA1, HSPH1, HSPD1, HSPE1), antioxidants (SOD2, GSTM3, HMOX1), and the cell cycle inhibitor p21 (CDKN1A). IHC analysis of ZnPT-treated EpiDerm™ confirmed upregulation of Hsp70 and TUNEL-positivity. Taken together our data demonstrate that ZnPT impairs zinc ion homeostasis and upregulates stress response gene expression in primary keratinocytes and reconstructed human epidermis, activities that may underlie therapeutic and toxicological effects of this topical drug. PMID:21424779

  1. Zinc pyrithione impairs zinc homeostasis and upregulates stress response gene expression in reconstructed human epidermis.


    Lamore, Sarah D; Wondrak, Georg T


    Zinc ion homeostasis plays an important role in human cutaneous biology where it is involved in epidermal differentiation and barrier function, inflammatory and antimicrobial regulation, and wound healing. Zinc-based compounds designed for topical delivery therefore represent an important class of cutaneous therapeutics. Zinc pyrithione (ZnPT) is an FDA-approved microbicidal agent used worldwide in over-the-counter topical antimicrobials, and has also been examined as an investigational therapeutic targeting psoriasis and UVB-induced epidermal hyperplasia. Recently, we have demonstrated that cultured primary human skin keratinocytes display an exquisite sensitivity to nanomolar ZnPT concentrations causing induction of heat shock response gene expression and poly(ADP-ribose) polymerase (PARP)-dependent cell death (Cell Stress Chaperones 15:309-322, 2010). Here we demonstrate that ZnPT causes rapid accumulation of intracellular zinc in primary keratinocytes as observed by quantitative fluorescence microscopy and inductively coupled plasma mass spectrometry (ICP-MS), and that PARP activation, energy crisis, and genomic impairment are all antagonized by zinc chelation. In epidermal reconstructs (EpiDerm™) exposed to topical ZnPT (0.1-2% in Vanicream™), ICP-MS demonstrated rapid zinc accumulation, and expression array analysis demonstrated upregulation of stress response genes encoding metallothionein-2A (MT2A), heat shock proteins (HSPA6, HSPA1A, HSPB5, HSPA1L, DNAJA1, HSPH1, HSPD1, HSPE1), antioxidants (SOD2, GSTM3, HMOX1), and the cell cycle inhibitor p21 (CDKN1A). IHC analysis of ZnPT-treated EpiDerm™ confirmed upregulation of Hsp70 and TUNEL-positivity. Taken together our data demonstrate that ZnPT impairs zinc ion homeostasis and upregulates stress response gene expression in primary keratinocytes and reconstructed human epidermis, activities that may underlie therapeutic and toxicological effects of this topical drug.

  2. HER2 mediates epidermal growth factor-induced down-regulation of E-cadherin in human ovarian cancer cells.


    Cheng, Jung-Chien; Qiu, Xin; Chang, Hsun-Ming; Leung, Peter C K


    Overexpression of HER2 is correlated with a poor prognosis in many types of human cancers. Due to the interaction between HER2 and other ErbB receptors, HER2 is implicated in the EGF family of ligands-regulated tumor progression. In ovarian cancer, although the relationships between HER2 amplification and patient prognosis remain controversial, the underlying molecular mechanisms of HER2-mediated tumor progression are not fully understood. Our previous studies demonstrated that EGF induces ovarian cancer cell invasion by down-regulating E-cadherin expression through the up-regulation of its transcriptional repressors, Snail and Slug. It has been shown that overexpression of HER2 down-regulates E-cadherin expression in human mammary epithelial cells. However, whether HER2 mediates EGF-induced down-regulation of E-cadherin remains unknown. In this study, we examined the potential role of HER2 in EGF-induced down-regulation of E-cadherin and increased cell invasion. We show that EGF treatment induces the interaction of EGFR with HER2 and increases the activation of HER2 in human ovarian cancer cells; we also show that these effects are diminished by knockdown of EGFR. Importantly, treatment with HER2-specific tyrosine kinase inhibitor, AG825, and HER2 siRNA diminished the up-regulation of Snail and Slug as well as the down-regulation of E-cadherin by EGF. Finally, we also show that EGF-induced cell invasion was attenuated by treatment with HER2 siRNA. This study demonstrates an important role for HER2 in mediating the effects of EGF on Snail, Slug and E-cadherin expression as well as invasiveness in human ovarian cancer cells.

  3. Ultraviolet radiation-induced tumor necrosis factor alpha, which is linked to the development of cutaneous SCC, modulates differential epidermal microRNAs expression

    PubMed Central

    Singh, Ashok; Willems, Estelle; Singh, Anupama; Hafeez, Bilal Bin; Ong, Irene M.; Mehta, Suresh L.; Verma, Ajit Kumar


    Chronic exposure to ultraviolet radiation (UVR) is linked to the development of cutaneous squamous cell carcinoma (SCC), a non-melanoma form of skin cancer that can metastasize. Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, is linked to UVR-induced development of SCC. To find clues about the mechanisms by which TNFα may promote UVR-induced development of SCC, we investigated changes in the expression profiling of microRNAs (miRNA), a novel class of short noncoding RNAs, which affects translation and stability of mRNAs. In this experiment, TNFα knockout (TNFα KO) mice and their wild type (WT) littermates were exposed to acute UVR (2.0 kJ/m2) and the expression profiling of epidermal miRNA was determined 4hr post UVR exposure. TNFα deletion in untreated WT mice resulted in differential expression (log fold change>1) of seventeen miRNA. UVR exposure in WT mice induced differential expression of 22 miRNA. However, UVR exposure in TNFα KO mice altered only two miRNAs. Four miRNA, were differentially expressed between WT+UVR and TNFα KO+UVR groups. Differentially expressed selected miRNAs were further validated using real time PCR. Few of the differentially expressed miRNAs (miR-31-5p, miR-196a-5p, miR-127-3p, miR-206-3p, miR-411-5p, miR-709, and miR-322-5p) were also observed in UVR-induced SCC. Finally, bio-informatics analysis using DIANA, MIRANDA, Target Scan, and miRDB algorithms revealed a link with major UVR-induced pathways (MAPK, PI3K-Akt, transcriptional mis-regulation, Wnt, and TGF-beta). PMID:26918454

  4. Ultraviolet radiation-induced tumor necrosis factor alpha, which is linked to the development of cutaneous SCC, modulates differential epidermal microRNAs expression.


    Singh, Ashok; Willems, Estelle; Singh, Anupama; Hafeez, Bilal Bin; Ong, Irene M; Mehta, Suresh L; Verma, Ajit Kumar


    Chronic exposure to ultraviolet radiation (UVR) is linked to the development of cutaneous squamous cell carcinoma (SCC), a non-melanoma form of skin cancer that can metastasize. Tumor necrosis factor-alpha (TNFα), a pro-inflammatory cytokine, is linked to UVR-induced development of SCC. To find clues about the mechanisms by which TNFα may promote UVR-induced development of SCC, we investigated changes in the expression profiling of microRNAs (miRNA), a novel class of short noncoding RNAs, which affects translation and stability of mRNAs. In this experiment, TNFα knockout (TNFα KO) mice and their wild type (WT) littermates were exposed to acute UVR (2.0 kJ/m2) and the expression profiling of epidermal miRNA was determined 4hr post UVR exposure. TNFα deletion in untreated WT mice resulted in differential expression (log fold change>1) of seventeen miRNA. UVR exposure in WT mice induced differential expression of 22 miRNA. However, UVR exposure in TNFα KO mice altered only two miRNAs. Four miRNA, were differentially expressed between WT+UVR and TNFα KO+UVR groups. Differentially expressed selected miRNAs were further validated using real time PCR. Few of the differentially expressed miRNAs (miR-31-5p, miR-196a-5p, miR-127-3p, miR-206-3p, miR-411-5p, miR-709, and miR-322-5p) were also observed in UVR-induced SCC. Finally, bio-informatics analysis using DIANA, MIRANDA, Target Scan, and miRDB algorithms revealed a link with major UVR-induced pathways (MAPK, PI3K-Akt, transcriptional mis-regulation, Wnt, and TGF-beta).

  5. Conversion of epidermal growth factor receptor 2 and hormone receptor expression in breast cancer metastases to the brain

    PubMed Central


    Introduction We investigated the status of estrogen receptor alpha (ERα), progesterone receptor (PR), and epidermal growth factor receptor 2 (HER2) in primary tumor and in the corresponding brain metastases in a consecutive series of breast cancer patients. Additionally, we studied factors potentially influencing conversion and evaluated its association with survival. Methods The study group included 120 breast cancer patients. ERα, PR, and HER2 status in primary tumors and in matched brain metastases was determined centrally by immunohistochemistry and/or fluorescence in situ hybridization. Results Using the Allred score of ≥ 3 as a threshold, conversion of ERα and PR in brain metastases occurred in 29% of cases for both receptors, mostly from positive to negative. Conversion of HER2 occurred in 14% of patients and was more balanced either way. Time to brain relapse and the use of chemotherapy or trastuzumab did not influence conversion, whereas endocrine therapy induced conversion of ERα (P = 0.021) and PR (P = 0.001), mainly towards their loss. Receptor conversion had no significant impact on survival. Conclusions Receptor conversion, particularly loss of hormone receptors, is a common event in brain metastases from breast cancer, and endocrine therapy may increase its incidence. Receptor conversion does not significantly affect survival. PMID:22898337

  6. The organic osmolyte betaine induces keratin 2 expression in rat epidermal keratinocytes - A genome-wide study in UVB irradiated organotypic 3D cultures.


    Rauhala, Leena; Hämäläinen, Lasse; Dunlop, Thomas W; Pehkonen, Petri; Bart, Geneviève; Kokkonen, Maarit; Tammi, Markku; Tammi, Raija; Pasonen-Seppänen, Sanna


    The moisturizing and potentially protective properties of the organic osmolyte betaine (trimethylglycine) have made it an attractive component for skin care products. Its wide use despite the lack of comprehensive studies addressing its specific effects in skin led us to characterize the molecular targets of betaine in keratinocytes and to explore, whether it modifies the effects of acute UVB exposure. Genome-wide expression analysis was performed on organotypic cultures of rat epidermal keratinocytes, treated either with betaine (10mM), UVB (30 mJ/cm(2)) or their combination. Results were verified with qRT-PCR, western blotting and immunohistochemistry. Additionally, cell proliferation and differentiation were analyzed. Among the 89 genes influenced by betaine, the differentiation marker keratin 2 showed the highest upregulation, which was also confirmed at protein level. Expression of Egr1, a transcription factor, and Purkinje cell protein 4, a regulator of Ca(2+)/calmodulin metabolism, also increased, while downregulated genes included several ion-channel components, such as Fxyd2. Bioinformatics analyses suggest that genes modulated by betaine are involved in DNA replication, might counteract UV-induced processes, and include many targets of transcription factors associated with cell proliferation and differentiation. Our results indicate that betaine controls unique gene expression pathways in keratinocytes, including some involved in differentiation.

  7. Down-Regulation of ClC-3 Expression Reduces Epidermal Stem Cell Migration by Inhibiting Volume-Activated Chloride Currents.


    Guo, Rui; Pan, Fuqiang; Tian, Yanping; Li, Hongli; Li, Shirong; Cao, Chuan


    ClC-3, a member of the ClC chloride (Cl(-)) channel family, has recently been proposed as the primary Cl(-) channel involved in cell volume regulation. Changes in cell volume influence excitability, contraction, migration, pathogen-host interactions, cell proliferation, and cell death processes. In this study, expression and function of ClC-3 channels were investigated during epidermal stem cell (ESC) migration. We observed differential expression of CLC-3 regulates migration of ESCs. Further, whole-cell patch-clamp recordings and image analysis demonstrated ClC-3 expression affected volume-activated Cl(-) current (I Cl,Vol) within ESCs. Live cell imaging systems, designed to observe cellular responses to overexpression and suppression of ClC-3 in real time, indicated ClC-3 may regulate ESC migratory dynamics. We employed IMARIS software to analyze the velocity and distance of ESC migration in vitro to demonstrate the function of ClC-3 channel in ESCs. As our data suggest volume-activated Cl(-) channels play a vital role in migration of ESCs, which contribute to skin repair by migrating from neighboring unwounded epidermis infundibulum, hair follicle or sebaceous glands, ClC-3 may represent a new and valuable target for stem cell therapies.

  8. Quantitative differences in host cell reactivation of ultraviolet-damaged virus in human skin fibroblasts and epidermal keratinocytes cultured from the same foreskin biopsy

    SciTech Connect

    Tyrrell, R.M.; Pidoux, M.


    Repair efficiency of cultured cells may be estimated by measuring the ability of a particular cell type to support virus damaged by an appropriate agent. In this study we have compared the inactivation of ultraviolet (254 nm)-damaged herpes simplex virus in human fibroblast and epidermal keratinocyte cell lines derived from the same foreskin biopsy and found the epithelial cells to be a factor of 3 times less efficient in supporting the damaged virus. The two different cell types show comparable ultraviolet inactivation of clone-forming ability, indicating that the difference is specific to viral host cell reactivation. This study required the development of a quantitative infectious centers assay for the measurement of viral titer in human epithelial cells, a system which may be of more general application in studies of potential human carcinogens.

  9. Epidermal growth factor-expressing Lactococcus lactis enhances growth performance of early-weaned pigs fed diets devoid of blood plasma.


    Bedford, A; Li, Z; Li, M; Ji, S; Liu, W; Huai, Y; de Lange, C F M; Li, J


    The effect of supplementing Lactococcus lactis (L. lactis) that was engineered to express epidermal growth factor (EGF-LL) to early-weaned pigs fed diets with typical levels of blood plasma (5%) or diets without blood plasma [blood plasma was substituted with soybean (Glycine max) meal and fish meal, based on amino acid supply] was examined. A total of 108 weaned piglets (19-26 d of age; mean initial BW 6.58 kg; 9 pigs per pen) were fed ad libitum according to a 2-phase feeding program without growth promoters. Three pens were assigned to each of 4 treatments: i) blood plasma-containing diet with blank bacterial growth medium (BP-Con), ii) blood plasma-containing diet with fermented EGF-LL (BP-EGF), iii) blood plasma-free diet with blank bacterial growth medium (BPF-Con), and iv) blood plasma-free diet with fermented EGF-LL (BPF-EGF). The amount of epidermal growth factor (EGF) was determined in the fermentation product and pigs were allotted 60 μg EGF/kg BW/d for 3 wk postweaning. There were no differences in overall growth performance between BP-Con and BP-EGF pigs and no differences in overall growth performance between LoCon and BPF-EGF pigs. Pigs fed BPF-EGF showed increased daily BW gain (410 vs. 260 g/d; P < 0.01) and gain:feed (0.67 vs. 0.58; P < 0.05) compared to BPF-Con pigs in wk 3 postweaning; this was comparable to values for the BP-Con group (400 g/d and 0.64). These results indicate that supplementation with EGF-LL can be effective in enhancing the performance of early-weaned piglets fed a low complexity diet and reduces the need for feeding high-quality animal proteins and antibiotics.

