The role of dileucine in the expression and function of human organic anion transporter 1 (hOAT1)
Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng
2011-01-01
Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1. PMID:21494320
The Role of Dileucine in the Expression and Function of Human Organic Anion Transporter 1 (hOAT1).
Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng
2011-01-01
Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1.
Misfolded rhodopsin mutants display variable aggregation properties.
Gragg, Megan; Park, Paul S-H
2018-06-08
The largest class of rhodopsin mutations causing autosomal dominant retinitis pigmentosa (adRP) is mutations that lead to misfolding and aggregation of the receptor. The misfolding mutants have been characterized biochemically, and categorized as either partial or complete misfolding mutants. This classification is incomplete and does not provide sufficient information to fully understand the disease pathogenesis and evaluate therapeutic strategies. A Förster resonance energy transfer (FRET) method was utilized to directly assess the aggregation properties of misfolding rhodopsin mutants within the cell. Partial (P23H and P267L) and complete (G188R, H211P, and P267R) misfolding mutants were characterized to reveal variability in aggregation properties. The complete misfolding mutants all behaved similarly, forming aggregates when expressed alone, minimally interacting with the wild-type receptor when coexpressed, and were unresponsive to treatment with the pharmacological chaperone 9-cis retinal. In contrast, variability was observed between the partial misfolding mutants. In the opsin form, the P23H mutant behaved similarly as the complete misfolding mutants. In contrast, the opsin form of the P267L mutant existed as both aggregates and oligomers when expressed alone and formed mostly oligomers with the wild-type receptor when coexpressed. The partial misfolding mutants both reacted similarly to the pharmacological chaperone 9-cis retinal, displaying improved folding and oligomerization when expressed alone but aggregating with wild-type receptor when coexpressed. The observed differences in aggregation properties and effect of 9-cis retinal predict different outcomes in disease pathophysiology and suggest that retinoid-based chaperones will be ineffective or even detrimental. Copyright © 2018 Elsevier B.V. All rights reserved.
Genetic requirements for high constitutive SOS expression in recA730 mutants of Escherichia coli.
Vlašić, Ignacija; Šimatović, Ana; Brčić-Kostić, Krunoslav
2011-09-01
The RecA protein in its functional state is in complex with single-stranded DNA, i.e., in the form of a RecA filament. In SOS induction, the RecA filament functions as a coprotease, enabling the autodigestion of the LexA repressor. The RecA filament can be formed by different mechanisms, but all of them require three enzymatic activities essential for the processing of DNA double-stranded ends. These are helicase, 5'-3' exonuclease, and RecA loading onto single-stranded DNA (ssDNA). In some mutants, the SOS response can be expressed constitutively during the process of normal DNA metabolism. The RecA730 mutant protein is able to form the RecA filament without the help of RecBCD and RecFOR mediators since it better competes with the single-strand binding (SSB) protein for ssDNA. As a consequence, the recA730 mutants show high constitutive SOS expression. In the study described in this paper, we studied the genetic requirements for constitutive SOS expression in recA730 mutants. Using a β-galactosidase assay, we showed that the constitutive SOS response in recA730 mutants exhibits different requirements in different backgrounds. In a wild-type background, the constitutive SOS response is partially dependent on RecBCD function. In a recB1080 background (the recB1080 mutation retains only helicase), constitutive SOS expression is partially dependent on RecBCD helicase function and is strongly dependent on RecJ nuclease. Finally, in a recB-null background, the constitutive SOS expression of the recA730 mutant is dependent on the RecJ nuclease. Our results emphasize the importance of the 5'-3' exonuclease for high constitutive SOS expression in recA730 mutants and show that RecBCD function can further enhance the excellent intrinsic abilities of the RecA730 protein in vivo. Copyright © 2011, American Society for Microbiology. All Rights Reserved.
Mutants with Enhanced Nitrogenase Activity in Hydroponic Azospirillum brasilense-Wheat Associations
Pereg Gerk, Lily; Gilchrist, Kate; Kennedy, Ivan R.
2000-01-01
The effect of a mutation affecting flocculation, differentiation into cyst-like forms, and root colonization on nitrogenase expression by Azospirillum brasilense is described. The gene flcA of strain Sp7 restored these phenotypes in spontaneous mutants of both strains Sp7 and Sp245. Employing both constitutive pLA-lacZ and nifH-lacZ reporter fusions expressed in situ, the colony morphology, colonization pattern, and potential for nitrogenase activity of spontaneous mutants and flcA Tn5-induced mutants were established. The results of this study show that the ability of Sp7 and Sp245 mutant strains to remain in a vegetative form improved their ability to express nitrogenase activity in association with wheat in a hydroponic system. Restoring the cyst formation and colonization pattern to the spontaneous mutant Sp7-S reduced nitrogenase activity rates in association with plants to that of the wild-type Sp7. Although Tn5-induced flcA mutants showed higher potentials for nitrogenase expression than Sp7, their potentials were lower than that of Sp7-S, indicating that other factors in this strain contribute to its exceptional nitrogenase activity rates on plants. The lack of lateral flagella is not one of these factors, as Sp7-PM23, a spontaneous mutant impaired in swarming and lateral-flagellum production but not in flocculation, showed wild-type nitrogenase activity and expression. The results also suggest factors of importance in evolving an effective symbiosis between Azospirillum and wheat, such as increasing the availability of microaerobic niches along the root, increased supply of carbon sources by the plant, and the retention of the bacterial cells in vegetative form for faster metabolism. PMID:10788397
Lon Protease of Azorhizobium caulinodans ORS571 Is Required for Suppression of reb Gene Expression
Nakajima, Azusa; Tsukada, Shuhei; Siarot, Lowela; Ogawa, Tetsuhiro; Oyaizu, Hiroshi
2012-01-01
Bacterial Lon proteases play important roles in a variety of biological processes in addition to housekeeping functions. In this study, we focused on the Lon protease of Azorhizobium caulinodans, which can fix nitrogen both during free-living growth and in stem nodules of the legume Sesbania rostrata. The nitrogen fixation activity of an A. caulinodans lon mutant in the free-living state was not significantly different from that of the wild-type strain. However, the stem nodules formed by the lon mutant showed little or no nitrogen fixation activity. By microscopic analyses, two kinds of host cells were observed in the stem nodules formed by the lon mutant. One type has shrunken host cells containing a high density of bacteria, and the other type has oval or elongated host cells containing a low density or no bacteria. This phenotype is similar to a praR mutant highly expressing the reb genes. Quantitative reverse transcription-PCR analyses revealed that reb genes were also highly expressed in the lon mutant. Furthermore, a lon reb double mutant formed stem nodules showing higher nitrogen fixation activity than the lon mutant, and shrunken host cells were not observed in these stem nodules. These results suggest that Lon protease is required to suppress the expression of the reb genes and that high expression of reb genes in part causes aberrance in the A. caulinodans-S. rostrata symbiosis. In addition to the suppression of reb genes, it was found that Lon protease was involved in the regulation of exopolysaccharide production and autoagglutination of bacterial cells. PMID:22752172
Agaisse, H; Lereclus, D
1994-08-01
Expression of the Bacillus thuringiensis cryIIIA gene encoding a Coleoptera-specific toxin is weak during vegetative growth and is activated at the onset of the stationary phase. cryIIIA'-'lacZ fusions and primer extension analysis show that the regulation of cryIIIA expression is similar in Bacillus subtilis and in B. thuringiensis. Activation of cryIIIA expression was not altered in B. subtilis mutant strains deficient for the sigma H and sigma E sporulation-specific sigma factors or for minor sigma factors such as sigma B, sigma D, or sigma L. This result and the nucleotide sequence of the -35 and -10 regions of the cryIIIA promoter suggest that cryIIIA expression might be directed by the E sigma A form of RNA polymerase. Expression of the cryIIIA'-'lacZ fusion is shut off after t2 (2 h after time zero) of sporulation in the B. subtilis wild-type strain grown on nutrient broth sporulation medium. However, no decrease in cryIIIA-directed beta-galactosidase activity occurred in sigma H, kinA, or spo0A mutant strains. Moreover, beta-galactosidase activity was higher and remained elevated after t2 in the spo0A mutant strain. beta-Galactosidase activity was weak in abrB and spo0A abrB mutant strains, suggesting that AbrB is responsible for the higher level of cryIIIA expression observed in a spo0A mutant. However, both in spo0A and spo0A abrB mutant strains, beta-galactosidase activity remained elevated after t2, suggesting that even in the absence of AbrB, cryIIIA expression is controlled through modulation of the phosphorylated form of Spo0A. When the cryIIIA gene is expressed in a B. subtilis spo0A mutant strain or in the 168 wild-type strain, large amounts of toxins are produced and accumulate to form a flat rectangular crystal characteristic of the coleopteran-specific B. thuringiensis strains.
1992-01-01
To elucidate the structural basis for membrane attachment of the alpha subunit of the stimulatory G protein (Gs alpha), mutant Gs alpha cDNAs with deletions of amino acid residues in the amino and/or carboxy termini were transiently expressed in COS-7 cells. The particulate and soluble fractions prepared from these cells were analyzed by immunoblot using peptide specific antibodies to monitor distribution of the expressed proteins. Transfection of mutant forms of Gs alpha with either 26 amino terminal residues deleted (delta 3-28) or with 59 amino terminal residues deleted (delta 1-59) resulted in immunoreactive proteins which localized primarily to the particulate fraction. Similarly, mutants with 10 (delta 385-394), 32 (delta 353-384), or 42 (delta 353-394) amino acid residues deleted from the carboxy terminus also localized to the particulate fraction, as did a mutant form of Gs alpha lacking amino acid residues at both the amino and carboxy termini (delta 3-28)/(delta 353-384). Mutant and wild type forms of Gs alpha demonstrated a similar degree of tightness in their binding to membranes as demonstrated by treatment with 2.5 M NaCl or 6 M urea, but some mutant forms were relatively resistant compared with wild type Gs alpha to solubilization by 15 mM NaOH or 1% sodium cholate. We conclude that: (a) deletion of significant portions of the amino and/or carboxyl terminus of Gs alpha is still compatible with protein expression; (b) deletion of these regions is insufficient to cause cytosolic localization of the expressed protein. The basis of Gs alpha membrane targeting remains to be elucidated. PMID:1400589
Avliyakulov, Nuraly K; Rajavel, Kavitha S; Le, Khanh Minh T; Guo, Lea; Mirsadraei, Leili; Yong, William H; Liau, Linda M; Li, Sichen; Lai, Albert; Nghiemphu, Phioanh L; Cloughesy, Timothy F; Linetsky, Michael; Haykinson, Michael J; Pope, Whitney B
2014-03-01
Malignant gliomas are the most common human primary brain tumors. Point mutation of amino acid arginine 132 to histidine (R132H) in the IDH1 protein leads to an enzymatic gain-of-function and is thought to promote gliomagenesis. Little is known about the downstream effects of the IDH1 mutation on protein expression and how and whether changes in protein expression are involved in tumor formation or propagation. In the current study, we used 2D DIGE (difference gel electrophoresis) and mass spectrometry to analyze differences in protein expression between IDH1(R132H) mutant and wild type anaplastic (grade III) astrocytoma from human brain cancer tissues. We show that expression levels of many proteins are altered in IDH1(R132H) mutant anaplastic astrocytoma. Some of the most over-expressed proteins in the mutants include several forms of αB-crystallin, a small heat-shock and anti-apoptotic protein. αB-crystallin proteins are elevated up to 22-fold in IDH1(R132H) mutant tumors, and αB-crystallin expression appears to be controlled at the post-translational level. We identified the most abundant form of αB-crystallin as a low molecular weight species that is C-terminally truncated. We also found that overexpression of αB-crystallin can be induced by transfecting U251 human glioblastoma cell lines with the IDH1(R132H) mutation. In conclusion, the association of a C-terminally truncated form of αB-crystallin protein with the IDH1(R132H) mutation is a novel finding that could impact apoptosis and stress response in IDH1 mutant glioma.
Johannessen, T.; Mukherjee, J.; Wood, M.; Viswanath, P.; Ohba, S.; Ronen, S.; Berkvig, R.; Pieper, R.
2017-01-01
Abstract Introduction: Missense R132H mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. We recently showed (Mol Cancer Res 14: 976–983, 2016) that although mutant IDH1 expression in hTERT-immortalized, p53/pRb-deficient astrocytes can drive cellular transformation and gliomagenesis, selective pharmacologic inhibition and elimination of 2-HG by the mutant IDH1 inhibitor AGI-5198 has little effect on the growth or clonagenicity of these transformed cells. To address the possible role of WT IDH1 in the growth of mutant IDH-driven tumor cells, we used a slightly different gliomagenesis model in which the transformation of TERT-deficient, p53/pRb-deficient astrocytes (pre-crisis cells) occurs only after prolonged expression of mutant IDH and passage through cellular crisis (post-crisis cells, Cancer Res 76:6680–6689, 2016). METHODS AND MATERIALS: Using this system we introduced AGI-5198, or siRNA targeting both WT and mutant forms of IDH1 into p53/pRb-deficient, mutant IDH1-expressing human astrocytes prior to or following their transformation, and compared the effects on cell growth and clonagenicity. Results: AGI-5198 exposure decreased levels of 2HG by greater than 90%, and as previously reported had no effect on the growth of either the pre-or post-crisis cell populations. A one-day exposure to a pan IDH1 siRNA resulted in a similar, prolonged (greater than 6 day), 80% inhibition of both WT and mutant IDH1 protein levels and 2HG in both cell groups. While the growth of the mutant IDH-expressing, non-transformed cells was similar to that of scramble siRNA controls, the growth of the mutant IDH-transformed cells was significantly reduced. This growth suppression was also accompanied by a four-fold increase in annexin V-positive apoptotic cells. Furthermore, the growth suppression in the cells transformed by mutant IDH1 expression could not be reversed by addition of a cell-permeable form of 2-HG. Conclusions: These results show that the in vitro transformative events driven by expression of mutant IDH1 make cells dependent not on continued mutant IDH1 expression, but rather on continued WT IDH1 expression. The data also support the development and testing of agents that can inhibit both the WT and mutant forms of IDH1.
Dill, Kariena K; Amacher, Sharon L
2005-11-15
We have identified the zebrafish tortuga (tor) gene by an ENU-induced mutation that disrupts the presomitic mesoderm (PSM) expression of Notch pathway genes. In tor mutants, Notch pathway gene expression persists in regions of the PSM where expression is normally off in wild type embryos. The expression of hairy/Enhancer of split-related 1 (her1) is affected first, followed by the delta genes deltaC and deltaD, and finally, by another hairy/Enhancer of split-related gene, her7. In situ hybridization with intron-specific probes for her1 and deltaC indicates that transcriptional bursts of expression are normal in tor mutants, suggesting that tor normally functions to refine her1 and deltaC message levels downstream of transcription. Despite the striking defects in Notch pathway gene expression, somite boundaries form normally in tor mutant embryos, although somitic mesoderm defects are apparent later, when cells mature to form muscle fibers. Thus, while the function of Notch pathway genes is required for proper somite formation, the tor mutant phenotype suggests that precise oscillations of Notch pathway transcripts are not essential for establishing segmental pattern in the presomitic mesoderm.
TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain
Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A.; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang
2014-01-01
Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology. PMID:24381309
TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain.
Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang
2014-05-15
Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology.
Reversion of autocrine transformation by a dominant negative platelet-derived growth factor mutant.
Vassbotn, F S; Andersson, M; Westermark, B; Heldin, C H; Ostman, A
1993-01-01
A non-receptor-binding mutant of the platelet-derived growth factor (PDGF) A chain, PDGF-0, was generated by exchanging 7 amino acids in the sequence. The mutant chains formed dimers that were similar to wild-type PDGF-AA with regard to stability and rate of processing to the mature 30-kDa secreted forms. Moreover, the mutant chains formed disulfide-bonded heterodimers with the PDGF B chain in NIH 3T3 cells heterodimer underwent the same processing and secretion as PDGF-AB. Transfection of c-sis-expressing 3T3 cells with PDGF-0 significantly inhibited the transformed phenotype of these cells, as determined by the following criteria. (i) Compared with PDGF-0-negative clones, PDGF-0-producing clones showed a reverted morphology. (ii) Clones producing PDGF-0 grew more slowly than PDGF-0-negative clones, with a fivefold difference in cell number after 14 days in culture. (iii) The expression of PDGF-0 completely inhibited the ability of the c-sis-expressing 3T3 cells to form colonies in soft agar; this inhibition was overcome by the addition of recombinant PDGF-BB to the culture medium, showing that the lack of colony formation of these cells was not due to a general unresponsiveness to PDGF. The specific expression of a PDGF-0/PDGF wild-type heterodimer in COS cells revealed that the affinity of the mutant heterodimer for the PDGF alpha receptor was decreased by approximately 50-fold compared with that of PDGF-AA. Thus, we show that a non-receptor-binding PDGF A-chain mutant neutralizes in a trans-dominant manner the autocrine transforming potential of the c-sis/PDGF B chain by forming low-affinity heterodimers with wild-type PDGF chains. This method of specifically antagonizing the effect of PDGF may be useful in investigations of the role of PDGF in normal and pathological conditions. Images PMID:8321214
Reversion of autocrine transformation by a dominant negative platelet-derived growth factor mutant.
Vassbotn, F S; Andersson, M; Westermark, B; Heldin, C H; Ostman, A
1993-07-01
A non-receptor-binding mutant of the platelet-derived growth factor (PDGF) A chain, PDGF-0, was generated by exchanging 7 amino acids in the sequence. The mutant chains formed dimers that were similar to wild-type PDGF-AA with regard to stability and rate of processing to the mature 30-kDa secreted forms. Moreover, the mutant chains formed disulfide-bonded heterodimers with the PDGF B chain in NIH 3T3 cells heterodimer underwent the same processing and secretion as PDGF-AB. Transfection of c-sis-expressing 3T3 cells with PDGF-0 significantly inhibited the transformed phenotype of these cells, as determined by the following criteria. (i) Compared with PDGF-0-negative clones, PDGF-0-producing clones showed a reverted morphology. (ii) Clones producing PDGF-0 grew more slowly than PDGF-0-negative clones, with a fivefold difference in cell number after 14 days in culture. (iii) The expression of PDGF-0 completely inhibited the ability of the c-sis-expressing 3T3 cells to form colonies in soft agar; this inhibition was overcome by the addition of recombinant PDGF-BB to the culture medium, showing that the lack of colony formation of these cells was not due to a general unresponsiveness to PDGF. The specific expression of a PDGF-0/PDGF wild-type heterodimer in COS cells revealed that the affinity of the mutant heterodimer for the PDGF alpha receptor was decreased by approximately 50-fold compared with that of PDGF-AA. Thus, we show that a non-receptor-binding PDGF A-chain mutant neutralizes in a trans-dominant manner the autocrine transforming potential of the c-sis/PDGF B chain by forming low-affinity heterodimers with wild-type PDGF chains. This method of specifically antagonizing the effect of PDGF may be useful in investigations of the role of PDGF in normal and pathological conditions.
Al Laham, Nahed; Rohde, Holger; Sander, Gunnar; Fischer, Andreas; Hussain, Muzaffar; Heilmann, Christine; Mack, Dietrich; Proctor, Richard; Peters, Georg; Becker, Karsten; von Eiff, Christof
2007-01-01
While coagulase-negative staphylococci (CoNS), with their ability to form a thick, multilayered biofilm on foreign bodies, have been identified as the major cause of implant-associated infections, no data are available about biofilm formation by staphylococcal small-colony variants (SCVs). In the past years, a number of device-associated infections due to staphylococcal SCVs were described, among them, several pacemaker infections due to SCVs of CoNS auxotrophic to hemin. To test the characteristics of SCVs of CoNS, in particular, to study the ability of SCVs to form a biofilm on foreign bodies, we generated a stable mutant in electron transport by interrupting one of the hemin biosynthetic genes, hemB, in Staphylococcus epidermidis. In fact, this mutant displayed a stable SCV phenotype with tiny colonies showing strong adhesion to the agar surface. When the incubation time was extended to 48 h or a higher inoculum concentration was used, the mutant produced biofilm amounts on polystyrene similar to those produced by the parent strain. When grown under planktonic conditions, the mutant formed markedly larger cell clusters than the parental strain which were completely disintegrated by the specific β-1,6-hexosaminidase dispersin B but were resistant to trypsin treatment. In a dot blot assay, the mutant expressed larger amounts of polysaccharide intercellular adhesin (PIA) than the parent strain. In conclusion, interrupting a hemin biosynthetic gene in S. epidermidis resulted in an SCV phenotype. Markedly larger cell clusters and the ability of the hemB mutant to form a biofilm are related to the augmented expression of PIA. PMID:17449620
Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A
2018-05-11
Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.
Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant
Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A.; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K.; Altenbach, Christian; Hong, Yuan; Hanson, Susan M.; Palazzo, Maria C.; Chen, Jeannie; Hubbell, Wayne L.; Gurevich, Eugenia V.; Gurevich, Vsevolod V.
2013-01-01
Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. PMID:24012956
Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant.
Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K; Altenbach, Christian; Hong, Yuan; Hanson, Susan M; Palazzo, Maria C; Chen, Jeannie; Hubbell, Wayne L; Gurevich, Eugenia V; Gurevich, Vsevolod V
2013-12-01
Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. © 2013.
Johnson, Kristen E.; Mitra, Shalini; Katoch, Parul; Kelsey, Linda S.; Johnson, Keith R.; Mehta, Parmender P.
2013-01-01
The molecular mechanisms regulating the assembly of connexins (Cxs) into gap junctions are poorly understood. Using human pancreatic tumor cell lines BxPC3 and Capan-1, which express Cx26 and Cx43, we show that, upon arrival at the cell surface, the assembly of Cx43 is impaired. Connexin43 fails to assemble, because it is internalized by clathrin-mediated endocytosis. Assembly is restored upon expressing a sorting-motif mutant of Cx43, which does not interact with the AP2 complex, and by expressing mutants that cannot be phosphorylated on Ser-279 and Ser-282. The mutants restore assembly by preventing clathrin-mediated endocytosis of Cx43. Our results also document that the sorting-motif mutant is assembled into gap junctions in cells in which the expression of endogenous Cx43 has been knocked down. Remarkably, Cx43 mutants that cannot be phosphorylated on Ser-279 or Ser-282 are assembled into gap junctions only when connexons are composed of Cx43 forms that can be phosphorylated on these serines and forms in which phosphorylation on these serines is abolished. Based on the subcellular fate of Cx43 in single and contacting cells, our results document that the endocytic itinerary of Cx43 is altered upon cell–cell contact, which causes Cx43 to traffic by EEA1-negative endosomes en route to lysosomes. Our results further show that gap-junctional plaques formed of a sorting motif–deficient mutant of Cx43, which is unable to be internalized by the clathrin-mediated pathway, are predominantly endocytosed in the form of annular junctions. Thus the differential phosphorylation of Cx43 on Ser-279 and Ser-282 is fine-tuned to control Cx43’s endocytosis and assembly into gap junctions. PMID:23363606
Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.
2008-01-01
Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558
Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function in yeast.
Bartish, Galyna; Moradi, Hossein; Nygård, Odd
2007-10-01
Yeast elongation factor 2 is an essential protein that contains two highly conserved threonine residues, T56 and T58, that could potentially be phosphorylated by the Rck2 kinase in response to environmental stress. The importance of residues T56 and T58 for elongation factor 2 function in yeast was studied using site directed mutagenesis and functional complementation. Mutations T56D, T56G, T56K, T56N and T56V resulted in nonfunctional elongation factor 2 whereas mutated factor carrying point mutations T56M, T56C, T56S, T58S and T58V was functional. Expression of mutants T56C, T56S and T58S was associated with reduced growth rate. The double mutants T56M/T58W and T56M/T58V were also functional but the latter mutant caused increased cell death and considerably reduced growth rate. The results suggest that the physiological role of T56 and T58 as phosphorylation targets is of little importance in yeast under standard growth conditions. Yeast cells expressing mutants T56C and T56S were less able to cope with environmental stress induced by increased growth temperatures. Similarly, cells expressing mutants T56M and T56M/T58W were less capable of adapting to increased osmolarity whereas cells expressing mutant T58V behaved normally. All mutants tested were retained their ability to bind to ribosomes in vivo. However, mutants T56D, T56G and T56K were under-represented on the ribosome, suggesting that these nonfunctional forms of elongation factor 2 were less capable of competing with wild-type elongation factor 2 in ribosome binding. The presence of nonfunctional but ribosome binding forms of elongation factor 2 did not affect the growth rate of yeast cells also expressing wild-type elongation factor 2.
Belting, H G; Hauptmann, G; Meyer, D; Abdelilah-Seyfried, S; Chitnis, A; Eschbach, C; Söll, I; Thisse, C; Thisse, B; Artinger, K B; Lunde, K; Driever, W
2001-11-01
The vertebrate midbrain-hindbrain boundary (MHB) organizes patterning and neuronal differentiation in the midbrain and anterior hindbrain. Formation of this organizing center involves multiple steps, including positioning of the MHB within the neural plate, establishment of the organizer and maintenance of its regional identity and signaling activities. Juxtaposition of the Otx2 and Gbx2 expression domains positions the MHB. How the positional information is translated into activation of Pax2, Wnt1 and Fgf8 expression during MHB establishment remains unclear. In zebrafish spiel ohne grenzen (spg) mutants, the MHB is not established, neither isthmus nor cerebellum form, the midbrain is reduced in size and patterning abnormalities develop within the hindbrain. In spg mutants, despite apparently normal expression of otx2, gbx1 and fgf8 during late gastrula stages, the initial expression of pax2.1, wnt1 and eng2, as well as later expression of fgf8 in the MHB primordium are reduced. We show that spg mutants have lesions in pou2, which encodes a POU-domain transcription factor. Maternal pou2 transcripts are distributed evenly in the blastula, and zygotic expression domains include the midbrain and hindbrain primordia during late gastrulation. Microinjection of pou2 mRNA can rescue pax2.1 and wnt1 expression in the MHB of spg/pou2 mutants without inducing ectopic expression. This indicates an essential but permissive role for pou2 during MHB establishment. pou2 is expressed normally in noi/pax2.1 and ace/fgf8 zebrafish mutants, which also form no MHB. Thus, expression of pou2 does not depend on fgf8 and pax2.1. Our data suggest that pou2 is required for the establishment of the normal expression domains of wnt1 and pax2.1 in the MHB primordium.
Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.
Loging, W T; Reisman, D
1999-11-01
The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.
Gonek, Maciej; Zee, Michael L.; Farnsworth, Jill C.; Amin, Randa A.; Andrews, Mary-Jeanette; Davis, Brian J.; Mackie, Ken; Morgan, Daniel J.
2017-01-01
We recently characterized S426A/S430A mutant mice expressing a desensitization-resistant form of the CB1 receptor. These mice display an enhanced response to endocannabinoids and ∆9-THC. In this study, S426A/S430A mutants were used as a novel model to test whether ethanol consumption, morphine dependence, and reward for these drugs are potentiated in mice with a “hyper-sensitive” form of CB1. Using an unlimited-access, two-bottle choice, voluntary drinking paradigm, S426A/S430A mutants exhibit modestly increased intake and preference for low (6%) but not higher concentrations of ethanol. S426A/S430A mutants and wild-type mice show similar taste preference for sucrose and quinine, exhibit normal sensitivity to the hypothermic and ataxic effects of ethanol, and have normal blood ethanol concentrations following administration of ethanol. S426A/S430A mutants develop robust conditioned place preference for ethanol (2 g/kg), morphine (10 mg/kg), and cocaine (10 mg/kg), demonstrating that drug reward is not changed in S426A/S430A mutants. Precipitated morphine withdrawal is also unchanged in opioid-dependent S426A/S430A mutant mice. Although ethanol consumption is modestly changed by enhanced CB1 signaling, reward, tolerance, and acute sensitivity to ethanol and morphine are normal in this model. PMID:28426670
Reed, Matthew D; Wilder, Julie A; Mega, William M; Hutt, Julie A; Kuehl, Philip J; Valderas, Michelle W; Chew, Lawrence L; Liang, Bertrand C; Squires, Charles H
2015-01-01
Protective antigen (PA), one of the components of the anthrax toxin, is the major component of human anthrax vaccine (Biothrax). Human anthrax vaccines approved in the United States and Europe consist of an alum-adsorbed or precipitated (respectively) supernatant material derived from cultures of toxigenic, non-encapsulated strains of Bacillus anthracis. Approved vaccination schedules in humans with either of these vaccines requires several booster shots and occasionally causes adverse injection site reactions. Mutant derivatives of the protective antigen that will not form the anthrax toxins have been described. We have cloned and expressed both mutant (PA SNKE167-ΔFF-315-E308D) and native PA molecules recombinantly and purified them. In this study, both the mutant and native PA molecules, formulated with alum (Alhydrogel), elicited high titers of anthrax toxin neutralizing anti-PA antibodies in New Zealand White rabbits. Both mutant and native PA vaccine preparations protected rabbits from lethal, aerosolized, B. anthracis spore challenge subsequent to two immunizations at doses of less than 1 μg.
Montibus, Mathilde; Ducos, Christine; Bonnin-Verdal, Marie-Noelle; Bormann, Jorg; Ponts, Nadia; Richard-Forget, Florence; Barreau, Christian
2013-01-01
Redox sensing is of primary importance for fungi to cope with oxidant compounds found in their environment. Plant pathogens are particularly subject to the oxidative burst during the primary steps of infection. In the budding yeast Saccharomyces cerevisiae, it is the transcription factor Yap1 that mediates the response to oxidative stress via activation of genes coding for detoxification enzymes. In the cereal pathogen Fusarium graminearum, Fgap1 a homologue of Yap1 was identified and its role was investigated. During infection, this pathogen produces mycotoxins belonging to the trichothecenes family that accumulate in the grains. The global regulation of toxin biosynthesis is not completely understood. However, it is now clearly established that an oxidative stress activates the production of toxins by F. graminearum. The involvement of Fgap1 in this activation was investigated. A deleted mutant and a strain expressing a truncated constitutive form of Fgap1 were constructed. None of the mutants was affected in pathogenicity. The deleted mutant showed higher level of trichothecenes production associated with overexpression of Tri genes. Moreover activation of toxin accumulation in response to oxidative stress was no longer observed. Regarding the mutant with the truncated constitutive form of Fgap1, toxin production was strongly reduced. Expression of oxidative stress response genes was not activated in the deleted mutant and expression of the gene encoding the mitochondrial superoxide dismutase MnSOD1 was up-regulated in the mutant with the truncated constitutive form of Fgap1. Our results demonstrate that Fgap1 plays a key role in the link between oxidative stress response and F. graminearum secondary metabolism. PMID:24349499
Lehane, Adele M; Kirk, Kiaran
2010-08-01
Chloroquine-resistant malaria parasites (Plasmodium falciparum) show an increased leak of H(+) ions from their internal digestive vacuole in the presence of chloroquine. This phenomenon has been attributed to the transport of chloroquine, together with H(+), out of the digestive vacuole (and hence away from its site of action) via a mutant form of the parasite's chloroquine resistance transporter (PfCRT). Here, using transfectant parasite lines, we show that a range of other antimalarial drugs, as well as various 'chloroquine resistance reversers' induce an increased leak of H(+) from the digestive vacuole of parasites expressing mutant PfCRT, consistent with these compounds being substrates for mutant forms, but not the wild-type form, of PfCRT. For some compounds there were significant differences observed between parasites having the African/Asian Dd2 form of PfCRT and those with the South American 7G8 form of PfCRT, consistent with there being differences in the transport properties of the two mutant proteins. The finding that chloroquine resistance reversers are substrates for mutant PfCRT has implications for the mechanism of action of this class of compound. © 2010 Blackwell Publishing Ltd.
Kudoh, T; Dawid, I B
2001-11-01
Random screening for tissue specific genes in zebrafish by in situ hybridization led us to isolate a gene which showed highly restricted expression in the developing eyes and midbrain at somitogenesis stages. This gene was very similar to mouse and human mab21l2. The characteristic expression pattern of mab21l2 facilitates a detailed description of the morphogenesis of the eyes and midbrain in the zebrafish. In the eye field, mab21l2 expression illustrates the transformation of the eye field to form two separate eyes in the anterior neural plate. Mab21l2 staining in the cyclopic mutants, cyc and oep, exhibited incomplete splitting of the eye primodium. In the midbrain, mab21l2 is expressed in the tectum, and its expression follows the expansion of the tectal region. In mutants affecting the mid-hindbrain boundary (MHB), mab21l2 expression is affected differentially. In the noi/pax2.1 mutant, mab21l2 is down-regulated and the size of the tectum remains small, whereas in the ace/fgf8 mutant, mab21l2 expression persists although the shape of the tectum is altered.
Chemokine guided angiogenesis directs coronary vasculature formation in zebrafish
Harrison, Michael R.M.; Bussmann, Jeroen; Huang, Ying; Zhao, Long; Osorio, Arthela; Burns, C. Geoffrey; Burns, Caroline E.; Sucov, Henry M.; Siekmann, Arndt F.; Lien, Ching-Ling
2015-01-01
SUMMARY Interruption of coronary blood supply severely impairs heart function with often-fatal consequences for heart disease patients. However the formation and maturation of these coronary vessels is not fully understood. Here we provide a detailed analysis of coronary vessel development in zebrafish. We observe that coronary vessels form in zebrafish by angiogenic sprouting of arterial cells derived from the endocardium at the atrioventricular canal. Endothelial cells express the CXC-motif chemokine receptor Cxcr4a and migrate to vascularize the ventricle under the guidance of the myocardium-expressed ligand Cxcl12b. cxcr4a mutant zebrafish fail to form a vascular network, whereas ectopic expression of Cxcl12b ligand induces coronary vessel formation. Importantly, cxcr4a mutant zebrafish fail to undergo heart regeneration following injury. Our results suggest that chemokine-signaling has an essential role in coronary vessel formation by directing migration of endocardium-derived endothelial cells. Poorly developed vasculature in cxcr4a mutants likely underlies decreased regenerative potential in adults. PMID:26017769
Intrinsic and Extrinsic Modifiers of the Regulative Capacity of the Developing Liver
Shin, Donghun; Weidinger, Gilbert; Moon, Randall T.; Stainier, Didier Y.R.
2012-01-01
Zebrafish wnt2bb mutants initially fail to form a liver, but surprisingly the liver eventually forms in a majority of these embryos which then develop into fertile adults. This unexpected result raised the possibility that identifying the mechanisms of liver formation in wnt2bb mutants could provide insights into the poorly understood yet general principle of regulative development, a process by which some cells can change fate in order to compensate for a deficiency. Here, we identify two factors that underlie the regulative capacity of endodermal tissues: an intrinsic factor, Sox32, a transcription factor of the SoxF subfamily, and an extrinsic factor, Fgf10a. sox32 is expressed in the extrahepatic duct primordium which is not affected in wnt2bb mutants. Blocking Sox32 function prevented liver formation in most wnt2bb mutants. fgf10a, which is expressed in the mesenchyme surrounding non-hepatic endodermal cells, negatively impacts the regulative capacity of endodermal tissues. In Wnt/β-catenin signaling deficient embryos, in which the liver completely fails to form, the repression of Fgf10a function allowed liver formation. Altogether, these studies reveal that there is more than one way to form a liver, and provide molecular insights into the phenomenon of tissue plasticity. PMID:22313811
Veereshlingam, Harita; Haynes, Janine G.; Penmetsa, R. Varma; Cook, Douglas R.; Sherrier, D. Janine; Dickstein, Rebecca
2004-01-01
To investigate the legume-Rhizobium symbiosis, we isolated and studied a novel symbiotic mutant of the model legume Medicago truncatula, designated nip (numerous infections and polyphenolics). When grown on nitrogen-free media in the presence of the compatible bacterium Sinorhizobium meliloti, the nip mutant showed nitrogen deficiency symptoms. The mutant failed to form pink nitrogen-fixing nodules that occur in the wild-type symbiosis, but instead developed small bump-like nodules on its roots that were blocked at an early stage of development. Examination of the nip nodules by light microscopy after staining with X-Gal for S. meliloti expressing a constitutive GUS gene, by confocal microscopy following staining with SYTO-13, and by electron microscopy revealed that nip initiated symbiotic interactions and formed nodule primordia and infection threads. The infection threads in nip proliferated abnormally and very rarely deposited rhizobia into plant host cells; rhizobia failed to differentiate further in these cases. nip nodules contained autofluorescent cells and accumulated a brown pigment. Histochemical staining of nip nodules revealed this pigment to be polyphenolic accumulation. RNA blot analyses demonstrated that nip nodules expressed only a subset of genes associated with nodule organogenesis, as well as elevated expression of a host defense-associated phenylalanine ammonia lyase gene. nip plants were observed to have abnormal lateral roots. nip plant root growth and nodulation responded normally to ethylene inhibitors and precursors. Allelism tests showed that nip complements 14 other M. truncatula nodulation mutants but not latd, a mutant with a more severe nodulation phenotype as well as primary and lateral root defects. Thus, the nip mutant defines a new locus, NIP, required for appropriate infection thread development during invasion of the nascent nodule by rhizobia, normal lateral root elongation, and normal regulation of host defense-like responses during symbiotic interactions. PMID:15516506
Iskandar, Kartini; Rezlan, Majidah; Yadav, Sanjiv Kumar; Foo, Chuan Han Jonathan; Sethi, Gautam; Qiang, Yu; Bellot, Gregory L; Pervaiz, Shazib
2016-05-10
We recently reported the death-inducing activity of a small-molecule compound, C1, which triggered reactive oxygen species (ROS)-dependent autophagy-associated apoptosis in a variety of human cancer cell lines. In this study, we examine the ability of the compound to specifically target cancer cells harboring mutant KRAS with minimal activity against wild-type (WT) RAS-expressing cells. HCT116 cells expressing mutated KRAS are susceptible, while the WT-expressing HT29 cells are resistant. Interestingly, C1 triggers activation of mutant RAS, which results in the downstream phosphorylation and activation of AKT/PKB. Gene knockdown of KRAS or AKT or their pharmacological inhibition resulted in the abrogation of C1-induced ROS production and rescued tumor colony-forming ability. We also made use of HCT116 mutant KRAS knockout (KO) cells, which express only a single WT KRAS allele. Exposure of KO cells to C1 failed to increase mitochondrial ROS and cell death, unlike the parental cells harboring mutant KRAS. Similarly, mutant KRAS-transformed prostate epithelial cells (RWPE-1-RAS) were more sensitive to the ROS-producing and death-inducing effects of C1 than the vector only expressing RWPE-1 cells. An in vivo model of xenograft tumors generated with HCT116 KRAS(WT/MUT) or KRAS(WT/-) cells showed the efficacy of C1 treatment and its ability to affect the relative mitotic index in tumors harboring KRAS mutant. These data indicate a synthetic lethal effect against cells carrying mutant KRAS, which could have therapeutic implications given the paucity of KRAS-specific chemotherapeutic strategies. Antioxid. Redox Signal. 24, 781-794.
Cellular and molecular mechanisms of autosomal dominant form of progressive hearing loss, DFNA2.
Kim, Hyo Jeong; Lv, Ping; Sihn, Choong-Ryoul; Yamoah, Ebenezer N
2011-01-14
Despite advances in identifying deafness genes, determination of the underlying cellular and functional mechanisms for auditory diseases remains a challenge. Mutations of the human K(+) channel hKv7.4 lead to post-lingual progressive hearing loss (DFNA2), which affects world-wide population with diverse racial backgrounds. Here, we have generated the spectrum of point mutations in the hKv7.4 that have been identified as diseased mutants. We report that expression of five point mutations in the pore region, namely L274H, W276S, L281S, G285C, and G296S, as well as the C-terminal mutant G321S in the heterologous expression system, yielded non-functional channels because of endoplasmic reticulum retention of the mutant channels. We mimicked the dominant diseased conditions by co-expressing the wild-type and mutant channels. As compared with expression of wild-type channel alone, the blend of wild-type and mutant channel subunits resulted in reduced currents. Moreover, the combinatorial ratios of wild type:mutant and the ensuing current magnitude could not be explained by the predictions of a tetrameric channel and a dominant negative effect of the mutant subunits. The results can be explained by the dependence of cell surface expression of the mutant on the wild-type subunit. Surprisingly, a transmembrane mutation F182L, which has been identified in a pre-lingual progressive hearing loss patient in Taiwan, yielded cell surface expression and functional features that were similar to that of the wild type, suggesting that this mutation may represent redundant polymorphism. Collectively, these findings provide traces of the cellular mechanisms for DFNA2.
Hu, Liyan; Pandey, Amit V; Eggimann, Sandra; Rüfenacht, Véronique; Möslinger, Dorothea; Nuoffer, Jean-Marc; Häberle, Johannes
2013-11-29
Argininosuccinic aciduria (ASA) is an autosomal recessive urea cycle disorder caused by deficiency of argininosuccinate lyase (ASL) with a wide clinical spectrum from asymptomatic to severe hyperammonemic neonatal onset life-threatening courses. We investigated the role of ASL transcript variants in the clinical and biochemical variability of ASA. Recombinant proteins for ASL wild type, mutant p.E189G, and the frequently occurring transcript variants with exon 2 or 7 deletions were (co-)expressed in human embryonic kidney 293T cells. We found that exon 2-deleted ASL forms a stable truncated protein with no relevant activity but a dose-dependent dominant negative effect on enzymatic activity after co-expression with wild type or mutant ASL, whereas exon 7-deleted ASL is unstable but seems to have, nevertheless, a dominant negative effect on mutant ASL. These findings were supported by structural modeling predictions for ASL heterotetramer/homotetramer formation. Illustrating the physiological relevance, the predominant occurrence of exon 7-deleted ASL was found in two patients who were both heterozygous for the ASL mutant p.E189G. Our results suggest that ASL transcripts can contribute to the highly variable phenotype in ASA patients if expressed at high levels. Especially, the exon 2-deleted ASL variant may form a heterotetramer with wild type or mutant ASL, causing markedly reduced ASL activity.
The Thiamine Biosynthesis Gene THI1 Promotes Nodule Growth and Seed Maturation1
Nagae, Miwa; Kawaguchi, Masayoshi; Takeda, Naoya
2016-01-01
Thiamine (vitamin B1) is essential for living organisms. Unlike animals, plants can synthesize thiamine. In Lotus japonicus, the expression of two thiamine biosynthesis genes, THI1 and THIC, was enhanced by inoculation with rhizobia but not by inoculation with arbuscular mycorrhizal fungi. THIC and THI2 (a THI1 paralog) were expressed in uninoculated leaves. THI2-knockdown plants and the transposon insertion mutant thiC had chlorotic leaves. This typical phenotype of thiamine deficiency was rescued by an exogenous supply of thiamine. In wild-type plants, THI1 was expressed mainly in roots and nodules, and the thi1 mutant had green leaves even in the absence of exogenous thiamine. THI1 was highly expressed in actively dividing cells of nodule primordia. The thi1 mutant had small nodules, and this phenotype was rescued by exogenous thiamine and by THI1 complementation. Exogenous thiamine increased nodule diameter, but the level of arbuscular mycorrhizal colonization was unaffected in the thi1 mutant or by exogenous thiamine. Expression of symbiotic marker genes was induced normally, implying that mainly nodule growth was delayed in the thi1 mutant. Furthermore, this mutant formed many immature seeds with reduced seed weight. These results indicate that thiamine biosynthesis mediated by THI1 enhances nodule enlargement and is required for seed development in L. japonicus. PMID:27702844
Arregui, Carlos O.; Balsamo, Janne; Lilien, Jack
1998-01-01
To investigate the role of nonreceptor protein tyrosine phosphatase 1B (PTP1B) in β1-integrin– mediated adhesion and signaling, we transfected mouse L cells with normal and catalytically inactive forms of the phosphatase. Parental cells and cells expressing the wild-type or mutant PTP1B were assayed for (a) adhesion, (b) spreading, (c) presence of focal adhesions and stress fibers, and (d) tyrosine phosphorylation. Parental cells and cells expressing wild-type PTP1B show similar morphology, are able to attach and spread on fibronectin, and form focal adhesions and stress fibers. In contrast, cells expressing the inactive PTP1B have a spindle-shaped morphology, reduced adhesion and spreading on fibronectin, and almost a complete absence of focal adhesions and stress fibers. Attachment to fibronectin induces tyrosine phosphorylation of focal adhesion kinase (FAK) and paxillin in parental cells and cells transfected with the wild-type PTP1B, while in cells transfected with the mutant PTP1B, such induction is not observed. Additionally, in cells expressing the mutant PTP1B, tyrosine phosphorylation of Src is enhanced and activity is reduced. Lysophosphatidic acid temporarily reverses the effects of the mutant PTP1B, suggesting the existence of a signaling pathway triggering focal adhesion assembly that bypasses the need for active PTP1B. PTP1B coimmunoprecipitates with β1-integrin from nonionic detergent extracts and colocalizes with vinculin and the ends of actin stress fibers in focal adhesions. Our data suggest that PTP1B is a critical regulatory component of integrin signaling pathways, which is essential for adhesion, spreading, and formation of focal adhesions. PMID:9813103
Moonjely, Soumya; Keyhani, Nemat O; Bidochka, Michael J
2018-04-01
The hyd1/hyd2 hydrophobins are important constituents of the conidial cell wall of the insect pathogenic fungus Beauveria bassiana. This fungus can also form intimate associations with several plant species. Here, we show that inactivation of two Class I hydrophobin genes, hyd1 or hyd2, significantly decreases the interaction of B. bassiana with bean roots. Curiously, the ∆hyd1/∆hyd2 double mutant was less impaired in root association than Δhyd1 or Δhyd2. Loss of hyd genes affected growth rate, conidiation ability and oosporein production. Expression patterns for genes involved in conidiation, cell wall integrity, insect virulence, signal transduction, adhesion, hydrophobicity and oosporein production were screened in the deletion mutants grown in different conditions. Repression of the major MAP-Kinase signal transduction pathways (Slt2 MAPK pathway) was observed that was more pronounced in the single versus double hyd mutants under certain conditions. The ∆hyd1/∆hyd2 double mutant showed up-regulation of the Hog1 MAPK and the Msn2 transcription factor under certain conditions when compared to the wild-type or single hyd mutants. The expression of the bad2 adhesin and the oosporein polyketide synthase 9 gene was severely reduced in all of the mutants. On the other hand, fewer changes were observed in the expression of key conidiation and cell wall integrity genes in hyd mutants compared to wild-type. Taken together, the data from this study indicated pleiotropic consequences of deletion of hyd1 and hyd2 on signalling and stress pathways as well as the ability of the fungus to form stable associations with plant roots.
Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K
1997-01-01
We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754
Somaratne, Yamuna; Tian, Youhui; Zhang, Hua; Wang, Mingming; Huo, Yanqing; Cao, Fengge; Zhao, Li; Chen, Huabang
2017-04-01
Anther cuticle and pollen exine are the major protective barriers against various stresses. The proper functioning of genes expressed in the tapetum is vital for the development of pollen exine and anther cuticle. In this study, we report a tapetum-specific gene, Abnormal Pollen Vacuolation1 (APV1), in maize that affects anther cuticle and pollen exine formation. The apv1 mutant was completely male sterile. Its microspores were swollen, less vacuolated, with a flat and empty anther locule. In the mutant, the anther epidermal surface was smooth, shiny, and plate-shaped compared with the three-dimensional crowded ridges and randomly formed wax crystals on the epidermal surface of the wild-type. The wild-type mature pollen had elaborate exine patterning, whereas the apv1 pollen surface was smooth. Only a few unevenly distributed Ubisch bodies were formed on the apv1 mutant, leading to a more apparent inner surface. A significant reduction in the cutin monomers was observed in the mutant. APV1 encodes a member of the P450 subfamily, CYP703A2-Zm, which contains 530 amino acids. APV1 appeared to be widely expressed in the tapetum at the vacuolation stage, and its protein signal co-localized with the endoplasmic reticulum (ER) signal. RNA-Seq data revealed that most of the genes in the fatty acid metabolism pathway were differentially expressed in the apv1 mutant. Altogether, we suggest that APV1 functions in the fatty acid hydroxylation pathway which is involved in forming sporopollenin precursors and cutin monomers that are essential for the development of pollen exine and anther cuticle in maize. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Bhatt, Shantanu; Edwards, Adrianne Nehrling; Nguyen, Hang Thi Thu; Merlin, Didier; Romeo, Tony; Kalman, Daniel
2009-01-01
The attaching and effacing (A/E) pathogen enteropathogenic Escherichia coli (EPEC) forms characteristic actin-filled membranous protrusions upon infection of host cells termed pedestals. Here we examine the role of the RNA binding protein CsrA in the expression of virulence genes and proteins that are necessary for pedestal formation. The csrA mutant was defective in forming actin pedestals on epithelial cells and in disrupting transepithelial resistance across polarized epithelial cells. Consistent with reduced pedestal formation, secretion of the translocators EspA, EspB, and EspD and the effector Tir was substantially reduced in the csrA mutant. Purified CsrA specifically bound to the sepL espADB mRNA leader, and the corresponding transcript levels were reduced in the csrA mutant. In contrast, Tir synthesis was unaffected in the csrA mutant. Reduced secretion of Tir appeared to be in part due to decreased synthesis of EscD, an inner membrane architectural protein of the type III secretion system (TTSS) and EscF, a protein that forms the protruding needle complex of the TTSS. These effects were not mediated through the locus of enterocyte effacement (LEE) transcriptional regulator GrlA or Ler. In contrast to the csrA mutant, multicopy expression of csrA repressed transcription from LEE1, grlRA, LEE2, LEE5, escD, and LEE4, an effect mediated by GrlA and Ler. Consistent with its role in other organisms, CsrA also regulated flagellar motility and glycogen levels. Our findings suggest that CsrA governs virulence factor expression in an A/E pathogen by regulating mRNAs encoding translocators, effectors, or transcription factors. PMID:19581394
Modification of SR-PSOX functions by multi-point mutations of basic amino acid residues.
Liu, Weiwei; Yin, Lan; Dai, Yalei
2013-02-01
SR-PSOX can function as a scavenger receptor, a chemokine and an adhesion molecule, and it could be an interesting player in the formation of atherosclerotic lesions. Our previous studies demonstrated that basic amino acid residues in the chemokine domain of SR-PSOX are critical for its functions. In this study the combinations of the key basic amino acids in the chemokine domain of SR-PSOX have been identified. Five combinations of basic amino acid residues that may form conformational motif for SR-PSOX functions were selected for multi-point mutants. The double mutants of K61AR62A, R76AK79A, R82AH85A, and treble mutants of R76AR78AK79A, R78AR82AH85A were successfully constructed by replacing the combinations of two or three basic amino acid residues with alanine. After successful expression of these mutants on the cells, the functional studies showed that the cells expressing R76AK79A and R82AH85A mutants significantly increased the activity of oxLDL uptake compared with that of wild-type SR-PSOX. Meanwhile, the cells expressing R76AK79A mutant also dramatically enhanced the phagocytotic activity of SR-PSOX. However, the cells expressing the construct of combination of R78A mutation in R76AK79A or R82AH85A could abolish these effects. More interestingly, the adhesive activities were remarkably down regulated in the cells expressing the multi-point mutants respectively. This study revealed that some conformational motifs of basic amino acid residues, especially R76 with K79 in SR-PSOX, may form a common functional motif for its critical functions. R78 in SR-PSOX has the potential action to stabilize the function of oxLDL uptake and bacterial phagocytosis. The results obtained may provide new insight for the development of drug target of atherosclerosis. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene.
Bardin, S D; Voegele, R T; Finan, T M
1998-08-01
Rhizobium meliloti mutants defective in the phoCDET-encoded phosphate transport system form root nodules on alfalfa plants that fail to fix nitrogen (Fix-). We have previously reported that two classes of second-site mutations can suppress the Fix- phenotype of phoCDET mutants to Fix+. Here we show that one of these suppressor loci (sfx1) contains two genes, orfA and pit, which appear to form an operon transcribed in the order orfA-pit. The Pit protein is homologous to various phosphate transporters, and we present evidence that three suppressor mutations arose from a single thymidine deletion in a hepta-thymidine sequence centered 54 nucleotides upstream of the orfA transcription start site. This mutation increased the level of orfA-pit transcription. These data, together with previous biochemical evidence, show that the orfA-pit genes encode a Pi transport system that is expressed in wild-type cells grown with excess Pi but repressed in cells under conditions of Pi limitation. In phoCDET mutant cells, orfA-pit expression is repressed, but this repression is alleviated by the second-site suppressor mutations. Suppression increases orfA-pit expression compensating for the deficiencies in phosphate assimilation and symbiosis of the phoCDET mutants.
Ramsay, Douglas; Bevan, Nicola; Rees, Stephen; Milligan, Graeme
2001-01-01
The wild-type β2-adrenoceptor and a constitutively active mutant of this receptor were C-terminally tagged with luciferase from the sea pansy Renilla reniformis. C-terminal addition of Renilla luciferase did not substantially alter the levels of expression of either form of the receptor, the elevated constitutive activity of the mutant β2-adrenoceptor nor the capacity of isoprenaline to elevate cyclic AMP levels in intact cells expressing these constructs. Treatment of cells expressing constitutively active mutant β2-adrenoceptor-Renilla luciferase with antagonist/inverse agonist ligands resulted in upregulation of levels of this polypeptide which could be monitored by the elevated luciferase activity. The pEC50 for ligand-induced luciferase upregulation and ligand affinity to bind the receptor were highly correlated. Similar upregulation could be observed following sustained treatment with agonist ligands. These effects were only observed at a constitutively active mutant of the β2-adrenoceptor. Co-expression of the wild-type β2-adrenoceptor C-terminally tagged with the luciferase from Photinus pyralis did not result in ligand-induced upregulation of the levels of activity of this luciferase. Co-expression of the constitutively active mutant β2-adrenoceptor-Renilla luciferase and an equivalent mutant of the α1b-adrenoceptor C-terminally tagged with green fluorescent protein allowed pharmacological selectivity of adrenoceptor antagonists to be demonstrated. This approach offers a sensitive and convenient means, which is amenable to high throughput analysis, to monitor ligand binding to a constitutively active mutant receptor. As no prior knowledge of receptor ligands is required this approach may be suitable to identify ligands at orphan G protein-coupled receptors. PMID:11350868
Li, J; Quilty, J; Popov, M; Reithmeier, R A
2000-07-01
The human erythrocyte anion exchanger (AE)1 (Band 3) contains a single complex N-linked oligosaccharide that is attached to Asn(642) in the fourth extracellular loop of this polytopic membrane protein, while other isoforms (AE2, AE3 and trout AE1) are N-glycosylated on the preceding extracellular loop. Human AE1 expressed in transfected human embryonic kidney (HEK)-293 or COS-7 cells contained a high-mannose oligosaccharide. The lack of oligosaccharide processing was not due to retention of AE1 in the endoplasmic reticulum since biotinylation assays showed that approx. 30% of the protein was expressed at the cell surface. Moving the N-glycosylation site to the preceding extracellular loop in an AE1 glycosylation mutant (N555) resulted in processing of the oligosaccharide and production of a complex form of AE1. A double N-glycosylation mutant (N555/N642) contained both a high-mannose and a complex oligosaccharide chain. The complex form of the N555 mutant could be biotinylated showing that this form of the glycoprotein was at the cell surface. Pulse-chase experiments showed that the N555 mutant was efficiently converted from a high-mannose to a complex oligosaccharide with a half-time of approx. 4 h, which reflected the time course of trafficking of AE1 from the endoplasmic reticulum to the plasma membrane. The turnover of the complex form of the N555 mutant occurred with a half-life of approx. 15 h. The results show that the oligosaccharide attached to the endogenous site in extracellular loop 4 in human AE1 is not processed in HEK-293 or COS-7 cells, while the oligosaccharide attached to the preceding loop is converted into the complex form.
Zhang, C; Pietras, K M; Sferrazza, G F; Jia, P; Athauda, G; Rueda-de-Leon, E; Rveda-de-Leon, E; Maier, J A; Dube, D K; Lemanski, S L; Lemanski, L F
2007-01-01
The Mexican axolotl, Ambystoma mexicanum, is an excellent animal model for studying heart development because it carries a naturally occurring recessive genetic mutation, designated gene c, for cardiac nonfunction. The double recessive mutants (c/c) fail to form organized myofibrils in the cardiac myoblasts resulting in hearts that fail to beat. Tropomyosin expression patterns have been studied in detail and show dramatically decreased expression in the hearts of homozygous mutant embryos. Because of the direct interaction between tropomyosin and troponin T (TnT), and the crucial functions of TnT in the regulation of striated muscle contraction, we have expanded our studies on this animal model to characterize the expression of the TnT gene in cardiac muscle throughout normal axolotl development as well as in mutant axolotls. In addition, we have succeeded in cloning the full-length cardiac troponin T (cTnT) cDNA from axolotl hearts. Confocal microscopy has shown a substantial, but reduced, expression of TnT protein in the mutant hearts when compared to normal during embryonic development. 2006 Wiley-Liss, Inc.
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Talukdar, Dibyendu; Talukdar, Tulika
2013-01-01
Two common bean (Phaseolus vulgaris L.) mutants, sodPv 1 and sodPv 2, exhibiting foliar superoxide dismutase (SOD) activity of only 25% and 40% of their mother control (MC) cv. VL 63 were isolated in EMS-mutagenized (0.15%, 8 h) M2 progeny. Native-PAGE analysis revealed occurrence of Mn SOD, Fe SOD, Cu/Zn SOD I and Cu/Zn SOD II isozymes in MC, while Fe SOD, and Mn SOD were not formed in sodPv 1 and sodPv 2 leaves, respectively. In-gel activity of individual isozymes differed significantly among the parents. SOD deficiency is inherited as recessive mutations, controlled by two different nonallelic loci. Gene expressions using qRT PCR confirmed higher expressions of Cu/Zn SOD transcripts in both mutants and the absence of Fe SOD in sodPv 1 and Mn SOD in sodPv 2. In 50 μM arsenic, Cu/Zn SODs genes were further upregulated but other isoforms downregulated in the two mutants, maintaining SOD activity in its control level. In an F2 double mutants of sodPv 1 × sodPv 2, no Fe SOD, and Mn SOD expressions were detectable, while both Cu/Zn SODs are down-regulated and arsenic-induced leaf necrosis appeared. In contrast to both mutants, ROS-imaging study revealed overaccumulation of both superoxides and H2O2 in leaves of double mutant. PMID:24078924
Ahn, Hyo-Min; Koh, Young Ho
2016-01-01
We investigated unknown in vivo functions of Torsin by using Drosophila as a model. Downregulation of Drosophila Torsin (DTor) by DTor-specific inhibitory double-stranded RNA (RNAi) induced abnormal locomotor behavior and increased susceptibility to H2O2. In addition, altered expression of DTor significantly increased the numbers of synaptic boutons. One important biochemical consequence of DTor-RNAi expression in fly brains was upregulation of alcohol dehydrogenase (ADH). Altered expression of ADH has also been reported in Drosophila Fragile-X mental retardation protein (DFMRP) mutant flies. Interestingly, expression of DFMRP was altered in DTor mutant flies, and DTor and DFMRP were present in the same protein complexes. In addition, DTor and DFMRP immunoreactivities were partially colocalized in several cellular organelles in larval muscles. Furthermore, there were no significant differences between synaptic morphologies of dfmrp null mutants and dfmrp mutants expressing DTor-RNAi. Taken together, our evidences suggested that DTor and DFMRP might be present in the same signaling pathway regulating synaptic plasticity. In addition, we also found that human Torsin1A and human FMRP were present in the same protein complexes, suggesting that this phenomenon is evolutionarily conserved. PMID:27313903
FGF8 is essential for formation of the ductal system in the male reproductive tract
Kitagaki, Jirouta; Ueda, Yutaka; Chi, Xuan; Sharma, Nirmala; Elder, Cynthia M.; Truffer, Erika; Costantini, Frank; Lewandoski, Mark; Perantoni, Alan O.
2011-01-01
During development of the urogenital tract, fibroblast growth factor 8 (Fgf8) is expressed in mesonephric tubules, but its role in this tissue remains undefined. An evaluation of previously generated T-Cre-mediated Fgf8-deficient mice (T-Cre; Fgf8flox/Δ2,3 mice), which lack Fgf8 expression in the mesoderm, revealed that the cranial region of the Wolffian duct degenerated prematurely and the cranial mesonephric tubules were missing. As a result, the epididymis, vas deferens and efferent ductules were largely absent in mutant mice. Rarb2-Cre was used to eliminate FGF8 from the mesonephric tubules but to allow expression in the adjacent somites. These mutants retained the cranial end of the Wolffian duct and formed the epididymis and vas deferens, but failed to elaborate the efferent ductules, indicating that Fgf8 expression by the mesonephric tubules is required specifically for the formation of the ductules. Ret knockout mice do not form the ureteric bud, a caudal outgrowth of the Wolffian duct and progenitor for the collecting duct network in the kidney, but they do develop the cranial end normally. This indicates that Fgf8, but not Ret, expression is essential to the outgrowth of the cranial mesonephric tubules from the Wolffian duct and to the development of major portions of the sex accessory tissues in the male reproductive tract. Mechanistically, FGF8 functions upstream of Lhx1 expression in forming the nephron, and analysis of Fgf8 mutants similarly shows deficient Lhx1 expression in the mesonephric tubules. These results demonstrate a multifocal requirement for FGF8 in establishing the male reproductive tract ducts and implicate Lhx1 signaling in tubule elongation. PMID:22110055
Mutant p53-associated myosin-X upregulation promotes breast cancer invasion and metastasis.
Arjonen, Antti; Kaukonen, Riina; Mattila, Elina; Rouhi, Pegah; Högnäs, Gunilla; Sihto, Harri; Miller, Bryan W; Morton, Jennifer P; Bucher, Elmar; Taimen, Pekka; Virtakoivu, Reetta; Cao, Yihai; Sansom, Owen J; Joensuu, Heikki; Ivaska, Johanna
2014-03-01
Mutations of the tumor suppressor TP53 are present in many forms of human cancer and are associated with increased tumor cell invasion and metastasis. Several mechanisms have been identified for promoting dissemination of cancer cells with TP53 mutations, including increased targeting of integrins to the plasma membrane. Here, we demonstrate a role for the filopodia-inducing motor protein Myosin-X (Myo10) in mutant p53-driven cancer invasion. Analysis of gene expression profiles from 2 breast cancer data sets revealed that MYO10 was highly expressed in aggressive cancer subtypes. Myo10 was required for breast cancer cell invasion and dissemination in multiple cancer cell lines and murine models of cancer metastasis. Evaluation of a Myo10 mutant without the integrin-binding domain revealed that the ability of Myo10 to transport β₁ integrins to the filopodia tip is required for invasion. Introduction of mutant p53 promoted Myo10 expression in cancer cells and pancreatic ductal adenocarcinoma in mice, whereas suppression of endogenous mutant p53 attenuated Myo10 levels and cell invasion. In clinical breast carcinomas, Myo10 was predominantly expressed at the invasive edges and correlated with the presence of TP53 mutations and poor prognosis. These data indicate that Myo10 upregulation in mutant p53-driven cancers is necessary for invasion and that plasma-membrane protrusions, such as filopodia, may serve as specialized metastatic engines.
Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...
2016-02-04
Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana
Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less
Ding, Jianqiang; Yannam, Govardhana R; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I; Wong, Ronald J; Avsar, Yesim; Guha, Chandan; Perlmutter, David H; Fox, Ira J; Roy-Chowdhury, Jayanta
2011-05-01
α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z-expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%-98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z-expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals.
Janowicz, Diane M; Cooney, Sean A; Walsh, Jessica; Baker, Beth; Katz, Barry P; Fortney, Kate R; Zwickl, Beth W; Ellinger, Sheila; Munson, Robert S
2011-09-22
Haemophilus ducreyi, the causative agent of the sexually transmitted disease chancroid, contains a flp (fimbria like protein) operon that encodes proteins predicted to contribute to adherence and pathogenesis. H. ducreyi mutants that lack expression of Flp1 and Flp2 or TadA, which has homology to NTPases of type IV secretion systems, have decreased abilities to attach to and form microcolonies on human foreskin fibroblasts (HFF). A tadA mutant is attenuated in its ability to cause disease in human volunteers and in the temperature dependent rabbit model, but a flp1flp2 mutant is virulent in rabbits. Whether a flp deletion mutant would cause disease in humans is not clear. We constructed 35000HPΔflp1-3, a deletion mutant that lacks expression of all three Flp proteins but has an intact tad secretion system. 35000HPΔflp1-3 was impaired in its ability to form microcolonies and to attach to HFF in vitro when compared to its parent (35000HP). Complementation of the mutant with flp1-3 in trans restored the parental phenotype. To test whether expression of Flp1-3 was necessary for virulence in humans, ten healthy adult volunteers were experimentally infected with a fixed dose of 35000HP (ranging from 54 to 67 CFU) on one arm and three doses of 35000HPΔflp1-3 (ranging from 63 to 961 CFU) on the other arm. The overall papule formation rate for the parent was 80% (95% confidence interval, CI, 55.2%-99.9%) and for the mutant was 70.0% (95% CI, 50.5%-89.5%) (P = 0.52). Mutant papules were significantly smaller (mean, 11.2 mm2) than were parent papules (21.8 mm2) 24 h after inoculation (P = 0.018). The overall pustule formation rates were 46.7% (95% CI 23.7-69.7%) at 30 parent sites and 6.7% (95% CI, 0.1-19.1%) at 30 mutant sites (P = 0.001). These data suggest that production and secretion of the Flp proteins contributes to microcolony formation and attachment to HFF cells in vitro. Expression of flp1-3 is also necessary for H. ducreyi to initiate disease and progress to pustule formation in humans. Future studies will focus on how Flp proteins contribute to microcolony formation and attachment in vivo. © 2011 Janowicz et al; licensee BioMed Central Ltd.
Broder, C C; Berger, E A
1993-01-01
The third complementarity-determining region (CDR3) within domain 1 of the human CD4 molecule has been suggested to play a critical role in membrane fusion mediated by the interaction of CD4 with the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein. To analyze in detail the role of CDR3 and adjacent regions in the fusion process, we used cassette mutagenesis to construct a panel of 30 site-directed mutations between residues 79 and 96 of the full-length CD4 molecule. The mutant proteins were transiently expressed by using recombinant vaccinia virus vectors and were analyzed for cell surface expression, recombinant gp120-binding activity, and overall structural integrity as assessed by reactivity with a battery of anti-CD4 monoclonal antibodies. Cells expressing the CD4 mutants were assayed for their ability to form syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. Surprisingly in view of published data from others, most of the mutations had little effect on syncytium-forming activity. Normal fusion was observed in 21 mutants, including substitution of human residues 85 to 95 with the corresponding sequences from either chimpanzee, rhesus, or mouse CD4; a panel of Ser-Arg double insertions after each residue from 86 to 91; and a number of other charge, hydrophobic, and proline substitutions and insertions within this region. The nine mutants that showed impaired fusion all displayed defective gp120 binding and disruption of overall structural integrity. In further contrast with results of other workers, we observed that transformant human cell lines expressing native chimpanzee or rhesus CD4 efficiently formed syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. These data refute the conclusion that certain mutations in the CDR3 region of CD4 abolish cell fusion activity, and they suggest that a wide variety of sequences can be functionally tolerated in this region, including those from highly divergent mammalian species. Syncytium formation mediated by several of the CDR3 mutants was partially or completely resistant to inhibition by the CDR3-directed monoclonal antibody L71, suggesting that the corresponding epitope is not directly involved in the fusion process.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419649
Broder, C C; Berger, E A
1993-02-01
The third complementarity-determining region (CDR3) within domain 1 of the human CD4 molecule has been suggested to play a critical role in membrane fusion mediated by the interaction of CD4 with the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein. To analyze in detail the role of CDR3 and adjacent regions in the fusion process, we used cassette mutagenesis to construct a panel of 30 site-directed mutations between residues 79 and 96 of the full-length CD4 molecule. The mutant proteins were transiently expressed by using recombinant vaccinia virus vectors and were analyzed for cell surface expression, recombinant gp120-binding activity, and overall structural integrity as assessed by reactivity with a battery of anti-CD4 monoclonal antibodies. Cells expressing the CD4 mutants were assayed for their ability to form syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. Surprisingly in view of published data from others, most of the mutations had little effect on syncytium-forming activity. Normal fusion was observed in 21 mutants, including substitution of human residues 85 to 95 with the corresponding sequences from either chimpanzee, rhesus, or mouse CD4; a panel of Ser-Arg double insertions after each residue from 86 to 91; and a number of other charge, hydrophobic, and proline substitutions and insertions within this region. The nine mutants that showed impaired fusion all displayed defective gp120 binding and disruption of overall structural integrity. In further contrast with results of other workers, we observed that transformant human cell lines expressing native chimpanzee or rhesus CD4 efficiently formed syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. These data refute the conclusion that certain mutations in the CDR3 region of CD4 abolish cell fusion activity, and they suggest that a wide variety of sequences can be functionally tolerated in this region, including those from highly divergent mammalian species. Syncytium formation mediated by several of the CDR3 mutants was partially or completely resistant to inhibition by the CDR3-directed monoclonal antibody L71, suggesting that the corresponding epitope is not directly involved in the fusion process.(ABSTRACT TRUNCATED AT 400 WORDS)
Fujimuro, Masahiro; Nishiya, Tadashi; Nomura, Yasuyuki; Yokosawa, Hideyoshi
2005-12-01
Polyubiquitination plays key roles in various proteasome-dependent and independent cellular events. To elucidate roles in stress response of polyubiquitin chains formed via specific chain linkages in mammalian cells, we established NIH3T3 stable cell lines that are capable of conditionally expressing K29R, K48R and K63R ubiquitin mutants, in which the Lys29, Lys48 and Lys63 residues of ubiquitin had been changed to Arg, and we examined the effects of various stresses on their cell viabilities. The expression of K63R ubiquitin mutant decreased viability of the cells post-exposed to ethanol, H(2)O(2) and methyl methanesulfonate (MMS), while that of K48R mutant decreased viability of the cells post-exposed to heat shock as well as ethanol, H(2)O(2) and MMS. Thus, these results suggest that polyubiquitin chains formed via specific chain linkages are involved in the respective stress responses in mammalian cells.
Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair
2016-07-01
In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.
McGregor, Alistair
2016-01-01
In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220
Hernández, Maria; Pearce-Kelling, Susan E.; Rodriguez, F. David; Aguirre, Gustavo D.; Vecino, Elena
2010-01-01
Purpose. Leber congenital amaurosis (LCA) is a group of childhood-onset retinal diseases characterized by severe visual impairment or blindness. One form is caused by mutations in the RPE65 gene, which encodes the retinal pigment epithelium (RPE) isomerase. In this study, the retinal structure and expression of molecular markers for different retinal cell types were characterized, and differences between control and RPE65 mutant dogs during the temporal evolution of the disease were analyzed. Methods. Retinas from normal and mutant dogs of different ages were examined by immunofluorescence with a panel of 16 different antibodies. Results. Cones and rods were preserved in the mutant retinas, and the number of cones was normal. However, there was altered expression of cone arrestin and delocalization of rod opsin. The ON bipolar cells showed sprouting of the dendritic arbors toward the outer nuclear layer (ONL) and retraction of their axons in the inner nuclear layer (INL). A decreased expression of GABA, and an increased expression of intermediate filament glial markers was also found in the mutant retinas. These changes were more evident in the adult than the young mutant retinas. Conclusions. The structure of the retina is well preserved in the mutant retina, but several molecular changes take place in photoreceptors and in bipolar and amacrine cells. Some of these changes are structural, whereas others reflect a change in localization of the examined proteins. This study provides new information that can be applied to the interpretation of outcomes of retinal gene therapy in animal models and humans. PMID:20671290
Brahimi-Adouane, Sabrina; Bachet, Jean-Baptiste; Tabone-Eglinger, Séverine; Subra, Frédéric; Capron, Claude; Blay, Jean-Yves; Emile, Jean-François
2013-06-01
Gain of function mutations of KIT are frequent in some human tumors, and are sensible to tyrosine kinase inhibitors. In most tumors, oncogenic mutations are heterozygous, however most in vitro data of KIT activation have been obtained with hemizygous mutation. This study aimed to investigate the maturation and activation of wild-type (WT) and mutant (M) forms of KIT in hemizygous and heterozygous conditions. WT and two types of exon 11 deletions M forms of human KIT were expressed in NIH3T3 cell lines. Membrane expression of KIT was quantified by flow cytometry. Quantification of glycosylated forms of KIT and phosphorylated forms of AKT and ERK were performed by western blot. Simultaneous activation of WT KIT and treatment with endoplasmic reticulum (ER) inhibitors, tunicamycin or brefeldin A induced a complete inhibition of membrane expression of the 145 kDa form of KIT. By contrast activation or ER inhibitors alone, only partly inhibited this form. ER inhibitors also inhibited KIT activation-dependent phosphorylation of AKT and ERK1/2. Brefeldin A induced a complete down regulation of the 145 kDa form in hemizygous M, and induced an intra-cellular accumulation of the 125 kDa form in WT but not in hemizygous M. Heterozygous cells had glycosylation and response to ER inhibitors patterns more similar to WT than to hemizygous M. Phosphorylated AKT was reduced in hemizygous cells in comparison to WT KIT cells and heterozygous cells, and in the presence of brefeldin A in all cell lines. Effects of ER inhibitors are significantly different in hemizygous and heterozygous mutants. Differences in intra-cellular trafficking of KIT forms result in differences in downstream signaling pathways, and activation of PI3K/AKT pathway appears to be tied to the presence of the mature 145 kDa form of KIT at the membrane surface. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
In Vitro Expansion of CAG, CAA, and Mixed CAG/CAA Repeats.