  10. The trisaccharide raffinose modulates epidermal differentiation through activation of liver X receptor

    PubMed Central

    Na, Tae-Young; Kim, Gyeong-Hwan; Oh, Hyeon-Jeong; Lee, Min-Ho; Han, Yong-Hyun; Kim, Ki Taek; Kim, Ji-Su; Kim, Dae-Duk; Lee, Mi-Ock


    The epidermal barrier function requires optimal keratinocyte differentiation and epidermal lipid synthesis. Liver X receptor (LXR) α and β, are important transcriptional regulators of the epidermal gene expression. Here, we show that raffinose, a ubiquitously present trisaccharide in plants, activated the transcriptional activity of LXRα/β, which led to the induction of genes required for keratinocyte differentiation such as involucrin and filaggrin, and genes involved in lipid metabolism and transport including SCD1 and ABCA1 in both HaCaT and normal human epidermal keratinocytes. Raffinose induced the expression of JunD and Fra1, and their DNA binding in the AP1 motif in the promoters of involucrin and loricrin. Interestingly, LXR bound the AP1 motif upon raffinose treatment, and conversely, JunD and Fra1 bound the LXR response element in promoters of LXR target genes, which indicates the presence of a postive cross-talk between LXR and AP1 in the regualtion of these genes. Finally, the effect of raffinose in epidermal barrier function was confirmed by applying raffinose in an ointment formulation to the skin of hairless mice. These findings suggest that raffinose could be examined as an ingredient in functional cosmetics and therapeutic agents for the treatment of cutaneous disorders associated with abnormal epidermal barrier function. PMID:28266648

  11. Evaluation of dermal-epidermal skin equivalents ('composite-skin') of human keratinocytes in a collagen-glycosaminoglycan matrix(Integra artificial skin).


    Kremer, M; Lang, E; Berger, A C


    Integra artificial skin (Integra LifeSciences Corp., Plainsboro, NJ, USA) is a dermal template consisting of bovine collagen, chondroitin-6-sulphate and a silastic membrane manufactured as Integra. This product has gained widespread use in the clinical treatment of third degree burn wounds and full thickness skin defects of different aetiologies. The product was designed to significantly reduce the time needed to achieve final wound closure in the treatment of major burn wounds, to optimise the sparse autologous donor skin resources and to improve the durable mechanical quality of the skin substitute. The clinical procedure requires two stages. The first step creates a self neodermis, the second creates a self epidermis on the neodermis. However, it is desirable to cover major burn wounds early in a single step by a skin substitute consisting of a dermal equivalent seeded in vitro with autologous keratinocytes ('composite-skin') out of which a full thickness skin develops in vivo.The goal of this experimental study was to develop a method to integrate human keratinocytes in homogeneous distribution and depth into Integra Artificial Skin. The seeded cell-matrix composites were grafted onto athymic mice in order to evaluate their potential to reconstitute a human epidermis in vivo. We were able to demonstrate that the inoculated human keratinocytes reproducibly displayed a homogeneous pattern of distribution, adherence, proliferation and confluence. The cell-matrix composites grafted in this model exhibited good wound adherence, complete healing, minor wound contraction and had the potential to reconstitute an elastic, functional and durable human skin. Histologically we were able to show that the inoculated human keratinocytes in vivo colonised the matrix in a histomorphologically characteristic epidermal pattern (keratomorula, keratinocyte bubbling) and developed a persisting, stratified, keratinising epidermis which immunohistologically proved to be of human

  12. Functional cyclic AMP response element in the breast cancer resistance protein (BCRP/ABCG2) promoter modulates epidermal growth factor receptor pathway- or androgen withdrawal-mediated BCRP/ABCG2 transcription in human cancer cells.


    Xie, Yi; Nakanishi, Takeo; Natarajan, Karthika; Safren, Lowell; Hamburger, Anne W; Hussain, Arif; Ross, Douglas D


    Phosphorylated cyclic-AMP (cAMP) response element binding protein (p-CREB) is a downstream effector of a variety of important signaling pathways. We investigated whether the human BCRP promoter contains a functional cAMP response element (CRE). 8Br-cAMP, a cAMP analogue, increased the activity of a BCRP promoter reporter construct and BCRP mRNA in human carcinoma cells. Epidermal growth factor receptor (EGFR) pathway activation also led to an increase in p-CREB and in BCRP promoter reporter activity via two major downstream EGFR signaling pathways: the phosphotidylinositol-3-kinase (PI3K)/AKT pathway and the mitogen-activated protein kinase (MAPK) pathway. EGF treatment increased the phosphorylation of EGFR, AKT, ERK and CREB, while simultaneously enhancing BCRP mRNA and functional protein expression. EGF-stimulated CREB phosphorylation and BCRP induction were diminished by inhibition of EGFR, PI3K/AKT or RAS/MAPK signaling. CREB silencing using RNA interference reduced basal levels of BCRP mRNA and diminished the induction of BCRP by EGF. Chromatin immunoprecipitation assays confirmed that a putative CRE site on the BCRP promoter bound p-CREB by a point mutation of the CRE site abolished EGF-induced stimulation of BCRP promoter reporter activity. Furthermore, the CREB co-activator, cAMP-regulated transcriptional co-activator (CRTC2), is involved in CREB-mediated BCRP transcription: androgen depletion of LNCaP human prostate cancer cells increased both CREB phosphorylation and CRTC2 nuclear translocation, and enhanced BCRP expression. Silencing CREB or CRTC2 reduced basal BCRP expression and BCRP induction under androgen-depletion conditions. This novel CRE site plays a central role in mediating BCRP gene expression in several human cancer cell lines following activation of multiple cancer-relevant signaling pathways.

  13. Localization and distribution of neurons that co-express xeroderma pigmentosum-A and epidermal growth factor receptor within Rosenthal's canal.


    Guthrie, O'neil W


    Xeroderma pigmentosum-A (XPA) is a C4-type zinc-finger scaffolding protein that regulates the removal of bulky-helix distorting DNA damage products from the genome. Phosphorylation of serine residues within the XPA protein is associated with improved protection of genomic DNA and cell death resistance. Therefore, kinase signaling is one important mechanism for regulating the protective function of XPA. Previous experiments have shown that spiral ganglion neurons (SGNs) may mobilize XPA as a general stress response to chemical and physical ototoxicants. Therapeutic optimization of XPA via kinase signaling could serve as a means to improve DNA repair capacity within neurons following injury. The kinase signaling activity of the epidermal growth factor receptor (EGFR) has been shown in tumor cell lines to increase the repair of DNA damage products that are primarily repaired by XPA. Such observations suggest that EGFR may regulate the protective function of XPA. However, it is not known whether SGNs in particular or neurons in general could co-express XPA and EGFR. In the current study gene and protein expression of XPA and EGFR were determined from cochlear homogenates. Immunofluorescence assays were then employed to localize neurons expressing both EGFR and XPA within the ganglion. This work was then confirmed with double-immunohistochemistry. Rosenthal's canal served as the reference space in these experiments and design-based stereology was employed in first-order stereology quantification of immunoreactive neurons. The results confirmed that a population of SGNs that constitutively express XPA may also express the EGFR. These results provide the basis for future experiments designed to therapeutically manipulate the EGFR in order to regulate XPA activity and restore gene function in neurons following DNA damage.

  14. Neuropharmacology of Human Appetite Expression

    ERIC Educational Resources Information Center

    Halford, Jason C. G.; Harrold, Joanne A.


    The regulation of appetite relies on the integration of numerous episodic (meal) and tonic (energy storage) generated signals in energy regulatory centres within the central nervous system (CNS). These centers provide the pharmacological potential to modify human appetite (hunger and satiety) to increase or decrease caloric intake, or to normalize…

  15. Regulation of Epidermal Growth Factor Receptor Expression by PML in Human Breast Cancer.

    DTIC Science & Technology


    acute promyelocytic leukemia (APL). We demonstrated that PML suppresses the clonogenicity and tumorigenicity of the APL-derived NB4 cells in soft...tumorigenic growth of NB4 cells as well as the transformation of the REF and NIH3T3 cells. These results suggest that the translocation of APL inactivated

  16. Epidermal Vascular Endothelial Growth Factor Production Is Required for Permeability Barrier Homeostasis, Dermal Angiogenesis, and the Development of Epidermal Hyperplasia

    PubMed Central

    Elias, Peter M.; Arbiser, Jack; Brown, Barbara E.; Rossiter, Heidemarie; Man, Mao-Qiang; Cerimele, Francesca; Crumrine, Debra; Gunathilake, Roshan; Choi, Eung Ho; Uchida, Yoshikazu; Tschachler, Erwin; Feingold, Kenneth R.


    Primary abnormalities in permeability barrier function appear to underlie atopic dermatitis and epidermal trauma; a concomitant barrier dysfunction could also drive other inflammatory dermatoses, including psoriasis. Central to this outside-inside view of disease pathogenesis is the epidermal generation of cytokines/growth factors, which in turn signal downstream epidermal repair mechanisms. Yet, this cascade, if sustained, signals downstream epidermal hyperplasia and inflammation. We found here that acute barrier disruption rapidly stimulates mRNA and protein expression of epidermal vascular endothelial growth factor-A (VEGF-A) in normal hairless mice, a specific response to permeability barrier requirements because up-regulation is blocked by application of a vapor-impermeable membrane. Moreover, epidermal vegf−/− mice display abnormal permeability barrier homeostasis, attributable to decreased VEGF signaling of epidermal lamellar body production; a paucity of dermal capillaries with reduced vascular permeability; and neither angiogenesis nor epidermal hyperplasia in response to repeated tape stripping (a model of psoriasiform hyperplasia). These results support a central role for epidermal VEGF in the maintenance of epidermal permeability barrier homeostasis and a link between epidermal VEGF production and both dermal angiogenesis and the development of epidermal hyperplasia. Because psoriasis is commonly induced by external trauma [isomorphic (Koebner) phenomenon] and is associated with a prominent permeability barrier abnormality, excess VEGF production, prominent angiogenesis, and epidermal hyperplasia, these results could provide a potential outside-inside mechanistic basis for the development of psoriasis. PMID:18688025

  17. A novel fully-human cytolytic fusion protein based on granzyme B shows in vitro cytotoxicity and ex vivo binding to solid tumors overexpressing the epidermal growth factor receptor.


    Niesen, Judith; Hehmann-Titt, Grit; Woitok, Mira; Fendel, Rolf; Barth, Stefan; Fischer, Rainer; Stein, Christoph


    Human cytolytic fusion proteins (hCFPs) offer a promising immunotherapeutic approach for the treatment of solid tumors, avoiding the immunogenicity and undesirable side-effects caused by immunotoxins derived from plants or bacteria. The well-characterized human serine protease granzyme B has already been used as a therapeutic pro-apoptotic effector domain. We therefore developed a novel recombinant hCFP (GbR201K-scFv1711) consisting of an epidermal growth factor receptor-specific human antibody fragment and a granzyme B point mutant (R201K) that is insensitive to serpin B9 (PI9), a natural inhibitor of wild-type granzyme B that is often expressed in solid tumors. We found that GbR201K-scFv1711 selectively bound to epidermoid cancer and rhabdomyosarcoma cells and was rapidly internalized by them. Nanomolar concentrations of GbR201K-scFv1711 achieved the specific killing of epidermoid cancer cells by inducing apoptosis, and similar effects were observed in rhabdomyosarcoma cells when GbR201K-scFv1711 was combined with the endosomolytic substance chloroquine. The novel hCFP was stable in serum and bound to human rhabdomyosarcoma tissue ex vivo. These data confirm that GbR201K-scFv1711 is a promising therapeutic candidate suitable for further clinical investigation.

  18. Survivin expression in canine epidermis and in canine and human cutaneous squamous cell carcinomas.


    Bongiovanni, Laura; Colombi, Isabella; Fortunato, Carmine; Della Salda, Leonardo


    Survivin, a member of the inhibitor of apoptosis protein (IAP) family, is ubiquitously expressed during tissue development, undetectable in most normal tissues, but re-expressed in most cancers, including skin malignancies. Expression of survivin was evaluated retrospectively in 19 canine cutaneous squamous cell carcinomas (SCCs; one in situ; 16 well differentiated; one invasive, one lymph node metastasis) and 19 well differentiated SCCs from human beings. Seven specimens of normal canine skin were included. Immunohistochemical expression of full-length survivin was determined using a commercially available antibody. In addition, apoptotic rate [Terminal deoxynucleotidyl Transferase Biotin-dUTP Nick End Labelling index (TUNEL) index] and mitotic index (MI), counting mitoses in 10 high power fields (HPF), were determined. Scattered survivin positive nuclei were identified in the epidermal basal cell layer of normal canine skin. Nuclear survivin expression was identified in 18 of 19 human and in all canine SCCs, mainly along the base of the tumour cell population. Cytoplasmic survivin expression was rarely observed in human SCCs and in 84.2% of canine SCCs. The TUNEL index ranged from 0.1 to 2.6 in human beings and from 7.5 to 69.4 in dogs, while MIs ranged from 0 to 4 in human beings and dogs. No correlation was found between survivin expression and apoptotic or mitotic rates. Canine and human tumours showed similar nuclear survivin expression, indicating similar functions of the molecule. We demonstrated survivin expression in normal adult canine epidermis. Increased nuclear survivin expression in pre-neoplastic and neoplastic lesions demonstrates a possible association of survivin with development of SCCs in human beings and dogs.

  19. Regulation of transferrin receptor expression at the cell surface by insulin-like growth factors, epidermal growth factor and platelet-derived growth factor

    SciTech Connect

    Davis, R.J.; Kuck, L.; Faucher, M.; Czech, M.P.


    Addition of platelet-derived growth factor (PDGF), recombinant insulin-like growth factor I (rIGF-I) or epidermal growth factor (EGF) to BALB/c 3T3 fibroblasts causes a marked increase in the binding of (/sup 125/I) diferric transferrin to cell surface receptors. This effect is very rapid and is complete within 5 minutes. The effect is transient with (/sup 125/I) diferric transferrin binding returning to control values within 25 minutes. In contrast, PDGF and rIGF-I cause a prolonged stimulation of (/sup 125/I) diferric transferrin binding that could be observed up to 2 hours. The increase in the binding of (/sup 125/I) diferric transferrin caused by growth factors was investigated by analysis of the binding isotherm. EGF, PDGF and rIGF-I were found to increase the cell surface expression of transferrin receptors rather than to alter the affinity of the transferrin receptors. Furthermore, PDGF and rIGF-I stimulated the sustained uptake of (/sup 59/Fe) diferric transferrin by BALB/c 3T3 fibroblasts. Thus, the effect of these growth factors to increase the cell surface expression of the transferrin receptor appears to have an important physiological consequence.