Figura, Grzegorz; Koscianska, Edyta; Krzyzosiak, Wlodzimierz J
2015-08-11
Polyglutamine diseases, including Huntington's disease and a number of spinocerebellar ataxias, are caused by expanded CAG repeats that are located in translated sequences of individual, functionally-unrelated genes. Only mutant proteins containing polyglutamine expansions have long been thought to be pathogenic, but recent evidence has implicated mutant transcripts containing long CAG repeats in pathogenic processes. The presence of two pathogenic factors prompted us to attempt to distinguish the effects triggered by mutant protein from those caused by mutant RNA in cellular models of polyglutamine diseases. We used the SLIP (Synthesis of Long Iterative Polynucleotide) method to generate plasmids expressing long CAG repeats (forming a hairpin structure), CAA-interrupted CAG repeats (forming multiple unstable hairpins) or pure CAA repeats (not forming any secondary structure). We successfully modified the original SLIP protocol to generate repeats of desired length starting from constructs containing short repeat tracts. We demonstrated that the SLIP method is a time- and cost-effective approach to manipulate the lengths of expanded repeat sequences.
Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M
1991-01-01
Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554
Friend or Foe: MicroRNAs in the p53 network.
Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo
2018-04-10
The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.
Ectopic expression of pMADS3 in transgenic petunia phenocopies the petunia blind mutant.
Tsuchimoto, S; van der Krol, A R; Chua, N H
1993-01-01
We cloned a MADS-box gene, pMADS3, from Petunia hybrida, which shows high sequence homology to the Arabidopsis AGAMOUS and Antirrhinum PLENA. pMADS3 is expressed exclusively in stamens and carpels of wild-type petunia plants. In the petunia mutant blind, which shows homeotic conversions of corolla limbs into antheroid structures with pollen grains and small parts of sepals into carpelloid tissue, pMADS3 is expressed in all floral organs as well as in leaves. Ectopic expression of pMADS3 in transgenic petunia leads to phenocopies of the blind mutant, i.e., the formation of antheroid structures on limbs and carpelloid tissue on sepals. Transgenic tobacco plants that overexpress pMADS3 exhibit an even more severe phenotype, with the sepals forming a carpel-like structure encasing the interior floral organs. Our results identify BLIND as a negative regulator of pMADS3, which specifies stamens and carpels during petunia flower development. PMID:8104573
Dahl, Marlis; Müller, Susanne; Voll, Lars M.; Koch, Christian
2015-01-01
We used insertional mutagenesis by Agrobacterium tumefaciens mediated transformation (ATMT) to isolate pathogenicity mutants of Colletotrichum higginsianum. From a collection of 7200 insertion mutants we isolated 75 mutants with reduced symptoms. 19 of these were affected in host penetration, while 17 were affected in later stages of infection, like switching to necrotrophic growth. For 16 mutants the location of T-DNA insertions could be identified by PCR. A potential plasma membrane H+-ATPase Pma2 was targeted in five independent insertion mutants. We genetically inactivated the Ku80 component of the non-homologous end-joining pathway in C. higginsianum to establish an efficient gene knockout protocol. Chpma2 deletion mutants generated by homologous recombination in the ΔChku80 background form fully melanized appressoria but entirely fail to penetrate the host tissue and are non-pathogenic. The ChPMA2 gene is induced upon appressoria formation and infection of A. thaliana. Pma2 activity is not important for vegetative growth of saprophytically growing mycelium, since the mutant shows no growth penalty under these conditions. Colletotrichum higginsianum codes for a closely related gene (ChPMA1), which is highly expressed under most growth conditions. ChPMA1 is more similar to the homologous yeast genes for plasma membrane pumps. We propose that expression of a specific proton pump early during infection may be common to many appressoria forming fungal pathogens as we found ChPMA2 orthologs in several plant pathogenic fungi. PMID:25992547
Functional Rescue of Trafficking-Impaired ABCB4 Mutants by Chemical Chaperones
Gordo-Gilart, Raquel; Andueza, Sara; Hierro, Loreto; Jara, Paloma; Alvarez, Luis
2016-01-01
Multidrug resistance protein 3 (MDR3, ABCB4) is a hepatocellular membrane protein that mediates biliary secretion of phosphatidylcholine. Null mutations in ABCB4 gene give rise to severe early-onset cholestatic liver disease. We have previously shown that the disease-associated mutations p.G68R, p.G228R, p.D459H, and p.A934T resulted in retention of ABCB4 in the endoplasmic reticulum, thus failing to target the plasma membrane. In the present study, we tested the ability of two compounds with chaperone-like activity, 4-phenylbutyrate and curcumin, to rescue these ABCB4 mutants by assessing their effects on subcellular localization, protein maturation, and phospholipid efflux capability. Incubation of transfected cells at a reduced temperature (30°C) or exposure to pharmacological doses of either 4-PBA or curcumin restored cell surface expression of mutants G228R and A934T. The delivery of these mutants to the plasma membrane was accompanied by a switch in the ratio of mature to inmature protein forms, leading to a predominant expression of the mature protein. This effect was due to an improvement in the maturation rate and not to the stabilization of the mature forms. Both mutants were also functionally rescued, displaying bile salt-dependent phospholipid efflux activity after addition of 4-PBA or curcumin. Drug-induced rescue was mutant specific, given neither 4-PBA nor curcumin had an effect on the ABCB4 mutants G68R and A934T. Collectively, these data indicate that the functionality of selected trafficking-defective ABCB4 mutants can be recovered by chemical chaperones through restoration of membrane localization, suggesting a potential treatment for patients carrying such mutations. PMID:26900700
Ding, Jianqiang; Yannam, Govardhana R.; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I.; Wong, Ronald J.; Avsar, Yesim; Guha, Chandan; Perlmutter, David H.; Fox, Ira J.; Roy-Chowdhury, Jayanta
2011-01-01
α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z–expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%–98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z–expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals. PMID:21505264
Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P
2012-03-01
The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.
Ambrosi, Cinzia; Walker, Amy E; Depriest, Adam D; Cone, Angela C; Lu, Connie; Badger, John; Skerrett, I Martha; Sosinsky, Gina E
2013-01-01
Human Connexin26 gene mutations cause hearing loss. These hereditary mutations are the leading cause of childhood deafness worldwide. Mutations in gap junction proteins (connexins) can impair intercellular communication by eliminating protein synthesis, mis-trafficking, or inducing channels that fail to dock or have aberrant function. We previously identified a new class of mutants that form non-functional gap junction channels and hemichannels (connexons) by disrupting packing and inter-helix interactions. Here we analyzed fourteen point mutations in the fourth transmembrane helix of connexin26 (Cx26) that cause non-syndromic hearing loss. Eight mutations caused mis-trafficking (K188R, F191L, V198M, S199F, G200R, I203K, L205P, T208P). Of the remaining six that formed gap junctions in mammalian cells, M195T and A197S formed stable hemichannels after isolation with a baculovirus/Sf9 protein purification system, while C202F, I203T, L205V and N206S formed hemichannels with varying degrees of instability. The function of all six gap junction-forming mutants was further assessed through measurement of dye coupling in mammalian cells and junctional conductance in paired Xenopus oocytes. Dye coupling between cell pairs was reduced by varying degrees for all six mutants. In homotypic oocyte pairings, only A197S induced measurable conductance. In heterotypic pairings with wild-type Cx26, five of the six mutants formed functional gap junction channels, albeit with reduced efficiency. None of the mutants displayed significant alterations in sensitivity to transjunctional voltage or induced conductive hemichannels in single oocytes. Intra-hemichannel interactions between mutant and wild-type proteins were assessed in rescue experiments using baculovirus expression in Sf9 insect cells. Of the four unstable mutations (C202F, I203T, L205V, N206S) only C202F and N206S formed stable hemichannels when co-expressed with wild-type Cx26. Stable M195T hemichannels displayed an increased tendency to aggregate. Thus, mutations in TM4 cause a range of phenotypes of dysfunctional gap junction channels that are discussed within the context of the X-ray crystallographic structure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Ning; Thanan, Raynoo; Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie
Highlights: {yields} Oct3/4-positive cells increase in Schistosoma haematobium (SH)-associated bladder cancer. {yields} iNOS-dependent DNA lesion, 8-nitroguanine, was formed in Oct3/4-positive cells. {yields} 8-Nitroguanine formed in stem-like cells plays a role in SH-induced carcinogenesis. {yields} Mutant stem cells may participate in inflammation-related carcinogenesis. -- Abstract: To investigate whether mutant stem cells participate in inflammation-related carcinogenesis, we performed immunohistochemical analysis to examine nitrative and oxidative DNA lesions (8-nitroguanine and 8-oxodG) and a stem cell marker Oct3/4 in bladder tissues obtained from cystitis and bladder cancer patients infected with Schistosomahaematobium (S. haematobium). We also detected the expression of nuclear factor-{kappa}B (NF-{kappa}B) and induciblemore » nitric oxide synthase (iNOS), which lead to 8-nitroguanine formation. The staining intensity of 8-nitroguanine and 8-oxodG was significantly higher in bladder cancer and cystitis tissues than in normal tissues. iNOS expression was colocalized with NF-{kappa}B in 8-nitroguanine-positive tumor cells from bladder cancer patients. Oct3/4 expression was significantly increased in cells from S. haematobium-associated bladder cancer tissues in comparison to normal bladder and cancer tissues without infection. Oct3/4 was also expressed in epithelial cells of cystitis patients. Moreover, 8-nitroguanine was formed in Oct3/4-positive stem cells in S. haematobium-associated cystitis and cancer tissues. In conclusion, inflammation by S.haematobium infection may increase the number of mutant stem cells, in which iNOS-dependent DNA damage occurs via NF-{kappa}B activation, leading to tumor development.« less
Gli function is essential for motor neuron induction in zebrafish.
Vanderlaan, Gary; Tyurina, Oksana V; Karlstrom, Rolf O; Chandrasekhar, Anand
2005-06-15
The Gli family of zinc-finger transcription factors mediates Hedgehog (Hh) signaling in all vertebrates. However, their roles in ventral neural tube patterning, in particular motor neuron induction, appear to have diverged across species. For instance, cranial motor neurons are essentially lost in zebrafish detour (gli1(-)) mutants, whereas motor neuron development is unaffected in mouse single gli and some double gli knockouts. Interestingly, the expression of some Hh-regulated genes (ptc1, net1a, gli1) is mostly unaffected in the detour mutant hindbrain, suggesting that other Gli transcriptional activators may be involved. To better define the roles of the zebrafish gli genes in motor neuron induction and in Hh-regulated gene expression, we examined these processes in you-too (yot) mutants, which encode dominant repressor forms of Gli2 (Gli2(DR)), and following morpholino-mediated knockdown of gli1, gli2, and gli3 function. Motor neuron induction at all axial levels was reduced in yot (gli2(DR)) mutant embryos. In addition, Hh target gene expression at all axial levels except in rhombomere 4 was also reduced, suggesting an interference with the function of other Glis. Indeed, morpholino-mediated knockdown of Gli2(DR) protein in yot mutants led to a suppression of the defective motor neuron phenotype. However, gli2 knockdown in wild-type embryos generated no discernable motor neuron phenotype, while gli3 knockdown reduced motor neuron induction in the hindbrain and spinal cord. Significantly, gli2 or gli3 knockdown in detour (gli1(-)) mutants revealed roles for Gli2 and Gli3 activator functions in ptc1 expression and spinal motor neuron induction. Similarly, gli1 or gli3 knockdown in yot (gli2(DR)) mutants resulted in severe or complete loss of motor neurons, and of ptc1 and net1a expression, in the hindbrain and spinal cord. In addition, gli1 expression was greatly reduced in yot mutants following gli3, but not gli1, knockdown, suggesting that Gli3 activator function is specifically required for gli1 expression. These observations demonstrate that Gli activator function (encoded by gli1, gli2, and gli3) is essential for motor neuron induction and Hh-regulated gene expression in zebrafish.
Akt mediated ROS-dependent selective targeting of mutant KRAS tumors.
Iskandar, Kartini; Rezlan, Majidah; Pervaiz, Shazib
2014-10-01
Reactive oxygen species (ROS) play a critical role in a variety of cellular processes, ranging from cell survival and proliferation to cell death. Previously, we reported the ability of a small molecule compound, C1, to induce ROS dependent autophagy associated apoptosis in human cancer cell lines and primary tumor cells (Wong C. et al. 2010). Our ongoing investigations have unraveled a hitherto undefined novel signaling network involving hyper-phosphorylation of Akt and Akt-mediated ROS production in cancer cell lines. Interestingly, drug-induced Akt activation is selectively seen in cell lines that carry mutant KRAS; HCT116 cells that carry the V13D KRAS mutation respond favorably to C1 while HT29 cells expressing wild type KRAS are relatively resistant. Of note, not only does the compound target mutant KRAS expressing cells but also induces RAS activation as evidenced by the PAK pull down assay. Corroborating this, pharmacological inhibition as well as siRNA mediated silencing of KRAS or Akt, blocked C1-induced ROS production and rescued tumor colony forming ability in HCT116 cells. To further confirm the involvement of KRAS, we made use of mutant KRAS transformed RWPE-1 prostate epithelial cells. Notably, drug-induced ROS generation and death sensitivity was significantly higher in RWPE-1-KRAS cells than the RWPE-1-vector cells, thus confirming the results obtained with mutant KRAS colorectal carcinoma cell line. Lastly, we made use of HCT116 mutant KRAS knockout cells (KO) where the mutant KRAS allele had been deleted, thus expressing a single wild-type KRAS allele. Exposure of the KO cells to C1 failed to induce Akt activation and mitochondrial ROS production. Taken together, results show the involvement of activated Akt in ROS-mediated selective targeting of mutant KRAS expressing tumors, which could have therapeutic implications given the paucity of chemotherapeutic strategies specifically targeting KRAS mutant cancers. Copyright © 2014. Published by Elsevier Inc.
Gelsomino, L; Panza, S; Giordano, C; Barone, I; Gu, G; Spina, E; Catalano, S; Fuqua, S; Andò, S
2018-04-24
The detection of recurrent mutations affecting the hormone binding domain (HBD) of estrogen receptor alpha (ERα/ESR1) in endocrine therapy-resistant and metastatic breast cancers has prompted interest in functional characterization of these genetic alterations. Here, we explored the role of HBD-ESR1 mutations in influencing the behavior of breast cancer stem cells (BCSCs), using various BC cell lines stably expressing wild-type or mutant (Y537 N, Y537S, D538G) ERα. Compared to WT-ERα clones, mutant cells showed increased CD44 + /CD24 - ratio, mRNA levels of stemness genes, Mammosphere Forming Efficiency (MFE), Self-Renewal and migratory capabilities. Mutant clones exhibited high expression of NOTCH receptors/ligands/target genes and blockade of NOTCH signaling reduced MFE and migratory potential. Mutant BCSC activity was dependent on ERα phosphorylation at serine 118, since its inhibition decreased MFE and NOTCH4 activation only in mutant cells. Collectively, we demonstrate that the expression of HBD-ESR1 mutations may drive BC cells to acquire stem cell traits through ER/NOTCH4 interplay. We propose the early detection of HBD-ESR1 mutations as a challenge in precision medicine strategy, suggesting the development of tailored-approaches (i.e. NOTCH inhibitors) to prevent disease development and metastatic spread in BC mutant-positive patients. Copyright © 2018 Elsevier B.V. All rights reserved.
Murata, Takayuki; Isomura, Hiroki; Yamashita, Yoriko; Toyama, Shigenori; Sato, Yoshitaka; Nakayama, Sanae; Kudoh, Ayumi; Iwahori, Satoko; Kanda, Teru; Tsurumi, Tatsuya
2009-06-20
The Epstein-Barr virus (EBV) BGLF4 gene product is the only protein kinase encoded by the virus genome. In order to elucidate its physiological roles in viral productive replication, we here established a BGLF4-knockout mutant and a revertant virus. While the levels of viral DNA replication of the deficient mutant were equivalent to those of the wild-type and the revertant, virus production was significantly impaired. Expression of the BGLF4 protein in trans fully complemented the low yield of the mutant virus, while expression of a kinase-dead (K102I) form of the protein failed to restore the virus titer. These results demonstrate that BGLF4 plays a significant role in production of infectious viruses and that the kinase activity is crucial.
Huang, Yongyi; Liu, Jianjun; Zhao, Yanhui; Jiang, Lizhen; Huang, Qin
2013-01-01
Sperm abnormalities are one of the main factors responsible for male infertility; however, their pathogenesis remains unclear. The role of microRNAs in the development of sperm abnormalities in infertile men has not yet been investigated. Here, we used human induced pluripotent stem cells to investigate the influence of miR-122 expression on the differentiation of these cells into spermatozoa-like cells in vitro. After induction, mutant miR-122-transfected cells formed spermatozoa-like cells. Flow cytometry of DNA content revealed a significant increase in the haploid cell population in spermatozoa-like cells derived from mutant miR-122-transfected cells as compared to those derived from miR-122-transfected cells. During induction, TNP2 and protamine mRNA and protein levels were significantly higher in mutant miR-122-transfected cells than in miR-122-transfected cells. High-throughput isobaric tags for relative and absolute quantification were used to identify and quantify the different protein expression levels in miR-122- and mutant miR-122-transfected cells. Among all the proteins analyzed, the expression of lipoproteins, for example, APOB and APOA1, showed the most significant difference between the two groups. This study illustrates that miR-122 expression is associated with abnormal sperm development. MiR-122 may influence spermatozoa-like cells by suppressing TNP2 expression and inhibiting the expression of proteins associated with sperm development. PMID:23327642
Liao, W; Bisgrove, B W; Sawyer, H; Hug, B; Bell, B; Peters, K; Grunwald, D J; Stainier, D Y
1997-01-01
The zebrafish cloche mutation affects both the endothelial and hematopoietic lineages at a very early stage (Stainier, D. Y. R., Weinstein, B. M., Detrich, H. W., Zon, L. I. and Fishman, M. C. (1995). Development 121, 3141-3150). The most striking vascular phenotype is the absence of endocardial cells from the heart. Microscopic examination of mutant embryos reveals the presence of endothelial-like cells in the lower trunk and tail regions while head vessels appear to be missing, indicating a molecular diversification of the endothelial lineage. Cell transplantation experiments show that cloche acts cell-autonomously within the endothelial lineage. To analyze further the role of cloche in regulating endothelial cell differentiation, we have examined the expression of flk-1 and tie, two receptor tyrosine kinase genes expressed early and sequentially in the endothelial lineage. In wild-type fish, flk-1-positive cells are found throughout the embryo and differentiate to form the nascent vasculature. In cloche mutants, flk-1-positive cells are found only in the lower trunk and tail regions, and this expression is delayed as compared to wild-type. Unlike the flk-1-positive cells in wild-type embryos, those in cloche mutants do not go on to express tie, suggesting that their differentiation is halted at an early stage. We also find that the cloche mutation is not linked to flk-1. These data indicate that cloche affects the differentiation of all endothelial cells and that it acts at a very early stage, either by directly regulating flk-1 expression or by controlling the differentiation of cells that normally develop to express flk-1. cloche mutants also have a blood deficit and their hematopoietic tissues show no expression of the hematopoietic transcription factor genes GATA-1 or GATA-2 at early stages. Because the appearance of distinct levels of flk-1 expression is delayed in cloche mutants, we examined GATA-1 expression at late embryonic stages and found some blood cell differentiation that appears to be limited to the region lined by the flk-1-expressing cells. The spatial restriction of blood in the ventroposterior-most region of cloche mutant embryos may be indicative of a ventral source of signal(s) controlling hematopoietic differentiation. In addition, the restricted colocalization of blood and endothelium in cloche mutants suggests that important interactions occur between these two lineages during normal development.
Gu, Wenyu; Farhan Ul Haque, Muhammad; Semrau, Jeremy D
2017-05-01
Methanotrophs or methane-oxidizing bacteria exhibit a unique 'copper-switch' where expression of two forms of methane monooxygenase (MMO) is controlled by the availability of copper. In the absence of copper, a cytoplasmic or soluble methane monooxygenase (sMMO) is expressed. In the presence of copper, a membrane-bound or particulate methane monooxygenase (pMMO) is expressed. These two forms of MMO have very different properties, and elucidation of the basis of the copper-switch is of significant interest as methanotrophs are becoming increasingly popular for the valorization of methane. Recently, it was suggested via characterization of a mutant of Methylosinus trichosporium OB3b that expresses sMMO in the presence of copper (smmoC mutant) that the copper-switch may be based on copCD. These genes encode for a periplasmic copper-binding protein and an inner membrane protein, respectively, and are used by other bacteria for copper uptake. Specific knockouts of copCD in M. trichosporium OB3b wild type, however, show that these genes are not part of the copper-switch in methanotrophs, nor do they appear to be critical for copper uptake. Rather, it appears that the constitutive expression of sMMO in the smmoC mutant of M. trichosporium OB3b may be due to multiple lesions as smmoC was generated via random chemical mutagenesis. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Shin, Hae-Young; Goto, Joy J.; Carp, Richard I.; Choi, Eun-Kyoung; Kim, Yong-Sun
2016-01-01
Prion diseases are infectious and fatal neurodegenerative diseases which require the cellular prion protein, PrPC, for development of diseases. The current study shows that the PrPC augments infectivity and plaque formation of a mouse endogenous retrovirus, MuLV. We have established four neuronal cell lines expressing mouse PrPC, PrP+/+; two express wild type PrPC (MoPrPwild) and the other two express mutant PrPC (MoPrPmut). Infection of neuronal cells from various PrP+/+ and PrP-/- (MoPrPKO) lines with MuLV yielded at least three times as many plaques in PrP+/+ than in PrP-/-. Furthermore, among the four PrP+/+ lines, one mutant line, P101L, had at least 2.5 times as many plaques as the other three PrP+/+ lines. Plaques in P101L were four times larger than those in other PrP+/+ lines. Colocalization of PrP and CAgag was seen in MuLV-infected PrP+/+ cells. In the PrP-MuLV interaction, the involvement of galectin-3 and -6 was observed by immunoprecipitation with antibody to PrPC. These results suggest that PrPC combined with galectin-3 and -6 can act as a receptor for MuLV. P101L, the disease form of mutant PrPC results suggest the genetic mutant form of PrPC may be more susceptible to viral infection. PMID:27936017
Expression and function of FGF10 in mammalian inner ear development
NASA Technical Reports Server (NTRS)
Pauley, Sarah; Wright, Tracy J.; Pirvola, Ulla; Ornitz, David; Beisel, Kirk; Fritzsch, Bernd
2003-01-01
We have investigated the expression of FGF10 during ear development and the effect of an FGF10 null mutation on ear development. Our in situ hybridization data reveal expression of FGF10 in all three canal crista sensory epithelia and the cochlea anlage as well as all sensory neurons at embryonic day 11.5 (E11.5). Older embryos (E18.5) displayed strong graded expression in all sensory epithelia. FGF10 null mutants show complete agenesis of the posterior canal crista and the posterior canal. The posterior canal sensory neurons form initially and project rather normally by E11.5, but they disappear within 2 days. FGF10 null mutants have no posterior canal system at E18.5. In addition, these mutants have deformations of the anterior and horizontal cristae, reduced formation of the anterior and horizontal canals, as well as altered position of the remaining sensory epithelia with respect to the utricle. Hair cells form but some have defects in their cilia formation. No defects were detected in the organ of Corti at the cellular level. Together these data suggest that FGF10 plays a major role in ear morphogenesis. Most of these data are consistent with earlier findings on a null mutation in FGFR2b, one of FGF10's main receptors. Copyright 2003 Wiley-Liss, Inc.
Implications of fALS Mutations on Sod1 Function and Oligomerization in Cell Models.
Brasil, Aline A; Magalhães, Rayne S S; De Carvalho, Mariana D C; Paiva, Isabel; Gerhardt, Ellen; Pereira, Marcos D; Outeiro, Tiago F; Eleutherio, Elis C A
2018-06-01
Among the familial forms of amyotrophic lateral sclerosis (fALS), 20% are associated with the Cu,Zn-superoxide dismutase (Sod1). fALS is characterized by the accumulation of aggregated proteins and the increase in oxidative stress markers. Here, we used the non-invasive bimolecular fluorescence complementation (BiFC) assay in human H4 cells to investigate the kinetics of aggregation and subcellular localization of Sod1 mutants. We also studied the effect of the different Sod1 mutants to respond against oxidative stress by following the levels of reactive oxygen species (ROS) after treatment with hydrogen peroxide. Our results showed that only 30% of cells transfected with A4VSod1 showed no inclusions while for the other Sod1 mutants tested (L38V, G93A and G93C), this percentage was at least 70%. In addition, we found that 10% of cells transfected with A4VSod1 displayed more than five inclusions per cell and that A4V and G93A Sod1 formed inclusions more rapidly than L38V and G93C Sod1. Expression of WTSod1 significantly decreased the intracellular oxidation levels in comparison with expression of fALS Sod1 mutants, suggesting the mutations induce a functional impairment. All fALS mutations impaired nuclear localization of Sod1, which is important for maintaining genomic stability. Consistently, expression of WTSod1, but not of fALS Sod1 mutants, reduced DNA damage, as measured by the comet assay. Altogether, our study sheds light into the effects of fALS Sod1 mutations on inclusion formation, dynamics, and localization as well as on antioxidant response, opening novel avenues for investigating the role of fALS Sod1 mutations in pathogenesis.
Lakhal-Naouar, Ines; Jardim, Armando; Strasser, Rona; Luo, Shen; Kozakai, Yukiko; Nakhasi, Hira L.; Duncan, Robert C.
2012-01-01
Background Gene expression analysis in Leishmania donovani (Ld) identified an orthologue of the urea cycle enzyme, argininosuccinate synthase (LdASS), that was more abundantly expressed in amastigotes than in promastigotes. In order to characterize in detail this newly identified protein in Leishmania, we determined its enzymatic activity, subcellular localization in the parasite and affect on virulence in vivo. Methodology/Principal Findings Two parasite cell lines either over expressing wild type LdASS or a mutant form (G128S) associated with severe cases of citrullinemia in humans were developed. In addition we also produced bacterially expressed recombinant forms of the same proteins. Our results demonstrated that LdASS has argininosuccinate synthase enzymatic activity that is abolished using an ASS specific inhibitor (MDLA: methyl-D-L-Aspartic acid). However, the mutant form of the protein is inactive. We demonstrate that though LdASS has a glycosomal targeting signal that binds the targeting apparatus in vitro, only a small proportion of the total cellular ASS is localized in a vesicle, as indicated by protection from protease digestion of the crude organelle fraction. The majority of LdASS was found to be in the cytosolic fraction that may include large cytosolic complexes as indicated by the punctate distribution in IFA. Surprisingly, comparison to known glycosomal proteins by IFA revealed that LdASS was located in a structure different from the known glycosomal vesicles. Significantly, parasites expressing a mutant form of LdASS associated with a loss of in vitro activity had reduced virulence in vivo in BALB/c mice as demonstrated by a significant reduction in the parasite load in spleen and liver. Conclusion/Significance Our study suggests that LdASS is an active enzyme, with unique localization and essential for parasite survival and growth in the mammalian host. Based on these observations LdASS could be further explored as a potential drug target. PMID:23094117
Involvement of Clostridium botulinum ATCC 3502 Sigma Factor K in Early-Stage Sporulation
Kirk, David G.; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu
2012-01-01
A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σK is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods. PMID:22544236
Involvement of Clostridium botulinum ATCC 3502 sigma factor K in early-stage sporulation.
Kirk, David G; Dahlsten, Elias; Zhang, Zhen; Korkeala, Hannu; Lindström, Miia
2012-07-01
A key survival mechanism of Clostridium botulinum, the notorious neurotoxic food pathogen, is the ability to form heat-resistant spores. While the genetic mechanisms of sporulation are well understood in the model organism Bacillus subtilis, nothing is known about these mechanisms in C. botulinum. Using the ClosTron gene-knockout tool, sigK, encoding late-stage (stage IV) sporulation sigma factor K in B. subtilis, was disrupted in C. botulinum ATCC 3502 to produce two different mutants with distinct insertion sites and orientations. Both mutants were unable to form spores, and their elongated cell morphology suggested that the sporulation pathway was blocked at an early stage. In contrast, sigK-complemented mutants sporulated successfully. Quantitative real-time PCR analysis of sigK in the parent strain revealed expression at the late log growth phase in the parent strain. Analysis of spo0A, encoding the sporulation master switch, in the sigK mutant and the parent showed significantly reduced relative levels of spo0A expression in the sigK mutant compared to the parent strain. Similarly, sigF showed significantly lower relative transcription levels in the sigK mutant than the parent strain, suggesting that the sporulation pathway was blocked in the sigK mutant at an early stage. We conclude that σ(K) is essential for early-stage sporulation in C. botulinum ATCC 3502, rather than being involved in late-stage sporulation, as reported for the sporulation model organism B. subtilis. Understanding the sporulation mechanism of C. botulinum provides keys to control the public health risks that the spores of this dangerous pathogen cause through foods.
Effect of the luxS gene on biofilm formation and antibiotic resistance by Salmonella serovar Dublin.
Ju, Xiangyu; Li, Junjie; Zhu, Mengjiao; Lu, Zhaoxin; Lv, Fengxia; Zhu, Xiaoyu; Bie, Xiaomei
2018-05-01
Biofilms are communities of bacterial cells that serve to protect them from external adverse influences and enhance bacterial resistance to antibiotics and sanitizers. Here, we studied the regulatory effects of glucose and sodium chloride on biofilm formation in Salmonella serovar Dublin (S. Dublin). To analyze expression levels of the quorum sensing gene luxS, we created a luxS knockout mutant. Also, antimicrobial resistance, hydrophobicity and autoinducer-2 (AI-2) activity of both the wild-type (WT) and the mutant strain were investigated. Our results revealed that glucose was not essential for S. Dublin biofilm formation but had an inhibitory effect on biofilm formation when the concentration was over 0.1%. NaCl was found to be indispensable in forming biofilm, and it also exerted an inhibitory effect at high concentrations (>1.0%). Both the WT and the mutant strains displayed significant MIC growth after biofilm formation. An increase of up to 32,768 times in the resistance of S. Dublin in biofilm phonotype against antibiotic (ampicillin) compared to its planktonic phonotype was observed. However, S. Dublin luxS knockout mutant only showed slight differences compared to the WT strain in the antimicrobial tests although it displayed better biofilm-forming capacity than the WT strain. The mutant strain also exhibited higher hydrophobicity than the WT strain, which was a feature related to biofilm formation. The production of the quorum sensing autoinducer-2 (AI-2) was significantly lower in the mutant strain than in the WT strain since the LuxS enzyme, encoded by the luxS gene, plays an essential role in AI-2 synthesis. However, the limited biofilm-forming ability in the WT strain indicated AI-2 was not directly related to S. Dublin biofilm formation. Furthermore, gene expression analysis of the WT and mutant strains revealed upregulation of genes related to biofilm stress response and enhanced resistance in the luxS mutant strain, which may provide evidence for the regulatory role of the luxS gene in biofilm formation. Copyright © 2018 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Busch, Albert; Kiel, Tilman; Heupel, Wolfgang-M.
Lamins, which form the nuclear lamina, not only constitute an important determinant of nuclear architecture, but additionally play essential roles in many nuclear functions. Mutations in A-type lamins cause a wide range of human genetic disorders (laminopathies). The importance of lamin A (LaA) in the spatial arrangement of nuclear pore complexes (NPCs) prompted us to study the role of LaA mutants in nuclear protein transport. Two mutants, causing prenatal skin disease restrictive dermopathy (RD) and the premature aging disease Hutchinson Gilford progeria syndrome, were used for expression in HeLa cells to investigate their impact on the subcellular localization of NPC-associatedmore » proteins and nuclear protein import. Furthermore, dynamics of the LaA mutants within the nuclear lamina were studied. We observed affected localization of NPC-associated proteins, diminished lamina dynamics for both LaA mutants and reduced nuclear import of representative cargo molecules. Intriguingly, both LaA mutants displayed similar effects on nuclear morphology and functions, despite their differences in disease severity. Reduced nuclear protein import was also seen in RD fibroblasts and impaired lamina dynamics for the nucleoporin Nup153. Our data thus represent the first study of a direct link between LaA mutant expression and reduced nuclear protein import.« less
Yang, Chunxing; Danielson, Eric W.; Qiao, Tao; Metterville, Jake; Brown, Robert H.; Landers, John E.; Xu, Zuoshang
2016-01-01
Mutations in the profilin 1 (PFN1) gene cause amyotrophic lateral sclerosis (ALS), a neurodegenerative disease caused by the loss of motor neurons leading to paralysis and eventually death. PFN1 is a small actin-binding protein that promotes formin-based actin polymerization and regulates numerous cellular functions, but how the mutations in PFN1 cause ALS is unclear. To investigate this problem, we have generated transgenic mice expressing either the ALS-associated mutant (C71G) or wild-type protein. Here, we report that mice expressing the mutant, but not the wild-type, protein had relentless progression of motor neuron loss with concomitant progressive muscle weakness ending in paralysis and death. Furthermore, mutant, but not wild-type, PFN1 forms insoluble aggregates, disrupts cytoskeletal structure, and elevates ubiquitin and p62/SQSTM levels in motor neurons. Unexpectedly, the acceleration of motor neuron degeneration precedes the accumulation of mutant PFN1 aggregates. These results suggest that although mutant PFN1 aggregation may contribute to neurodegeneration, it does not trigger its onset. Importantly, these experiments establish a progressive disease model that can contribute toward identifying the mechanisms of ALS pathogenesis and the development of therapeutic treatments. PMID:27681617
Aoshima, Ryota; Hiraoka, Rieko; Shimada, Nao; Kawata, Takefumi
2006-01-01
A Dd-STATa-null mutant, which is defective in expression of a Dictyostelium homologue of the metazoan STAT (signal transducers and activators of transcription) proteins, fails to culminate and this phenotype correlates with the loss of expression of various prestalk (pst) genes. An EST clone, SSK395, encodes a close homologue of the adducin amino-terminal head domain and harbors a putative actin-binding domain. We fused promoter fragments of the cognate gene, ahhA (adducin head homologue A), to a lacZ reporter and determined their expression pattern. The proximal promoter region is necessary for the expression of ahhA at an early (pre-aggregative) stage of development and this expression is Dd-STATa independent. The distal promoter region is necessary for expression at later stages of development in pstA cells, of the slug and in upper cup and pstAB cells during culmination. The distal region is partly Dd-STATa-dependent. The ahhA-null mutant develops almost normally until culmination, but it forms slanting culminants that tend to collapse on to the substratum. The mutant also occasionally forms fruiting bodies with swollen papillae and with constrictions in the prestalk region. The AhhA protein localizes to the stalk tube entrance and also to the upper cup cells and in cells at or near to the constricted region where an F-actin ring is localized. These findings suggest that Dd-STATa regulates culmination and may be necessary for straight downward elongation of the stalk, via the putative actin-binding protein AhhA.
Resistance to collagen-induced arthritis in SHPS-1 mutant mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Okuzawa, Chie; Kaneko, Yoriaki; Murata, Yoji
SHPS-1 is a transmembrane protein that binds the protein tyrosine phosphatases SHP-1 and SHP-2 through its cytoplasmic region and is abundantly expressed on dendritic cells and macrophages. Here we show that mice expressing a mutant form of SHPS-1 fail to develop type-II collagen (CII)-induced arthritis (CIA), a model for rheumatoid arthritis in humans. Histological examinations of the arthritic paws from immunized wild-type mice revealed that cartilage was destroyed in association with marked mononuclear cell infiltration, while only mild cell infiltration was observed in immunized SHPS-1 mutant mice. Consistently, the serum levels of both IgG and IgG2a specific to CII andmore » of IL-1{beta} in immunized SHPS-1 mutant mice were markedly reduced compared with those apparent for wild-type mice. The CII-induced proliferation of, and production of cytokines by, T cells from immunized SHPS-1 mutant mice were reduced compared to wild-type cells. These results suggest that SHPS-1 is essential for development of CIA.« less
Baker, Stefanie H.; Jin, Songmu; Aldrich, Henry C.; Howard, Gary T.; Shively, Jessup M.
1998-01-01
It has been previously established that Thiobacillus neapolitanus fixes CO2 by using a form I ribulose bisphosphate carboxylase/oxygenase (RuBisCO), that much of the enzyme is sequestered into carboxysomes, and that the genes for the enzyme, cbbL and cbbS, are part of a putative carboxysome operon. In the present study, cbbL and cbbS were cloned and sequenced. Analysis of RNA showed that cbbL and cbbS are cotranscribed on a message approximately 2,000 nucleotides in size. The insertion of a kanamycin resistance cartridge into cbbL resulted in a premature termination of transcription; a polar mutant was generated. The mutant is able to fix CO2, but requires a CO2 supplement for growth. Separation of cellular proteins from both the wild type and the mutant on sucrose gradients and subsequent analysis of the RuBisCO activity in the collected fractions showed that the mutant assimilates CO2 by using a form II RuBisCO. This was confirmed by immunoblot analysis using antibodies raised against form I and form II RuBisCOs. The mutant does not possess carboxysomes. Smaller, empty inclusions are present, but biochemical analysis indicates that if they are carboxysome related, they are not functional, i.e., do not contain RuBisCO. Northern analysis showed that some of the shell components of the carboxysome are produced, which may explain the presence of these inclusions in the mutant. PMID:9696760
García, Isaac E.; Maripillán, Jaime; Jara, Oscar; Ceriani, Ricardo; Palacios-Muñoz, Angelina; Ramachandran, Jayalakshimi; Olivero, Pablo; Pérez-Acle, Tomás; González, Carlos; Sáez, Juan C.; Contreras, Jorge E.; Martínez, Agustín D.
2015-01-01
Mutations in Cx26 gene are found in most cases of human genetic deafness. Some mutations produce syndromic deafness associated with skin disorders, like Keratitis Ichthyosis Deafness syndrome (KID). Because in the human skin Cx26 is co-expressed with other connexins, like Cx43 and Cx30, and since KID syndrome is inherited as autosomal dominant condition, it is possible that KID mutations change the way Cx26 interacts with other co-expressed connexins. Indeed, some Cx26 syndromic mutations showed gap junction dominant negative effect when co-expressed with wild type connexins, including Cx26 and Cx43. The nature of these interactions and the consequences on hemichannels and gap junction channels functions remain unknown. In this study we demonstrate that syndromic mutations at the N-terminus segment of Cx26, change connexin oligomerization compatibility, allowing aberrant interactions with Cx43. Strikingly, heteromeric oligomer formed by Cx43/Cx26 (syndromic mutants) show exacerbated hemichannel activity, but nonfunctional gap junction channels; this also occurs for those Cx26 KID mutants that do not show functional homomeric hemichannels. Heterologous expression of these hyperactive heteromeric hemichannels increases cell membrane permeability, favoring ATP release and Ca2+ overload. The functional paradox produced by oligomerization of Cx43 and Cx26 KID mutants could underlie the severe syndromic phenotype in human skin. PMID:25625422
A Mutant Connexin50 with Enhanced Hemichannel Function Leads to Cell Death
Minogue, Peter J.; Tong, Jun-Jie; Arora, Anita; Russell-Eggitt, Isabelle; Hunt, David M.; Moore, Anthony T.; Ebihara, Lisa; Beyer, Eric C.; Berthoud, Viviana M.
2009-01-01
PURPOSE To determine the consequences of expression of a novel connexin50 (CX50) mutant identified in a child with congenital total cataracts. METHODS The GJA8 gene was directly sequenced. Formation of functional channels was assessed by two-microelectrode voltage-clamp. Connexin protein levels and distribution were assessed by immunoblotting and immunofluorescence. The proportion of apoptotic cells was determined by flow cytometry. RESULTS Direct sequencing of the GJA8 gene identified a 137 G>T transition that resulted in the replacement of glycine by valine at position 46 of the coding region of CX50 (CX50G46V). Both CX50 and CX50G46V induced gap junctional currents in pairs of Xenopus oocytes. In single Xenopus oocytes, CX50G46V induced connexin hemichannel currents that were activated by removal of external calcium; their magnitudes were much higher than those in oocytes injected with similar amounts of CX50 cRNA. When expressed in HeLa cells under the control of an inducible promoter, both CX50 and CX50G46V formed gap junctional plaques. Induction of CX50G46V expression led to a decrease in cell number and an increase in the proportion of apoptotic cells. CX50G46V-induced cell death was prevented by high concentrations of extracellular calcium ions. CONCLUSIONS Unlike previously characterized CX50 mutants that exhibit impaired trafficking and/or lack of function, CX50G46V traffics properly to the plasma membrane and forms functional hemichannels and gap junction channels; however, it causes cell death even when expressed at minute levels. The biochemical results indirectly suggest a potential novel mechanism by which connexin mutants could lead to cataracts: cytotoxicity due to enhanced hemichannel function. PMID:19684000
Golsaz Shirazi, Forough; Amiri, Mohammad Mehdi; Mohammadi, Hamed; Bayat, Ali Ahmad; Roohi, Azam; Khoshnoodi, Jalal; Zarnani, Amir Hassan; Jeddi-Tehrani, Mahmood; Kardar, Gholam Ali; Shokri, Fazel
2013-09-01
The antibody response to hepatitis B surface antigen (HBsAg) controls hepatitis B virus infection. The "a" determinant of HBsAg is the most important target for protective antibody response, diagnosis and immunoprophylaxis. Mutations in this area may induce immune escape mutants and affect the performance of HBsAg assays. To construct clinically relevant recombinant mutant forms of HBsAg and assessment of their reactivity with anti-HBs monoclonal antibodies (MAbs). Wild type (wt) and mutant (mt) HBsAg genes were constructed by site directed mutagenesis and SEOing PCR. The amplified genes were inserted into pCMV6-neo plasmid and transfected in CHO cell line. The expression of wt- and mtHBsAg was assessed by commercial ELISA assays and stable cells were established and cloned by limiting dilution. The recombinant mutants were further characterized using a panel of anti-HBs monoclonal antibodies (MAbs) and the pattern of their reactivity was assessed by ELISA. Ten HBsAg mutants having single mutation within the "a" determinant including P120E, T123N, Q129H, M133L, K141E, P142S, D144A, G145R, N146S and C147S together with a wt form were successfully constructed and expressed in CHO cells. Reactivity of anti-HBs MAbs with mtHBsAgs displayed different patterns. The effect of mutations on antibody binding differed depending on the amino acid involved and its location within the ''a'' determinant. Mutation at amino acids 123 and 145 resulted in either complete loss or significant reduction of binding to all anti-HBs MAbs. Our panel of mtHBsAgs is a valuable tool for assessment of the antibody response to HBV escape mutants and may have substantial implications in HBV immunological diagnostics.
Azetsu, Yuki; Inohaya, Keiji; Takano, Yoshiro; Kinoshita, Masato; Tasaki, Mai; Kudo, Akira
2017-11-15
Sp7 is a zinc finger transcription factor that is essential for osteoblast differentiation in mammals. To verify the characteristic features of osteoblast-lineage cells in teleosts, we established medaka sp7 mutants using a transcription activator-like effector nuclease (TALEN) genome editing system. These mutants showed severe defects in the formation of skeletal structures. In particular, the neural and the hemal arches were not formed, although the chordal centra were formed. Analysis of the transgenic medaka revealed that sp7 mutant had normal distribution of type X collagen a1 a (col10a1a)-positive osteoblast-like cells around the centrum and at the proximal region of the vertebral arch. The sp7 mutant phenotype could be rescued by exogenous sp7 expression in col10a1a-positive cells, as well as in sp7-positive osteoblast cells. Furthermore, runx2-positive osteoblast progenitors were observed on the vertebral arches, but not on the centrum, during vertebral column development. In addition, these osteoblast progenitors differentiated into the col10a1a-positive cells. In sp7 mutant, the runx2-positive cells were normally distributed at the region of unformed vertebral arch but failed to differentiate into col10a1a-positive cells. These results indicate that osteoblast-lineage cells undergo two distinct differentiation processes during development of the vertebral arch and the centrum. Nevertheless, our results verified that sp7 gene expression in osteoblast-lineage cells is required for differentiation into mature osteoblasts to form the vertebral column and other skeletal structures. Copyright © 2017 Elsevier Inc. All rights reserved.
Burnat, Mireia; Flores, Enrique
2014-10-01
Arginine decarboxylase produces agmatine, and arginase and agmatinase are ureohydrolases that catalyze the production of ornithine and putrescine from arginine and agmatine, respectively, releasing urea. In the genome of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, ORF alr2310 putatively encodes an ureohydrolase. Cells of Anabaena supplemented with [(14) C]arginine took up and catabolized this amino acid generating a set of labeled amino acids that included ornithine, proline, and glutamate. In an alr2310 deletion mutant, an agmatine spot appeared and labeled glutamate increased with respect to the wild type, suggesting that Alr2310 is an agmatinase rather than an arginase. As determined in cell-free extracts, agmatinase activity could be detected in the wild type but not in the mutant. Thus, alr2310 is the Anabaena speB gene encoding agmatinase. The ∆alr2310 mutant accumulated large amounts of cyanophycin granule polypeptide, lacked nitrogenase activity, and did not grow diazotrophically. Growth tests in solid media showed that agmatine is inhibitory for Anabaena, especially under diazotrophic conditions, suggesting that growth of the mutant is inhibited by non-metabolized agmatine. Measurements of incorporation of radioactivity from [(14) C]leucine into macromolecules showed, however, a limited inhibition of protein synthesis in the ∆alr2310 mutant. Analysis of an Anabaena strain producing an Alr2310-GFP (green fluorescent protein) fusion showed expression in vegetative cells but much less in heterocysts, implying compartmentalization of the arginine decarboxylation pathway in the diazotrophic filaments of this heterocyst-forming cyanobacterium. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Johnson, Jeremiah G; Murphy, Caitlin N; Sippy, Jean; Johnson, Tylor J; Clegg, Steven
2011-07-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression.
Johnson, Jeremiah G.; Murphy, Caitlin N.; Sippy, Jean; Johnson, Tylor J.; Clegg, Steven
2011-01-01
Klebsiella pneumoniae is an opportunistic pathogen which frequently causes hospital-acquired urinary and respiratory tract infections. K. pneumoniae may establish these infections in vivo following adherence, using the type 3 fimbriae, to indwelling devices coated with extracellular matrix components. Using a colony immunoblot screen, we identified transposon insertion mutants which were deficient for type 3 fimbrial surface production. One of these mutants possessed a transposon insertion within a gene, designated mrkI, encoding a putative transcriptional regulator. A site-directed mutant of this gene was constructed and shown to be deficient for fimbrial surface expression under aerobic conditions. MrkI mutants have a significantly decreased ability to form biofilms on both abiotic and extracellular matrix-coated surfaces. This gene was found to be cotranscribed with a gene predicted to encode a PilZ domain-containing protein, designated MrkH. This protein was found to bind cyclic-di-GMP (c-di-GMP) and regulate type 3 fimbrial expression. PMID:21571997
2011-01-01
Background Well differentiated papillary mesothelioma of the peritoneum (WDPMP) is a rare variant of epithelial mesothelioma of low malignancy potential, usually found in women with no history of asbestos exposure. In this study, we perform the first exome sequencing of WDPMP. Results WDPMP exome sequencing reveals the first somatic mutation of E2F1, R166H, to be identified in human cancer. The location is in the evolutionarily conserved DNA binding domain and computationally predicted to be mutated in the critical contact point between E2F1 and its DNA target. We show that the R166H mutation abrogates E2F1's DNA binding ability and is associated with reduced activation of E2F1 downstream target genes. Mutant E2F1 proteins are also observed in higher quantities when compared with wild-type E2F1 protein levels and the mutant protein's resistance to degradation was found to be the cause of its accumulation within mutant over-expressing cells. Cells over-expressing wild-type E2F1 show decreased proliferation compared to mutant over-expressing cells, but cell proliferation rates of mutant over-expressing cells were comparable to cells over-expressing the empty vector. Conclusions The R166H mutation in E2F1 is shown to have a deleterious effect on its DNA binding ability as well as increasing its stability and subsequent accumulation in R166H mutant cells. Based on the results, two compatible theories can be formed: R166H mutation appears to allow for protein over-expression while minimizing the apoptotic consequence and the R166H mutation may behave similarly to SV40 large T antigen, inhibiting tumor suppressive functions of retinoblastoma protein 1. PMID:21955916
Mutant TDP-43 in motor neurons promotes the onset and progression of ALS in rats
Huang, Cao; Tong, Jianbin; Bi, Fangfang; Zhou, Hongxia; Xia, Xu-Gang
2011-01-01
Amyotrophic lateral sclerosis (ALS) is characterized by progressive motor neuron degeneration, which ultimately leads to paralysis and death. Mutation of TAR DNA binding protein 43 (TDP-43) has been linked to the development of an inherited form of ALS. Existing TDP-43 transgenic animals develop a limited loss of motor neurons and therefore do not faithfully reproduce the core phenotype of ALS. Here, we report the creation of multiple lines of transgenic rats in which expression of ALS-associated mutant human TDP-43 is restricted to either motor neurons or other types of neurons and skeletal muscle and can be switched on and off. All of these rats developed progressive paralysis reminiscent of ALS when the transgene was switched on. Rats expressing mutant TDP-43 in motor neurons alone lost more spinal motor neurons than rats expressing the disease gene in varying neurons and muscle cells, although these rats all developed remarkable denervation atrophy of skeletal muscles. Intriguingly, progression of the disease was halted after transgene expression was switched off; in rats with limited loss of motor neurons, we observed a dramatic recovery of motor function, but in rats with profound loss of motor neurons, we only observed a moderate recovery of motor function. Our finding suggests that mutant TDP-43 in motor neurons is sufficient to promote the onset and progression of ALS and that motor neuron degeneration is partially reversible, at least in mutant TDP-43 transgenic rats. PMID:22156203
Ozgul, Sinem; Kasap, Murat; Akpinar, Gurler; Kanli, Aylin; Güzel, Nil; Karaosmanoglu, Kübra; Baykal, Ahmet Tarik; Iseri, Pervin
2015-01-01
Parkin is an E3-protein ubiquitin ligase, which plays an important role as a scavenger in cell metabolism. Since the discovery of the link between Parkin and Parkinson's disease, Parkin was placed in the center of Parkinson's disease research. Previously, we isolated a mutant form of the Parkin protein (Q311R and A371T) from a Parkinson's disease patient. In this study, we aimed at characterizing this mutant Parkin protein by using biochemical and proteomic approaches. We used neuroblastoma cells (SH-SY5Y) as our model and created two inducible cell lines that expressed the wild type and the mutant Parkin proteins. We first investigated the effect of expressing both the wild type and the mutant Parkin proteins on the overall proteome by using 2D-DIGE approach. The experiments yielded the identification of 22 differentially regulated proteins, of which 13 were regulated in the mutant Parkin expressing cells. Classification of the identified proteins based on biological process and molecular function revealed that the majority of the regulated proteins belonged to protein folding and energy metabolism. Ingenuity Pathway Analysis predicted the presence of a link between the regulated proteins of the mutant Parkin expressing cells and Parkinson's disease. We also performed biochemical characterization studies on the wild type and the mutant Parkin proteins to make sense out of the differences observed at the proteome level. Both proteins displayed biological activity, had similar stabilities and localized similarly to the cytoplasm and the nucleus in SH-SY5Y cells. The mutant protein, however, was cut by a protease and subjected to a post-translational modification. The observed differences at the proteome level might be due to the differences in processing of the mutant Parkin protein. Overall, we were able to create a possible link between a pair of Parkin mutations to its pertinent disease by using 2D-DIGE in combination with biochemical and molecular approaches. Copyright © 2015 Elsevier Ltd. All rights reserved.
Wang, Min-Cheng; Liaw, Shwu-Jen
2014-01-01
Hfq is a bacterial RNA chaperone involved in the riboregulation of diverse genes via small noncoding RNAs. Here, we show that Hfq is critical for the uropathogenic Proteus mirabilis to effectively colonize the bladder and kidneys in a murine urinary tract infection (UTI) model and to establish burned wound infection of the rats. In this regard, we found the hfq mutant induced higher IL-8 and MIF levels of uroepithelial cells and displayed reduced intra-macrophage survival. The loss of hfq affected bacterial abilities to handle H2O2 and osmotic pressures and to grow at 50°C. Relative to wild-type, the hfq mutant had reduced motility, fewer flagella and less hemolysin expression and was less prone to form biofilm and to adhere to and invade uroepithelial cells. The MR/P fimbrial operon was almost switched to the off phase in the hfq mutant. In addition, we found the hfq mutant exhibited an altered outer membrane profile and had higher RpoE expression, which indicates the hfq mutant may encounter increased envelope stress. With the notion of envelope disturbance in the hfq mutant, we found increased membrane permeability and antibiotic susceptibilities in the hfq mutant. Finally, we showed that Hfq positively regulated the RpoS level and tolerance to H2O2 in the stationary phase seemed largely mediated through the Hfq-dependent RpoS expression. Together, our data indicate that Hfq plays a critical role in P. mirabilis to establish UTIs by modulating stress responses, surface structures and virulence factors. This study suggests Hfq may serve as a scaffold molecule for development of novel anti-P. mirabilis drugs and P. mirabilis hfq mutant is a vaccine candidate for preventing UTIs. PMID:24454905
Characterization of the R162W Kir7.1 mutation associated with snowflake vitreoretinopathy
Zhang, Wei; Zhang, Xiaoming; Wang, Hui; Sharma, Anil K.; Edwards, Albert O.
2013-01-01
KCNJ13 encodes Kir7.1, an inwardly rectifying K+ channel that is expressed in multiple ion-transporting epithelia. A mutation in KCNJ13 resulting in an arginine-to-tryptophan change at residue 162 (R162W) of Kir7.1 was associated with snowflake vitreoretinal degeneration, an inherited autosomal-dominant disease characterized by vitreous degeneration and mild retinal degeneration. We used the Xenopus laevis oocyte expression system to assess the functional properties of the R162W (mutant) Kir7.1 channel and determine how wild-type (WT) Kir7.1 is affected by the presence of the mutant subunit. Recordings obtained via the two-electrode voltage-clamp technique revealed that injection of oocytes with mutant Kir7.1 cRNA resulted in currents and cation selectivity that were indistinguishable from those in water-injected oocytes, suggesting that the mutant protein does not form functional channels in the plasma membrane. Coinjection of oocytes with equal amounts of mutant and WT Kir7.1 cRNAs resulted in inward K+ and Rb+ currents with amplitudes that were ∼17% of those in oocytes injected with WT Kir7.1 cRNA alone, demonstrating a dominant-negative effect of the mutant subunit. Similar to oocytes injected with WT Kir7.1 cRNA alone, coinjected oocytes exhibited inwardly rectifying Rb+ currents that were more than seven times larger than K+ currents, indicating that mutant subunits did not alter Kir7.1 channel selectivity. Immunostaining of Xenopus oocytes or Madin-Darby canine kidney cells expressing mutant or WT Kir7.1 demonstrated distribution of both proteins primarily in the plasma membrane. Our data suggest that the R162W mutation suppresses Kir7.1 channel activity, possibly by negatively impacting gating by membrane phosphadidylinositol 4,5-bisphosphate. PMID:23255580
Role of PII proteins in nitrogen fixation control of Herbaspirillum seropedicae strain SmR1
2011-01-01
Background The PII protein family comprises homotrimeric proteins which act as transducers of the cellular nitrogen and carbon status in prokaryotes and plants. In Herbaspirillum seropedicae, two PII-like proteins (GlnB and GlnK), encoded by the genes glnB and glnK, were identified. The glnB gene is monocistronic and its expression is constitutive, while glnK is located in the nlmAglnKamtB operon and is expressed under nitrogen-limiting conditions. Results In order to determine the involvement of the H. seropedicae glnB and glnK gene products in nitrogen fixation, a series of mutant strains were constructed and characterized. The glnK- mutants were deficient in nitrogen fixation and they were complemented by plasmids expressing the GlnK protein or an N-truncated form of NifA. The nitrogenase post-translational control by ammonium was studied and the results showed that the glnK mutant is partially defective in nitrogenase inactivation upon addition of ammonium while the glnB mutant has a wild-type phenotype. Conclusions Our results indicate that GlnK is mainly responsible for NifA activity regulation and ammonium-dependent post-translational regulation of nitrogenase in H. seropedicae. PMID:21223584
Role of PII proteins in nitrogen fixation control of Herbaspirillum seropedicae strain SmR1.
Noindorf, Lilian; Bonatto, Ana C; Monteiro, Rose A; Souza, Emanuel M; Rigo, Liu U; Pedrosa, Fabio O; Steffens, Maria B R; Chubatsu, Leda S
2011-01-11
The PII protein family comprises homotrimeric proteins which act as transducers of the cellular nitrogen and carbon status in prokaryotes and plants. In Herbaspirillum seropedicae, two PII-like proteins (GlnB and GlnK), encoded by the genes glnB and glnK, were identified. The glnB gene is monocistronic and its expression is constitutive, while glnK is located in the nlmAglnKamtB operon and is expressed under nitrogen-limiting conditions. In order to determine the involvement of the H. seropedicae glnB and glnK gene products in nitrogen fixation, a series of mutant strains were constructed and characterized. The glnK- mutants were deficient in nitrogen fixation and they were complemented by plasmids expressing the GlnK protein or an N-truncated form of NifA. The nitrogenase post-translational control by ammonium was studied and the results showed that the glnK mutant is partially defective in nitrogenase inactivation upon addition of ammonium while the glnB mutant has a wild-type phenotype. Our results indicate that GlnK is mainly responsible for NifA activity regulation and ammonium-dependent post-translational regulation of nitrogenase in H. seropedicae.
Bryant, Kevin F; Yan, Zhipeng; Dreyfus, David H; Knipe, David M
2012-06-01
Herpes simplex virus 1 (HSV-1) ICP8 is a single-stranded DNA-binding protein that is necessary for viral DNA replication and exhibits recombinase activity in vitro. Alignment of the HSV-1 ICP8 amino acid sequence with ICP8 homologs from other herpesviruses revealed conserved aspartic acid (D) and glutamic acid (E) residues. Amino acid residue D1087 was conserved in every ICP8 homolog analyzed, indicating that it is likely critical for ICP8 function. We took a genetic approach to investigate the functions of the conserved ICP8 D and E residues in HSV-1 replication. The E1086A D1087A mutant form of ICP8 failed to support the replication of an ICP8 mutant virus in a complementation assay. E1086A D1087A mutant ICP8 bound DNA, albeit with reduced affinity, demonstrating that the protein is not globally misfolded. This mutant form of ICP8 was also recognized by a conformation-specific antibody, further indicating that its overall structure was intact. A recombinant virus expressing E1086A D1087A mutant ICP8 was defective in viral replication, viral DNA synthesis, and late gene expression in Vero cells. A class of enzymes called DDE recombinases utilize conserved D and E residues to coordinate divalent metal cations in their active sites. We investigated whether the conserved D and E residues in ICP8 were also required for binding metal cations and found that the E1086A D1087A mutant form of ICP8 exhibited altered divalent metal binding in an in vitro iron-induced cleavage assay. These results identify a novel divalent metal cation-binding site in ICP8 that is required for ICP8 functions during viral replication.
Yam, Gary Hin-Fai; Gaplovska-Kysela, Katarina; Zuber, Christian; Roth, Jürgen
2007-04-01
To evaluate the effect of chemical chaperones on the trafficking of secretion-incompetent primary open-angle glaucoma-associated mutant myocilin and the possibility to rescue cells coexpressing mutant and wild-type myocilin from endoplasmic reticulum (ER) stress and apoptosis. CHO-K1, HEK293 and human trabecular meshwork cells were transfected to express wild-type or mutant (C245Y, G364V, P370L, Y437H) myocilin-green fluorescent protein fusion protein and were treated or not with various chemical chaperones (glycerol, dimethylsulfoxide, or sodium 4-phenylbutyrate) for different time periods. The secretion, Triton X-100 solubility, and intracellular distribution of wild-type and mutant myocilin were analyzed by immunoprecipitation, Western blotting, and confocal double immunofluorescence. The effect of sodium 4-phenylbutyrate on ER stress proteins and apoptosis was examined in cells coexpressing mutant and wild-type myocilin. Treatment with sodium 4-phenylbutyrate, but not with glycerol or dimethylsulfoxide, reduced the amount of detergent-insoluble myocilin aggregates, diminished myocilin interaction with calreticulin, and restored the secretion of mutant myocilin. Heteromeric complexes formed by mutant and wild-type myocilin induced the ER stress-associated phosphorylated form of ER-localized eukaryotic initiation factor (eIF)-2alpha kinase and the active form of caspase 3, which resulted in an increased rate of apoptosis. Sodium 4-phenylbutyrate treatment of cells coexpressing mutant and wild-type myocilin relieved ER stress and significantly reduced the rate of apoptosis. These findings indicate that sodium 4-phenylbutyrate protects cells from the deleterious effects of ER-retained aggregated mutant myocilin. These data point to the possibility of a chemical chaperone treatment for myocilin-caused primary open-angle glaucoma.
Mundy, Christina; Yasuda, Tadashi; Kinumatsu, Takashi; Yamaguchi, Yu; Iwamoto, Masahiro; Enomoto-Iwamoto, Motomi; Koyama, Eiki; Pacifici, Maurizio
2011-03-01
Heparan sulfate proteoglycans (HSPGs) regulate a number of major developmental processes, but their roles in synovial joint formation remain unknown. Here we created conditional mouse embryo mutants lacking Ext1 in developing joints by mating Ext1(f/f) and Gdf5-Cre mice. Ext1 encodes a subunit of the Ext1/Ext2 Golgi-associated protein complex responsible for heparan sulfate (HS) synthesis. The proximal limb joints did form in the Gdf5-Cre;Ext1(f/f) mutants, but contained an uneven articulating superficial zone that expressed very low lubricin levels. The underlying cartilaginous epiphysis was deranged as well and displayed random patterns of cell proliferation and matrillin-1 and collagen IIA expression, indicative of an aberrant phenotypic definition of the epiphysis itself. Digit joints were even more affected, lacked a distinct mesenchymal interzone and were often fused likely as a result of local abnormal BMP and hedgehog activity and signaling. Interestingly, overall growth and lengthening of long bones were also delayed in the mutants. To test whether Ext1 function is needed for joint formation at other sites, we examined the spine. Indeed, entire intervertebral discs, normally composed by nucleus pulposus surrounded by the annulus fibrosus, were often missing in Gdf5-Cre;Ext1(f/f) mice. When disc remnants were present, they displayed aberrant organization and defective joint marker expression. Similar intervertebral joint defects and fusions occurred in Col2-Cre;β-catenin(f/f) mutants. The study provides novel evidence that local Ext1 expression and HS production are needed to maintain the phenotype and function of joint-forming cells and coordinate local signaling by BMP, hedgehog and Wnt/β-catenin pathways. The data indicate also that defects in joint formation reverberate on, and delay, overall long bone growth. Copyright © 2011 Elsevier Inc. All rights reserved.
A transcriptome analysis of two grapevine populations segregating for tendril phyllotaxy
Arro, Jie; Cuenca, Jose; Yang, Yingzhen; Liang, Zhenchang; Cousins, Peter; Zhong, Gan-Yuan
2017-01-01
The shoot structure of cultivated grapevine Vitis vinifera L. typically exhibits a three-node modular repetitive pattern, two sequential leaf-opposed tendrils followed by a tendril-free node. In this study, we investigated the molecular basis of this pattern by characterizing differentially expressed genes in 10 bulk samples of young tendril tissue from two grapevine populations showing segregation of mutant or wild-type shoot/tendril phyllotaxy. One population was the selfed progeny and the other one, an outcrossed progeny of a Vitis hybrid, ‘Roger’s Red’. We analyzed 13 375 expressed genes and carried out in-depth analyses of 324 of them, which were differentially expressed with a minimum of 1.5-fold changes between the mutant and wild-type bulk samples in both selfed and cross populations. A significant portion of these genes were direct cis-binding targets of 14 transcription factor families that were themselves differentially expressed. Network-based dependency analysis further revealed that most of the significantly rewired connections among the 10 most connected hub genes involved at least one transcription factor. TCP3 and MYB12, which were known important for plant-form development, were among these transcription factors. More importantly, TCP3 and MYB12 were found in this study to be involved in regulating the lignin gene PRX52, which is important to plant-form development. A further support evidence for the roles of TCP3-MYB12-PRX52 in contributing to tendril phyllotaxy was the findings of two other lignin-related genes uniquely expressed in the mutant phyllotaxy background. PMID:28713572
Dysfunction of outer segment guanylate cyclase caused by retinal disease related mutations
Zägel, Patrick; Koch, Karl-Wilhelm
2014-01-01
Membrane bound guanylate cyclases are expressed in rod and cone cells of the vertebrate retina and mutations in several domains of rod outer segment guanylate cyclase 1 (ROS-GC1 encoded by the gene GUCY2D) correlate with different forms of retinal degenerations. In the present work we investigated the biochemical consequences of three point mutations, one is located in position P575L in the juxtamembrane domain close to the kinase homology domain and two are located in the cyclase catalytic domain at H1019P and P1069R. These mutations correlate with various retinal diseases like autosomal dominant progressive cone degeneration, e.g., Leber Congenital Amaurosis and a juvenile form of retinitis pigmentosa. Wildtype and mutant forms of ROS-GC1 were heterologously expressed in HEK cells, their cellular distribution was investigated and activity profiles in the presence and absence of guanylate cyclase-activating proteins were measured. The mutant P575L was active under all tested conditions, but it displayed a twofold shift in the Ca2+-sensitivity, whereas the mutant P1069R remained inactive despite normal expression levels. The mutation H1019P caused the cyclase to become more labile. The different biochemical consequences of these mutations seem to reflect the different clinical symptoms. The mutation P575L induces a dysregulation of the Ca2+-sensitive cyclase activation profile causing a slow progression of the disease by the distortion of the Ca2+-cGMP homeostasis. In contrast, a strong reduction in cGMP synthesis due to an inactive or structurally unstable ROS-GC1 would trigger more severe forms of retinal diseases. PMID:24616660
Hepatitis B Virus Core Gene Mutations Which Block Nucleocapsid Envelopment
Koschel, Matthias; Oed, Daniela; Gerelsaikhan, Tudevdagwa; Thomssen, Reiner; Bruss, Volker
2000-01-01
Recently we generated a panel of hepatitis B virus core gene mutants carrying single insertions or deletions which allowed efficient expression of the core protein in bacteria and self-assembly of capsids. Eleven of these mutations were introduced into a eukaryotic core gene expression vector and characterized by trans complementation of a core-negative HBV genome in cotransfected human hepatoma HuH7 cells. Surprisingly, four mutants (two insertions [EFGA downstream of A11 and LDTASALYR downstream of R39] and two deletions [Y38-R39-E40 and L42]) produced no detectable capsids. The other seven mutants supported capsid formation and pregenome packaging/viral minus- and plus-strand-DNA synthesis but to different levels. Four of these seven mutants (two insertions [GA downstream of A11 and EHCSP downstream of P50] and two deletions [S44 and A80]) allowed virion morphogenesis and secretion. The mutant carrying a deletion of A80 at the tip of the spike protruding from the capsid was hepatitis B virus core antigen negative but wild type with respect to virion formation, indicating that this site might not be crucial for capsid-surface protein interactions during morphogenesis. The other three nucleocapsid-forming mutants (one insertion [LS downstream of S141] and two deletions [T12 and P134]) were strongly blocked in virion formation. The corresponding sites are located in the part of the protein forming the body of the capsid and not in the spike. These mutations may alter sites on the particle which contact surface proteins during envelopment, or they may block the appearance of a signal for the transport or the maturation of the capsid which is linked to viral DNA synthesis and required for envelopment. PMID:10590084
Marroquin-Guzman, Margarita; Wilson, Richard A.
2015-01-01
Fungal plant pathogens are persistent and global food security threats. To invade their hosts they often form highly specialized infection structures, known as appressoria. The cAMP/ PKA- and MAP kinase-signaling cascades have been functionally delineated as positive-acting pathways required for appressorium development. Negative-acting regulatory pathways that block appressorial development are not known. Here, we present the first detailed evidence that the conserved Target of Rapamycin (TOR) signaling pathway is a powerful inhibitor of appressorium formation by the rice blast fungus Magnaporthe oryzae. We determined TOR signaling was activated in an M. oryzae mutant strain lacking a functional copy of the GATA transcription factor-encoding gene ASD4. Δasd4 mutant strains could not form appressoria and expressed GLN1, a glutamine synthetase-encoding orthologue silenced in wild type. Inappropriate expression of GLN1 increased the intracellular steady-state levels of glutamine in Δasd4 mutant strains during axenic growth when compared to wild type. Deleting GLN1 lowered glutamine levels and promoted appressorium formation by Δasd4 strains. Furthermore, glutamine is an agonist of TOR. Treating Δasd4 mutant strains with the specific TOR kinase inhibitor rapamycin restored appressorium development. Rapamycin was also shown to induce appressorium formation by wild type and Δcpka mutant strains on non-inductive hydrophilic surfaces but had no effect on the MAP kinase mutant Δpmk1. When taken together, we implicate Asd4 in regulating intracellular glutamine levels in order to modulate TOR inhibition of appressorium formation downstream of cPKA. This study thus provides novel insight into the metabolic mechanisms that underpin the highly regulated process of appressorium development. PMID:25901357
Yamamoto, Ayako; Uchiyama, Koji; Nara, Tomoka; Nishimura, Naomichi; Hayasaka, Michiko; Hanaoka, Kazunori; Yamamoto, Tatsuro
2014-01-01
Spock3/Testican-3 is a nervous system-expressed heparan sulfate proteoglycan belonging to a subgroup of the BM-40/SPARC/osteonectin family, the role of which in brain development is unclear. Because Spock1, a member of the Spock family, inhibits their attachment to substrates and the neurite outgrowth of cultured neuronal cells, Spock3 is also thought to be similarly involved in the neuronal development. In the present study, we established a Spock3-mutant mouse harboring a deletion extending from the presumptive upstream regulatory region to exon 4 of the Spock3 locus and performed histological and behavioral studies on these mutant mice. In wild-type (WT) mice, all Spock members were clearly expressed during brain development. In adults, intense Spock1 and Spock2 expressions were observed throughout the entire brain; whereas, Spock3 expression was no longer visible except in the thalamic nuclei. Thus, Spock3 expression is mostly confined to the developmental stage of the brain. In adult mutant mice, the cells of all cortical layers were swollen. The corpus callosum was narrowed around the central region along the rostral-caudal axis and many small spaces were observed without myelin sheaths throughout the entire corpus callosum. In addition, the cortical input and output fibers did not form into thick bundled fibers as well as the WT counterparts did. Moreover, a subpopulation of corticospinal axonal fibers penetrated into the dorsal striatum with moderately altered orientations. Consistent with these modifications of brain structures, the mutant mice exhibited decreased anxiety-like behavior and lowered sociability. Together, these results demonstrate that Spock3 plays an important role in the formation or maintenance of major neuronal structures in the brain. © 2014 S. Karger AG, Basel.
Ikegami, Tetsuro; Won, Sungyong; Peters, C J; Makino, Shinji
2006-03-01
Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) has a tripartite negative-strand genome, causes a mosquito-borne disease that is endemic in sub-Saharan African countries and that also causes large epidemics among humans and livestock. Furthermore, it is a bioterrorist threat and poses a risk for introduction to other areas. In spite of its danger, neither veterinary nor human vaccines are available. We established a T7 RNA polymerase-driven reverse genetics system to rescue infectious clones of RVFV MP-12 strain entirely from cDNA, the first for any phlebovirus. Expression of viral structural proteins from the protein expression plasmids was not required for virus rescue, whereas NSs protein expression abolished virus rescue. Mutants of MP-12 partially or completely lacking the NSs open reading frame were viable. These NSs deletion mutants replicated efficiently in Vero and 293 cells, but not in MRC-5 cells. In the latter cell line, accumulation of beta interferon mRNA occurred after infection by these NSs deletion mutants, but not after infection by MP-12. The NSs deletion mutants formed larger plaques than MP-12 did in Vero E6 cells and failed to shut off host protein synthesis in Vero cells. An MP-12 mutant carrying a luciferase gene in place of the NSs gene replicated as efficiently as MP-12 did, produced enzymatically active luciferase during replication, and stably retained the luciferase gene after 10 virus passages, representing the first demonstration of foreign gene expression in any bunyavirus. This reverse genetics system can be used to study the molecular virology of RVFV, assess current vaccine candidates, produce new vaccines, and incorporate marker genes into animal vaccines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Satterlee, J.D.; Erman, J.E.; Mauro, J.M.
Proton NMR spectra of cytochrome c peroxidase (CcP) isolated from yeast (wild type) and two Escherichia coli expressed proteins, the parent expressed protein (CcP(MI)) and the site-directed mutant CcP(MI,D235N) (Asp-235 {yields} Asn-235), have been examined. At neutral pH and in the presence of only potassium phosphate buffer and potassium nitrate, wild-type Ccp and CcP(MI) demonstrate nearly identical spectra corresponding to normal (i.e., unaged) high-spin ferric peroxidase. In contrast, the mutant protein displays a spectrum characteristic of a low-spin form, probably a result of hydroxide ligation. Asp-235 is hydrogen-bonded to the proximal heme ligand, His-175. Changing Asp-235 to Asn results inmore » alteration of the pK for formation of the basic form of CcP. Thus, changes in proximal side structure mediate the chemistry of the distal ligand binding site. All three proteins bind F{sup {minus}}, N{sub 3}{sup {minus}}, and CN{sup {minus}} ions, although the affinity of the mutant protein (D235N) for fluoride ion appears to be much higher than that of the other two proteins. Analysis of proton NMR spectra of the cyanide ligated forms leads to the conclusion that the mutant protein (D235N) possesses a more neutral proximal histidine imidazole ring than does either wild-type CcP or CcP(MI). It confirms that an important feature of the cytochrome c peroxidase structure is at least partial, and probably full, imidazolate character for the proximal histidine (His-175).« less
Formation of virions is strictly required for turnip yellows virus long-distance movement in plants.
Hipper, Clémence; Monsion, Baptiste; Bortolamiol-Bécet, Diane; Ziegler-Graff, Véronique; Brault, Véronique
2014-02-01
Viral genomic RNA of the Turnip yellows virus (TuYV; genus Polerovirus; family Luteoviridae) is protected in virions formed by the major capsid protein (CP) and the minor component, the readthrough (RT*) protein. Long-distance transport, used commonly by viruses to systemically infect host plants, occurs in phloem sieve elements and two viral forms of transport have been described: virions and ribonucleoprotein (RNP) complexes. With regard to poleroviruses, virions have always been presumed to be the long-distance transport form, but the potential role of RNP complexes has not been investigated. Here, we examined the requirement of virions for polerovirus systemic movement by analysing CP-targeted mutants that were unable to form viral particles. We confirmed that TuYV mutants that cannot encapsidate into virions are not able to reach systemic leaves. To completely discard the possibility that the introduced mutations in CP simply blocked the formation or the movement of RNP complexes, we tested in trans complementation of TuYV CP mutants by providing WT CP expressed in transgenic plants. WT CP was able to facilitate systemic movement of TuYV CP mutants and this observation was always correlated with the formation of virions. This demonstrated clearly that virus particles are essential for polerovirus systemic movement.
Qiu, Z; Hobman, T C; McDonald, H L; Seto, N O; Gillam, S
1992-01-01
The role of N-linked glycosylation in processing and intracellular transport of rubella virus glycoprotein E2 has been studied by expressing glycosylation mutants of E2 in COS cells. A panel of E2 glycosylation mutants were generated by oligonucleotide-directed mutagenesis. Each of the three potential N-linked glycosylation sites was eliminated separately as well as in combination with the other two sites. Expression of the E2 mutant proteins in COS cells indicated that in rubella virus M33 strain, all three sites are used for the addition of N-linked oligosaccharides. Removal of any of the glycosylation sites resulted in slower glycan processing, lower stability, and aberrant disulfide bonding of the mutant proteins, with the severity of defect depending on the number of deleted carbohydrate sites. The mutant proteins were transported to the endoplasmic reticulum and Golgi complex but were not detected on the cell surface. However, the secretion of the anchor-free form of E2 into the medium was not completely blocked by the removal of any one of its glycosylation sites. This effect was dependent on the position of the deleted glycosylation site. Images PMID:1583721
Zwerger, Monika; Kolb, Thorsten; Richter, Karsten; Karakesisoglou, Iakowos; Herrmann, Harald
2010-01-15
Lamin B receptor (LBR) is an inner nuclear membrane protein involved in tethering the nuclear lamina and the underlying chromatin to the nuclear envelope. In addition, LBR exhibits sterol reductase activity. Mutations in the LBR gene cause two different human diseases: Pelger-Huët anomaly and Greenberg skeletal dysplasia, a severe chrondrodystrophy causing embryonic death. Our study aimed at investigating the effect of five LBR disease mutants on human cultured cells. Three of the tested LBR mutants caused a massive compaction of chromatin coincidental with the formation of a large nucleus-associated vacuole (NAV) in several human cultured cell lines. Live cell imaging and electron microscopy revealed that this structure was generated by the separation of the inner and outer nuclear membrane. During NAV formation, nuclear pore complexes and components of the linker of nucleoskeleton and cytoskeleton complex were lost in areas of membrane separation. Concomitantly, a large number of smaller vacuoles formed throughout the cytoplasm. Notably, forced expression of the two structurally related sterol reductases transmembrane 7 superfamily member 2 and 7-dehydrocholesterol reductase caused, even in their wild-type form, a comparable phenotype in susceptible cell lines. Hence, LBR mutant variants and sterol reductases can severely interfere with the regular organization of the nuclear envelope and the endoplasmic reticulum.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boulet, L.; Karpati, G.; Shoubridge, E.A.
1992-12-01
The authors investigated the distribution and expression of mutant mtDNAs carrying the A-to-G mutation at position 8344 in the tRNA[sup Lys] gene in the skeletal muscle of four patients with myoclonus epilepsy and ragged-red fibers (MERRF). The proportion of mutant genomes was greater than 80% of total mtDNAs in muscle samples of all patients and was associated with a decrease in the activity of cytochrome c oxidase (COX). The vast majority of myoblasts, cloned from the satellite-cell population in the same muscles, were homoplasmic for the mutation. The overall proportion of mutant mtDNAs in this population was similar to thatmore » in differentiated muscle, suggesting that the ratio of mutant to wild-type mtDNAs in skeletal muscle is determined either in the ovum or during early development and changes little with age. Translation of all mtDNA-encoded genes was severely depressed in homoplasmic mutant myoblast clones but not in heteroplasmic or wild-type clones. The threshold for biochemical expression of the mutation was determined in heteroplasmic myotubes formed by fusion of different proportions of mutant and wild-type myoblasts. The magnitude of the decrease in translation in myotubes containing mutant mtDNAs was protein specific. Complex I and IV subunits were more affected than complex V subunits, and there was a rough correlation with both protein size and number of lysine residues. Approximately 15% wild-type mtDNAs restored translation and COX activity to near normal levels. These results show that the A-to-G substitution in tRNA[sup Lys] is a functionally recessive mutation that can be rescued by intraorganellar complementation with a small proportion of wild-type mtDNAs and explain the steep threshold for expression of the MERRF clinical phenotype. 40 refs., 7 figs., 2 tabs.« less
Qualls, David A.; Crosby, Keith; Brown, Hilda; Borchelt, David R.
2013-01-01
Background By mechanisms yet to be discerned, the co-expression of high levels of wild-type human superoxide dismutase 1 (hSOD1) with variants of hSOD1 encoding mutations linked familial amyotrophic lateral sclerosis (fALS) hastens the onset of motor neuron degeneration in transgenic mice. Although it is known that spinal cords of paralyzed mice accumulate detergent insoluble forms of WT hSOD1 along with mutant hSOD1, it has been difficult to determine whether there is co-deposition of the proteins in inclusion structures. Methodology/Principal Findings In the present study, we use cell culture models of mutant SOD1 aggregation, focusing on the A4V, G37R, and G85R variants, to examine interactions between WT-hSOD1 and misfolded mutant SOD1. In these studies, we fuse WT and mutant proteins to either yellow or red fluorescent protein so that the two proteins can be distinguished within inclusions structures. Conclusions/Significance Although the interpretation of the data is not entirely straightforward because we have strong evidence that the nature of the fused fluorophores affects the organization of the inclusions that form, our data are most consistent with the idea that normal dimeric WT-hSOD1 does not readily interact with misfolded forms of mutant hSOD1. We also demonstrate the monomerization of WT-hSOD1 by experimental mutation does induce the protein to aggregate, although such monomerization may enable interactions with misfolded mutant SOD1. Our data suggest that WT-hSOD1 is not prone to become intimately associated with misfolded mutant hSOD1 within intracellular inclusions that can be generated in cultured cells. PMID:24391857
Zhang, Na; Yang, Li; Luo, Sha; Wang, Xutong; Wang, Wei; Cheng, Yuxin; Tian, Hainan; Zheng, Kaijie; Cai, Ling; Wang, Shucai
2018-04-13
Trichome formation in Arabidopsis is regulated by a MBW complex formed by MYB, bHLH and WD40 transcriptional factors, which can activate GLABRA2 (GL2) and the R3 MYB transcription factor genes. GL2 promotes trichome formation, whereas R3 MYBs are able to block the formation of the MBW complex. It has been reported that the C2H2 transcription factor GIS (GLABROUS INFLORESCENCE STEMS) functions upstream of the MBW activator complex to regulate trichome formation, and that the expression of TCL1 is not regulated by the MBW complex. However, gis and the R3 MYB gene mutant tcl1 (trichomeless 1) have opposite inflorescence trichome phenotypes, but their relationship in regulating trichome formation remained unknown. By generating and characterization of the gis tcl1 double mutant, we found that trichome formation in the gis tcl1double and the tcl1 single mutants were largely indistinguishable, but the trichome formation in the 35S:TCL1/gis transgenic plant was similar to that in the gis mutant. By using quantitative RT-PCR analysis, we showed that expression level of GIS was increased in the triple mutant tcl1 try cpc, but the expression level of TCL1 was not affected in the gis mutant. On the other hand, trichome morphology in both gis tcl1 and 35S:TCL1/gis plants was similar to that in the gis mutant. In summary, our results indicate that GIS may work downstream of TCL1 to regulate trichome formation, and GIS has a dominant role in controlling trichome morphology.
Xu, Yin; Zhang, Jin; Tian, Chan; Ren, Ke; Yan, Yu-E; Wang, Ke; Wang, Hui; Chen, Cao; Wang, Jing; Shi, Qi; Dong, Xiao-Ping
2014-04-01
The protein of p62/sequestosome 1 (SQSTM1), a key cargo adaptor protein involved in autophagy-lysosome degradation, exhibits inclusion bodies structure in cytoplasm and plays a protective role in some models of neurodegenerative diseases. Some PrP mutants, such as PrP-CYTO and PrP-PG14, also form cytosolic inclusion bodies and trigger neuronal apoptosis either in cultured cells or in transgenic mice. Here, we demonstrated that the cellular p62/SQSTM1 incorporated into the inclusion bodies formed by expressing the abnormal PrP mutants, PrP-CYTO and PrP-PG14, in human embryonic kidney 293 cells. Overexpression of p62/SQSTM1 efficiently relieved the cytosolic aggregations and cell apoptosis induced by the abnormal PrPs. Autophagy-lysosome inhibitors instead of proteasome inhibitor sufficiently blocked the p62/SQSTM1-mediated degradations of abnormal PrPs. Overexpression of p62/SQSTM1 did not alter the levels of light chain 3 (LC3) in the cells expressing various PrPs. However, more complexes of p62/SQSTM1 with LC3 were detected in the cells expressing the misfolded PrPs. These data imply that p62/SQSTM1 plays an important role in the homeostasis of abnormal PrPs via autophagy-lysosome-dependent way.
Zhou, Q; Zhao, J; Hüsler, T; Sims, P J
1996-10-01
CD59 is a plasma membrane-anchored glycoprotein that serves to protect human cells from lysis by the C5b-9 complex of complement. The immunodominant epitopes of CD59 are known to be sensitive to disruption of native tertiary structure, complicating immunological measurement of expressed mutant constructs for structure function analysis. In order to quantify cell-surface expression of wild-type and mutant forms of this complement inhibitor, independent of CD59 antigen, an 11-residue peptide (TAG) recognized by monoclonal antibody (mAb) 9E10 was inserted before the N-terminal codon (L1) of mature CD59, in a pcDNA3 expression plasmid. SV-T2 cells were transfected with this plasmid, yielding cell lines expressing 0 to > 10(5) CD59/cell. The TAG-CD59 fusion protein was confirmed to be GPI-anchored, N-glycosylated and showed identical complement-inhibitory function to wild-type CD59, lacking the TAG peptide sequence. Using this construct, the contribution of each of four surface-localized aromatic residues (4Y, 47F, 61Y, and 62Y) to CD59's complement-inhibitory function was examined. These assays revealed normal surface expression with complete loss of complement-inhibitory function in the 4Y --> S, 47F --> G and 61Y --> S mutants. By contrast, 62Y --> S mutants retained approximately 40% of function of wild-type CD59. These studies confirmed the utility of the TAG-CD59 construct for quantifying CD59 surface expression and activity, and implicate surface aromatic residues 4Y, 47F, 61Y and 62Y as essential to maintenance of CD59's normal complement-regulatory function.
Su, W C; Kitagawa, M; Xue, N; Xie, B; Garofalo, S; Cho, J; Deng, C; Horton, W A; Fu, X Y
1997-03-20
The achondroplasia class of chondrodysplasias comprises the most common genetic forms of dwarfism in humans and includes achondroplasia, hypochondroplasia and thanatophoric dysplasia types I and II (TDI and TDII), which are caused by different mutations in a fibroblast growth-factor receptor FGFR3 (ref. 1). The molecular mechanism and the mediators of these FGFR3-related growth abnormalities are not known. Here we show that mutant TDII FGFR3 has a constitutive tyrosine kinase activity which can specifically activate the transcription factor Stat1 (for signal transducer and activator of transcription). Furthermore, expression of TDII FGFR3 induced nuclear translocation of Stat1, expression of the cell-cycle inhibitor p21(WAF1/CIP1), and growth arrest of the cell. Thus, TDII FGFR3 may use Stat1 as a mediator of growth retardation in bone development. Consistent with this, Stat1 activation and increased p21(WAF1/CIP1) expression was found in the cartilage cells from the TDII fetus, but not in those from the normal fetus. Thus, abnormal STAT activation and p21(WAF1/CIP1) expression by the TDII mutant receptor may be responsible for this FGFR3-related bone disease.
α2-COP is involved in early secretory traffic in Arabidopsis and is required for plant growth
Gimeno-Ferrer, Fátima; Pastor-Cantizano, Noelia; Bernat-Silvestre, César; Selvi-Martínez, Pilar; Vera-Sirera, Francisco; Gao, Caiji; Perez-Amador, Miguel Angel; Jiang, Liwen; Aniento, Fernando
2017-01-01
Abstract COP (coat protein) I-coated vesicles mediate intra-Golgi transport and retrograde transport from the Golgi to the endoplasmic reticulum. These vesicles form through the action of the small GTPase ADP-ribosylation factor 1 (ARF1) and the COPI heptameric protein complex (coatomer), which consists of seven subunits (α-, β-, β′-, γ-, δ-, ε- and ζ-COP). In contrast to mammals and yeast, several isoforms for coatomer subunits, with the exception of γ and δ, have been identified in Arabidopsis. To understand the role of COPI proteins in plant biology, we have identified and characterized a loss-of-function mutant of α2-COP, an Arabidopsis α-COP isoform. The α2-cop mutant displayed defects in plant growth, including small rosettes, stems and roots and mislocalization of p24δ5, a protein of the p24 family containing a C-terminal dilysine motif involved in COPI binding. The α2-cop mutant also exhibited abnormal morphology of the Golgi apparatus. Global expression analysis of the α2-cop mutant revealed altered expression of plant cell wall-associated genes. In addition, a strong upregulation of SEC31A, which encodes a subunit of the COPII coat, was observed in the α2-cop mutant; this also occurs in a mutant of a gene upstream of COPI assembly, GNL1, which encodes an ARF-guanine nucleotide exchange factor (GEF). These findings suggest that loss of α2-COP affects the expression of secretory pathway genes. PMID:28025315
Integration host factor is necessary for lysogenization of Escherichia coli by bacteriophage P2.
Saha, S; Haggård-Ljungquist, E; Nordström, K
1990-01-01
Whether infection by bacteriophage P2 results in lysogenization of the host or vegetative growth of the phage depends upon a race between transcription from the repressor promoter Pc and the early promoter Pe; transcription from these promoters is mutually exclusive, since the Pc repressor Cox is formed from the Pe transcript and the Pe repressor C from the Pc transcript. The involvement of integration host factor (IHF) in the lysogenization of Escherichia coli K12 by P2 was tested by comparing wild-type and IHF-deficient (himA and himD) mutants. No lysogenic clones were formed following infection of the mutant bacteria. A switch plasmid that contains Pc-C-cat and Pe-cox-kan was used to test the choice for expression of Pc versus Pe. In the wild-type K12 bacteria, 20% of the clones expressed Pe transcription and 80% Pc transcription, whereas all transformed IHF-defective clones expressed transcription from Pe only. The effects of IHF on the in vivo expression of the Pe and Pc promoters were only marginal. The IHF protein was found to bind upstream of the Pe promoter, where a potential ihf sequence is located.
Expression and Purification of Soluble STAT5b/STAT3 Proteins for SH2 Domain Binding Assay.
Asai, Akira; Takakuma, Kazuyuki
2017-01-01
When a large hydrophobic full-length protein is expressed in bacteria, it is often challenging to obtain recombinant proteins in the soluble fraction. One way to overcome this challenge is expression of deletion mutants that have improved solubility while maintaining biological activity. In this chapter, we describe a protocol for expression of truncated forms of STAT5b and STAT3 proteins that are soluble and retain SH2-mediated activity for phospho-Tyr peptide recognition.
Reversed polarized delivery of an aquaporin-2 mutant causes dominant nephrogenic diabetes insipidus
Kamsteeg, Erik-Jan; Bichet, Daniel G.; Konings, Irene B.M.; Nivet, Hubert; Lonergan, Michelle; Arthus, Marie-Françoise; van Os, Carel H.; Deen, Peter M.T.
2003-01-01
Vasopressin regulates body water conservation by redistributing aquaporin-2 (AQP2) water channels from intracellular vesicles to the apical surface of renal collecting ducts, resulting in water reabsorption from urine. Mutations in AQP2 cause autosomal nephrogenic diabetes insipidus (NDI), a disease characterized by the inability to concentrate urine. Here, we report a frame-shift mutation in AQP2 causing dominant NDI. This AQP2 mutant is a functional water channel when expressed in Xenopus oocytes. However, expressed in polarized renal cells, it is misrouted to the basolateral instead of apical plasma membrane. Additionally, this mutant forms heterotetramers with wild-type AQP2 and redirects this complex to the basolateral surface. The frame shift induces a change in the COOH terminus of AQP2, creating both a leucine- and a tyrosine-based motif, which cause the reversed sorting of AQP2. Our data reveal a novel cellular phenotype in dominant NDI and show that dominance of basolateral sorting motifs in a mutant subunit can be the molecular basis for disease. PMID:14662748
2014-01-01
Introduction NLRP3 plays a role in sensing various pathogen components or stresses in the innate immune system. Once activated, NLRP3 associates with apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and procaspase-1 to form a large protein complex termed inflammasome. Although some investigators have proposed a model of NLRP3-inflammasome containing an adaptor protein caspase recruitment domain-containing protein 8 (CARD8), the role of this molecule remains obscure. This study aimed to clarify the interaction between CARD8 and wild-type NLRP3 as well as mutant forms of NLRP3 linked with cryopyrin-associated periodic syndromes (CAPS). Methods In here HEK293 expression system, cells were transfected with the cDNAs for inflammasome components. Also used were peripheral blood mononuclear cells (PBMCs) and human monocyte-derived macrophages (HMDMs) from healthy volunteers. The interaction of CARD8 and NLRP3 was studied by immunoprecipitation. The effect of CARD8 expression on IL-1β secretion was assessed by ELISA. CARD8 knockdown experiments were carried out by transfection of the specific siRNA into HMDMs. Results In HEK293 cells, CARD8 interacted with wild-type NLRP3, but not with CAPS-associated mutant NLRP3. CARD8 significantly reduced IL-1β secretion from cells transfected with wild-type NLRP3, but not if they were transfected with mutant NLRP3. In addition, association of endogenously expressed CARD8 with NLRP3 was confirmed in resting PBMCs, and CARD8 knockdown resulted in higher amount of IL-1β secretion from HMDMs. Conclusions Until specific stimuli activate NLRP3, CARD8 holds NLRP3, and is supposed to prevent activation by subtle stimuli. However, CAPS-associated mutant NLRP3 is unable to bind with CARD8, which might be relevant to the pathogenesis of CAPS. PMID:24517500
Ito, Sayaka; Hara, Yukichi; Kubota, Tetsuo
2014-02-12
NLRP3 plays a role in sensing various pathogen components or stresses in the innate immune system. Once activated, NLRP3 associates with apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and procaspase-1 to form a large protein complex termed inflammasome. Although some investigators have proposed a model of NLRP3-inflammasome containing an adaptor protein caspase recruitment domain-containing protein 8 (CARD8), the role of this molecule remains obscure. This study aimed to clarify the interaction between CARD8 and wild-type NLRP3 as well as mutant forms of NLRP3 linked with cryopyrin-associated periodic syndromes (CAPS). In here HEK293 expression system, cells were transfected with the cDNAs for inflammasome components. Also used were peripheral blood mononuclear cells (PBMCs) and human monocyte-derived macrophages (HMDMs) from healthy volunteers. The interaction of CARD8 and NLRP3 was studied by immunoprecipitation. The effect of CARD8 expression on IL-1β secretion was assessed by ELISA. CARD8 knockdown experiments were carried out by transfection of the specific siRNA into HMDMs. In HEK293 cells, CARD8 interacted with wild-type NLRP3, but not with CAPS-associated mutant NLRP3. CARD8 significantly reduced IL-1β secretion from cells transfected with wild-type NLRP3, but not if they were transfected with mutant NLRP3. In addition, association of endogenously expressed CARD8 with NLRP3 was confirmed in resting PBMCs, and CARD8 knockdown resulted in higher amount of IL-1β secretion from HMDMs. Until specific stimuli activate NLRP3, CARD8 holds NLRP3, and is supposed to prevent activation by subtle stimuli. However, CAPS-associated mutant NLRP3 is unable to bind with CARD8, which might be relevant to the pathogenesis of CAPS.
Pratter, S M; Eixelsberger, T; Nidetzky, B
2015-12-01
A novel Saccharomyces cerevisiae whole-cell biocatalyst for xylitol production based on Candida tenuis xylose reductase (CtXR) is presented. Six recombinant strains expressing wild-type CtXR or an NADH-specific mutant were constructed and evaluated regarding effects of expression mode, promoter strength, biocatalyst concentration and medium composition. Intracellular XR activities ranged from 0.09 U mgProt(-1) to 1.05 U mgProt(-1) but did not correlate with the strains' xylitol productivities, indicating that other factors limited xylose conversion in the high-activity strains. The CtXR mutant decreased the biocatalyst's performance, suggesting use of the NADPH-preferring wild-type enzyme when (semi-)aerobic conditions are applied. In a bioreactor process, the best-performing strain converted 40 g L(-1) xylose with an initial productivity of 1.16 g L(-1)h(-1) and a xylitol yield of 100%. The obtained results underline the potential of CtXR wild-type for xylose reduction and point out parameters to improve "green" xylitol production. Copyright © 2015 Elsevier Ltd. All rights reserved.
Epithelial heparan sulfate regulates Sonic Hedgehog signaling in lung development.
He, Hua; Huang, Meina; Sun, Shenfei; Wu, Yihui; Lin, Xinhua
2017-08-01
The tree-like structure of the mammalian lung is generated from branching morphogenesis, a reiterative process that is precisely regulated by numerous factors. How the cell surface and extra cellular matrix (ECM) molecules regulate this process is still poorly understood. Herein, we show that epithelial deletion of Heparan Sulfate (HS) synthetase Ext1 resulted in expanded branching tips and reduced branching number, associated with several mesenchymal developmental defects. We further demonstrate an expanded Fgf10 expression and increased FGF signaling activity in Ext1 mutant lungs, suggesting a cell non-autonomous mechanism. Consistent with this, we observed reduced levels of SHH signaling which is responsible for suppressing Fgf10 expression. Moreover, reactivating SHH signaling in mutant lungs rescued the tip dilation phenotype and attenuated FGF signaling. Importantly, the reduced SHH signaling activity did not appear to be caused by decreased Shh expression or protein stability; instead, biologically active form of SHH proteins were reduced in both the Ext1 mutant epithelium and surrounding wild type mesenchymal cells. Together, our study highlights the epithelial HS as a key player for dictating SHH signaling critical for lung morphogenesis.
Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P; Geddes, Ryan D; Shanmugam, Keelnatham T; Ingram, Lonnie O
2013-05-01
Furfural is an inhibitory side product formed during the depolymerization of hemicellulose with mineral acids. In Escherichia coli, furfural tolerance can be increased by expressing the native fucO gene (encoding lactaldehyde oxidoreductase). This enzyme also catalyzes the NADH-dependent reduction of furfural to the less toxic alcohol. Saturation mutagenesis was combined with growth-based selection to isolate a mutated form of fucO that confers increased furfural tolerance. The mutation responsible, L7F, is located within the interfacial region of FucO homodimers, replacing the most abundant codon for leucine with the most abundant codon for phenylalanine. Plasmid expression of the mutant gene increased FucO activity by more than 10-fold compared to the wild-type fucO gene and doubled the rate of furfural metabolism during fermentation. No inclusion bodies were evident with either the native or the mutated gene. mRNA abundance for the wild-type and mutant fucO genes differed by less than 2-fold. The Km (furfural) for the mutant enzyme was 3-fold lower than that for the native enzyme, increasing efficiency at low substrate concentrations. The L7F mutation is located near the FucO N terminus, within the ribosomal binding region associated with translational initiation. Free-energy calculations for mRNA folding in this region (nucleotides -7 to +37) were weak for the native gene (-4.1 kcal mol(-1)) but weaker still for the fucO mutant (-1.0 to -0.1 kcal mol(-1)). The beneficial L7F mutation in FucO is proposed to increase furfural tolerance by improving gene expression and increasing enzyme effectiveness at low substrate levels.
Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P.; Geddes, Ryan D.; Shanmugam, Keelnatham T.
2013-01-01
Furfural is an inhibitory side product formed during the depolymerization of hemicellulose with mineral acids. In Escherichia coli, furfural tolerance can be increased by expressing the native fucO gene (encoding lactaldehyde oxidoreductase). This enzyme also catalyzes the NADH-dependent reduction of furfural to the less toxic alcohol. Saturation mutagenesis was combined with growth-based selection to isolate a mutated form of fucO that confers increased furfural tolerance. The mutation responsible, L7F, is located within the interfacial region of FucO homodimers, replacing the most abundant codon for leucine with the most abundant codon for phenylalanine. Plasmid expression of the mutant gene increased FucO activity by more than 10-fold compared to the wild-type fucO gene and doubled the rate of furfural metabolism during fermentation. No inclusion bodies were evident with either the native or the mutated gene. mRNA abundance for the wild-type and mutant fucO genes differed by less than 2-fold. The Km (furfural) for the mutant enzyme was 3-fold lower than that for the native enzyme, increasing efficiency at low substrate concentrations. The L7F mutation is located near the FucO N terminus, within the ribosomal binding region associated with translational initiation. Free-energy calculations for mRNA folding in this region (nucleotides −7 to +37) were weak for the native gene (−4.1 kcal mol−1) but weaker still for the fucO mutant (−1.0 to −0.1 kcal mol−1). The beneficial L7F mutation in FucO is proposed to increase furfural tolerance by improving gene expression and increasing enzyme effectiveness at low substrate levels. PMID:23475621
Ulbrich, Lisa; Favaloro, Flores Lietta; Trobiani, Laura; Marchetti, Valentina; Patel, Vruti; Pascucci, Tiziana; Comoletti, Davide; Marciniak, Stefan J.; De Jaco, Antonella
2015-01-01
Several forms of monogenic heritable autism spectrum disorders are associated with mutations in the neuroligin genes. The autism-linked substitution R451C in neuroligin3 induces local misfolding of its extracellular domain, causing partial retention in the ER (endoplasmic reticulum) of expressing cells. We have generated a PC12 Tet-On cell model system with inducible expression of wild-type or R451C neuroligin3 to investigate whether there is activation of the UPR (unfolded protein response) as a result of misfolded protein retention. As a positive control for protein misfolding, we also expressed the mutant G221R neuroligin3, which is known to be completely retained within the ER. Our data show that overexpression of either R451C or G221R mutant proteins leads to the activation of all three signalling branches of the UPR downstream of the stress sensors ATF6 (activating transcription factor 6), IRE1 (inositol-requiring enzyme 1) and PERK [PKR (dsRNA-dependent protein kinase)-like endoplasmic reticulum kinase]. Each branch displayed different activation profiles that partially correlated with the degree of misfolding caused by each mutation. We also show that up-regulation of BiP (immunoglobulin heavy-chain-binding protein) and CHOP [C/EBP (CCAAT/enhancer-binding protein)-homologous protein] was induced by both mutant proteins but not by wild-type neuroligin3, both in proliferative cells and cells differentiated to a neuron-like phenotype. Collectively, our data show that mutant R451C neuroligin3 activates the UPR in a novel cell model system, suggesting that this cellular response may have a role in monogenic forms of autism characterized by misfolding mutations. PMID:26621873
Aguilar, Claudio; Vlamakis, Hera; Guzman, Alejandra; Losick, Richard; Kolter, Roberto
2010-05-18
Bacillus subtilis cells form multicellular biofilm communities in which spatiotemporal regulation of gene expression occurs, leading to differentiation of multiple coexisting cell types. These cell types include matrix-producing and sporulating cells. Extracellular matrix production and sporulation are linked in that a mutant unable to produce matrix is delayed for sporulation. Here, we show that the delay in sporulation is not due to a growth advantage of the matrix-deficient mutant under these conditions. Instead, we show that the link between matrix production and sporulation is through the Spo0A signaling pathway. Both processes are regulated by the phosphorylated form of the master transcriptional regulator Spo0A. When cells have low levels of phosphorylated Spo0A (Spo0A~P), matrix genes are expressed; however, at higher levels of Spo0A~P, sporulation commences. We have found that Spo0A~P levels are maintained at low levels in the matrix-deficient mutant, thereby delaying expression of sporulation-specific genes. This is due to the activity of one of the components of the Spo0A phosphotransfer network, KinD. A deletion of kinD suppresses the sporulation defect of matrix mutants, while its overproduction delays sporulation. Our data indicate that KinD displays a dual role as a phosphatase or a kinase and that its activity is linked to the presence of extracellular matrix in the biofilms. We propose a novel role for KinD in biofilms as a checkpoint protein that regulates the onset of sporulation by inhibiting the activity of Spo0A until matrix, or a component therein, is sensed.
Aguilar, Claudio; Vlamakis, Hera; Guzman, Alejandra; Losick, Richard; Kolter, Roberto
2010-01-01
ABSTRACT Bacillus subtilis cells form multicellular biofilm communities in which spatiotemporal regulation of gene expression occurs, leading to differentiation of multiple coexisting cell types. These cell types include matrix-producing and sporulating cells. Extracellular matrix production and sporulation are linked in that a mutant unable to produce matrix is delayed for sporulation. Here, we show that the delay in sporulation is not due to a growth advantage of the matrix-deficient mutant under these conditions. Instead, we show that the link between matrix production and sporulation is through the Spo0A signaling pathway. Both processes are regulated by the phosphorylated form of the master transcriptional regulator Spo0A. When cells have low levels of phosphorylated Spo0A (Spo0A~P), matrix genes are expressed; however, at higher levels of Spo0A~P, sporulation commences. We have found that Spo0A~P levels are maintained at low levels in the matrix-deficient mutant, thereby delaying expression of sporulation-specific genes. This is due to the activity of one of the components of the Spo0A phosphotransfer network, KinD. A deletion of kinD suppresses the sporulation defect of matrix mutants, while its overproduction delays sporulation. Our data indicate that KinD displays a dual role as a phosphatase or a kinase and that its activity is linked to the presence of extracellular matrix in the biofilms. We propose a novel role for KinD in biofilms as a checkpoint protein that regulates the onset of sporulation by inhibiting the activity of Spo0A until matrix, or a component therein, is sensed. PMID:20689749
Ordóñez, Adriana; Snapp, Erik L; Tan, Lu; Miranda, Elena; Marciniak, Stefan J; Lomas, David A
2013-01-01
Point mutants of α1-antitrypsin form ordered polymers that are retained as inclusions within the endoplasmic reticulum (ER) of hepatocytes in association with neonatal hepatitis, cirrhosis and hepatocellular carcinoma. These inclusions cause cell damage and predispose to ER stress in the absence of the classical unfolded protein response (UPR). The pathophysiology underlying this ER stress was explored by generating cell models that conditionally express wildtype α1-antitrypsin, two mutants that cause polymer-mediated inclusions and liver disease (E342K [the Z allele] and H334D) and a truncated mutant (Null Hong Kong, NHK) that induces classical ER stress and is removed by ER associated degradation. Expression of the polymeric mutants resulted in gross changes in the ER luminal environment that recapitulated the changes seen in liver sections from individuals with PI*ZZ α1-antitrypsin deficiency. In contrast expression of NHK α1-antitrypsin caused electron lucent dilatation and expansion of the ER throughout the cell. Photobleaching microscopy in live cells demonstrated a decrease in the mobility of soluble luminal proteins in cells that express E342K and H334D α1-antitrypsin when compared to those that express wildtype and NHK α1-antitrypsin (0.34±0.05, 0.22±0.03, 2.83±0.30 and 2.84±0.55 μm2/s respectively). There was no effect on protein mobility within ER membranes indicating that cisternal connectivity was not disrupted. Polymer expression alone was insufficient to induce the UPR but the resulting protein overload rendered cells hypersensitive to ER stress induced by either tunicamycin or glucose depletion. Conclusion Changes in protein diffusion provide an explanation for the cellular consequences of ER protein overload in mutants that cause inclusion body formation and α1-antitrypsin deficiency. PMID:23197448
Altered striatal function in a mutant mouse lacking D1A dopamine receptors.
Drago, J; Gerfen, C R; Lachowicz, J E; Steiner, H; Hollon, T R; Love, P E; Ooi, G T; Grinberg, A; Lee, E J; Huang, S P
1994-01-01
Of the five known dopamine receptors, D1A and D2 represent the major subtypes expressed in the striatum of the adult brain. Within the striatum, these two subtypes are differentially distributed in the two main neuronal populations that provide direct and indirect pathways between the striatum and the output nuclei of the basal ganglia. Movement disorders, including Parkinson disease and various dystonias, are thought to result from imbalanced activity in these pathways. Dopamine regulates movement through its differential effects on D1A receptors expressed by direct output neurons and D2 receptors expressed by indirect output neurons. To further examine the interaction of D1A and D2 neuronal pathways in the striatum, we used homologous recombination to generate mutant mice lacking functional D1A receptors (D1A-/-). D1A-/- mutants are growth retarded and die shortly after weaning age unless their diet is supplemented with hydrated food. With such treatment the mice gain weight and survive to adulthood. Neurologically, D1A-/- mice exhibit normal coordination and locomotion, although they display a significant decrease in rearing behavior. Examination of the striatum revealed changes associated with the altered phenotype of these mutants. D1A receptor binding was absent in striatal sections from D1A-/- mice. Striatal neurons normally expressing functional D1A receptors are formed and persist in adult homozygous mutants. Moreover, substance P mRNA, which is colocalized specifically in striatal neurons with D1A receptors, is expressed at a reduced level. In contrast, levels of enkephalin mRNA, which is expressed in striatal neurons with D2 receptors, are unaffected. These findings show that D1A-/- mice exhibit selective functional alterations in the striatal neurons giving rise to the direct striatal output pathway. Images Fig. 2 Fig. 4 PMID:7809078
Peres, Lázaro Eustáquio Pereira
2012-01-01
Despite the wide use of plant regeneration for biotechnological purposes, the signals that allow cells to become competent to assume different fates remain largely unknown. Here, it is demonstrated that the Regeneration1 (Rg1) allele, a natural genetic variation from the tomato wild relative Solanum peruvianum, increases the capacity to form both roots and shoots in vitro; and that the gibberellin constitutive mutant procera (pro) presented the opposite phenotype, reducing organogenesis on either root-inducing medium (RIM) or shoot-inducing medium (SIM). Mutants showing alterations in the formation of specific organs in vitro were the auxin low-sensitivity diageotropica (dgt), the lateral suppresser (ls), and the KNOX-overexpressing Mouse ears (Me). dgt failed to form roots on RIM, Me increased shoot formation on SIM, and the high capacity for in vitro shoot formation of ls contrasted with its recalcitrance to form axillary meristems. Interestingly, Rg1 rescued the in vitro organ formation capacity in proRg1 and dgtRg1 double mutants and the ex vitro low lateral shoot formation in pro and ls. Such epistatic interactions were also confirmed in gene expression and histological analyses conducted in the single and double mutants. Although Me phenocopied the high shoot formation of Rg1 on SIM, it failed to increase rooting on RIM and to rescue the non-branching phenotype of ls. Taken together, these results suggest REGENERATION1 and the DELLA mutant PROCERA as controlling a common competence to assume distinct cell fates, rather than the specific induction of adventitious roots or shoots, which is controlled by DIAGEOTROPICA and MOUSE EARS, respectively. PMID:22915742
Lombardi-Crestana, Simone; da Silva Azevedo, Mariana; e Silva, Geraldo Felipe Ferreira; Pino, Lílian Ellen; Appezzato-da-Glória, Beatriz; Figueira, Antonio; Nogueira, Fabio Tebaldi Silveira; Peres, Lázaro Eustáquio Pereira
2012-09-01
Despite the wide use of plant regeneration for biotechnological purposes, the signals that allow cells to become competent to assume different fates remain largely unknown. Here, it is demonstrated that the Regeneration1 (Rg1) allele, a natural genetic variation from the tomato wild relative Solanum peruvianum, increases the capacity to form both roots and shoots in vitro; and that the gibberellin constitutive mutant procera (pro) presented the opposite phenotype, reducing organogenesis on either root-inducing medium (RIM) or shoot-inducing medium (SIM). Mutants showing alterations in the formation of specific organs in vitro were the auxin low-sensitivity diageotropica (dgt), the lateral suppresser (ls), and the KNOX-overexpressing Mouse ears (Me). dgt failed to form roots on RIM, Me increased shoot formation on SIM, and the high capacity for in vitro shoot formation of ls contrasted with its recalcitrance to form axillary meristems. Interestingly, Rg1 rescued the in vitro organ formation capacity in proRg1 and dgtRg1 double mutants and the ex vitro low lateral shoot formation in pro and ls. Such epistatic interactions were also confirmed in gene expression and histological analyses conducted in the single and double mutants. Although Me phenocopied the high shoot formation of Rg1 on SIM, it failed to increase rooting on RIM and to rescue the non-branching phenotype of ls. Taken together, these results suggest REGENERATION1 and the DELLA mutant PROCERA as controlling a common competence to assume distinct cell fates, rather than the specific induction of adventitious roots or shoots, which is controlled by DIAGEOTROPICA and MOUSE EARS, respectively.
Sonic hedgehog: restricted expression and limb dysmorphologies
Hill, Robert E; Heaney, Simon JH; Lettice, Laura A
2003-01-01
Sonic hedgehog, SHH, is required for patterning the limb. The array of skeletal elements that compose the hands and feet, and the ordered arrangement of these bones to form the pattern of fingers and toes are dependent on SHH. The mechanism of action of SHH in the limb is not fully understood; however, an aspect that appears to be important is the localized, asymmetric expression of Shh. Shh is expressed in the posterior margin of the limb bud in a region defined as the zone of polarizing activity (ZPA). Analysis of mouse mutants which have polydactyly (extra toes) shows that asymmetric expression of Shh is lost due to the appearance of an ectopic domain of expression in the anterior limb margin. One such polydactylous mouse mutant, sasquatch (Ssq), maps to the corresponding chromosomal region of the human condition pre-axial polydactyly (PPD) and thus represents a model for this condition. The mutation responsible for Ssq is located 1 Mb away from the Shh gene; however, the mutation disrupts a long-range cis-acting regulator of Shh expression. By inference, human pre-axial polydactyly results from a similar disruption of Shh expression. Other human congenital abnormalities also map near the pre-axial polydactyly locus, suggesting a major chromosomal region for limb dysmorphologies. The distinct phenotypes range from loss of all bones of the hands and feet to syndactyly of the soft tissue and fusion of the digits. We discuss the role played by Shh expression in mouse mutant phenotypes and the human limb dysmorphologies. PMID:12587915
Kawaguchi, Yuka; Nariki, Hiroaki; Kawamoto, Naoko; Kanehiro, Yuichi; Miyazaki, Satoshi; Suzuki, Mari; Magari, Masaki; Tokumitsu, Hiroshi; Kanayama, Naoki
2017-04-01
Activation-induced cytidine deaminase (AID) is essential for diversification of the Ig variable region (IgV). AID is excluded from the nucleus, where it normally functions. However, the molecular mechanisms responsible for regulating AID localization remain to be elucidated. The SR-protein splicing factor SRSF1 is a nucleocytoplasmic shuttling protein, a splicing isoform of which called SRSF1-3, has previously been shown to contribute to IgV diversification in chicken DT40 cells. In this study, we examined whether SRSF1-3 functions in IgV diversification by promoting nuclear localization of AID. AID expressed alone was localized predominantly in the cytoplasm. In contrast, co-expression of AID with SRSF1-3 led to the nuclear accumulation of both AID and SRSF1-3 and the formation of a protein complex that contained them both, although SRSF1-3 was dispensable for nuclear import of AID. Expression of either SRSF1-3 or a C-terminally-truncated AID mutant increased IgV diversification in DT40 cells. However, overexpression of exogenous SRSF1-3 was unable to further enhance IgV diversification in DT40 cells expressing the truncated AID mutant, although SRSF1-3 was able to form a protein complex with the AID mutant. These results suggest that SRSF1-3 promotes nuclear localization of AID probably by forming a nuclear protein complex, which might stabilize nuclear AID and induce IgV diversification in an AID C-terminus-dependent manner. Copyright © 2017 Elsevier Inc. All rights reserved.
Aya Castañeda, María del Rosario; Sarnacki, Sebastián Hernán; Noto Llana, Mariángeles; López Guerra, Adriana Gabriela; Giacomodonato, Mónica Nancy; Cerquetti, María Cristina
2015-01-16
The ecological success of Salmonella enterica to survive in different environments is due, in part, to the ability to form biofilms, something which is especially important for food industry. The aim of the current study was to evaluate the involvement of Dam methylation in biofilm production in S. Enteritidis strains. The ability to generate biofilms was analyzed in wild type and dam mutant strains. In S. Enteritidis, the absence of Dam affected the capacity to develop pellicles at the air-liquid interface and reduced the ability to form biofilm on polystyrene surfaces. Curli and cellulose production, determined by Congo red and calcofluor assays, were affected in dam mutant strains. Relative quantitative real-time PCR experiments showed that the expression of csgD and csgA genes is reduced in mutants lacking dam gene with respect to the wild type strains, whereas transcript levels of bcsA are not affected in the absence of Dam. To our knowledge, this is the first report on the participation of Dam methylation on biofilm production in Enteritidis or any other serovar of S. enterica. Results presented here suggest that changes in gene expression required for biofilm production are finely regulated by Dam methylation. Thus, Dam methylation could modulate csgD expression and upregulate the expression of factors related with biofilm production, including curli and cellulose. This study contributes to the understanding of biofilm regulation in Salmonella spp. and to the design of new strategies to prevent food contamination and humans and animals infections. Copyright © 2014. Published by Elsevier B.V.
Guedes Aguiar, Bruno; Padmanabhan, Prasad K; Dumas, Carole; Papadopoulou, Barbara
2018-06-12
Valosin-containing protein (VCP)/p97/Cdc48 is one of the best-characterised type II cytosolic AAA+ ATPases most known for their role in ubiquitin-dependent protein quality control. Here, we provide functional insights into the role of the Leishmania VCP/p97 homologue (LiVCP) in the parasite intracellular development. We demonstrate that although LiVCP is an essential gene, Leishmania infantum promastigotes can grow with less VCP. In contrast, growth of axenic and intracellular amastigotes is dramatically affected upon decreased LiVCP levels in heterozygous and temperature sensitive (ts) LiVCP mutants or the expression of dominant negative mutants known to specifically target the second conserved VCP ATPase domain, a major contributor of the VCP overall ATPase activity. Interestingly, these VCP mutants are also unable to survive heat stress, and a ts VCP mutant is defective in amastigote growth. Consistent with LiVCP's essential function in amastigotes, LiVCP messenger ribonucleic acid undergoes 3'Untranslated Region (UTR)-mediated developmental regulation, resulting in higher VCP expression in amastigotes. Furthermore, we show that parasite mutant lines expressing lower VCP levels or dominant negative VCP forms exhibit high accumulation of polyubiquitinated proteins and increased sensitivity to proteotoxic stress, supporting the ubiquitin-selective chaperone function of LiVCP. Together, these results emphasise the crucial role LiVCP plays under heat stress and during the parasite intracellular development. © 2018 John Wiley & Sons Ltd.
Reith, A D; Ellis, C; Maroc, N; Pawson, T; Bernstein, A; Dubreuil, P
1993-01-01
Point mutations in highly conserved amino acid residues in the catalytic domain of the Kit receptor tyrosine kinase (RTK) are responsible for the coat color, fertility and hematopoietic defects of mice bearing mutant alleles at the dominant white-spotting (W) locus. The dominant nature of structural Kit mutations suggests that expression of other kinase-defective RTKs might also specifically interfere with signal transduction by normal receptors. To test this possibility, we have investigated the functional consequences of introducing analogous mutations into the RTK encoded by the c-fms proto-oncogene. Both Fms37 (glu582-->lys) and Fms42 (asp776-->asn) mutant proteins, corresponding to the strongly dominant-negative W37 and W42 mutant c-kit alleles, had undetectable in vitro kinase activity and were unable to transform Rat-2 fibroblasts in the presence of exogenous CSF-1. Moreover, expression of Fms37 or Fms42 proteins in Rat-2 cells specifically inhibited anchorage-independent growth mediated by the normal Fms receptor in the presence of exogenous CSF-1 and conferred a dominant loss of Fms-associated PI3-kinase activity on CSF-1 stimulation. Mutant RTKs, bearing point substitutions identical to those present in mild or severe W mutants, may provide a generally applicable strategy for inducing dominant loss of function defects in RTK-mediated signalling pathways.
Absence of cell surface expression of human ACE leads to perinatal death
Michaud, Annie; Acharya, K. Ravi; Masuyer, Geoffrey; Quenech'du, Nicole; Gribouval, Olivier; Morinière, Vincent; Gubler, Marie-Claire; Corvol, Pierre
2014-01-01
Renal tubular dysgenesis (RTD) is a recessive autosomal disease characterized most often by perinatal death. It is due to the inactivation of any of the major genes of the renin-angiotensin system (RAS), one of which is the angiotensin I-converting enzyme (ACE). ACE is present as a tissue-bound enzyme and circulates in plasma after its solubilization. In this report, we present the effect of different ACE mutations associated with RTD on ACE intracellular trafficking, secretion and enzymatic activity. One truncated mutant, R762X, responsible for neonatal death was found to be an enzymatically active, secreted form, not inserted in the plasma membrane. In contrast, another mutant, R1180P, was compatible with life after transient neonatal renal insufficiency. This mutant was located at the plasma membrane and rapidly secreted. These results highlight the importance of tissue-bound ACE versus circulating ACE and show that the total absence of cell surface expression of ACE is incompatible with life. In addition, two missense mutants (W594R and R828H) and two truncated mutants (Q1136X and G1145AX) were also studied. These mutants were neither inserted in the plasma membrane nor secreted. Finally, the structural implications of these ACE mutations were examined by molecular modelling, which suggested some important structural alterations such as disruption of intra-molecular non-covalent interactions (e.g. salt bridges). PMID:24163131
Hert, A P; Roberts, P D; Momol, M T; Minsavage, G V; Tudor-Nelson, S M; Jones, J B
2005-07-01
In a previous study, tomato race 3 (T3) strains of Xanthomonas perforans became predominant in fields containing both X. euvesicatoria and X. perforans races T1 and T3, respectively. This apparent ability to take over fields led to the discovery that there are three bacteriocin-like compounds associated with T3 strains. T3 strain 91-118 produces at least three different bacteriocin-like compounds (BCN-A, BCN-B, and BCN-C) antagonistic toward T1 strains. We determined the relative importance of the bacteriocin-like compounds by constructing the following mutant forms of a wild-type (WT) T3 strain to evaluate the antagonism to WT T1 strains: Mut-A (BCN-A-), Mut-B (BCN-B-), Mut-C (BCN-C-), Mut-AB, Mut-BC, and Mut-ABC. Although all mutant and WT T3 strains reduced the T1 populations in in planta growth room experiments, Mut-B and WT T3 were significantly more effective. Mutants expressing BCN-B and either BCN-A or BCN-C reduced T1 populations less than mutants expressing only BCN-A or BCN-C. The triple-knockout mutant Mut-ABC also had a significant competitive advantage over the T1 strain. In pairwise-inoculation field experiments where plants were coinoculated with an individual mutant or WT T3 strain and the T1 strain, the mutant strains and the WT T3 strain were reisolated from more than 70% of the lesions. WT T3 and Mut-B were the most frequently reisolated strains. In field experiments where plants were group inoculated with Mut-A, Mut-B, Mut-C, Mut-ABC, and WT T1 and T3 strains, Mut-B populations dominated all three seasons. In greenhouse and field experiments, the WT and mutant T3 strains had a selective advantage over T1 strains. Bacterial strains expressing both BCN-A and BCN-C appeared to have a competitive advantage over all other mutant and WT strains. Furthermore, BCN-B appeared to be a negative factor, with mutant T3 strains lacking BCN-B having a selective advantage in the field.
A cadmium-sensitive, glutathione-deficient mutant of Arabidopsis thaliana.
Howden, R; Andersen, C R; Goldsbrough, P B; Cobbett, C S
1995-01-01
The roots of the cadmium-sensitive mutant of Arabidopsis thaliana, cad1-1, become brown in the presence of cadmium. A new cadmium-sensitive mutant affected at a second locus, cad2, has been identified using this phenotype. Genetic analysis has grown that the sensitive phenotype is recessive to the wild type and segregates as a single Mendelian locus. Assays of cadmium accumulation by intact plants indicated that the mutant is deficient in its ability to sequester cadmium. Undifferentiated callus tissue was also cadmium sensitive, suggesting that the mutant phenotype is expressed at the cellular level. The level of cadmium-binding complexes formed in vivo was decreased compared with the wild type and accumulation of phytochelatins was about 10% of that in the wild type. The level of glutathione, the substrate for phytochelatin biosynthesis, in tissues of the mutant was decreased to about 15 to 30% of that in the wild type. Thus, the deficiency in phytochelatin biosynthesis can be explained by a deficiency in glutathione. PMID:7770518
Rukke, H V; Engen, S A; Schenck, K; Petersen, F C
2016-08-01
Streptococcus mitis is a colonizer of the oral cavity and the nasopharynx, and is closely related to Streptococcus pneumoniae. Both species occur in encapsulated and unencapsulated forms, but in S. mitis the role of the capsule in host interactions is mostly unknown. Therefore, the aim of this study was to examine how capsule expression in S. mitis can modulate interactions with the host with relevance for colonization. The S. mitis type strain, as well as two mutants of the type strain, an isogenic capsule deletion mutant, and a capsule switch mutant expressing the serotype 4 capsule of S. pneumoniae TIGR4, were used. Wild-type and capsule deletion strains of S. pneumoniae TIGR4 were included for comparison. We found that capsule production in S. mitis reduced adhesion to oral and lung epithelial cells. Further, exposure of oral epithelial cells to encapsulated S. mitis resulted in higher interleukin-6 and CXCL-8 transcription levels relative to the unencapsulated mutant. Capsule expression in S. mitis increased the sensitivity to human neutrophil peptide 1-3 but reduced the sensitivity to human β-defensin-3 and cathelicidin. This was in contrast with S. pneumoniae in which capsule expression has been generally associated with increased sensitivity to human antimicrobial peptides (AMPs). Collectively, these findings indicate that capsule expression in S. mitis is important in modulating interactions with epithelial cells, and is associated with increased or reduced susceptibility to AMPs depending on the nature of the AMP. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Newton, Jason; Hait, Nitai C.; Maceyka, Michael; Colaco, Alexandria; Maczis, Melissa; Wassif, Christopher A.; Cougnoux, Antony; Porter, Forbes D.; Milstien, Sheldon; Platt, Nicholas; Platt, Frances M.; Spiegel, Sarah
2017-01-01
Niemann-Pick type C (NPC) disease is a fatal neurodegenerative disorder caused by mutations in NPC1 or NPC2 with decreased functions leading to lysosomal accumulation of cholesterol and sphingolipids. FTY720/fingolimod, used for treatment of multiple sclerosis, is phosphorylated by nuclear sphingosine kinase 2, and its active phosphorylated form (FTY720-P) is an inhibitor of class I histone deacetylases. In this study, administration of clinically relevant doses of FTY720 to mice increased expression of NPC1 and -2 in brain and liver and decreased cholesterol in an SphK2-dependent manner. FTY720 greatly increased expression of NPC1 and -2 in human NPC1 mutant fibroblasts that correlated with formation of FTY720-P and significantly reduced the accumulation of cholesterol and glycosphingolipids. In agreement with this finding, FTY720 pretreatment of human NPC1 mutant fibroblasts restored transport of the cholera toxin B subunit, which binds ganglioside GM1, to the Golgi apparatus. Together, these findings suggest that FTY720 administration can ameliorate cholesterol and sphingolipid storage and trafficking defects in NPC1 mutant fibroblasts. Because neurodegeneration is the main clinical feature of NPC disease, and FTY720 accumulates in the CNS and has several advantages over available histone deacetylase inhibitors now in clinical trials, our work provides a potential opportunity for treatment of this incurable disease.—Newton, J., Hait, N. C., Maceyka, M., Colaco, A., Maczis, M., Wassif, C. A., Cougnoux, A., Porter, F. D., Milstien, S., Platt, N., Platt, F. M., Spiegel, S. FTY720/fingolimod increases NPC1 and NPC2 expression and reduces cholesterol and sphingolipid accumulation in Niemann-Pick type C mutant fibroblasts. PMID:28082351
Petit, Sarah J; Chayen, Naomi E; Pease, James E
2008-08-01
Chemokine receptor CXCR6 mediates the chemotaxis and adhesion of leukocytes to soluble and membrane-anchored forms of CXCL16, and is an HIV-1 co-receptor. Here, we describe the effects of mutation of acidic extracellular CXCR6 residues on receptor function. Although most CXCR6 mutants examined were expressed at levels similar to wild-type (WT) CXCR6, an N-terminal E3Q mutant was poorly expressed, which may explain previously reported protective effects of a similar single nucleotide polymorphism, with respect to late-stage HIV-1 infection. In contrast to several other chemokine receptors, mutation of the CXCR6 N terminus and inhibition of post-translational modifications of this region were without effect on receptor function. Likewise, N-terminal extension of CXCL16 resulted in a protein with decent potency and efficacy in chemotaxis and not, as anticipated, a CXCR6 antagonist. D176N and E274Q CXCR6 mutants were unable to interact with soluble CXCL16, suggesting a critical role for D176 and E274 in ligand binding. Intriguingly, although unable to interact with soluble CXCL16, the E274Q mutant could promote robust adhesion to membrane-anchored CXCL16, suggesting that soluble and membrane-bound forms of CXCL16 possess distinct conformations. Collectively, our data suggest a novel paradigm for the CXCR6:CXCL16 interaction, a finding which may impact the discovery of small-molecule antagonists of CXCR6.
Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M
2009-01-01
Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.
Kim, Hyun Uk; van Oostende, Chloë; Basset, Gilles J C; Browse, John
2008-04-01
Phylloquinone is the one-electron carrier at the A(1) site of photosystem I, and is essential for photosynthesis. Arabidopsis mutants deficient in early steps of phylloquinone synthesis do not become autotrophic and are seedling lethals, even when grown on sucrose-supplemented media. Here, we identify acyl-activating enzyme 14 (AAE14, At1g30520) as the o-succinylbenzoyl-coenzyme A (OSB-CoA) ligase acting in phylloquinone synthesis. Three aae14 mutant alleles, identified by reverse genetics, were found to be seedling lethal, to contain no detectable phylloquinone (< 0.1 pmol mg(-1) fresh weight) compared with 10 pmol mg(-1) fresh weight in wild-type leaves, and to accumulate OSB. AAE14 was able to restore menaquinone biosynthesis when expressed in an Escherichia coli mutant disrupted in the menE gene that encodes the bacterial OSB-CoA ligase. Weak expression of an AAE14 transgene in mutant plants (controlled by the uninduced XVE promoter) resulted in chlorotic, slow-growing plants that accumulated an average of 4.7 pmol mg(-1) fresh weight of phylloquinone. Inducing the XVE promoter in these plants, or expressing an AAE14 transgene under the control of the CaMV 35S promoter, led to full complementation of the mutant phenotype. aae14-mutant plants were also able to synthesize phylloquinone when provided with 1,4-dihydroxy-2-naphthoate, an intermediate in phylloquinone synthesis downstream of the OSB-CoA ligase reaction. Expression of an AAE14:GFP reporter construct indicated that the protein accumulated in discrete foci within the chloroplasts. This and other evidence suggests that the enzymes of phylloquinone synthesis from isochorismate may form a complex in the chloroplast stroma to facilitate the efficient channeling of intermediates through the pathway.
Moore, Adrian W; Roegiers, Fabrice; Jan, Lily Y; Jan, Yuh-Nung
2004-03-15
The Drosophila external sensory organ forms in a lineage elaborating from a single precursor cell via a stereotypical series of asymmetric divisions. HAMLET transcription factor expression demarcates the lineage branch that generates two internal cell types, the external sensory neuron and thecogen. In HAMLET mutant organs, these internal cells are converted to external cells via an unprecedented cousin-cousin cell-fate respecification event. Conversely, ectopic HAMLET expression in the external cell branch leads to internal cell production. The fate-determining signals NOTCH and PAX2 act at multiple stages of lineage elaboration and HAMLET acts to modulate their activity in a branch-specific manner.
Ujike, Makoto; Nakajima, Katsuhisa; Nobusawa, Eri
2004-11-01
The cytoplasmic tail (CT) of hemagglutinin (HA) of influenza B virus (BHA) contains at positions 578 and 581 two highly conserved cysteine residues (Cys578 and Cys581) that are modified with palmitic acid (PA) through a thioester linkage. To investigate the role of PA in the fusion activity of BHA, site-specific mutagenesis was performed with influenza B virus B/Kanagawa/73 HA cDNA. All of the HA mutants were expressed on Cos cells by an expression vector. The membrane fusion ability of the HA mutants at a low pH was quantitatively examined with lipid (octadecyl rhodamine B chloride) and aqueous (calcein) dye transfer assays and with the syncytium formation assay. Two deacylation mutants lacking a CT or carrying serine residues substituting for Cys578 and Cys581 promoted full fusion. However, one of the single-acylation-site mutants, C6, in which Cys581 is replaced with serine, promoted hemifusion but not pore formation. In contrast, four other single-acylation-site mutants that have a sole cysteine residue in the CT at position 575, 577, 579, or 581 promoted full fusion. The impaired pore-forming ability of C6 was improved by amino acid substitution between residues 578 and 582 or by deletion of the carboxy-terminal leucine at position 582. Syncytium-forming ability, however, was not adequately restored by these mutations. These facts indicated that the acylation was not significant in membrane fusion by BHA but that pore formation and pore dilation were appreciably affected by the particular amino acid sequence of the CT and the existence of a single acylation site in CT residue 578.
Smith, Rowena; Huang, Yu-Ting; Tian, Tian; Vojtasova, Dominika; Mesalles-Naranjo, Oscar; Price, David J.
2017-01-01
During vertebrate eye morphogenesis, a transient fissure forms at its inferior part, known as the optic fissure. This will gradually close, giving rise to a healthy, spherical optic cup. Failure of the optic fissure to close gives rise to an ocular disorder known as coloboma. During this developmental process, Foxg1 is expressed in the optic neuroepithelium, with highest levels of expression in the nasal optic stalk. Foxg1−/− mutant mice have microphthalmic eyes with a large ventral coloboma. We found Wnt8b expression upregulated in the Foxg1−/− optic stalk and hypothesized that, similar to what is observed in telencephalic development, Foxg1 directs development of the optic neuroepithelium through transcriptional suppression of Wnt8b. To test this, we generated Foxg1−/−;Wnt8b−/− double mutants of either sex and found that the morphology of the optic cup and stalk and the closure of the optic fissure were substantially rescued in these embryos. This rescue correlates with restored Pax2 expression in the anterior tip of the optic fissure. In addition, although we do not find evidence implicating altered proliferation in the rescue, we observe a significant increase in apoptotic cell density in Foxg1−/−;Wnt8b−/− double mutants compared with the Foxg1−/− single mutant. Upregulation of Wnt/β-catenin target molecules in the optic cup and stalk may underlie the molecular and morphological defects in the Foxg1−/− mutant. Our results show that proper optic fissure closure relies on Wnt8b suppression by Foxg1 in the nasal optic stalk to maintain balanced apoptosis and Pax2 expression in the nasal and temporal edges of the fissure. SIGNIFICANCE STATEMENT Coloboma is an ocular disorder that may result in a loss of visual acuity and accounts for ∼10% of childhood blindness. It results from errors in the sealing of the optic fissure (OF), a transient structure at the bottom of the eye. Here, we investigate the colobomatous phenotype of the Foxg1−/− mutant mouse. We identify upregulated expression of Wnt8b in the optic stalk of Foxg1−/− mutants before OF closure initiates. Foxg1−/−;Wnt8b−/− double mutants show a substantial rescue of the Foxg1−/− coloboma phenotype, which correlates with a rescue in molecular and cellular defects of Foxg1−/− mutants. Our results unravel a new role of Foxg1 in promoting OF closure providing additional knowledge about the molecules and cellular mechanisms underlying coloboma formation. PMID:28729440
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ji, Quanjiang; Zhang, Liang; Sun, Fei
As a human pathogen, Staphylococcus aureus must cope with oxidative stress generated by the human immune system. Here, we report that CymR utilizes its sole Cys-25 to sense oxidative stress. Oxidation followed by thiolation of this cysteine residue leads to dissociation of CymR from its cognate promoter DNA. In contrast, the DNA binding of the CymRC25S mutant was insensitive to oxidation and thiolation, suggesting that CymR senses oxidative stress through oxidation of its sole cysteine to form a mixed disulfide with low molecular weight thiols. The determined crystal structures of the reduced and oxidized forms of CymR revealed that Cys-25more » is oxidized to Cys-25-SOH in the presence of H{sub 2}O{sub 2}. Deletion of cymR reduced the resistance of S. aureus to oxidative stresses, and the resistance was restored by expressing a C25S mutant copy of cymR. In a C25S substitution mutant, the expression of two genes, tcyP and mccB, was constitutively repressed and did not respond to hydrogen peroxide stress, whereas the expression of the genes were highly induced under oxidative stress in a wild-type strain, indicating the critical role of Cys-25 in redox signaling in vivo. Thus, CymR is another master regulator that senses oxidative stress and connects stress responses to virulence regulation in S. aureus.« less
Hinits, Yaniv; Pan, Luyuan; Walker, Charline; Dowd, John; Moens, Cecilia B.; Hughes, Simon M.
2013-01-01
Summary Mef2 transcription factors have been strongly linked with early heart development. D-mef2 is required for heart formation in Drosophila, but whether Mef2 is essential for vertebrate cardiomyocyte (CM) differentiation is unclear. In mice, although Mef2c is expressed in all CMs, targeted deletion of Mef2c causes lethal loss of second heart field (SHF) derivatives and failure of cardiac looping, but first heart field CMs can differentiate. Here we examine Mef2 function in early heart development in zebrafish. Two Mef2c genes exist in zebrafish, mef2ca and mef2cb. Both are expressed similarly in the bilateral heart fields but mef2cb is strongly expressed in the heart poles at the primitive heart tube stage. By using fish mutants for mef2ca and mef2cb and antisense morpholinos to knock down either or both Mef2cs, we show that Mef2ca and Mef2cb have essential but redundant roles in myocardial differentiation. Loss of both Mef2ca and Mef2cb function does not interfere with early cardiogenic markers such as nkx2.5, gata4 and hand2 but results in a dramatic loss of expression of sarcomeric genes and myocardial markers such as bmp4, nppa, smyd1b and late nkx2.5 mRNA. Rare residual CMs observed in mef2ca;mef2cb double mutants are ablated by a morpholino capable of knocking down other Mef2s. Mef2cb over-expression activates bmp4 within the cardiogenic region, but no ectopic CMs are formed. Surprisingly, anterior mesoderm and other tissues become skeletal muscle. Mef2ca single mutants have delayed heart development, but form an apparently normal heart. Mef2cb single mutants have a functional heart and are viable adults. Our results show that the key role of Mef2c in myocardial differentiation is conserved throughout the vertebrate heart. PMID:22750409
Functional verification of a porcine myostatin propeptide mutant.
Ma, Dezun; Jiang, Shengwang; Gao, Pengfei; Qian, Lili; Wang, Qingqing; Cai, Chunbo; Xiao, Gaojun; Yang, Jinzeng; Cui, Wentao
2015-10-01
Myostatin is a member of TGF-β superfamily that acts as a key negative regulator in development and growth of embryonic and postnatal muscles. In this study, the inhibitory activities of recombinant porcine myostatin propeptide and its mutated form (at the cleavage site of metalloproteinases of BMP-1/TLD family) against murine myostatin was evaluated in vivo by intraperitoneal injection into mice. Results showed that both wild type and mutated form of porcine propeptide significantly inhibited myostatin activity in vivo. The average body weight of mice receiving wild type propeptide or its mutated form increased by 12.5 % and 24.14%, respectively, compared to mice injected with PBS, implying that the in vivo efficacy of porcine propeptide mutant is greater than its wild type propeptide. Transgenic mice expressing porcine myostatin propeptide mutant were generated to further verify the results obtained from mice injected with recombinant porcine propeptide mutant. Compared with wild type (non-transgenic) mice, relative weight of gastrocnemius, rectusfemoris, and tibialis anterior increased by 22.14 %, 34.13 %, 25.37%, respectively, in transgenic male mice, and by 19.90 %, 42.47 %, 45.61%, respectively, in transgenic female mice. Our data also demonstrated that the mechanism by which muscle growth enhancement is achieved by these propeptides is due to an increase in fiber sizes, not by an increase in number of fiber cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiang, J.C.; Lee, W.R.; Chang, S.H.
1992-01-01
To study mechanisms for dominance of phenotype, eight ENU- and four x-ray-induced mutations at the alcohol dehydrogenase (Adh) locus were analyzed for partial dominance in their interaction with normal alleles. All ENU and one of the x-ray mutations were single base substitutions; the other three x-ray mutations were 9-21 base deletions. All but one of the 12 mutant alleles were selected for this study because they produced detectable mutant polypeptides, but seven of the 11 producing a peptide could not form dimers with the normal peptide and the enzyme activity of heterozygotes was about half that of normal homozygotes. Fourmore » mutations formed dimers with a decreased catalytic efficiency and two of these were near the limit of detectability; these two also inhibited the formation of normal homodimers. The mutant alleles therefore show multiple mechanisms leading to partial enzyme expression in heterozygotes and a wide range of dominance ranging from almost complete recessive to nearly dominant. All amino acid changes in mutant peptides that form dimers are located between amino acids 182 and 194, so this region is not critical for dimerization. It may, however, be an important surface domain for catalyzation. 34 refs., 8 figs., 2 tabs.« less
Nascimento, Heloisa H; Silva, Lucas E P; Souza, Renata T; Silva, Neusa P; Scaletsky, Isabel C A
2014-07-10
Biofilm formation by enteropathogenic Escherichia coli (EPEC) have been recently described in the prototype typical EPEC E2348/69 strain and in an atypical EPEC O55:H7 strain. In this study, we sought to evaluate biofilm formation in a collection of 126 atypical EPEC strains isolated from 92 diarrheic and 34 nondiarrheic children, belonging to different serotypes. The association of biofilm formation and adhesin-related genes were also investigated. Biofilm formation occurred in 37 (29%) strains of different serotypes, when the assays were performed at 26°C and 37°C for 24 h. Among these, four strains (A79, A87, A88, and A111) formed a stronger biofilm than did the others. The frequency of biofilm producers was higher among isolates from patients compared with isolates from controls (34.8% vs 14.7%; P = 0.029). An association was found between biofilm formation and expression of type 1 fimbriae and curli (P < 0.05). Unlike the previously described aEPEC O55:H7, one aEPEC O119:HND strain (A111) formed a strong biofilm and pellicle at the air-liquid interface, but did not express curli. Transposon mutagenesis was used to identify biofilm-deficient mutants. Transposon insertion sequences of six mutants revealed similarity with type 1 fimbriae (fimC, fimD, and fimH), diguanylate cyclase, ATP synthase F1, beta subunit (atpD), and the uncharacterized YjiC protein. All these mutants were deficient in biofilm formation ability. This study showed that the ability to adhere to abiotic surfaces and form biofilm is present in an array of aEPEC strains. Moreover, it seems that the ability to form biofilms is associated with the presence of type 1 fimbriae and diguanylate cyclase. Characterization of additional biofilm formation mutants may reveal other mechanisms involved in biofilm formation and bring new insights into aEPEC adhesion and pathogenesis.
Modeling familial British and Danish dementia.
Garringer, Holly J; Murrell, Jill; D'Adamio, Luciano; Ghetti, Bernardino; Vidal, Ruben
2010-03-01
Familial British dementia (FBD) and familial Danish dementia (FDD) are two autosomal dominant neurodegenerative diseases caused by mutations in the BRI ( 2 ) gene. FBD and FDD are characterized by widespread cerebral amyloid angiopathy (CAA), parenchymal amyloid deposition, and neurofibrillary tangles. Transgenic mice expressing wild-type and mutant forms of the BRI(2) protein, Bri ( 2 ) knock-in mutant mice, and Bri ( 2 ) gene knock-out mice have been developed. Transgenic mice expressing a human FDD-mutated form of the BRI ( 2 ) gene have partially reproduced the neuropathological lesions observed in FDD. These mice develop extensive CAA, parenchymal amyloid deposition, and neuroinflammation in the central nervous system. These animal models allow the study of the molecular mechanism(s) underlying the neuronal dysfunction in these diseases and allow the development of potential therapeutic approaches for these and related neurodegenerative conditions. In this review, a comprehensive account of the advances in the development of animal models for FBD and FDD and of their relevance to the study of Alzheimer disease is presented.
Drummond, Revel S M; Martínez-Sánchez, N Marcela; Janssen, Bart J; Templeton, Kerry R; Simons, Joanne L; Quinn, Brian D; Karunairetnam, Sakuntala; Snowden, Kimberley C
2009-12-01
One of the key factors that defines plant form is the regulation of when and where branches develop. The diversity of form observed in nature results, in part, from variation in the regulation of branching between species. Two CAROTENOID CLEAVAGE DIOXYGENASE (CCD) genes, CCD7 and CCD8, are required for the production of a branch-suppressing plant hormone. Here, we report that the decreased apical dominance3 (dad3) mutant of petunia (Petunia hybrida) results from the mutation of the PhCCD7 gene and has a less severe branching phenotype than mutation of PhCCD8 (dad1). An analysis of the expression of this gene in wild-type, mutant, and grafted petunia suggests that in petunia, CCD7 and CCD8 are coordinately regulated. In contrast to observations in Arabidopsis (Arabidopsis thaliana), ccd7ccd8 double mutants in petunia show an additive phenotype. An analysis using dad3 or dad1 mutant scions grafted to wild-type rootstocks showed that when these plants produce adventitious mutant roots, branching is increased above that seen in plants where the mutant roots are removed. The results presented here indicate that mutation of either CCD7 or CCD8 in petunia results in both the loss of an inhibitor of branching and an increase in a promoter of branching.
Drummond, Revel S.M.; Martínez-Sánchez, N. Marcela; Janssen, Bart J.; Templeton, Kerry R.; Simons, Joanne L.; Quinn, Brian D.; Karunairetnam, Sakuntala; Snowden, Kimberley C.