  20. The desmosomal protein Desmoglein 1 aids recovery of epidermal differentiation after acute ultraviolet light exposure

    PubMed Central

    Johnson, Jodi L.; Koetsier, Jennifer L.; Sirico, Anna; Agidi, Ada T.; Antonini, Dario; Missero, Caterina; Green, Kathleen J.


    Epidermal structure is damaged by exposure to ultraviolet (UV) light but the molecular mechanisms governing structural repair are largely unknown. UVB (290-320 nm wavelengths) exposure prior to induction of differentiation reduced expression of differentiation-associated proteins, including Desmoglein 1 (Dsg1), Desmocollin 1 (Dsc1) and Keratins 1 and 10 (K1/K10) in a dose-dependent manner in normal human epidermal keratinocytes (NHEKs). The UVB- induced reduction in both Dsg1 transcript and protein was associated with reduced binding of the p63 transcription factor to previously unreported enhancer regulatory regions of the Dsg1 gene. Since Dsg1 promotes epidermal differentiation in addition to participating in cell-cell adhesion, the role of Dsg1 in aiding differentiation after UVB damage was tested. Compared to controls, depleting Dsg1 via shRNA resulted in further reduction of Dsc1 and K1/K10 expression in monolayer NHEK cultures and in abnormal epidermal architecture in organotypic skin models recovering from UVB exposure. Ectopic expression of Dsg1 in keratinocyte monolayers rescued the UVB-induced differentiation defect. Treatment of UVB-exposed monolayer or organotypic cultures with Trichostatin A, a histone deacetylase inhibitor, partially restored differentiation marker expression, suggesting a potential therapeutic strategy for reversing UV-induced impairment of epidermal differentiation after acute sun exposure. PMID:24594668

  1. The desmosomal protein desmoglein 1 aids recovery of epidermal differentiation after acute UV light exposure.


    Johnson, Jodi L; Koetsier, Jennifer L; Sirico, Anna; Agidi, Ada T; Antonini, Dario; Missero, Caterina; Green, Kathleen J


    Epidermal structure is damaged by exposure to UV light, but the molecular mechanisms governing structural repair are largely unknown. UVB (290-320 nm wavelengths) exposure before induction of differentiation reduced expression of differentiation-associated proteins, including desmoglein 1 (Dsg1), desmocollin 1 (Dsc1), and keratins 1 and 10 (K1/K10), in a dose-dependent manner in normal human epidermal keratinocytes (NHEKs). The UVB-induced reduction in both Dsg1 transcript and protein was associated with reduced binding of the p63 transcription factor to previously unreported enhancer regulatory regions of the Dsg1 gene. As Dsg1 promotes epidermal differentiation in addition to participating in cell-cell adhesion, the role of Dsg1 in aiding differentiation after UVB damage was tested. Compared with controls, depleting Dsg1 via short hairpin RNA resulted in further reduction of Dsc1 and K1/K10 expression in monolayer NHEK cultures and in abnormal epidermal architecture in organotypic skin models recovering from UVB exposure. Ectopic expression of Dsg1 in keratinocyte monolayers rescued the UVB-induced differentiation defect. Treatment of UVB-exposed monolayer or organotypic cultures with trichostatin A, a histone deacetylase inhibitor, partially restored differentiation marker expression, suggesting a potential therapeutic strategy for reversing UV-induced impairment of epidermal differentiation after acute sun exposure.

  2. Effects of the differentiated keratinocyte phenotype on expression levels of CYP1-4 family genes in human skin cells

    SciTech Connect

    Du Liping; Neis, Mark M.; Ladd, Patricia A.; Yost, Garold S.; Keeney, Diane S. . E-mail:


    Epoxyeicosatrienoic acids produced by mouse CYP2B19 have been implicated in mechanisms regulating epidermal cornification (Ladd, P.A., Du, L., Capdevila, J.H., Mernaugh, R., Keeney, D.S., 2003. Epoxyeicosatrienoic acids activate transglutaminases in situ and induce cornification of epidermal keratinocytes. J. Biol. Chem. 278, 35184-35192). In this study, we aimed to identify CYPs that are up-regulated during keratinocyte differentiation and potentially responsible for epoxyeicosatrienoic acid formation in human skin. The cellular differentiation state of human epidermal cell cultures was manipulated to resemble the basal, spinous, and granular cell phenotypes in vivo. Changes in CYP mRNA levels were measured as a function of differentiation state for a panel of 15 CYPs that included known and putative arachidonate monooxygenases. Quantitative real-time PCR analyses showed that all of the CYPs were expressed in differentiating epidermal cell cultures and in human epidermis, with the exception of CYP2B6, which was poorly expressed in vitro. Six CYPs were strongly up-regulated at Day 6 and Day 8 of in vitro differentiation (CYP4B1, 2W1, 2C18, 3A4, 2C19, 2C9); the increase in mRNA levels ranged from 27- to 356-fold. Only CYP2U1 mRNA levels decreased (6-fold change) during cellular differentiation. Six CYPs showed little variation (<2-fold change) in mRNA levels during in vitro differentiation (CYP2S1, 2J2, 1B1, 1A1, 2E1, 2D6). No single CYP was identifiable as being a functional counterpart to CYP2B19 in mouse skin since none qualified as being mainly responsible for epidermal epoxyeicosatrienoic acid formation. Rather, the data suggest that epoxyeicosatrienoic acids in human skin are formed by several CYPs expressed in different cell layers of the epidermis. This would predict that CYP-derived eicosanoids have different functions in different epidermal cell layers.

  3. Concurrent Autophagy Inhibition Overcomes the Resistance of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Human Bladder Cancer Cells

    PubMed Central

    Kang, Minyong; Lee, Kyoung-Hwa; Lee, Hye Sun; Jeong, Chang Wook; Kwak, Cheol; Kim, Hyeon Hoe; Ku, Ja Hyeon


    Despite the potential therapeutic efficacy of epithelial growth factor receptor (EGFR) inhibitors in the treatment of advanced stage bladder cancer, there currently is no clear evidence to support this hypothesis. In this study, we investigate whether the concurrent treatment of autophagy-blocking agents with EGFR inhibitors exerts synergistic anti-cancer effects in T24 and J82 human bladder cancer cells. Lapatinib and gefitinib were used as EGFR inhibitors, and bafilomycin A1 (BFA1), chloroquine (CQ) and 3-methyladenine (3-MA) were used as the pharmacologic inhibitors of autophagy activities. To assess the proliferative and self-renewal capabilities, the Cell Counting Kit-8 (CCK-8) assay and a clonogenic assay were performed, respectively. To examine apoptotic cell death, flow cytometry using annexin-V/propidium iodide (PI) was used. To measure the autophagy activities, the expression levels of LC3I and II was determined by Western blot analysis. To validate the synergistic effects of autophagy inhibition with EGFR inhibitors, we specifically blocked key autophagy regulatory gene ATG12 by transfection of small interference RNA and examined the phenotypic changes. Of note, lapatinib and gefitinib triggered autophagy activities in T24 and J82 human bladder cancer cells, as indicated by upregulation of LC3II. More importantly, inhibiting autophagy activities with pharmacologic inhibitors (BFA1, CQ or 3-MA) remarkably reduced the cell viabilities and clonal proliferation of T24 and J82 cells, compared to those treated with either of the agents alone. We also obtained similar results of the enhanced anti-cancer effects of EGFR inhibitors by suppressing the expression of ATG12. Notably, the apoptotic assay showed that synergistic anti-cancer effects were induced via the increase of apoptotic cell death. In summary, concomitant inhibition of autophagy activities potentiated the anti-cancer effects of EGFR inhibitors in human bladder cancer cells, indicating a novel

  4. Expression and purification of recombinant human EGFL7 protein.


    Picuric, Srdjan; Friedrich, Matthias; Oess, Stefanie


    The secreted epidermal growth factor-like protein 7 (EGFL7) plays an important role in angiogenesis, especially in the recruitment of endothelial and smooth muscle cells to the site of the nascent vessel and their ordered assembly into functional vasculature. However, progress in the understanding of the underlying mechanisms is to date greatly hindered by the lack of recombinant EGFL7 protein in a stable, soluble, native state, thus preventing e.g. the characterization of the proposed functional receptor as well as investigation of additional biological effects of EGFL7. So far all attempts to produce sufficient amounts of recombinant EGFL7 protein by various groups have failed. In this study we describe a procedure for the expression and purification of human EGFL7 from Sf9 cells and for the first time provide means to isolate biologically functional EGFL7 protein in sufficient quantities for its further biological characterization. We believe that the availability of EGFL7 will greatly accelerate our understanding of the precise role of EGFL7 and the underlying molecular mechanisms of EGFL7 action in the fundamentally important process of angiogenesis.

  5. Molecular modifications of dermal and epidermal biomarkers following UVA exposures on reconstructed full-thickness human skin.


    Meloni, Marisa; Farina, Anne; de Servi, Barbara


    Ultraviolet A (UVA) radiation adversely affects skin health and appearance via multiple molecular pathways. Biologically relevant UVA damage are classified as short-term effects (e.g. formation of reactive oxygen species [ROS], inflammation, photo-oxidation, DNA damage, immunosuppression, photoallergy and cell-mediated contact hypersensitivity) or long-term effects (elastosis, photoageing and photocarcinogenesis). Single and chronic experimental exposure to UVA are limited in humans by ethical concerns, and furthermore it is impossible to quantify long-term endpoints such as photoageing over the life-span of a human volunteer. The aim of the present study was to investigate the biological relevance of the Phenion FT skin model for use in photobiological studies. Biological responses to acute and repeated UVA exposures were investigated by monitoring the kinetics of gene expression during the post-irradiation period. By using a dynamic approach, we were able to define early and stable markers of UVA-induced effects that could be predictive of UVA damage in vivo. The transcriptomic approach applied to 3D human tissues appears to be an encouraging method for gaining a deeper understanding of the UVA effects on skin and for studying the dermal response with non-invasive techniques.

  6. Expression of polarity genes in human cancer.


    Lin, Wan-Hsin; Asmann, Yan W; Anastasiadis, Panos Z


    Polarity protein complexes are crucial for epithelial apical-basal polarity and directed cell migration. Since alterations of these processes are common in cancer, polarity proteins have been proposed to function as tumor suppressors or oncogenic promoters. Here, we review the current understanding of polarity protein functions in epithelial homeostasis, as well as tumor formation and progression. As most previous studies focused on the function of single polarity proteins in simplified model systems, we used a genomics approach to systematically examine and identify the expression profiles of polarity genes in human cancer. The expression profiles of polarity genes were distinct in different human tissues and classified cancer types. Additionally, polarity expression profiles correlated with disease progression and aggressiveness, as well as with identified cancer types, where specific polarity genes were commonly altered. In the case of Scribble, gene expression analysis indicated its common amplification and upregulation in human cancer, suggesting a tumor promoting function.

  7. Photoacoustic measurement of epidermal melanin

    NASA Astrophysics Data System (ADS)

    Viator, John A.; Svaasand, Lars O.; Aguilar, Guillermo; Choi, Bernard; Nelson, J. Stuart


    Most dermatologic laser procedures must consider epidermal melanin, as it is a broadband optical absorber which affects subsurface fluence, effectively limiting the amount of light reaching the dermis and targeted chromophores. An accurate method for quantifying epidermal melanin content would aid clinicians in determining proper light dosage for therapeutic laser procedures. While epidermal melanin content has been quantified non-invasively using optical methods, there is currently no way to determine the melanin distribution in the epidermis. We have developed a photoacoustic probe that uses a Q-switched, frequency doubled Nd:YAG laser operating at 532nm to generate acoustic pulses in skin in vivo. The probe contained a piezoelectric element that detected photoacoustic waves which were then analyzed for epidermal melanin content, using a photoacoustic melanin index (PAMI). We tested 15 human subjects with skin types I--VI using the photoacoustic probe. We also present photoacoustic data for a human subject with vitiligo. Photoacoustic measurement showed melanin in the vitiligo subject was almost completely absent.

  8. Expression of prostacyclin receptor in human megakaryocytes.


    Sasaki, Y; Takahashi, T; Tanaka, I; Nakamura, K; Okuno, Y; Nakagawa, O; Narumiya, S; Nakao, K


    Prostacyclin (prostaglandin I2, PGI2) is a potent vasodilator and inhibitor of platelet aggregation. Although it is well known that the specific receptor for prostacyclin (PGI2-R) is abundantly expressed on platelets, PGI2-R expression in megakaryocytes is poorly understood. In this study, we examined its expression in leukemic or normal megakaryocytes. PGI2-R mRNA was expressed in human leukemic cell lines of megakaryocytic nature as evaluated by Northern blot analysis. Phorbol 12-myristate 13-acetate (PMA), interleukin-1 (IL-1), IL-3, IL-6, granulocyte-macrophage colony-stimulating factor (GM-CSF), thrombopoietin (TPO), and tumor necrosis factor-alpha (TNF-alpha) enhanced PGI2-R mRNA expression. The enhancement of PGI2-R expression by PMA and TPO was associated with the upregulation of platelet factor 4 or glycoprotein IIb mRNA expression. Iloprost, an agonist of prostacyclin, induced significant cyclic (c)AMP synthesis in these leukemic cells indicating that interaction of PGI2-R and its ligand can induce postreceptor signal transduction. Furthermore, iloprost-induced cAMP synthesis was enhanced by the pretreatment with PMA or the cytokines that promoted PGI2-R expression. PMA and TPO also increased the specific binding of [3H]iloprost to these cells. Pooled normal megakaryocytic colonies from TPO-containing semisolid culture of purified human CD34+ cells expressed PGI2-R, which were increased as the megakaryocytes matured with the peak expression before proplatelet formation, as evaluated by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR). These results indicate that PGI2-R is expressed in human megakaryocytes and is upregulated by cytokines involved in thrombopoiesis or inflammation. Also, it was indicated that megakaryocytic maturation accompanies enhancement of PGI2-R expression.

  9. Involvement of cysteine-rich protein 61 in the epidermal growth factor-induced migration of human anaplastic thyroid cancer cells.


    Chin, Li-Han; Hsu, Sung-Po; Zhong, Wen-Bin; Liang, Yu-Chih


    Anaplastic thyroid cancer (ATC) is among the most aggressive types of malignant cancer. Epidermal growth factor (EGF) plays a crucial role in the pathogenesis of ATC, and patients with thyroid carcinoma typically exhibit increased cysteine-rich protein 61 (Cyr61). In this study, we found that EGF treatment induced cell migration, stress fiber formation, Cyr61 mRNA and protein expressions, and Cyr61 protein secretion in ATC cells. The recombinant Cyr61 protein significantly induced cell migration; however, inhibition of Cyr61 activity by a Cyr61-specific antibody abrogated EGF-induced cell migration. EGF treatment also affected epithelial-to-mesenchymal transition (EMT)-related marker protein expression, as evidenced by an increase in vimentin and a decrease in E-cadherin expression. Inhibition of Cyr61 expression by Cyr61 siRNA decreased cell migration and reversed the EMT-related marker protein expression. EGF treatment increased the phosphorylation of the extracellular signal-regulated kinase (ERK) and cAMP response element-binding protein (CREB), and finally activated Cyr61 promoter plasmid activity. Our results suggest that Cyr61 is induced by EGF through the ERK/CREB signal pathway and that it plays a crucial role in the migration and invasion of ATC cells; moreover, Cyr61 might be a therapeutic target for metastatic ATC.

  10. Genetic and pharmacological analysis identifies a physiological role for the AHR in epidermal differentiation

    PubMed Central

    van den Bogaard, Ellen; Podolsky, Michael; Smits, Jos; Cui, Xiao; John, Christian; Gowda, Krishne; Desai, Dhimant; Amin, Shantu; Schalkwijk, Joost; Perdew, Gary H.


    Stimulation of the aryl hydrocarbon receptor (AHR) by xenobiotics is known to affect epidermal differentiation and skin barrier formation. The physiological role of endogenous AHR signaling in keratinocyte differentiation is not known. We used murine and human skin models to address the hypothesis that AHR activation is required for normal keratinocyte differentiation. Using transcriptome analysis of Ahr-/- and Ahr+/+ murine keratinocytes, we found significant enrichment of differentially expressed genes linked to epidermal differentiation. Primary Ahr-/- keratinocytes showed a significant reduction in terminal differentiation gene and protein expression, similar to Ahr+/+ keratinocytes treated with AHR antagonists GNF351 and CH223191, or the selective AHR modulator (SAhRM), SGA360. In vitro keratinocyte differentiation led to increased AHR levels and subsequent nuclear translocation, followed by induced CYP1A1 gene expression. Monolayer cultured primary human keratinocytes treated with AHR antagonists also showed an impaired terminal differentiation program. Inactivation of AHR activity during human skin equivalent development severely impaired epidermal stratification, terminal differentiation protein expression and stratum corneum formation. As disturbed epidermal differentiation is a main feature of many skin diseases, pharmacological agents targeting AHR signaling or future identification of endogenous keratinocyte-derived AHR ligands should be considered as potential new drugs in dermatology. PMID:25602157

  11. Toxic epidermal necrolysis

    PubMed Central

    Hoetzenecker, Wolfram; Mehra, Tarun; Saulite, Ieva; Glatz, Martin; Schmid-Grendelmeier, Peter; Guenova, Emmanuella; Cozzio, Antonio; French, Lars E.


    Toxic epidermal necrolysis (TEN) is a rare, life-threatening drug-induced skin disease with a mortality rate of approximately 30%. The clinical hallmark of TEN is a marked skin detachment caused by extensive keratinocyte cell death associated with mucosal involvement. The exact pathogenic mechanism of TEN is still uncertain. Recent advances in this field have led to the identification of several factors that might contribute to the induction of excessive apoptosis of keratinocytes. In addition, specific human leukocyte antigen types seem to be associated with certain drugs and the development of TEN. As well-controlled studies are lacking, patients are treated with various immunomodulators (e.g. intravenous immunoglobulin) in addition to the best supportive care. PMID:27239294

  12. Type VII and XVII Collagen mRNA Expressions in Regenerated Epidermal Laminae in Chronic Equine Laminitis.


    Kuwano, Atsutoshi; Hasegawa, Telhisa; Arai, Katsuhiko


    To confirm ability forming the basement membrane of the regenerated laminar epidermis (rLE) in chronic laminitis, expression of type VII and type XVII collagen mRNAs in the rLE was studied applying sequences of two type of murine collagens. On northern blot analysis, complement DNA (cDNA) probes adjusted from the murine type VII and type XVII collagen could hybridize with the equine mRNAs, and each signal was detected as single-bands at approximately 9.5 kb and 5.6 kb, respectively. Contrasting with the expression level of equine glyceraldehyde-3-phosphate dehydrogenease mRNA, the band of type VII collagen mRNA in laminitis was stronger than normal, but the type XVII collagen mRNA in laminitis was less than normal. By in situ hybridization, positive signals in response to the murine type VII and type XVII collagen mRNA probes could be detected in the equine laminitic rLE region. From these results, it is concluded that the keratinocytes constructing the rLE in chronic stage of laminitis can express type VII and type XVII collagen mRNAs and these expression patterns were different from the normal.

  13. High Expression of the Tonoplast Aquaporin ZmTIP1 in Epidermal and Conducting Tissues of Maize1

    PubMed Central

    Barrieu, François; Chaumont, François; Chrispeels, Maarten J.


    Aquaporins are integral membrane proteins of the tonoplast and the plasma membrane that facilitate the passage of water through these membranes. Because of their potentially important role in regulating water flow in plants, studies documenting aquaporin gene expression in specialized tissues involved in water and solute transport are important. We used in situ hybridization to examine the expression pattern of the tonoplast aquaporin ZmTIP1 in different organs of maize (Zea mays L.). This tonoplast water channel is highly expressed in the root epidermis, the root endodermis, the small parenchyma cells surrounding mature xylem vessels in the root and the stem, phloem companion cells and a ring of cells around the phloem strand in the stem and the leaf sheath, and the basal endosperm transfer cells in developing kernels. We postulate that the high level of expression of ZmTIP1 in these tissues facilitates rapid flow of water through the tonoplast to permit osmotic equilibration between the cytosol and the vacuolar content, and to permit rapid transcellular water flow through living cells when required. PMID:9701571

  14. Epidermal T cells and wound healing.


    Havran, Wendy L; Jameson, Julie M


    The murine epidermis contains resident T cells that express a canonical gammadelta TCR. These cells arise from fetal thymic precursors and use a TCR that is restricted to the skin in adult animals. These cells assume a dendritic morphology in normal skin and constitutively produce low levels of cytokines that contribute to epidermal homeostasis. When skin is wounded, an unknown Ag is expressed on damaged keratinocytes. Neighboring gammadelta T cells then round up and contribute to wound healing by local production of epithelial growth factors and inflammatory cytokines. In the absence of skin gammadelta T cells, wound healing is impaired. Similarly, epidermal T cells from patients with healing wounds are activated and secreting growth factors. Patients with nonhealing wounds have a defective epidermal T cell response. Information gained on the role of epidermal-resident T cells in the mouse may provide information for development of new therapeutic approaches to wound healing.

  15. Mitogen-activated protein kinase kinase 1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors sensitize reduced glucocorticoid response mediated by TNF{alpha} in human epidermal keratinocytes (HaCaT)

    SciTech Connect

    Onda, Kenji . E-mail:; Nagashima, Masahiro; Kawakubo, Yo; Inoue, Shota; Hirano, Toshihiko; Oka, Kitaro


    Glucocorticoids (GCs) are essential drugs administered topically or systematically for the treatment of autoimmune skin diseases such as pemphigus. However, a certain proportion of patients does not respond well to GCs. Although studies on the relationship between cytokines and GC insensitivity in local tissues have attracted attention recently, little is known about the underlying mechanism(s) for GC insensitivity in epidermal keratinocytes. Here, we report that tumor necrosis factor (TNF) {alpha} reduces GC-induced transactivation of endogenous genes as well as a reporter plasmid which contains GC responsive element (GRE) in human epidermal keratinocyte cells (HaCaT). The GC insensitivity by TNF{alpha} was not accompanied by changes in mRNA expressions of GR isoforms ({alpha} or {beta}). However, we observed that mitogen-activated protein kinase kinase-1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors (PD98059 and U0126) significantly sensitized the GC-induced transactivation of anti-inflammatory genes (glucocorticoid-induced leucine zipper (GILZ) and mitogen-activated protein kinase phosphatase (MKP)-1) and FK506 binding protein (FKBP) 51 gene in the presence of TNF{alpha}. Additionally, we observed that TNF{alpha} reduced prednisolone (PSL)-dependent nuclear translocation of GR, which was restored by pre-treatment of MEK-1 inhibitors. This is the first study demonstrating a role of the MEK-1/ERK cascade in TNF{alpha}-mediated GC insensitivity. Our data suggest that overexpression of TNF{alpha} leads to topical GC insensitivity by reducing GR nuclear translocation in keratinocytes, and our findings also suggest that inhibiting the MEK-1/ERK cascade may offer a therapeutic potential for increasing GC efficacy in epidermis where sufficient inflammatory suppression is required.

  16. Oral administration of Polypodium leucotomos delays skin tumor development and increases epidermal p53 expression and the anti-oxidant status of UV-irradiated hairless mice.


    Rodríguez-Yanes, Esperanza; Cuevas, Jesús; González, Salvador; Mallol, Jordi


    Chronic exposure to ultraviolet radiation (UVR) induces skin tumors in hairless mice. Daily oral administration of a Polypodium leucotomos (PL) extract significantly delayed tumor development in PL-treated versus non-PL-treated mice. UVR and/or PL treatment modified several oxidative stress markers. In all irradiated mice, erythrocytic glutathione S-transferase (GST) activity and glutathione disulphide (GSSG) content increased and in all PL-treated mice GSSG content decreased, specially in non-irradiated animals, and total plasma anti-oxidant capacity (ORAC) increased. In dorsolateral non-tumoral skin of all irradiated mice, glutathione reductase (GR) and glutathione peroxidase (GPx) activities increased and GSSG decreased in non-irradiated PL-treated animals. UVR induced a steep increase of p53 expression in epidermal cells. In non-tumoral skin, this increase was significantly higher in PL-treated animals than in non-treated mice and can contribute in delaying tumor development, either by repairing the damaged DNA or by increasing apoptosis. These results reinforce the usefulness of PL as systemic photoprotective agent, especially in patients highly sensitive to UVR.

  17. Treatment challenges for community oncologists treating postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2-negative advanced breast cancer

    PubMed Central

    Gradishar, William J


    Community-based oncologists are faced with challenges and opportunities when delivering quality patient care, including high patient volumes and diminished resources; however, there may be the potential to deliver increased patient education and subsequently improve outcomes. This review discusses the treatment of postmenopausal women with endocrine-resistant, hormone receptor-positive, human epidermal growth factor receptor 2- negative advanced breast cancer in order to illustrate considerations in the provision of pertinent quality education in the treatment of these patients and the management of therapy-related adverse events. An overview of endocrine-resistant breast cancer and subsequent treatment challenges is also provided. Approved treatment options for endocrine-resistant breast cancer include hormonal therapies and mammalian target of rapamycin inhibitors. Compounds under clinical investigation are also discussed. PMID:27468248

  18. Bazex Syndrome in Lung Squamous Cell Carcinoma: High Expression of Epidermal Growth Factor Receptor in Lesional Keratinocytes with Th2 Immune Shift

    PubMed Central

    Amano, Maki; Hanafusa, Takaaki; Chikazawa, Sakiko; Ueno, Makiko; Namiki, Takeshi; Igawa, Ken; Miura, Keiko; Yokozeki, Hiroo


    An 82-year-old Japanese man was referred for detailed examination of hyperkeratotic erythematous plaques on his palms and soles for 6 months. Two weeks before his first visit, he had undergone lung lobectomy for right lung squamous cell carcinoma (SCC). Laboratory findings showed elevations of eosinophil counts, serum IgE, thymus and activation-regulated chemokine, SCC antigen, and soluble interleukin-2 receptor levels. Histological results of a skin biopsy involving the left palm showed psoriasiform dermatitis. Before lung lobectomy, the hyperkeratotic erythematous plaques on the palms and soles and the erythemas on the trunk and extremities were difficult to treat with topical steroids. After lobectomy, the skin symptoms dramatically and rapidly subsided with topical steroids. Therefore, we diagnosed Bazex syndrome (BS), also known as acrokeratosis paraneoplastica, as a paraneoplastic cutaneous disease in lung SCC. The mild eosinophilia subsided and levels of SCC antigen, IgE, and soluble interleukin-2 receptor were reduced. BS is a paraneoplastic cutaneous disease characterized by acral psoriasiform lesions associated with an underlying neoplasm. In a previous report, a shift to the Th2 immune condition was found in patients with non-small cell lung cancer, as shown in our patient. Epidermal growth factor receptor (EGFR) is also known as tumor growth factor-α receptor; it is increased in psoriatic keratinocytes. In our case, EGFR expression increased in lesional keratinocytes 2 weeks after surgery and decreased 4 weeks after surgery. We speculate that a shift to Th2 immune reactions in lung SCC may be the pathogenesis of BS, whereby lesional keratinocytes highly express EGFR in parallel with disease activity. PMID:28101024

  19. MAb 806 Enhances the Efficacy of Ionizing Radiation in Glioma Xenografts Expressing the de2-7 Epidermal Growth Factor Receptor

    SciTech Connect

    Johns, Terrance G.; McKay, Michael J.; Cvrljevic, Anna N.; Gan, Hui K.; Taylor, Caitlin; Xu Huiling; Smyth, Fiona E.; Scott, Andrew M.


    Purpose: Mutations of the epidermal growth factor receptor (EGFR) are common in glioma. The most frequent mutation, de2-7 EGFR/EGFRvIII, occurs in approximately 40% of high-grade gliomas and confers resistance to ionizing radiation (IR). We have previously shown that mAb 806, a novel EGFR-specific antibody, is able to inhibit the growth of U87MG.{Delta}2-7 glioma xenografts expressing the de2-7 EGFR and may have potential as a therapeutic. Methods and Materials: Nude mice bearing U87MG.{Delta}2-7 xenografts were treated with mAb 806 and/or IR. Comparison of tumor volumes, the effect of treatment on angiogenesis as determined by mean vessel density, and expression changes in prosurvival protein pAkt between treatment groups were undertaken. Results: Treatment of mice bearing U87MG.{Delta}2-7 xenografts with mAb 806 and IR resulted in schedule-dependent radiosensitization. Maximal benefit was obtained when antibody treatment was given before irradiation, with the greatest inhibition of both tumor angiogenesis and tumor growth. Combination treatment mediated radiosensitization by selectively blocking the phosphorylation of the prosurvival protein Akt at serine 473, a process that is independent of DNA-dependent protein kinase catalytic subunit. Conclusions: Our results provide a rationale for the use of mAb 806 in combination with IR for the treatment of glioma and potentially other solid tumors bearing the de2-7 EGFR.