2009-01-01
One of the key factors that defines plant form is the regulation of when and where branches develop. The diversity of form observed in nature results, in part, from variation in the regulation of branching between species. Two CAROTENOID CLEAVAGE DIOXYGENASE (CCD) genes, CCD7 and CCD8, are required for the production of a branch-suppressing plant hormone. Here, we report that the decreased apical dominance3 (dad3) mutant of petunia (Petunia hybrida) results from the mutation of the PhCCD7 gene and has a less severe branching phenotype than mutation of PhCCD8 (dad1). An analysis of the expression of this gene in wild-type, mutant, and grafted petunia suggests that in petunia, CCD7 and CCD8 are coordinately regulated. In contrast to observations in Arabidopsis (Arabidopsis thaliana), ccd7ccd8 double mutants in petunia show an additive phenotype. An analysis using dad3 or dad1 mutant scions grafted to wild-type rootstocks showed that when these plants produce adventitious mutant roots, branching is increased above that seen in plants where the mutant roots are removed. The results presented here indicate that mutation of either CCD7 or CCD8 in petunia results in both the loss of an inhibitor of branching and an increase in a promoter of branching. PMID:19846541
Late-onset of spinal neurodegeneration in knock-in mice expressing a mutant BiP.
Jin, Hisayo; Mimura, Naoya; Kashio, Makiko; Koseki, Haruhiko; Aoe, Tomohiko
2014-01-01
Most human neurodegenerative diseases are sporadic, and appear later in life. While the underlying mechanisms of the progression of those diseases are still unclear, investigations into the familial forms of comparable diseases suggest that endoplasmic reticulum (ER) stress is involved in the pathogenesis. Binding immunoglobulin protein (BiP) is an ER chaperone that is central to ER function. We produced knock-in mice expressing a mutant BiP that lacked the retrieval sequence in order to evaluate the effect of a functional defect in an ER chaperone in multi-cellular organisms. Here we report that heterozygous mutant BiP mice revealed motor disabilities in aging. We found a degeneration of some motoneurons in the spinal cord accompanied by accumulations of ubiquitinated proteins. The defect in retrieval of BiP by the KDEL receptor leads to impaired activities in quality control and autophagy, suggesting that functional defects in the ER chaperones may contribute to the late onset of neurodegenerative diseases.
Massie, Michelle R.; Lapoczka, Elizabeth M.; Boggs, Kristy D.; Stine, Karen E.; White, Glenn E.
2003-01-01
Historically, sodium azide has been used to anesthetize the nematode Caenorhabditis elegans; however, the mechanism by which it survives this exposure is not understood. In this study, we report that exposure of wild-type C elegans to 10 mM sodium azide for up to 90 minutes confers thermotolerance (defined as significantly increased survival probability [SP] at 37°C) on the animal. In addition, sodium dodecyl sulfate–polyacrylamide gel electrophoresis revealed enhanced Hsp70 expression, whereas Western blot analysis revealed the induction of Hsp16. We also tested the only known C elegans Hsp mutant daf-21 (codes for Hsp90), which constitutively enters the stress-resistant state known as the dauer larvae. Daf-21 mutants also acquire sodium azide–induced thermotolerance, whereas 3 non-Hsp, constitutive dauer-forming mutants exhibited a variable response to azide exposure. We conclude that the ability of C elegans to survive exposure to azide is associated with the induction of at least 2 stress proteins. PMID:12820649
Salido, Eduardo C.; Li, Xiao M.; Lu, Yang; Wang, Xia; Santana, Alfredo; Roy-Chowdhury, Namita; Torres, Armando; Shapiro, Larry J.; Roy-Chowdhury, Jayanta
2006-01-01
Mutations in the alanine–glyoxylate amino transferase gene (AGXT) are responsible for primary hyperoxaluria type I, a rare disease characterized by excessive hepatic oxalate production that leads to renal failure. We generated a null mutant mouse by targeted mutagenesis of the homologous gene, Agxt, in embryonic stem cells. Mutant mice developed normally, and they exhibited hyperoxaluria and crystalluria. Approximately half of the male mice in mixed genetic background developed calcium oxalate urinary stones. Severe nephrocalcinosis and renal failure developed after enhancement of oxalate production by ethylene glycol administration. Hepatic expression of human AGT1, the protein encoded by AGXT, by adenoviral vector-mediated gene transfer in Agxt−/− mice normalized urinary oxalate excretion and prevented oxalate crystalluria. Subcellular fractionation and immunofluorescence studies revealed that, as in the human liver, the expressed wild-type human AGT1 was predominantly localized in mouse hepatocellular peroxisomes, whereas the most common mutant form of AGT1 (G170R) was localized predominantly in the mitochondria. PMID:17110443
Differential expression of the lethal gene Luteus-Pa in cacao of the Parinari series.
Rehem, B C; Almeida, A-A F; Figueiredo, G S F; Gesteira, A S; Santos, S C; Corrêa, R X; Yamada, M M; Valle, R R
2016-02-22
The recessive lethal character Luteus-Pa is found in cacao (Theobroma cacao) genotypes of the Parinari series (Pa) and is characterized by expression of leaf chlorosis and seedling death. Several genotypes of the Pa series are bearers of the gene responsible for the expression of the Luteus-Pa character, which can be used as a tool for determining relationships between genotypes of this group. To evaluate this phenomenon, we analyzed the differential expression of genes between mutant seedlings and wild-type hybrid Pa 30 x 169 seedlings, with the aim of elucidating the possible lethal mechanisms of the homozygous recessive character Luteus-Pa. Plant material was harvested from leaves of wild and mutant seedlings at different periods to construct a subtractive library and perform quantitative analysis using real-time PCR. The 649 sequences obtained from the subtractive library had an average length of 500 bp, forming 409 contigs. The probable proteins encoded were grouped into 10 functional categories. Data from ESTs identified genes associated with Rubisco, peroxidases, and other proteins and enzymes related to carbon assimilation, respiration, and photosystem 2. Mutant seedlings were characterized by synthesizing defective PsbO and PsbA proteins, which were overexpressed from 15 to 20 days after seedling emergence.
Cloning and characterization of ftsZ and pyrF from the archaeon Thermoplasma acidophilum
NASA Technical Reports Server (NTRS)
Yaoi, T.; Laksanalamai, P.; Jiemjit, A.; Kagawa, H. K.; Alton, T.; Trent, J. D.
2000-01-01
To characterize cytoskeletal components of archaea, the ftsZ gene from Thermoplasma acidophilum was cloned and sequenced. In T. acidophilum ftsZ, which is involved in cell division, was found to be in an operon with the pyrF gene, which encodes orotidine-5'-monophosphate decarboxylase (ODC), an essential enzyme in pyrimidine biosynthesis. Both ftsZ and pyrF from T. acidophilum were expressed in Escherichia coli and formed functional proteins. FtsZ expression in wild-type E. coli resulted in the filamentous phenotype characteristic of ftsZ mutants. T. acidophilum pyrF expression in an E. coli mutant lacking pyrF complemented the mutation and rescued the strain. Sequence alignments of ODCs from archaea, bacteria, and eukarya reveal five conserved regions, two of which have homology to 3-hexulose-6-phosphate synthase (HPS), suggesting a common substrate recognition and binding motif. Copyright 2000 Academic Press.
Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A
1993-01-01
A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064
Thomas, Jennifer L.; Vihtelic, Thomas S.; denDekker, Aaron D.; Willer, Gregory; Luo, Xixia; Murphy, Taylor R.; Gregg, Ronald G.; Hyde, David R.
2011-01-01
Purpose. To establish the zebrafish platinum mutant as a model for studying vision defects caused by syndromic albinism diseases such as Chediak-Higashi syndrome, Griscelli syndrome, and Hermansky-Pudlak syndrome (HPS). Methods. Bulked segregant analysis and candidate gene sequencing revealed that the zebrafish platinum mutation is a single-nucleotide insertion in the vps11 (vacuolar protein sorting 11) gene. Expression of vps11 was determined by RT-PCR and in situ hybridization. Mutants were analyzed for pigmentation defects and retinal disease by histology, immunohistochemistry, and transmission electron microscopy. Results. Phenocopy and rescue experiments determined that a loss of Vps11 results in the platinum phenotype. Expression of vps11 appeared ubiquitous during zebrafish development, with stronger expression in the developing retina and retinal pigmented epithelium (RPE). Zebrafish platinum mutants exhibited reduced pigmentation in the body and RPE; however, melanophore development, migration, and dispersion occurred normally. RPE, photoreceptors, and inner retinal neurons formed normally in zebrafish platinum mutants. However, a gradual loss of RPE, an absence of mature melanosomes, and the subsequent degradation of RPE/photoreceptor interdigitation was observed. Conclusions. These data show that Vps11 is not necessary for normal retinal development or initiation of melanin biosynthesis, but is essential for melanosome maturation and healthy maintenance of the RPE and photoreceptors. PMID:21330665
The scaffolding and signaling functions of a localization factor impact polar development
Curtis, Patrick D.; Quardokus, Ellen M.; Lawler, Melanie L.; Guo, Xiaoyun; Klein, David; Chen, Joseph C.; Arnold, Randy J.; Brun, Yves V.
2012-01-01
SUMMARY In the differentiating alphaproteobacterium Caulobacter crescentus, organelle synthesis at cell poles is critical to forming different progeny after cell division. Coordination of polar organelle synthesis, including pili and holdfast, and flagellum ejection, is mediated in part by the scaffolding protein PodJ. At the time of cell division, PodJ undergoes regulated processing to a short form that persists at the flagellar pole of swarmer cells. This study analyzes how PodJ’s role in structural and signaling protein localization impacts organelle synthesis. A PodJ mutant with an internal deletion exhibits reduced sensitivity to pili-tropic phage ΦCbK, resulting from reduced pilA gene expression, which can be linked to altered signaling protein localization. The phage sensitivity defect of a ΔpodJ mutant can be partially suppressed by ectopic pilA expression. Induction of PodJ processing, by manipulation of podJ itself or controlled perP expression, resulted in decreased pilus biogenesis and, when coupled with a podJ mutation that reduced pilA expression, led to complete loss of phage sensitivity. As a whole, the results show that PodJ’s scaffolding role for structural and signaling proteins both contribute to flagellar pole organelle development. PMID:22512778
Banks, Eric A; Yu, X Sean; Shi, Qian; Jiang, Jean X
2007-10-15
We previously reported that, among the three connexins expressed in chick lens, overexpression of connexin (Cx) 45.6, not Cx43 or Cx56, stimulates lens cell differentiation; however, the underlying mechanism responsible for this effect is unclear. Here, we took advantage of naturally occurring loss-of-gap-junction function mutations of Cx50 (ortholog of chick Cx45.6) and generated the corresponding site mutants in Cx45.6: Cx45.6(D47A) and Cx45.6(P88S). In contrast to wild-type Cx45.6, the mutants failed to form functional gap junctions, and Cx45.6(P88S) and, to a lesser degree, Cx45.6(D47A) functioned in a dominant-negative manner. Interestingly, overexpression of both mutants incapable of forming gap junctions significantly increased epithelial-fiber differentiation to a level comparable to that of wild-type Cx45.6. To map the functional domain of Cx45.6, we generated a C-terminus chimera as well as deletion mutants. Overexpression of Cx56(*)45.6C, the mutant in which the C-terminus of Cx56 was replaced with that of Cx45.6, had a stimulatory effect on lens cell differentiation similar to that of Cx45.6. However, cells overexpressing Cx45.6(*)56C, the mutant in which C-terminus of Cx45.6 was replaced with that of Cx56, and Cx45.6(-C), in which the C-terminus was deleted, failed to promote differentiation. Taken together, we conclude that the expression of Cx45.6, but not Cx45.6-dependent gap junction channels, is involved in lens epithelial-fiber cell differentiation, and the C-terminal domain of Cx45.6 plays a predominant role in mediating this process.
Tanaka, Yoshinori; Nonaka, Takashi; Suzuki, Genjiro; Kametani, Fuyuki; Hasegawa, Masato
2016-04-01
Profilin 1 (PFN1) is an actin monomer-binding protein essential for regulating cytoskeletal dynamics in all cell types. Recently, mutations in the PFN1 gene have been identified as a cause of familial amyotrophic lateral sclerosis (ALS). The co-aggregation of PFN1 bearing mutations that cause ALS with TDP-43 (a key molecule in both sporadic and some familial forms of ALS), together with the classical TDP-43 pathology detected in post-mortem tissues of patients with autosomal dominant PFN1 mutation, imply that gain-of-toxic-function of PFN1 mutants is associated with the onset of ALS. However, it remains unknown how PFN1 mutants cause ALS. We found mutant PFN1 that causes ALS formed cytoplasmic aggregates positive for ubiquitin and p62, and these aggregates sequestered endogenous TDP-43. In cells harboring PFN1 aggregates, formation of aggresome-like structures was inhibited in the presence of proteasome inhibitor, and conversion of LC3-I to LC3-II was suppressed in the presence of lysosome inhibitor. Further, insoluble TDP-43 was increased in both cases. Co-expression of ALS-linked mutant PFN1 and TDP-43 increased insoluble and phosphorylated TDP-43 levels. The C-terminal region of TDP-43, essential for aggregation of TDP-43, was also indispensable for the interaction with PFN1. Interestingly, insoluble fractions prepared from cells expressing ALS-linked mutant PFN1 functioned as a seed to induce accumulation and phosphorylation of TDP-43, indicating that TDP-43 accumulated in the presence of the PFN1 mutants is converted to prion-like species. These findings provide new insight into the mechanisms of neurodegeneration in ALS, suggesting that gain-of-toxic-function PFN1 gene mutation leads to conformational change of TDP-43. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Arnold, Jelena S.; Braunstein, Evan M.; Ohyama, Takahiro; Groves, Andrew K.; Adams, Joe C.; Brown, M. Christian; Morrow, Bernice E.
2007-01-01
Most 22q11.2 deletion syndrome (22q11DS) patients have middle and outer ear anomalies, whereas some have inner ear malformations. Tbx1, a gene hemizygously deleted in 22q11DS patients and required for ear development, is expressed in multiple tissues during embryogenesis. To determine the role of Tbx1 in the first pharyngeal pouch (PPI) in forming outer and middle ears, we tissue-specifically inactivated the gene using Foxg1-Cre. In the conditional mutants, PPI failed to outgrow, preventing the middle ear bone condensations from forming. Tbx1 was also inactivated in the otic vesicle (OV), resulting in the failure of inner ear sensory organ formation, and in duplication of the cochleovestibular ganglion (CVG). Consistent with the anatomical defects, the sensory genes, Otx1 and Bmp4 were downregulated, whereas the CVG genes, Fgf3 and NeuroD, were upregulated. To delineate Tbx1 cell-autonomous roles, a more selective ablation, exclusively in the OV, was performed using Pax2-Cre. In contrast to the Foxg1-Cre mutants, Pax2-Cre conditional mutant mice survived to adulthood and had normal outer and middle ears but had the same inner ear defects as the Tbx1 null mice, with the same gene expression changes. These results demonstrate that Tbx1 has non-cell autonomous roles in PPI in the formation of outer and middle ears and cell-autonomous roles in the OV. Periotic mesenchymal markers, Prx2 and Brn4 were normal in both conditional mutants, whereas they were diminished in Tbx1−/− embryos. Thus, Tbx1 in the surrounding mesenchyme in both sets of conditional mutants cannot suppress the defects in the OV that occur in the null mutants. PMID:16600992
Synthetic Nucleic Acids and Treatment of Neurological Diseases.
Corey, David R
2016-10-01
The ability to control gene expression with antisense oligonucleotides (ASOs) could provide a new treatment strategy for disease. To review the use of ASOs for the treatment of neurological disorders. Articles were identified through a search of PubMed references from 2000 to 2016 for articles describing the use of ASOs to treat disease, with specific attention to neurological disease. We concentrated our review on articles pertaining to activation of frataxin expression (Friedreich's ataxia) and production of active survival motor neuron 2 (SMN2, spinal muscular atrophy). Many neurological diseases are caused by inappropriate expression of a protein. Mutations may reduce expression of a wild-type protein, and strategies to activate expression may provide therapeutic benefit. For other diseases, a mutant protein may be expressed too highly and methods that reduce mutant protein expression might form the basis for drug development. Synthetic ASOs can recognize cellular RNA and control gene expression. Antisense oligonucleotides are not a new concept, but successful clinical development has proceeded at a slow pace. Advances in ASO chemistry, biological understanding, and clinical design are making successful applications more likely. Both laboratory and clinical studies are demonstrating the potential of ASOs as a source of drugs to treat neurological disease.
Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng
2013-09-15
The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.
Heterokaryosis in Trichophyton mentagrophytes.
Weigl, E; Hejtmánek, M
1976-01-01
Heterokaryosis was demonstrated in the dermatophyte Trichophyton mentagrophytes. Ten biochemical mutants of this fungus, requiring, tryptophan, histidine, methionine, arginine and thiamine, were used in the experiments. Six mutant pairs with different biochemical markers formed the heterokaryotic mycelium (trp + his, trp + met arg, trp + thi, his + met arg). The heterokaryotic constitution was determined by ths dissociation of a heterokaryon into auxotrophic components in microconidial spreads and by the isolation of the hyphal tips from which the prototrophic colonies grew out. The heterokaryotic constitution was expressed by the complementation of nutritional requirements and morphologically.
Munc18-1 is a molecular chaperone for α-synuclein, controlling its self-replicating aggregation.
Chai, Ye Jin; Sierecki, Emma; Tomatis, Vanesa M; Gormal, Rachel S; Giles, Nichole; Morrow, Isabel C; Xia, Di; Götz, Jürgen; Parton, Robert G; Collins, Brett M; Gambin, Yann; Meunier, Frédéric A
2016-09-12
Munc18-1 is a key component of the exocytic machinery that controls neurotransmitter release. Munc18-1 heterozygous mutations cause developmental defects and epileptic phenotypes, including infantile epileptic encephalopathy (EIEE), suggestive of a gain of pathological function. Here, we used single-molecule analysis, gene-edited cells, and neurons to demonstrate that Munc18-1 EIEE-causing mutants form large polymers that coaggregate wild-type Munc18-1 in vitro and in cells. Surprisingly, Munc18-1 EIEE mutants also form Lewy body-like structures that contain α-synuclein (α-Syn). We reveal that Munc18-1 binds α-Syn, and its EIEE mutants coaggregate α-Syn. Likewise, removal of endogenous Munc18-1 increases the aggregative propensity of α-Syn(WT) and that of the Parkinson's disease-causing α-Syn(A30P) mutant, an effect rescued by Munc18-1(WT) expression, indicative of chaperone activity. Coexpression of the α-Syn(A30P) mutant with Munc18-1 reduced the number of α-Syn(A30P) aggregates. Munc18-1 mutations and haploinsufficiency may therefore trigger a pathogenic gain of function through both the corruption of native Munc18-1 and a perturbed chaperone activity for α-Syn leading to aggregation-induced neurodegeneration. © 2016 Chai et al.
Munc18-1 is a molecular chaperone for α-synuclein, controlling its self-replicating aggregation
Giles, Nichole; Morrow, Isabel C.; Collins, Brett M.
2016-01-01
Munc18-1 is a key component of the exocytic machinery that controls neurotransmitter release. Munc18-1 heterozygous mutations cause developmental defects and epileptic phenotypes, including infantile epileptic encephalopathy (EIEE), suggestive of a gain of pathological function. Here, we used single-molecule analysis, gene-edited cells, and neurons to demonstrate that Munc18-1 EIEE-causing mutants form large polymers that coaggregate wild-type Munc18-1 in vitro and in cells. Surprisingly, Munc18-1 EIEE mutants also form Lewy body–like structures that contain α-synuclein (α-Syn). We reveal that Munc18-1 binds α-Syn, and its EIEE mutants coaggregate α-Syn. Likewise, removal of endogenous Munc18-1 increases the aggregative propensity of α-SynWT and that of the Parkinson’s disease–causing α-SynA30P mutant, an effect rescued by Munc18-1WT expression, indicative of chaperone activity. Coexpression of the α-SynA30P mutant with Munc18-1 reduced the number of α-SynA30P aggregates. Munc18-1 mutations and haploinsufficiency may therefore trigger a pathogenic gain of function through both the corruption of native Munc18-1 and a perturbed chaperone activity for α-Syn leading to aggregation-induced neurodegeneration. PMID:27597756
McCourt, Peter; Browse, John; Watson, Jan; Arntzen, Charles J.; Somerville, Chris R.
1985-01-01
Several lines of evidence support the proposal that the unusual chloroplast-specific lipid acyl group Δ3,trans-hexadecenoic acid (trans-C16:1) stimulates the formation or maintenance of the oligomeric form of the light-harvesting chlorophyll a/b complex (LHCP). To assess the functional significance of this apparent association we have analyzed LHCP structure and function in a mutant of Arabidopsis thaliana (L.) which lacks trans-C16:1 by electrophoretic analysis of the protein-chlorophyll complexes and by measurements of chlorophyll fluorescence under a variety of conditions. By these criteria the putative oligomeric form of LHCP appears to be slightly more labile to detergent-mediated dissociation in the mutant. The oligomeric PSI chlorophyll-protein complex, associated with PSI, was also more labile to detergent-mediated dissociation in the mutant, suggesting a previously unsuspected association of trans-C16:1 with the PSI complex. However, no significant effect of the mutation on the efficiency of energy transfer from LHCP to the photochemical reaction centers was observed under any of the various conditions imposed. Also, the stability of the chlorophyll-protein complexes to temperature-induced dissociation was unaffected in the mutant. The role of trans-C16:1 is very subtle or is only conditionally expressed. Images Fig. 1 PMID:16664340
Atkinson, Nicky; Leitão, Nuno; Orr, Douglas J; Meyer, Moritz T; Carmo-Silva, Elizabete; Griffiths, Howard; Smith, Alison M; McCormick, Alistair J
2017-04-01
Introducing components of algal carbon concentrating mechanisms (CCMs) into higher plant chloroplasts could increase photosynthetic productivity. A key component is the Rubisco-containing pyrenoid that is needed to minimise CO 2 retro-diffusion for CCM operating efficiency. Rubisco in Arabidopsis was re-engineered to incorporate sequence elements that are thought to be essential for recruitment of Rubisco to the pyrenoid, namely the algal Rubisco small subunit (SSU, encoded by rbcS) or only the surface-exposed algal SSU α-helices. Leaves of Arabidopsis rbcs mutants expressing 'pyrenoid-competent' chimeric Arabidopsis SSUs containing the SSU α-helices from Chlamydomonas reinhardtii can form hybrid Rubisco complexes with catalytic properties similar to those of native Rubisco, suggesting that the α-helices are catalytically neutral. The growth and photosynthetic performance of complemented Arabidopsis rbcs mutants producing near wild-type levels of the hybrid Rubisco were similar to those of wild-type controls. Arabidopsis rbcs mutants expressing a Chlamydomonas SSU differed from wild-type plants with respect to Rubisco catalysis, photosynthesis and growth. This confirms a role for the SSU in influencing Rubisco catalytic properties. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Parker, J Alex; Metzler, Martina; Georgiou, John; Mage, Marilyne; Roder, John C; Rose, Ann M; Hayden, Michael R; Néri, Christian
2007-10-10
Huntingtin-interacting protein 1 (HIP1) was identified through its interaction with htt (huntingtin), the Huntington's disease (HD) protein. HIP1 is an endocytic protein that influences transport and function of AMPA and NMDA receptors in the brain. However, little is known about its contribution to neuronal dysfunction in HD. We report that the Caenorhabditis elegans HIP1 homolog hipr-1 modulates presynaptic activity and the abundance of synaptobrevin, a protein involved in synaptic vesicle fusion. Presynaptic function was also altered in hippocampal brain slices of HIP1-/- mice demonstrating delayed recovery from synaptic depression and a reduction in paired-pulse facilitation, a form of presynaptic plasticity. Interestingly, neuronal dysfunction in transgenic nematodes expressing mutant N-terminal huntingtin was specifically enhanced by hipr-1 loss of function. A similar effect was observed with several other mutant proteins that are expressed at the synapse and involved in endocytosis, such as unc-11/AP180, unc-26/synaptojanin, and unc-57/endophilin. Thus, HIP1 is involved in presynaptic nerve terminal activity and modulation of mutant polyglutamine-induced neuronal dysfunction. Moreover, synaptic proteins involved in endocytosis may protect neurons against amino acid homopolymer expansion.
Kamisaka, Yasushi; Kimura, Kazuyoshi; Uemura, Hiroshi; Yamaoka, Masakazu
2013-08-01
Lipid production by Saccharomyces cerevisiae was improved by overexpression of the yeast diacylglycerol acyltransferase Dga1p lacking the N-terminal 29 amino acids (Dga1∆Np), which was previously found to be an active form in the ∆snf2 mutant. Overexpression of Dga1∆Np in the ∆snf2 mutant, however, did not increase lipid content as expected, which prompted us to search for a more suitable strain in which to study the role of Dga1∆Np in lipid accumulation. We found that the overexpression of Dga1∆Np in the ∆dga1 mutant effectively increased the lipid content up to about 45 % in the medium containing 10 % glucose. The high lipid content of the transformant was dependent on glucose concentration, nitrogen limitation, and active leucine biosynthesis. To better understand the effect of dga1 disruption on the ability of Dga1∆Np to stimulate lipid accumulation, the ∆dga1-1 mutant, in which the 3'-terminal 36 bp of the dga1 open reading frame (ORF) remained, and the ∆dga1-2 mutant, in which the 3'-terminal 36 bp were also deleted, were prepared with URA3 disruption cassettes. Surprisingly, the overexpression of Dga1∆Np in the ∆dga1-1 mutant had a lower lipid content than the original ∆dga1 mutant, whereas overexpression in the ∆dga1-2 mutant led to a high lipid content of about 45 %. These results indicated that deletion of the 3' terminal region of the dga1 ORF, rather than abrogation of genomic Dga1p expression, was crucial for the effect of Dga1∆Np on lipid accumulation. To investigate whether dga1 disruption affected gene expression adjacent to DGA1, we found that the overexpression of Esa1p together with Dga1∆Np in the ∆dga1 mutant reverted the lipid content to the level of the wild-type strain overexpressing Dga1∆Np. In addition, RT-qPCR analysis revealed that ESA1 mRNA expression in the ∆dga1 mutant was decreased compared to the wild-type strain at the early stages of culture, suggesting that lowered Esa1p expression is involved in the effect of dga1 disruption on Dga1∆Np-dependent lipid accumulation. These results provide a new strategy to engineer S. cerevisiae for optimal lipid production.
Lynn, K; Fernandez, A; Aida, M; Sedbrook, J; Tasaka, M; Masson, P; Barton, M K
1999-02-01
Several lines of evidence indicate that the adaxial leaf domain possesses a unique competence to form shoot apical meristems. Factors required for this competence are expected to cause a defect in shoot apical meristem formation when inactivated and to be expressed or active preferentially in the adaxial leaf domain. PINHEAD, a member of a family of proteins that includes the translation factor eIF2C, is required for reliable formation of primary and axillary shoot apical meristems. In addition to high-level expression in the vasculature, we find that low-level PINHEAD expression defines a novel domain of positional identity in the plant. This domain consists of adaxial leaf primordia and the meristem. These findings suggest that the PINHEAD gene product may be a component of a hypothetical meristem forming competence factor. We also describe defects in floral organ number and shape, as well as aberrant embryo and ovule development associated with pinhead mutants, thus elaborating on the role of PINHEAD in Arabidopsis development. In addition, we find that embryos doubly mutant for PINHEAD and ARGONAUTE1, a related, ubiquitously expressed family member, fail to progress to bilateral symmetry and do not accumulate the SHOOT MERISTEMLESS protein. Therefore PINHEAD and ARGONAUTE1 together act to allow wild-type growth and gene expression patterns during embryogenesis.
Prion Propagation in Cells Expressing PrP Glycosylation Mutants ▿
Salamat, Muhammad K.; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert
2011-01-01
Infection by prions involves conversion of a host-encoded cell surface protein (PrPC) to a disease-related isoform (PrPSc). PrPC carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrPC glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrPSc and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrPSc, while PrPC with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrPC, were able to form infectious PrPSc. Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection. PMID:21248032
Atack, John M; Srikhanta, Yogitha N; Djoko, Karrera Y; Welch, Jessica P; Hasri, Norain H M; Steichen, Christopher T; Vanden Hoven, Rachel N; Grimmond, Sean M; Othman, Dk Seti Maimonah Pg; Kappler, Ulrike; Apicella, Michael A; Jennings, Michael P; Edwards, Jennifer L; McEwan, Alastair G
2013-06-01
NtrYX is a sensor-histidine kinase/response regulator two-component system that has had limited characterization in a small number of Alphaproteobacteria. Phylogenetic analysis of the response regulator NtrX showed that this two-component system is extensively distributed across the bacterial domain, and it is present in a variety of Betaproteobacteria, including the human pathogen Neisseria gonorrhoeae. Microarray analysis revealed that the expression of several components of the respiratory chain was reduced in an N. gonorrhoeae ntrX mutant compared to that in the isogenic wild-type (WT) strain 1291. These included the cytochrome c oxidase subunit (ccoP), nitrite reductase (aniA), and nitric oxide reductase (norB). Enzyme activity assays showed decreased cytochrome oxidase and nitrite reductase activities in the ntrX mutant, consistent with microarray data. N. gonorrhoeae ntrX mutants had reduced capacity to survive inside primary cervical cells compared to the wild type, and although they retained the ability to form a biofilm, they exhibited reduced survival within the biofilm compared to wild-type cells, as indicated by LIVE/DEAD staining. Analyses of an ntrX mutant in a representative alphaproteobacterium, Rhodobacter capsulatus, showed that cytochrome oxidase activity was also reduced compared to that in the wild-type strain SB1003. Taken together, these data provide evidence that the NtrYX two-component system may be a key regulator in the expression of respiratory enzymes and, in particular, cytochrome c oxidase, across a wide range of proteobacteria, including a variety of bacterial pathogens.
ChR2 mutants at L132 and T159 with improved operational light sensitivity for vision restoration.
Pan, Zhuo-Hua; Ganjawala, Tushar H; Lu, Qi; Ivanova, Elena; Zhang, Zhifei
2014-01-01
The ectopic expression of microbial opsin-based optogenetic sensors, such as channelrhodopsin-2 (ChR2) in surviving inner retinal neurons, is a promising approach to restoring vision after retinal degeneration. However, a major limitation in using native ChR2 as a light sensor for vision restoration is the low light sensitivity of its expressing cells. Recently, two ChR2 mutations, T159C and L132C, were reported to produce higher photocurrents or have ultra light sensitivity. In this study, we created additional ChR2 mutants at these two sites to search for more light responsive ChR2 forms and evaluate their suitability for vision restoration by examining their light responsive properties in HEK cells and mouse retinal ganglion cells. We found additional ChR2 mutants at these two sites that showed a further increase in current amplitude at low light levels in the cells expressing these mutants, or operational light sensitivity. However, the increase in the operational light sensitivity was correlated with a decrease in temporal kinetics. Therefore, there is a trade-off between operational light sensitivity and temporal resolution for these more light responsive ChR2 mutants. Our results showed that for the two most light responsive mutants, L132C/T159C and L132C/T159S, the required light intensities for generating the threshold spiking activity in retinal ganglion cells were 1.5 and nearly 2 log units lower than wild-type ChR2 (wt-ChR2), respectively. Additionally, their ChR2-mediated spiking activities could follow flicker frequencies up to 20 and 10 Hz, respectively, at light intensities up to 1.5 log units above their threshold levels. Thus, the use of these more light responsive ChR2 mutants could make the optogenetic approach to restoring vision more feasible.
Mechanisms of Resistance to Bacteriocins Targeting the Mannose Phosphotransferase System ▿
Kjos, Morten; Nes, Ingolf F.; Diep, Dzung B.
2011-01-01
The membrane proteins IIC and IID of the mannose phosphotransferase system (Man-PTS) together form a membrane-located complex that serves as a receptor for several different bacteriocins, including the pediocin-like class IIa bacteriocins and the class IIc bacteriocin lactococcin A. Bacterial strains sensitive to class IIa bacteriocins readily give rise to resistant mutants upon bacteriocin exposure. In the present study, we have therefore investigated lactococcin A-resistant mutants of Lactococcus lactis as well as natural food isolates of Listeria monocytogenes with different susceptibilities to class IIa bacteriocins. We found two major mechanisms of resistance. The first involves downregulation of Man-PTS gene expression, which takes place both in spontaneous resistant mutants and in natural resistant isolates. The second involves normal expression of the Man-PTS system, but the underlying mechanism of resistance for these cells is unknown. In some cases, the resistant phenotype was linked to a shift in the metabolism; i.e., reduced growth on glucose due to reduction in Man-PTS expression was accompanied by enhanced growth on another sugar, such as galactose. The implications of these findings in terms of metabolic heterogeneity are discussed. PMID:21421780
Li, Lei; Cotmore, Susan F.
2013-01-01
The 121-nucleotide left-end telomere of Minute Virus of Mice (MVM) can be folded into a Y-shaped hairpin with short axial ears that are highly conserved within genus Parvovirus. To explore their potential role(s) during infection, we constructed infectious plasmid clones that lacked one or other ear. Although these were nonviable when transfected into A9 cells, excision of the viral genome and DNA amplification appeared normal, and viral transcripts and proteins were expressed, but progeny virion production was minimal, supporting the idea of a potential role for the ears in genome packaging. To circumvent the absence of progeny that confounded further analysis of these mutants, plasmids were transfected into 293T cells both with and without an adenovirus helper construct, generating single bursts of progeny. These virions bound to A9 cells and were internalized but failed to initiate viral transcription, protein expression, or DNA replication. No defects in mutant virion stability or function could be detected in vitro. Significantly, mutant capsid gene expression and DNA replication could be rescued by coinfection with wild-type virions carrying a replication-competent, capsid-gene-replacement vector. To pinpoint where such complementation occurred, prior transfection of plasmids expressing only MVM nonstructural proteins was explored. NS1 alone, but not NS2, rescued transcription and protein expression from both P4 and P38 promoters, whereas NS1 molecules deleted for their C-terminal transactivation domain did not. These results suggest that the mutant virions reach the nucleus, uncoat, and are converted to duplex DNA but require an intact left-end hairpin structure to form the initiating transcription complex. PMID:23903839
Ruiz, Zandra; D'Abramo, Anthony; Tattersall, Peter
2006-06-05
The MVM NS2 proteins are required for viral replication in cells of its normal murine host, but are dispensable in transformed human 324K cells. Alternate splicing at the minor intron controls synthesis of three forms of this protein, which differ in their C-terminal hexapeptides and in their relative abundance, with NS2P and NS2Y, the predominant isoforms, being expressed at a 5:1 ratio. Mutant genomes were constructed with premature termination codons in the C-terminal exons of either NS2P or NS2Y, which resulted in their failure to accumulate in vivo. To modulate their expression levels, we also introduced a mutation at the putative splice branch point of the large intron, dubbed NS2(lo), that reduced total NS2 expression in murine A9 cells such that NS2P accumulated to approximately half the level normally seen for NS2Y. All mutants replicated productively in human 324K cells. In A9 cells, NS2Y(-) mutants replicated like wildtype, and the NS2(lo) mutants expressed NS1 and replicated duplex viral DNA like wildtype, although their progeny single-strand DNA synthesis was reduced. However, while NS2P(-) and NS2-null viruses initiated infection efficiently in A9 cells, they gave diminished NS1 levels, and viral macromolecular synthesis appeared to become paralyzed shortly after the onset of viral duplex DNA amplification, such that no progeny single-strand DNA could be detected. Thus, the NS2P isoform, even when expressed at a level lower than that of NS2Y, performs a critical role in infection of A9 cells that cannot be accomplished by the NS2Y isoform alone.
Gavalas, Anthony; Ruhrberg, Christiana; Livet, Jean; Henderson, Christopher E; Krumlauf, Robb
2003-12-01
Hox genes are instrumental in assigning segmental identity in the developing hindbrain. Auto-, cross- and para-regulatory interactions help establish and maintain their expression. To understand to what extent such regulatory interactions shape neuronal patterning in the hindbrain, we analysed neurogenesis, neuronal differentiation and motoneuron migration in Hoxa1, Hoxb1 and Hoxb2 mutant mice. This comparison revealed that neurogenesis and differentiation of specific neuronal subpopulations in r4 was impaired in a similar fashion in all three mutants, but with different degrees of severity. In the Hoxb1 mutants, neurons derived from the presumptive r4 territory were re-specified towards an r2-like identity. Motoneurons derived from that territory resembled trigeminal motoneurons in both their migration patterns and the expression of molecular markers. Both migrating motoneurons and the resident territory underwent changes consistent with a switch from an r4 to r2 identity. Abnormally migrating motoneurons initially formed ectopic nuclei that were subsequently cleared. Their survival could be prolonged through the introduction of a block in the apoptotic pathway. The Hoxa1 mutant phenotype is consistent with a partial misspecification of the presumptive r4 territory that results from partial Hoxb1 activation. The Hoxb2 mutant phenotype is a hypomorph of the Hoxb1 mutant phenotype, consistent with the overlapping roles of these genes in facial motoneuron specification. Therefore, we have delineated the functional requirements in hindbrain neuronal patterning that follow the establishment of the genetic regulatory hierarchy between Hoxa1, Hoxb1 and Hoxb2.
Odnokoz, Olena; Nakatsuka, Kyle; Klichko, Vladimir I.; Nguyen, Jacqueline; Solis, Liz Calderon; Ostling, Kaitlin; Badinloo, Marziyeh; Orr, William C.; Radyuk, Svetlana N.
2016-01-01
Previously, we have shown that flies under-expressing the two mitochondrial peroxiredoxins (Prxs), dPrx3 and dPrx5, display increases in tissue-specific apoptosis and dramatically shortened life span, associated with a redox crisis, manifested as changes in GSH:GSSG and accumulation of protein mixed disulfides. To identify specific pathways responsible for the observed biological effects, we performed a transcriptome analysis. Functional clustering revealed a prominent group enriched for immunity-related genes, including a considerable number of NF-kB-dependent antimicrobial peptides (AMP) that are up-regulated in the Prx double mutant. Using qRT-PCR analysis we determined that the age-dependent changes in AMP levels in mutant flies were similar to those observed in controls when scaled to percentage of life span. To further clarify the role of Prx-dependent mitochondrial signaling, we expressed different forms of dPrx5, which unlike the uniquely mitochondrial dPrx3 is found in multiple subcellular compartments, including mitochondrion, nucleus and cytosol. Ectopic expression of dPrx5 in mitochondria but not nucleus or cytosol partially extended longevity under normal or oxidative stress conditions while complete restoration of life span occurred when all three forms of dPrx5 were expressed from the wild type dPrx5 transgene. When dPrx5 was expressed in mitochondria or in all three compartments, it substantially delayed the development of hyperactive immunity while expression of cytosolic or nuclear forms had no effect on the immune phenotype. The data suggest a critical role of mitochondria in development of chronic activation of the immune response triggered by impaired redox control. PMID:27770625
Films of Bacteria at Interfaces (FBI): Remodeling of Fluid Interfaces by Pseudomonas aeruginosa.
Niepa, Tagbo H R; Vaccari, Liana; Leheny, Robert L; Goulian, Mark; Lee, Daeyeon; Stebe, Kathleen J
2017-12-19
Bacteria at fluid interfaces endure physical and chemical stresses unique to these highly asymmetric environments. The responses of Pseudomonas aeruginosa PAO1 and PA14 to a hexadecane-water interface are compared. PAO1 cells form elastic films of bacteria, excreted polysaccharides and proteins, whereas PA14 cells move actively without forming an elastic film. Studies of PAO1 mutants show that, unlike solid-supported biofilms, elastic interfacial film formation occurs in the absence of flagella, pili, or certain polysaccharides. Highly induced genes identified in transcriptional profiling include those for putative enzymes and a carbohydrate metabolism enzyme, alkB2; this latter gene is not upregulated in PA14 cells. Notably, PAO1 mutants lacking the alkB2 gene fail to form an elastic layer. Rather, they form an active film like that formed by PA14. These findings demonstrate that genetic expression is altered by interfacial confinement, and suggest that the ability to metabolize alkanes may play a role in elastic film formation at oil-water interfaces.
Sun, Wei; Roland, Kenneth L; Kuang, Xiaoying; Branger, Christine G; Curtiss, Roy
2010-03-01
Two mutant strains of Yersinia pestis KIM5+, a Deltacrp mutant and a mutant with arabinose-dependent regulated delayed-shutoff crp expression (araC P(BAD) crp), were constructed, characterized in vitro, and evaluated for virulence, immunogenicity, and protective efficacy in mice. Both strains were highly attenuated by the subcutaneous (s.c.) route. The 50% lethal doses (LD(50)s) of the Deltacrp and araC P(BAD) crp mutants were approximately 1,000,000-fold and 10,000-fold higher than those of Y. pestis KIM5+, respectively, indicating that both strains were highly attenuated. Mice vaccinated s.c. with 3.8 x 10(7) CFU of the Deltacrp mutant developed high anti-Y. pestis and anti-LcrV serum IgG titers, both with a strong Th2 bias, and induced protective immunity against subcutaneous challenge with virulent Y. pestis (80% survival) but no protection against pulmonary challenge. Mice vaccinated with 3.0 x 10(4) CFU of the araC P(BAD) crp mutant also developed high anti-Y. pestis and anti-LcrV serum IgG titers but with a more balanced Th1/Th2 response. This strain induced complete protection against s.c. challenge and partial protection (70% survival) against pulmonary challenge. Our results demonstrate that arabinose-dependent regulated crp expression is an effective strategy to attenuate Y. pestis while retaining strong immunogenicity, leading to protection against the pneumonic and bubonic forms of plague.
Schaefer, Natascha; Kluck, Christoph J; Price, Kerry L; Meiselbach, Heike; Vornberger, Nadine; Schwarzinger, Stephan; Hartmann, Stephanie; Langlhofer, Georg; Schulz, Solveig; Schlegel, Nadja; Brockmann, Knut; Lynch, Bryan; Becker, Cord-Michael; Lummis, Sarah C R; Villmann, Carmen
2015-01-07
Recent studies on the pathogenic mechanisms of recessive hyperekplexia indicate disturbances in glycine receptor (GlyR) α1 biogenesis. Here, we examine the properties of a range of novel glycine receptor mutants identified in human hyperekplexia patients using expression in transfected cell lines and primary neurons. All of the novel mutants localized in the large extracellular domain of the GlyR α1 have reduced cell surface expression with a high proportion of receptors being retained in the ER, although there is forward trafficking of glycosylated subpopulations into the ER-Golgi intermediate compartment and cis-Golgi compartment. CD spectroscopy revealed that the mutant receptors have proportions of secondary structural elements similar to wild-type receptors. Two mutants in loop B (G160R, T162M) were functional, but none of those in loop D/β2-3 were. One nonfunctional truncated mutant (R316X) could be rescued by coexpression with the lacking C-terminal domain. We conclude that a proportion of GlyR α1 mutants can be transported to the plasma membrane but do not necessarily form functional ion channels. We suggest that loop D/β2-3 is an important determinant for GlyR trafficking and functionality, whereas alterations to loop B alter agonist potencies, indicating that residues here are critical elements in ligand binding. Copyright © 2015 the authors 0270-6474/15/350422-16$15.00/0.
Kim, Jeong Im; Ciesielski, Peter N.; Donohoe, Bryon S.; Chapple, Clint; Li, Xu
2014-01-01
The phenylpropanoid pathway is responsible for the biosynthesis of diverse and important secondary metabolites including lignin and flavonoids. The reduced epidermal fluorescence8 (ref8) mutant of Arabidopsis (Arabidopsis thaliana), which is defective in a lignin biosynthetic enzyme p-coumaroyl shikimate 3′-hydroxylase (C3′H), exhibits severe dwarfism and sterility. To better understand the impact of perturbation of phenylpropanoid metabolism on plant growth, we generated a chemically inducible C3′H expression construct and transformed it into the ref8 mutant. Application of dexamethasone to these plants greatly alleviates the dwarfism and sterility and substantially reverses the biochemical phenotypes of ref8 plants, including the reduction of lignin content and hyperaccumulation of flavonoids and p-coumarate esters. Induction of C3′H expression at different developmental stages has distinct impacts on plant growth. Although early induction effectively restored the elongation of primary inflorescence stem, application to 7-week-old plants enabled them to produce new rosette inflorescence stems. Examination of hypocotyls of these plants revealed normal vasculature in the newly formed secondary xylem, presumably restoring water transport in the mutant. The ref8 mutant accumulates higher levels of salicylic acid than the wild type, but depletion of this compound in ref8 did not relieve the mutant’s growth defects, suggesting that the hyperaccumulation of salicylic acid is unlikely to be responsible for dwarfism in this mutant. PMID:24381065
Dinan, Adam M; Atkins, John F; Firth, Andrew E
2017-10-16
Programmed ribosomal frameshifting (PRF) is a gene expression mechanism which enables the translation of two N-terminally coincident, C-terminally distinct protein products from a single mRNA. Many viruses utilize PRF to control or regulate gene expression, but very few phylogenetically conserved examples are known in vertebrate genes. Additional sex combs-like (ASXL) genes 1 and 2 encode important epigenetic and transcriptional regulatory proteins that control the expression of homeotic genes during key developmental stages. Here we describe an ~150-codon overlapping ORF (termed TF) in ASXL1 and ASXL2 that, with few exceptions, is conserved throughout vertebrates. Conservation of the TF ORF, strong suppression of synonymous site variation in the overlap region, and the completely conserved presence of an EH[N/S]Y motif (a known binding site for Host Cell Factor-1, HCF-1, an epigenetic regulatory factor), all indicate that TF is a protein-coding sequence. A highly conserved UCC_UUU_CGU sequence (identical to the known site of +1 ribosomal frameshifting for influenza virus PA-X expression) occurs at the 5' end of the region of enhanced synonymous site conservation in ASXL1. Similarly, a highly conserved RG_GUC_UCU sequence (identical to a known site of -2 ribosomal frameshifting for arterivirus nsp2TF expression) occurs at the 5' end of the region of enhanced synonymous site conservation in ASXL2. Due to a lack of appropriate splice forms, or initiation sites, the most plausible mechanism for translation of the ASXL1 and 2 TF regions is ribosomal frameshifting, resulting in a transframe fusion of the N-terminal half of ASXL1 or 2 to the TF product, termed ASXL-TF. Truncation or frameshift mutants of ASXL are linked to myeloid malignancies and genetic diseases, such as Bohring-Opitz syndrome, likely at least in part as a result of gain-of-function or dominant-negative effects. Our hypothesis now indicates that these disease-associated mutant forms represent overexpressed defective versions of ASXL-TF. This article was reviewed by Laurence Hurst and Eugene Koonin.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Imhof, Simon; Vu, Xuan Lan; Bütikofer, Peter; Roditi, Isabel
2015-06-01
Transmission of African trypanosomes by tsetse flies requires that the parasites migrate out of the midgut lumen and colonize the ectoperitrophic space. Early procyclic culture forms correspond to trypanosomes in the lumen; on agarose plates they exhibit social motility, migrating en masse as radial projections from an inoculation site. We show that an Rft1(-/-) mutant needs to reach a greater threshold number before migration begins, and that it forms fewer projections than its wild-type parent. The mutant is also up to 4 times less efficient at establishing midgut infections. Ectopic expression of Rft1 rescues social motility defects and restores the ability to colonize the fly. These results are consistent with social motility reflecting movement to the ectoperitrophic space, implicate N-glycans in the signaling cascades for migration in vivo and in vitro, and provide the first evidence that parasite-parasite interactions determine the success of transmission by the insect host. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Stalk cell differentiation without polyketides in the cellular slime mold.
Sato, Yukie G; Suarez, Teresa; Saito, Tamao
2016-07-01
Polyketides induce prestalk cell differentiation in Dictyostelium. In the double-knockout mutant of the SteelyA and B polyketide synthases, most of the pstA cells-the major part of the prestalk cells-are lost, and we show by whole mount in situ hybridization that expression of prestalk genes is also reduced. Treatment of the double-knockout mutant with the PKS inhibitor cerulenin gave a further reduction, but some pstA cells still remained in the tip region, suggesting the existence of a polyketide-independent subtype of pstA cells. The double-knockout mutant and cerulenin-treated parental Ax2 cells form fruiting bodies with fragile, single-cell layered stalks after cerulenin treatment. Our results indicate that most pstA cells are induced by polyketides, but the pstA cells at the very tip of the slug are induced in some other way. In addition, a fruiting body with a single-cell layered, vacuolated stalk can form without polyketides.
Saeed, Sadia; Tremp, Annie Z; Dessens, Johannes T
2012-10-01
Malaria parasites express a conserved family of LCCL-lectin adhesive-like domain proteins (LAPs) that have essential functions in sporozoite transmission. In Plasmodium falciparum all six family members are expressed in gametocytes and form a multi-protein complex. Intriguingly, knockout of P. falciparum LCCL proteins adversely affects expression of other family members at protein, but not at mRNA level, a phenomenon termed co-dependent expression. Here, we investigate this in Plasmodium berghei by crossing a PbLAP1 null mutant parasite with a parasite line expressing GFP-tagged PbLAP3 that displays strong fluorescence in gametocytes. Selected and validated double mutants show normal synthesis and subcellular localization of PbLAP3::GFP. However, GFP-based fluorescence is dramatically reduced without PbLAP1 present, indicating that PbLAP1 and PbLAP3 interact. Moreover, absence of PbLAP1 markedly reduces the half-life of PbLAP3, consistent with a scenario of misfolding. These findings unveil a potential mechanism of conformational interdependence that facilitates assembly and stability of the functional LCCL protein complex. Copyright © 2012 Elsevier B.V. All rights reserved.
Lusson, J; Benjannet, S; Hamelin, J; Savaria, D; Chrétien, M; Seidah, N G
1997-01-01
In order to define the functional importance of the conserved RRGDL motif in the P-domain of the mammalian proprotein convertases(PCs) we generated and cellularly expressed three mutant PC1 vaccinia-virus (VV) recombinants: ARGDL-PC1, RAGDL-PC1 and RRGEL-PC1. Functionally, these mutants caused a decreased level of processing of pro-opiomelanocortin (POMC) into beta-lipotropic pituitary hormone (beta-LPH), especially in the constitutively secreting BSC40 cells. Pulse-chase analyses demonstrated that, in part, this effect was due to both an increased degradation of the mutant PC1s within the endoplasmic reticulum and to a diminished level of zymogen processing in the same compartment. In addition, within cells containing secretory granules such as PC12 and GH4C1 cells, such mutations prevented the C-terminal auto-processing of PC1 into the fully mature 66 kDa form stored in the secretory granules of regulated cells. Since the 66 kDa PC1 is the most active form of the enzyme, it is proposed that the RRGDL sequence is critical for the generation of maximal intracellular PC1 activity. In regulated cells, co-expression of POMC with PC1 or its mutants together with the general PC inhibitor alpha1-antitrypsin Portland (alpha1-PDX), which acts primarily within the constitutive secretory pathway, demonstrated that the latter completely inhibited the formation of beta-LPH by PC1 mutants, whereas it only partially inhibited the ability of wild-type PC1 to process POMC. This suggests that RRGDL mutations prevent PC1 from entering secretory granules and hence the formation of the 66 kDa PC1, and result in the mis-sorting of PC1 mutants towards the constitutive secretory pathway. This conclusion was further supported by immunocytochemical data demonstrating that RRGDL mutants exhibit an intracellular localization pattern different from that of the granule-associated wild-type PC1,but similar to that of the Golgi-localized convertase PC5-B. PMID:9307023
Dominant-negative inhibitors of the Clostridium perfringens epsilon-toxin.
Pelish, Teal M; McClain, Mark S
2009-10-23
The Clostridium perfringens epsilon-toxin is responsible for a severe, often lethal intoxication. In this study, we characterized dominant-negative inhibitors of the epsilon-toxin. Site-specific mutations were introduced into the gene encoding epsilon-toxin, and recombinant proteins were expressed in Escherichia coli. Paired cysteine substitutions were introduced at locations predicted to form a disulfide bond. One cysteine in each mutant was introduced into the membrane insertion domain of the toxin; the second cysteine was introduced into the protein backbone. Mutant proteins with cysteine substitutions at amino acid positions I51/A114 and at V56/F118 lacked detectable cytotoxic activity in a MDCK cell assay. Cytotoxic activity could be reconstituted in both mutant proteins by incubation with dithiothreitol, indicating that the lack of cytotoxic activity was attributable to the formation of a disulfide bond. Fluorescent labeling of the cysteines also indicated that the introduced cysteines participated in a disulfide bond. When equimolar mixtures of wild-type epsilon-toxin and mutant proteins were added to MDCK cells, the I51C/A114C and V56C/F118C mutant proteins each inhibited the activity of wild-type epsilon-toxin. Further analysis of the inhibitory activity of the I51C/A114C and V56C/F118C mutant proteins indicated that these proteins inhibit the ability of the active toxin to form stable oligomeric complexes in the context of MDCK cells. These results provide further insight into the properties of dominant-negative inhibitors of oligomeric pore-forming toxins and provide the basis for developing new therapeutics for treating intoxication by epsilon-toxin.
Benmohamed, Radhia; Arvanites, Anthony C; Kim, Jinho; Ferrante, Robert J; Silverman, Richard B; Morimoto, Richard I; Kirsch, Donald R
2011-03-01
The underlying cause of amyotrophic lateral sclerosis (ALS), a progressive neurodegenerative disorder, remains unknown. However, there is strong evidence that one pathophysiological mechanism, toxic protein misfolding and/or aggregation, may trigger motor neuron dysfunction and loss. Since the clinical and pathological features of sporadic and familial ALS are indistinguishable, all forms of the disease may be better understood and ultimately treated by studying pathogenesis and therapy in models expressing mutant forms of SOD1. We developed a cellular model in which cell death depended on the expression of G93A-SOD1, a mutant form of superoxide dismutase found in familial ALS patients that produces toxic protein aggregates. This cellular model was optimized for high throughput screening to identify protective compounds from a >50,000 member chemical library. Three novel chemical scaffolds were selected for further study following screen implementation, counter-screening and secondary testing, including studies with purchased analogs. All three scaffolds blocked SOD1 aggregation in high content screening assays and data on the optimization and further characterization of these compounds will be reported separately. These data suggest that optimization of these chemicals scaffolds may produce therapeutic candidates for ALS patients.
A Heme-responsive Regulator Controls Synthesis of Staphyloferrin B in Staphylococcus aureus*♦
Laakso, Holly A.; Marolda, Cristina L.; Pinter, Tyler B.; Stillman, Martin J.; Heinrichs, David E.
2016-01-01
Staphylococcus aureus possesses a multitude of mechanisms by which it can obtain iron during growth under iron starvation conditions. It expresses an effective heme acquisition system (the iron-regulated surface determinant system), it produces two carboxylate-type siderophores staphyloferrin A and staphyloferrin B (SB), and it expresses transporters for many other siderophores that it does not synthesize. The ferric uptake regulator protein regulates expression of genes encoding all of these systems. Mechanisms of fine-tuning expression of iron-regulated genes, beyond simple iron regulation via ferric uptake regulator, have not been uncovered in this organism. Here, we identify the ninth gene of the sbn operon, sbnI, as encoding a ParB/Spo0J-like protein that is required for expression of genes in the sbn operon from sbnD onward. Expression of sbnD–I is drastically decreased in an sbnI mutant, and the mutant does not synthesize detectable SB during early phases of growth. Thus, SB-mediated iron acquisition is impaired in an sbnI mutant strain. We show that the protein forms dimers and tetramers in solution and binds to DNA within the sbnC coding region. Moreover, we show that SbnI binds heme and that heme-bound SbnI does not bind DNA. Finally, we show that providing exogenous heme to S. aureus growing in an iron-free medium results in delayed synthesis of SB. This is the first study in S. aureus that identifies a DNA-binding regulatory protein that senses heme to control gene expression for siderophore synthesis. PMID:26534960
Tight Junction Protein 1a regulates pigment cell organisation during zebrafish colour patterning.
Fadeev, Andrey; Krauss, Jana; Frohnhöfer, Hans Georg; Irion, Uwe; Nüsslein-Volhard, Christiane
2015-04-27
Zebrafish display a prominent pattern of alternating dark and light stripes generated by the precise positioning of pigment cells in the skin. This arrangement is the result of coordinated cell movements, cell shape changes, and the organisation of pigment cells during metamorphosis. Iridophores play a crucial part in this process by switching between the dense form of the light stripes and the loose form of the dark stripes. Adult schachbrett (sbr) mutants exhibit delayed changes in iridophore shape and organisation caused by truncations in Tight Junction Protein 1a (ZO-1a). In sbr mutants, the dark stripes are interrupted by dense iridophores invading as coherent sheets. Immuno-labelling and chimeric analyses indicate that Tjp1a is expressed in dense iridophores but down-regulated in the loose form. Tjp1a is a novel regulator of cell shape changes during colour pattern formation and the first cytoplasmic protein implicated in this process.
Liu, Yanhong; Yoo, Brian B.; Hwang, Cheng-An; Suo, Yujuan; Sheen, Shiowshuh; Khosravi, Parvaneh; Huang, Lihan
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes listeriosis, which is a major public health concern due to the high fatality rate. LMOf2365_0442, 0443, and 0444 encode for fructose-specific EIIABC components of phosphotransferase transport system (PTS) permease that is responsible for sugar transport. In previous studies, in-frame deletion mutants of a putative fructose-specific PTS permease (LMOf2365_0442, 0443, and 0444) were constructed and analyzed. However, the virulence potential of these deletion mutants has not been studied. In this study, two in vitro methods were used to analyze the virulence potential of these L. monocytogenes deletion mutants. First, invasion assays were used to measure the invasion efficiencies to host cells using the human HT-29 cell line. Second, plaque forming assays were used to measure cell-to-cell spread in host cells. Our results showed that the deletion mutant ΔLMOf2365_0442 had reduced invasion and cell-to-cell spread efficiencies in human cell line compared to the parental strain LMOf2365, indicating that LMOf2365_0442 encoding for a fructose specific PTS permease IIA may be required for virulence in L. monocytogenes strain F2365. In addition, the gene expression levels of 15 virulence and stress-related genes were analyzed in the stationary phase cells of the deletion mutants using RT-PCR assays. Virulence-related gene expression levels were elevated in the deletion mutants ΔLMOf2365_0442-0444 compared to the wild type parental strain LMOf2365, indicating the down-regulation of virulence genes by this PTS permease in L. monocytogenes. Finally, stress-related gene clpC expression levels were also increased in all of the deletion mutants, suggesting the involvement of this PTS permease in stress response. Furthermore, these deletion mutants displayed the same pressure tolerance and the same capacity for biofilm formation compared to the wild-type parental strain LMOf2365. In summary, our findings suggest that the LMOf2365_0442 gene can be used as a potential target to develop inhibitors for new therapeutic and pathogen control strategies for public health. PMID:28900418
Kawaharada, Yasuyuki; James, Euan K; Kelly, Simon; Sandal, Niels; Stougaard, Jens
2017-03-01
Several hundred genes are transcriptionally regulated during infection-thread formation and development of nitrogen-fixing root nodules. We have characterized a set of Lotus japonicus mutants impaired in root-nodule formation and found that the causative gene, Ern1, encodes a protein with a characteristic APETALA2/Ethylene Responsive Factor (AP2/ERF) transcription-factor domain. Phenotypic characterization of four ern1 alleles shows that infection pockets are formed but root-hair infection threads are absent. Formation of root-nodule primordia is delayed and no normal transcellular infection threads are found in the infected nodules. Corroborating the role of ERN1 (ERF Required for Nodulation1) in nodule organogenesis, spontaneous nodulation induced by an autoactive CCaMK and cytokinin-induced nodule primordia were not observed in ern1 mutants. Expression of Ern1 is induced in the susceptible zone by Nod factor treatment or rhizobial inoculation. At the cellular level, the pErn1:GUS reporter is highly expressed in root epidermal cells of the susceptible zone and in the cortical cells that form nodule primordia. The genetic regulation of this cellular expression pattern was further investigated in symbiotic mutants. Nod factor induction of Ern1 in epidermal cells was found to depend on Nfr1, Cyclops, and Nsp2 but was independent of Nin and Nf-ya1. These results suggest that ERN1 functions as a transcriptional regulator involved in the formation of infection threads and development of nodule primordia and may coordinate these two processes.
Gap junction-dependent homolog avoidance in the developing CNS.
Baker, Michael W; Yazdani, Neema; Macagno, Eduardo R
2013-10-16
Oppositely directed projections of some homologous neurons in the developing CNS of the medicinal leech (Hirudo verbana), such as the AP cells, undergo a form of contact-dependent homolog avoidance. Embryonic APs extend axons within the connective nerve toward adjacent ganglia, in which they meet and form gap junctions (GJs) with the oppositely directed axons of their segmental homologs, stop growing, and are later permanently retracted (Wolszon et al., 1994a,b). However, early deletion of an AP neuron leads to resumed growth and permanent maintenance of the projections of neighboring APs. Here we test the hypothesis that a GJ-based signaling mechanism is responsible for this instance of homolog avoidance. We demonstrate that selective knockdown of GJ gene Hve-inx1 expression in single embryonic APs, by expressing a short-hairpin interfering RNA, leads to continued growth of the projections of the cell toward, into, and beyond adjacent ganglia. Moreover, the projections of the APs in adjacent ganglia also resume growth, mimicking their responses to cell deletion. Continued growth was also observed when two different INX1 mutant transgenes that abolish dye coupling between APs were expressed. These include a mutant transgene that effectively downregulates all GJ plaques that include the INX1 protein and a closed channel INX1 mutant that retains the adhesive cellular binding characteristic of INX1 GJs but not the open channel pore function. Our results add GJ intercellular communication to the list of molecular signaling mechanisms that can act as mediators of growth-inhibiting cell-cell interactions that define the topography of neuronal arbors.
Cheng, Hai-Ping; Walker, Graham C.
1998-01-01
Rhizobium meliloti Rm1021 must be able to synthesize succinoglycan in order to invade successfully the nodules which it elicits on alfalfa and to establish an effective nitrogen-fixing symbiosis. Using R. meliloti cells that express green fluorescent protein (GFP), we have examined the nature of the symbiotic deficiency of exo mutants that are defective or altered in succinoglycan production. Our observations indicate that an exoY mutant, which does not produce succinoglycan, is symbiotically defective because it cannot initiate the formation of infection threads. An exoZ mutant, which produces succinoglycan without the acetyl modification, forms nitrogen-fixing nodules on plants, but it exhibits a reduced efficiency in the initiation and elongation of infection threads. An exoH mutant, which produces symbiotically nonfunctional high-molecular-weight succinoglycan that lacks the succinyl modification, cannot form extended infection threads. Infection threads initiate at a reduced rate and then abort before they reach the base of the root hairs. Overproduction of succinoglycan by the exoS96::Tn5 mutant does not reduce the efficiency of infection thread initiation and elongation, but it does significantly reduce the ability of this mutant to colonize the curled root hairs, which is the first step of the invasion process. The exoR95::Tn5 mutant, which overproduces succinoglycan to an even greater extent than the exoS96::Tn5 mutant, has completely lost its ability to colonize the curled root hairs. These new observations lead us to propose that succinoglycan is required for both the initiation and elongation of infection threads during nodule invasion and that excess production of succinoglycan interferes with the ability of the rhizobia to colonize curled root hairs. PMID:9748453
Candidate genes for panhypopituitarism identified by gene expression profiling
Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis
2011-01-01
Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya
2006-08-04
Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less
Martínez-Silva, Ana Valeria; Aguirre-Martínez, César; Flores-Tinoco, Carlos E.; Alejandri-Ramírez, Naholi D.; Dinkova, Tzvetanka D.
2012-01-01
One of the most regulated steps of translation initiation is the recruitment of mRNA by the translation machinery. In eukaryotes, this step is mediated by the 5′end cap-binding factor eIF4E bound to the bridge protein eIF4G and forming the eIF4F complex. In plants, different isoforms of eIF4E and eIF4G form the antigenically distinct eIF4F and eIF(iso)4F complexes proposed to mediate selective translation. Using a microarray analysis of polyribosome- and non-polyribosome-purified mRNAs from 15 day-old Arabidopsis thaliana wild type [WT] and eIF(iso)4E knockout mutant [(iso)4E-1] seedlings we found 79 transcripts shifted from polyribosomes toward non-polyribosomes, and 47 mRNAs with the opposite behavior in the knockout mutant. The translationally decreased mRNAs were overrepresented in root-preferentially expressed genes and proteins from the endomembrane system, including several transporters such as the phosphate transporter PHOSPHATE1 (PHO1), Sucrose transporter 3 (SUC3), ABC transporter-like with ATPase activity (MRP11) and five electron transporters, as well as signal transduction-, protein modification- and transcription-related proteins. Under normal growth conditions, eIF(iso)4E expression under the constitutive promoter 35 S enhanced the polyribosomal recruitment of PHO1 supporting its translational preference for eIF(iso)4E. Furthermore, under phosphate deficiency, the PHO1 protein increased in the eIF(iso)4E overexpressing plants and decreased in the knockout mutant as compared to wild type. In addition, the knockout mutant had larger root, whereas the 35 S directed expression of eIF(iso)4E caused shorter root under normal growth conditions, but not under phosphate deficiency. These results indicate that selective translation mediated by eIF(iso)4E is relevant for Arabidopsis root development under normal growth conditions. PMID:22363683
NASA Astrophysics Data System (ADS)
Rich, Devra P.; Anderson, Matthew P.; Gregory, Richard J.; Cheng, Seng H.; Paul, Sucharita; Jefferson, Douglas M.; McCann, John D.; Klinger, Katherine W.; Smith, Alan E.; Welsh, Michael J.
1990-09-01
The cystic fibrosis transmembrane conductance regulator (CFTR) was expressed in cultured cystic fibrosis airway epithelial cells and Cl- channel activation assessed in single cells using a fluorescence microscopic assay and the patch-clamp technique. Expression of CFTR, but not of a mutant form of CFTR (ΔF508), corrected the Cl- channel defect. Correction of the phenotypic defect demonstrates a causal relationship between mutations in the CFTR gene and defective Cl- transport which is the hallmark of the disease.
Sun, Xin; Marque, Leonard O.; Cordner, Zachary; Pruitt, Jennifer L.; Bhat, Manik; Li, Pan P.; Kannan, Geetha; Ladenheim, Ellen E.; Moran, Timothy H.; Margolis, Russell L.; Rudnicki, Dobrila D.
2014-01-01
Huntington's disease (HD) is a neurodegenerative disorder caused by a CAG trinucleotide repeat expansion in the huntingtin (HTT) gene. Disease pathogenesis derives, at least in part, from the long polyglutamine tract encoded by mutant HTT. Therefore, considerable effort has been dedicated to the development of therapeutic strategies that significantly reduce the expression of the mutant HTT protein. Antisense oligonucleotides (ASOs) targeted to the CAG repeat region of HTT transcripts have been of particular interest due to their potential capacity to discriminate between normal and mutant HTT transcripts. Here, we focus on phosphorodiamidate morpholino oligomers (PMOs), ASOs that are especially stable, highly soluble and non-toxic. We designed three PMOs to selectively target expanded CAG repeat tracts (CTG22, CTG25 and CTG28), and two PMOs to selectively target sequences flanking the HTT CAG repeat (HTTex1a and HTTex1b). In HD patient–derived fibroblasts with expanded alleles containing 44, 77 or 109 CAG repeats, HTTex1a and HTTex1b were effective in suppressing the expression of mutant and non-mutant transcripts. CTGn PMOs also suppressed HTT expression, with the extent of suppression and the specificity for mutant transcripts dependent on the length of the targeted CAG repeat and on the CTG repeat length and concentration of the PMO. PMO CTG25 reduced HTT-induced cytotoxicity in vitro and suppressed mutant HTT expression in vivo in the N171-82Q transgenic mouse model. Finally, CTG28 reduced mutant HTT expression and improved the phenotype of HdhQ7/Q150 knock-in HD mice. These data demonstrate the potential of PMOs as an approach to suppressing the expression of mutant HTT. PMID:25035419
Rockenstein, Edward; Overk, Cassia R; Ubhi, Kiren; Mante, Michael; Patrick, Christina; Adame, Anthony; Bisquert, Alejandro; Trejo-Morales, Margarita; Spencer, Brian; Masliah, Eliezer
2015-01-01
Tauopathies are a group of disorders leading to cognitive and behavioral impairment in the aging population. While four-repeat (4R) Tau is more abundant in corticobasal degeneration, progressive supranuclear palsy, and Alzheimer's disease, three-repeat (3R) Tau is the most abundant splice, in Pick's disease. A number of transgenic models expressing wild-type and mutant forms of the 4R Tau have been developed. However, few models of three-repeat Tau are available. A transgenic mouse model expressing three-repeat Tau was developed bearing the mutations associated with familial forms of Pick's disease (L266V and G272V mutations). Two lines expressing high (Line 13) and low (Line 2) levels of the three-repeat mutant Tau were analyzed. By Western blot, using antibodies specific to three-repeat Tau, Line 13 expressed 5-times more Tau than Line 2. The Tau expressed by these mice was most abundant in the frontal-temporal cortex and limbic system and was phosphorylated at residues detected by the PHF-1, AT8, CP9 and CP13 antibodies. The higher-expressing mice displayed hyperactivity, memory deficits in the water maze and alterations in the round beam. The behavioral deficits started at 6-8 months of age and were associated with a progressive increase in the accumulation of 3R Tau. By immunocytochemistry, mice from Line 13 displayed extensive accumulation of 3R Tau in neuronal cells bodies in the pyramidal neurons of the neocortex, CA1-3 regions, and dentate gyrus of the hippocampus. Aggregates in the granular cells had a globus appearance and mimic Pick's-like inclusions. There were abundant dystrophic neurites, astrogliosis and synapto-dendritic damage in the neocortex and hippocampus of the higher expresser line. The hippocampal lesions were moderately argyrophilic and Thioflavin-S negative. By electron microscopy, discrete straight filament aggregates were detected in some neurons in the hippocampus. This model holds promise for better understanding the natural history and progression of 3R tauopathies and their relationship with mitochondrial alterations and might be suitable for therapeutical testing.
The Membrane Dynamics of Pexophagy Are Influenced by Sar1p in Pichia pastoris
Schroder, Laura A.; Ortiz, Michael V.
2008-01-01
Several Sec proteins including a guanosine diphosphate/guanosine triphosphate exchange factor for Sar1p have been implicated in autophagy. In this study, we investigated the role of Sar1p in pexophagy by expressing dominant-negative mutant forms of Sar1p in Pichia pastoris. When expressing sar1pT34N or sar1pH79G, starvation-induced autophagy, glucose-induced micropexophagy, and ethanol-induced macropexophagy are dramatically suppressed. These Sar1p mutants did not affect the initiation or expansion of the sequestering membranes nor the trafficking of Atg11p and Atg9p to these membranes during micropexophagy. However, the lipidation of Atg8p and assembly of the micropexophagic membrane apparatus, which are essential to complete the incorporation of the peroxisomes into the degradative vacuole, were inhibited when either Sar1p mutant protein was expressed. During macropexophagy, the expression of sar1pT34N inhibited the formation of the pexophagosome, whereas sar1pH79G suppressed the delivery of the peroxisome from the pexophagosome to the vacuole. The pexophagosome contained Atg8p in wild-type cells, but in cells expressing sar1pH79G these organelles contain both Atg8p and endoplasmic reticulum components as visualized by DsRFP-HDEL. Our results demonstrate key roles for Sar1p in both micro- and macropexophagy. PMID:18768759
Molecular Genetic Analysis of an Endotoxin Nonresponder Mutant Cell Line
Schromm, Andra B.; Lien, Egil; Henneke, Philipp; Chow, Jesse C.; Yoshimura, Atsutoshi; Heine, Holger; Latz, Eicke; Monks, Brian G.; Schwartz, David A.; Miyake, Kensuke; Golenbock, Douglas T.
2001-01-01
Somatic cell mutagenesis is a powerful tool for characterizing receptor systems. We reported previously two complementation groups of mutant cell lines derived from CD14-transfected Chinese hamster ovary–K1 fibroblasts defective in responses to bacterial endotoxin. Both classes of mutants expressed a normal gene product for Toll-like receptor (TLR)4, and fully responded to stimulation by tumor necrosis factor (TNF)-α or interleukin (IL)-1β. We identified the lesion in one of the complementation groups in the gene for MD-2, a putative TLR4 coreceptor. The nonresponder phenotype of this mutant was reversed by transfection with MD-2. Cloning of MD-2 from the nonresponder cell line revealed a point mutation in a highly conserved region resulting in a C95Y amino acid exchange. Both forms of MD-2 colocalized with TLR4 on the cell surface after transfection, but only the wild-type cDNA reverted the lipopolysaccharide (LPS) nonresponder phenotype. Furthermore, soluble MD-2, but not soluble MD-2C95Y, functioned to enable LPS responses in cells that expressed TLR4. Thus, MD-2 is a required component of the LPS signaling complex and can function as a soluble receptor for cells that do not otherwise express it. We hypothesize that MD-2 conformationally affects the extracellular domain of TLR4, perhaps resulting in a change in affinity for LPS or functioning as a portion of the true ligand for TLR4. PMID:11435474
Marcus, Jeffrey M.; Evans, Travis M.
2008-01-01
The color patterns on the wings of butterflies have been an important model system in evolutionary developmental biology. A recent computational model tested genetic regulatory hierarchies hypothesized to underlie the formation of butterfly eyespot foci (Evans and Marcus, 2006). The computational model demonstrated that one proposed hierarchy was incapable of reproducing the known patterns of gene expression associated with eyespot focus determination in wild-type butterflies, but that two slightly modified alternative hierarchies were capable of reproducing all of the known gene expressions patterns. Here we extend the computational models previously implemented in Delphi 2.0 to two mutants derived from the squinting bush brown butterfly (Bicyclus anynana). These two mutants, comet and Cyclops, have aberrantly shaped eyespot foci that are produced by different mechanisms. The comet mutation appears to produce a modified interaction between the wing margin and the eyespot focus that results in a series of comet-shaped eyespot foci. The Cyclops mutation causes the failure of wing vein formation between two adjacent wing-cells and the fusion of two adjacent eyespot foci to form a single large elongated focus in their place. The computational approach to modeling pattern formation in these mutants allows us to make predictions about patterns of gene expression, which are largely unstudied in butterfly mutants. It also suggests a critical experiment that will allow us to distinguish between two hypothesized genetic regulatory hierarchies that may underlie all butterfly eyespot foci. PMID:18586070
Davis, A.O.; O’Leary, J.O.; Muthaiyan, A.; Langevin, M.J.; Delgado, A.; Abalos, A.T.; Fajardo, A.R.; Marek, J.; Wilkinson, B.J.; Gustafson, J.E.
2013-01-01
Aims To characterize mutants of Staphylococcus aureus expressing reduced susceptibility to house cleaners (HC), assess the impact of the alternative sigma factor SigB on HC susceptibility, and determine the MIC of clinical methicillin-resistant S. aureus (MRSA) to a HC. Methods and Results Susceptibility to HC, HC components, H2O2, vancomycin and oxacillin and physiological parameters were determined for HC-reduced susceptibility (HCRS) mutants, parent strain COL and COLsigB::kan. HCRS mutants selected with three HC expressed reduced susceptibility to multiple HC, HC components, H2O2 and vancomycin. Two unique HCRS mutants also lost the methicillin resistance determinant. In addition, all HCRS mutants exhibited better growth at two temperatures, and one HCRS mutant expressed reduced carotenoid production. COLsigB::kan demonstrated increased susceptibility to all HC and many HC components. sigB operon mutations were not detected in one HCRS mutant background. Of 76 clinical MRSA, 20 exhibited reduced susceptibility to a HC. Conclusions HCRS mutants demonstrate altered susceptibility to multiple antimicrobials. While sigB is required for full HC resistance, one HCRS mechanism does not involve sigB operon mutations. Clinical MRSA expressing reduced susceptibility to a common HC were detected. Significance and Impact of the Study This study suggests that HCRS mutants are not protected against, nor selected by, practical HC concentrations. PMID:15659191
Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.
Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako
2011-09-01
Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.
Nesi, Nathalie; Debeaujon, Isabelle; Jond, Clarisse; Stewart, Amanda J.; Jenkins, Gareth I.; Caboche, Michel; Lepiniec, Loïc
2002-01-01
Screening for seed pigmentation phenotypes in Arabidopsis led to the isolation of three allelic yellow-seeded mutants, which defined the novel TRANSPARENT TESTA16 (TT16) locus. Cloning of TT16 was performed by T-DNA tagging and confirmed by genetic complementation and sequencing of two mutant alleles. TT16 encodes the ARABIDOPSIS BSISTER (ABS) MADS domain protein. ABS belongs to the recently identified “B-sister” (BS) clade, which contains genes of unknown function that are expressed mainly in female organs. Phylogenetic analyses using a maximum parsimony approach confirmed that TT16/ABS and related proteins form a monophyletic group. TT16/ABS was expressed mainly in the ovule, as are the other members of the BS clade. TT16/ABS is necessary for BANYULS expression and proanthocyanidin accumulation in the endothelium of the seed coat, with the exception of the chalazal-micropylar area. In addition, mutant phenotype and ectopic expression analyses suggested that TT16/ABS also is involved in the specification of endothelial cells. Nevertheless, TT16/ABS apparently is not required for proper ovule function. We report the functional characterization of a member of the BS MADS box gene subfamily, demonstrating its involvement in endothelial cell specification as well as in the increasingly complex genetic control of flavonoid biosynthesis in the Arabidopsis seed coat. PMID:12368498
FGFR3 Heterodimerization in Achondroplasia, the Most Common Form of Human Dwarfism*
He, Lijuan; Shobnam, Nadia; Wimley, William C.; Hristova, Kalina
2011-01-01
The G380R mutation in the transmembrane domain of fibroblast growth factor receptor 3 (FGFR3) causes achondroplasia, the most common form of human dwarfism. Achondroplasia is a heterozygous disorder, and thus the affected individuals express both wild-type and mutant FGFR3. Yet heterodimerization in achondroplasia has not been characterized thus far. To investigate the formation of FGFR3 heterodimers in cellular membranes, we designed an FGFR3 construct that lacks the kinase domain, and we monitored the formation of inactive heterodimers between this construct and wild-type and mutant FGFR3. The formation of the inactive heterodimers depleted the pool of full-length receptors capable of forming active homodimers and ultimately reduced their phosphorylation. By analyzing the effect of the truncated FGFR3 on full-length receptor phosphorylation, we demonstrated that FGFR3 WT/G380R heterodimers form with lower probability than wild-type FGFR3 homodimers at low ligand concentration. These results further our knowledge of FGFR3-associated bone disorders. PMID:21324899
Chamizo-Ampudia, Alejandro; Sanz-Luque, Emanuel; Llamas, Ángel; Ocaña-Calahorro, Francisco; Mariscal, Vicente; Carreras, Alfonso; Barroso, Juan B; Galván, Aurora; Fernández, Emilio
2016-10-01
Nitric oxide (NO) is a relevant signal molecule involved in many plant processes. However, the mechanisms and proteins responsible for its synthesis are scarcely known. In most photosynthetic organisms NO synthases have not been identified, and Nitrate Reductase (NR) has been proposed as the main enzymatic NO source, a process that in vitro is also catalysed by other molybdoenzymes. By studying transcriptional regulation, enzyme approaches, activity assays with in vitro purified proteins and in vivo and in vitro NO determinations, we have addressed the role of NR and Amidoxime Reducing Component (ARC) in the NO synthesis process. N\\R and ARC were intimately related both at transcriptional and activity level. Thus, arc mutants showed high NIA1 (NR gene) expression and NR activity. Conversely, mutants without active NR displayed an increased ARC expression in nitrite medium. Our results with nia1 and arc mutants and with purified enzymes support that ARC catalyses the NO production from nitrite taking electrons from NR and not from Cytb5-1/Cytb5-Reductase, the component partners previously described for ARC (proposed as NOFNiR, Nitric Oxide-Forming Nitrite Reductase). This NR-ARC dual system would be able to produce NO in the presence of nitrate, condition under which NR is unable to do it. © 2016 John Wiley & Sons Ltd.
Ras-GTP dimers activate the mitogen-activated protein kinase (MAPK) pathway
Nan, Xiaolin; Tamgüney, Tanja M.; Collisson, Eric A.; ...
2015-06-16
Rat sarcoma (Ras) GTPases regulate cell proliferation and survival through effector pathways including Raf-MAPK, and are the most frequently mutated genes in human cancer. Although it is well established that Ras activity requires binding to both GTP and the membrane, details of how Ras operates on the cell membrane to activate its effectors remain elusive. Efforts to target mutant Ras in human cancers to therapeutic benefit have also been largely unsuccessful. Here we show that Ras-GTP forms dimers to activate MAPK. We used quantitative photoactivated localization microscopy (PALM) to analyze the nanoscale spatial organization of PAmCherry1-tagged KRas 4B (hereafter referredmore » to KRas) on the cell membrane under various signaling conditions. We found that at endogenous expression levels KRas forms dimers, and KRas G12D, a mutant that constitutively binds GTP, activates MAPK. Overexpression of KRas leads to formation of higher order Ras nanoclusters. Conversely, at lower expression levels, KRas G12D is monomeric and activates MAPK only when artificially dimerized. Moreover, dimerization and signaling of KRas are both dependent on an intact CAAX (C, cysteine; A, aliphatic; X, any amino acid) motif that is also known to mediate membrane localization. These results reveal a new, dimerization-dependent signaling mechanism of Ras, and suggest Ras dimers as a potential therapeutic target in mutant Ras-driven tumors.« less
Ras-GTP dimers activate the Mitogen-Activated Protein Kinase (MAPK) pathway
Nan, Xiaolin; Tamgüney, Tanja M.; Collisson, Eric A.; Lin, Li-Jung; Pitt, Cameron; Galeas, Jacqueline; Lewis, Sophia; Gray, Joe W.; McCormick, Frank; Chu, Steven
2015-01-01
Rat sarcoma (Ras) GTPases regulate cell proliferation and survival through effector pathways including Raf-MAPK, and are the most frequently mutated genes in human cancer. Although it is well established that Ras activity requires binding to both GTP and the membrane, details of how Ras operates on the cell membrane to activate its effectors remain elusive. Efforts to target mutant Ras in human cancers to therapeutic benefit have also been largely unsuccessful. Here we show that Ras-GTP forms dimers to activate MAPK. We used quantitative photoactivated localization microscopy (PALM) to analyze the nanoscale spatial organization of PAmCherry1-tagged KRas 4B (hereafter referred to KRas) on the cell membrane under various signaling conditions. We found that at endogenous expression levels KRas forms dimers, and KRasG12D, a mutant that constitutively binds GTP, activates MAPK. Overexpression of KRas leads to formation of higher order Ras nanoclusters. Conversely, at lower expression levels, KRasG12D is monomeric and activates MAPK only when artificially dimerized. Moreover, dimerization and signaling of KRas are both dependent on an intact CAAX (C, cysteine; A, aliphatic; X, any amino acid) motif that is also known to mediate membrane localization. These results reveal a new, dimerization-dependent signaling mechanism of Ras, and suggest Ras dimers as a potential therapeutic target in mutant Ras-driven tumors. PMID:26080442
Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.
2015-01-01
Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995
Prion propagation in cells expressing PrP glycosylation mutants.
Salamat, Muhammad K; Dron, Michel; Chapuis, Jérôme; Langevin, Christelle; Laude, Hubert
2011-04-01
Infection by prions involves conversion of a host-encoded cell surface protein (PrP(C)) to a disease-related isoform (PrP(Sc)). PrP(C) carries two glycosylation sites variably occupied by complex N-glycans, which have been suggested by previous studies to influence the susceptibility to these diseases and to determine characteristics of prion strains. We used the Rov cell system, which is susceptible to sheep prions, to generate a series of PrP(C) glycosylation mutants with mutations at one or both attachment sites. We examined their subcellular trafficking and ability to convert into PrP(Sc) and to sustain stable prion propagation in the absence of wild-type PrP. The susceptibility to infection of mutants monoglycosylated at either site differed dramatically depending on the amino acid substitution. Aglycosylated double mutants showed overaccumulation in the Golgi compartment and failed to be infected. Introduction of an ectopic glycosylation site near the N terminus fully restored cell surface expression of PrP but not convertibility into PrP(Sc), while PrP(C) with three glycosylation sites conferred cell permissiveness to infection similarly to the wild type. In contrast, predominantly aglycosylated molecules with nonmutated N-glycosylation sequons, produced in cells expressing glycosylphosphatidylinositol-anchorless PrP(C), were able to form infectious PrP(Sc). Together our findings suggest that glycosylation is important for efficient trafficking of anchored PrP to the cell surface and sustained prion propagation. However, properly trafficked glycosylation mutants were not necessarily prone to conversion, thus making it difficult in such studies to discern whether the amino acid changes or glycan chain removal most influences the permissiveness to prion infection.
Tekleyohans, Dawit G.; Wittkop, Benjamin; Snowdon, Rod J.
2016-01-01
Seed formation is a pivotal process in plant reproduction and dispersal. It begins with megagametophyte development in the ovule, followed by fertilization and subsequently coordinated development of embryo, endosperm, and maternal seed coat. Two closely related MADS-box genes, SHATTERPROOF 1 and 2 (SHP1 and SHP2) are involved in specifying ovule integument identity in Arabidopsis thaliana. The MADS box gene ARABIDOPSIS BSISTER (ABS or TT16) is required, together with SEEDSTICK (STK) for the formation of endothelium, part of the seed coat and innermost tissue layer formed by the maternal plant. Little is known about the genetic interaction of SHP1 and SHP2 with ABS and the coordination of endosperm and seed coat development. In this work, mutant and expression analysis shed light on this aspect of concerted development. Triple tt16 shp1 shp2 mutants produce malformed seedlings, seed coat formation defects, fewer seeds, and mucilage reduction. While shp1 shp2 mutants fail to coordinate the timely development of ovules, tt16 mutants show less peripheral endosperm after fertilization. Failure in coordinated division of the innermost integument layer in early ovule stages leads to inner seed coat defects in tt16 and tt16 shp1 shp2 triple mutant seeds. An antagonistic action of ABS and SHP1/SHP2 is observed in inner seed coat layer formation. Expression analysis also indicates that ABS represses SHP1, SHP2, and FRUITFUL expression. Our work shows that the evolutionary conserved Bsister genes are required not only for endothelium but also for endosperm development and genetically interact with SHP1 and SHP2 in a partially antagonistic manner. PMID:27776173
New VMD2 gene mutations identified in patients affected by Best vitelliform macular dystrophy
Marchant, D; Yu, K; Bigot, K; Roche, O; Germain, A; Bonneau, D; Drouin‐Garraud, V; Schorderet, D F; Munier, F; Schmidt, D; Neindre, P Le; Marsac, C; Menasche, M; Dufier, J L; Fischmeister, R; Hartzell, C; Abitbol, M
2007-01-01
Purpose The mutations responsible for Best vitelliform macular dystrophy (BVMD) are found in a gene called VMD2. The VMD2 gene encodes a transmembrane protein named bestrophin‐1 (hBest1) which is a Ca2+‐sensitive chloride channel. This study was performed to identify disease‐specific mutations in 27 patients with BVMD. Because this disease is characterised by an alteration in Cl− channel function, patch clamp analysis was used to test the hypothesis that one of the VMD2 mutated variants causes the disease. Methods Direct sequencing analysis of the 11 VMD2 exons was performed to detect new abnormal sequences. The mutant of hBest1 was expressed in HEK‐293 cells and the associated Cl− current was examined using whole‐cell patch clamp analysis. Results Six new VMD2 mutations were identified, located exclusively in exons four, six and eight. One of these mutations (Q293H) was particularly severe. Patch clamp analysis of human embryonic kidney cells expressing the Q293H mutant showed that this mutant channel is non‐functional. Furthermore, the Q293H mutant inhibited the function of wild‐type bestrophin‐1 channels in a dominant negative manner. Conclusions This study provides further support for the idea that mutations in VMD2 are a necessary factor for Best disease. However, because variable expressivity of VMD2 was observed in a family with the Q293H mutation, it is also clear that a disease‐linked mutation in VMD2 is not sufficient to produce BVMD. The finding that the Q293H mutant does not form functional channels in the membrane could be explained either by disruption of channel conductance or gating mechanisms or by improper trafficking of the protein to the plasma membrane. PMID:17287362
Gonzalez-Escobedo, Geoffrey
2013-01-01
Salmonella spp. are able to form biofilms on abiotic and biotic surfaces. In vivo studies in our laboratory have shown that Salmonella can form biofilms on the surfaces of cholesterol gallstones in the gallbladders of mice and human carriers. Biofilm formation on gallstones has been demonstrated to be a mechanism of persistence. The purpose of this work was to identify and evaluate Salmonella sp. cholesterol-dependent biofilm factors. Differential gene expression analysis between biofilms on glass or cholesterol-coated surfaces and subsequent quantitative real-time PCR (qRT-PCR) revealed that type 1 fimbria structural genes and a gene encoding a putative outer membrane protein (ycfR) were specifically upregulated in Salmonella enterica serovar Typhimurium biofilms grown on cholesterol-coated surfaces. Spatiotemporal expression of ycfR and FimA verified their regulation during biofilm development on cholesterol-coated surfaces. Surprisingly, confocal and scanning electron microscopy demonstrated that a mutant of type 1 fimbria structural genes (ΔfimAICDHF) and a ycfR mutant showed increased biofilm formation on cholesterol-coated surfaces. In vivo experiments using Nramp1+/+ mice harboring gallstones showed that only the ΔycfR mutant formed extensive biofilms on mouse gallstones at 7 and 21 days postinfection; ΔfimAICDHF was not observed on gallstone surfaces after the 7-day-postinfection time point. These data suggest that in Salmonella spp., wild-type type 1 fimbriae are important for attachment to and/or persistence on gallstones at later points of chronic infection, whereas YcfR may represent a specific potential natural inhibitor of initial biofilm formation on gallstones. PMID:23897604
Amyloid precursor protein-induced axonopathies are independent of amyloid-beta peptides.
Stokin, Gorazd B; Almenar-Queralt, Angels; Gunawardena, Shermali; Rodrigues, Elizabeth M; Falzone, Tomás; Kim, Jungsu; Lillo, Concepción; Mount, Stephanie L; Roberts, Elizabeth A; McGowan, Eileen; Williams, David S; Goldstein, Lawrence S B
2008-11-15
Overexpression of amyloid precursor protein (APP), as well as mutations in the APP and presenilin genes, causes rare forms of Alzheimer's disease (AD). These genetic changes have been proposed to cause AD by elevating levels of amyloid-beta peptides (Abeta), which are thought to be neurotoxic. Since overexpression of APP also causes defects in axonal transport, we tested whether defects in axonal transport were the result of Abeta poisoning of the axonal transport machinery. Because directly varying APP levels also alters APP domains in addition to Abeta, we perturbed Abeta generation selectively by combining APP transgenes in Drosophila and mice with presenilin-1 (PS1) transgenes harboring mutations that cause familial AD (FAD). We found that combining FAD mutant PS1 with FAD mutant APP increased Abeta42/Abeta40 ratios and enhanced amyloid deposition as previously reported. Surprisingly, however, this combination suppressed rather than increased APP-induced axonal transport defects in both Drosophila and mice. In addition, neuronal apoptosis induced by expression of FAD mutant human APP in Drosophila was suppressed by co-expressing FAD mutant PS1. We also observed that directly elevating Abeta with fusions to the Familial British and Danish Dementia-related BRI protein did not enhance axonal transport phenotypes in APP transgenic mice. Finally, we observed that perturbing Abeta ratios in the mouse by combining FAD mutant PS1 with FAD mutant APP did not enhance APP-induced behavioral defects. A potential mechanism to explain these findings was suggested by direct analysis of axonal transport in the mouse, which revealed that axonal transport or entry of APP into axons is reduced by FAD mutant PS1. Thus, we suggest that APP-induced axonal defects are not caused by Abeta.
Al-Hinai, Mohab A.; Jones, Shawn W.
2014-01-01
Sporulation in the model endospore-forming organism Bacillus subtilis proceeds via the sequential and stage-specific activation of the sporulation-specific sigma factors, σH (early), σF, σE, σG, and σK (late). Here we show that the Clostridium acetobutylicum σK acts both early, prior to Spo0A expression, and late, past σG activation, thus departing from the B. subtilis model. The C. acetobutylicum sigK deletion (ΔsigK) mutant was unable to sporulate, and solventogenesis, the characteristic stationary-phase phenomenon for this organism, was severely diminished. Transmission electron microscopy demonstrated that the ΔsigK mutant does not develop an asymmetric septum and produces no granulose. Complementation of sigK restored sporulation and solventogenesis to wild-type levels. Spo0A and σG proteins were not detectable by Western analysis, while σF protein levels were significantly reduced in the ΔsigK mutant. spo0A, sigF, sigE, sigG, spoIIE, and adhE1 transcript levels were all downregulated in the ΔsigK mutant, while those of the sigH transcript were unaffected during the exponential and transitional phases of culture. These data show that σK is necessary for sporulation prior to spo0A expression. Plasmid-based expression of spo0A in the ΔsigK mutant from a nonnative promoter restored solventogenesis and the production of Spo0A, σF, σE, and σG, but not sporulation, which was blocked past the σG stage of development, thus demonstrating that σK is also necessary in late sporulation. sigK is expressed very early at low levels in exponential phase but is strongly upregulated during the middle to late stationary phase. This is the first sporulation-specific sigma factor shown to have two developmentally separated roles. PMID:24187083
Al-Hinai, Mohab A; Jones, Shawn W; Papoutsakis, Eleftherios T
2014-01-01
Sporulation in the model endospore-forming organism Bacillus subtilis proceeds via the sequential and stage-specific activation of the sporulation-specific sigma factors, σ(H) (early), σ(F), σ(E), σ(G), and σ(K) (late). Here we show that the Clostridium acetobutylicum σ(K) acts both early, prior to Spo0A expression, and late, past σ(G) activation, thus departing from the B. subtilis model. The C. acetobutylicum sigK deletion (ΔsigK) mutant was unable to sporulate, and solventogenesis, the characteristic stationary-phase phenomenon for this organism, was severely diminished. Transmission electron microscopy demonstrated that the ΔsigK mutant does not develop an asymmetric septum and produces no granulose. Complementation of sigK restored sporulation and solventogenesis to wild-type levels. Spo0A and σ(G) proteins were not detectable by Western analysis, while σ(F) protein levels were significantly reduced in the ΔsigK mutant. spo0A, sigF, sigE, sigG, spoIIE, and adhE1 transcript levels were all downregulated in the ΔsigK mutant, while those of the sigH transcript were unaffected during the exponential and transitional phases of culture. These data show that σ(K) is necessary for sporulation prior to spo0A expression. Plasmid-based expression of spo0A in the ΔsigK mutant from a nonnative promoter restored solventogenesis and the production of Spo0A, σ(F), σ(E), and σ(G), but not sporulation, which was blocked past the σ(G) stage of development, thus demonstrating that σ(K) is also necessary in late sporulation. sigK is expressed very early at low levels in exponential phase but is strongly upregulated during the middle to late stationary phase. This is the first sporulation-specific sigma factor shown to have two developmentally separated roles.
Huang, Jian-Wen; Cheng, Ya-Shan; Ko, Tzu-Ping; Lin, Cheng-Yen; Lai, Hui-Lin; Chen, Chun-Chi; Ma, Yanhe; Zheng, Yingying; Huang, Chun-Hsiang; Zou, Peijian; Liu, Je-Ruei; Guo, Rey-Ting
2012-04-01
1,3-1,4-β-D-Glucanase has been widely used as a feed additive to help non-ruminant animals digest plant fibers, with potential in increasing nutrition turnover rate and reducing sanitary problems. Engineering of enzymes for better thermostability is of great importance because it not only can broaden their industrial applications, but also facilitate exploring the mechanism of enzyme stability from structural point of view. To obtain enzyme with higher thermostability and specific activity, structure-based rational design was carried out in this study. Eleven mutants of Fibrobacter succinogenes 1,3-1,4-β-D-glucanase were constructed in attempt to improve the enzyme properties. In particular, the crude proteins expressed in Pichia pastoris were examined firstly to ensure that the protein productions meet the need for industrial fermentation. The crude protein of V18Y mutant showed a 2 °C increment of Tm and W203Y showed ∼30% increment of the specific activity. To further investigate the structure-function relationship, some mutants were expressed and purified from P. pastoris and Escherichia coli. Notably, the specific activity of purified W203Y which was expressed in E. coli was 63% higher than the wild-type protein. The double mutant V18Y/W203Y showed the same increments of Tm and specific activity as the single mutants did. When expressed and purified from E. coli, V18Y/W203Y showed similar pattern of thermostability increment and 75% higher specific activity. Furthermore, the apo-form and substrate complex structures of V18Y/W203Y were solved by X-ray crystallography. Analyzing protein structure of V18Y/W203Y helps elucidate how the mutations could enhance the protein stability and enzyme activity.
Connexins in Prostate Cancer Initiation and Progression
2012-09-01
Isoleucine and A=alanine. In L212A/I213A the leucine at position 212 and isoleucine at position 213 were mutated to alanine. Similar strategy was used to...and isoleucine at the indicated amino acid residues were mutated to alanine using site-directed mutagenesis (Figure 3). Expression of Cx32 and...Its Mutants and Gap Junction Assembly Human LNCaP cells neither express Cx32 nor form functional GJs [23]. We introduced WT-Cx32 and various
Zheng, Ling; Shockey, Jay; Bian, Fei; Chen, Gao; Shan, Lei; Li, Xinguo; Wan, Shubo; Peng, Zhenying
2017-01-01
Diacylglycerol acyltransferase (DGAT) catalyzes the final step in triacylglycerol (TAG) biosynthesis via the acyl-CoA-dependent acylation of diacylglycerol. This reaction is a major control point in the Kennedy pathway for biosynthesis of TAG, which is the most important form of stored metabolic energy in most oil-producing plants. In this study, Arachis hypogaea type 2 DGAT (AhDGAT2) genes were cloned from the peanut cultivar ‘Luhua 14.’ Sequence analysis of 11 different peanut cultivars revealed a gene family of 8 peanut DGAT2 genes (designated AhDGAT2a-h). Sequence alignments revealed 21 nucleotide differences between the eight ORFs, but only six differences result in changes to the predicted amino acid (AA) sequences. A representative full-length cDNA clone (AhDGAT2a) was characterized in detail. The biochemical effects of altering the AhDGAT2a sequence to include single variable AA residues were tested by mutagenesis and functional complementation assays in transgenic yeast systems. All six mutant variants retained enzyme activity and produced lipid droplets in vivo. The N6D and A26P mutants also displayed increased enzyme activity and/or total cellular fatty acid (FA) content. N6D mutant mainly increased the content of palmitoleic acid, and A26P mutant mainly increased the content of palmitic acid. The A26P mutant grew well both in the presence of oleic and C18:2, but the other mutants grew better in the presence of C18:2. AhDGAT2 is expressed in all peanut organs analyzed, with high transcript levels in leaves and flowers. These levels are comparable to that found in immature seeds, where DGAT2 expression is most abundant in other plants. Over-expression of AhDGAT2a in tobacco substantially increased the FA content of transformed tobacco seeds. Expression of AhDGAT2a also altered transcription levels of endogenous tobacco lipid metabolic genes in transgenic tobacco, apparently creating a larger carbon ‘sink’ that supports increased FA levels. PMID:29085382
ACTIVATION OF A CRYPTIC D-SERINE DEAMINASE (DSD) GENE FROM PSEUDOMONAS CEPACIA 17616
D-serine inhibits growth of P. cepacia 17616; however, resistant mutants able to express an ordinarily cryptic D-serine deaminase (dsd) gene were isolated readily. The resistant strains formed high levels of a D-serine deaminase active on D-threonine as well as D-serine. IS eleme...
Hilbert, Manuel; Noga, Akira; Frey, Daniel; Hamel, Virginie; Guichard, Paul; Kraatz, Sebastian H W; Pfreundschuh, Moritz; Hosner, Sarah; Flückiger, Isabelle; Jaussi, Rolf; Wieser, Mara M; Thieltges, Katherine M; Deupi, Xavier; Müller, Daniel J; Kammerer, Richard A; Gönczy, Pierre; Hirono, Masafumi; Steinmetz, Michel O
2016-04-01
Centrioles are critical for the formation of centrosomes, cilia and flagella in eukaryotes. They are thought to assemble around a nine-fold symmetric cartwheel structure established by SAS-6 proteins. Here, we have engineered Chlamydomonas reinhardtii SAS-6-based oligomers with symmetries ranging from five- to ten-fold. Expression of a SAS-6 mutant that forms six-fold symmetric cartwheel structures in vitro resulted in cartwheels and centrioles with eight- or nine-fold symmetries in vivo. In combination with Bld10 mutants that weaken cartwheel-microtubule interactions, this SAS-6 mutant produced six- to eight-fold symmetric cartwheels. Concurrently, the microtubule wall maintained eight- and nine-fold symmetries. Expressing SAS-6 with analogous mutations in human cells resulted in nine-fold symmetric centrioles that exhibited impaired length and organization. Together, our data suggest that the self-assembly properties of SAS-6 instruct cartwheel symmetry, and lead us to propose a model in which the cartwheel and the microtubule wall assemble in an interdependent manner to establish the native architecture of centrioles.
Dynamic nuclear envelope phenotype in rats overexpressing mutated human torsinA protein.
Yu-Taeger, Libo; Gaiser, Viktoria; Lotzer, Larissa; Roenisch, Tina; Fabry, Benedikt Timo; Stricker-Shaver, Janice; Casadei, Nicolas; Walter, Michael; Schaller, Martin; Riess, Olaf; Nguyen, Huu Phuc; Ott, Thomas; Grundmann-Hauser, Kathrin
2018-05-08
A three-base-pair deletion in the human TOR1A gene is causative for the most common form of primary dystonia, the early-onset dystonia type 1 (DYT1 dystonia). The pathophysiological consequences of this mutation are still unknown.To study the pathology of the mutant torsinA (TOR1A) protein, we have generated a transgenic rat line that overexpresses the human mutant protein under the control of the human TOR1A promoter. This new animal model was phenotyped with several approaches, including behavioral tests and neuropathological analyses. A motor phenotype and cellular and ultrastructural key features of torsinA pathology were found in this new transgenic rat line supporting that it can be used as a model system for investigating the disease development. Analyses of mutant TOR1A protein expression in various brain regions also showed a dynamic expression pattern and a reversible nuclear envelope pathology. These findings suggest the differential vulnerabilities of distinct neuronal subpopulations. Furthermore the reversibility of the nuclear envelope pathology might be a therapeutic target to treat the disease. © 2018. Published by The Company of Biologists Ltd.
Increased intracellular proteolysis reduces disease severity in an ER stress-associated dwarfism.
Mullan, Lorna A; Mularczyk, Ewa J; Kung, Louise H; Forouhan, Mitra; Wragg, Jordan Ma; Goodacre, Royston; Bateman, John F; Swanton, Eileithyia; Briggs, Michael D; Boot-Handford, Raymond P
2017-10-02
The short-limbed dwarfism metaphyseal chondrodysplasia type Schmid (MCDS) is linked to mutations in type X collagen, which increase ER stress by inducing misfolding of the mutant protein and subsequently disrupting hypertrophic chondrocyte differentiation. Here, we show that carbamazepine (CBZ), an autophagy-stimulating drug that is clinically approved for the treatment of seizures and bipolar disease, reduced the ER stress induced by 4 different MCDS-causing mutant forms of collagen X in human cell culture. Depending on the nature of the mutation, CBZ application stimulated proteolysis of misfolded collagen X by either autophagy or proteasomal degradation, thereby reducing intracellular accumulation of mutant collagen. In MCDS mice expressing the Col10a1.pN617K mutation, CBZ reduced the MCDS-associated expansion of the growth plate hypertrophic zone, attenuated enhanced expression of ER stress markers such as Bip and Atf4, increased bone growth, and reduced skeletal dysplasia. CBZ produced these beneficial effects by reducing the MCDS-associated abnormalities in hypertrophic chondrocyte differentiation. Stimulation of intracellular proteolysis using CBZ treatment may therefore be a clinically viable way of treating the ER stress-associated dwarfism MCDS.
Zhang, Yong Q; Friedman, David B; Wang, Zhe; Woodruff, Elvin; Pan, Luyuan; O'donnell, Janis; Broadie, Kendal
2005-03-01
Fragile X syndrome is the most common form of inherited mental retardation, associated with both cognitive and behavioral anomalies. The disease is caused by silencing of the fragile X mental retardation 1 (fmr1) gene, which encodes the mRNA-binding, translational regulator FMRP. Previously we established a disease model through mutation of Drosophila fmr1 (dfmr1) and showed that loss of dFMRP causes defects in neuronal structure, function, and behavioral output similar to the human disease state. To uncover molecular targets of dFMRP in the brain, we use here a proteomic approach involving two-dimensional difference gel electrophoresis analyses followed by mass spectrometry identification of proteins with significantly altered expression in dfmr1 null mutants. We then focus on two misregulated enzymes, phenylalanine hydroxylase (Henna) and GTP cyclohydrolase (Punch), both of which mediate in concert the synthetic pathways of two key monoamine neuromodulators, dopamine and serotonin. Brain enzymatic assays show a nearly 2-fold elevation of Punch activity in dfmr1 null mutants. Consistently brain neurochemical assays show that both dopamine and serotonin are significantly increased in dfmr1 null mutants. At a cellular level, dfmr1 null mutant neurons display a highly significant elevation of the dense core vesicles that package these monoamine neuromodulators for secretion. Taken together, these data indicate that dFMRP normally down-regulates the monoamine pathway, which is consequently up-regulated in the mutant condition. Elevated brain levels of dopamine and serotonin provide a plausible mechanistic explanation for aspects of cognitive and behavioral deficits in human patients.
Kück, Ulrich
2005-10-01
Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.
Forsbach-Birk, Vera; McNealy, Tamara; Shi, Chunwei; Lynch, Damien; Marre, Reinhard
2004-07-01
Legionella bacteria have a developmental cycle in which they go from existing in the aquatic environment to replicating inside eukaryotic host cells. The adaptation to the new environment requires an efficient regulatory system. Overexpression of CsrA, a global regulatory protein found in a variety of gram-negative bacteria has been shown to suppress virulence-associated traits in Legionella pneumophila. Since evidence resulting only from overproduction may not be sufficient to validate the role of a regulatory protein, a csrA mutant strain, CsrA(-), with a drastically reduced production of CsrA, was created. Using RNA slot blots and Western blotting it was shown that fliA and flaA, genes which contribute to flagellation, were expressed early in the mutant. Additionally, in CsrA(-) the levels of the stationary-phase sigma factor, RpoS, and a recently described regulator of virulence traits, LetE, were increased. Growth curves of CsrA(-) bacteria were delayed with pigment production occurring at the same OD578 but at reduced levels in the mutant. Replication ability of the CsrA(-) mutant in amoebae was also affected. Based on these results, we could show that CsrA is involved in the regulation of the bacterial switch from the replicative to the transmissible form.
Galbiati, Mariarita; Onesto, Elisa; Zito, Arianna; Crippa, Valeria; Rusmini, Paola; Mariotti, Raffaella; Bentivoglio, Marina; Bendotti, Caterina; Poletti, Angelo
2012-01-01
Anabolic/androgenic steroids (AAS) are drugs that enhance muscle mass, and are often illegally utilized in athletes to improve their performances. Recent data suggest that the increased risk for amyotrophic lateral sclerosis (ALS) in male soccer and football players could be linked to AAS abuse. ALS is a motor neuron disease mainly occurring in sporadic (sALS) forms, but some familial forms (fALS) exist and have been linked to mutations in different genes. Some of these, in their wild type (wt) form, have been proposed as risk factors for sALS, i.e. superoxide dismutase 1 (SOD1) gene, whose mutations are causative of about 20% of fALS. Notably, SOD1 toxicity might occur both in motor neurons and in muscle cells. Using gastrocnemius muscles of mice overexpressing human mutant SOD1 (mutSOD1) at different disease stages, we found that the expression of a selected set of genes associated to muscle atrophy, MyoD, myogenin, atrogin-1, and transforming growth factor (TGF)β1, is up-regulated already at the presymptomatic stage. Atrogin-1 gene expression was increased also in mice overexpressing human wtSOD1. Similar alterations were found in axotomized mouse muscles and in cultured ALS myoblast models. In these ALS models, we then evaluated the pharmacological effects of the synthetic AAS nandrolone on the expression of the genes modified in ALS muscle. Nandrolone administration had no effects on MyoD, myogenin, and atrogin-1 expression, but it significantly increased TGFβ1 expression at disease onset. Altogether, these data suggest that, in fALS, muscle gene expression is altered at early stages, and AAS may exacerbate some of the alterations induced by SOD1 possibly acting as a contributing factor also in sALS. PMID:22178654
Galbiati, Mariarita; Onesto, Elisa; Zito, Arianna; Crippa, Valeria; Rusmini, Paola; Mariotti, Raffaella; Bentivoglio, Marina; Bendotti, Caterina; Poletti, Angelo
2012-02-01
Anabolic/androgenic steroids (AAS) are drugs that enhance muscle mass, and are often illegally utilized in athletes to improve their performances. Recent data suggest that the increased risk for amyotrophic lateral sclerosis (ALS) in male soccer and football players could be linked to AAS abuse. ALS is a motor neuron disease mainly occurring in sporadic (sALS) forms, but some familial forms (fALS) exist and have been linked to mutations in different genes. Some of these, in their wild type (wt) form, have been proposed as risk factors for sALS, i.e. superoxide dismutase 1 (SOD1) gene, whose mutations are causative of about 20% of fALS. Notably, SOD1 toxicity might occur both in motor neurons and in muscle cells. Using gastrocnemius muscles of mice overexpressing human mutant SOD1 (mutSOD1) at different disease stages, we found that the expression of a selected set of genes associated to muscle atrophy, MyoD, myogenin, atrogin-1, and transforming growth factor (TGF)β1, is up-regulated already at the presymptomatic stage. Atrogin-1 gene expression was increased also in mice overexpressing human wtSOD1. Similar alterations were found in axotomized mouse muscles and in cultured ALS myoblast models. In these ALS models, we then evaluated the pharmacological effects of the synthetic AAS nandrolone on the expression of the genes modified in ALS muscle. Nandrolone administration had no effects on MyoD, myogenin, and atrogin-1 expression, but it significantly increased TGFβ1 expression at disease onset. Altogether, these data suggest that, in fALS, muscle gene expression is altered at early stages, and AAS may exacerbate some of the alterations induced by SOD1 possibly acting as a contributing factor also in sALS. Copyright © 2011 Elsevier Ltd. All rights reserved.
Traeger, Stefanie; Nowrousian, Minou
2015-04-14
During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.
Traeger, Stefanie; Nowrousian, Minou
2015-01-01
During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638
Hama, S; Kimura, G
1980-01-01
Eleven temperature-sensitive mutants of adenovirus type 12, capable of forming plaques in human cells at 33 C but not at 39.5 C, were isolated from a stock of a wild-type strain after treatment with either nitrous acid or hydroxylamine. Complementation tests in doubly infected human cells permitted a tentative assignment of eight of these mutants to six complementation groups. Temperature-shift experiments revealed that one mutant is affected early and most of the other mutants are affected late. Only the early mutant, H12ts505, was temperature sensitive in viral DNA replication. Infectious virions of all the mutants except H12ts505 and two of the late mutants produced at 33 C, appeared to be more heat labile than those of the wild type. Only H12ts505 was temperature sensitive for the establishment of transformation of rat 3Y1 cells. One of the late mutants (H12ts504) had an increased transforming ability at the permissive temperature. Results of temperature-shift transformation experiments suggest that a viral function affected in H12ts505 is required for "initiation" of transformation. Some of the growth properties of H12ts505-transformed cells were also temperature dependent, suggesting that a functional expression of a gene mutation in H12ts505 is required to maintain at least some aspects of the transformed state.
Differential expression of the TWEAK receptor Fn14 in IDH1 wild-type and mutant gliomas.
Hersh, David S; Peng, Sen; Dancy, Jimena G; Galisteo, Rebeca; Eschbacher, Jennifer M; Castellani, Rudy J; Heath, Jonathan E; Legesse, Teklu; Kim, Anthony J; Woodworth, Graeme F; Tran, Nhan L; Winkles, Jeffrey A
2018-06-01
The TNF receptor superfamily member Fn14 is overexpressed by many solid tumor types, including glioblastoma (GBM), the most common and lethal form of adult brain cancer. GBM is notable for a highly infiltrative growth pattern and several groups have reported that high Fn14 expression levels can increase tumor cell invasiveness. We reported previously that the mesenchymal and proneural GBM transcriptomic subtypes expressed the highest and lowest levels of Fn14 mRNA, respectively. Given the recent histopathological re-classification of human gliomas by the World Health Organization based on isocitrate dehydrogenase 1 (IDH1) gene mutation status, we extended this work by comparing Fn14 gene expression in IDH1 wild-type (WT) and mutant (R132H) gliomas and in cell lines engineered to overexpress the IDH1 R132H enzyme. We found that both low-grade and high-grade (i.e., GBM) IDH1 R132H gliomas exhibit low Fn14 mRNA and protein levels compared to IDH1 WT gliomas. Forced overexpression of the IDH1 R132H protein in glioma cells reduced Fn14 expression, while treatment of IDH1 R132H-overexpressing cells with the IDH1 R132H inhibitor AGI-5198 or the DNA demethylating agent 5-aza-2'-deoxycytidine increased Fn14 expression. These results support a role for Fn14 in the more aggressive and invasive phenotype associated with IDH1 WT tumors and indicate that the low levels of Fn14 gene expression noted in IDH1 R132H mutant gliomas may be due to epigenetic regulation via changes in DNA methylation.
Plummer, Amy; Halsey, Kirstie; Lovegrove, Alison; Hammond-Kosack, Kim
2017-01-01
Pathogenic fungi must extend filamentous hyphae across solid surfaces to cause diseases of plants. However, the full inventory of genes which support this is incomplete and many may be currently concealed due to their essentiality for the hyphal growth form. During a random T-DNA mutagenesis screen performed on the pleomorphic wheat (Triticum aestivum) pathogen Zymoseptoria tritici, we acquired a mutant unable to extend hyphae specifically when on solid surfaces. In contrast “yeast-like” growth, and all other growth forms, were unaffected. The inability to extend surface hyphae resulted in a complete loss of virulence on plants. The affected gene encoded a predicted type 2 glycosyltransferase (ZtGT2). Analysis of >800 genomes from taxonomically diverse fungi highlighted a generally widespread, but discontinuous, distribution of ZtGT2 orthologues, and a complete absence of any similar proteins in non-filamentous ascomycete yeasts. Deletion mutants of the ZtGT2 orthologue in the taxonomically un-related fungus Fusarium graminearum were also severely impaired in hyphal growth and non-pathogenic on wheat ears. ZtGT2 expression increased during filamentous growth and electron microscopy on deletion mutants (ΔZtGT2) suggested the protein functions to maintain the outermost surface of the fungal cell wall. Despite this, adhesion to leaf surfaces was unaffected in ΔZtGT2 mutants and global RNAseq-based gene expression profiling highlighted that surface-sensing and protein secretion was also largely unaffected. However, ΔZtGT2 mutants constitutively overexpressed several transmembrane and secreted proteins, including an important LysM-domain chitin-binding virulence effector, Zt3LysM. ZtGT2 likely functions in the synthesis of a currently unknown, potentially minor but widespread, extracellular or outer cell wall polysaccharide which plays a key role in facilitating many interactions between plants and fungi by enabling hyphal growth on solid matrices. PMID:29020037
Snapp, Karen R.; Craig, Ron; Herron, Michael; Nelson, Robert D.; Stoolman, Lloyd M.; Kansas, Geoffrey S.
1998-01-01
Interactions between P-selectin, expressed on endothelial cells and activated platelets, and its leukocyte ligand, a homodimer termed P-selectin glycoprotein ligand-1 (PSGL-1), mediate the earliest adhesive events during an inflammatory response. To investigate whether dimerization of PSGL-1 is essential for functional interactions with P-selectin, a mutant form of PSGL-1 was generated in which the conserved membrane proximal cysteine was mutated to alanine (designated C320A). Western blotting under both denaturing and native conditions of the C320A PSGL-1 mutant isolated from stably transfected cells revealed expression of only a monomeric form of PSGL-1. In contrast to cells cotransfected with α1-3 fucosyltransferase-VII (FucT-VII) plus PSGL-1, K562 cells expressing FucT-VII plus C320A failed to bind COS cells transfected with P-selectin in a low shear adhesion assay, or to roll on CHO cells transfected with P-selectin under conditions of physiologic flow. In addition, C320A transfectants failed to bind chimeric P-selectin fusion proteins. Both PSGL-1 and C320A were uniformly distributed on the surface of transfected K562 cells. Thus, dimerization of PSGL-1 through the single, conserved, extracellular cysteine is essential for functional recognition of P-selectin. PMID:9660879
Caine, Charlotte; Shohat, Meytal; Kim, Jeong-Ki; Nakanishi, Koki; Homma, Shunichi; Mosharov, Eugene V; Monani, Umrao R
2017-11-15
Homozygous mutations in the aromatic l-amino acid decarboxylase (AADC) gene result in a severe depletion of its namesake protein, triggering a debilitating and often fatal form of infantile Parkinsonism known as AADC deficiency. AADC deficient patients fail to produce normal levels of the monoamine neurotransmitters dopamine and serotonin, and suffer a multi-systemic disorder characterized by movement abnormalities, developmental delay and autonomic dysfunction; an absolute loss of dopamine is generally considered incompatible with life. There is no optimal treatment for AADC deficiency and few truly good models in which to investigate disease mechanisms or develop and refine therapeutic strategies. In this study, we introduced a relatively frequently reported but mildly pathogenic S250F missense mutation into the murine Aadc gene. We show that mutants homozygous for the mutation are viable and express a stable but minimally active form of the AADC protein. Although the low enzymatic activity of the protein resulted in only modestly reduced concentrations of brain dopamine, serotonin levels were markedly diminished, and this perturbed behavior as well as autonomic function in mutant mice. Still, we found no evidence of morphologic abnormalities of the dopaminergic cells in mutant brains. The striatum as well as substantia nigra appeared normal and no loss of dopamine expressing cells in the latter was detected. We conclude that even minute levels of active AADC are sufficient to allow for substantial amounts of dopamine to be produced in model mice harboring the S250F mutation. Such mutants represent a novel, mild model of human AADC deficiency. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Nair, Aswathy; Bhargava, Sujata
2012-01-01
Comparison of the expression of 13 genes involved in arbuscular mycorrhizal (AM) symbiosis was performed in a wild type tomato (Solanum lycopersicum cv 76R) and its reduced mycorrhizal colonization mutant rmc in response to colonization with Glomus fasiculatum. Four defense-related genes were induced to a similar extent in the mutant and wild type AM colonized plants, indicating a systemic response to AM colonization. Genes related to nutrient exchange between the symbiont partners showed higher expression in the AM roots of wild type plants than the mutant plants, which correlated with their arbuscular frequency. A symbiosis receptor kinase that is involved in both nodulation and AM symbiosis was not expressed in the rmc mutant. The fact that some colonization was observed in rmc was suggestive of the existence of an alternate colonization signaling pathway for AM symbiosis in this mutant. PMID:23221680
Interaction of metronidazole with DNA repair mutants of Escherichia coli.
Yeung, T C; Beaulieu, B B; McLafferty, M A; Goldman, P
1984-01-01
It has been proposed that one of metronidazole's partially reduced intermediates interacts either with DNA to exert a bactericidal effect or with water to form acetamide. To test this hypothesis we have examined the effect of metronidazole on several mutants of Escherichia coli that are defective in DNA repair. UV-susceptible RecA- and UvrB- point mutants have an increased susceptibility to metronidazole as manifested by both a decreased minimal inhibitory concentration and a greater bactericidal response to metronidazole in resting cultures. By these criteria, however, we find that UvrB- deletion mutants, which lack the ability to reduce nitrate and chlorate, are no more susceptible to metronidazole than is the wild type. We find, however, that these deletion mutants also lack the ability to reduce metronidazole and thus possibly to form its reactive species. When metronidazole's bactericidal effect is expressed in terms of the concurrent accumulation of acetamide derived from metronidazole, then all RecA- and UvrB- mutants are killed more efficiently than their wild types. The data are consistent, therefore, with metronidazole's lethal effect being mediated by a partially reduced intermediate on the metabolic pathway between metronidazole and acetamide. Defects in other aspects of the DNA repair system do not confer this increased susceptibility to the proposed intermediate. A Tag- mutant, for example, which is defective in 3-methyl-adenine-DNA glycosylase, does not have this increased susceptibility to the presumed precursor of acetamide. Thus, these results provide further support for the hypothesis that the bactericidal effect of metronidazole is mediated by a partially reduced intermediate in the metabolic conversion of metronidazole to acetamide and suggest that this intermediate interacts with DNA to produce a lesion similar to that caused by UV light.
Interaction of metronidazole with DNA repair mutants of Escherichia coli.
Yeung, T C; Beaulieu, B B; McLafferty, M A; Goldman, P
1984-01-01
It has been proposed that one of metronidazole's partially reduced intermediates interacts either with DNA to exert a bactericidal effect or with water to form acetamide. To test this hypothesis we have examined the effect of metronidazole on several mutants of Escherichia coli that are defective in DNA repair. UV-susceptible RecA- and UvrB- point mutants have an increased susceptibility to metronidazole as manifested by both a decreased minimal inhibitory concentration and a greater bactericidal response to metronidazole in resting cultures. By these criteria, however, we find that UvrB- deletion mutants, which lack the ability to reduce nitrate and chlorate, are no more susceptible to metronidazole than is the wild type. We find, however, that these deletion mutants also lack the ability to reduce metronidazole and thus possibly to form its reactive species. When metronidazole's bactericidal effect is expressed in terms of the concurrent accumulation of acetamide derived from metronidazole, then all RecA- and UvrB- mutants are killed more efficiently than their wild types. The data are consistent, therefore, with metronidazole's lethal effect being mediated by a partially reduced intermediate on the metabolic pathway between metronidazole and acetamide. Defects in other aspects of the DNA repair system do not confer this increased susceptibility to the proposed intermediate. A Tag- mutant, for example, which is defective in 3-methyl-adenine-DNA glycosylase, does not have this increased susceptibility to the presumed precursor of acetamide. Thus, these results provide further support for the hypothesis that the bactericidal effect of metronidazole is mediated by a partially reduced intermediate in the metabolic conversion of metronidazole to acetamide and suggest that this intermediate interacts with DNA to produce a lesion similar to that caused by UV light. PMID:6367636
Jones, Christopher J.; Newsom, David; Kelly, Benjamin; Irie, Yasuhiko; Jennings, Laura K.; Xu, Binjie; Limoli, Dominique H.; Harrison, Joe J.; Parsek, Matthew R.; White, Peter; Wozniak, Daniel J.
2014-01-01
The transcription factor AmrZ regulates genes important for P. aeruginosa virulence, including type IV pili, extracellular polysaccharides, and the flagellum; however, the global effect of AmrZ on gene expression remains unknown, and therefore, AmrZ may directly regulate many additional genes that are crucial for infection. Compared to the wild type strain, a ΔamrZ mutant exhibits a rugose colony phenotype, which is commonly observed in variants that accumulate the intracellular second messenger cyclic diguanylate (c-di-GMP). Cyclic di-GMP is produced by diguanylate cyclases (DGC) and degraded by phosphodiesterases (PDE). We hypothesized that AmrZ limits the intracellular accumulation of c-di-GMP through transcriptional repression of gene(s) encoding a DGC. In support of this, we observed elevated c-di-GMP in the ΔamrZ mutant compared to the wild type strain. Consistent with other strains that accumulate c-di-GMP, when grown as a biofilm, the ΔamrZ mutant formed larger microcolonies than the wild-type strain. This enhanced biofilm formation was abrogated by expression of a PDE. To identify potential target DGCs, a ChIP-Seq was performed and identified regions of the genome that are bound by AmrZ. RNA-Seq experiments revealed the entire AmrZ regulon, and characterized AmrZ as an activator or repressor at each binding site. We identified an AmrZ-repressed DGC-encoding gene (PA4843) from this cohort, which we named AmrZ dependent cyclase A (adcA). PAO1 overexpressing adcA accumulates 29-fold more c-di-GMP than the wild type strain, confirming the cyclase activity of AdcA. In biofilm reactors, a ΔamrZ ΔadcA double mutant formed smaller microcolonies than the single ΔamrZ mutant, indicating adcA is responsible for the hyper biofilm phenotype of the ΔamrZ mutant. This study combined the techniques of ChIP-Seq and RNA-Seq to define the comprehensive regulon of a bifunctional transcriptional regulator. Moreover, we identified a c-di-GMP mediated mechanism for AmrZ regulation of biofilm formation and chronicity. PMID:24603766
Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich
2005-04-01
The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.
Hu, Zhilian; Holzschuh, Jochen; Driever, Wolfgang
2015-01-01
DNA damage-binding protein 1 (DDB1) is a large subunit of the heterodimeric DDB complex that recognizes DNA lesions and initiates the nucleotide excision repair process. DDB1 is also a component of the CUL4 E3 ligase complex involved in a broad spectrum of cellular processes by targeted ubiquitination of key regulators. Functions of DDB1 in development have been addressed in several model organisms, however, are not fully understood so far. Here we report an ENU induced mutant ddb1 allele (ddb1m863) identified in zebrafish (Danio rerio), and analyze its effects on development. Zebrafish ddb1 is expressed broadly, both maternally and zygotically, with enhanced expression in proliferation zones. The (ddb1m863 mutant allele affects the splice acceptor site of exon 20, causing a splicing defect that results in truncation of the 1140 amino acid protein after residue 800, lacking part of the β-propeller domain BPC and the C-terminal helical domain CTD. ddb1m863 zygotic mutant embryos have a pleiotropic phenotype, including smaller and abnormally shaped brain, head skeleton, eyes, jaw, and branchial arches, as well as reduced dopaminergic neuron groups. However, early forming tissues develop normally in zygotic ddb1m863 mutant embryos, which may be due to maternal rescue. In ddb1m863 mutant embryos, pcna-expressing proliferating cell populations were reduced, concurrent with increased apoptosis. We also observed a concomitant strong up-regulation of transcripts of the tumor suppressor p53 (tp53) and the cell cycle inhibitor cdkn1a (p21a/bCIP1/WAF1) in proliferating tissues. In addition, transcription of cyclin genes ccna2 and ccnd1 was deregulated in ddb1m863 mutants. Reduction of p53 activity by anti-sense morpholinos alleviated the apoptotic phenotype in ddb1m863 mutants. These results imply that Ddb1 may be involved in maintaining proper cell cycle progression and viability of dividing cells during development through transcriptional mechanisms regulating genes involved in cell cycle control and cell survival.
Gerber, Simon D.; Amann, Ruth; Wyder, Stefan; Trueb, Beat
2012-01-01
Fgfrl1 (fibroblast growth factor receptor-like 1) is a transmembrane receptor that is essential for the development of the metanephric kidney. It is expressed in all nascent nephrogenic structures and in the ureteric bud. Fgfrl1 null mice fail to develop the metanephric kidneys. Mutant kidney rudiments show a dramatic reduction of ureteric branching and a lack of mesenchymal-to-epithelial transition. Here, we compared the expression profiles of wildtype and Fgfrl1 mutant kidneys to identify genes that act downstream of Fgfrl1 signaling during the early steps of nephron formation. We detected 56 differentially expressed transcripts with 2-fold or greater reduction, among them many genes involved in Fgf, Wnt, Bmp, Notch, and Six/Eya/Dach signaling. We validated the microarray data by qPCR and whole-mount in situ hybridization and showed the expression pattern of candidate genes in normal kidneys. Some of these genes might play an important role during early nephron formation. Our study should help to define the minimal set of genes that is required to form a functional nephron. PMID:22432025
Yoshida, Akihiro; Niki, Mamiko; Yamamoto, Yuji; Yasunaga, Ai; Ansai, Toshihiro
2015-01-01
Oral streptococci are primary colonizers of tooth surfaces and Streptococcus mutans is the principal causative agent of dental caries in humans. A number of proteins are involved in the formation of monospecies biofilms by S. mutans. This study analyzed the protein expression profiles of S. mutans biofilms formed in the presence or absence of S. gordonii, a pioneer colonizer of the tooth surface, by two-dimensional gel electrophoresis (2-DE). After identifying S. mutans proteins by Mass spectrometric analysis, their expression in the presence of S. gordonii was analyzed. S. mutans was inoculated with or without S. gordonii DL1. The two species were compartmentalized using 0.2-μl Anopore membranes. The biofilms on polystyrene plates were harvested, and the solubilized proteins were separated by 2-DE. When S. mutans biofilms were formed in the presence of S. gordonii, the peroxide resistance protein Dpr of the former showed 4.3-fold increased expression compared to biofilms that developed in the absence of the pioneer colonizer. In addition, we performed a competition assay using S. mutans antioxidant protein mutants together with S. gordonii and other initial colonizers. Growth of the dpr-knockout S. mutans mutant was significantly inhibited by S. gordonii, as well as by S. sanguinis. Furthermore, a cell viability assay revealed that the viability of the dpr-defective mutant was significantly attenuated compared to the wild-type strain when co-cultured with S. gordonii. Therefore, these results suggest that Dpr might be one of the essential proteins for S. mutans survival on teeth in the presence of early colonizing oral streptococci. PMID:25816242
Bele, Aditya; Mirza, Sameer; Zhang, Ying; Ahmad Mir, Riyaz; Lin, Simon; Kim, Jun Hyun; Gurumurthy, Channabasavaiah Basavaraju; West, William; Qiu, Fang; Band, Hamid; Band, Vimla
2015-01-01
The mammalian ortholog of Drosophila ecdysoneless (Ecd) gene product regulates Rb-E2F interaction and is required for cell cycle progression. Ecd is overexpressed in breast cancer and its overexpression predicts shorter survival in patients with ErbB2-positive tumors. Here, we demonstrate Ecd knock down (KD) in human mammary epithelial cells (hMECs) induces growth arrest, similar to the impact of Ecd Knock out (KO) in mouse embryonic fibroblasts. Furthermore, whole-genome mRNA expression analysis of control vs. Ecd KD in hMECs demonstrated that several of the top 40 genes that were down-regulated were E2F target genes. To address the role of Ecd in mammary oncogenesis, we overexpressed Ecd and/or mutant H-Ras in hTERT-immortalized hMECs. Cell cycle analyses revealed hMECs overexpressing Ecd+Ras showed incomplete arrest in G1 phase upon growth factor deprivation, and more rapid cell cycle progression in growth factor-containing medium. Analyses of cell migration, invasion, acinar structures in 3-D Matrigel and anchorage-independent growth demonstrated that Ecd+Ras-overexpressing cells exhibit substantially more dramatic transformed phenotype as compared to cells expressing vector, Ras or Ecd. Under conditions of nutrient deprivation, Ecd+Ras-overexpressing hMECs exhibited better survival, with substantial upregulation of the autophagy marker LC3 both at the mRNA and protein levels. Significantly, while hMECs expressing Ecd or mutant Ras alone did not form tumors in NOD/SCID mice, Ecd+Ras-overexpressing hMECs formed tumors, clearly demonstrating oncogenic cooperation between Ecd and mutant Ras. Collectively, we demonstrate an important co-oncogenic role of Ecd in the progression of mammary oncogenesis through promoting cell survival.
Toplak, Tim; Palmieri, Benoit; Juanes-García, Alba; Vicente-Manzanares, Miguel; Grant, Martin; Wiseman, Paul W.
2017-01-01
We introduce and use Wavelet Imaging on Multiple Scales (WIMS) as an improvement to fluorescence correlation spectroscopy to measure physical processes and features that occur across multiple length scales. In this study, wavelet transforms of cell images are used to characterize molecular dynamics at the cellular and subcellular levels (i.e. focal adhesions). We show the usefulness of the technique by applying WIMS to an image time series of a migrating osteosarcoma cell expressing fluorescently labelled adhesion proteins, which allows us to characterize different components of the cell ranging from optical resolution scale through to focal adhesion and whole cell size scales. Using WIMS we measured focal adhesion numbers, orientation and cell boundary velocities for retraction and protrusion. We also determine the internal dynamics of individual focal adhesions undergoing assembly, disassembly or elongation. Thus confirming as previously shown, WIMS reveals that the number of adhesions and the area of the protruding region of the cell are strongly correlated, establishing a correlation between protrusion size and adhesion dynamics. We also apply this technique to characterize the behavior of adhesions, actin and myosin in Chinese hamster ovary cells expressing a mutant form of myosin IIB (1935D) that displays decreased filament stability and impairs front-back cell polarity. We find separate populations of actin and myosin at each adhesion pole for both the mutant and wild type form. However, we find these populations move rapidly inwards toward one another in the mutant case in contrast to the cells that express wild type myosin IIB where those populations remain stationary. Results obtained with these two systems demonstrate how WIMS has the potential to reveal novel correlations between chosen parameters that belong to different scales. PMID:29049414
Bele, Aditya; Mirza, Sameer; Zhang, Ying; Ahmad Mir, Riyaz; Lin, Simon; Kim, Jun Hyun; Gurumurthy, Channabasavaiah Basavaraju; West, William; Qiu, Fang; Band, Hamid; Band, Vimla
2015-01-01
The mammalian ortholog of Drosophila ecdysoneless (Ecd) gene product regulates Rb-E2F interaction and is required for cell cycle progression. Ecd is overexpressed in breast cancer and its overexpression predicts shorter survival in patients with ErbB2-positive tumors. Here, we demonstrate Ecd knock down (KD) in human mammary epithelial cells (hMECs) induces growth arrest, similar to the impact of Ecd Knock out (KO) in mouse embryonic fibroblasts. Furthermore, whole-genome mRNA expression analysis of control vs. Ecd KD in hMECs demonstrated that several of the top 40 genes that were down-regulated were E2F target genes. To address the role of Ecd in mammary oncogenesis, we overexpressed Ecd and/or mutant H-Ras in hTERT-immortalized hMECs. Cell cycle analyses revealed hMECs overexpressing Ecd+Ras showed incomplete arrest in G1 phase upon growth factor deprivation, and more rapid cell cycle progression in growth factor-containing medium. Analyses of cell migration, invasion, acinar structures in 3-D Matrigel and anchorage-independent growth demonstrated that Ecd+Ras-overexpressing cells exhibit substantially more dramatic transformed phenotype as compared to cells expressing vector, Ras or Ecd. Under conditions of nutrient deprivation, Ecd+Ras-overexpressing hMECs exhibited better survival, with substantial upregulation of the autophagy marker LC3 both at the mRNA and protein levels. Significantly, while hMECs expressing Ecd or mutant Ras alone did not form tumors in NOD/SCID mice, Ecd+Ras-overexpressing hMECs formed tumors, clearly demonstrating oncogenic cooperation between Ecd and mutant Ras. Collectively, we demonstrate an important co-oncogenic role of Ecd in the progression of mammary oncogenesis through promoting cell survival. PMID:25616580
Gautam, Dipendra
2013-01-01
Adenovirus (Ad) mutants that lack early region 4 (E4) are unable to produce the early regulatory proteins that normally inactivate the Mre11/Rad50/Nbs1 (MRN) sensor complex, which is a critical component for the ability of cells to respond to DNA damage. E4 mutant infection therefore activates a DNA damage response, which in turn interferes with a productive viral infection. MRN complex proteins localize to viral DNA replication centers in E4 mutant-infected cells, and this complex is critical for activating the kinases ataxia-telangiectasia mutated (ATM) and ATM and Rad3-related (ATR), which phosphorylate numerous substrates important for DNA repair, cell cycle checkpoint activation, and apoptosis. E4 mutant growth defects are substantially rescued in cells lacking an intact MRN complex. We have assessed the role of the downstream ATM and ATR kinases in several MRN-dependent E4 mutant phenotypes. We did not identify a role for either ATM or ATR in “repair” of E4 mutant genomes to form concatemers. ATR was also not observed to contribute to E4 mutant defects in late protein production. In contrast, the kinase activity of ATM was important for preventing efficient E4 mutant DNA replication and late gene expression. Our results suggest that the MRN complex interferes with E4 mutant DNA replication at least in part through its ability to activate ATM. PMID:23740981
Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein
Gupta, Gagan Deep; Kumar, Vinay
2012-01-01
Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937
Davidson, F F; Loewen, P C; Khorana, H G
1994-01-01
A disulfide bond that is evidently conserved in the guanine nucleotide-binding protein-coupled receptors is present in rhodopsin between Cys-110 and Cys-187. We have replaced these two cysteine residues by alanine residues and now report on the properties of the resulting rhodopsin mutants. The mutant protein C110A/C187A expressed in COS cells resembles wild-type rhodopsin in the ground state. It folds correctly to bind 11-cis-retinal and form the characteristic rhodopsin chromophore. It is inert to hydroxylamine in the dark, and its stability to dark thermal decay is reduced, relative to that of the wild type, by a delta delta G not equal to of only -2.9 kcal/mol. Further, the affinities of the mutant and wild-type rhodopsins to the antirhodopsin antibody rho4D2 are similar, both in the dark and in light. However, the metarhodopsin II (MII) and MIII photointermediates of the mutant are less stable than those formed by the wild-type rhodopsin. Although the initial rates of transducin activation are the same for both mutant and wild-type MII intermediates at 4 degrees C, at 15 degrees C the MII photointermediate in the mutant decays more than 20 times faster than in wild type. We conclude that the disulfide bond between Cys-110 and Cys-187 is a key component in determining the stability of the MII structure and its coupling to transducin activation. PMID:8171030
Mutant Huntingtin Causes a Selective Decrease in the Expression of Synaptic Vesicle Protein 2C.
Peng, Chaohua; Zhu, Gaochun; Liu, Xiangqian; Li, He
2018-04-30
Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (Htt) protein. Mutant Htt causes synaptic transmission dysfunctions by interfering in the expression of synaptic proteins, leading to early HD symptoms. Synaptic vesicle proteins 2 (SV2s), a family of synaptic vesicle proteins including 3 members, SV2A, SV2B, and SV2C, plays important roles in synaptic physiology. Here, we investigated whether the expression of SV2s is affected by mutant Htt in the brains of HD transgenic (TG) mice and Neuro2a mouse neuroblastoma cells (N2a cells) expressing mutant Htt. Western blot analysis showed that the protein levels of SV2A and SV2B were not significantly changed in the brains of HD TG mice expressing mutant Htt with 82 glutamine repeats. However, in the TG mouse brain there was a dramatic decrease in the protein level of SV2C, which has a restricted distribution pattern in regions particularly vulnerable in HD. Immunostaining revealed that the immunoreactivity of SV2C was progressively weakened in the basal ganglia and hippocampus of TG mice. RT-PCR demonstrated that the mRNA level of SV2C progressively declined in the TG mouse brain without detectable changes in the mRNA levels of SV2A and SV2B, indicating that mutant Htt selectively inhibits the transcriptional expression of SV2C. Furthermore, we found that only SV2C expression was progressively inhibited in N2a cells expressing a mutant Htt containing 120 glutamine repeats. These findings suggest that the synaptic dysfunction in HD results from the mutant Htt-mediated inhibition of SV2C transcriptional expression. These data also imply that the restricted distribution and decreased expression of SV2C contribute to the brain region-selective pathology of HD.
Harris, S L; Elliott, D A; Blake, M C; Must, L M; Messenger, M; Orndorff, P E
1990-01-01
The product of the pilE (also called fimH) gene is a minor component of type 1 pili in Escherichia coli. Mutants that have insertions in the pilE gene are fully piliated but unable to bind to and agglutinate guinea pig erythrocytes, a characteristic of wild-type type 1 piliated E. coli. In this paper we describe the isolation of 48 mutants with point lesions that map to the pilE gene. Such mutants were isolated by using mutT mutagenesis and an enrichment procedure devised to favor the growth of individuals that could form a pellicle in static broth containing alpha-methylmannoside, an inhibitor of erythrocyte binding and pellicle formation. Results indicated that the enrichment favored mutants expressing pilE gene products that were defective in mediating erythrocyte binding. Characterization of 12 of the mutants in greater detail revealed that certain lesions affected pilus number and length. In addition, a mutant that was temperature sensitive for erythrocyte binding was isolated and used to provide evidence that pellicle formation relies on the intercellular interaction of pilE gene products. Our results suggest a molecular explanation for the old and paradoxical observations connecting pellicle formation and erythrocyte agglutination by type 1 piliated E. coli. Images PMID:1977736
Vishnivetskiy, Sergey. A.; Ostermaier, Martin K.; Singhal, Ankita; Panneels, Valerie; Homan, Kristoff T.; Glukhova, Alisa; Sligar, Stephen G.; Tesmer, John J. G.; Schertler, Gebhard F.X.; Standfuss, Joerg; Gurevich, Vsevolod V.
2013-01-01
The effects of activating mutations associated with night blindness on the stoichiometry of rhodopsin interactions with G protein-coupled receptor kinase 1 (GRK1) and arrestin-1 have not been reported. Here we show that the monomeric form of WT rhodopsin and its constitutively active mutants M257Y, G90D, and T94I, reconstituted into HDL particles are effectively phosphorylated by GRK1, as well as two more ubiquitously expressed subtypes, GRK2 and GRK5. All versions of arrestin-1 tested (WT, pre-activated, and constitutively monomeric mutants) bind to monomeric rhodopsin and show the same selectivity for different functional forms of rhodopsin as in native disc membranes. Rhodopsin phosphorylation by GRK1 and GRK2 promotes arrestin-1 binding to a comparable extent, whereas similar phosphorylation by GRK5 is less effective, suggesting that not all phosphorylation sites on rhodopsin are equivalent in promoting arrestin-1 binding. The binding of WT arrestin-1 to phospho-opsin is comparable to the binding to its preferred target, P-Rh*, suggesting that in photoreceptors arrestin-1 only dissociates after opsin regeneration with 11-cis-retinal, which converts phospho-opsin into inactive phospho-rhodopsin that has lower affinity for arrestin-1. Reduced binding of arrestin-1 to the phospho-opsin form of G90D mutant likely contributes to night blindness caused by this mutation in humans. PMID:23872075
Vishnivetskiy, Sergey A; Ostermaier, Martin K; Singhal, Ankita; Panneels, Valerie; Homan, Kristoff T; Glukhova, Alisa; Sligar, Stephen G; Tesmer, John J G; Schertler, Gebhard F X; Standfuss, Joerg; Gurevich, Vsevolod V
2013-11-01
The effects of activating mutations associated with night blindness on the stoichiometry of rhodopsin interactions with G protein-coupled receptor kinase 1 (GRK1) and arrestin-1 have not been reported. Here we show that the monomeric form of WT rhodopsin and its constitutively active mutants M257Y, G90D, and T94I, reconstituted into HDL particles are effectively phosphorylated by GRK1, as well as two more ubiquitously expressed subtypes, GRK2 and GRK5. All versions of arrestin-1 tested (WT, pre-activated, and constitutively monomeric mutants) bind to monomeric rhodopsin and show the same selectivity for different functional forms of rhodopsin as in native disc membranes. Rhodopsin phosphorylation by GRK1 and GRK2 promotes arrestin-1 binding to a comparable extent, whereas similar phosphorylation by GRK5 is less effective, suggesting that not all phosphorylation sites on rhodopsin are equivalent in promoting arrestin-1 binding. The binding of WT arrestin-1 to phospho-opsin is comparable to the binding to its preferred target, P-Rh*, suggesting that in photoreceptors arrestin-1 only dissociates after opsin regeneration with 11-cis-retinal, which converts phospho-opsin into inactive phospho-rhodopsin that has lower affinity for arrestin-1. Reduced binding of arrestin-1 to the phospho-opsin form of G90D mutant likely contributes to night blindness caused by this mutation in humans. © 2013.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sui, Yiyan; Liu, Yaobin; Xu, Guoqiang, E-mail: gux2002@suda.edu.cn
2015-06-12
Neural-precursor-cell-expressed developmentally down-regulated 8 (NEDD8) is a ubiquitin-like modifier, which forms covalent conjugates on lysines of its substrates. This post-translational modification, neddylation, plays important roles in tumor cell proliferation and viability. Ubiquitin can form diverse polyubiquitin chains, on its seven lysines, which play important functions in various biological processes. However, the roles of lysines in NEDD8 have not been explored. Here, we generated nine NEDD8 point mutants, each with one lysine replaced by an arginine, to study the putative function of lysines in NEDD8. Our experiments discover that Lys27 in NEDD8 is a critical residue for protein neddylation. Replacement ofmore » this residue with arginine almost completely eliminates the conjugation of NEDD8 to its substrates. Furthermore, we find that the K27R mutant impairs NEDD8 conjugation to the E2 enzyme, which normally forms thioester bonds for further transferring NEDD8 to its ligases and substrates. Therefore, this mutation completely inhibits global protein neddylation, including neddylation of cullin family proteins, resulting in decreased activity of cullin-RING E3 ligases. This work sheds new light on the roles of NEDD8 lysines on neddylation cascades and provides a dominant negative mutant for the study of neddylation and its biological functions. - Highlights: • Lys27 in NEDD8 is critical for protein neddylation. • NEDD8 K27R mutant impairs the NEDD8 conjugation. • NEDD8 K27R mutant significantly reduces the activity of cullin-RING E3 ligases.« less
MEMO1 drives cranial endochondral ossification and palatogenesis
Otterloo, Eric Van; Feng, Weiguo; Jones, Kenneth L; Hynes, Nancy E; Clouthier, David E; Niswander, Lee; Williams, Trevor
2016-01-01
The cranial base is a component of the neurocranium and has a central role in the structural integration of the face, brain and vertebral column. Consequently, alteration in the shape of the human cranial base has been intimately linked with primate evolution and defective development is associated with numerous human facial abnormalities. Here we describe a novel recessive mutant mouse strain that presented with a domed head and fully penetrant cleft secondary palate coupled with defects in the formation of the underlying cranial base. Mapping and non-complementation studies revealed a specific mutation in Memo1 - a gene originally associated with cell migration. Expression analysis of Memo1 identified robust expression in the perichondrium and periosteum of the developing cranial base, but only modest expression in the palatal shelves. Fittingly, although the palatal shelves failed to elevate in Memo1 mutants, expression changes were modest within the shelves themselves. In contrast, the cranial base, which forms via endochondral ossification had major reductions in the expression of genes responsible for bone formation, notably matrix metalloproteinases and markers of the osteoblast lineage, mirrored by an increase in markers of cartilage and extracellular matrix development. Concomitant with these changes, mutant cranial bases showed an increased zone of hypertrophic chondrocytes accompanied by a reduction in both vascular invasion and mineralization. Finally, neural crest cell-specific deletion of Memo1 caused a failure of anterior cranial base ossification indicating a cell autonomous role for MEMO1 in the development of these neural crest cell derived structures. However, palate formation was largely normal in these conditional mutants, suggesting a non-autonomous role for MEMO1 in palatal closure. Overall, these findings assign a new function to MEMO1 in driving endochondral ossification in the cranium, and also link abnormal development of the cranial base with more widespread effects on craniofacial shape relevant to human craniofacial dysmorphology. PMID:26746790
NIK and Cot cooperate to trigger NF-kappaB p65 phosphorylation.