  20. Human eosinophils express functional CCR7.


    Akuthota, Praveen; Ueki, Shigeharu; Estanislau, Jessica; Weller, Peter F


    Human eosinophils display directed chemotactic activity toward an array of soluble chemokines. Eosinophils have been observed to migrate to draining lymph nodes in experimental models of allergic inflammation, yet it is unknown whether eosinophils express CCR7, a key chemokine receptor in coordinating leukocyte trafficking to lymph nodes. The purpose of this study is to demonstrate expression of CCR7 by human eosinophils and functional responses to CCL19 and CCL21, the known ligands of CCR7. Human eosinophils were purified by negative selection from healthy donors. CCR7 expression of freshly purified, unstimulated eosinophils and of IL-5-primed eosinophils was determined by flow cytometry and Western blot. Chemotaxis to CCL19 and CCL21 was measured in transwell assays. Shape changes to CCL19 and CCL21 were analyzed by flow cytometry and microscopy. Calcium fluxes of fluo-4 AM-loaded eosinophils were recorded by flow cytometry after chemokine stimulation. ERK phosphorylation of CCL19- and CCL21-stimulated eosinophils was measured by Western blot and Luminex assay. Human eosinophils expressed CCR7 as demonstrated by flow cytometry and Western blots. Eosinophils exhibited detectable cell surface expression of CCR7. IL-5-primed eosinophils exhibited chemotaxis toward CCL19 and CCL21 in a dose-dependent fashion. Upon stimulation with CCL19 or CCL21, IL-5-primed eosinophils demonstrated dose-dependent shape changes with polarization of F-actin and exhibited calcium influxes. Finally, primed eosinophils stimulated with CCL19 or CCL21 exhibited increased phosphorylation of ERK in response to both CCR7 ligands. We demonstrate that human eosinophils express CCR7 and have multipotent responses to the known ligands of CCR7.

  1. Oral pathogens change proliferation properties of oral tumor cells by affecting gene expression of human defensins.


    Hoppe, T; Kraus, D; Novak, N; Probstmeier, R; Frentzen, M; Wenghoefer, M; Jepsen, S; Winter, J


    The impact of oral pathogens onto the generation and variability of oral tumors has only recently been investigated. To get further insights, oral cancer cells were treated with pathogens and additionally, as a result of this bacterial cellular infection, with human defensins, which are as anti-microbial peptide members of the innate immune system. After cell stimulation, proliferation behavior, expression analysis of oncogenic relevant defensin genes, and effects on EGFR signaling were investigated. The expression of oncogenic relevant anti-microbial peptides was analyzed with real-time PCR and immunohistochemistry. Cell culture experiments were performed to examine cellular impacts caused by stimulation, i.e., altered gene expression, proliferation rate, and EGF receptor-dependent signaling. Incubation of oral tumor cells with an oral pathogen (Porphyromonas gingivalis) and human α-defensins led to an increase in cell proliferation. In contrast, another oral bacterium used, Aggregatibacter actinomycetemcomitans, enhanced cell death. The bacteria and anti-microbial peptides exhibited diverse effects on the transcript levels of oncogenic relevant defensin genes and epidermal growth factor receptor signaling. These two oral pathogens exhibited opposite primary effects on the proliferation behavior of oral tumor cells. Nevertheless, both microbe species led to similar secondary impacts on the proliferation rate by modifying expression levels of oncogenic relevant α-defensin genes. In this respect, oral pathogens exerted multiplying effects on tumor cell proliferation. Additionally, human defensins were shown to differently influence epidermal growth factor receptor signaling, supporting the hypothesis that these anti-microbial peptides serve as ligands of EGFR, thus modifying the proliferation behavior of oral tumor cells.

  2. Expression of Axl and its prognostic significance in human breast cancer

    PubMed Central

    Jin, Gaoyuan; Wang, Zhenzhen; Wang, Jianguang; Zhang, Like; Chen, Yanbin; Yuan, Pengfei; Liu, Dechun


    Breast cancer is the most common malignant cancer and second leading cause of cancer-related death among women, and its prevalence continues to increase. Axl overexpression has been identified in the many types of human cancer, and it has been demonstrated to participate in signaling pathways related to carcinogenesis and cancer development. In the present study, Axl expression was examined by performing immunohistochemical staining in 60 breast cancer tumors and 40 benign breast lesions (25 mammary dysplasia and 15 breast fibroadenoma). In total, 34 (56.67%) cancer tissues and 13 (32.5%) benign breast lesions were classified as exhibiting high levels of Axl expression, indicating a significant association between malignancy and high Axl expression. High Axl expression was also associated with estrogen receptor (ER) positivity (P=0.028), progesterone receptor (PR) positivity (P=0.007), and poor tumor differentiation (P=0.033). No significant associations were observed between Axl expression and age, tumor size, lymph node metastasis, tumor node metastasis staging, human epidermal growth factor receptor 2 and Ki67 antigen. The Kaplan-Meier survival analysis and Cox proportional hazard model both demonstrated that there was no statistical difference between Axl expression and breast cancer prognosis. However, it remains unclear whether the expression of Axl is correlated with the prognosis of luminal type breast cancer patients. PMID:28356938

  3. The role of repair protein Rad51 in synergistic cytotoxicity and mutagenicity induced by epidermal growth factor receptor inhibitor (Gefitinib, Iressa{sup R}) and benzo[a]pyrene in human lung cancer

    SciTech Connect

    Ko, J.-C.; Hong, J.-H.; Wang, L.-H.; Lin, Y.-W.


    Rad51 protein is essential for homologous recombination repair of DNA damage, and is over-expressed in chemo- or radioresistant carcinomas. The polycyclic hydrocarbon carcinogen benzo[a]pyrene (B[a]P) affects MAPKs transduction pathways. Gefitinib (Iressa{sup R}, ZD1839) is a selective epidermal growth factor receptor tyrosine kinase inhibitor that blocks growth factor-mediated cell proliferation and ERK1/2 activation. We hypothesized that gefitinib enhances B[a]P-mediated cytotoxicity by decreasing ERK1/2 activation. Exposure of human lung cancer cells to gefitinib decreased B[a]P-elicited ERK1/2 activation and induced Rad51 protein expression. Gefitinib and B[a]P co-treatment decreased Rad51 protein stability by triggering degradation via a 26S proteasome-dependent pathway. Expression of constitutive active MKK1/2 vectors (MKK1/2-CA) rescues the decreased ERK1/2 activity, and restores Rad51 protein level and stability under gefitinib and B[a]P co-treatment. Gefitinib enhances B[a]P-induced growth inhibition, cytotoxicity and mutagenicity. Co-treatment with gefitinib and B[a]P can further inhibit cell growth significantly after depletion of endogenous Rad51 by siRad51 RNA transfection. Enhancement of ERK1/2 activation by MKK1-CA expression decrease B[a]P- and gefitinib-induced cytotoxicity, and B[a]P-induced mutagenicity. Rad51 protein protects lung cancer cells from synergistic cytotoxic and mutagenic effects induced by gefitinib and B[a]P. Suppression of Rad51 protein expression may be a novel lung cancer therapeutic modality to overcome drug resistance to gefitinib.

  4. Oxygen deprivation inhibits basal keratinocyte proliferation in a model of human skin and induces regio-specific changes in the distribution of epidermal adherens junction proteins, aquaporin-3, and glycogen.


    Straseski, Joely A; Gibson, Angela L; Thomas-Virnig, Christina L; Allen-Hoffmann, B Lynn


    It is generally accepted that hypoxia and recovery from oxygen deprivation contribute to the breakdown and ulceration of human skin. The effects of these stresses on proliferation, differentiation and expression of cell-cell adhesion molecules were investigated for the first time in an organotypic model of human skin. Fully stratified tissues were exposed to a time course of oxygen deprivation and subsequent reoxygenation. Regional changes in keratinocyte morphology, glycogen stores and cellular junctions were observed, with more differentiated layers of the epidermis exhibiting the first evidence of oxygen deprivation. Cellular swelling within the granular layer was concurrent with aquaporin-3 depletion. The keratinocyte adherens junction proteins E-cadherin and beta-catenin were dramatically decreased in a regio-specific manner throughout the epidermis following oxygen deprivation. In contrast, P-cadherin and the desmosomal proteins desmoplakin and desmoglein-1 were refractory to oxygen deprivation. Relative to normoxic controls, hypoxic tissues exhibited increased mRNA levels of the transcriptional repressor Slug; however, mRNA levels of the related transcriptional factor Snail were unaffected. All cellular and molecular changes were reversible upon reoxygenation. These results show that oxygen deprivation and reoxygenation exert differential effects on epidermal adhesion proteins and suggest a novel role for cadherins, beta-catenin, and Slug in hypoxia-induced junctional changes occurring in stratified squamous epithelium.

  5. Oxygen deprivation inhibits basal keratinocyte proliferation in a model of human skin and induces regio-specific changes in the distribution of epidermal adherens junction proteins, aquaporin-3, and glycogen

    PubMed Central

    Straseski, Joely A.; Gibson, Angela L.; Thomas-Virnig, Christina L.; Allen-Hoffmann, B. Lynn


    It is generally accepted that hypoxia and recovery from oxygen deprivation contribute to the breakdown and ulceration of human skin. The effects of these stresses on proliferation, differentiation and expression of cell-cell adhesion molecules were investigated for the first time in an organotypic model of human skin. Fully stratified tissues were exposed to a time course of oxygen deprivation and subsequent reoxygenation. Regional changes in keratinocyte morphology, glycogen stores and cellular junctions were observed, with more differentiated layers of the epidermis exhibiting the first evidence of oxygen deprivation. Cellular swelling within the granular layer was concurrent with aquaporin-3 depletion. The keratinocyte adherens junction proteins E-cadherin and β-catenin were dramatically decreased in a regio-specific manner throughout the epidermis following oxygen deprivation. In contrast, P-cadherin and the desmosomal proteins desmoplakin and desmoglein-1 were refractory to oxygen deprivation. Relative to normoxic controls, hypoxic tissues exhibited increased mRNA levels of the transcriptional repressor Slug however mRNA levels of the related transcriptional factor Snail were unaffected. All cellular and molecular changes were reversible upon reoxygenation. These results demonstrate that oxygen deprivation and reoxygenation exert differential effects on epidermal adhesion proteins and suggest a novel role for cadherins, β-catenin, and Slug in hypoxia-induced junctional changes occurring in stratified squamous epithelium. PMID:19614926

  6. Expression cloning of human B cell immunoglobulins.


    Wardemann, Hedda; Kofer, Juliane


    The majority of lymphomas originate from B cells at the germinal center stage or beyond. Preferential selection of B cell clones by a limited set of antigens has been suggested to drive lymphoma development. However, little is known about the specificity of the antibodies expressed by lymphoma cells, and the role of antibody-specificity in lymphomagenesis remains elusive. Here, we describe a strategy to characterize the antibody reactivity of human B cells. The approach allows the unbiased characterization of the human antibody repertoire on a single cell level through the generation of recombinant monoclonal antibodies from single primary human B cells of defined origin. This protocol offers a detailed description of the method starting from the flow cytometric isolation of single human B cells, to the RT-PCR-based amplification of the expressed Igh, Igκ, and Igλ chain genes, and Ig gene expression vector cloning for the in vitro production of monoclonal antibodies. The strategy may be used to obtain information on the clonal evolution of B cell lymphomas by single cell Ig gene sequencing and on the antibody reactivity of human lymphoma B cells.

  7. Activated Protein C Enhances Human Keratinocyte Barrier Integrity via Sequential Activation of Epidermal Growth Factor Receptor and Tie2*

    PubMed Central

    Xue, Meilang; Chow, Shu-Oi; Dervish, Suat; Chan, Yee-Ka Agnes; Julovi, Sohel M.; Jackson, Christopher J.


    Keratinocytes play a critical role in maintaining epidermal barrier function. Activated protein C (APC), a natural anticoagulant with anti-inflammatory and endothelial barrier protective properties, significantly increased the barrier impedance of keratinocyte monolayers, measured by electric cell substrate impedance sensing and FITC-dextran flux. In response to APC, Tie2, a tyrosine kinase receptor, was rapidly activated within 30 min, and relocated to cell-cell contacts. APC also increased junction proteins zona occludens, claudin-1 and VE-cadherin. Inhibition of Tie2 by its peptide inhibitor or small interfering RNA abolished the barrier protective effect of APC. Interestingly, APC did not activate Tie2 through its major ligand, angiopoietin-1, but instead acted by binding to endothelial protein C receptor, cleaving protease-activated receptor-1 and transactivating EGF receptor. Furthermore, when activation of Akt, but not ERK, was inhibited, the barrier protective effect of APC on keratinocytes was abolished. Thus, APC activates Tie2, via a mechanism requiring, in sequential order, the receptors, endothelial protein C receptor, protease-activated receptor-1, and EGF receptor, which selectively enhances the PI3K/Akt signaling to enhance junctional complexes and reduce keratinocyte permeability. PMID:21173154

  8. Optimization of 6,7-disubstituted-4-(arylamino)quinoline-3-carbonitriles as orally active, irreversible inhibitors of human epidermal growth factor receptor-2 kinase activity.


    Tsou, Hwei-Ru; Overbeek-Klumpers, Elsebe G; Hallett, William A; Reich, Marvin F; Floyd, M Brawner; Johnson, Bernard D; Michalak, Ronald S; Nilakantan, Ramaswamy; Discafani, Carolyn; Golas, Jonathan; Rabindran, Sridhar K; Shen, Ru; Shi, Xiaoqing; Wang, Yu-Fen; Upeslacis, Janis; Wissner, Allan


    A series of new 6,7-disubstituted-4-(arylamino)quinoline-3-carbonitrile derivatives that function as irreversible inhibitors of human epidermal growth factor receptor-2 (HER-2) and epidermal growth factor receptor (EGFR) kinases have been prepared. These compounds demonstrated enhanced activities for inhibiting HER-2 kinase and the growth of HER-2 positive cells compared to our EGFR kinase inhibitor 86 (EKB-569). Three synthetic routes were used to prepare these compounds. They were prepared mostly by acylation of 6-amino-4-(arylamino)quinoline-3-carbonitriles with unsaturated acid chlorides or by amination of 4-chloro-6-(crotonamido)quinoline-3-carbonitriles with monocyclic or bicyclic anilines. The third route was developed to prepare a key intermediate, 6-acetamido-4-chloroquinoline-3-carbonitrile, that involved a safer cyclization step. We show that attaching a large lipophilic group at the para position of the 4-(arylamino) ring results in improved potency for inhibiting HER-2 kinase. We also show the importance of a basic dialkylamino group at the end of the Michael acceptor for activity, due to intramolecular catalysis of the Michael addition. This, along with improved water solubility, resulted in compounds with enhanced biological properties. We present molecular modeling results consistent with the proposed mechanism of inhibition. Binding studies of one compound, 25o (C-14 radiolabeled), showed that it binds irreversibly to HER-2 protein in BT474 cells. Furthermore, it demonstrated excellent oral activity, especially in HER-2 overexpressing xenografts. Compound 25o (HKI-272) was selected for further studies and is currently in phase I clinical trials for the treatment of cancer.

  9. Comparison of rat epidermal keratinocyte organotypic culture (ROC) with intact human skin: lipid composition and thermal phase behavior of the stratum corneum.


    Pappinen, Sari; Hermansson, Martin; Kuntsche, Judith; Somerharju, Pentti; Wertz, Philip; Urtti, Arto; Suhonen, Marjukka


    The present report is a part of our continuing efforts to explore the utility of the rat epidermal keratinocyte organotypic culture (ROC) as an alternative model to human skin in transdermal drug delivery and skin irritation studies of new chemical entities and formulations. The aim of the present study was to compare the stratum corneum lipid content of ROC with the corresponding material from human skin. The lipid composition was determined by thin-layer chromatography (TLC) and mass-spectrometry, and the thermal phase transitions of stratum corneum were studied by differential scanning calorimetry (DSC). All major lipid classes of the stratum corneum were present in ROC in a similar ratio as found in human stratum corneum. Compared to human skin, the level of non-hydroxyacid-sphingosine ceramide (NS) was increased in ROC, while alpha-hydroxyacid-phytosphingosine ceramide (AP) and non-hydroxyacid-phytosphingosine ceramides (NP) were absent. Also some alterations in fatty acid profiles of ROC ceramides were noted, e.g., esterified omega-hydroxyacid-sphingosine contained increased levels of oleic acid instead of linoleic acid. The fraction of lipids covalently bound to corneocyte proteins was distinctly lower in ROC compared to human skin, in agreement with the results from DSC. ROC underwent a lipid lamellar order to disorder transition (T2) at a slightly lower temperature (68 degrees C) than human skin (74 degrees C). These differences in stratum corneum lipid composition and the thermal phase transitions may explain the minor differences previously observed in drug permeation between ROC and human skin.

  10. Differential Gene Expression in Human Cerebrovascular Malformations

    PubMed Central

    Shenkar, Robert; Elliott, J. Paul; Diener, Katrina; Gault, Judith; Hu, Ling-Jia; Cohrs, Randall J.; Phang, Tzulip; Hunter, Lawrence; Breeze, Robert E.; Awad, Issam A.


    OBJECTIVE We sought to identify genes with differential expression in cerebral cavernous malformations (CCMs), arteriovenous malformations (AVMs), and control superficial temporal arteries (STAs) and to confirm differential expression of genes previously implicated in the pathobiology of these lesions. METHODS Total ribonucleic acid was isolated from four CCM, four AVM, and three STA surgical specimens and used to quantify lesion-specific messenger ribonucleic acid expression levels on human gene arrays. Data were analyzed with the use of two separate methodologies: gene discovery and confirmation analysis. RESULTS The gene discovery method identified 42 genes that were significantly up-regulated and 36 genes that were significantly down-regulated in CCMs as compared with AVMs and STAs (P = 0.006). Similarly, 48 genes were significantly up-regulated and 59 genes were significantly down-regulated in AVMs as compared with CCMs and STAs (P = 0.006). The confirmation analysis showed significant differential expression (P < 0.05) in 11 of 15 genes (angiogenesis factors, receptors, and structural proteins) that previously had been reported to be expressed differentially in CCMs and AVMs in immunohistochemical analysis. CONCLUSION We identify numerous genes that are differentially expressed in CCMs and AVMs and correlate expression with the immunohistochemistry of genes implicated in cerebrovascular malformations. In future efforts, we will aim to confirm candidate genes specifically related to the pathobiology of cerebrovascular malformations and determine their biological systems and mechanistic relevance. PMID:12535382

  11. Phorbol ester and epidermal growth factor enhance the expression of two inducible prostaglandin H synthase genes in rat tracheal epithelial cells.


    Hamasaki, Y; Kitzler, J; Hardman, R; Nettesheim, P; Eling, T E


    Previous studies from our laboratory suggested that phorbol 12-myristate 13-acetate (TPA) stimulates prostaglandin E2 (PGE2) production by inducing de novo synthesis of prostaglandin H synthase (PHS) in a rat tracheal cell line. We report here an extension of this work to further elucidate the mechanisms by which TPA (and epidermal growth factor) stimulates PGE2 production. We used the rat tracheal cell line EGV6, which has a lower basal level of PGE2 production and responds to TPA and EGF stimulation with a much greater increase in PGE2 synthesis than the previously used cell line, Incubation of EGV6 cultures with TPA or EGF resulted in a time- and dose-dependent increase in PGE2 synthesis up to 40-fold and 6-fold, respectively. Serum also stimulated PGE2 synthesis, while bombesin, retinoic acid, and bacterial lipopolysaccharide did not. PHS protein levels in microsomal preparations from the cells were estimated by Western analysis. Antibodies raised against murine PHS-2 cross reacted with the EGV-6 PHS while several antibody preparations that react with PHS-1 from ram or mouse reacted poorly with the cellular preparation. TPA treatment increased the de novo synthesis of PHS-2 while dexamethasone treatment reduced the response to TPA. Northern blot analysis of mRNA from EGV6 cultures using a ram PHS cDNA revealed a 2.8- and a 4.5- to 4.9-kb (designated 4.9 kb) transcript. Treatment with TPA or EGF increased the expression of both transcripts and this effect was further enhanced by cyclohexamide. To further define the PHS mRNA species of EGV6 cells, two well-characterized murine PHS cDNA probes were used. The constitutive murine PHS cDNA probe hybridized only with the 2.8-kb transcript, and the inducible murine PHS cDNA hybridized only with the 4.9-kb transcript. The rates of induction as well as degradation of the 4.9-kb PHS mRNA were much more rapid than those of the 2.8-kb mRNA species. Dexamethasone partially inhibited the induction of both PHS transcripts by

  12. Epiprofin orchestrates epidermal keratinocyte proliferation and differentiation.


    Nakamura, Takashi; Yoshitomi, Yasuo; Sakai, Kiyoshi; Patel, Vyomesh; Fukumoto, Satoshi; Yamada, Yoshihiko


    The basal layer of the epidermis contains stem cells and transit amplifying cells that rapidly proliferate and differentiate further into the upper layers of the epidermis. A number of molecules have been identified as regulators of this process, including p63 (also known as tumor protein 63) and Notch1. However, little is known about the mechanisms that regulate the transitions from stem cell to proliferating or differentiating transit amplifying cell. Here, we demonstrate that epiprofin (Epfn, also known as Sp6) plays crucial distinct roles in these transition stages as a cell cycle regulator and a transcription factor. Epfn knockout mice have a thickened epidermis, in which p63-expressing basal cells form multiple layers owing to the accumulation of premature transit amplifying cells with reduced proliferation and a reduction in the number of differentiating keratinocytes expressing Notch1. We found that low levels of Epfn expression increased the proliferation of human immortalized keratinocyte (HaCaT) cells by increasing EGF responsiveness and superphosphorylation of Rb. By contrast, high levels of Epfn expression promoted cell cycle exit and differentiation, by reducing E2F transactivation and inducing Notch1 expression. Our findings identify multiple novel functions of Epfn in epidermal development.

  13. Circadian Kisspeptin expression in human term placenta.


    de Pedro, M A; Morán, J; Díaz, I; Murias, L; Fernández-Plaza, C; González, C; Díaz, E


    Kisspeptin is an essential gatekeeper of reproductive function. During pregnancy high circulating levels of kisspeptin have been described, however the clear role of this neuropeptide in pregnancy remains unknown. We tested the existence of rhythmic kisspeptin expression in human full-term placenta from healthy pregnant women at six different time points during the day. The data obtained by Western blotting were fitted to a mathematical model (Fourier series), demonstrating, for the first time, the existence of a circadian rhythm in placental kisspeptin expression.

  14. c-Jun promotes whereas JunB inhibits epidermal neoplasia.


    Jin, Jane Y; Ke, Hengning; Hall, Russell P; Zhang, Jennifer Y


    Deregulation of the activator protein 1 (AP1) family gene regulators has been implicated in a wide range of diseases, including cancer. In this study we report that c-Jun was activated in human squamous cell carcinoma (SCC) and coexpression of c-Jun with oncogenic Ras was sufficient to transform primary human epidermal cells into malignancy in a regenerated human skin grafting model. In contrast, JunB was not induced in a majority of human SCC cells. Moreover, exogenous expression of JunB inhibited tumorigenesis driven by Ras or spontaneous human SCC cells. Conversely, the dominant-negative JunB mutant (DNJunB) promoted tumorigenesis, which is in contrast to the tumor-suppressor function of the corresponding c-Jun mutant. At the cellular level, JunB induced epidermal cell senescence and slowed cell growth in a cell-autonomous manner. Consistently, coexpression of JunB and Ras induced premature epidermal differentiation concomitant with upregulation of p16 and filaggrin and downregulation of cyclin D1 and cyclin-dependent kinase 4 (CDK4). These findings indicate that JunB and c-Jun differentially regulate cell growth and differentiation and induce opposite effects on epidermal neoplasia.JID JOURNAL CLUB ARTICLE: For questions, answers, and open discussion about this article, please go to

  15. Beneficial Effects of the Genus Aloe on Wound Healing, Cell Proliferation, and Differentiation of Epidermal Keratinocytes

    PubMed Central

    Uda, Junki; Kubo, Hirokazu; Nakajima, Yuka; Goto, Arisa; Akaki, Junji; Yoshida, Ikuyo; Matsuoka, Nobuya; Hayakawa, Takao


    Aloe has been used as a folk medicine because it has several important therapeutic properties. These include wound and burn healing, and Aloe is now used in a variety of commercially available topical medications for wound healing and skin care. However, its effects on epidermal keratinocytes remain largely unclear. Our data indicated that both Aloe vera gel (AVG) and Cape aloe extract (CAE) significantly improved wound healing in human primary epidermal keratinocytes (HPEKs) and a human skin equivalent model. In addition, flow cytometry analysis revealed that cell surface expressions of β1-, α6-, β4-integrin, and E-cadherin increased in HPEKs treated with AVG and CAE. These increases may contribute to cell migration and wound healing. Treatment with Aloe also resulted in significant changes in cell-cycle progression and in increases in cell number. Aloe increased gene expression of differentiation markers in HPEKs, suggesting roles for AVG and CAE in the improvement of keratinocyte function. Furthermore, human skin epidermal equivalents developed from HPEKs with medium containing Aloe were thicker than control equivalents, indicating the effectiveness of Aloe on enhancing epidermal development. Based on these results, both AVG and CAE have benefits in wound healing and in treatment of rough skin. PMID:27736988

  16. Glycoprotein expression in human milk during lactation.


    Froehlich, John W; Dodds, Eric D; Barboza, Mariana; McJimpsey, Erica L; Seipert, Richard R; Francis, Jimi; An, Hyun Joo; Freeman, Samara; German, J Bruce; Lebrilla, Carlito B


    While milk proteins have been studied for decades, strikingly little effort has been applied to determining how the post-translational modifications (PTMs) of these proteins may change during the course of lactation. PTMs, particularly glycosylation, can greatly influence protein structure, function, and stability and can particularly influence the gut where their degradation products are potentially bioactive. In this work, previously undiscovered temporal variations in both expression and glycosylation of the glycoproteome of human milk are observed. Lactoferrin, one of the most abundant glycoproteins in human milk, is shown to be dynamically glycosylated during the first 10 days of lactation. Variations in expression or glycosylation levels are also demonstrated for several other abundant whey proteins, including tenascin, bile salt-stimulated lipase, xanthine dehydrogenase, and mannose receptor.

  17. Synergistic anti-proliferative and pro-apoptotic activity of combined therapy with bortezomib, a proteasome inhibitor, with anti-epidermal growth factor receptor (EGFR) drugs in human cancer cells.


    Cascone, Tina; Morelli, Maria Pia; Morgillo, Floriana; Kim, Woo-Young; Rodolico, Gabriella; Pepe, Stefano; Tortora, Giampaolo; Berrino, Liberato; Lee, Ho-Young; Heymach, John V; Ciardiello, Fortunato


    The proteasome plays a pivotal role in the turnover of regulatory transduction proteins induced by activated cell membrane growth factor receptors. The epidermal growth factor receptor (EGFR) pathway is crucial in the development and progression of human epithelial cancers. Proteasome inhibition may sensitize human cancer cell lines to EGFR inhibitors. We investigated the growth inhibitory and pro-apoptotic effects of the proteasome inhibitor bortezomib in combination with anti-EGFR drugs, such as gefitinib, vandetanib, and cetuximab in EGFR-expressing human cancer cell lines. Bortezomib determined dose-dependent growth inhibition in a nine cancer cell line panel (IC(50) values, range 6-42 nM). A significant synergistic growth inhibitory effect was observed with the combination of bortezomib and each EGFR inhibitor in all cell lines (combination index, CI, range 0.10-0.55), which was accompanied by a significant induction in apoptosis by the combined treatment with bortezomib, cetuximab and vandetanib. In HCT-116 colon cancer and A549 lung adenocarcinoma cells, bortezomib plus EGFR inhibitor treatment induced a more effective inhibition of EGFR-activated down-stream signals, including a marked suppression in activated, phosphorylated Akt (P-Akt). In contrast, overexpression of a constitutively active P-Akt protected A549 cells by cell growth inhibition and apoptosis following treatment with bortezomib and EGFR inhibitors. The combined treatment with bortezomib and EGFR inhibitors has a synergistic growth inhibitory and pro-apoptotic activity in different human cancer cells which possess a functional EGFR-dependent autocrine growth pathway through to a more efficient and sustained inhibition of Akt.

  18. Down-regulation of E-cadherin in human bronchial epithelial cells leads to epidermal growth factor receptor-dependent Th2 cell-promoting activity.


    Heijink, Irene H; Kies, P Marcel; Kauffman, Henk F; Postma, Dirkje S; van Oosterhout, Antoon J M; Vellenga, Edo


    Airway epithelial cells are well-known producers of thymus- and activation-regulated chemokine (TARC), a Th2 cell-attracting chemokine that may play an important role in the development of allergic airway inflammation. However, the mechanism responsible for up-regulation of TARC in allergy is still unknown. In the asthmatic airways, loss of expression of the cell-cell contact molecule E-cadherin and reduced epithelial barrier function has been observed, which may be the result of an inadequate repair response. Because E-cadherin also suppressed multiple signaling pathways, we studied whether disruption of E-cadherin-mediated cell contact may contribute to increased proallergic activity of epithelial cells, e.g., production of the chemokine TARC. We down-regulated E-cadherin in bronchial epithelial cells by small interference RNA and studied effects on electrical resistance, signaling pathways, and TARC expression (by electric cell-substrate impedance sensing, immunodetection, immunofluorescent staining, and real-time PCR). Small interference RNA silencing of E-cadherin resulted in loss of E-cadherin-mediated junctions, enhanced phosphorylation of epidermal growth factor receptor (EGFR), and the downstream targets MEK/ERK-1/2 and p38 MAPK, finally resulting in up-regulation of TARC as well as thymic stromal lymphopoietin expression. The use of specific inhibitors revealed that the effect on TARC is mediated by EGFR-dependent activation of the MAPK pathways. In contrast to TARC, expression of the Th1/Treg cell-attracting chemokine RANTES was unaffected by E-cadherin down-regulation. In summary, we show that loss of E-cadherin-mediated epithelial cell-cell contact by damaging stimuli, e.g., allergens, may result in reduced suppression of EGFR-dependent signaling pathways and subsequent induction of Th2 cell-attracting molecule TARC. Thus, disruption of intercellular epithelial contacts may specifically promote Th2 cell recruitment in allergic asthma.