Wittwer, Tobias; Schmitz, M Lienhard
2008-06-27
The serine/threonine kinase Cot triggers NF-kappaB-dependent transactivation and activation of various MAPKinases. Here we identify Cot as a novel p65 interacting protein kinase. Cot expression induces p65 phosphorylation at serines 536 and 468 in dependence from its kinase function. Accordingly, shRNA-mediated knockdown of Cot expression interferes with TNF-induced NF-kappaB-dependent gene expression. Also the C-terminally truncated, oncogenic form of Cot is able to trigger p65 phosphorylation. In vitro kinase assays and dominant negative mutants revealed that NIK functions downstream of Cot to mediate p65 phosphorylation.
Drosophila melanogaster White Mutant w1118 Undergo Retinal Degeneration
Ferreiro, María José; Pérez, Coralia; Marchesano, Mariana; Ruiz, Santiago; Caputi, Angel; Aguilera, Pedro; Barrio, Rosa; Cantera, Rafael
2018-01-01
Key scientific discoveries have resulted from genetic studies of Drosophila melanogaster, using a multitude of transgenic fly strains, the majority of which are constructed in a genetic background containing mutations in the white gene. Here we report that white mutant flies from w1118 strain undergo retinal degeneration. We observed also that w1118 mutants have progressive loss of climbing ability, shortened life span, as well as impaired resistance to various forms of stress. Retinal degeneration was abolished by transgenic expression of mini-white+ in the white null background w1118. We conclude that beyond the classical eye-color phenotype, mutations in Drosophila white gene could impair several biological functions affecting parameters like mobility, life span and stress tolerance. Consequently, we suggest caution and attentiveness during the interpretation of old experiments employing white mutant flies and when planning new ones, especially within the research field of neurodegeneration and neuroprotection. We also encourage that the use of w1118 strain as a wild-type control should be avoided. PMID:29354028
Drosophila melanogaster White Mutant w 1118 Undergo Retinal Degeneration.
Ferreiro, María José; Pérez, Coralia; Marchesano, Mariana; Ruiz, Santiago; Caputi, Angel; Aguilera, Pedro; Barrio, Rosa; Cantera, Rafael
2017-01-01
Key scientific discoveries have resulted from genetic studies of Drosophila melanogaster , using a multitude of transgenic fly strains, the majority of which are constructed in a genetic background containing mutations in the white gene. Here we report that white mutant flies from w 1118 strain undergo retinal degeneration. We observed also that w 1118 mutants have progressive loss of climbing ability, shortened life span, as well as impaired resistance to various forms of stress. Retinal degeneration was abolished by transgenic expression of mini-white + in the white null background w 1118 . We conclude that beyond the classical eye-color phenotype, mutations in Drosophila white gene could impair several biological functions affecting parameters like mobility, life span and stress tolerance. Consequently, we suggest caution and attentiveness during the interpretation of old experiments employing white mutant flies and when planning new ones, especially within the research field of neurodegeneration and neuroprotection. We also encourage that the use of w 1118 strain as a wild-type control should be avoided.
Marcus, Jeffrey M; Evans, Travis M
2008-09-01
The color patterns on the wings of butterflies have been an important model system in evolutionary developmental biology. A recent computational model tested genetic regulatory hierarchies hypothesized to underlie the formation of butterfly eyespot foci [Evans, T.M., Marcus, J.M., 2006. A simulation study of the genetic regulatory hierarchy for butterfly eyespot focus determination. Evol. Dev. 8, 273-283]. The computational model demonstrated that one proposed hierarchy was incapable of reproducing the known patterns of gene expression associated with eyespot focus determination in wild-type butterflies, but that two slightly modified alternative hierarchies were capable of reproducing all of the known gene expressions patterns. Here we extend the computational models previously implemented in Delphi 2.0 to two mutants derived from the squinting bush brown butterfly (Bicyclus anynana). These two mutants, comet and Cyclops, have aberrantly shaped eyespot foci that are produced by different mechanisms. The comet mutation appears to produce a modified interaction between the wing margin and the eyespot focus that results in a series of comet-shaped eyespot foci. The Cyclops mutation causes the failure of wing vein formation between two adjacent wing-cells and the fusion of two adjacent eyespot foci to form a single large elongated focus in their place. The computational approach to modeling pattern formation in these mutants allows us to make predictions about patterns of gene expression, which are largely unstudied in butterfly mutants. It also suggests a critical experiment that will allow us to distinguish between two hypothesized genetic regulatory hierarchies that may underlie all butterfly eyespot foci.
Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.
Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y
2016-10-07
CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.
Domergue, Frédéric; Vishwanath, Sollapura J.; Joubès, Jérôme; Ono, Jasmine; Lee, Jennifer A.; Bourdon, Matthieu; Alhattab, Reem; Lowe, Christine; Pascal, Stéphanie; Lessire, René; Rowland, Owen
2010-01-01
Suberin is a protective hydrophobic barrier consisting of phenolics, glycerol, and a variety of fatty acid derivatives, including C18:0-C22:0 primary fatty alcohols. An eight-member gene family encoding alcohol-forming fatty acyl-coenzyme A reductases (FARs) has been identified in Arabidopsis (Arabidopsis thaliana). Promoter-driven expression of the β-glucuronidase reporter gene indicated that three of these genes, FAR1(At5g22500), FAR4(At3g44540), and FAR5(At3g44550), are expressed in root endodermal cells. The three genes were transcriptionally induced by wounding and salt stress. These patterns of gene expression coincide with known sites of suberin deposition. We then characterized a set of mutants with T-DNA insertions in FAR1, FAR4, or FAR5 and found that the suberin compositions of roots and seed coats were modified in each far mutant. Specifically, C18:0-OH was reduced in far5-1, C20:0-OH was reduced in far4-1, and C22:0-OH was reduced in far1-1. We also analyzed the composition of polymer-bound lipids of leaves before and after wounding and found that the basal levels of C18:0-C22:0 primary alcohols in wild-type leaves were increased by wounding. In contrast, C18:0-OH and C22:0-OH were not increased by wounding in far5-1 and far1-1 mutants, respectively. Heterologous expression of FAR1, FAR4, and FAR5 in yeast confirmed that they are indeed active alcohol-forming FARs with distinct, but overlapping, chain length specificities ranging from C18:0 to C24:0. Altogether, these results indicate that Arabidopsis FAR1, FAR4, and FAR5 generate the fatty alcohols found in root, seed coat, and wound-induced leaf tissue. PMID:20571114
OsCSLD1, a cellulose synthase-like D1 gene, is required for root hair morphogenesis in rice.
Kim, Chul Min; Park, Sung Han; Je, Byoung Il; Park, Su Hyun; Park, Soon Ju; Piao, Hai Long; Eun, Moo Young; Dolan, Liam; Han, Chang-deok
2007-03-01
Root hairs are long tubular outgrowths that form on the surface of specialized epidermal cells. They are required for nutrient and water uptake and interact with the soil microflora. Here we show that the Oryza sativa cellulose synthase-like D1 (OsCSLD1) gene is required for root hair development, as rice (Oryza sativa) mutants that lack OsCSLD1 function develop abnormal root hairs. In these mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that OsCSLD1 function is required for hair elongation but not initiation. Both gene trap expression pattern and in situ hybridization analyses indicate that OsCSLD1 is expressed in only root hair cells. Furthermore, OsCSLD1 is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene KOJAK/AtCSLD3 is required for root hair elongation and is expressed in the root hair, it appears that OsCSLD1 may be the functional ortholog of KOJAK/AtCSLD3 and that these two genes represent the root hair-specific members of this family of proteins. Thus, at least part of the mechanism of root hair morphogenesis in Arabidopsis is conserved in rice.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Seong K., E-mail: skim1@lsuhsc.edu; Kim, Seongman; Dai Gan
2011-09-01
The equine herpesvirus 1 (EHV-1) negative regulatory IR2 protein (IR2P), an early 1,165-amino acid (aa) truncated form of the 1487-aa immediate-early protein (IEP), lacks the trans-activation domain essential for IEP activation functions but retains domains for binding DNA, TFIIB, and TBP and the nuclear localization signal. IR2P mutants of the N-terminal region which lack either DNA-binding activity or TFIIB-binding activity were unable to down-regulate EHV-1 promoters. In EHV-1-infected cells expressing full-length IR2P, transcription and protein expression of viral regulatory IE, early EICP0, IR4, and UL5, and late ETIF genes were dramatically inhibited. Viral DNA levels were reduced to 2.1% ofmore » control infected cells, but were vey weakly affected in cells that express the N-terminal 706 residues of IR2P. These results suggest that IR2P function requires the two N-terminal domains for binding DNA and TFIIB as well as the C-terminal residues 707 to 1116 containing the TBP-binding domain. - Highlights: > We examine the functional domains of IR2P that mediates negative regulation. > IR2P inhibits at the transcriptional level. > DNA-binding mutant or TFIIB-binding mutant fails to inhibit. > C-terminal aa 707 to 1116 are required for full inhibition. > Inhibition requires the DNA-binding domain, TFIIB-binding domain, and C-terminus.« less
Control of Flagellar Gene Regulation in Legionella pneumophila and Its Relation to Growth Phase▿ †
Albert-Weissenberger, Christiane; Sahr, Tobias; Sismeiro, Odile; Hacker, Jörg; Heuner, Klaus; Buchrieser, Carmen
2010-01-01
The bacterial pathogen Legionella pneumophila responds to environmental changes by differentiation. At least two forms are well described: replicative bacteria are avirulent; in contrast, transmissive bacteria express virulence traits and flagella. Phenotypic analysis, Western blotting, and electron microscopy of mutants of the regulatory genes encoding RpoN, FleQ, FleR, and FliA demonstrated that flagellin expression is strongly repressed and that the mutants are nonflagellated in the transmissive phase. Transcriptome analyses elucidated that RpoN, together with FleQ, enhances transcription of 14 out of 31 flagellar class II genes, which code for the basal body, hook, and regulatory proteins. Unexpectedly, FleQ independent of RpoN enhances the transcription of fliA encoding sigma 28. Expression analysis of a fliA mutant showed that FliA activates three out of the five remaining flagellar class III genes and the flagellar class IV genes. Surprisingly, FleR does not induce but inhibits expression of at least 14 flagellar class III genes on the transcriptional level. Thus, we propose that flagellar class II genes are controlled by FleQ and RpoN, whereas the transcription of the class III gene fliA is controlled in a FleQ-dependent but RpoN-independent manner. However, RpoN and FleR might influence flagellin synthesis on a posttranscriptional level. In contrast to the commonly accepted view that enhancer-binding proteins such as FleQ always interact with RpoN to fullfill their regulatory functions, our results strongly indicate that FleQ regulates gene expression that is RpoN dependent and RpoN independent. Finally, FliA induces expression of flagellar class III and IV genes leading to the complete synthesis of the flagellum. PMID:19915024
Requirements for FGF3 and FGF10 during inner ear formation.
Alvarez, Yolanda; Alonso, Maria Teresa; Vendrell, Victor; Zelarayan, Laura Cecilia; Chamero, Pablo; Theil, Thomas; Bösl, Michael R; Kato, Shigeaki; Maconochie, Mark; Riethmacher, Dieter; Schimmang, Thomas
2003-12-01
Members of the fibroblast growth factor (FGF) gene family control formation of the body plan and organogenesis in vertebrates. FGF3 is expressed in the developing hindbrain and has been shown to be involved in inner ear development of different vertebrate species, including zebrafish, Xenopus, chick and mouse. In the mouse, insertion of a neomycin resistance gene into the Fgf3 gene via homologous recombination results in severe developmental defects during differentiation of the otic vesicle. We have addressed the precise roles of FGF3 and other FGF family members during formation of the murine inner ear using both loss- and gain-of-function experiments. We generated a new mutant allele lacking the entire FGF3-coding region but surprisingly found no evidence for severe defects either during inner ear development or in the mature sensory organ, suggesting the functional involvement of other FGF family members during its formation. Ectopic expression of FGF10 in the developing hindbrain of transgenic mice leads to the formation of ectopic vesicles, expressing some otic marker genes and thus indicating a role for FGF10 during otic vesicle formation. Expression analysis of FGF10 during mouse embryogenesis reveals a highly dynamic pattern of expression in the developing hindbrain, partially overlapping with FGF3 expression and coinciding with formation of the inner ear. However, FGF10 mutant mice have been reported to display only mild defects during inner ear differentiation. We thus created double mutant mice for FGF3 and FGF10, which form severely reduced otic vesicles, suggesting redundant roles of these FGFs, acting in combination as neural signals for otic vesicle formation.
Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O
2015-07-16
p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.
Zhu, Qiuqiang; Yu, Shuguang; Chen, Guanshui; Ke, Lanlan; Pan, Daren
2017-01-01
The importance of leaf rolling in rice (Oryza sativa L.) has been widely recognized. Although several studies have investigated rice leaf rolling and identified some related genes, knowledge of the molecular mechanism underlying rice leaf rolling, especially outward leaf rolling, is limited. Therefore, in this study, differential proteomics and gene expression profiling were used to analyze rolled leaf mutant of transgenic rice in order to investigate differentially expressed genes and proteins related to rice leaf rolling. To this end, 28 differentially expressed proteins related to rolling leaf traits were isolated and identified. Digital expression profiling detected 10 genes related to rice leaf rolling. Some of the proteins and genes detected are involved in lipid metabolism, which is related to the development of bulliform cells, such as phosphoinositide phospholipase C, Mgll gene, and At4g26790 gene. The "omics"-level techniques were useful for simultaneously isolating several proteins and genes related to rice leaf rolling. In addition, the results of the analysis of differentially expressed proteins and genes were closely consistent with those from a corresponding functional analysis of cellular mechanisms; our study findings might form the basis for further research on the molecular mechanisms underlying rice leaf rolling.
Du, Jianguang; Takeuchi, Hideyuki; Leonhard-Melief, Christina; Shroyer, Kenneth R.; Dlugosz, Malgosia; Haltiwanger, Robert S.; Holdener, Bernadette C.
2010-01-01
Thrombospondin type 1 repeat (TSR) superfamily members regulate diverse biological activities ranging from cell motility to inhibition of angiogenesis. In this study, we verified that mouse protein O-fucosyltransferase-2 (POFUT2) specifically adds O-fucose to TSRs. Using two Pofut2 gene trap lines, we demonstrated that O-fucosylation of TSRs was essential for restricting epithelial to mesenchymal transition in the primitive streak, correct patterning of mesoderm, and localization of the definitive endoderm. Although Pofut2 mutant embryos established anterior/posterior polarity, they underwent extensive mesoderm differentiation at the expense of maintaining epiblast pluripotency. Moreover, mesoderm differentiation was biased towards the vascular endothelial cell lineage. Localization of Foxa2 and Cer1 expressing cells within the interior of Pofut2 mutant embryos suggested that POFUT2 activity was also required for the displacement of the primitive endoderm by definitive endoderm. Notably, Nodal, BMP4, Fgf8, and Wnt3 expression were markedly elevated and expanded in Pofut2 mutants, providing evidence that O-fucose modification of TSRs was essential for modulation of growth factor signaling during gastrulation. The ability of Pofut2 mutant embryos to form teratomas comprised of tissues from all three germ layer origins suggested that defects in Pofut2 mutant embryos resulted from abnormalities in the extracellular environment. This prediction is consistent with the observation that POFUT2 targets are constitutive components of the extracellular matrix (ECM) or associate with the ECM. For this reason, the Pofut2 mutants represent a valuable tool for studying the role of O-fucosylation in ECM synthesis and remodeling, and will be a valuable model to study how post-translational modification of ECM components regulates the formation of tissue boundaries, cell movements, and signaling. PMID:20637190
ALS-related misfolded protein management in motor neurons and muscle cells.
Galbiati, Mariarita; Crippa, Valeria; Rusmini, Paola; Cristofani, Riccardo; Cicardi, Maria Elena; Giorgetti, Elisa; Onesto, Elisa; Messi, Elio; Poletti, Angelo
2014-12-01
Amyotrophic Lateral Sclerosis (ALS) is the most common form of adult-onset motor neuron disease. It is now considered a multi-factorial and multi-systemic disorder in which alterations of the crosstalk between neuronal and non-neuronal cell types might influence the course of the disease. In this review, we will provide evidence that dysfunctions of affected muscle cells are not only a marginal consequence of denervation associated to motor neurons loss, but a direct consequence of cell muscle toxicity of mutant SOD1. In muscle, the misfolded state of mutant SOD1 protein, unlike in motor neurons, does not appear to have direct effects on protein aggregation and mitochondrial functionality. Muscle cells are, in fact, more capable than motor neurons to handle misfolded proteins, suggesting that mutant SOD1 toxicity in muscle is not mediated by classical mechanisms of intracellular misfolded proteins accumulation. Several recent works indicate that a higher activation of molecular chaperones and degradative systems is present in muscle cells, which for this reason are possibly able to better manage misfolded mutant SOD1. However, several alterations in gene expression and regenerative potential of skeletal muscles have also been reported as a consequence of the expression of mutant SOD1 in muscle. Whether these changes in muscle cells are causative of ALS or a consequence of motor neuron alterations is not yet clear, but their elucidation is very important, since the understanding of the mechanisms involved in mutant SOD1 toxicity in muscle may facilitate the design of treatments directed toward this specific tissue to treat ALS or at least to delay disease progression. Copyright © 2014 Elsevier Ltd. All rights reserved.
Ramos-Kuri, Manuel; Rapti, Kleopatra; Mehel, Hind; Zhang, Shihong; Dhandapany, Perundurai S.; Liang, Lifan; García-Carrancá, Alejandro; Bobe, Regis; Fischmeister, Rodolphe; Adnot, Serge; Lebeche, Djamel; Hajjar, Roger J.; Lipskaia, Larissa; Chemaly, Elie R.
2015-01-01
The importance of the oncogene Ras in cardiac hypertrophy is well appreciated. The hypertrophic effects of the constitutively active mutant Ras-Val12 are revealed by clinical syndromes due to the Ras mutations and experimental studies. We examined the possible anti-hypertrophic effect of Ras inhibition in vitro using rat neonatal cardiomyocytes (NRCM) and in vivo in the setting of pressure-overload left ventricular (LV) hypertrophy (POH) in rats. Ras functions were modulated via adenovirus directed gene transfer of active mutant Ras-Val12 or dominant negative mutant N17-DN-Ras (DN-Ras). Ras-Val12 expression in vitro activates NFAT resulting in pro-hypertrophic and cardio-toxic effects on NRCM beating and Z-line organization. In contrast, the DN-Ras was antihypertrophic on NRCM, inhibited NFAT and exerted cardio-protective effects attested by preserved NRCM beating and Z line structure. Additional experiments with silencing H-Ras gene strategy corroborated the antihypertrophic effects of siRNA-H-Ras on NRCM. In vivo, with the POH model, both Ras mutants were associated with similar hypertrophy two weeks after simultaneous induction of POH and Ras-mutant gene transfer. However, LV diameters were higher and LV fractional shortening lower in the Ras-Val12 group compared to control and DN-Ras. Moreover, DN-Ras reduced the cross-sectional area of cardiomyocytes in vivo, and decreased the expression of markers of pathologic cardiac hypertrophy. In isolated adult cardiomyocytes after 2 weeks of POH and Ras-mutant gene transfer, DN-Ras improved sarcomere shortening and calcium transients compared to Ras-Val12. Overall, DN-Ras promotes a more physiological form of hypertrophy, suggesting an interesting therapeutic target for pathological cardiac hypertrophy. PMID:26260012
Müller, M; Laxton, C; Briscoe, J; Schindler, C; Improta, T; Darnell, J E; Stark, G R; Kerr, I M
1993-01-01
Mutants in complementation group U3, completely defective in the response of all genes tested to interferons (IFNs) alpha and gamma, do not express the 91 and 84 kDa polypeptide components of interferon-stimulated gene factor 3 (ISGF3), a transcription factor known to play a primary role in the IFN-alpha response pathway. The 91 and 84 kDa polypeptides are products of a single gene. They result from differential splicing and differ only in a 38 amino acid extension at the C-terminus of the 91 kDa polypeptide. Complementation of U3 mutants with cDNA constructs expressing the 91 kDa product at levels comparable to those observed in induced wild-type cells completely restored the response to both IFN-alpha and -gamma and the ability to form ISGF3. Complementation with the 84 kDa component similarly restored the ability to form ISGF3 and, albeit to a lower level, the IFN-alpha response of all genes tested so far. It failed, however, to restore the IFN-gamma response of any gene analysed. The precise nature of the DNA motifs and combination of factors required for the transcriptional response of all genes inducible by IFN-alpha and -gamma remains to be established. The results presented here, however, emphasize the apparent general requirement of the 91 kDa polypeptide in the primary transcriptional response to both types of IFN. Images PMID:7693454
Bansal, Ankita; Kar, Debasish; Murugan, Rajagopal A; Mallick, Sathi; Dutta, Mouparna; Pandey, Satya Deo; Chowdhury, Chiranjit; Ghosh, Anindya S
2015-05-01
DD-carboxypeptidases (DD-CPases) are low-molecular-mass (LMM) penicillin-binding proteins (PBPs) that are mainly involved in peptidoglycan remodelling, but little is known about the dd-CPases of mycobacteria. In this study, a putative DD-CPase of Mycobacterium smegmatis, MSMEG_2433 is characterized. The gene for the membrane-bound form of MSMEG_2433 was cloned and expressed in Escherichia coli in its active form, as revealed by its ability to bind to the Bocillin-FL (fluorescent penicillin). Interestingly, in vivo expression of MSMEG_2433 could restore the cell shape oddities of the septuple PBP mutant of E. coli, which was a prominent physiological characteristic of DD-CPases. Moreover, expression of MSMEG_2433 in trans elevated beta-lactam resistance in PBP deletion mutants (ΔdacAdacC) of E. coli, strengthening its physiology as a dd-CPase. To confirm the biochemical reason behind such physiological behaviours, a soluble form of MSMEG_2433 (sMSMEG_2433) was created, expressed and purified. In agreement with the observed physiological phenomena, sMSMEG_2433 exhibited DD-CPase activity against artificial and peptidoglycan-mimetic DD-CPase substrates. To our surprise, enzymic analyses of MSMEG_2433 revealed efficient deacylation for beta-lactam substrates at physiological pH, which is a unique characteristic of beta-lactamases. In addition to the MSMEG_2433 active site that favours dd-CPase activity, in silico analyses also predicted the presence of an omega-loop-like region in MSMEG_2433, which is an important determinant of its beta-lactamase activity. Based on the in vitro, in vivo and in silico studies, we conclude that MSMEG_2433 is a dual enzyme, possessing both DD-CPase and beta-lactamase activities. © 2015 The Authors.
Kimura, Koji; Kawaguchi, Kosuke; Ueda, Yumiko; Arai, Seisuke; Morita, Masashi; Imanaka, Tsuneo; Wada, Ikuo
2015-01-01
The endoplasmic reticulum (ER) adjusts its size and architecture to adapt to change in the surrounding environment. Russell bodies (RBs) were originally described as dilated structures of the ER cisternae containing large amounts of mutant immunoglobulin. Similar structures are observed in a wide variety of mutant proteins accumulated in the ER. We previously prepared Chinese hamster ovary (CHO) cells in which the expression of mutant antithrombin (AT) (C95R) was controlled with a Tet-On system and showed that RBs can be conditionally formed. However the precise architecture and intracellular behavior of RBs have been as yet only poorly characterized. To characterize the properties of RB, we prepared the same system using a green fluorescent protein (GFP)-fused mutant and measured the dynamics and architecture of RBs. We observed the mobile nature of the molecule in the RB lumen and RBs were separated from the rest of the ER network by narrow tubes. Furthermore, we found that the RBs were not simply expanded ER membranes. The RB lumen is filled with misfolded proteins that are surrounded by ER membranes. In addition, RBs mostly maintain their structure during cell division, possess ribosomes on their membranes and synthesize AT(C95R)-GFP. Based on the characterization of the hydrodynamic radius of AT(C95R)-GFP and the effect of DP1, an ER-shaping protein, we propose that RBs are spontaneously formed as a result of the partitioning of the misfolded AT with the shaping protein.
Tucakov, Anna Katharina; Yavuz, Sabine; Schürmann, Eva-Maria; Mischler, Manjula; Klingebeil, Anne; Meyers, Gregor
2018-01-01
The classical swine fever virus (CSFV) represents one of the most important pathogens of swine. The CSFV glycoprotein E rns is an essential structural protein and an important virulence factor. The latter is dependent on the RNase activity of this envelope protein and, most likely, its secretion from the infected cell. A further important feature with regard to its function as a virulence factor is the formation of disulfide-linked E rns homodimers that are found in virus-infected cells and virions. Mutant CSFV lacking cysteine (Cys) 171, the residue responsible for intermolecular disulfide bond formation, were found to be attenuated in pigs (Tews BA, Schürmann EM, Meyers G. J Virol 2009;83:4823-4834). In the course of an animal experiment with such a dimerization-negative CSFV mutant, viruses were reisolated from pigs that contained a mutation of serine (Ser) 209 to Cys. This mutation restored the ability to form disulphide-linked E rns homodimers. In transient expression studies E rns mutants carrying the S209C change were found to form homodimers with about wt efficiency. Also the secretion level of the mutated proteins was equivalent to that of wt E rns . Virus mutants containing the Cys171Ser/Ser209Cys configuration exhibited wt growth rates and increased virulence when compared with the Cys171Ser mutant. These results provide further support for the connection between CSFV virulence and E rns dimerization.
A Yeast Model of FUS/TLS-Dependent Cytotoxicity
Ju, Shulin; Tardiff, Daniel F.; Han, Haesun; Divya, Kanneganti; Zhong, Quan; Maquat, Lynne E.; Bosco, Daryl A.; Hayward, Lawrence J.; Brown, Robert H.; Lindquist, Susan; Ringe, Dagmar; Petsko, Gregory A.
2011-01-01
FUS/TLS is a nucleic acid binding protein that, when mutated, can cause a subset of familial amyotrophic lateral sclerosis (fALS). Although FUS/TLS is normally located predominantly in the nucleus, the pathogenic mutant forms of FUS/TLS traffic to, and form inclusions in, the cytoplasm of affected spinal motor neurons or glia. Here we report a yeast model of human FUS/TLS expression that recapitulates multiple salient features of the pathology of the disease-causing mutant proteins, including nuclear to cytoplasmic translocation, inclusion formation, and cytotoxicity. Protein domain analysis indicates that the carboxyl-terminus of FUS/TLS, where most of the ALS-associated mutations are clustered, is required but not sufficient for the toxicity of the protein. A genome-wide genetic screen using a yeast over-expression library identified five yeast DNA/RNA binding proteins, encoded by the yeast genes ECM32, NAM8, SBP1, SKO1, and VHR1, that rescue the toxicity of human FUS/TLS without changing its expression level, cytoplasmic translocation, or inclusion formation. Furthermore, hUPF1, a human homologue of ECM32, also rescues the toxicity of FUS/TLS in this model, validating the yeast model and implicating a possible insufficiency in RNA processing or the RNA quality control machinery in the mechanism of FUS/TLS mediated toxicity. Examination of the effect of FUS/TLS expression on the decay of selected mRNAs in yeast indicates that the nonsense-mediated decay pathway is probably not the major determinant of either toxicity or suppression. PMID:21541368
Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.
2008-01-01
Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803
Barghetti, Andrea; Sjögren, Lars; Floris, Maïna; Paredes, Esther Botterweg; Wenkel, Stephan; Brodersen, Peter
2017-11-15
Protein farnesylation is central to molecular cell biology. In plants, protein farnesyl transferase mutants are pleiotropic and exhibit defective meristem organization, hypersensitivity to the hormone abscisic acid, and increased drought resistance. The precise functions of protein farnesylation in plants remain incompletely understood because few relevant farnesylated targets have been identified. Here, we show that defective farnesylation of a single factor-heat-shock protein 40 (HSP40), encoded by the J2 and J3 genes-is sufficient to confer ABA hypersensitivity, drought resistance, late flowering, and enlarged meristems, indicating that altered function of chaperone client proteins underlies most farnesyl transferase mutant phenotypes. We also show that expression of an abiotic stress-related microRNA (miRNA) regulon controlled by the transcription factor SPL7 requires HSP40 farnesylation. Expression of a truncated SPL7 form mimicking its activated proteolysis fragment of the membrane-bound SPL7 precursor partially restores accumulation of SPL7-dependent miRNAs in farnesyl transferase mutants. These results implicate the pathway directing SPL7 activation from its membrane-bound precursor as an important target of farnesylated HSP40, consistent with our demonstration that HSP40 farnesylation facilitates its membrane association. The results also suggest that altered gene regulation via select miRNAs contributes to abiotic stress-related phenotypes of farnesyl transferase mutants. © 2017 Barghetti et al.; Published by Cold Spring Harbor Laboratory Press.
Cusick, John K; Hager, Elizabeth; Gill, Ronald E
2015-01-01
The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Schwarz, Günter; Schulze, Jutta; Bittner, Florian; Eilers, Thomas; Kuper, Jochen; Bollmann, Gabriele; Nerlich, Andrea; Brinkmann, Henner; Mendel, Ralf R.
2000-01-01
Molybdenum (Mo) plays an essential role in the active site of all eukaryotic Mo-containing enzymes. In plants, Mo enzymes are important for nitrate assimilation, phytohormone synthesis, and purine catabolism. Mo is bound to a unique metal binding pterin (molybdopterin [MPT]), thereby forming the active Mo cofactor (Moco), which is highly conserved in eukaryotes, eubacteria, and archaebacteria. Here, we describe the function of the two-domain protein Cnx1 from Arabidopsis in the final step of Moco biosynthesis. Cnx1 is constitutively expressed in all organs and in plants grown on different nitrogen sources. Mo-repairable cnxA mutants from Nicotiana plumbaginifolia accumulate MPT and show altered Cnx1 expression. Transformation of cnxA mutants and the corresponding Arabidopsis chl-6 mutant with cnx1 cDNA resulted in functional reconstitution of their Moco deficiency. We also identified a point mutation in the Cnx1 E domain of Arabidopsis chl-6 that causes the molybdate-repairable phenotype. Recombinant Cnx1 protein is capable of synthesizing Moco. The G domain binds and activates MPT, whereas the E domain is essential for activating Mo. In addition, Cnx1 binds to the cytoskeleton in the same way that its mammalian homolog gephyrin does in neuronal cells, which suggests a hypothetical model for anchoring the Moco-synthetic machinery by Cnx1 in plant cells. PMID:11148290
Du, Yujuan
2017-01-01
Plant development is characterized by repeated initiation of meristems, regions of dividing cells that give rise to new organs. During lateral root (LR) formation, new LR meristems are specified to support the outgrowth of LRs along a new axis. The determination of the sequential events required to form this new growth axis has been hampered by redundant activities of key transcription factors. Here, we characterize the effects of three PLETHORA (PLT) transcription factors, PLT3, PLT5, and PLT7, during LR outgrowth. In plt3plt5plt7 triple mutants, the morphology of lateral root primordia (LRP), the auxin response gradient, and the expression of meristem/tissue identity markers are impaired from the “symmetry-breaking” periclinal cell divisions during the transition between stage I and stage II, wherein cells first acquire different identities in the proximodistal and radial axes. Particularly, PLT1, PLT2, and PLT4 genes that are typically expressed later than PLT3, PLT5, and PLT7 during LR outgrowth are not induced in the mutant primordia, rendering “PLT-null” LRP. Reintroduction of any PLT clade member in the mutant primordia completely restores layer identities at stage II and rescues mutant defects in meristem and tissue establishment. Therefore, all PLT genes can activate the formative cell divisions that lead to de novo meristem establishment and tissue patterning associated with a new growth axis. PMID:29078398
Barmada, Sami J.; Skibinski, Gaia; Korb, Erica; Rao, Elizabeth J.; Wu, Jane Y.; Finkbeiner, Steven
2010-01-01
Mutations in the gene encoding TDP-43 — the major protein component of neuronal aggregates characteristic of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration with ubiquitin-positive inclusion bodies (FTLDu) — have been linked to familial forms of both disorders. Aggregates of TDP-43 in cortical and spinal motoneurons in ALS, or in neurons of the frontal and temporal cortices in FTLD, are closely linked to neuron loss and atrophy in these areas. However, the mechanism by which TDP-43 mutations lead to neurodegeneration is unclear. To investigate the pathogenic role of TDP-43 mutations, we established a model of TDP-43 proteinopathies by expressing fluorescently tagged wildtype and mutant TDP-43 in primary rat cortical neurons. Expression of mutant TDP-43 was toxic to neurons, and mutant-specific toxicity was associated with increased cytoplasmic mislocalization of TDP-43. Inclusion bodies were not necessary for the toxicity and did not affect the risk of cell death. Cellular survival was unaffected by the total amount of exogenous TDP-43 in the nucleus, but the amount of cytoplasmic TDP-43 was a strong and independent predictor of neuronal death. These results suggest that mutant TDP-43 is mislocalized to the cytoplasm, where it exhibits a toxic gain-of-function and induces cell death. PMID:20071528
Old yellow enzymes protect against acrolein toxicity in the yeast Saccharomyces cerevisiae.
Trotter, Eleanor W; Collinson, Emma J; Dawes, Ian W; Grant, Chris M
2006-07-01
Acrolein is a ubiquitous reactive aldehyde which is formed as a product of lipid peroxidation in biological systems. In this present study, we screened the complete set of viable deletion strains in Saccharomyces cerevisiae for sensitivity to acrolein to identify cell functions involved in resistance to reactive aldehydes. We identified 128 mutants whose gene products are localized throughout the cell. Acrolein-sensitive mutants were distributed among most major biological processes but particularly affected gene expression, metabolism, and cellular signaling. Surprisingly, the screen did not identify any antioxidants or similar stress-protective molecules, indicating that acrolein toxicity may not be mediated via reactive oxygen species. Most strikingly, a mutant lacking an old yellow enzyme (OYE2) was identified as being acrolein sensitive. Old yellow enzymes are known to reduce alpha,beta-unsaturated carbonyl compounds in vitro, but their physiological roles have remained uncertain. We show that mutants lacking OYE2, but not OYE3, are sensitive to acrolein, and overexpression of both isoenzymes increases acrolein tolerance. Our data indicate that OYE2 is required for basal levels of tolerance, whereas OYE3 expression is particularly induced following acrolein stress. Despite the range of alpha,beta-unsaturated carbonyl compounds that have been identified as substrates of old yellow enzymes in vitro, we show that old yellow enzymes specifically mediate resistance to small alpha,beta-unsaturated carbonyl compounds, such as acrolein, in vivo.
Wild-type cells rescue genotypically Math1-null hair cells in the inner ears of chimeric mice.
Du, Xiaoping; Jensen, Patricia; Goldowitz, Daniel; Hamre, Kristin M
2007-05-15
The transcription factor Math1 has been shown to be critical in the formation of hair cells (HCs) in the inner ear. However, the influence of environmental factors in HC specification suggests that cell extrinsic factors are also crucial to their development. To test whether extrinsic factors impact development of Math1-null (Math1(beta-Gal/beta-Gal)) HCs, we examined neonatal (postnatal ages P0-P4.5) Math1-null chimeric mice in which genotypically mutant and wild-type cells intermingle to form the inner ear. We provide the first direct evidence that Math1-null HCs are able to be generated and survive in the conducive chimeric environment. beta-Galactosidase expression was used to identify genetically mutant cells while cells were phenotypically defined as HCs by morphological characteristics notably the expression of HC-specific markers. Genotypically mutant HCs were found in all sensory epithelia of the inner ear at all ages examined. Comparable results were obtained irrespective of the wild-type component of the chimeric mice. Thus, genotypically mutant cells retain the competence to differentiate into HCs. The implication is that the lack of the Math1 gene in HC precursors can be overcome by environmental influences, such as cell-cell interactions with wild-type cells, to ultimately result in the formation of HCs.
Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan
2014-01-01
The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417
notch3 is essential for oligodendrocyte development and vascular integrity in zebrafish
Zaucker, Andreas; Mercurio, Sara; Sternheim, Nitzan; Talbot, William S.; Marlow, Florence L.
2013-01-01
SUMMARY Mutations in the human NOTCH3 gene cause CADASIL syndrome (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy). CADASIL is an inherited small vessel disease characterized by diverse clinical manifestations including vasculopathy, neurodegeneration and dementia. Here we report two mutations in the zebrafish notch3 gene, one identified in a previous screen for mutations with reduced expression of myelin basic protein (mbp) and another caused by a retroviral insertion. Reduced mbp expression in notch3 mutant embryos is associated with fewer oligodendrocyte precursor cells (OPCs). Despite an early neurogenic phenotype, mbp expression recovered at later developmental stages and some notch3 homozygous mutants survived to adulthood. These mutants, as well as adult zebrafish carrying both mutant alleles together, displayed a striking stress-associated accumulation of blood in the head and fins. Histological analysis of mutant vessels revealed vasculopathy, including: an enlargement (dilation) of vessels in the telencephalon and fin, disorganization of the normal stereotyped arrangement of vessels in the fin, and an apparent loss of arterial morphological structure. Expression of hey1, a well-known transcriptional target of Notch signaling, was greatly reduced in notch3 mutant fins, suggesting that Notch3 acts via a canonical Notch signaling pathway to promote normal vessel structure. Ultrastructural analysis confirmed the presence of dilated vessels in notch3 mutant fins and revealed that the vessel walls of presumed arteries showed signs of deterioration. Gaps in the arterial wall and the presence of blood cells outside of vessels in mutants indicated that compromised vessel structure led to hemorrhage. In notch3 heterozygotes, we found elevated expression of both notch3 itself and target genes, indicating that specific alterations in gene expression due to partial loss of Notch3 function might contribute to the abnormalities observed in heterozygous larvae and adults. Our analysis of zebrafish notch3 mutants indicates that Notch3 regulates OPC development and mbp gene expression in larvae, and maintains vascular integrity in adults. PMID:23720232
Rezaie, F; Davami, F; Mansouri, K; Agha Amiri, S; Fazel, R; Mahdian, R; Davoudi, N; Enayati, S; Azizi, M; Khalaj, V
2017-05-08
The Escherichia coli expression system is highly effective in producing recombinant proteins. However, there are some limitations in this system, especially in obtaining correctly folded forms of some complex proteins such as Fab fragments. To improve the solubility and folding quality of Fab fragments, we have examined the effect of simultaneous application of a SUMO fusion tag, EnBase ® cultivation mode and a redox mutant strain in the E. coli expression system. A bicistronic gene construct was designed to express an antivascular endothelial growth factor (VEGF) Fab fragment as a model system. The construct contained a dual SUMO fusion gene fragment to encode SUMO-tagged heavy and light chains. While the expression of the construct in batch cultures of BL21 or SHuffle ® transformants produced insoluble and unfolded products, the induction of the transformants in EnBase ® medium resulted in soluble and correctly folded Fab fragment, reaching as high as 19% of the total protein in shuffle strain. The functional assays indicated that the biological activity of the target Fab is similar to the commercial anti-VEGF, Lucentis ® . This study demonstrated that the combination of SUMO fusion technology, EnBase ® cultivation system and recruiting a redox mutant of E. coli can efficiently enhance the solubility and productivity of recombinant Fab fragments. The presented strategy provides not only a novel method to produce soluble and active form of an anti-VEGF Fab but also may use in the efficient production of other antibody fragments. © 2017 The Society for Applied Microbiology.
Buczynski, Kimberly A; Kim, Seong K; O'Callaghan, Dennis J
2005-10-01
The sole immediate-early (IE) gene of equine herpesvirus 1 (EHV-1) encodes a major regulatory protein of 1487 amino acids (aa) capable of modulating gene expression from both early and late promoters and also of trans-repressing its own promoter. Using a specially designed recombination system and a library of IE linker-insertion, deletion, point, and nonsense mutant constructs that encode forms of the IE protein (IEP) harboring mutations within all five regions, 17 mutant viruses were generated and characterized. Ribonuclease protection analyses revealed that all 17 mutants synthesize the IE mRNA in RK-13 cells, whereas those that failed to replicate on non-complementing RK-13 cells displayed a defect in the transcription of either an important early gene (EICP0) and/or an essential late gene (glycoprotein D). Western blot analyses showed that the IEP was synthesized and detectable in cells infected with each mutant virus, including those mutants that failed to replicate on non-complementing RK-13 cells. Eleven of the 17 mutants were capable of growth on non-complementing RK-13 cells, whereas mutant viruses with deletions within the serine-rich tract (SRT), nucleus localization signal (NLS), or DNA-binding domain (DBD) were capable of growth only on the IEP-producing cell line (IE13.1). Lastly, temperature shift experiments revealed that mutant viruses containing deletions within the C-terminus (KyAn1029 and KyAn1411) or within the SRT (KyADeltaSRT2) of the IEP exhibited a temperature-sensitive phenotype in that these viruses, in contrast to the parent KyA, failed to replicate at 39 degrees C. Overall, these results indicate that the C-terminus of the IEP is not essential for IEP function in cell culture, but this region contains elements that enhance the function(s) of the IEP. The initial characterization of these 17 EHV-1 mutants has shown that sequences totaling at least 43% of the IEP are not essential for virus replication in cell culture.
Role of Myofibril-Inducing RNA in cardiac TnT expression in developing Mexican axolotl
Sferrazza, Gian-Franco; Zhang, Chi; Jia, Pingping; Lemanski, Sharon L.; Athauda, Gagani; Stassi, Alyssa; Halager, Kristine; Maier, Jennifer A.; Rueda-de-Leon, Elena; Gupta, Amit; Dube, Syamalima; Huang, Xupei; Prentice, Howard M.; Dube, Dipak K.; Lemanski, Larry F.
2007-01-01
The Mexican axolotl, Ambystoma mexicanum, has been a useful animal model to study heart development and cardiac myofibrillogenesis. A naturally-occurring recessive mutant, gene “c”, for cardiac non-function in the Mexican axolotl causes a failure of myofibrillogenesis due to a lack of tropomyosin expression in homozygous mutant (c/c) embryonic hearts.. Myofibril-Inducing RNA (MIR) rescues mutant hearts in vitro by promoting tropomyosin expression and myofibril formation thereafter. We have studied the effect of MIR on the expression of various isoforms of cardiac Troponin-T (cTnT), a component of the thin filament that binds with tropomyosin. Four alternatively spliced cTnT isoforms have been characterized from developing axolotl heart. The expression of various cTnT isoforms in normal, mutant, and mutant hearts corrected with MIR, is evaluated by real-time RT-PCR using isoform specific primer pairs; MIR affects the total transcription as well as the splicing of the cTnT in axolotl heart PMID:17408593
Heme oxygenase 1 defects lead to reduced chlorophyll in Brassica napus.
Zhu, Lixia; Yang, Zonghui; Zeng, Xinhua; Gao, Jie; Liu, Jie; Yi, Bin; Ma, Chaozhi; Shen, Jinxiong; Tu, Jinxing; Fu, Tingdong; Wen, Jing
2017-04-01
We previously described a Brassica napus chlorophyll-deficient mutant (ygl) with yellow-green seedling leaves and mapped the related gene, BnaC.YGL, to a 0.35 cM region. However, the molecular mechanisms involved in this chlorophyll defect are still unknown. In this study, the BnaC07.HO1 gene (equivalent to BnaC.YGL) was isolated by the candidate gene approach, and its function was confirmed by genetic complementation. Comparative sequencing analysis suggested that BnaC07.HO1 was lost in the mutant, while a long noncoding-RNA was inserted into the promoter of the homologous gene BnaA07.HO1. This insert was widely present in B. napus cultivars and down-regulated BnaA07.HO1 expression. BnaC07.HO1 was highly expressed in the seedling leaves and encoded heme oxygenase 1, which was localized in the chloroplast. Biochemical analysis showed that BnaC07.HO1 can catalyze heme conversion to form biliverdin IXα. RNA-seq analysis revealed that the loss of BnaC07.HO1 impaired tetrapyrrole metabolism, especially chlorophyll biosynthesis. According, the levels of chlorophyll intermediates were reduced in the ygl mutant. In addition, gene expression in multiple pathways was affected in ygl. These findings provide molecular evidences for the basis of the yellow-green leaf phenotype and further insights into the crucial role of HO1 in B. napus.
Enamel protein regulation and dental and periodontal physiopathology in MSX2 mutant mice.
Molla, Muriel; Descroix, Vianney; Aïoub, Muhanad; Simon, Stéphane; Castañeda, Beatriz; Hotton, Dominique; Bolaños, Alba; Simon, Yohann; Lezot, Frédéric; Goubin, Gérard; Berdal, Ariane
2010-11-01
Signaling pathways that underlie postnatal dental and periodontal physiopathology are less studied than those of early tooth development. Members of the muscle segment homeobox gene (Msx) family encode homeoproteins that show functional redundancy during development and are known to be involved in epithelial-mesenchymal interactions that lead to crown morphogenesis and ameloblast cell differentiation. This study analyzed the MSX2 protein during mouse postnatal growth as well as in the adult. The analysis focused on enamel and periodontal defects and enamel proteins in Msx2-null mutant mice. In the epithelial lifecycle, the levels of MSX2 expression and enamel protein secretion were inversely related. Msx2+/- mice showed increased amelogenin expression, enamel thickness, and rod size. Msx2-/- mice displayed compound phenotypic characteristics of enamel defects, related to both enamel-specific gene mutations (amelogenin and enamelin) in isolated amelogenesis imperfecta, and cell-cell junction elements (laminin 5 and cytokeratin 5) in other syndromes. These effects were also related to ameloblast disappearance, which differed between incisors and molars. In Msx2-/- roots, Malassez cells formed giant islands that overexpressed amelogenin and ameloblastin that grew over months. Aberrant expression of enamel proteins is proposed to underlie the regional osteopetrosis and hyperproduction of cellular cementum. These enamel and periodontal phenotypes of Msx2 mutants constitute the first case report of structural and signaling defects associated with enamel protein overexpression in a postnatal context.
Smith, M R; Greene, W C
1991-01-01
The Tax oncoprotein of the type I human T cell leukemia virus (HTLV-I) activates transcription of cellular and viral genes through at least two different transcription factor pathways. Tax activates transcription of the c-fos proto-oncogene by a mechanism that appears to involve members of the cAMP response element binding protein (CREB) and activating transcription factor (ATF) family of DNA-binding proteins. Tax also induces the nuclear expression of the NF-kappa B family of rel oncogene-related enhancer-binding proteins. We have investigated the potential role of these CREB/ATF and NF-kappa B/Rel transcription factors in Tax-mediated transformation by analyzing the oncogenic potential of Tax mutants that functionally segregate these two pathways of transactivation. Rat fibroblasts (Rat2) stably expressing either the wild-type Tax protein or a Tax mutant selectively deficient in the ability to induce NF-kappa B/Rel demonstrated marked changes in morphology and growth characteristics including the ability to form tumors in athymic mice. In contrast, Rat2 cells stably expressing a Tax mutant selectively deficient in the ability to activate transcription through CREB/ATF demonstrated no detectable changes in morphology or growth characteristics. These results suggest that transcriptional activation through the CREB/ATF pathway may play an important role in Tax-mediated cellular transformation. Images PMID:1832173
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pauly, Markus; Sorensen, Susanne Oxenboll; Harholt, Jesper
2009-08-19
Xylogalacturonan (XGA) is a class of pectic polysaccharide found in plant cell walls. The Arabidopsis thaliana locus At5g33290 encodes a predicted Type II membrane protein, and insertion mutants of the At5g33290 locus had decreased cell wall xylose. Immunological studies, enzymatic extraction of polysaccharides, monosaccharide linkage analysis, and oligosaccharide mass profiling were employed to identify the affected cell wall polymer. Pectic XGA was reduced to much lower levels in mutant than in wild-type leaves, indicating a role of At5g33290 in XGA biosynthesis. The mutated gene was designated xylogalacturonan deficient1 (xgd1). Transformation of the xgd1-1 mutant with the wild-type gene restored XGAmore » to wild-type levels. XGD1 protein heterologously expressed in Nicotiana benthamiana catalyzed the transfer of xylose from UDP-xylose onto oligogalacturonides and endogenous acceptors. The products formed could be hydrolyzed with an XGA-specific hydrolase. These results confirm that the XGD1 protein is a XGA xylosyltransferase. The protein was shown by expression of a fluorescent fusion protein in N. benthamiana to be localized in the Golgi vesicles as expected for a glycosyltransferase involved in pectin biosynthesis.« less
Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich
2013-11-22
Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.
HFE genotype affects exosome phenotype in cancer.
Mrowczynski, Oliver D; Madhankumar, A B; Slagle-Webb, Becky; Lee, Sang Y; Zacharia, Brad E; Connor, James R
2017-08-01
Neuroblastoma is the third most common childhood cancer, and timely diagnosis and sensitive therapeutic monitoring remain major challenges. Tumor progression and recurrence is common with little understanding of mechanisms. A major recent focus in cancer biology is the impact of exosomes on metastatic behavior and the tumor microenvironment. Exosomes have been demonstrated to contribute to the oncogenic effect on the surrounding tumor environment and also mediate resistance to therapy. The effect of genotype on exosomal phenotype has not yet been explored. We interrogated exosomes from human neuroblastoma cells that express wild-type or mutant forms of the HFE gene. HFE, one of the most common autosomal recessive polymorphisms in the Caucasian population, originally associated with hemochromatosis, has also been associated with increased tumor burden, therapeutic resistance boost, and negative impact on patient survival. Herein, we demonstrate that changes in genotype cause major differences in the molecular and functional properties of exosomes; specifically, HFE mutant derived exosomes have increased expression of proteins relating to invasion, angiogenesis, and cancer therapeutic resistance. HFE mutant derived exosomes were also shown to transfer this cargo to recipient cells and cause an increased oncogenic functionality in those recipient cells. Copyright © 2017. Published by Elsevier B.V.
Lee, Choong-il; Kim, Hyongbum; Kim, Jin-Soo
2013-01-01
The ability to enrich cells with targeted mutations greatly facilitates the process of using engineered nucleases, including zinc-finger nucleases and transcription activator-like effector nucleases, to construct such cells. We previously used surrogate reporters to enrich cells containing nuclease-induced mutations via flow cytometry. This method is, however, limited by the availability of flow cytometers. Furthermore, sorted cells occasionally fail to form colonies after exposure to a strong laser and hydrostatic pressure. Here we describe two different types of novel reporters that enable mutant cell enrichment without the use of flow cytometers. We designed reporters that express H-2Kk, a surface antigen, and the hygromycin resistance protein (HygroR), respectively, when insertions or deletions are generated at the target sequences by the activity of engineered nucleases. After cotransfection of these reporters and the engineered nuclease-encoding plasmids, H-2Kk- and HygroR-expressing cells were isolated using magnetic separation and hygromycin treatment, respectively. We found that mutant cells were drastically enriched in the isolated cells, suggesting that these two reporters enable efficient enrichment of mutants. We propose that these two reporters will greatly facilitate the use of engineered nucleases in a wider range of biomedical research. PMID:23441197
Deficient Gene Expression in Protein Kinase Inhibitor α Null Mutant Mice
Gangolli, Esha A.; Belyamani, Mouna; Muchinsky, Sara; Narula, Anita; Burton, Kimberly A.; McKnight, G. Stanley; Uhler, Michael D.; Idzerda, Rejean L.
2000-01-01
Protein kinase inhibitor (PKI) is a potent endogenous inhibitor of the cyclic AMP (cAMP)-dependent protein kinase (PKA). It functions by binding the free catalytic (C) subunit with a high affinity and is also known to export nuclear C subunit to the cytoplasm. The significance of these actions with respect to PKI's physiological role is not well understood. To address this, we have generated by homologous recombination mutant mice that are deficient in PKIα, one of the three isoforms of PKI. The mice completely lack PKI activity in skeletal muscle and, surprisingly, show decreased basal and isoproterenol-induced gene expression in muscle. Further examination revealed reduced levels of the phosphorylated (active) form of the transcription factor CREB (cAMP response element binding protein) in the knockouts. This phenomenon stems, at least in part, from lower basal PKA activity levels in the mutants, arising from a compensatory increase in the level of the RIα subunit of PKA. The deficit in gene induction, however, is not easily explained by current models of PKI function and suggests that PKI may play an as yet undescribed role in PKA signaling. PMID:10779334
Regulation of Compound Leaf Development by PHANTASTICA in Medicago truncatula1[C][W][OPEN
Ge, Liangfa; Peng, Jianling; Berbel, Ana; Madueño, Francisco; Chen, Rujin
2014-01-01
Plant leaves, simple or compound, initiate as peg-like structures from the peripheral zone of the shoot apical meristem, which requires class I KNOTTED-LIKE HOMEOBOXI (KNOXI) transcription factors to maintain its activity. The MYB domain protein encoded by the ASYMMETRIC LEAVES1/ROUGH SHEATH2/PHANTASTICA (ARP) gene, together with other factors, excludes KNOXI gene expression from incipient leaf primordia to initiate leaves and specify leaf adaxial identity. However, the regulatory relationship between ARP and KNOXI is more complex in compound-leafed species. Here, we investigated the role of ARP and KNOXI genes in compound leaf development in Medicago truncatula. We show that the M. truncatula phantastica mutant exhibited severe compound leaf defects, including curling and deep serration of leaf margins, shortened petioles, increased rachises, petioles acquiring motor organ characteristics, and ectopic development of petiolules. On the other hand, the M. truncatula brevipedicellus mutant did not exhibit visible compound leaf defects. Our analyses show that the altered petiole development requires ectopic expression of ELONGATED PETIOLULE1, which encodes a lateral organ boundary domain protein, and that the distal margin serration requires the auxin efflux protein M. truncatula PIN-FORMED10 in the M. truncatula phantastica mutant. PMID:24218492
Quaternary structure assessment of ICln by fluorescence resonance energy transfer (FRET) in vivo.
Schmidt, Sabine; Jakab, Martin; Costa, Ivano; Fürst, Johannes; Ravasio, Andrea; Paulmichl, Markus; Botta, Guido; Ritter, Markus
2009-01-01
ICln is a ubiquitously expressed multifunctional protein that plays a critical role in regulatory volume decrease after cell swelling. The majority of ICln is localized in the cytosol and a small fraction of ICln associates with the plasma membrane. In artificial lipid bilayers ICln forms ion channels, and a putative channel model predicts the association of at least two ICln molecules to form a functional ion-conducting pore. Oligomers of ICln have been demonstrated in cytosolic fractions of different cells by native PAGE and gel filtration analysis, but these data have not yet been verified in vivo, and the basis of ICln homooligomerization is unknown. In silico prediction of the quaternary structure of ICln from its primary structure predicts that ICln forms a dimer, and that the C-terminus of ICln may be essential for the intermolecular interaction. To explore the quaternary structure of ICln in living NIH3T3 fibroblasts, we performed fluorescence resonance energy transfer (FRET) experiments using eCFP (donor) and eYFP (acceptor) fused to the C- and/or N-termini of both full length wild type ICln and of C-terminal truncation mutants thereof (ICln(159) and ICln(134)). FRET was assessed by the acceptor photobleaching technique. Here we show that ICln forms oligomers in vivo, and demonstrate intermolecular FRET between the C-, but not the N-termini of full length ICln. In the truncation mutant ICln(159) oligomerization occurs and intermolecular FRET between N-termini can be detected, which indicates that the C-terminus of ICln sterically interferes with interactions between N-termini in full length ICln oligomers. In cells expressing the truncation mutant ICln(134) no FRET between C- and/or N-termini could be measured, suggesting the absence of interaction and a role of amino acids P135-Q159 in the oligomerization of ICln. Copyright 2009 S. Karger AG, Basel.
Maruta, Takanori; Miyazaki, Nozomi; Nosaka, Ryota; Tanaka, Hiroyuki; Padilla-Chacon, Daniel; Otori, Kumi; Kimura, Ayako; Tanabe, Noriaki; Yoshimura, Kazuya; Tamoi, Masahiro; Shigeoka, Shigeru
2015-05-01
Plastid gene expression (PGE) is one of the signals that regulate the expression of photosynthesis-associated nuclear genes (PhANGs) via GENOMES UNCOUPLED1 (GUN1)-dependent retrograde signaling. We recently isolated Arabidopsis sugar-inducible cotyledon yellow-192 (sicy-192), a gain-of-function mutant of plastidic invertase, and showed that following the treatment of this mutant with sucrose, the expression of PhANGs as well as PGE decreased, suggesting that the sicy-192 mutation activates a PGE-evoked and GUN1-mediated retrograde pathway. To clarify the relationship between the sicy-192 mutation, PGE, and GUN1-mediated pathway, plastid and nuclear gene expression in a double mutant of sicy-192 and gun1-101, a null mutant of GUN1 was studied. Plastid-encoded RNA polymerase (PEP)-dependent PGE was markedly suppressed in the sicy-192 mutant by the sucrose treatment, but the suppression as well as cotyledon yellow phenotype was not mitigated by GUN1 disruption. Microarray analysis revealed that the altered expression of nuclear genes such as PhANG in the sucrose-treated sicy-192 mutant was largely dependent on GUN1. The present findings demonstrated that the sicy-192 mutation alters nuclear gene expression with sucrose treatment via GUN1, which is possibly followed by inhibiting PEP-dependent PGE, providing a new insight into the role of plastid sugar metabolism in nuclear gene expression. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Ruhela, Deepa; Kamthan, Ayushi; Maiti, Protiti; Datta, Asis
2014-01-01
In Saccharomyces cerevisiae MPS1 is one of the major protein kinase that governs the spindle checkpoint pathway. The S. cerevisiae structural homolog of opportunistic pathogen Candida albicans CaMPS1, is indispensable for the cell viability. The essentiality of Mps1 was confirmed by Homozygote Trisome test. To determine its biological function in this pathogen conditional mutant was generated through regulatable MET3 promoter. Examination of heterozygous and conditional (+Met/Cys) mps1 mutants revealed a mitosis specific arrest phenotype, where mutants showed large buds with undivided nuclei. Flowcytometry analysis revealed abnormal ploidy levels in mps1mutant. In presence of anti-microtubule drug Nocodazole, mps1 mutant showed a dramatic loss of viability suggesting a role of Mps1 in Spindle Assembly Checkpoint (SAC) activation. These mutants were also defective in microtubule organization. Moreover, heterozygous mutant showed defective in-vitro yeast to hyphae morphological transition. Growth defect in heterozygous mutant suggest haploinsufficiency of this gene. qRT PCR analysis showed around 3 fold upregulation of MPS1 in presence of serum. This expression of MPS1 is dependent on Efg1and is independent of other hyphal regulators like Ras1 and Tpk2. Furthermore, mps1 mutants were also sensitive to oxidative stress. Heterozygous mps1 mutant did not undergo morphological transition and showed 5-Fold reduction in colony forming units in response to macrophage. Thus, the vital checkpoint kinase, Mps1 besides cell division also has a role in morphogenesis and oxidative stress tolerance, in this pathogenic fungus. PMID:25025778
Kamthan, Mohan; Nalla, Vijaya Kumar; Ruhela, Deepa; Kamthan, Ayushi; Maiti, Protiti; Datta, Asis
2014-01-01
In Saccharomyces cerevisiae MPS1 is one of the major protein kinase that governs the spindle checkpoint pathway. The S. cerevisiae structural homolog of opportunistic pathogen Candida albicans CaMPS1, is indispensable for the cell viability. The essentiality of Mps1 was confirmed by Homozygote Trisome test. To determine its biological function in this pathogen conditional mutant was generated through regulatable MET3 promoter. Examination of heterozygous and conditional (+Met/Cys) mps1 mutants revealed a mitosis specific arrest phenotype, where mutants showed large buds with undivided nuclei. Flowcytometry analysis revealed abnormal ploidy levels in mps1 mutant. In presence of anti-microtubule drug Nocodazole, mps1 mutant showed a dramatic loss of viability suggesting a role of Mps1 in Spindle Assembly Checkpoint (SAC) activation. These mutants were also defective in microtubule organization. Moreover, heterozygous mutant showed defective in-vitro yeast to hyphae morphological transition. Growth defect in heterozygous mutant suggest haploinsufficiency of this gene. qRT PCR analysis showed around 3 fold upregulation of MPS1 in presence of serum. This expression of MPS1 is dependent on Efg1 and is independent of other hyphal regulators like Ras1 and Tpk2. Furthermore, mps1 mutants were also sensitive to oxidative stress. Heterozygous mps1 mutant did not undergo morphological transition and showed 5-Fold reduction in colony forming units in response to macrophage. Thus, the vital checkpoint kinase, Mps1 besides cell division also has a role in morphogenesis and oxidative stress tolerance, in this pathogenic fungus.
Cheng, Li-Hao; Hung, Kai-Feng; Huang, Tung-Fu; Hsieh, Hsin-Pei; Wang, Shu-Ying; Huang, Chih-Yang; Lo, Jeng-Fan
2016-11-29
S100A4 is a calcium-binding protein capable of promoting epithelial-mesenchymal transition. Previously, we have demonstrated that S100A4 is required to sustain the head and neck cancer-initiating cells (HN-CICs) subpopulation. In this study, to further investigate the molecular mechanism, we established the head and neck squamous cell carcinoma (HNSCC) cell lines stably expressing mutant S100A4 proteins with defective calcium-binding sites on either N-terminal (NM) or C-terminal (CM), or a deletion of the last 15 amino-acid residues (CD). We showed that the NM, CM and CD harboring sphere cells that were enriched with HN-CICs population exhibited impaired stemness and malignant properties in vitro, as well as reduced tumor growth ability in vivo. Mechanistically, we demonstrated that mutant S100A4 proteins decreased the promoter activity of Nanog, likely through inhibition of p53. Moreover, the biophysical analyses of purified recombinant mutant S100A4 proteins suggest that both NM and CM mutant S100A4 were very similar to the WT S100A4 with subtle difference on the secondary structure, and that the CD mutant protein displayed the unexpected monomeric form in the solution phase.Taken together, our results suggest that both the calcium-binding ability and the C-terminal region of S100A4 are important for HN-CICs to sustain its stemness property and malignancy, and that the mechanism could be mediated by repressing p53 and subsequently activating the Nanog expression.
Katayama, Masafumi; Kiyono, Tohru; Horie, Kengo; Hirayama, Takashi; Eitsuka, Takahiro; Kuroda, Kengo; Donai, Kenichiro; Hidema, Shizu; Nishimori, Katsuhiko; Fukuda, Tomokazu
2015-01-01
The prairie vole (Microtus ochrogaster) shows social behaviors such as monogamy and parenting of infants with pair bonding. These social behaviors are specific to the prairie vole and have not been observed in other types of voles, such as mountain voles. Although the prairie vole has several unique characteristics, an in vitro cell culture system has not been established for this species. Furthermore, establishment of cultured cells derived from the prairie vole may be beneficial based on the three Rs (i.e., Replacement, Reduction, and Refinement) concept. Therefore, in this study, we attempted to establish an immortalized cell line derived from the prairie vole. Our previous research has shown that transduction with mutant forms of cyclin-dependent kinase 4 (CDK4), cyclin D, and telomerase reverse transcriptase (TERT) could efficiently immortalize cells from multiple species, including humans, cattle, pigs, and monkeys. Here, we introduced these three genes into prairie vole-derived muscle fibroblasts. The expression of mutant CDK4 and cyclin D proteins was confirmed by western blotting, and telomerase activity was detected in immortalized vole muscle-derived fibroblasts (VMF-K4DT cells or VMFs) by stretch PCR. Population doubling analysis showed that the introduction of mutant CDK4, cyclin D, and TERT extended the lifespan of VMFs. To the best of our knowledge, this is the first report describing the establishment of an immortalized cell line derived from the prairie vole through the expression of mutant CDK4, cyclin D, and human TERT. PMID:26496927
Katayama, Masafumi; Kiyono, Tohru; Horie, Kengo; Hirayama, Takashi; Eitsuka, Takahiro; Kuroda, Kengo; Donai, Kenichiro; Hidema, Shizu; Nishimori, Katsuhiko; Fukuda, Tomokazu
2016-01-01
The prairie vole (Microtus ochrogaster) shows social behaviors such as monogamy and parenting of infants with pair bonding. These social behaviors are specific to the prairie vole and have not been observed in other types of voles, such as mountain voles. Although the prairie vole has several unique characteristics, an in vitro cell culture system has not been established for this species. Furthermore, establishment of cultured cells derived from the prairie vole may be beneficial based on the three Rs (i.e., Replacement, Reduction, and Refinement) concept. Therefore, in this study, we attempted to establish an immortalized cell line derived from the prairie vole. Our previous research has shown that transduction with mutant forms of cyclin-dependent kinase 4 (CDK4), cyclin D, and telomerase reverse transcriptase (TERT) could efficiently immortalize cells from multiple species, including humans, cattle, pigs, and monkeys. Here, we introduced these three genes into prairie vole-derived muscle fibroblasts. The expression of mutant CDK4 and cyclin D proteins was confirmed by western blotting, and telomerase activity was detected in immortalized vole muscle-derived fibroblasts (VMF-K4DT cells or VMFs) by stretch PCR. Population doubling analysis showed that the introduction of mutant CDK4, cyclin D, and TERT extended the lifespan of VMFs. To the best of our knowledge, this is the first report describing the establishment of an immortalized cell line derived from the prairie vole through the expression of mutant CDK4, cyclin D, and human TERT.
In Vivo Analysis of Lrig Genes Reveals Redundant and Independent Functions in the Inner Ear
del Rio, Tony; Nishitani, Allison M.; Yu, Wei-Ming; Goodrich, Lisa V.
2013-01-01
Lrig proteins are conserved transmembrane proteins that modulate a variety of signaling pathways from worm to humans. In mammals, there are three family members – Lrig1, Lrig2, and Lrig3 – that are defined by closely related extracellular domains with a similar arrangement of leucine rich repeats and immunoglobulin domains. However, the intracellular domains show little homology. Lrig1 inhibits EGF signaling through internalization and degradation of ErbB receptors. Although Lrig3 can also bind ErbB receptors in vitro, it is unclear whether Lrig2 and Lrig3 exhibit similar functions to Lrig1. To gain insights into Lrig gene functions in vivo, we compared the expression and function of the Lrigs in the inner ear, which offers a sensitive system for detecting effects on morphogenesis and function. We find that all three family members are expressed in the inner ear throughout development, with Lrig1 and Lrig3 restricted to subsets of cells and Lrig2 expressed more broadly. Lrig1 and Lrig3 overlap prominently in the developing vestibular apparatus and simultaneous removal of both genes disrupts inner ear morphogenesis. This suggests that these two family members act redundantly in the otic epithelium. In contrast, although Lrig1 and Lrig2 are frequently co-expressed, Lrig1−/−;Lrig2−/− double mutant ears show no enhanced structural abnormalities. At later stages, Lrig1 expression is sustained in non-sensory tissues, whereas Lrig2 levels are enhanced in neurons and sensory epithelia. Consistent with these distinct expression patterns, Lrig1 and Lrig2 mutant mice exhibit different forms of impaired auditory responsiveness. Notably, Lrig1−/−;Lrig2−/− double mutant mice display vestibular deficits and suffer from a more severe auditory defect that is accompanied by a cochlear innervation phenotype not present in single mutants. Thus, Lrig genes appear to act both redundantly and independently, with Lrig2 emerging as the most functionally distinct family member. PMID:24086156
Wang, I-Ching; Zhang, Yufang; Snyder, Jonathan; Sutherland, Mardi J.; Burhans, Michael S.; Shannon, John M.; Park, Hyun Jung; Whitsett, Jeffrey A.; Kalinichenko, Vladimir V.
2010-01-01
Foxm1 is a member of the Forkhead Box (Fox) family of transcription factors. Foxm1 (previously called Foxm1b, HFH-11B, Trident, Win, or MPP2) is expressed in multiple cell types and plays important roles in cellular proliferation, differentiation and tumorigenesis. Genetic deletion of Foxm1 from mouse respiratory epithelium during initial stages of lung development inhibits lung maturation and causes respiratory failure after birth. However, the role of Foxm1 during postnatal lung morphogenesis remains unknown. In the present study, Foxm1 expression was detected in epithelial cells of conducting and peripheral airways and changing dynamically with lung maturation. To discern the biological role of Foxm1 in the prenatal and postnatal lung, a novel transgenic mouse line that expresses a constitutively active form of FoxM1 (FoxM1 N-terminal deletion mutant or FoxM1-ΔN) under the control of lung epithelial-specific SPC promoter was produced. Expression of the FoxM1-ΔN transgene during embryogenesis caused epithelial hyperplasia, inhibited lung sacculation and expression of the type II epithelial marker, pro-SPC. Expression of FoxM1-ΔN mutant during the postnatal period did not influence alveologenesis but caused focal airway hyperplasia and increased proliferation of Clara cells. Likewise, expression of FoxM1-ΔN mutant in conducting airways with Scgb1a1 promoter was sufficient to induce Clara cell hyperplasia. Furthermore, FoxM1-ΔN cooperated with activated K-Ras to induce lung tumor growth in vivo. Increased activity of Foxm1 altered lung sacculation, induced proliferation in the respiratory epithelium and accelerated lung tumor growth, indicating that precise regulation of Foxm1 is critical for normal lung morphogenesis and development of lung cancer. PMID:20816795
Fanzani, Alessandro; Stoppani, Elena; Gualandi, Laura; Giuliani, Roberta; Galbiati, Ferruccio; Rossi, Stefania; Fra, Anna; Preti, Augusto; Marchesini, Sergio
2007-10-30
Caveolin-3 (Cav-3) is the main scaffolding protein present in myofiber caveolae. We transfected C2C12 myoblasts with dominant negative forms of Cav-3, P104L or DeltaTFT, respectively, which cause the limb-girdle muscular dystrophy 1-C. Both these forms triggered Cav-3 loss during C2C12 cell differentiation. The P104L mutation reduced myofiber formation by impaired AKT signalling, accompanied by dramatic expression of the E3 ubiquitin ligase Atrogin. On the other hand, the DeltaTFT mutation triggered hypertrophic myotubes sustained by prolonged AKT activation, but independent of increased levels of follistatin and interleukin 4 expression. These data suggest that separated mutations within the same dystrophy-related gene may cause muscle degeneration through different mechanisms.
Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok
2015-10-26
Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chandra, P. Manish; Brannigan, James A., E-mail: jab@ysbl.york.ac.uk; Prabhune, Asmita
The production, crystallization and characterization of three inactive mutants of penicillin V acylase from B. sphaericus in their respective precursor and processed forms are reported. The space groups are different for the native enzyme and the mutants. The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants willmore » provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme.« less
Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L
2010-05-01
Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.