  19. Metabolic Disposition of Osimertinib in Rats, Dogs, and Humans: Insights into a Drug Designed to Bind Covalently to a Cysteine Residue of Epidermal Growth Factor Receptor.


    Dickinson, Paul A; Cantarini, Mireille V; Collier, Jo; Frewer, Paul; Martin, Scott; Pickup, Kathryn; Ballard, Peter


    Preclinical and clinical studies were conducted to determine the metabolism and pharmacokinetics of osimertinib and key metabolites AZ5104 and AZ7550. Osimertinib was designed to covalently bind to epidermal growth factor receptors, allowing it to achieve nanomolar cellular potency (Finlay et al., 2014). Covalent binding was observed in incubations of radiolabeled osimertinib with human and rat hepatocytes, human and rat plasma, and human serum albumin. Osimertinib, AZ5104, and AZ7550 were predominantly metabolized by CYP3A. Seven metabolites were detected in human hepatocytes, also observed in rat or dog hepatocytes at similar or higher levels. After oral administration of radiolabeled osimertinib to rats, drug-related material was widely distributed, with the highest radioactivity concentrations measured at 6 hours postdose in most tissues; radioactivity was detectable in 42% of tissues 60 days postdose. Concentrations of [(14)C]-radioactivity in blood were lower than in most tissues. After the administration of a single oral dose of 20 mg of radiolabeled osimertinib to healthy male volunteers, ∼19% of the dose was recovered by 3 days postdose. At 84 days postdose, mean total radioactivity recovery was 14.2% and 67.8% of the dose in urine and feces. The most abundant metabolite identified in feces was AZ5104 (∼6% of dose). Osimertinib accounted for ∼1% of total radioactivity in the plasma of non-small cell lung cancer patients after 22 days of 80-mg osimertinib once-daily treatment; the most abundant circulatory metabolites were AZ7550 and AZ5104 (<10% of total osimertinib-related material). Osimertinib is extensively distributed and metabolized in humans and is eliminated primarily via the fecal route.

  20. A novel control of human keratin expression: cannabinoid receptor 1-mediated signaling down-regulates the expression of keratins K6 and K16 in human keratinocytes in vitro and in situ

    PubMed Central

    Zákány, Nóra; Tóth, Balázs I.; Bíró, Tamás


    Cannabinoid receptors (CB) are expressed throughout human skin epithelium. CB1 activation inhibits human hair growth and decreases proliferation of epidermal keratinocytes. Since psoriasis is a chronic hyperproliferative, inflammatory skin disease, it is conceivable that the therapeutic modulation of CB signaling, which can inhibit both proliferation and inflammation, could win a place in future psoriasis management. Given that psoriasis is characterized by up-regulation of keratins K6 and K16, we have investigated whether CB1 stimulation modulates their expression in human epidermis. Treatment of organ-cultured human skin with the CB1-specific agonist, arachidonoyl-chloro-ethanolamide (ACEA), decreased K6 and K16 staining intensity in situ. At the gene and protein levels, ACEA also decreased K6 expression of cultured HaCaT keratinocytes, which show some similarities to psoriatic keratinocytes. These effects were partly antagonized by the CB1-specific antagonist, AM251. While CB1-mediated signaling also significantly inhibited human epidermal keratinocyte proliferation in situ, as shown by K6/Ki-67-double immunofluorescence, the inhibitory effect of ACEA on K6 expression in situ was independent of its anti-proliferative effect. Given recent appreciation of the role of K6 as a functionally important protein that regulates epithelial wound healing in mice, it is conceivable that the novel CB1-mediated regulation of keratin 6/16 revealed here also is relevant to wound healing. Taken together, our results suggest that cannabinoids and their receptors constitute a novel, clinically relevant control element of human K6 and K16 expression. PMID:23638377

  1. Cell-free synthesis of functional human epidermal growth factor receptor: Investigation of ligand-independent dimerization in Sf21 microsomal membranes using non-canonical amino acids

    PubMed Central

    Quast, Robert B.; Ballion, Biljana; Stech, Marlitt; Sonnabend, Andrei; Varga, Balázs R.; Wüstenhagen, Doreen A.; Kele, Péter; Schiller, Stefan M.; Kubick, Stefan


    Cell-free protein synthesis systems represent versatile tools for the synthesis and modification of human membrane proteins. In particular, eukaryotic cell-free systems provide a promising platform for their structural and functional characterization. Here, we present the cell-free synthesis of functional human epidermal growth factor receptor and its vIII deletion mutant in a microsome-containing system derived from cultured Sf21 cells. We provide evidence for embedment of cell-free synthesized receptors into microsomal membranes and asparagine-linked glycosylation. Using the cricket paralysis virus internal ribosome entry site and a repetitive synthesis approach enrichment of receptors inside the microsomal fractions was facilitated thereby providing analytical amounts of functional protein. Receptor tyrosine kinase activation was demonstrated by monitoring receptor phosphorylation. Furthermore, an orthogonal cell-free translation system that provides the site-directed incorporation of p-azido-L-phenylalanine is characterized and applied to investigate receptor dimerization in the absence of a ligand by photo-affinity cross-linking. Finally, incorporated azides are used to generate stable covalently linked receptor dimers by strain-promoted cycloaddition using a novel linker system. PMID:27670253

  2. Local Adaptation of Sun-Exposure-Dependent Gene Expression Regulation in Human Skin

    PubMed Central

    Kita, Ryosuke; Fraser, Hunter B.


    Sun-exposure is a key environmental variable in the study of human evolution. Several skin-pigmentation genes serve as classical examples of positive selection, suggesting that sun-exposure has significantly shaped worldwide genomic variation. Here we investigate the interaction between genetic variation and sun-exposure, and how this impacts gene expression regulation. Using RNA-Seq data from 607 human skin samples, we identified thousands of transcripts that are differentially expressed between sun-exposed skin and non-sun-exposed skin. We then tested whether genetic variants may influence each individual’s gene expression response to sun-exposure. Our analysis revealed 10 sun-exposure-dependent gene expression quantitative trait loci (se-eQTLs), including genes involved in skin pigmentation (SLC45A2) and epidermal differentiation (RASSF9). The allele frequencies of the RASSF9 se-eQTL across diverse populations correlate with the magnitude of solar radiation experienced by these populations, suggesting local adaptation to varying levels of sunlight. These results provide the first examples of sun-exposure-dependent regulatory variation and suggest that this variation has contributed to recent human adaptation. PMID:27760139

  3. Biology of human skin transplanted to the nude mouse: I. Response to agents which modify epidermal proliferation.


    Krueger, G G; Shelby, J


    To accept human skin transplanted to the congenitally athymic (nude) mouse as a system to study human skin and its physiologic and pathologic states, it must be demonstrated that skin so maintained retains its function as a biologic unit. We have found that responses of grafted human skin and nude mouse skin to various agents differ. This difference in response has been utilized to assess barrier function and proliferative capacity of human skin grafts. Human skin grafts undergo a proliferative response when 10 ng of the tumor promoter, 12-O-tetradecanoyl phorbol 13-acetate (TPA) is applied. Nudes do not respond to this dose. Increasing the dose to 100 ng of TPA evokes a response in both. However, only in the human skin grafts can this response be blocked with betamethasone valerate (BV). In that human skin grafts do not take on their hosts' responsiveness, and the response of domestic pig skin to these agents before and after grafting is identical, the conclusion is reached that human skin appears to retain its inherent biologic unit function. The data also demonstrate some of the potential of this system to study kinetics of the epidermis of human skin.

  4. A Comparison of Artificial Subtle Expressions with Human-like Expressions on Expressing Confidence Level

    NASA Astrophysics Data System (ADS)

    Komatsu, Takanori; Kobayashi, Kazuki; Yamada, Seiji; Funakoshi, Kotaro; Nakano, Mikio

    Expressing the confidence level of a system's suggestions by using speech sounds is an important cue to users of the system for perceiving how likely it is for the suggestions to be correct. We assume that expressing confidence levels by using human-like expressions would cause users to have a poorer impression of the systems than if artificial subtle expressions (ASEs) were used when the quality of the presented information does not match the expressed confidence level. We confirmed that this assumption was correct by conducting a psychological experiment.

  5. Clinical effects of prior trastuzumab on combination eribulin mesylate plus trastuzumab as first-line treatment for human epidermal growth factor receptor 2 positive locally recurrent or metastatic breast cancer: results from a Phase II, single-arm, multicenter study

    PubMed Central

    Puhalla, Shannon; Wilks, Sharon; Brufsky, Adam M; O’Shaughnessy, Joyce; Schwartzberg, Lee S; Berrak, Erhan; Song, James; Vahdat, Linda


    Eribulin mesylate, a novel nontaxane microtubule dynamics inhibitor in the halichondrin class of antineoplastic drugs, is indicated for the treatment of patients with metastatic breast cancer who previously received ≥2 chemotherapy regimens in the metastatic setting. Primary data from a Phase II trial for the first-line combination of eribulin plus trastuzumab in human epidermal growth factor receptor 2 positive patients showed a 71% objective response rate and tolerability consistent with the known profile of these agents. Here, we present prespecified analyses of efficacy of this combination based on prior trastuzumab use. Patients received eribulin mesylate 1.4 mg/m2 (equivalent to 1.23 mg/m2 eribulin [expressed as free base]) intravenously on days 1 and 8 plus trastuzumab (8 mg/kg intravenously/cycle 1, then 6 mg/kg) on day 1 of each 21-day cycle. Objective response rates, progression-free survival, and tolerability were assessed in patients who had and had not received prior adjuvant or neoadjuvant (neo/adjuvant) trastuzumab treatment. Fifty-two patients (median age: 59.5 years) received eribulin/trastuzumab for a median treatment duration of ~31 weeks; 40.4% (n=21) had been previously treated with neo/adjuvant trastuzumab prior to treatment with eribulin plus trastuzumab for metastatic disease (median time between neo/adjuvant and study treatment: 23 months). In trastuzumab-naïve patients (n=31) compared with those who had received prior trastuzumab, objective response rate was 77.4% versus 61.9%, respectively; duration of response was 11.8 versus 9.5 months, respectively; clinical benefit rate was 87.1% versus 81.0%, respectively; and median progression-free survival was 12.2 versus 11.5 months, respectively. The most common grade 3/4 treatment-emergent adverse events (occuring in ≥5% of patients) in patients who received prior trastuzumab versus trastuzumab naïve patients, respectively, were neutropenia (47.6% vs 32.3%), peripheral neuropathy (14

  6. Preclinical safety assessment of a DNA vaccine using particle-mediated epidermal delivery in domestic pig, minipig and mouse.


    Dincer, Zuhal; Jones, Stewart; Haworth, Richard


    DNA vaccination involves the direct injection of genes coding for specific antigenic proteins. One technique known as particle-mediated epidermal delivery (PMED) is a practical approach for epidermal delivery and provides a strong immune response. An important aspect of the preclinical safety assessment of DNA vaccines is the selection of a pharmacologically relevant animal model for the assessment of antigen expression, optimization of delivery and formulation of the plasmid. This paper describes a comparative study of domestic pig, minipig and mouse in regard to local tolerance and antigen expression of HIV immunotherapeutic using PMED. Pig/minipig is considered a good model for the safety assessment of DNA vaccines due to the similarity to human skin. Local reactions were evaluated at 10 min, 4, 24 and 48 h. Histology of administration sites revealed epidermal necrosis with associated dermal inflammation at 10 min and 4h, and subsequent regeneration with repair at 24 and 48 h. The degree and extent of these changes varied according to species. Domestic pig and minipig showed superficial epidermal necrosis and complete repair, while the mouse showed full-thickness epidermal necrosis and partial repair. Expression of HIV antigen was confirmed using immunohistochemistry in all three species at 4, 24 and 48 h. The results showed that PMED is an effective system for DNA vaccine delivery as demonstrated by the antigen expression seen as early as 4 h.

  7. MicroRNA-143 inhibits IL-13-induced dysregulation of the epidermal barrier-related proteins in skin keratinocytes via targeting to IL-13Rα1.


    Zeng, Yue-Ping; Nguyen, Giang Huong; Jin, Hong-Zhong


    Atopic dermatitis is a chronic inflammatory skin disease characterized by the dysregulation of the epidermal barrier and the immune system. Interleukin (IL)-13, a key T helper 2 cytokine, has been shown to impair the epidermal barrier function via downregulating epidermal barrier proteins. MicroRNAs are small noncoding RNAs of approximately 22 nucleotides that act as negative regulators of gene expression at posttranscriptional levels. MicroRNA-143 is known to be a tumor suppressor in various tumors; however, its role in the regulation of allergic diseases including atopic dermatitis remains elusive. In this study, we investigated whether IL-13Rα1 was a microRNA-143 target to regulate the effects of IL-13 on epidermal barrier function. After the stimulation of IL-13 in human epidermal keratinocytes, the level of microRNA-143 was decreased. The luciferase activity of the vector containing 3'UTR of IL-13Rα1 was decreased in keratinocytes transfected with microRNA-143 mimic compared to those of the corresponding controls. The forced expression of microRNA-143 mimic blocked the IL-13-induced downregulation of filaggrin, loricrin, and involucrin in epidermal keratinocytes. Collectively, these data suggest that microRNA-143 suppresses IL-13 activity and inflammation through targeting of IL-13Rα1 in epidermal keratinocytes. MicroRNA-143 may serve as a potential preventive and therapeutic target in atopic dermatitis.

  8. Gene expression profiling of human ovarian tumours

    PubMed Central

    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; LiVolsi, V A; Johnson, S W


    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT–PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers. PMID:16969345

  9. Gene expression profiling of human ovarian tumours.


    Biade, S; Marinucci, M; Schick, J; Roberts, D; Workman, G; Sage, E H; O'Dwyer, P J; Livolsi, V A; Johnson, S W


    There is currently a lack of reliable diagnostic and prognostic markers for ovarian cancer. We established gene expression profiles for 120 human ovarian tumours to identify determinants of histologic subtype, grade and degree of malignancy. Unsupervised cluster analysis of the most variable set of expression data resulted in three major tumour groups. One consisted predominantly of benign tumours, one contained mostly malignant tumours, and one was comprised of a mixture of borderline and malignant tumours. Using two supervised approaches, we identified a set of genes that distinguished the benign, borderline and malignant phenotypes. These algorithms were unable to establish profiles for histologic subtype or grade. To validate these findings, the expression of 21 candidate genes selected from these analyses was measured by quantitative RT-PCR using an independent set of tumour samples. Hierarchical clustering of these data resulted in two major groups, one benign and one malignant, with the borderline tumours interspersed between the two groups. These results indicate that borderline ovarian tumours may be classified as either benign or malignant, and that this classifier could be useful for predicting the clinical course of borderline tumours. Immunohistochemical analysis also demonstrated increased expression of CD24 antigen in malignant versus benign tumour tissue. The data that we have generated will contribute to a growing body of expression data that more accurately define the biologic and clinical characteristics of ovarian cancers.

  10. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland

    PubMed Central

    Slominski, Andrzej T.; Kim, Tae-Kang; Shehabi, Haleem Z.; Tang, Edith; Benson, Heather A. E.; Semak, Igor; Lin, Zongtao; Yates, Charles R.; Wang, Jin; Li, Wei; Tuckey, Robert C.


    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)2D2, 1,20(OH)2D2, 25(OH)D2 and 1,25(OH)2D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)2D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)2D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity. PMID:24382416

  11. In vivo production of novel vitamin D2 hydroxy-derivatives by human placentas, epidermal keratinocytes, Caco-2 colon cells and the adrenal gland.


    Slominski, Andrzej T; Kim, Tae-Kang; Shehabi, Haleem Z; Tang, Edith K Y; Benson, Heather A E; Semak, Igor; Lin, Zongtao; Yates, Charles R; Wang, Jin; Li, Wei; Tuckey, Robert C


    We investigated the metabolism of vitamin D2 to hydroxyvitamin D2 metabolites ((OH)D2) by human placentas ex-utero, adrenal glands ex-vivo and cultured human epidermal keratinocytes and colonic Caco-2 cells, and identified 20(OH)D2, 17,20(OH)₂D2, 1,20(OH)₂D2, 25(OH)D2 and 1,25(OH)₂D2 as products. Inhibition of product formation by 22R-hydroxycholesterol indicated involvement of CYP11A1 in 20- and 17-hydroxylation of vitamin D2, while use of ketoconazole indicated involvement of CYP27B1 in 1α-hydroxylation of products. Studies with purified human CYP11A1 confirmed the ability of this enzyme to convert vitamin D2 to 20(OH)D2 and 17,20(OH)₂D2. In placentas and Caco-2 cells, production of 20(OH)D2 was higher than 25(OH)D2 while in human keratinocytes the production of 20(OH)D2 and 25(OH)D2 were comparable. HaCaT keratinocytes showed high accumulation of 1,20(OH)₂D2 relative to 20(OH)D2 indicating substantial CYP27B1 activity. This is the first in vivo evidence for a novel pathway of vitamin D2 metabolism initiated by CYP11A1 and modified by CYP27B1, with the product profile showing tissue- and cell-type specificity.

  12. Matriptase and prostasin are expressed in human skin in an inverse trend over the course of differentiation and are targeted to different regions of the plasma membrane.


    Lai, Chih-Hsin; Chang, Shun-Cheng; Chen, Yen-Ju; Wang, Yi-Jie J; Lai, Ying-Jun J; Chang, Hsiang-Hua D; Berens, Eric B; Johnson, Michael D; Wang, Jehng-Kang; Lin, Chen-Yong


    Matriptase and prostasin, acting as a tightly coupled proteolytic cascade, were reported to be required for epidermal barrier formation in mouse skin. Here we show that, in human skin, matriptase and prostasin are expressed with an inverse pattern over the course of differentiation. Matriptase was detected primarily in epidermal basal keratinocytes and the basaloid cells in the outer root sheath of hair follicles and the sebaceous gland, where prostasin was not detected. In contrast, prostasin was detected primarily in differentiated cells in the epidermal granular layer, the inner root sheath of hair follicles, and the sebaceous gland, where matriptase expression is negligible. While co-expressed in the middle stage of differentiation, prostasin was detected as polarized patches, and matriptase at intercellular junctions. Targeting to different subcellular localizations is also observed in HaCaT human keratinocytes, in which matriptase was detected primarily at intercellular junctions, and prostasin primarily on membrane protrusion. Furthermore, upon induction of zymogen activation, free active prostasin remains cell-associated and free active matriptase is rapidly shed into the extracellular milieu. Our data suggest that matriptase and prostasin likely function as independent entities in human skin rather than as a tightly coupled proteolytic cascade as observed in mouse skin.

  13. Matriptase and prostasin are expressed in human skin in an inverse trend over the course of differentiation and are targeted to different regions of the plasma membrane

    PubMed Central

    Lai, Chih-Hsin; Chang, Shun-Cheng; Chen, Yen-Ju; Wang, Yi-Jie J.; Lai, Ying-Jun J.; Chang, Hsiang-Hua D.; Berens, Eric B.; Johnson, Michael D.; Wang, Jehng-Kang; Lin, Chen-Yong


    ABSTRACT Matriptase and prostasin, acting as a tightly coupled proteolytic cascade, were reported to be required for epidermal barrier formation in mouse skin. Here we show that, in human skin, matriptase and prostasin are expressed with an inverse pattern over the course of differentiation. Matriptase was detected primarily in epidermal basal keratinocytes and the basaloid cells in the outer root sheath of hair follicles and the sebaceous gland, where prostasin was not detected. In contrast, prostasin was detected primarily in differentiated cells in the epidermal granular layer, the inner root sheath of hair follicles, and the sebaceous gland, where matriptase expression is negligible. While co-expressed in the middle stage of differentiation, prostasin was detected as polarized patches, and matriptase at intercellular junctions. Targeting to different subcellular localizations is also observed in HaCaT human keratinocytes, in which matriptase was detected primarily at intercellular junctions, and prostasin primarily on membrane protrusion. Furthermore, upon induction of zymogen activation, free active prostasin remains cell-associated and free active matriptase is rapidly shed into the extracellular milieu. Our data suggest that matriptase and prostasin likely function as independent entities in human skin rather than as a tightly coupled proteolytic cascade as observed in mouse skin. PMID:27543057


    EPA Science Inventory

    Epidemiological studies have implicated zinc in the toxicity of ambient particulate matter (PM) inhalation. We previously showed that exposure to metal-laden PM inhibits protein tyrosine phosphatase (PTP) activity in human primary bronchial epithelial cells (HAEC) and leads t...

  15. Role of the Epidermal Growth Factor Receptor Variant (EGFRvIII) in Radiation Response of Human Breast Cancer Cells

    DTIC Science & Technology


    when activated by ligand and when activated by ionizing radiation . Unlike HER2, which is constitutively active when over-expressed, response to single dose ionizing radiation over a range of doses for either cell line, nor were there differences in the radiation response...fractionated radiation . N 2 Gy x 0 2Gyx3 LL o C l MCF10A -pLXSN MCF10A -vIIl 3. Effect of inhibition of constitutive activation of EGFRvII[ and HER2 in

  16. Reference genes for gene expression analysis in proliferating and differentiating human keratinocytes.


    Lanzafame, Manuela; Botta, Elena; Teson, Massimo; Fortugno, Paola; Zambruno, Giovanna; Stefanini, Miria; Orioli, Donata


    Abnormalities in keratinocyte growth and differentiation have a pathogenic significance in many skin disorders and result in gene expression alterations detectable by quantitative real-time RT-PCR (qRT-PCR). Relative quantification based on endogenous control (EC) genes is the commonly adopted approach, and the use of multiple reference genes from independent pathways is considered a best practice guideline, unless fully validated EC genes are available. The literature on optimal reference genes during in vitro calcium-induced differentiation of normal human epidermal keratinocytes (NHEK) is inconsistent. In many studies, the expression of target genes is compared to that of housekeeping genes whose expression, however, significantly varies during keratinocyte differentiation. Here, we report the results of our investigations on the expression stability of 15 candidate EC genes, including those commonly used as reference in expression analysis by qRT-PCR, during NHEK calcium-induced differentiation. We demonstrate that YWHAZ and UBC are extremely stable genes, and therefore, they represent optimal EC genes for expression studies in proliferating and calcium-induced differentiating NHEK. Furthermore, we demonstrate that YWHAZ/14-3-3-zeta is a suitable reference for quantitative comparison of both transcript and protein levels.

  17. [Verrucose epidermal nevus with belated grow and pregnancy. Case report].


    Aguilera Martínez, Verónica; Cervantes Villarreal, Gustavo Enrique; Ramos Garibay, Alberto; Ruiz Mondragón, María Eugenia


    Verrucose epidermal nevus is a benign and congenital hyperplasia of the superficial epidermis and annexes. It expresses itself during the firs year of life, grows during childhood and in adolescence reaches its largest size. It can appear everywhere in skin surface. We present a case of late verrucose epidermal nevus with genital onset. Differential diagnosis was done with acuminated condylomas.

  18. Ultraviolet B, melanin and mitochondrial DNA: Photo-damage in human epidermal keratinocytes and melanocytes modulated by alpha-melanocyte-stimulating hormone

    PubMed Central

    Böhm, Markus; Hill, Helene Z.


    Alpha-melanocyte-stimulating hormone (alpha-MSH) increases melanogenesis and protects from UV-induced DNA damage. However, its effect on mitochondrial DNA (mtDNA) damage is unknown. We have addressed this issue in a pilot study using human epidermal keratinocytes and melanocytes incubated with alpha-MSH and irradiated with UVB. Real-time touchdown PCR was used to quantify total and deleted mtDNA. The deletion detected encompassed the common deletion but was more sensitive to detection. There were 4.4 times more mtDNA copies in keratinocytes than in melanocytes. Irradiation alone did not affect copy numbers. Alpha-MSH slightly increased copy numbers in both cell types in the absence of UVB and caused a similar small decrease in copy number with dose in both cell types. Deleted copies were nearly twice as frequent in keratinocytes as in melanocytes. Alpha-MSH reduced the frequency of deleted copies by half in keratinocytes but not in melanocytes. UVB dose dependently led to an increase in the deleted copy number in alpha-MSH-treated melanocytes. UVB irradiation had little effect on deleted copy number in alpha-MSH-treated keratinocytes. In summary, alpha-MSH enhances mtDNA damage in melanocytes presumably by increased melanogenesis, while α-MSH is protective in keratinocytes, the more so in the absence of irradiation. PMID:27303631

  19. The effect of continuous release of recombinant human epidermal growth factor (rh-EGF) in chitosan film on full thickness excisional porcine wounds.


    Hong, Joon Pio; Kim, Yeun Wha; Lee, Sang Kil; Kim, Sun Hee; Min, Kyung Hyun


    The purpose of this article is to evaluate the effect of continuously released recombinant human epidermal growth factor (rh-EGF) in chitosan film in full thickness porcine wounds. A total of 10 domestic pigs (Yorkshire species) weighing 18 to 22 kg between the ages of 50 to 60 days were used. The wounds were divided into 3 groups and treated selectively with rh-EGF in chitosan film (EGF 20 ug/wound/d), chitosan film without rh-EGF, or remained as the control group. One hundred percent healing time was observed, and hematoxylin and eosin and Anti Ki-67 antibody immunohistochemical staining were performed. The 100% healing time and Anti Ki-67 antibody immunohistochemical staining showed statistical significance of the rh-EGF chitosan film-treated group against the control group (P < 0.05). But it did not reveal any statistical significance over the chitosan film-treated group. In this preliminary study, although continuous release of rh-EGF in chitosan film accelerates epithelialization, the benefit of the combination of rh-EGF in chitosan cannot be determined over the use of chitosan alone. Further analysis using complex wound models such as diabetes or infection, which may have different pathology in healing, will be needed to evaluate the potential benefit/synergistic effectiveness.

  20. Resistance to therapy in estrogen receptor positive and human epidermal growth factor 2 positive breast cancers: progress with latest therapeutic strategies.


    Lousberg, Laurence; Collignon, Joëlle; Jerusalem, Guy


    In this article, we focus on the subtype of estrogen receptor (ER)-positive, human epidermal growth factor 2 (HER2)-positive breast cancer (BC). Preclinical and clinical data indicate a complex molecular bidirectional crosstalk between the ER and HER2 pathways. This crosstalk probably constitutes one of the key mechanisms of drug resistance in this subclass of BC. Delaying or even reversing drug resistance seems possible by targeting pathways implicated in this crosstalk. High-risk patients currently receive anti-HER2 therapy, chemotherapy and endocrine therapy in the adjuvant setting. In metastatic cases, most patients receive a combination of anti-HER2 therapy and chemotherapy. Only selected patients presenting more indolent disease are candidates for combinations of anti-HER2 therapy and endocrine therapy. However, relative improvements in progression-free survival by chemotherapy-based regimens are usually lower in ER-positive patients than the ER-negative and HER2-positive subgroup. Consequently, new approaches aiming to overcome endocrine therapy resistance by adding targeted therapies to endocrine therapy based regimens are currently explored. In addition, dual blockade of HER2 or the combination of trastuzumab and phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mammalian target of rapamycin (mTOP) inhibitors targeting the downstream pathway are strategies to overcome resistance to trastuzumab. This may lead in the near future to the less frequent use of chemotherapy-based treatment options in ER-positive, HER2-positive BC.

  1. Metastatic human epidermal growth factor 2 (HER2/neu) amplified breast cancer with acute fulminant hepatitis responding to trastuzumab, pertuzumab and carboplatin

    PubMed Central

    Macias, Mariela N; Shin, Daniel Sanghoon; Ledezma, Blanca; Sadeghi, Saeed


    A 30-year-old woman presented to an outside hospital with pain in the right upper abdomen. Imaging revealed over 100 liver lesions, the largest measuring 74 mm×71 mm, and multiple lytic bone lesions. An outpatient liver biopsy showed a poorly differentiated adenocarcinoma favouring a breast primary. The tumour was oestrogen and progesterone receptor negative, but human epidermal growth factor 2 (HER2/neu) amplified. In her second clinic visit she had decompensated liver failure manifested by new-onset ascites and jaundice. Initially, the chemotherapy plan was for docetaxel, pertuzumab and trastuzumab, but given her severe liver dysfunction we used a combination of carboplatin, pertuzumab and trastuzumab as an inpatient. She was hospitalised for 14 days and eventually discharged with a marked improvement of her symptoms and liver tests. She subsequently completed five outpatient chemotherapy cycles. We showed that carboplatin is a possible alternative to docetaxel when severe liver dysfunction precludes docetaxel's use in combination with pertuzumab and trastuzumab. PMID:24899001

  2. Metastatic human epidermal growth factor 2 (HER2/neu) amplified breast cancer with acute fulminant hepatitis responding to trastuzumab, pertuzumab and carboplatin.


    Macias, Mariela N; Shin, Daniel Sanghoon; Ledezma, Blanca; Sadeghi, Saeed


    A 30-year-old woman presented to an outside hospital with pain in the right upper abdomen. Imaging revealed over 100 liver lesions, the largest measuring 74 mm×71 mm, and multiple lytic bone lesions. An outpatient liver biopsy showed a poorly differentiated adenocarcinoma favouring a breast primary. The tumour was oestrogen and progesterone receptor negative, but human epidermal growth factor 2 (HER2/neu) amplified. In her second clinic visit she had decompensated liver failure manifested by new-onset ascites and jaundice. Initially, the chemotherapy plan was for docetaxel, pertuzumab and trast