Piercey, Marta J; Hingston, Patricia A; Truelstrup Hansen, Lisbeth
2016-04-16
Listeria monocytogenes is a pathogenic foodborne bacterium whose persistence in food processing environments is in part attributed to its biofilm formation. Most biofilm studies have been carried out at 30-37 °C rather than at temperatures found in the food processing plants (i.e., 10-20 °C). The objective of the present study was to mine for novel genes that contribute to L. monocytogenes biofilm formation at 15 °C using the random insertional mutagenesis approach. A library of 11,024 L. monocytogenes 568 (serotype 1/2a) Himar1 insertional mutants was created. Mutants with reduced or enhanced biofilm formation at 15 °C were detected in microtiter plate assays with crystal violet and safranin staining. Fourteen mutants expressed enhanced biofilm phenotypes, and harbored transposon insertions in genes encoding cell wall biosynthesis, motility, metabolism, stress response, and cell surface associated proteins. Deficient mutants (n=5) contained interruptions in genes related to peptidoglycan, teichoic acid, or lipoproteins. Enhanced mutants produced significantly (p<0.05) higher cell densities in biofilm formed on stainless steel (SS) coupons at 15 °C (48 h) than deficient mutants, which were also more sensitive to benzalkonium chloride. All biofilm deficient mutants and four enhanced mutants in the microtiter plate assay (flaA, cheR, lmo2563 and lmo2488) formed no biofilm in a peg lid assay (Calgary biofilm device) while insertions in lmo1224 and lmo0543 led to excess biofilm in all assays. Two enhanced biofilm formers were more resistant to enzymatic removal with DNase, proteinase K or pectinase than the parent strain. Scanning electron microscopy of individual biofilms made by five mutants and the parent on SS surfaces showed formation of heterogeneous biofilm with dense zones by immotile mutants, while deficient mutants exhibited sparse growth. In conclusion, interruptions of 9 genes not previously linked to biofilm formation in L. monocytogenes (lmo2572, lmo2488 (uvrA), lmo1224, lmo0434 (inlB), lmo0263 (inlH), lmo0543, lmo0057 (EsaA), lmo2563, lmo0453), caused enhanced biofilm formation in the bacterium at 15 °C. The remaining mutants harbored interruptions in 10 genetic loci previously associated with biofilm formation at higher temperatures, indicating some temperature driven differences in the formation of biofilm by L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.
The role of RNase H2 in processing ribonucleotides incorporated during DNA replication.
Williams, Jessica S; Gehle, Daniel B; Kunkel, Thomas A
2017-05-01
Saccharomyces cerevisiae RNase H2 resolves RNA-DNA hybrids formed during transcription and it incises DNA at single ribonucleotides incorporated during nuclear DNA replication. To distinguish between the roles of these two activities in maintenance of genome stability, here we investigate the phenotypes of a mutant of yeast RNase H2 (rnh201-RED; ribonucleotide excision defective) that retains activity on RNA-DNA hybrids but is unable to cleave single ribonucleotides that are stably incorporated into the genome. The rnh201-RED mutant was expressed in wild type yeast or in a strain that also encodes a mutant allele of DNA polymerase ε (pol2-M644G) that enhances ribonucleotide incorporation during DNA replication. Similar to a strain that completely lacks RNase H2 (rnh201Δ), the pol2-M644G rnh201-RED strain exhibits replication stress and checkpoint activation. Moreover, like its null mutant counterpart, the double mutant pol2-M644G rnh201-RED strain and the single mutant rnh201-RED strain delete 2-5 base pairs in repetitive sequences at a high rate that is topoisomerase 1-dependent. The results highlight an important role for RNase H2 in maintaining genome integrity by removing single ribonucleotides incorporated during DNA replication. Published by Elsevier B.V.
Salmonella promotes virulence by repressing cellulose production
Pontes, Mauricio H.; Lee, Eun-Jin; Choi, Jeongjoon; Groisman, Eduardo A.
2015-01-01
Cellulose is the most abundant organic polymer on Earth. In bacteria, cellulose confers protection against environmental insults and is a constituent of biofilms typically formed on abiotic surfaces. We report that, surprisingly, Salmonella enterica serovar Typhimurium makes cellulose when inside macrophages. We determine that preventing cellulose synthesis increases virulence, whereas stimulation of cellulose synthesis inside macrophages decreases virulence. An attenuated mutant lacking the mgtC gene exhibited increased cellulose levels due to increased expression of the cellulose synthase gene bcsA and of cyclic diguanylate, the allosteric activator of the BcsA protein. Inactivation of bcsA restored wild-type virulence to the Salmonella mgtC mutant, but not to other attenuated mutants displaying a wild-type phenotype regarding cellulose. Our findings indicate that a virulence determinant can promote pathogenicity by repressing a pathogen's antivirulence trait. Moreover, they suggest that controlling antivirulence traits increases long-term pathogen fitness by mediating a trade-off between acute virulence and transmission. PMID:25848006
Zhou, Mingxu; Guo, Zhiyan; Yang, Yang; Duan, Qiangde; Zhang, Qi; Yao, Fenghua; Zhu, Jun; Zhang, Xinjun; Hardwidge, Philip R; Zhu, Guoqiang
2014-01-10
Bacteria that form biofilms are often highly resistant to antibiotics and are capable of evading the host immune system. To evaluate the role of flagellin and F4 fimbriae on biofilm formation by enterotoxigenic Escherichia coli (ETEC), we deleted the fliC (encoding the major flagellin protein) and/or the faeG (encoding the major subunit of F4 fimbriae) genes from ETEC C83902. Biofilm formation was reduced in the fliC mutant but increased in the faeG mutant, as compared with the wild-type strain. The expression of AI-2 quorum sensing associated genes was regulated in the fliC and faeG mutants, consistent with the biofilm formation of these strains. But, deleting fliC and/or faeG also inhibited AI-2 quorum sensing activity. Copyright © 2013 Elsevier B.V. All rights reserved.
Chen, Li-Qing; Lin, I Winnie; Qu, Xiao-Qing; Sosso, Davide; McFarlane, Heather E.; Londoño, Alejandra; Samuels, A. Lacey; Frommer, Wolf B.
2015-01-01
Developing plant embryos depend on nutrition from maternal tissues via the seed coat and endosperm, but the mechanisms that supply nutrients to plant embryos have remained elusive. Sucrose, the major transport form of carbohydrate in plants, is delivered via the phloem to the maternal seed coat and then secreted from the seed coat to feed the embryo. Here, we show that seed filling in Arabidopsis thaliana requires the three sucrose transporters SWEET11, 12, and 15. SWEET11, 12, and 15 exhibit specific spatiotemporal expression patterns in developing seeds, but only a sweet11;12;15 triple mutant showed severe seed defects, which include retarded embryo development, reduced seed weight, and reduced starch and lipid content, causing a “wrinkled” seed phenotype. In sweet11;12;15 triple mutants, starch accumulated in the seed coat but not the embryo, implicating SWEET-mediated sucrose efflux in the transfer of sugars from seed coat to embryo. This cascade of sequentially expressed SWEETs provides the feeding pathway for the plant embryo, an important feature for yield potential. PMID:25794936
Mutants of Agrobacterium tumefaciens with elevated vir gene expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pazour, G.J.; Ta, C.N.; Das, A.
1991-08-15
Expression of Agrobacterium tumefaciens virulence (vir) genes requires virA, virG, and a plant-derived inducing compound such as acetosyringone. To identify the critical functional domains of virA and virG, a mutational approach was used. Agrobacterium A136 harboring plasmid pGP159, which contains virA, virG, and a reporter virB:lacZ gene fusion, was mutagenized with UV light or nitrosoguanidine. Survivors that formed blue colonies on a plate containing 5-bromo-4-chloro-3-indolyl beta-D-galactoside were isolated and analyzed. Quantification of beta-galactosidase activity in liquid assays identified nine mutant strains. By plasmid reconstruction and other procedures, all mutations mapped to the virA locus. These mutations caused an 11- tomore » 560-fold increase in the vegetative level of virB:lacZ reporter gene expression. DNA sequence analysis showed that the mutations are located in four regions of VirA: transmembrane domain one, the active site, a glycine-rich region with homology to ATP-binding sites, and a region at the C terminus that has homology to the N terminus of VirG.« less
Yang, Yang; Cui, Yiting; Tang, Beisha
2017-01-01
Spinocerebellar ataxia 17 (SCA17) is caused by polyglutamine (polyQ) repeat expansion in the TATA-binding protein (TBP) and is among a family of neurodegenerative diseases in which polyQ expansion leads to preferential neuronal loss in the brain. Although previous studies have demonstrated that expression of polyQ-expanded proteins in glial cells can cause neuronal injury via noncell-autonomous mechanisms, these studies investigated animal models that overexpress transgenic mutant proteins. Since glial cells are particularly reactive to overexpressed mutant proteins, it is important to investigate the in vivo role of glial dysfunction in neurodegeneration when mutant polyQ proteins are endogenously expressed. In the current study, we generated two conditional TBP-105Q knock-in mouse models that specifically express mutant TBP at the endogenous level in neurons or in astrocytes. We found that mutant TBP expression in neuronal cells or astrocytes alone only caused mild neurodegeneration, whereas severe neuronal toxicity requires the expression of mutant TBP in both neuronal and glial cells. Coculture of neurons and astrocytes further validated that mutant TBP in astrocytes promoted neuronal injury. We identified activated inflammatory signaling pathways in mutant TBP-expressing astrocytes, and blocking nuclear factor κB (NF-κB) signaling in astrocytes ameliorated neurodegeneration. Our results indicate that the synergistic toxicity of mutant TBP in neuronal and glial cells plays a critical role in SCA17 pathogenesis and that targeting glial inflammation could be a potential therapeutic approach for SCA17 treatment. SIGNIFICANCE STATEMENT Mutant TBP with polyglutamine expansion preferentially affects neuronal viability in SCA17 patients. Whether glia, the cells that support and protect neurons, contribute to neurodegeneration in SCA17 remains mostly unexplored. In this study, we provide both in vivo and in vitro evidence arguing that endogenous expression of mutant TBP in neurons and glia synergistically impacts neuronal survival. Hyperactivated inflammatory signaling pathways, particularly the NF-κB pathway, underlie glia-mediated neurotoxicity. Moreover, blocking NF-κB activity with small chemical inhibitors alleviated such neurotoxicity. Our study establishes glial dysfunction as an important component of SCA17 pathogenesis and suggests targeting glial inflammation as a potential therapeutic approach for SCA17 treatment. PMID:28821675
Constantino, Nasie N.; Mastouri, Fatemeh; Damarwinasis, Ramadhika; Borrego, Eli J.; Moran-Diez, Maria E.; Kenerley, Charley M.; Gao, Xiquan; Kolomiets, Michael V.
2013-01-01
We have previously reported that disruption of a maize root-expressed 9-lipoxygenase (9-LOX) gene, ZmLOX3, results in dramatic increase in resistance to diverse leaf and stalk pathogens. Despite evident economic significance of these findings, the mechanism behind this increased resistance remained elusive. In this study, we found that increased resistance of the lox3-4 mutants is due to constitutive activation of induced systemic resistance (ISR) signaling. We showed that ZmLOX3 lacked expression in leaves in response to anthracnose leaf blight pathogen Colletotrichum graminicola, but was expressed constitutively in the roots, thus, prompting our hypothesis: the roots of lox3-4 mutants are the source of increased resistance in leaves. Supporting this hypothesis, treatment of wild-type plants (WT) with xylem sap of lox3-4 mutant induced resistance to C. graminicola to the levels comparable to those observed in lox3-4 mutant. Moreover, treating mutants with the sap collected from WT plants partially restored the susceptibility to C. graminicola. lox3-4 mutants showed primed defense responses upon infection, which included earlier and greater induction of defense-related PAL and GST genes compared to WT. In addition to the greater expression of the octadecanoid pathway genes, lox3-4 mutant responded earlier and with a greater accumulation of H2O2 in response to C. graminicola infection or treatment with alamethicin. These findings suggest that lox3-4 mutants display constitutive ISR-like signaling. In support of this idea, root colonization by Trichoderma virens strain GV29-8 induced the same level of disease resistance in WT as the treatment with the mutant sap, but had no additional resistance effect in lox3-4 mutant. While treatment with T. virens GV29 strongly and rapidly suppressed ZmLOX3 expression in hydroponically grown WT roots, T. virens Δsml mutant, which is deficient in ISR induction, was unable to suppress expression of ZmLOX3, thus, providing genetic evidence that SM1 function in ISR, at least in part, by suppressing host ZmLOX3 gene. This study and the genetic tools generated herein will allow the identification of the signals regulating the induction of resistance to aboveground attackers by beneficial soil microorganisms in the future. PMID:24391653
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai
Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species.more » The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.« less
Dysregulated human Tyrosyl-DNA phosphodiesterase I acts as cellular toxin
Cuya, Selma M.; Comeaux, Evan Q.; Wanzeck, Keith; Yoon, Karina J.; van Waardenburg, Robert C.A.M.
2016-01-01
Tyrosyl-DNA phosphodiesterase I (TDP1) hydrolyzes the drug-stabilized 3’phospho-tyrosyl bond formed between DNA topoisomerase I (TOPO1) and DNA. TDP1-mediated hydrolysis uses a nucleophilic histidine (Hisnuc) and a general acid/base histidine (Hisgab). A Tdp1Hisgab to Arg mutant identified in patients with the autosomal recessive neurodegenerative disease SCAN1 causes stabilization of the TDP1-DNA intermediate. Based on our previously reported Hisgab-substitutions inducing yeast toxicity (Gajewski et al. J. Mol. Biol. 415, 741-758, 2012), we propose that converting TDP1 into a cellular poison by stabilizing the covalent enzyme-DNA intermediate is a novel therapeutic strategy for cancer treatment. Here, we analyzed the toxic effects of two TDP1 catalytic mutants in HEK293 cells. Expression of human Tdp1HisnucAla and Tdp1HisgabAsn mutants results in stabilization of the covalent TDP1-DNA intermediate and induces cytotoxicity. Moreover, these mutants display reduced in vitro catalytic activity compared to wild type. Co-treatment of Tdp1mutant with topotecan shows more than additive cytotoxicity. Overall, these results support the hypothesis that stabilization of the TDP1-DNA covalent intermediate is a potential anti-cancer therapeutic strategy. PMID:27893431
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shin, Kwang-Soo, E-mail: shinks@dju.kr; Kim, Young Hwan; Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon, 305-764
2015-07-31
The opportunistic human pathogenic fungus Aspergillus fumigatus primarily reproduces by forming a large number of asexual spores (conidia). Sequential activation of the central regulators BrlA, AbaA and WetA is necessary for the fungus to undergo asexual development. In this study, to address the presumed roles of these key developmental regulators during proliferation of the fungus, we analyzed and compared the proteomes of vegetative cells of wild type (WT) and individual mutant strains. Approximately 1300 protein spots were detectable from 2-D electrophoresis gels. Among these, 13 proteins exhibiting significantly altered accumulation levels were further identified by ESI-MS/MS. Markedly, we found thatmore » the GliM and GliT proteins associated with gliotoxin (GT) biosynthesis and self-protection of the fungus from GT were significantly down-regulated in the ΔabaA and ΔbrlA mutants. Moreover, mRNA levels of other GT biosynthetic genes including gliM, gliP, gliT, and gliZ were significantly reduced in both mutant strains, and no and low levels of GT were detectable in the ΔbrlA and ΔabaA mutant strains, respectively. As GliT is required for the protection of the fungus from GT, growth of the ΔbrlA mutant with reduced levels of GliT was severely impaired by exogenous GT. Our studies demonstrate that AbaA and BrlA positively regulate expression of the GT biosynthetic gene cluster in actively growing vegetative cells, and likely bridge morphological and chemical development during the life-cycle of A. fumigatus. - Highlights: • Proteome analyses of WT and mutants reveal 13 differentially expressed proteins. • The GliT and GliM proteins are significantly down-regulated by ΔabaA and ΔbrlA. • Expression of other gliotoxin biosynthetic genes is lowered by ΔabaA and ΔbrlA. • Growth of ΔbrlA strain lacking GliT is completely inhibited by exogenous gliotoxin. • BrlA and AbaA play key roles in biogenesis of gliotoxin in Aspergillus fumigatus.« less
A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis
Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A
2015-01-01
Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829
Takamatsu, Daisuke; Bensing, Barbara A.; Sullam, Paul M.
2004-01-01
Platelet binding by Streptococcus gordonii strain M99 is mediated predominantly by the cell surface glycoprotein GspB. This adhesin consists of a putative N-terminal signal peptide, two serine-rich regions (SRR1 and SRR2), a basic region between SRR1 and SRR2, and a C-terminal cell wall anchoring domain. The glycosylation of GspB is mediated at least in part by Gly and Nss, which are encoded in the secY2A2 locus immediately downstream of gspB. This region also encodes two proteins (Gtf and Orf4) that are required for the expression of GspB but whose functions have not been delineated. In this study, we further characterized the roles of Gly, Nss, Gtf, and Orf4 by investigating the expression and glycosylation of a series of glutathione S-transferase-GspB fusion proteins in M99 and in gly, nss, gtf, and orf4 mutants. Compared with fusion proteins expressed in the wild-type background, fusion proteins expressed in the mutant strain backgrounds showed altered electrophoretic mobility. In addition, the fusion proteins formed insoluble aggregates in protoplasts of the gtf and orf4 mutants. Glycan detection and lectin blot analysis revealed that SRR1 and SRR2 were glycosylated but that the basic region was unmodified. When the fusion protein was expressed in Escherichia coli, glycosylation of this protein was observed only in the presence of both gtf and orf4. These results demonstrate that Gly, Nss, Gtf, and Orf4 are all involved in the intracellular glycosylation of SRRs. Moreover, Gtf and Orf4 are essential for glycosylation, which in turn is important for the solubility of GspB. PMID:15489421
Functional characterization of type-B response regulators in the Arabidopsis cytokinin response.
Hill, Kristine; Mathews, Dennis E; Kim, Hyo Jung; Street, Ian H; Wildes, Sarah L; Chiang, Yi-Hsuan; Mason, Michael G; Alonso, Jose M; Ecker, Joseph R; Kieber, Joseph J; Schaller, G Eric
2013-05-01
Cytokinins play critical roles in plant growth and development, with the transcriptional response to cytokinin being mediated by the type-B response regulators. In Arabidopsis (Arabidopsis thaliana), type-B response regulators (ARABIDOPSIS RESPONSE REGULATORS [ARRs]) form three subfamilies based on phylogenic analysis, with subfamily 1 having seven members and subfamilies 2 and 3 each having two members. Cytokinin responses are predominantly mediated by subfamily 1 members, with cytokinin-mediated effects on root growth and root meristem size correlating with type-B ARR expression levels. To determine which type-B ARRs can functionally substitute for the subfamily 1 members ARR1 or ARR12, we expressed different type-B ARRs from the ARR1 promoter and assayed their ability to rescue arr1 arr12 double mutant phenotypes. ARR1, as well as a subset of other subfamily 1 type-B ARRs, restore the cytokinin sensitivity to arr1 arr12. Expression of ARR10 from the ARR1 promoter results in cytokinin hypersensitivity and enhances shoot regeneration from callus tissue, correlating with enhanced stability of the ARR10 protein compared with the ARR1 protein. Examination of transfer DNA insertion mutants in subfamilies 2 and 3 revealed little effect on several well-characterized cytokinin responses. However, a member of subfamily 2, ARR21, restores cytokinin sensitivity to arr1 arr12 roots when expressed from the ARR1 promoter, indicating functional conservation of this divergent family member. Our results indicate that the type-B ARRs have diverged in function, such that some, but not all, can complement the arr1 arr12 mutant. In addition, our results indicate that type-B ARR expression profiles in the plant, along with posttranscriptional regulation, play significant roles in modulating their contribution to cytokinin signaling.
Rebello, George; Ramesar, Rajkumar; Vorster, Alvera; Roberts, Lisa; Ehrenreich, Liezle; Oppon, Ekow; Gama, Dumisani; Bardien, Soraya; Greenberg, Jacquie; Bonapace, Giuseppe; Waheed, Abdul; Shah, Gul N.; Sly, William S.
2004-01-01
Genetic and physical mapping of the RP17 locus on 17q identified a 3.6-megabase candidate region that includes the gene encoding carbonic anhydrase IV (CA4), a glycosylphosphatidylinositol-anchored protein that is highly expressed in the choriocapillaris of the human eye. By sequencing candidate genes in this region, we identified a mutation that causes replacement of an arginine with a tryptophan (R14W) in the signal sequence of the CA4 gene at position -5 relative to the signal sequence cleavage site. This mutation was found to cosegregate with the disease phenotype in two large families and was not found in 36 unaffected family members or 100 controls. Expression of the mutant cDNA in COS-7 cells produced several findings, suggesting a mechanism by which the mutation can explain the autosomal dominant disease. In transfected COS-7 cells, the R14W mutation (i) reduced the steady-state level of carbonic anhydrase IV activity expressed by 28% due to a combination of decreased synthesis and accelerated turnover; (ii) led to up-regulation of immunoglobulin-binding protein, double-stranded RNA-regulated protein kinase-like ER kinase, and CCAAT/enhancer-binding protein homologous protein, markers of the unfolded protein response and endoplasmic reticulum stress; and (iii) induced apoptosis, as evidenced by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining, in most cells expressing the mutant, but not the WT, protein. We suggest that a high level of expression of the mutant allele in the endothelial cells of the choriocapillaris leads to apoptosis, leading in turn to ischemia in the overlying retina and producing autosomal dominant retinitis pigmentosa. PMID:15090652
Biofilm formation ability of Salmonella enterica serovar Typhimurium acrAB mutants.
Schlisselberg, Dov B; Kler, Edna; Kisluk, Guy; Shachar, Dina; Yaron, Sima
2015-10-01
Recent studies offer contradictory findings about the role of multidrug efflux pumps in bacterial biofilm development. Thus, the aim of this study was to investigate the involvement of the AcrAB efflux pump in biofilm formation by investigating the ability of AcrB and AcrAB null mutants of Salmonella enterica serovar Typhimurium to produce biofilms. Three models were used to compare the ability of S. Typhimurium wild-type and its mutants to form biofilms: formation of biofilm on polystyrene surfaces; production of biofilm (mat model) on the air/liquid interface; and expression of curli and cellulose on Congo red-supplemented agar plates. All three investigated genotypes formed biofilms with similar characteristics. However, upon exposure to chloramphenicol, formation of biofilms on solid surfaces as well as the production of curli were either reduced or were delayed more significantly in both mutants, whilst there was no visible effect on pellicle formation. It can be concluded that when no selective pressure is applied, S. Typhimurium is able to produce biofilms even when the AcrAB efflux pumps are inactivated, implying that the use of efflux pump inhibitors to prevent biofilm formation is not a general solution and that combined treatments might be more efficient. Other factors that affect the ability to produce biofilms depending on efflux pump activity are yet to be identified. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Blank, T E; Woods, M P; Lebo, C M; Xin, P; Hopper, J E
1997-01-01
Gal4p-mediated activation of galactose gene expression in Saccharomyces cerevisiae normally requires both galactose and the activity of Gal3p. Recent evidence suggests that in cells exposed to galactose, Gal3p binds to and inhibits Ga180p, an inhibitor of the transcriptional activator Gal4p. Here, we report on the isolation and characterization of novel mutant forms of Gal3p that can induce Gal4p activity independently of galactose. Five mutant GAL3(c) alleles were isolated by using a selection demanding constitutive expression of a GAL1 promoter-driven HIS3 gene. This constitutive effect is not due to overproduction of Gal3p. The level of constitutive GAL gene expression in cells bearing different GAL3(c) alleles varies over more than a fourfold range and increases in response to galactose. Utilizing glutathione S-transferase-Gal3p fusions, we determined that the mutant Gal3p proteins show altered Gal80p-binding characteristics. The Gal3p mutant proteins differ in their requirements for galactose and ATP for their Gal80p-binding ability. The behavior of the novel Gal3p proteins provides strong support for a model wherein galactose causes an alteration in Gal3p that increases either its ability to bind to Gal80p or its access to Gal80p. With the Gal3p-Gal80p interaction being a critical step in the induction process, the Gal3p proteins constitute an important new reagent for studying the induction mechanism through both in vivo and in vitro methods. PMID:9111326
Klein, Ophir; Polack, Glenda W.; Surti, Toral; Kegler-Ebo, Deena; Smith, Steven O.; DiMaio, Daniel
1998-01-01
The bovine papillomavirus E5 protein is a small, homodimeric transmembrane protein that forms a stable complex with the cellular platelet-derived growth factor (PDGF) β receptor through transmembrane and juxtamembrane interactions, resulting in receptor activation and cell transformation. Glutamine 17 in the transmembrane domain of the 44-amino-acid E5 protein is critical for complex formation and receptor activation, and we previously proposed that glutamine 17 forms a hydrogen bond with threonine 513 of the PDGF β receptor. We have constructed and analyzed mutant E5 proteins containing all possible amino acids at position 17 and examined the ability of these proteins to transform C127 fibroblasts, which express endogenous PDGF β receptor. Although several position 17 mutants were able to transform cells, mutants containing amino acids with side groups that were unable to participate in hydrogen bonding interactions did not form a stable complex with the PDGF β receptor or transform cells, in agreement with the proposed interaction between position 17 of the E5 protein and threonine 513 of the receptor. The nature of the residue at position 17 also affected the ability of the E5 proteins to dimerize. Overall, there was an excellent correlation between the ability of the various E5 mutant proteins to bind the PDGF β receptor, lead to receptor tyrosine phosphorylation, and transform cells. Similar results were obtained in Ba/F3 hematopoietic cells expressing exogenous PDGF β receptor. In addition, treatment of E5-transformed cells with a specific inhibitor of the PDGF receptor tyrosine kinase reversed the transformed phenotype. These results confirm the central importance of the PDGF β receptor in mediating E5 transformation and highlight the critical role of the residue at position 17 of the E5 protein in the productive interaction with the PDGF β receptor. On the basis of molecular modeling analysis and the known chemical properties of the amino acids, we suggest a structural basis for the role of the residue at position 17 in E5 dimerization and in complex formation between the E5 protein and the PDGF β receptor. PMID:9765437
Klein, O; Polack, G W; Surti, T; Kegler-Ebo, D; Smith, S O; DiMaio, D
1998-11-01
The bovine papillomavirus E5 protein is a small, homodimeric transmembrane protein that forms a stable complex with the cellular platelet-derived growth factor (PDGF) beta receptor through transmembrane and juxtamembrane interactions, resulting in receptor activation and cell transformation. Glutamine 17 in the transmembrane domain of the 44-amino-acid E5 protein is critical for complex formation and receptor activation, and we previously proposed that glutamine 17 forms a hydrogen bond with threonine 513 of the PDGF beta receptor. We have constructed and analyzed mutant E5 proteins containing all possible amino acids at position 17 and examined the ability of these proteins to transform C127 fibroblasts, which express endogenous PDGF beta receptor. Although several position 17 mutants were able to transform cells, mutants containing amino acids with side groups that were unable to participate in hydrogen bonding interactions did not form a stable complex with the PDGF beta receptor or transform cells, in agreement with the proposed interaction between position 17 of the E5 protein and threonine 513 of the receptor. The nature of the residue at position 17 also affected the ability of the E5 proteins to dimerize. Overall, there was an excellent correlation between the ability of the various E5 mutant proteins to bind the PDGF beta receptor, lead to receptor tyrosine phosphorylation, and transform cells. Similar results were obtained in Ba/F3 hematopoietic cells expressing exogenous PDGF beta receptor. In addition, treatment of E5-transformed cells with a specific inhibitor of the PDGF receptor tyrosine kinase reversed the transformed phenotype. These results confirm the central importance of the PDGF beta receptor in mediating E5 transformation and highlight the critical role of the residue at position 17 of the E5 protein in the productive interaction with the PDGF beta receptor. On the basis of molecular modeling analysis and the known chemical properties of the amino acids, we suggest a structural basis for the role of the residue at position 17 in E5 dimerization and in complex formation between the E5 protein and the PDGF beta receptor.
Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata
2005-01-01
Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.
Beaudoin, Guillaume A.W.; Johnson, Timothy S.; Hanson, Andrew D.
2018-01-01
In plants, the hydroxymethylpyrimidine (HMP) and thiazole precursors of thiamin are synthesized and coupled together to form thiamin in plastids. Mutants unable to form HMP can be rescued by exogenous HMP, implying the presence of HMP transporters in the plasma membrane and plastids. Analysis of bacterial genomes revealed a transporter gene that is chromosomally clustered with thiamin biosynthesis and salvage genes. Its closest Arabidopsis homolog, the plastidic nucleobase transporter (PLUTO), is co-expressed with several thiamin biosynthetic enzymes. Heterologous expression of PLUTO in Escherichia coli or Saccharomyces cerevisiae increased sensitivity to a toxic HMP analog, and disrupting PLUTO in an HMP-requiring Arabidopsis line reduced root growth at low HMP concentrations. These data implicate PLUTO in plastidial transport and salvage of HMP. PMID:29507060
2018-01-01
ABSTRACT Botrytis cinerea is a plant-pathogenic fungus producing apothecia as sexual fruiting bodies. To study the function of mating type (MAT) genes, single-gene deletion mutants were generated in both genes of the MAT1-1 locus and both genes of the MAT1-2 locus. Deletion mutants in two MAT genes were entirely sterile, while mutants in the other two MAT genes were able to develop stipes but never formed an apothecial disk. Little was known about the reprogramming of gene expression during apothecium development. We analyzed transcriptomes of sclerotia, three stages of apothecium development (primordia, stipes, and apothecial disks), and ascospores by RNA sequencing. Ten secondary metabolite gene clusters were upregulated at the onset of sexual development and downregulated in ascospores released from apothecia. Notably, more than 3,900 genes were differentially expressed in ascospores compared to mature apothecial disks. Among the genes that were upregulated in ascospores were numerous genes encoding virulence factors, which reveals that ascospores are transcriptionally primed for infection prior to their arrival on a host plant. Strikingly, the massive transcriptional changes at the initiation and completion of the sexual cycle often affected clusters of genes, rather than randomly dispersed genes. Thirty-five clusters of genes were jointly upregulated during the onset of sexual reproduction, while 99 clusters of genes (comprising >900 genes) were jointly downregulated in ascospores. These transcriptional changes coincided with changes in expression of genes encoding enzymes participating in chromatin organization, hinting at the occurrence of massive epigenetic regulation of gene expression during sexual reproduction. PMID:29440571
Spiers, Andrew J; Rainey, Paul B
2005-09-01
The wrinkly spreader (WS) isolate of Pseudomonas fluorescens SBW25 forms a substantial biofilm at the air-liquid interface. The biofilm is composed of an extracellular partially acetylated cellulose-fibre matrix, and previous mutagenesis of WS with mini-Tn5 had identified both the regulatory and cellulose-biosynthetic operons. One uncharacterized WS mutant, WS-5, still expressed cellulose but produced very weak biofilms. In this work, the mini-Tn5 insertion site in WS-5 has been identified as being immediately upstream of the tol-pal operon. Like Tol-Pal mutants of other Gram-negative bacteria, WS-5 showed a "leaky-membrane" phenotype, including the serendipitous ability to utilize sucrose, increased uptake of the hydrophilic dye propidium iodide, and the loss of lipopolysaccharide (LPS) expression. WS-5 cells were altered in relative hydrophobicity, and showed poorer recruitment and maintenance in the biofilm than WS. The WS-5 biofilm was also less sensitive to chemical interference during development. However, growth rate, cellulose expression and attachment were not significantly different between WS and WS-5. Finally, WS-5 biofilms could be partially complemented with WS-4, a biofilm- and attachment-deficient mutant that expressed LPS, resulting in a mixed biofilm with significantly increased strength. These findings show that a major component of the WS air-liquid biofilm strength results from the interactions between LPS and the cellulose matrix of the biofilm--and that in the WS biofilm, cellulose fibres, attachment factor and LPS are required for biofilm development, strength and integrity.
OsCSLD1, a Cellulose Synthase-Like D1 Gene, Is Required for Root Hair Morphogenesis in Rice1[C][W
Kim, Chul Min; Park, Sung Han; Je, Byoung Il; Park, Su Hyun; Park, Soon Ju; Piao, Hai Long; Eun, Moo Young; Dolan, Liam; Han, Chang-deok
2007-01-01
Root hairs are long tubular outgrowths that form on the surface of specialized epidermal cells. They are required for nutrient and water uptake and interact with the soil microflora. Here we show that the Oryza sativa cellulose synthase-like D1 (OsCSLD1) gene is required for root hair development, as rice (Oryza sativa) mutants that lack OsCSLD1 function develop abnormal root hairs. In these mutants, while hair development is initiated normally, the hairs elongate less than the wild-type hairs and they have kinks and swellings along their length. Because the csld1 mutants develop the same density and number of root hairs along their seminal root as the wild-type plants, we propose that OsCSLD1 function is required for hair elongation but not initiation. Both gene trap expression pattern and in situ hybridization analyses indicate that OsCSLD1 is expressed in only root hair cells. Furthermore, OsCSLD1 is the only member of the four rice CSLD genes that shows root-specific expression. Given that the Arabidopsis (Arabidopsis thaliana) gene KOJAK/AtCSLD3 is required for root hair elongation and is expressed in the root hair, it appears that OsCSLD1 may be the functional ortholog of KOJAK/AtCSLD3 and that these two genes represent the root hair-specific members of this family of proteins. Thus, at least part of the mechanism of root hair morphogenesis in Arabidopsis is conserved in rice. PMID:17259288
Probing transcription-specific outputs of β-catenin in vivo
Valenta, Tomas; Gay, Max; Steiner, Sarah; Draganova, Kalina; Zemke, Martina; Hoffmans, Raymond; Cinelli, Paolo; Aguet, Michel; Sommer, Lukas; Basler, Konrad
2011-01-01
β-Catenin, apart from playing a cell-adhesive role, is a key nuclear effector of Wnt signaling. Based on activity assays in Drosophila, we generated mouse strains where the endogenous β-catenin protein is replaced by mutant forms, which retain the cell adhesion function but lack either or both of the N- and the C-terminal transcriptional outputs. The C-terminal activity is essential for mesoderm formation and proper gastrulation, whereas N-terminal outputs are required later during embryonic development. By combining the double-mutant β-catenin with a conditional null allele and a Wnt1-Cre driver, we probed the role of Wnt/β-catenin signaling in dorsal neural tube development. While loss of β-catenin protein in the neural tube results in severe cell adhesion defects, the morphology of cells and tissues expressing the double-mutant form is normal. Surprisingly, Wnt/β-catenin signaling activity only moderately regulates cell proliferation, but is crucial for maintaining neural progenitor identity and for neuronal differentiation in the dorsal spinal cord. Our model animals thus allow dissecting signaling and structural functions of β-catenin in vivo and provide the first genetic tool to generate cells and tissues that entirely and exclusively lack canonical Wnt pathway activity. PMID:22190459
Engineering Visual Arrestin-1 with Special Functional Characteristics*
Vishnivetskiy, Sergey A.; Chen, Qiuyan; Palazzo, Maria C.; Brooks, Evan K.; Altenbach, Christian; Iverson, Tina M.; Hubbell, Wayne L.; Gurevich, Vsevolod V.
2013-01-01
Arrestin-1 preferentially binds active phosphorylated rhodopsin. Previously, a mutant with enhanced binding to unphosphorylated active rhodopsin (Rh*) was shown to partially compensate for lack of rhodopsin phosphorylation in vivo. Here we showed that reengineering of the receptor binding surface of arrestin-1 further improves the binding to Rh* while preserving protein stability. In mammals, arrestin-1 readily self-associates at physiological concentrations. The biological role of this phenomenon can only be elucidated by replacing wild type arrestin-1 in living animals with a non-oligomerizing mutant retaining all other functions. We demonstrate that constitutively monomeric forms of arrestin-1 are sufficiently stable for in vivo expression. We also tested the idea that individual functions of arrestin-1 can be independently manipulated to generate mutants with the desired combinations of functional characteristics. Here we showed that this approach is feasible; stable forms of arrestin-1 with high Rh* binding can be generated with or without the ability to self-associate. These novel molecular tools open the possibility of testing of the biological role of arrestin-1 self-association and pave the way to elucidation of full potential of compensational approach to gene therapy of gain-of-function receptor mutations. PMID:23250748
Reedijk, M; Liu, X Q; Pawson, T
1990-01-01
The interactions of the macrophage colony-stimulating factor 1 (CSF-1) receptor with potential targets were investigated after ligand stimulation either of mouse macrophages or of fibroblasts that ectopically express mouse CSF-1 receptors. In Rat-2 cells expressing the mouse CSF-1 receptor, full activation of the receptor and cellular transformation require exogenous CSF-1, whereas NIH 3T3 cells expressing mouse c-fms are transformed by autocrine stimulation. Activated CSF-1 receptors physically associate with a phosphatidylinositol (PI) 3'-kinase. A mutant CSF-1 receptor with a deletion of the kinase insert region was deficient in its ability to bind functional PI 3'-kinase and to induce PI 3'-kinase activity precipitable with antiphosphotyrosine antibodies. In fibroblasts, CSF-1 stimulation also induced the phosphorylation of the GTPase-activating protein (GAP)-associated protein p62 on tyrosine, although GAP itself was a relatively poor substrate. In contrast to PI 3'-kinase association, phosphorylation of p62 and GAP was not markedly affected by deletion of the kinase insert region. These results indicate that the kinase insert region selectively enhances the CSF-1-dependent association of the CSF-1 receptor with active PI 3'-kinase. The insert deletion mutant retains considerable transforming activity in NIH 3T3 cells (G. Taylor, M. Reedijk, V. Rothwell, L. Rohrschneider, and T. Pawson, EMBO J. 8:2029-2037, 1989). This mutant was more seriously impaired in Rat-2 cell transformation, although mutant-expressing Rat-2 cells still formed small colonies in soft agar in the presence of CSF-1. Therefore, phosphorylation of GAP and p62 through activation of the CSF-1 receptor does not result in full fibroblast transformation. The interaction between the CSF-1 receptor and PI 3'-kinase may contribute to c-fms fibroblast transformation and play a role in CSF-1-stimulated macrophages. Images PMID:2172781
Yoshida, Takuya; Fujita, Yasunari; Sayama, Hiroko; Kidokoro, Satoshi; Maruyama, Kyonoshin; Mizoi, Junya; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko
2010-02-01
A myriad of drought stress-inducible genes have been reported, and many of these are activated by abscisic acid (ABA). In the promoter regions of such ABA-regulated genes, conserved cis-elements, designated ABA-responsive elements (ABREs), control gene expression via bZIP-type AREB/ABF transcription factors. Although all three members of the AREB/ABF subfamily, AREB1, AREB2, and ABF3, are upregulated by ABA and water stress, it remains unclear whether these are functional homologs. Here, we report that all three AREB/ABF transcription factors require ABA for full activation, can form hetero- or homodimers to function in nuclei, and can interact with SRK2D/SnRK2.2, an SnRK2 protein kinase that was identified as a regulator of AREB1. Along with the tissue-specific expression patterns of these genes and the subcellular localization of their encoded proteins, these findings clearly indicate that AREB1, AREB2, and ABF3 have largely overlapping functions. To elucidate the role of these AREB/ABF transcription factors, we generated an areb1 areb2 abf3 triple mutant. Large-scale transcriptome analysis, which showed that stress-responsive gene expression is remarkably impaired in the triple mutant, revealed novel AREB/ABF downstream genes in response to water stress, including many LEA class and group-Ab PP2C genes and transcription factors. The areb1 areb2 abf3 triple mutant is more resistant to ABA than are the other single and double mutants with respect to primary root growth, and it displays reduced drought tolerance. Thus, these results indicate that AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent gene expression for ABA signaling under conditions of water stress.
Dysregulation of chromatin remodelling complexes in amyotrophic lateral sclerosis.
Tibshirani, Michael; Zhao, Beibei; Gentil, Benoit J; Minotti, Sandra; Marques, Christine; Keith, Julia; Rogaeva, Ekaterina; Zinman, Lorne; Rouaux, Caroline; Robertson, Janice; Durham, Heather D
2017-11-01
Amyotrophic lateral sclerosis is a fatal neurodegenerative disease with paralysis resulting from dysfunction and loss of motor neurons. A common neuropathological finding is attrition of motor neuron dendrites, which make central connections vital to motor control. The chromatin remodelling complex, neuronal Brahma-related gene 1 (Brg1)-associated factor complex (nBAF), is critical for neuronal differentiation, dendritic extension and synaptic function. We have identified loss of the crucial nBAF subunits Brg1, Brg1-associated factor 53b and calcium responsive transactivator in cultured motor neurons expressing FUS or TAR-DNA Binding Protein 43 (TDP-43) mutants linked to familial ALS. When plasmids encoding wild-type or mutant human FUS or TDP-43 were expressed in motor neurons of dissociated spinal cord cultures prepared from E13 mice, mutant proteins in particular accumulated in the cytoplasm. Immunolabelling of nBAF subunits was reduced in proportion to loss of nuclear FUS or TDP-43 and depletion of Brg1 was associated with nuclear retention of Brg1 mRNA. Dendritic attrition (loss of intermediate and terminal dendritic branches) occurred in motor neurons expressing mutant, but not wild-type, FUS or TDP-43. This attrition was delayed by ectopic over-expression of Brg1 and was reproduced by inhibiting Brg1 activity either through genetic manipulation or treatment with the chemical inhibitor, (E)-1-(2-Hydroxyphenyl)-3-((1R, 4R)-5-(pyridin-2-yl)-2, 5-diazabicyclo[2.2.1]heptan-2-yl)prop-2-en-1-one, demonstrating the importance of Brg1 to maintenance of dendritic architecture. Loss of nBAF subunits was also documented in spinal motor neurons in autopsy tissue from familial amyotrophic sclerosis (chromosome 9 open reading frame 72 with G4C2 nucleotide expansion) and from sporadic cases with no identified mutation, pointing to dysfunction of nBAF chromatin remodelling in multiple forms of ALS. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females
Sakai, Takaomi; Kasuya, Junko; Kitamoto, Toshihiro; Aigaki, Toshiro
2009-01-01
Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. Here we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNAi in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. On the other hand, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity. PMID:19531155
The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females.
Sakai, T; Kasuya, J; Kitamoto, T; Aigaki, T
2009-07-01
Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. In this study, we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNA interference (RNAi) in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. However, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity.
Boyce, John D.; Harper, Marina; St. Michael, Frank; John, Marietta; Aubry, Annie; Parnas, Henrietta; Logan, Susan M.; Wilkie, Ian W.; Ford, Mark; Cox, Andrew D.; Adler, Ben
2009-01-01
We previously determined the structure of the Pasteurella multocida Heddleston type 1 lipopolysaccharide (LPS) molecule and characterized some of the transferases essential for LPS biosynthesis. We also showed that P. multocida strains expressing truncated LPS display reduced virulence. Here, we have identified all of the remaining glycosyltransferases required for synthesis of the oligosaccharide extension of the P. multocida Heddleston type 1 LPS, including a novel α-1,6 glucosyltransferase, a β-1,4 glucosyltransferase, a putative bifunctional galactosyltransferase, and two heptosyltransferases. In addition, we identified a novel oligosaccharide extension expressed only in a heptosyltransferase (hptE) mutant background. All of the analyzed mutants expressing LPS with a truncated main oligosaccharide extension displayed reduced virulence, but those expressing LPS with an intact heptose side chain were able to persist for long periods in muscle tissue. The hptC mutant, which expressed LPS with the shortest oligosaccharide extension and no heptose side chain, was unable to persist on the muscle or cause any disease. Furthermore, all of the mutants displayed increased sensitivity to the chicken antimicrobial peptide fowlicidin 1, with mutants expressing highly truncated LPS being the most sensitive. PMID:19168738
Finiguerra, Michael; Avery, David E.; Dam, Hans G.
2015-01-01
The marine copepod Acartia hudsonica was shown to be adapted to dinoflagellate prey, Alexandrium fundyense, which produce paralytic shellfish toxins (PST). Adaptation to PSTs in other organisms is caused by a mutation in the sodium channel. Recently, a mutation in the sodium channel in A. hudsonica was found. In this study, we rigorously tested for advantages, costs, and trade-offs associated with the mutant isoform of A. hudsonica under toxic and non-toxic conditions. We combined fitness with wild-type: mutant isoform ratio measurements on the same individual copepod to test our hypotheses. All A. hudsonica copepods express both the wild-type and mutant sodium channel isoforms, but in different proportions; some individuals express predominantly mutant (PMI) or wild-type isoforms (PWI), while most individuals express relatively equal amounts of each (EI). There was no consistent pattern of improved performance as a function of toxin dose for egg production rate (EPR), ingestion rate (I), and gross growth efficiency (GGE) for individuals in the PMI group relative to individuals in the PWI expression group. Neither was there any evidence to indicate a fitness benefit to the mutant isoform at intermediate toxin doses. No clear advantage under toxic conditions was associated with the mutation. Using a mixed-diet approach, there was also no observed relationship between individual wild-type: mutant isoform ratios and among expression groups, on both toxic and non-toxic diets, for eggs produced over three days. Lastly, expression of the mutant isoform did not mitigate the negative effects of the toxin. That is, the reductions in EPR from a toxic to non-toxic diet for copepods were independent of expression groups. Overall, the results did not support our hypotheses; the mutant sodium channel isoform does not appear to be related to adaptation to PST in A. hudsonica. Other potential mechanisms responsible for the adaptation are discussed. PMID:26075900
The Cytoplasmic Carbonic Anhydrases βCA2 and βCA4 Are Required for Optimal Plant Growth at Low CO2.
DiMario, Robert J; Quebedeaux, Jennifer C; Longstreth, David J; Dassanayake, Maheshi; Hartman, Monica M; Moroney, James V
2016-05-01
Carbonic anhydrases (CAs) are zinc metalloenzymes that interconvert CO2 and HCO3 (-) In plants, both α- and β-type CAs are present. We hypothesize that cytoplasmic βCAs are required to modulate inorganic carbon forms needed in leaf cells for carbon-requiring reactions such as photosynthesis and amino acid biosynthesis. In this report, we present evidence that βCA2 and βCA4 are the two most abundant cytoplasmic CAs in Arabidopsis (Arabidopsis thaliana) leaves. Previously, βCA4 was reported to be localized to the plasma membrane, but here, we show that two forms of βCA4 are expressed in a tissue-specific manner and that the two proteins encoded by βCA4 localize to two different regions of the cell. Comparing transfer DNA knockout lines with wild-type plants, there was no reduction in the growth rates of the single mutants, βca2 and βca4 However, the growth rate of the double mutant, βca2βca4, was reduced significantly when grown at 200 μL L(-1) CO2 The reduction in growth of the double mutant was not linked to a reduction in photosynthetic rate. The amino acid content of leaves from the double mutant showed marked reduction in aspartate when compared with the wild type and the single mutants. This suggests the cytoplasmic CAs play an important but not previously appreciated role in amino acid biosynthesis. © 2016 American Society of Plant Biologists. All Rights Reserved.
Hathroubi, S.; Hancock, M. A.; Langford, P. R.; Tremblay, Y. D. N.; Labrie, J.
2015-01-01
Actinobacillus pleuropneumoniae is a Gram-negative bacterium belonging to the Pasteurellaceae family and the causative agent of porcine pleuropneumonia, a highly contagious lung disease causing important economic losses. Surface polysaccharides, including lipopolysaccharides (LPS) and capsular polysaccharides (CPS), are implicated in the adhesion and virulence of A. pleuropneumoniae, but their role in biofilm formation is still unclear. In this study, we investigated the requirement for these surface polysaccharides in biofilm formation by A. pleuropneumoniae serotype 1. Well-characterized mutants were used: an O-antigen LPS mutant, a truncated core LPS mutant with an intact O antigen, a capsule mutant, and a poly-N-acetylglucosamine (PGA) mutant. We compared the amount of biofilm produced by the parental strain and the isogenic mutants using static and dynamic systems. Compared to the findings for the biofilm of the parental or other strains, the biofilm of the O antigen and the PGA mutants was dramatically reduced, and it had less cell-associated PGA. Real-time PCR analyses revealed a significant reduction in the level of pgaA, cpxR, and cpxA mRNA in the biofilm cells of the O-antigen mutant compared to that in the biofilm cells of the parental strain. Specific binding between PGA and LPS was consistently detected by surface plasmon resonance, but the lack of O antigen did not abolish these interactions. In conclusion, the absence of the O antigen reduces the ability of A. pleuropneumoniae to form a biofilm, and this is associated with the reduced expression and production of PGA. PMID:26483403
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang Qishan; Bag, Jnanankur
Formation of nuclear inclusions consisting of aggregates of a polyalanine expansion mutant of nuclear poly(A)-binding protein (PABPN1) is the hallmark of oculopharyngeal muscular dystrophy (OPMD). OPMD is a late onset autosomal dominant disease. Patients with this disorder exhibit progressive swallowing difficulty and drooping of their eye lids, which starts around the age of 50. Previously we have shown that treatment of cells expressing the mutant PABPN1 with a number of chemicals such as ibuprofen, indomethacin, ZnSO{sub 4}, and 8-hydroxy-quinoline induces HSP70 expression and reduces PABPN1 aggregation. In these studies we have shown that expression of additional HSPs including HSP27, HSP40,more » and HSP105 were induced in mutant PABPN1 expressing cells following exposure to the chemicals mentioned above. Furthermore, all three additional HSPs were translocated to the nucleus and probably helped to properly fold the mutant PABPN1 by co-localizing with this protein.« less
Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Kirkwood, John; Avogadri-Connors, Francesca; Cutler Jr, Richard E.; Lalani, Alshad S.; Dent, Paul
2018-01-01
ABSTRACT The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins. PMID:29219657
Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul
2018-02-01
The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins.
Hudson, Lauren E.; Fasken, Milo B.; McDermott, Courtney D.; McBride, Shonna M.; Kuiper, Emily G.; Guiliano, David B.; Corbett, Anita H.; Lamb, Tracey J.
2014-01-01
Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders. PMID:25391025
Hudson, Lauren E; Fasken, Milo B; McDermott, Courtney D; McBride, Shonna M; Kuiper, Emily G; Guiliano, David B; Corbett, Anita H; Lamb, Tracey J
2014-01-01
Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders.
Study the Expression of ompf Gene in Esherichia coli Mutants.
Jaktaji, R Pourahmad; Heidari, F
2013-09-01
The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5' end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription.
Kaurilind, Eve; Brosché, Mikael
2017-01-01
Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.
Katayama, Yuki; Ito, Teruyo; Hiramatsu, Keiichi
2001-01-01
We report on the structural diversity of mecA gene complexes carried by 38 methicillin-resistant Staphylococcus aureus and 91 methicillin-resistant coagulase-negative Staphylococcus strains of seven different species with a special reference to its correlation with phenotypic expression of methicillin resistance. The most prevalent and widely disseminated mec complex had the structure mecI-mecR1-mecA-IS431R (or IS431mec), designated the class A mecA gene complex. In contrast, in S. haemolyticus, mecA was bracketed by two copies of IS431, forming the structure IS431L-mecA-IS431R. Of the 38 S. haemolyticus strains, 5 had low-level methicillin resistance (MIC, 1 to 4 mg/liter) and characteristic heterogeneous methicillin resistance as judged by population analysis. In these five strains, IS431L was located to the left of an intact mecI gene, forming the structure IS431L-class A mecA-gene complex. In other S. haemolyticus strains, IS431L was associated with the deletion of mecI and mecR1, forming the structure IS431L-ΔmecR1-mecA-IS431mec, designated the class C mecA gene complex. Mutants with the class C mecA gene complex were obtained in vitro by selecting strain SH621, containing the IS431L-class A mecA gene complex with low concentrations of methicillin (1 and 3 mg/liter). The mutants had intermediate level of methicillin resistance (MIC, 16 to 64 mg/liter). The mecA gene transcription was shown to be derepressed in a representative mutant strain, SH621-37. Our study indicated that the mecI-encoded repressor function is responsible for the low-level methicillin resistance of some S. haemolyticus clinical strains and that the IS431-mediated mecI gene deletion causes the expression of methicillin resistance through the derepression of mecA gene transcription. PMID:11408208
An antimicrobial peptide essential for bacterial survival in the nitrogen-fixing symbiosis.
Kim, Minsoo; Chen, Yuhui; Xi, Jiejun; Waters, Christopher; Chen, Rujin; Wang, Dong
2015-12-08
In the nitrogen-fixing symbiosis between legume hosts and rhizobia, the bacteria are engulfed by a plant cell membrane to become intracellular organelles. In the model legume Medicago truncatula, internalization and differentiation of Sinorhizobium (also known as Ensifer) meliloti is a prerequisite for nitrogen fixation. The host mechanisms that ensure the long-term survival of differentiating intracellular bacteria (bacteroids) in this unusual association are unclear. The M. truncatula defective nitrogen fixation4 (dnf4) mutant is unable to form a productive symbiosis, even though late symbiotic marker genes are expressed in mutant nodules. We discovered that in the dnf4 mutant, bacteroids can apparently differentiate, but they fail to persist within host cells in the process. We found that the DNF4 gene encodes NCR211, a member of the family of nodule-specific cysteine-rich (NCR) peptides. The phenotype of dnf4 suggests that NCR211 acts to promote the intracellular survival of differentiating bacteroids. The greatest expression of DNF4 was observed in the nodule interzone II-III, where bacteroids undergo differentiation. A translational fusion of DNF4 with GFP localizes to the peribacteroid space, and synthetic NCR211 prevents free-living S. meliloti from forming colonies, in contrast to mock controls, suggesting that DNF4 may interact with bacteroids directly or indirectly for its function. Our findings indicate that a successful symbiosis requires host effectors that not only induce bacterial differentiation, but also that maintain intracellular bacteroids during the host-symbiont interaction. The discovery of NCR211 peptides that maintain bacterial survival inside host cells has important implications for improving legume crops.
Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles
1999-01-01
Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625
Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis.
Phillips, A L; Ward, D A; Uknes, S; Appleford, N E; Lange, T; Huttly, A K; Gaskin, P; Graebe, J E; Hedden, P
1995-07-01
Using degenerate oligonucleotide primers based on a pumpkin (Cucurbita maxima) gibberellin (GA) 20-oxidase sequence, six different fragments of dioxygenase genes were amplified by polymerase chain reaction from arabidopsis thaliana genomic DNA. One of these was used to isolate two different full-length cDNA clones, At2301 and At2353, from shoots of the GA-deficient Arabidopsis mutant ga1-2. A third, related clone, YAP169, was identified in the Database of Expressed Sequence Tags. The cDNA clones were expressed in Escherichia coli as fusion proteins, each of which oxidized GA12 at C-20 to GA15, GA24, and the C19 compound GA9, a precursor of bioactive GAs; the C20 tricarboxylic acid compound GA25 was formed as a minor product. The expression products also oxidized the 13-hydroxylated substrate GA53, but less effectively than GA12. The three cDNAs hybridized to mRNA species with tissue-specific patterns of accumulation, with At2301 being expressed in stems and inflorescences, At2353 in inflorescences and developing siliques, and YAP169 in siliques only. In the floral shoots of the ga1-2 mutant, transcript levels corresponding to each cDNA decreased dramatically after GA3 application, suggesting that GA biosynthesis may be controlled, at least in part, through down-regulation of the expression of the 20-oxidase genes.
E, Guangqi; Drujon, Thierry; Correia, Isabelle; Ploux, Olivier; Guianvarc'h, Dominique
2013-12-01
We have produced and purified an active site mutant of the Escherichia coli cyclopropane fatty acid synthase (CFAS) by replacing the strictly conserved G236 within cyclopropane synthases, by a glutamate residue, which corresponds to E146 of the homologous mycolic acid methyltransferase, Hma, producing hydroxymethyl mycolic acids. The G236E CFAS mutant had less than 1% of the in vitro activity of the wild type enzyme. We expressed the G236E CFAS mutant in an E. coli (DE3) strain in which the chromosomal cfa gene had been deleted. After extraction of phospholipids and conversion into the corresponding fatty acid methyl esters (FAMEs), we observed the formation of cyclopropanated FAMEs suggesting that the mutant retained some of the normal activity in vivo. However, we also observed the formation of new C17 methyl-branched unsaturated FAMEs whose structures were determined using GC/MS and NMR analyses. The double bond was located at different positions 8, 9 or 10, and the methyl group at position 10 or 9. Thus, this new FAMEs are likely arising from a 16:1 acyl chain of a phospholipid that had been transformed by the G236E CFAS mutant in vivo. The reaction catalyzed by this G236E CFAS mutant thus starts by the methylation of the unsaturated acyl chain at position 10 or 9 yielding a carbocation at position 9 or 10 respectively. It follows then two competing steps, a normal cyclopropanation or hydride shift/elimination events giving different combinations of alkenes. This study not only provides further evidence that cyclopropane synthases (CSs) form a carbocationic intermediate but also opens the way to CSs engineering for the synthesis of non-natural fatty acids. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Vettath, Sunitha Kodengil; Shivashankar, Gaganashree; Menon, Krishnakumar N; Vijayachandran, Lakshmi S
2018-04-15
Epidermal Growth Factor Receptor variant III (EGFRvIII) is a tumor specific antigen detected in various tumors including gliomas, breast cancer, lung cancer, head and neck squamous cell carcinoma (HNSCC). Screening of EGFRvIII targeting drug molecules can be accelerated by developing drug screening platforms using recombinantly expressed protein. Choice of expression system is one of the major factors deciding the success of recombinant expression of a protein. In our study, we have tried to express and purify the extracellular domain (ECD) of this highly unstable protein using bacterial and baculovirus expression systems to select the expression system suited for our purpose. Even though the protein was successfully expressed in prokaryotic system, purification could be done only under denaturing conditions. But in the baculovirus expression system, the protein was expressed in soluble form and could be purified under native conditions, with single step of purification. Based on our results, we conclude that insect cells are better choice over E. coli cells for expressing EGFRvIII ECD in soluble form. This study provides insights for other researchers involved in expression of similar unstable membrane proteins, on selecting the best expression system and challenges involved. Copyright © 2018 Elsevier B.V. All rights reserved.
Aguilera, Paulina; Marcoleta, Andrés; Lobos-Ruiz, Pablo; Arranz, Rocío; Valpuesta, José M.; Monasterio, Octavio; Lagos, Rosalba
2016-01-01
Microcin E492 (MccE492) is a pore-forming bacteriocin produced and exported by Klebsiella pneumoniae RYC492. Besides its antibacterial activity, excreted MccE492 can form amyloid fibrils in vivo as well as in vitro. It has been proposed that bacterial amyloids can be functional playing a biological role, and in the particular case of MccE492 it would control the antibacterial activity. MccE492 amyloid fibril’s morphology and formation kinetics in vitro have been well-characterized, however, it is not known which amino acid residues determine its amyloidogenic propensity, nor if it forms intracellular amyloid inclusions as has been reported for other bacterial amyloids. In this work we found the conditions in which MccE492 forms intracellular amyloids in Escherichia coli cells, that were visualized as round-shaped inclusion bodies recognized by two amyloidophilic probes, 2-4′-methylaminophenyl benzothiazole and thioflavin-S. We used this property to perform a flow cytometry-based assay to evaluate the aggregation propensity of MccE492 mutants, that were designed using an in silico prediction of putative aggregation hotspots. We established that the predicted amino acid residues 54–63, effectively act as a pro-amyloidogenic stretch. As in the case of other amyloidogenic proteins, this region presented two gatekeeper residues (P57 and P59), which disfavor both intracellular and in vitro MccE492 amyloid formation, preventing an uncontrolled aggregation. Mutants in each of these gatekeeper residues showed faster in vitro aggregation and bactericidal inactivation kinetics, and the two mutants were accumulated as dense amyloid inclusions in more than 80% of E. coli cells expressing these variants. In contrast, the MccE492 mutant lacking residues 54–63 showed a significantly lower intracellular aggregation propensity and slower in vitro polymerization kinetics. Electron microscopy analysis of the amyloids formed in vitro by these mutants revealed that, although with different efficiency, all formed fibrils morphologically similar to wild-type MccE492. The physiological implication of MccE492 intracellular amyloid formation is probably similar to the inactivation process observed for extracellular amyloids, and could be used as a mean of sequestering potentially toxic species inside the cell when this bacteriocin is produced in large amounts. PMID:26858708
Kim, Jung-Hoon; Yang, Yoon-Mo; Ji, Chang-Jun; Ryu, Su-Hyun; Won, Young-Bin; Ju, Shin-Yeong; Kwon, Yumi; Lee, Yeh-Eun; Youn, Hwan; Lee, Jin-Won
2017-06-01
PerR, a member of Fur family protein, is a metal-dependent H 2 O 2 sensing transcription factor that regulates genes involved in peroxide stress response. Industrially important bacterium Bacillus licheniformis contains three PerR-like proteins (PerR BL , PerR2, and PerR3) compared to its close relative Bacillus subtilis. Interestingly, unlike other bacteria including B. subtilis, no authentic perR BL null mutant could be established for B. licheniformis. Thus, we constructed a conditional perR BL mutant using a xylose-inducible promoter, and investigated the genes under the control of PerR BL . PerR BL regulon genes include katA, mrgA, ahpC, pfeT, hemA, fur, and perR as observed for PerR BS . However, there is some variation in the expression levels of fur and hemA genes between B. subtilis and B. licheniformis in the derepressed state. Furthermore, katA, mrgA, and ahpC are strongly induced, whereas the others are only weakly or not induced by H 2 O 2 treatment. In contrast to the B. subtilis perR null mutant which frequently gives rise to large colony phenotype mainly due to the loss of katA, the suppressors of B. licheniformis perR mutant, which can form colonies on LB agar, were all catalase-positive. Instead, many of the suppressors showed increased levels of siderophore production, suggesting that the suppressor mutation is linked to the fur gene. Consistent with this, perR fur double mutant could grow on LB agar without Fe supplementation, whereas perR katA double mutant could only grow on LB agar with Fe supplementation. Taken together, our data suggest that in B. licheniformis, despite the similarity in PerR BL and PerR BS regulon genes, perR is an essential gene required for growth and that the inability of perR null mutant to grow is mainly due to elevated expression of Fur.
Briscoe, C; Moniakis, J; Kim, J Y; Brown, J M; Hereld, D; Devreotes, P N; Firtel, R A
2001-05-01
cAMP receptors mediate some signaling pathways via coupled heterotrimeric G proteins, while others are G-protein-independent. This latter class includes the activation of the transcription factors GBF and STATa. Within the cellular mounds formed by aggregation of Dictyostelium, micromolar levels of cAMP activate GBF function, thereby inducing the transcription of postaggregative genes and initiating multicellular differentiation. Activation of STATa, a regulator of culmination and ecmB expression, results from cAMP receptor-dependent tyrosine phosphorylation and nuclear localization, also in mound-stage cells. During mound development, the cAMP receptor cAR1 is in a low-affinity state and is phosphorylated on multiple serine residues in its C-terminus. This paper addresses possible roles of cAMP receptor phosphorylation in the cAMP-mediated stimulation of GBF activity, STATa tyrosine phosphorylation, and cell-type-specific gene expression. To accomplish this, we have expressed cAR1 mutants in a strain in which the endogenous cAMP receptors that mediate postaggregative gene expression in vivo are deleted. We then examined the ability of these cells to undergo morphogenesis and induce postaggregative and cell-type-specific gene expression and STATa tyrosine phosphorylation. Analysis of cAR1 mutants in which the C-terminal tail is deleted or the ligand-mediated phosphorylation sites are mutated suggests that the cAR1 C-terminus is not essential for GBF-mediated postaggregative gene expression or STATa tyrosine phosphorylation, but may play a role in regulating cell-type-specific gene expression and morphogenesis. A mutant receptor, in which the C-terminal tail is constitutively phosphorylated, exhibits constitutive activation of STATa tyrosine phosphorylation in pulsed cells in suspension and a significantly impaired ability to induce cell-type-specific gene expression. The constitutively phosphorylated receptor also exerts a partial dominant negative effect on multicellular development when expressed in wild-type cells. These findings suggest that the phosphorylated C-terminus of cAR1 may be involved in regulating aspects of receptor-mediated processes, is not essential for GBF function, and may play a role in mediating subsequent development. Copyright 2001 Academic Press.
Della Rovere, F; Fattorini, L; D'Angeli, S; Veloccia, A; Del Duca, S; Cai, G; Falasca, G; Altamura, M M
2015-03-01
Adventitious roots (ARs) are essential for vegetative propagation. The Arabidopsis thaliana transcription factors SHORT ROOT (SHR) and SCARECROW (SCR) affect primary/lateral root development, but their involvement in AR formation is uncertain. LAX3 and AUX1 auxin influx carriers contribute to primary/lateral root development. LAX3 expression is regulated by SHR, and LAX3 contributes to AR tip auxin maximum. In contrast, AUX1 involvement in AR development is unknown. Xylogenesis is induced by auxin plus cytokinin as is AR formation, but the genes involved are largely unknown. Stem thin cell layers (TCLs) form ARs and undergo xylogenesis under the same auxin plus cytokinin input. The aim of this research was to investigate SHR, SCR, AUX1 and LAX3 involvement in AR formation and xylogenesis in intact hypocotyls and stem TCLs in arabidopsis. Hypocotyls of scr-1, shr-1, lax3, aux1-21 and lax3/aux1-21 Arabidopsis thaliana null mutant seedlings grown with or without auxin plus cytokinin were examined histologically, as were stem TCLs cultured with auxin plus cytokinin. SCR and AUX1 expression was monitored using pSCR::GFP and AUX1::GUS lines, and LAX3 expression and auxin localization during xylogenesis were monitored by using LAX3::GUS and DR5::GUS lines. AR formation was inhibited in all mutants, except lax3. SCR was expressed in pericycle anticlinally derived AR-forming cells of intact hypocotyls, and in cell clumps forming AR meristemoids of TCLs. The apex was anomalous in shr and scr ARs. In all mutant hypocotyls, the pericycle divided periclinally to produce xylogenesis. Xylary element maturation was favoured by auxin plus cytokinin in shr and aux1-21. Xylogenesis was enhanced in TCLs, and in aux1-21 and shr in particular. AUX1 was expressed before LAX3, i.e. in the early derivatives leading to either ARs or xylogenesis. AR formation and xylogenesis are developmental programmes that are inversely related, but they involve fine-tuning by the same proteins, namely SHR, SCR and AUX1. Pericycle activity is central for the equilibrium between xylary development and AR formation in the hypocotyl, with a role for AUX1 in switching between, and balancing of, the two developmental programmes. © The Author 2015. Published by Oxford University Press on behalf of the Annals of Botany Company.
Chandra, P. Manish; Brannigan, James A.; Prabhune, Asmita; Pundle, Archana; Turkenburg, Johan P.; Dodson, G. Guy; Suresh, C. G.
2005-01-01
The crystallization of three catalytically inactive mutants of penicillin V acylase (PVA) from Bacillus sphaericus in precursor and processed forms is reported. The mutant proteins crystallize in different primitive monoclinic space groups that are distinct from the crystal forms for the native enzyme. Directed mutants and clone constructs were designed to study the post-translational autoproteolytic processing of PVA. The catalytically inactive mutants will provide three-dimensional structures of precursor PVA forms, plus open a route to the study of enzyme–substrate complexes for this industrially important enzyme. PMID:16508111
Moro, Camila Fernandes; Gaspar, Marilia; da Silva, Felipe Rodrigues; Pattathil, Sivakumar; Hahn, Michael G; Salgado, Ione; Braga, Marcia Regina
2017-03-01
Nitric oxide (NO) exerts pleiotropic effects on plant development; however, its involvement in cell wall modification during root hair formation (RHF) has not yet been addressed. Here, mutants of Arabidopsis thaliana with altered root hair phenotypes were used to assess the involvement of S-nitrosoglutathione (GSNO), the primary NO source, in cell wall dynamics and gene expression in roots induced to form hairs. GSNO and auxin restored the root hair phenotype of the hairless root hair defective 6 (rhd6) mutant. A positive correlation was observed between increased NO production and RHF induced by auxin in rhd6 and transparent testa glabra (ttg) mutants. Deposition of an epitope within rhamnogalacturonan-I recognized by the CCRC-M2 antibody was delayed in root hair cells (trichoblasts) compared with nonhair cells (atrichoblasts). GSNO, but not auxin, restored the wild-type root glycome and transcriptome profiles in rhd6, modulating the expression of a large number of genes related to cell wall composition and metabolism, as well as those encoding ribosomal proteins, DNA and histone-modifying enzymes and proteins involved in post-translational modification. Our results demonstrate that NO plays a key role in cell wall remodelling in trichoblasts and suggest that it also participates in chromatin modification in root cells of A. thaliana. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Dotsenko, Anna S; Gusakov, Alexander V; Volkov, Pavel V; Rozhkova, Aleksandra M; Sinitsyn, Arkady P
2016-02-01
Cellobiohydrolase I from Penicillium verruculosum (PvCel7A) has four potential N-glycosylation sites at its catalytic module: Asn45, Asn194, Asn388, and Asn430. In order to investigate how the N-glycosylation influences the activity and other properties of the enzyme, the wild type (wt) PvCel7A and its mutant forms, carrying Asn to Ala substitutions, were cloned into Penicillium canescens PCA10 (niaD-) strain, a fungal host for production of heterologous proteins. The rPvCel7A-wt and N45A, N194A, N388A mutants were successfully expressed and purified for characterization, whereas the expression of N430A mutant was not achieved. The MALDI-TOF mass spectrometry fingerprinting of peptides, obtained as a result of digestion of rPvCel7A forms with specific proteases, showed that the N-linked glycans represent variable high-mannose oligosaccharides and the products of their sequential enzymatic trimming, according to the formula (Man)0-13 (GlcNAc)2 , or a single GlcNAc residue. Mutations had no notable effect on pH-optimum of PvCel7A activity and enzyme thermostability. However, the mutations influenced both the enzyme adsorption ability on Avicel and its activity against natural and synthetic substrates. In particular, the N45A mutation led to a significant increase in the rate of Avicel and milled aspen wood hydrolysis, while the substrate digestion rates in the case of N194A and N388A mutants were notably lower relative to rPvCel7A-wt. These data, together with data of 3D structural modeling of the PvCel7A catalytic module, indicate that the N-linked glycans are an important part of the processive catalytic machinery of PvCel7A. © 2015 Wiley Periodicals, Inc.
Wu, Xiaoyang; Katz, Evan; Valle, Maria Cecilia Della; Mascioli, Kirsten; Flanagan, John J; Castelli, Jeffrey P; Schiffmann, Raphael; Boudes, Pol; Lockhart, David J; Valenzano, Kenneth J; Benjamin, Elfrida R
2011-01-01
Fabry disease is caused by mutations in the gene (GLA) that encodes α-galactosidase A (α-Gal A). The iminosugar AT1001 (GR181413A, migalastat hydrochloride, 1-deoxygalactonojirimycin) is a pharmacological chaperone that selectively binds and stabilizes α-Gal A, increasing total cellular levels and activity for some mutant forms (defined as “responsive”). In this study, we developed a cell-based assay in cultured HEK-293 cells to identify mutant forms of α-Gal A that are responsive to AT1001. Concentration-dependent increases in α-Gal A activity in response to AT1001 were shown for 49 (60%) of 81 mutant forms. The responses of α-Gal A mutant forms were generally consistent with the responses observed in male Fabry patient-derived lymphoblasts. Importantly, the HEK-293 cell responses of 19 α-Gal A mutant forms to a clinically achievable concentration of AT1001 (10 µM) were generally consistent with observed increases in α-Gal A activity in peripheral blood mononuclear cells from male Fabry patients orally administered AT1001 during Phase 2 clinical studies. This indicates that the cell-based responses can identify mutant forms of α-Gal A that are likely to respond to AT1001 in vivo. Thus, the HEK-293 cell-based assay may be a useful aid in the identification of Fabry patients with AT1001-responsive mutant forms. Hum Mutat 32:1–13, 2011. © 2011 Wiley-Liss, Inc. PMID:21598360
Gerasimovich, Evgeniia S; Strelkov, Sergei V; Gusev, Nikolai B
2017-11-01
Physico-chemical properties of G154S, R157H and A171T mutants of αB-crystallin (HspB5) associated with congenital human diseases including certain myopathies and cataract were investigated. Oligomers formed by G154S and A171T mutants have the size and apparent molecular weight indistinguishable from those of the wild-type HspB5, whereas the size of oligomers formed by R157H mutant is slightly smaller. All mutants are less thermostable and start to aggregate at a lower temperature than the wild-type protein. All mutants effectively interact with a triple phosphomimicking mutant of HspB1 and form large heterooligomeric complexes of similar composition. All mutants interact with HspB6 forming heterooligomeric complexes with size and composition dependent on the molar ratio of two proteins. The wild-type HspB5 and its G154S and A171T mutants form only high molecular weight (300-450 kDa) heterooligomeric complexes with HspB6, whereas the R157H mutant forms both high and low (∼120 kDa) molecular weight complexes. The wild-type HspB5 and its G154S and A171T mutants form two types of heterooligomers with HspB4, whereas R157H mutant effectively forms only one type of heterooligomers with HspB4. G154S and A171T mutants have lower chaperone-like activity than the wild-type protein when subfragment S1 of myosin or β L -crystallin are used as a model substrates. With these substrates, the R157H mutant shows equal or higher chaperone activity than the wild-type HspB5. We hypothesize that the mutations in the C-terminal region modulate the binding of the IP(I/V) motif to the core α-crystallin domain. The R157H mutation is located in the immediate proximity of this motif. Such modulation could cause altered interaction of HspB5 with partners and substrates and eventually lead to pathological processes. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Andrographolide induces degradation of mutant p53 via activation of Hsp70.
Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu
2018-05-22
The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.
Ditsworth, Dara; Maldonado, Marcus; McAlonis-Downes, Melissa; Sun, Shuying; Seelman, Amanda; Drenner, Kevin; Arnold, Eveline; Ling, Shuo-Chien; Pizzo, Donald; Ravits, John; Cleveland, Don W; Da Cruz, Sandrine
2017-06-01
Mutations in TDP-43 cause amyotrophic lateral sclerosis (ALS), a fatal paralytic disease characterized by degeneration and premature death of motor neurons. The contribution of mutant TDP-43-mediated damage within motor neurons was evaluated using mice expressing a conditional allele of an ALS-causing TDP-43 mutant (Q331K) whose broad expression throughout the central nervous system mimics endogenous TDP-43. TDP-43 Q331K mice develop age- and mutant-dependent motor deficits from degeneration and death of motor neurons. Cre-recombinase-mediated excision of the TDP-43 Q331K gene from motor neurons is shown to delay onset of motor symptoms and appearance of TDP-43-mediated aberrant nuclear morphology, and abrogate subsequent death of motor neurons. However, reduction of mutant TDP-43 selectively in motor neurons did not prevent age-dependent degeneration of axons and neuromuscular junction loss, nor did it attenuate astrogliosis or microgliosis. Thus, disease mechanism is non-cell autonomous with mutant TDP-43 expressed in motor neurons determining disease onset but progression defined by mutant acting within other cell types.
Heisenberg, C P; Brennan, C; Wilson, S W
1999-05-01
During the development of the zebrafish nervous system both noi, a zebrafish pax2 homolog, and ace, a zebrafish fgf8 homolog, are required for development of the midbrain and cerebellum. Here we describe a dominant mutation, aussicht (aus), in which the expression of noi and ace is upregulated. In aus mutant embryos, ace is upregulated at many sites in the embryo, while noi expression is only upregulated in regions of the forebrain and midbrain which also express ace. Subsequent to the alterations in noi and ace expression, aus mutants exhibit defects in the differentiation of the forebrain, midbrain and eyes. Within the forebrain, the formation of the anterior and postoptic commissures is delayed and the expression of markers within the pretectal area is reduced. Within the midbrain, En and wnt1 expression is expanded. In heterozygous aus embryos, there is ectopic outgrowth of neural retina in the temporal half of the eyes, whereas in putative homozygous aus embryos, the ventral retina is reduced and the pigmented retinal epithelium is expanded towards the midline. The observation that aus mutant embryos exhibit widespread upregulation of ace raised the possibility that aus might represent an allele of the ace gene itself. However, by crossing carriers for both aus and ace, we were able to generate homozygous ace mutant embryos that also exhibited the aus phenotype. This indicated that aus is not tightly linked to ace and is unlikely to be a mutation directly affecting the ace locus. However, increased Ace activity may underly many aspects of the aus phenotype and we show that the upregulation of noi in the forebrain of aus mutants is partially dependent upon functional Ace activity. Conversely, increased ace expression in the forebrain of aus mutants is not dependent upon functional Noi activity. We conclude that aus represents a mutation involving a locus normally required for the regulation of ace expression during embryogenesis.
Crosby, Heidi A.; Schlievert, Patrick M.; Merriman, Joseph A.; King, Jessica M.; Salgado-Pabón, Wilmara; Horswill, Alexander R.
2016-01-01
Staphylococcus aureus is a human commensal and opportunistic pathogen that causes devastating infections in a wide range of locations within the body. One of the defining characteristics of S. aureus is its ability to form clumps in the presence of soluble fibrinogen, which likely has a protective benefit and facilitates adhesion to host tissue. We have previously shown that the ArlRS two-component regulatory system controls clumping, in part by repressing production of the large surface protein Ebh. In this work we show that ArlRS does not directly regulate Ebh, but instead ArlRS activates expression of the global regulator MgrA. Strains lacking mgrA fail to clump in the presence of fibrinogen, and clumping can be restored to an arlRS mutant by overexpressing either arlRS or mgrA, indicating that ArlRS and MgrA constitute a regulatory pathway. We used RNA-seq to show that MgrA represses ebh, as well as seven cell wall-associated proteins (SraP, Spa, FnbB, SasG, SasC, FmtB, and SdrD). EMSA analysis showed that MgrA directly represses expression of ebh and sraP. Clumping can be restored to an mgrA mutant by deleting the genes for Ebh, SraP and SasG, suggesting that increased expression of these proteins blocks clumping by steric hindrance. We show that mgrA mutants are less virulent in a rabbit model of endocarditis, and virulence can be partially restored by deleting the genes for the surface proteins ebh, sraP, and sasG. While mgrA mutants are unable to clump, they are known to have enhanced biofilm capacity. We demonstrate that this increase in biofilm formation is partially due to up-regulation of SasG, a surface protein known to promote intercellular interactions. These results confirm that ArlRS and MgrA constitute a regulatory cascade, and that they control expression of a number of genes important for virulence, including those for eight large surface proteins. PMID:27144398
Spinola, Stanley M; Li, Wei; Fortney, Kate R; Janowicz, Diane M; Zwickl, Beth; Katz, Barry P; Munson, Robert S
2012-02-01
Sialylated glycoconjugates on the surfaces of mammalian cells play important roles in intercellular communication and self-recognition. The sialic acid preferentially expressed in human tissues is N-acetylneuraminic acid (Neu5Ac). In a process called molecular mimicry, many bacterial pathogens decorate their cell surface glycolipids with Neu5Ac. Incorporation of Neu5Ac into bacterial glycolipids promotes bacterial interactions with host cell receptors called Siglecs. These interactions affect bacterial adherence, resistance to serum killing and phagocytosis, and innate immune responses. Haemophilus ducreyi, the etiologic agent of chancroid, expresses lipooligosaccharides (LOS) that are highly sialylated. However, an H. ducreyi sialyltransferase (lst) mutant, whose LOS contain reduced levels of Neu5Ac, is fully virulent in human volunteers. Recently, a second sialyltransferase gene (Hd0053) was discovered in H. ducreyi, raising the possibility that Hd0053 compensated for the loss of lst during human infection. CMP-Neu5Ac is the obligate nucleotide sugar donor for all bacterial sialyltransferases; LOS derived from an H. ducreyi CMP-Neu5Ac synthetase (neuA) mutant has no detectable Neu5Ac. Here, we compared an H. ducreyi neuA mutant to its wild-type parent in several models of pathogenesis. In human inoculation experiments, the neuA mutant formed papules and pustules at rates that were no different than those of its parent. When grown in media with and without Neu5Ac supplementation, the neuA mutant and its parent had similar phenotypes in bactericidal, macrophage uptake, and dendritic cell activation assays. Although we cannot preclude a contribution of LOS sialylation to ulcerative disease, these data strongly suggest that sialylation of LOS is dispensable for H. ducreyi pathogenesis in humans.
Enamel Protein Regulation and Dental and Periodontal Physiopathology in Msx2 Mutant Mice
Molla, Muriel; Descroix, Vianney; Aïoub, Muhanad; Simon, Stéphane; Castañeda, Beatriz; Hotton, Dominique; Bolaños, Alba; Simon, Yohann; Lezot, Frédéric; Goubin, Gérard; Berdal, Ariane
2010-01-01
Signaling pathways that underlie postnatal dental and periodontal physiopathology are less studied than those of early tooth development. Members of the muscle segment homeobox gene (Msx) family encode homeoproteins that show functional redundancy during development and are known to be involved in epithelial-mesenchymal interactions that lead to crown morphogenesis and ameloblast cell differentiation. This study analyzed the MSX2 protein during mouse postnatal growth as well as in the adult. The analysis focused on enamel and periodontal defects and enamel proteins in Msx2-null mutant mice. In the epithelial lifecycle, the levels of MSX2 expression and enamel protein secretion were inversely related. Msx2+/− mice showed increased amelogenin expression, enamel thickness, and rod size. Msx2−/− mice displayed compound phenotypic characteristics of enamel defects, related to both enamel-specific gene mutations (amelogenin and enamelin) in isolated amelogenesis imperfecta, and cell-cell junction elements (laminin 5 and cytokeratin 5) in other syndromes. These effects were also related to ameloblast disappearance, which differed between incisors and molars. In Msx2−/− roots, Malassez cells formed giant islands that overexpressed amelogenin and ameloblastin that grew over months. Aberrant expression of enamel proteins is proposed to underlie the regional osteopetrosis and hyperproduction of cellular cementum. These enamel and periodontal phenotypes of Msx2 mutants constitute the first case report of structural and signaling defects associated with enamel protein overexpression in a postnatal context. PMID:20934968
Critical Hydrogen Bond Formation for Activation of the Angiotensin II Type 1 Receptor*
Cabana, Jérôme; Holleran, Brian; Beaulieu, Marie-Ève; Leduc, Richard; Escher, Emanuel; Guillemette, Gaétan; Lavigne, Pierre
2013-01-01
G protein-coupled receptors contain selectively important residues that play central roles in the conformational changes that occur during receptor activation. Asparagine 111 (N1113.35) is such a residue within the angiotensin II type 1 (AT1) receptor. Substitution of N1113.35 for glycine leads to a constitutively active receptor, whereas substitution for tryptophan leads to an inactivable receptor. Here, we analyzed the AT1 receptor and two mutants (N111G and N111W) by molecular dynamics simulations, which revealed a novel molecular switch involving the strictly conserved residue D742.50. Indeed, D742.50 forms a stable hydrogen bond (H-bond) with the residue in position 1113.35 in the wild-type and the inactivable receptor. However, in the constitutively active mutant N111G-AT1 receptor, residue D74 is reoriented to form a new H-bond with another strictly conserved residue, N461.50. When expressed in HEK293 cells, the mutant N46G-AT1 receptor was poorly activable, although it retained a high binding affinity. Interestingly, the mutant N46G/N111G-AT1 receptor was also inactivable. Molecular dynamics simulations also revealed the presence of a cluster of hydrophobic residues from transmembrane domains 2, 3, and 7 that appears to stabilize the inactive form of the receptor. Whereas this hydrophobic cluster and the H-bond between D742.50 and W1113.35 are more stable in the inactivable N111W-AT1 receptor, the mutant N111W/F77A-AT1 receptor, designed to weaken the hydrophobic core, showed significant agonist-induced signaling. These results support the potential for the formation of an H-bond between residues D742.50 and N461.50 in the activation of the AT1 receptor. PMID:23223579
Lee, Jae Hoon; Zhao, Youfu
2018-02-01
The bacterial enhancer binding protein (bEBP) HrpS is essential for Erwinia amylovora virulence by activating the type III secretion system (T3SS). However, how the hrpS gene is regulated remains poorly understood in E. amylovora. In this study, 5' rapid amplification of cDNA ends and promoter deletion analyses showed that the hrpS gene contains two promoters driven by HrpX/HrpY and the Rcs phosphorelay system, respectively. Electrophoretic mobility shift and gene expression assays demonstrated that integration host factor IHF positively regulates hrpS expression through directly binding the hrpX promoter and positively regulating hrpX/hrpY expression. Moreover, hrpX expression was down-regulated in the relA/spoT ((p)ppGpp-deficient) mutant and the dksA mutant, but up-regulated when the wild-type strain was treated with serine hydroxamate, which induced (p)ppGpp-mediated stringent response. Furthermore, the csrA mutant showed significantly reduced transcripts of major hrpS activators, including the hrpX/hrpY, rcsA and rcsB genes, indicating that CsrA is required for full hrpS expression. On the other hand, the csrB mutant exhibited up-regulation of the rcsA and rcsB genes, and hrpS expression was largely diminished in the csrB/rcsB mutant, indicating that the Rcs system is mainly responsible for the increased hrpS expression in the csrB mutant. These findings suggest that E. amylovora recruits multiple stimuli-sensing systems, including HrpX/HrpY, the Rcs phosphorelay system and the Gac-Csr system, to regulate hrpS and T3SS gene expression.
Becherelli, Marco; Manetti, Andrea G O; Buccato, Scilla; Viciani, Elisa; Ciucchi, Laura; Mollica, Giulia; Grandi, Guido; Margarit, Imma
2012-01-01
Summary Gram-positive pili are known to play a role in bacterial adhesion to epithelial cells and in the formation of biofilm microbial communities. In the present study we undertook the functional characterization of the pilus ancillary protein 1 (AP1_M6) from Streptococcus pyogenes isolates expressing the FCT-1 pilus variant, known to be strong biofilm formers. Cell binding and biofilm formation assays using S. pyogenes in-frame deletion mutants, Lactococcus expressing heterologous FCT-1 pili and purified recombinant AP1_M6, indicated that this pilin is a strong cell adhesin that is also involved in bacterial biofilm formation. Moreover, we show that AP1_M6 establishes homophilic interactions that mediate inter-bacterial contact, possibly promoting bacterial colonization of target epithelial cells in the form of three-dimensional microcolonies. Finally, AP1_M6 knockout mutants were less virulent in mice, indicating that this protein is also implicated in GAS systemic infection. PMID:22320452
Nagae, Miwa; Parniske, Martin; Kawaguchi, Masayoshi; Takeda, Naoya
2016-12-01
Lotus japonicus THIC is expressed in all organs, and the encoded protein catalyzes thiamine biosynthesis. Loss of function produces chlorosis, a typical thiamine-deficiency phenotype, and mortality. To investigate thiamine's role in symbiosis, we focused on THI1, a thiamine-biosynthesis gene expressed in roots, nodules, and seeds. The thi1 mutant had green leaves, but formed small nodules and immature seeds. These phenotypes were rescued by THI1 complementation and by exogenous thiamine. Thus, THI1 is required for nodule enlargement and seed maturation. On the other hand, colonization by arbuscular mycorrhiza (AM) fungus Rhizophagus irregularis was not affected in the thi1 mutant or by exogenous thiamine. However, spores of R. irregularis stored more thiamine than the source (host plants), despite lacking thiamine biosynthesis genes. Therefore, disturbance of the thiamine supply would affect progeny phenotypes such as spore formation and hyphal growth. Further investigation will be required to elucidate thiamine's effect on AM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kish, Kevin; McDonnell, Patricia A.; Goldfarb, Valentina
Protein tyrosine phosphatase {gamma} is a membrane-bound receptor and is designated RPTP{gamma}. RPTP{gamma} and two mutants, RPTP{gamma}(V948I, S970T) and RPTP{gamma}(C858S, S970T), were recombinantly expressed and purified for X-ray crystallographic studies. The purified enzymes were crystallized using the hanging-drop vapor-diffusion method. Crystallographic data were obtained from several different crystal forms in the absence and the presence of inhibitor. In this paper, a description is given of how three different crystal forms were obtained that were used with various ligands. An orthorhombic crystal form and a trigonal crystal form were obtained both with and without ligand, and a monoclinic crystal form wasmore » only obtained in the presence of a particularly elaborated inhibitor.« less
Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning
2016-04-22
The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatinmore » immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.« less
[The Expression of Pokemon in Endometrial Carcinoma Tissue and the Correlation with Mutant p53].
Yi, Tian-jin; Wang, Ping
2016-05-01
To detect the expression of Pokemon in endometrial carcinoma (EC), to provide preliminary theoretical basis for clarifying pathogenesis and searching for effective targets. Ninety-eight cases of endometrial tissue paraffin specimens form July 2012 to July 2014 in West China Second University Hospital, Sichuan University, were collected, including: EC group, consisting of adenocarcinoma 23 cases, adenosquamous 12 cases, serous 3 cases, mucinous 11 cases and clear cell 9 cases, and control group, consisting of atypical hyperplasia endometrium 20 cases and normal endometrium 20 cases (secretory 10 cases, hyperplasia 10 cases). Immunohistochemistry was used to detect the expression of Pokemonin each section, analyzing the correlation of Pokemon expression with clinicopathologic characteristics and p53 expression. The positive rate of Pokemon in normal endometrium was 25% (5/20), significantly lower than that in atypical hyperplasia endometrium (60.0%, 12/20) and EC (93.1%, 54/58) (P < 0.05); the rate in type II was 97. 12% (34/35), significantly higher than that in type I (86.96%, 20/23) (P = 0.018). The positive rate of Pokemon in III-IV stage, type II and Ki-67 ≥ 50 EC tissue was much higher (P = 0.012, 0.023, 0.029). In type II EC tissue, the correlation index between Pokemon and p53 is 0.669 (P = 0.000). The over expression of Pokemon upregulates the expression of mutant p53, which may be one of the carcinogenesis modes in type II EC.
Huang, Huan; Li, Shuo; Sun, Lizhou; Zhou, Guohua
2015-01-01
To simultaneously analyze mutations and expression levels of multiple genes on one detection platform, we proposed a method termed "multiplex ligation-dependent probe amplification-digital amplification coupled with hydrogel bead-array" (MLPA-DABA) and applied it to diagnose colorectal cancer (CRC). CRC cells and tissues were sampled to extract nucleic acid, perform MLPA with sequence-tagged probes, perform digital emulsion polymerase chain reaction (PCR), and produce a hydrogel bead-array to immobilize beads and form a single bead layer on the array. After hybridization with fluorescent probes, the number of colored beads, which reflects the abundance of expressed genes and the mutation rate, was counted for diagnosis. Only red or green beads occurred on the chips in the mixed samples, indicating the success of single-molecule PCR. When a one-source sample was analyzed using mixed MLPA probes, beads of only one color occurred, suggesting the high specificity of the method in analyzing CRC mutation and gene expression. In gene expression analysis of a CRC tissue from one CRC patient, the mutant percentage was 3.1%, and the expression levels of CRC-related genes were much higher than those of normal tissue. The highly sensitive MLPA-DABA succeeds in the relative quantification of mutations and gene expressions of exfoliated cells in stool samples of CRC patients on the same chip platform. MLPA-DABA coupled with hydrogel bead-array is a promising method in the non-invasive diagnosis of CRC.
Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.
2004-01-01
Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234
Tam, Ming F.; Rice, Natalie W.; Maillett, David H.; Simplaceanu, Virgil; Ho, Nancy T.; Tam, Tsuey Chyi S.; Shen, Tong-Jian; Ho, Chien
2013-01-01
The E11 valine in the distal heme pocket of either the α- or β-subunit of human adult hemoglobin (Hb A) was replaced by leucine, isoleucine, or phenylalanine. Recombinant proteins were expressed in Escherichia coli and purified for structural and functional studies. 1H NMR spectra were obtained for the CO and deoxy forms of Hb A and the mutants. The mutations did not disturb the α1β2 interface in either form, whereas the H-bond between αHis-103 and βGln-131 in the α1β1 interfaces of the deoxy α-subunit mutants was weakened. Localized structural changes in the mutated heme pocket were detected for the CO form of recombinant Hb (rHb) (αV62F), rHb (βV67I), and rHb (βV67F) compared with Hb A. In the deoxy form the proximal histidyl residue in the β-subunit of rHb (βV67F) has been altered. Furthermore, the interactions between the porphyrin ring and heme pocket residues have been perturbed in rHb (αV62I), rHb (αV62F), and rHb (βV67F). Functionally, the oxygen binding affinity (P50), cooperativity (n50), and the alkaline Bohr Effect of the three α-subunit mutants and rHb (βV67L) are similar to those of Hb A. rHb (βV67I) and rHb (βV67F) exhibit low and high oxygen affinity, respectively. rHb (βV67F) has P50 values lower that those reported for rHb (αL29F), a B10 mutant studied previously in our laboratory (Wiltrout, M. E., Giovannelli, J. L., Simplaceanu, V., Lukin, J. A., Ho, N. T., and Ho, C. (2005) Biochemistry 44, 7207–7217). These E11 mutations do not slow down the autoxidation and azide-induced oxidation rates of the recombinant proteins. Results from this study provide new insights into the roles of E11 mutants in the structure-function relationship in hemoglobin. PMID:23867463
Hou, Xingsheng; McMillan, Mary; Coumans, Joëlle V F; Poljak, Anne; Raftery, Mark J; Pereg, Lily
2014-01-01
FlcA is a response regulator controlling flocculation and the morphological transformation of Azospirillum cells from vegetative to cyst-like forms. To understand the cellular responses of Azospirillum to conditions that cause morphological transformation, proteins differentially expressed under flocculation conditions in A. brasilense Sp7 and its flcA knockout mutant were investigated. Comparison of 2-DE protein profiles of wild-type (Sp7) and a flcA deletion mutant (Sp7-flcAΔ) revealed a total of 33 differentially expressed 2-DE gel spots, with 22 of these spots confidently separated to allow protein identification. Analysis of these spots by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and MASCOT database searching identified 48 proteins (≥10% emPAI in each spot). The functional characteristics of these proteins included carbon metabolism (beta-ketothiolase and citrate synthase), nitrogen metabolism (Glutamine synthetase and nitric oxide synthase), stress tolerance (superoxide dismutase, Alkyl hydroperoxidase and ATP-dependent Clp protease proteolytic subunit) and morphological transformation (transducer coupling protein). The observed differences between Sp7 wild-type and flcA- strains enhance our understanding of the morphological transformation process and help to explain previous phenotypical observations. This work is a step forward in connecting the Azospirillum phenome and genome.
Coumans, Joëlle V. F.; Poljak, Anne; Raftery, Mark J.; Pereg, Lily
2014-01-01
FlcA is a response regulator controlling flocculation and the morphological transformation of Azospirillum cells from vegetative to cyst-like forms. To understand the cellular responses of Azospirillum to conditions that cause morphological transformation, proteins differentially expressed under flocculation conditions in A. brasilense Sp7 and its flcA knockout mutant were investigated. Comparison of 2-DE protein profiles of wild-type (Sp7) and a flcA deletion mutant (Sp7-flcAΔ) revealed a total of 33 differentially expressed 2-DE gel spots, with 22 of these spots confidently separated to allow protein identification. Analysis of these spots by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and MASCOT database searching identified 48 proteins (≥10% emPAI in each spot). The functional characteristics of these proteins included carbon metabolism (beta-ketothiolase and citrate synthase), nitrogen metabolism (Glutamine synthetase and nitric oxide synthase), stress tolerance (superoxide dismutase, Alkyl hydroperoxidase and ATP-dependent Clp protease proteolytic subunit) and morphological transformation (transducer coupling protein). The observed differences between Sp7 wild-type and flcA − strains enhance our understanding of the morphological transformation process and help to explain previous phenotypical observations. This work is a step forward in connecting the Azospirillum phenome and genome. PMID:25502569
Watanabe, Takashi; Sakiyama, Ryo; Iimi, Yuya; Sekine, Satomi; Abe, Eriko; Nomura, Kazuko H; Nomura, Kazuya; Ishibashi, Yohei; Okino, Nozomu; Hayashi, Masahiro; Ito, Makoto
2017-12-01
Thraustochytrids are marine single-cell protists that produce large amounts of PUFAs, such as DHA. They accumulate PUFAs in lipid droplets (LDs), mainly as constituent(s) of triacylglycerol (TG). We identified a novel protein in the LD fraction of Aurantiochytrium limacinum F26-b using 2D-difference gel electrophoresis. The protein clustered with orthologs of thraustochytrids; however, the cluster was evolutionally different from known PAT family proteins or plant LD protein; thus, we named it thraustochytrid-specific LD protein 1 (TLDP1). TLDP1 surrounded LDs when expressed as a GFP-tagged form. Disruption of the tldp1 gene decreased the content of TG and number of LDs per cell; however, irregular and unusually large LDs were generated in tldp1 -deficient mutants. Although the level of TG synthesis was unchanged by the disruption of tldp1 , the level of TG degradation was higher in tldp1 -deficient mutants than in the WT. These phenotypic abnormalities in tldp1 -deficient mutants were restored by the expression of tldp1 These results indicate that TLDP1 is a thraustochytrid-specific LD protein and regulates the TG accumulation and LD morphology in A. limacinum F26-b. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
Villarino, María; Mendizabal, Gorka; Garzia, Aitor; Ugalde, Unai
2017-01-01
Microbial cells interact with the environment by adapting to external changes. Signal transduction pathways participate in both sensing and responding in the form of modification of gene expression patterns, enabling cell survival. The filamentous fungal-specific SltA pathway regulates tolerance to alkalinity, elevated cation concentrations and, as shown in this work, also stress conditions induced by borates. Growth of sltA− mutants is inhibited by increasing millimolar concentrations of boric acid or borax (sodium tetraborate). In an attempt to identify genes required for boron-stress response, we determined the boric acid or borax-dependent expression of sbtA and sbtB, orthologs of Saccharomyces cerevisiae bor1, and a reduction in their transcript levels in a ΔsltA mutant. Deletion of sbtA, but mainly that of sbtB, decreased the tolerance to boric acid or borax. In contrast, null mutants of genes coding for additional transporters of the Solute Carrier (SLC) family, sB, sbtD or sbtE, showed an unaltered growth pattern under the same stress conditions. Taken together, our results suggest that the SltA pathway induces, through SbtA and SbtB, the export of toxic concentrations of borates, which have largely recognized antimicrobial properties. PMID:28753996
Lipopeptide biosurfactant viscosin enhances dispersal of Pseudomonas fluorescens SBW25 biofilms
Bygvraa Svenningsen, Nanna; Rybtke, Morten; de Bruijn, Irene; Raaijmakers, Jos M.; Tolker-Nielsen, Tim; Nybroe, Ole
2015-01-01
Pseudomonads produce several lipopeptide biosurfactants that have antimicrobial properties but that also facilitate surface motility and influence biofilm formation. Detailed studies addressing the significance of lipopeptides for biofilm formation and architecture are rare. Hence, the present study sets out to determine the specific role of the lipopeptide viscosin in Pseudomonas fluorescens SBW25 biofilm formation, architecture and dispersal, and to relate viscA gene expression to viscosin production and effect. Initially, we compared biofilm formation of SBW25 and the viscosin-deficient mutant strain SBW25ΔviscA in static microtitre assays. These experiments demonstrated that viscosin had little influence on the amount of biofilm formed by SBW25 during the early stages of biofilm development. Later, however, SBW25 formed significantly less biofilm than SBW25ΔviscA. The indication that viscosin is involved in biofilm dispersal was confirmed by chemical complementation of the mutant biofilm. Furthermore, a fluorescent bioreporter showed that viscA expression was induced in biofilms 4 h prior to dispersal. Subsequent detailed studies of biofilms formed in flow cells for up to 5 days revealed that SBW25 and SBW25ΔviscA developed comparable biofilms dominated by well-defined, mushroom-shaped structures. Carbon starvation was required to obtain biofilm dispersal in this system. Dispersal of SBW25 biofilms was significantly greater than of SBW25ΔviscA biofilms after 3 h and, importantly, carbon starvation strongly induced viscA expression, in particular for cells that were apparently leaving the biofilm. Thus, the present study points to a role for viscosin-facilitated motility in dispersal of SBW25 biofilms. PMID:26419730
Lipopeptide biosurfactant viscosin enhances dispersal of Pseudomonas fluorescens SBW25 biofilms.
Bonnichsen, Lise; Bygvraa Svenningsen, Nanna; Rybtke, Morten; de Bruijn, Irene; Raaijmakers, Jos M; Tolker-Nielsen, Tim; Nybroe, Ole
2015-12-01
Pseudomonads produce several lipopeptide biosurfactants that have antimicrobial properties but that also facilitate surface motility and influence biofilm formation. Detailed studies addressing the significance of lipopeptides for biofilm formation and architecture are rare. Hence, the present study sets out to determine the specific role of the lipopeptide viscosin in Pseudomonas fluorescens SBW25 biofilm formation, architecture and dispersal, and to relate viscA gene expression to viscosin production and effect. Initially, we compared biofilm formation of SBW25 and the viscosin-deficient mutant strain SBW25ΔviscA in static microtitre assays. These experiments demonstrated that viscosin had little influence on the amount of biofilm formed by SBW25 during the early stages of biofilm development. Later, however, SBW25 formed significantly less biofilm than SBW25ΔviscA. The indication that viscosin is involved in biofilm dispersal was confirmed by chemical complementation of the mutant biofilm. Furthermore, a fluorescent bioreporter showed that viscA expression was induced in biofilms 4 h prior to dispersal. Subsequent detailed studies of biofilms formed in flow cells for up to 5 days revealed that SBW25 and SBW25ΔviscA developed comparable biofilms dominated by well-defined, mushroom-shaped structures. Carbon starvation was required to obtain biofilm dispersal in this system. Dispersal of SBW25 biofilms was significantly greater than of SBW25ΔviscA biofilms after 3 h and, importantly, carbon starvation strongly induced viscA expression, in particular for cells that were apparently leaving the biofilm. Thus, the present study points to a role for viscosin-facilitated motility in dispersal of SBW25 biofilms.
Understanding the Role of O-GlcNAc Modifications in Plant Development
DOE Office of Scientific and Technical Information (OSTI.GOV)
Olszewski, Neil, E.
2011-06-16
This project has contributed towards understanding the role of O-GlcNAc (O-linked N-acetylglucosamine) transferases (OGTs) in plants. Through analyses of single and double mutants, we have investigated the unique and overlapping functions of SECRET AGENT (SEC) and SPINDLY (SPY), the arabidopsis OGTs. This work showed that SEC functions as negative regulators of the long-day flowering pathway. SEC also has a positive role in regulation of rosette. An E. coli co-expression system that allows potential substrates to be co-expressed with and O-GlcNAc modified by SEC was developed. We showed that SEC is a bona fide OGT that modifies itself with single O-linkedmore » GlcNAc(s). Using this system, we tested a number of proteins that were hypothesized to be substrates of SEC and identified a number of substrates include GIGANTEA (GI), a component of the long day flowering pathway. The hypothesis that O-GlcNAc modification controls GI activity was tested by first mapping where E. coli-expressed SEC modifies GI and then assessing the activity of a non-modifiable mutant form of GI. The activity of the mutant form of GI was indistinguishable from that of wild type suggesting that either O-GlcNAc does not regulate GI activity or that additional modification sites exist on GI. In collaboration with Dr. Juan Antonio Garcia at Universidad Autónoma de Madrid the role of O-GlcNAc modification of the plum pox virus coat protein (PPV-CP) was investigated. SEC was shown to O-GlcNAc modify PPV-CP and the modification was shown to facilitate the infection process. E. coli-expressed SEC was shown to modify the same PPV-CP sites that are modified in plants. SEC has a large protein interaction domain called the TPR domain that has been hypothesized to have a role in determining the substrate specificity of the enzyme and/or to regulate its activity. A mutational analysis of the TPR domain did not find evidence for a role in substrate specificity but did obtain evidence that the domain regulates enzyme activity.« less
Temperature-responsive genetic loci in the plant pathogen Pseudomonas syringae pv. glycinea.
Ullrich, M S; Schergaut, M; Boch, J; Ullrich, B
2000-10-01
Plant-pathogenic bacteria may sense variations in environmental factors, such as temperature, to adapt to plant-associated habitats during pathogenesis or epiphytic growth. The bacterial blight pathogen of soybean, Pseudomonas syringae pv. glycinea PG4180, preferentially produces the phytotoxin coronatine at 18 degrees C and infects the host plant under conditions of low temperature and high humidity. A miniTn5-based promoterless glucuronidase (uidA) reporter gene was used to identify genetic loci of PG4180 preferentially expressed at 18 or 28 degrees C. Out of 7500 transposon mutants, 61 showed thermoregulated uidA expression as determined by a three-step screening procedure. Two-thirds of these mutants showed an increased reporter gene expression at 18 degrees C whilst the remainder exhibited higher uidA expression at 28 degrees C. MiniTn5-uidA insertion loci from these mutants were subcloned and their nucleotide sequences were determined. Several of the mutants induced at 18 degrees C contained the miniTn5-uidA insertion within the 32.8 kb coronatine biosynthetic gene cluster. Among the other mutants with increased uidA expression at 18 degrees C, insertions were found in genes encoding formaldehyde dehydrogenase, short-chain dehydrogenase and mannuronan C-5-epimerase, in a plasmid-borne replication protein, and in the hrpT locus, involved in pathogenicity of P. syringae. Among the mutants induced at 28 degrees C, insertions disrupted loci with similarities to a repressor of conjugal plasmid transfer, UV resistance determinants, an isoflavanoid-degrading enzyme, a HU-like DNA-binding protein, two additional regulatory proteins, a homologue of bacterial adhesins, transport proteins, LPS synthesis enzymes and two proteases. Genetic loci from 13 mutants did not show significant similarities to any database entries. Results of plant inoculations showed that three of the mutants tested were inhibited in symptom development and in planta multiplication rates. Temperature-shift experiments suggested that all of the identified loci showed a rather slow induction of expression upon change of temperature.
Study the Expression of ompf Gene in Esherichia coli Mutants
Jaktaji, R. Pourahmad; Heidari, F.
2013-01-01
The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5’ end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription. PMID:24403654
Establishment of a tissue-specific RNAi system in C. elegans.
Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo
2007-10-01
In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.
Establishment of a tissue-specific RNAi system in C. elegans
Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo
2011-01-01
In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718
Channel-Opening Kinetic Mechanism of Wild-Type GluK1 Kainate Receptors and a C-Terminal Mutant
Han, Yan; Wang, Congzhou; Park, Jae Seon; Niu, Li
2012-01-01
GluK1 is a kainate receptor subunit in the ionotropic glutamate receptor family and can form functional channels when expressed, for instance, in HEK-293 cells. However, the channel-opening mechanism of GluK1 is poorly understood. One major challenge to studying the GluK1 channel is its apparent low surface expression, which results in a low whole-cell current response even to a saturating concentration of agonist. The low surface expression is thought to be contributed by an endoplasmic reticulum (ER) retention signal sequence. When this sequence motif is present as in the wild-type GluK1-2b C-terminus, the receptor is significantly retained in the ER. Conversely, when this sequence is lacking, as in wild-type GluK1-2a (i.e., a different alternatively spliced isoform at the C-terminus) and in a GluK1-2b mutant (i.e., R896A, R897A, R900A and K901A) that disrupts the ER retention signal, there is higher surface expression and greater whole-cell current response. Here we characterize the channel-opening kinetic mechanism for these three GluK1 receptors expressed in HEK-293 cells by using a laser-pulse photolysis technique. Our results show that the wild-type GluK1-2a, wild-type GluK1-2b and the mutant GluK1-2b have identical channel-opening and channel-closing rate constants. These results indicate that the C-terminal ER retention signal sequence, which affects receptor trafficking/expression, does not affect channel-gating properties. Furthermore, as compared with the GluK2 kainate receptor, the GluK1 channel is faster to open, close, and desensitize by at least two-fold, yet the EC50 value of GluK1 is similar to that of GluK2. PMID:22191429
Moleleki, Lucy Novungayo; Pretorius, Rudolph Gustav; Tanui, Collins Kipngetich; Mosina, Gabolwelwe; Theron, Jacques
2017-01-01
Pectobacterium carotovorum ssp. brasiliense 1692 (Pcb1692) is an important emerging pathogen of potatoes causing blackleg in the field and soft rot during post-harvest storage. Blackleg diseases involve the bacterial colonization of vascular tissue and the formation of aggregates, also known as biofilms. To understand the role of quorum sensing in vascular colonization by Pcb1692, we generated a Pcb1692ΔexpI mutant strain. Inactivation of expI led to the reduced production of plant cell wall-degrading enzymes (PCWDEs), the inability to produce acyl homoserine lactone (AHL) and reduced virulence in potato tubers and stems. Complementation of the mutant strain with the wild-type expI gene in trans successfully restored AHL and PCWDE production as well as virulence. Transmission electron microscopy and in vitro motility assays demonstrated hyperpiliation and loss of flagella and swimming motility in the mutant strain compared with the wild-type Pcb1692. Furthermore, we noted that, in the early stages of infection, Pcb1692 wild-type cells had intact flagella which were shed at the later stages of infection. Confocal laser microscopy of PcbΔexpI-inoculated plants showed that the mutant strain tended to aggregate in intercellular spaces, but was unable to transit to xylem tissue. On the contrary, the wild-type strain was often observed forming aggregates within xylem tissue of potato stems. Gene expression analyses confirmed that flagella are part of the quorum sensing regulon, whereas fimbriae and pili appear to be negatively regulated by quorum sensing. The relative expression levels of other important putative virulence genes, such as those encoding different groups of PCWDEs, were down-regulated in the mutant compared with the wild-type strain. © 2016 BSPP and John Wiley & Sons Ltd.
Roberts, Blaine R; Lim, Nastasia K H; McAllum, Erin J; Donnelly, Paul S; Hare, Dominic J; Doble, Philip A; Turner, Bradley J; Price, Katherine A; Lim, Sin Chun; Paterson, Brett M; Hickey, James L; Rhoads, Timothy W; Williams, Jared R; Kanninen, Katja M; Hung, Lin W; Liddell, Jeffrey R; Grubman, Alexandra; Monty, Jean-Francois; Llanos, Roxana M; Kramer, David R; Mercer, Julian F B; Bush, Ashley I; Masters, Colin L; Duce, James A; Li, Qiao-Xin; Beckman, Joseph S; Barnham, Kevin J; White, Anthony R; Crouch, Peter J
2014-06-04
Mutations in the metallo-protein Cu/Zn-superoxide dismutase (SOD1) cause amyotrophic lateral sclerosis (ALS) in humans and an expression level-dependent phenotype in transgenic rodents. We show that oral treatment with the therapeutic agent diacetyl-bis(4-methylthiosemicarbazonato)copper(II) [Cu(II)(atsm)] increased the concentration of mutant SOD1 (SOD1G37R) in ALS model mice, but paradoxically improved locomotor function and survival of the mice. To determine why the mice with increased levels of mutant SOD1 had an improved phenotype, we analyzed tissues by mass spectrometry. These analyses revealed most SOD1 in the spinal cord tissue of the SOD1G37R mice was Cu deficient. Treating with Cu(II)(atsm) decreased the pool of Cu-deficient SOD1 and increased the pool of fully metallated (holo) SOD1. Tracking isotopically enriched (65)Cu(II)(atsm) confirmed the increase in holo-SOD1 involved transfer of Cu from Cu(II)(atsm) to SOD1, suggesting the improved locomotor function and survival of the Cu(II)(atsm)-treated SOD1G37R mice involved, at least in part, the ability of the compound to improve the Cu content of the mutant SOD1. This was supported by improved survival of SOD1G37R mice that expressed the human gene for the Cu uptake protein CTR1. Improving the metal content of mutant SOD1 in vivo with Cu(II)(atsm) did not decrease levels of misfolded SOD1. These outcomes indicate the metal content of SOD1 may be a greater determinant of the toxicity of the protein in mutant SOD1-associated forms of ALS than the mutations themselves. Improving the metal content of SOD1 therefore represents a valid therapeutic strategy for treating ALS caused by SOD1. Copyright © 2014 the authors 0270-6474/14/348021-11$15.00/0.
Stenman, Jan; Yu, Ruth T; Evans, Ronald M; Campbell, Kenneth
2003-03-01
We have examined the role of Tlx, an orphan nuclear receptor, in dorsal-ventral patterning of the mouse telencephalon. Tlx is expressed broadly in the ventricular zone, with the exception of the dorsomedial and ventromedial regions. The expression spans the pallio-subpallial boundary, which separates the dorsal (i.e. pallium) and ventral (i.e. subpallium) telencephalon. Despite being expressed on both sides of the pallio-subpallial boundary, Tlx homozygous mutants display alterations in the development of this boundary. These alterations include a dorsal shift in the expression limits of certain genes that abut at the pallio-subpallial boundary as well as the abnormal formation of the radial glial palisade that normally marks this boundary. The Tlx mutant phenotype is similar to, but less severe than, that seen in Small eye (i.e. Pax6) mutants. Interestingly, removal of one allele of Pax6 on the homozygous Tlx mutant background significantly worsens the phenotype. Thus Tlx and Pax6 cooperate genetically to regulate the establishment of the pallio-subpallial boundary. The patterning defects in the Tlx mutant telencephalon result in a loss of region-specific gene expression in the ventral-most pallial region. This correlates well with the malformation of the lateral and basolateral amygdala in Tlx mutants, both of which have been suggested to derive from ventral portions of the pallium.
Diabetes and exocrine pancreatic insufficiency in E2F1/E2F2 double-mutant mice.
Iglesias, Ainhoa; Murga, Matilde; Laresgoiti, Usua; Skoudy, Anouchka; Bernales, Irantzu; Fullaondo, Asier; Moreno, Bernardino; Lloreta, José; Field, Seth J; Real, Francisco X; Zubiaga, Ana M
2004-05-01
E2F transcription factors are thought to be key regulators of cell growth control. Here we use mutant mouse strains to investigate the function of E2F1 and E2F2 in vivo. E2F1/E2F2 compound-mutant mice develop nonautoimmune insulin-deficient diabetes and exocrine pancreatic dysfunction characterized by endocrine and exocrine cell dysplasia, a reduction in the number and size of acini and islets, and their replacement by ductal structures and adipose tissue. Mutant pancreatic cells exhibit increased rates of DNA replication but also of apoptosis, resulting in severe pancreatic atrophy. The expression of genes involved in DNA replication and cell cycle control was upregulated in the E2F1/E2F2 compound-mutant pancreas, suggesting that their expression is repressed by E2F1/E2F2 activities and that the inappropriate cell cycle found in the mutant pancreas is likely the result of the deregulated expression of these genes. Interestingly, the expression of ductal cell and adipocyte differentiation marker genes was also upregulated, whereas expression of pancreatic cell marker genes were downregulated. These results suggest that E2F1/E2F2 activity negatively controls growth of mature pancreatic cells and is necessary for the maintenance of differentiated pancreatic phenotypes in the adult.
Karachaliou, Niki; Codony-Servat, Jordi; Teixidó, Cristina; Pilotto, Sara; Drozdowskyj, Ana; Codony-Servat, Carles; Giménez-Capitán, Ana; Molina-Vila, Miguel Angel; Bertrán-Alamillo, Jordi; Gervais, Radj; Massuti, Bartomeu; Morán, Teresa; Majem, Margarita; Felip, Enriqueta; Carcereny, Enric; García-Campelo, Rosario; Viteri, Santiago; González-Cao, María; Morales-Espinosa, Daniela; Verlicchi, Alberto; Crisetti, Elisabetta; Chaib, Imane; Santarpia, Mariacarmela; Luis Ramírez, José; Bosch-Barrera, Joaquim; Felipe Cardona, Andrés; de Marinis, Filippo; López-Vivanco, Guillermo; Miguel Sánchez, José; Vergnenegre, Alain; Sánchez Hernández, José Javier; Sperduti, Isabella; Bria, Emilio; Rosell, Rafael
2015-12-07
BIM is a proapoptotic protein that initiates apoptosis triggered by EGFR tyrosine kinase inhibitors (TKI). mTOR negatively regulates apoptosis and may influence response to EGFR TKI. We examined mRNA expression of BIM and MTOR in 57 patients with EGFR-mutant NSCLC from the EURTAC trial. Risk of mortality and disease progression was lower in patients with high BIM compared with low/intermediate BIM mRNA levels. Analysis of MTOR further divided patients with high BIM expression into two groups, with those having both high BIM and MTOR experiencing shorter overall and progression-free survival to erlotinib. Validation of our results was performed in an independent cohort of 19 patients with EGFR-mutant NSCLC treated with EGFR TKIs. In EGFR-mutant lung adenocarcinoma cell lines with high BIM expression, concomitant high mTOR expression increased IC50 of gefitinib for cell proliferation. We next sought to analyse the signalling pattern in cell lines with strong activation of mTOR and its substrate P-S6. We showed that mTOR and phosphodiesterase 4D (PDE4D) strongly correlate in resistant EGFR-mutant cancer cell lines. These data suggest that the combination of EGFR TKI with mTOR or PDE4 inhibitors could be adequate therapy for EGFR-mutant NSCLC patients with high pretreatment levels of BIM and mTOR.
Du, Qingyou; Schaap, Pauline
2014-01-01
Amoebas and other freely moving protists differentiate into walled cysts when exposed to stress. As cysts, amoeba pathogens are resistant to biocides, preventing treatment and eradication. Lack of gene modification procedures has left the mechanisms of encystation largely unexplored. Genetically tractable Dictyostelium discoideum amoebas require cellulose synthase for formation of multicellular fructifications with cellulose-rich stalk and spore cells. Amoebas of its distant relative Polysphondylium pallidum (Ppal), can additionally encyst individually in response to stress. Ppal has two cellulose synthase genes, DcsA and DcsB, which we deleted individually and in combination. Dcsa- mutants formed fruiting bodies with normal stalks, but their spore and cyst walls lacked cellulose, which obliterated stress-resistance of spores and rendered cysts entirely non-viable. A dcsa-/dcsb- mutant made no walled spores, stalk cells or cysts, although simple fruiting structures were formed with a droplet of amoeboid cells resting on an sheathed column of decaying cells. DcsB is expressed in prestalk and stalk cells, while DcsA is additionally expressed in spores and cysts. We conclude that cellulose is essential for encystation and that cellulose synthase may be a suitable target for drugs to prevent encystation and render amoeba pathogens susceptible to conventional antibiotics. PMID:25113829
Vidal, Ruben; Barbeito, Ana G; Miravalle, Leticia; Ghetti, Bernardino
2009-01-01
Familial Danish dementia (FDD) is an autosomal dominant neurodegenerative disease clinically characterized by the presence of cataracts, hearing impairment, cerebellar ataxia and dementia. Neuropathologically, FDD is characterized by the presence of widespread cerebral amyloid angiopathy (CAA), parenchymal amyloid deposition and neurofibrillary tangles. FDD is caused by a 10-nucleotide duplication-insertion in the BRI(2) gene that generates a larger-than-normal precursor protein, of which the Danish amyloid subunit (ADan) comprises the last 34 amino acids. Here, we describe a transgenic mouse model for FDD (Tg-FDD) in which the mouse Prnp (prion protein) promoter drives the expression of the Danish mutant form of human BRI(2). The main neuropathological findings in Tg-FDD mice are the presence of widespread CAA and parenchymal deposition of ADan. In addition, we observe the presence of amyloid-associated gliosis, an inflammatory response and deposition of oligomeric ADan. As the animals aged, they showed abnormal grooming behavior, an arched back, and walked with a wide-based gait and shorter steps. This mouse model may give insights on the pathogenesis of FDD and will prove useful for the development of therapeutics. Moreover, the study of Tg-FDD mice may offer new insights into the role of amyloid in neurodegeneration in other disorders, including Alzheimer disease.
Hsp27 and F-box protein β-TrCP promote degradation of mRNA decay factor AUF1.
Li, Mei-Ling; Defren, Jennifer; Brewer, Gary
2013-06-01
Activation of the mitogen-activated protein (MAP) pathway kinases p38 and MK2 induces phosphorylation of the chaperone Hsp27 and stabilization of mRNAs containing AU-rich elements (AREs) (ARE-mRNAs). Likewise, expression of phosphomimetic mutant forms of Hsp27 also stabilizes ARE-mRNAs. It appears to perform this function by promoting degradation of the ARE-mRNA decay factor AUF1 by proteasomes. In this study, we examined the molecular mechanism linking Hsp27 phosphorylation to AUF1 degradation by proteasomes. AUF1 is a target of β-TrCP, the substrate recognition subunit of the E3 ubiquitin ligase Skp1-cullin-F-box protein complex, SCF(β-TrCP). Depletion of β-TrCP stabilized AUF1. In contrast, overexpression of β-TrCP enhanced ubiquitination and degradation of AUF1 and led to stabilization of reporter mRNAs containing cytokine AREs. Enhanced AUF1 degradation required expression of phosphomimetic mutant forms of both Hsp27 and AUF1. Our results suggest that a signaling axis composed of p38 MAP kinase-MK2-Hsp27-β-TrCP may promote AUF1 degradation by proteasomes and stabilization of cytokine ARE-mRNAs.
Demir, Eşref; Turna, Fatma; Vales, Gerard; Kaya, Bülent; Creus, Amadeu; Marcos, Ricard
2013-11-01
As in vivo system, we propose Drosophila melanogaster as a useful model for study the genotoxic risks associated with nanoparticle exposure. In this study we have carried out a genotoxic evaluation of titanium dioxide (TiO2), zirconium oxide (ZrO2) and aluminium oxide (Al2O3) nanoparticles and their microparticulated forms in D. melanogaster by using the wing somatic mutation and recombination assay. This assay is based on the principle that loss of heterozygosis and the corresponding expression of the suitable recessive markers, multiple wing hairs and flare-3, can lead to the formation of mutant clones in treated larvae, which are expressed as mutant spots on the wings of adult flies. Third instar larvae were feed with TiO2, ZrO2 and Al2O3 nanoparticles, and their microparticulated forms, at concentrations ranging from 0.1 to 10mM. Although a certain level of aggregation/agglomeration was observed in solution, it must be noted than the constant digging activity of larvae ensures that treated medium pass constantly through the digestive tract ensuring exposure. The results showed that no significant increases in the frequency of all spots (e.g. small single, large single, twin, total mwh and total spots) were observed, indicating that these nanoparticles were not able to induce genotoxic activity in the wing spot assay of D. melanogaster. Negative data were also obtained with the microparticulated forms. This indicates that the nanoparticulated form of the selected nanomaterials does not modify the potential genotoxicity of their microparticulated versions. These in vivo results contribute to increase the genotoxicity database on the TiO2, ZrO2 and Al2O3 nanoparticles. Copyright © 2013 Elsevier Ltd. All rights reserved.
Zhou, Liang; Yang, Dong; Wang, De-Juan; Xie, Ya-Jun; Zhou, Jia-Huan; Zhou, Lin; Huang, Hao; Han, Shuo; Shao, Chong-Yu; Li, Hua-Shun; Zhu, J Julius; Qiu, Meng-Sheng; De Zeeuw, Chris I; Shen, Ying
2015-12-15
Protein Numb, first identified as a cell-fate determinant in Drosophila, has been shown to promote the development of neurites in mammals and to be cotransported with endocytic receptors in clathrin-coated vesicles in vitro. Nevertheless, its function in mature neurons has not yet been elucidated. Here we show that cerebellar Purkinje cells (PCs) express high levels of Numb during adulthood and that conditional deletion of Numb in PCs is sufficient to impair motor coordination despite maintenance of a normal cerebellar cyto-architecture. Numb proved to be critical for internalization and recycling of metabotropic glutamate 1 receptor (mGlu1) in PCs. A significant decrease of mGlu1 and an inhibition of long-term depression at the parallel fiber-PC synapse were observed in conditional Numb knockout mice. Indeed, the trafficking of mGlu1 induced by agonists was inhibited significantly in these mutants, but the expression of ionotropic glutamate receptor subunits and of mGlu1-associated proteins was not affected by the loss of Numb. Moreover, transient and persistent forms of mGlu1 plasticity were robustly induced in mutant PCs, suggesting that they do not require mGlu1 trafficking. Together, our data demonstrate that Numb is a regulator for constitutive expression and dynamic transport of mGlu1.
Shox2-deficiency leads to dysplasia and ankylosis of the temporomandibular joint in Mice
Gu, Shuping; Wei, Na; Yu, Ling; Fei, Jian; Chen, YiPing
2010-01-01
The temporomandibular joint (TMJ) is a unique synovial joint whose development differs from the formation of other synovial joints. Mutations have been associated with the developmental defects of the TMJ only in a few genes. In this study, we report the expression of the homeobox gene Shox2 in the cranial neural crest derived mesenchymal cells of the maxilla-mandibular junction and later in the progenitor cells and undifferentiated chondrocytes of the condyle as well as the glenoid fossa of the developing TMJ. A conditional inactivation of Shox2 in the cranial neural crest-derived cells causes developmental abnormalities in the TMJ, including dysplasia of the condyle and glenoid fossa. The articulating disc forms but fuses with the fibrous layers of the condyle and glenoid fossa, clinically known as TMJ ankylosis. Histological examination indicates a delay in development in the mutant TMJ, accompanied by a significantly reduced rate of cell proliferation. In situ hybridization further demonstrates an altered expression of several key osteogenic genes and a delayed expression of the osteogenic differentiation markers. Shox2 appears to regulate the expression of osteogenic genes and is essential for the development and function of the TMJ. The Shox2 conditional mutant thus provides a unique animal model of TMJ ankylosis. PMID:18514492
Beaudoin, Guillaume A W; Johnson, Timothy S; Hanson, Andrew D
2018-04-27
In plants, the hydroxymethylpyrimidine (HMP) and thiazole precursors of thiamin are synthesized and coupled together to form thiamin in plastids. Mutants unable to form HMP can be rescued by exogenous HMP, implying the presence of HMP transporters in the plasma membrane and plastids. Analysis of bacterial genomes revealed a transporter gene that is chromosomally clustered with thiamin biosynthesis and salvage genes. Its closest Arabidopsis homolog, the plastidic nucleobase transporter (PLUTO), is co-expressed with several thiamin biosynthetic enzymes. Heterologous expression of PLUTO in Escherichia coli or Saccharomyces cerevisiae increased sensitivity to a toxic HMP analog, and disrupting PLUTO in an HMP-requiring Arabidopsis line reduced root growth at low HMP concentrations. These data implicate PLUTO in plastidial transport and salvage of HMP. © 2018 The Author(s).
The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.
Ren, Jun; Prescott, John F
2004-11-15
An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.
Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene ExpressionW⃞
Hunter, Brenda G.; Beatty, Mary K.; Singletary, George W.; Hamaker, Bruce R.; Dilkes, Brian P.; Larkins, Brian A.; Jung, Rudolf
2002-01-01
Maize starchy endosperm mutants have kernel phenotypes that include a brittle texture, susceptibility to insect pests, and inferior functional characteristics of products made from their flour. At least 18 such mutants have been identified, but only in the cases of opaque2 (o2) and floury2 (fl2), which affect different aspects of storage protein synthesis, is the molecular basis of the mutation known. To better understand the relationship between the phenotypes of these mutants and their biochemical bases, we characterized the protein and amino acid composition, as well as the mRNA transcript profiles, of nearly isogenic inbred lines of W64A o1, o2, o5, o9, o11, Mucuronate (Mc), Defective endosperm B30 (DeB30), and fl2. The largest reductions in zein protein synthesis occur in the W64A o2, DeB30, and fl2 mutants, which have ∼35 to 55% of the wild-type level of storage proteins. Zeins in W64A o5, o9, o11, and Mc are within 80 to 90% of the amount found in the wild type. Only in the cases of o5 and Mc were significant qualitative changes in zein synthesis observed. The pattern of gene expression in normal and mutant genotypes was assayed by profiling endosperm mRNA transcripts at 18 days after pollination with an Affymetrix GeneChip containing >1400 selected maize gene sequences. Compared with W64A sugary1, a mutant defective in starch synthesis, alterations in the gene expression patterns of the opaque mutants are very pleiotropic. Increased expression of genes associated with physiological stress, and the unfolded protein response, are common features of the opaque mutants. Based on global patterns of gene expression, these mutants were categorized in four phenotypic groups as follows: W64A+ and o1; o2; o5/o9/o11; and Mc and fl2. PMID:12368507
Duan, Qiangde; Zhou, Mingxu; Zhu, Xiaofang; Bao, Wenbin; Wu, Shenglong; Ruan, Xiaosai; Zhang, Weiping; Yang, Yang; Zhu, Jun; Zhu, Guoqiang
2012-11-09
Bacterial flagella contribute to pathogen virulence; however, the role of flagella in the pathogenesis of F18ab E. coli-mediated swine edema disease (ED) is not currently known. We therefore evaluated the role of flagella in F18ab E. coli adhesion, invasion, biofilm formation, and IL-8 production using an in vitro cell infection model approach with gene-deletion mutant and complemented bacterial strains. We demonstrated that the flagellin-deficient fliC mutant had a marked decrease in the ability to adhere to and invade porcine epithelial IPEC-J2 cells. Surprisingly, there was no difference in adhesion between the F18 fimbriae-deficient ΔfedA mutant and its parent strain. In addition, both the ΔfedA and double ΔfliCΔfedA mutants exhibited an increased ability to invade IPEC-J2 cells compared to the wild-type strain, although this may be due to increased expression of other adhesins following the loss of F18ab fimbriae and flagella. Compared to the wild-type strain, the ΔfliC mutant showed significantly reduced ability to form biofilm, whereas the ΔfedA mutant increased biofilm formation. Although ΔfliC, ΔfedA, and ΔfliCΔfedA mutants had a reduced ability to stimulate IL-8 production from infected Caco-2 cells, the ΔfliC mutant impaired this ability to a greater extent than the ΔfedA mutant. The results from this study clearly demonstrate that flagella are required for efficient F18ab E. coli adhesion, invasion, biofilm formation, and IL-8 production in vitro. Copyright © 2012 Elsevier B.V. All rights reserved.
Perry, Matthew D; Ng, Chai Ann; Phan, Kevin; David, Erikka; Steer, Kieran; Hunter, Mark J; Mann, Stefan A; Imtiaz, Mohammad; Hill, Adam P; Ke, Ying; Vandenberg, Jamie I
2016-07-15
Most missense long QT syndrome type 2 (LQTS2) mutations result in Kv11.1 channels that show reduced levels of membrane expression. Pharmacological chaperones that rescue mutant channel expression could have therapeutic potential to reduce the risk of LQTS2-associated arrhythmias and sudden cardiac death, but only if the mutant Kv11.1 channels function normally (i.e. like WT channels) after membrane expression is restored. Fewer than half of mutant channels exhibit relatively normal function after rescue by low temperature. The remaining rescued missense mutant Kv11.1 channels have perturbed gating and/or ion selectivity characteristics. Co-expression of WT subunits with gating defective missense mutations ameliorates but does not eliminate the functional abnormalities observed for most mutant channels. For patients with mutations that affect gating in addition to expression, it may be necessary to use a combination therapy to restore both normal function and normal expression of the channel protein. In the heart, Kv11.1 channels pass the rapid delayed rectifier current (IKr ) which plays critical roles in repolarization of the cardiac action potential and in the suppression of arrhythmias caused by premature stimuli. Over 500 inherited mutations in Kv11.1 are known to cause long QT syndrome type 2 (LQTS2), a cardiac electrical disorder associated with an increased risk of life threatening arrhythmias. Most missense mutations in Kv11.1 reduce the amount of channel protein expressed at the membrane and, as a consequence, there has been considerable interest in developing pharmacological agents to rescue the expression of these channels. However, pharmacological chaperones will only have clinical utility if the mutant Kv11.1 channels function normally after membrane expression is restored. The aim of this study was to characterize the gating phenotype for a subset of LQTS2 mutations to assess what proportion of mutations may be suitable for rescue. As an initial screen we used reduced temperature to rescue expression defects of mutant channels expressed in Xenopus laevis oocytes. Over half (∼56%) of Kv11.1 mutants exhibited functional gating defects that either dramatically reduced the amount of current contributing to cardiac action potential repolarization and/or reduced the amount of protective current elicited in response to premature depolarizations. Our data demonstrate that if pharmacological rescue of protein expression defects is going to have clinical utility in the treatment of LQTS2 then it will be important to assess the gating phenotype of LQTS2 mutations before attempting rescue. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.
Trapping a 96° domain rotation in two distinct conformations by engineered disulfide bridges
Schultz-Heienbrok, Robert; Maier, Timm; Sträter, Norbert
2004-01-01
Engineering disulfide bridges is a common technique to lock a protein movement in a defined conformational state. We have designed two double mutants of Escherichia coli 5′-nucleotidase to trap the enzyme in both an open (S228C, P513C) and a closed (P90C, L424C) conformation by the formation of disulfide bridges. The mutant proteins have been expressed, purified, and crystallized, to structurally characterize the designed variants. The S228C, P513C is a double mutant crystallized in two different crystal forms with three independent conformers, which differ from each other by a rotation of up to 12° of the C-terminal domain with respect to the N-terminal domain. This finding, as well as an analysis of the domain motion in the crystal, indicates that the enzyme still exhibits considerable residual domain flexibility. In the double mutant that was designed to trap the enzyme in the closed conformation, the structure analysis reveals an unexpected intermediate conformation along the 96° rotation trajectory between the open and closed enzyme forms. A comparison of the five independent conformers analyzed in this study shows that the domain movement of the variant enzymes is characterized by a sliding movement of the residues of the domain interface along the interface, which is in contrast to a classical closure motion where the residues of the domain interface move perpendicular to the interface. PMID:15215524
Park, Jin Hwan; Lee, Byungho; Jo, Youmi; Choi, Sang Ho
2016-11-07
Biofilms are recalcitrant and raise safety problems in the food industry. In this study, the role of CabA, an extracellular matrix protein, in the resistance of the biofilms of Vibrio vulnificus, a foodborne pathogen, to decontamination strategies was investigated. Biofilms of the cabA mutant revealed reduced resistance to detachment by vibration and disinfection by sodium hypochlorite compared to the biofilms of the parental wild type in vitro. The reduced resistance of the cabA mutant biofilms was complemented by introducing a recombinant cabA, indicating that the reduced resistance of the cabA mutant biofilms is caused by the inactivation of cabA. The expression of cabA was induced in cells bound to oyster, the primary vehicle of the pathogen. The cabA mutant biofilms on oyster are defective in biomass and resistance to detachment and disinfection. The bacterial cells in the wild-type biofilms are clustered by filaments which are not apparent in the cabA mutant biofilms. The combined results indicated that CabA contributes to the structural integrity of V. vulnificus biofilms possibly by forming filaments in the matrix and thus rendering the biofilms robust, suggesting that CabA could be a target to control V. vulnificus biofilms on oyster. Copyright © 2016 Elsevier B.V. All rights reserved.
Saini, Nidhi; Georgiev, Oleg; Schaffner, Walter
2011-01-01
The gene for Parkin, an E3 ubiquitin ligase, is mutated in some familial forms of Parkinson's disease, a severe neurodegenerative disorder. A homozygous mutant of the Drosophila ortholog of human parkin is viable but results in severe motoric impairment including an inability to fly, female and male sterility, and a decreased life span. We show here that a double mutant of the genes for Parkin and the metal-responsive transcription factor 1 (MTF-1) is not viable. MTF-1, which is conserved from insects to mammals, is a key regulator of heavy metal homeostasis and detoxification and plays additional roles in other stress conditions, notably oxidative stress. In contrast to the synthetic lethality of the double mutant, elevated expression of MTF-1 dramatically ameliorates the parkin mutant phenotype, as evidenced by a prolonged life span, motoric improvement including short flight episodes, and female fertility. At the cellular level, muscle and mitochondrial structures are substantially improved. A beneficial effect is also seen with a transgene encoding human MTF-1. We propose that Parkin and MTF-1 provide complementary functions in metal homeostasis, oxidative stress and other cellular stress responses. Our findings also raise the possibility that MTF-1 gene polymorphisms in humans could affect the severity of Parkinson's disease. PMID:21383066
Mottram, J C; McCready, B P; Brown, K G; Grant, K M
1996-11-01
The generation of homozygous null mutants for the crk1 Cdc2-Related Kinase of Leishmania mexicana was attempted using targeted gene disruption. Promastigote mutants heterozygous for crk1 were readily isolated with a hyg-targeting fragment, but attempts to create null mutants by second-round transfections with a bie-targeting fragment yielded two classes of mutant, neither of which was null. First, the transfected fragment formed an episome; second, the cloned transfectants were found to contain wild-type crk1 alleles as well as hyg and ble integrations. DNA-content analysis revealed that these mutants were triploid or tetraploid. Plasticity in chromosome number following targeting has been proposed as a means by which Leishmania avoids deletion of essential genes. These data support this theory and implicate crk1 as an essential gene, validating CRK1 as a potential drug target. L mexicana transfected with a Trypanosoma brucel homologue, tbcrk1, was shown to be viable in an immcrk1 null background, thus showing complementation of function between these trypanosomatid genes. The expression of crk1 was further manipulated by engineering a six-histidine tag at the C-terminus of the kinase, allowing purification of the active complex by affinity selection on Nl(2+)-nitriloacetic acid (NTA) agarose.
VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.
Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G
1993-04-01
Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dance-Barnes, Stephanie T.; Kock, Nancy D.; Floyd, Heather S.
2008-08-15
Studies in cell culture have suggested that the level of RAS expression can influence the transformation of cells and the signaling pathways stimulated by mutant RAS expression. However, the levels of RAS expression in vivo appear to be subject to feedback regulation, limiting the total amount of RAS protein that can be expressed. We utilized a bitransgenic mouse lung tumor model that expressed the human Ki-ras{sup G12C} allele in a tetracycline-inducible, lung-specific manner. Treatment for 12 months with 500 {mu}g/ml of doxycycline (DOX) allowed for maximal expression of the human Ki-ras{sup G12C} allele in the lung, and resulted in themore » development of focal hyperplasia and adenomas. We determined if different levels of mutant RAS expression would influence the phenotype of the lung lesions. Treatment with 25, 100 and 500 {mu}g/ml of DOX resulted in dose-dependent increases in transgene expression and tumor multiplicity. Microscopic analysis of the lungs of mice treated with the 25 {mu}g/ml dose of DOX revealed infrequent foci of hyperplasia, whereas mice treated with the 100 and 500 {mu}g/ml doses exhibited numerous hyperplastic foci and also adenomas. Immunohistochemical and RNA analysis of the downstream effector pathways demonstrated that different levels of mutant RAS transgene expression resulted in differences in the expression and/or phosphorylation of specific signaling molecules. Our results suggest that the molecular alterations driving tumorigenesis may differ at different levels of mutant Ki-ras{sup G12C} expression, and this should be taken into consideration when inducible transgene systems are utilized to promote tumorigenesis in mouse models.« less
Kang, WonKyung; Imai, Noriko; Kawasaki, Yu; Nagamine, Toshihiro; Matsumoto, Shogo
2005-11-01
The Bombyx mori nucleopolyhedrovirus (BmNPV) ORF8 protein has previously been reported to colocalize with IE1 to specific nuclear sites during infection. Transient expression of green fluorescent protein (GFP)-fused ORF8 showed the protein to have cytoplasmic localization, but following BmNPV infection the protein formed foci, suggesting that ORF8 requires some other viral factor(s) for this. Therefore, interacting factors were looked for using the yeast two-hybrid system and IE1 was identified. We mapped the interacting region of ORF8 using a yeast two-hybrid assay. An N-terminal region (residues 1-110) containing a predicted coiled-coil domain interacted with IE1, while a truncated N-terminal region (residues 1-78) that lacks this domain did not. In addition, a protein with a complete deletion of the N-terminal region failed to interact with IE1. These results suggest that the ORF8 N-terminal region containing the coiled-coil domain is required for the interaction with IE1. Next, whether IE1 plays a role in ORF8 localization was investigated. In the presence of IE1, GFP-ORF8 localized to the nucleus. In addition, cotransfection with a plasmid expressing IE1 and a plasmid containing the hr3 element resulted in nuclear foci formation. A GFP-fused ORF8 mutant protein containing the coiled-coil domain, previously shown to interact with IE1, also formed nuclear foci in the presence of IE1 and hr3. However, ORF8 mutant proteins that did not interact with IE1 failed to form nuclear foci. In contrast to wild-type IE1, focus formation was not observed for an IE1 mutant protein that was deficient in hr binding. These results suggest that IE1 and hr facilitate the localization of BmNPV ORF8 to specific nuclear sites.
Yao, Kun; Duan, Zejun; Hu, Zeliang; Bian, Yu; Qi, Xueling
2014-10-01
To correlate the presence of chromosome 1p/19q deletion with the expression of R132H mutant IDH1 status in oligodendroglial tumors, and to explore molecular markers for predicting chemosensitivity of oligodendroglial tumors. The study included 75 oligodendroglial tumors (38 oligodendrogliomas and 37 oligoastrocytomas). Immunohistochemistry was used to detect the expression of R132H mutant IDH1 protein, and fluorescence in situ hybridization (FISH) was employed to detect 1p/19q deletion. Deletion of chromosome 1p and/or 19q was detected in 37 cases (37/75, 49.3%), among which co-deletion of 1p and 19q was seen in 34 cases (closely correlated, P < 0.01). Oligodendrogliomas WHOIIhad a slightly higher deletion rate than oligodendrogliomas WHO III, although without statistical significance. Oligodendrogliomas WHO IIand WHO III had a significantly higher deletion rate of chromosome 1p/19q than oligoastrocytomas WHO II and WHO III (P < 0.05). While combined loss of 1p/19q was always detected in oligodendrogliomas when FISH was positive, isolated 1p or 19q deletion was only found in oligoastrocytomas. The expression of R132H mutant IDH1 was detected in 51 of 75 cases (68.0%), in which oligodendrogliomas had a higher positive rate than oligoastrocytomas. Statistical analysis demonstrated a significant correlation between the expression of R132H mutant IDH1 protein and the presence of combined 1p/19q deletion in oligodendrogliomas (P < 0.05). A significant correlation was observed between the expression of R132H mutant protein and 1p/19q LOH.Expression of 132H mutant IDH1 protein is the potential biomarker for predicating the presence of 1p/19q deletion in oligodendrogliomas.
Coustou, Virginie; Besteiro, Sébastien; Rivière, Loïc; Biran, Marc; Biteau, Nicolas; Franconi, Jean-Michel; Boshart, Michael; Baltz, Théo; Bringaud, Frédéric
2005-04-29
Trypanosoma brucei is a parasitic protist responsible for sleeping sickness in humans. The procyclic stage of T. brucei expresses a soluble NADH-dependent fumarate reductase (FRDg) in the peroxisome-like organelles called glycosomes. This enzyme is responsible for the production of about 70% of the excreted succinate, the major end product of glucose metabolism in this form of the parasite. Here we functionally characterize a new gene encoding FRD (FRDm1) expressed in the procyclic stage. FRDm1 is a mitochondrial protein, as evidenced by immunolocalization, fractionation of digitonin-permeabilized cells, and expression of EGFP-tagged FRDm1 in the parasite. RNA interference was used to deplete FRDm1, FRDg, or both together. The analysis of the resulting mutant cell lines showed that FRDm1 is responsible for 30% of the cellular NADH-FRD activity, which solves a long standing debate regarding the existence of a mitochondrial FRD in trypanosomatids. FRDg and FRDm1 together account for the total NADH-FRD activity in procyclics, because no activity was measured in the double mutant lacking expression of both proteins. Analysis of the end products of 13C-enriched glucose excreted by these mutant cell lines showed that FRDm1 contributes to the production of between 14 and 44% of the succinate excreted by the wild type cells. In addition, depletion of one or both FRD enzymes results in up to 2-fold reduction of the rate of glucose consumption. We propose that FRDm1 is involved in the maintenance of the redox balance in the mitochondrion, as proposed for the ancestral soluble FRD presumably present in primitive anaerobic cells.
Fujita, H; Okada, F; Hamada , J; Hosokawa, M; Moriuchi, T; Koya, R C; Kuzumaki, N
2001-09-01
Gelsolin, an actin-binding protein, is implicated as a critical regulator in cell motility. In addition, we have reported that cellular levels of gelsolin are decreased in various tumor cells, and overexpression of gelsolin by gene transfer suppresses tumorigenicity. We sought to assess the effects of gelsolin overexpression on metastasis and to determine the importance of a carboxyl-terminus that confers Ca(2+) dependency on gelsolin for effects of its overexpression. Expression vectors with cDNA encoding either full-length wild-type or His321 mutant form, isolated from a flat revertant of Ras-transformed cells and a carboxyl-terminal truncate, C-del of gelsolin, were transfected into a highly metastatic murine melanoma cell line, B16-BL6. Expression of introduced cDNA in transfectants was confirmed using Western blotting, 2-dimensional gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR). We characterized phenotypes of transfectants, such as growth rate, colony formation in soft agar, cell motility and metastasis formation in vivo. Transfectants expressing the wild-type, His321 mutant and C-del gelsolin exhibited reduced growth ability in soft agar. Although expression of integrin beta1 or alpha4 on the cell surface of transfectants was not changed, wild-type and His321 mutant gelsolin, except for C-del gelsolin, exhibited retardation of cell spreading, reduced chemotatic migration to fibronectin and suppressed lung colonization in spontaneous metastasis assay. Gelsolin may function as a metastasis suppressor as well as a tumor suppressor gene. The carboxyl-terminus of gelsolin is important for retardation of cell spreading, reduced chemotasis and metastasis suppression. Copyright 2001 Wiley-Liss, Inc.
Górska-Andrzejak, Jolanta; Chwastek, Elżbieta M; Walkowicz, Lucyna; Witek, Kacper
2018-01-01
We show that the level of the core protein of the circadian clock Period (PER) expressed by glial peripheral oscillators depends on their location in the Drosophila optic lobe. It appears to be controlled by the ventral lateral neurons (LNvs) that release the circadian neurotransmitter Pigment Dispersing Factor (PDF). We demonstrate that glial cells of the distal medulla neuropil (dMnGl) that lie in the vicinity of the PDF-releasing terminals of the LNvs possess receptors for PDF (PDFRs) and express PER at significantly higher level than other types of glia. Surprisingly, the amplitude of PER molecular oscillations in dMnGl is increased twofold in PDF-free environment, that is in Pdf 0 mutants. The Pdf 0 mutants also reveal an increased level of glia-specific protein REPO in dMnGl. The photoreceptors of the compound eye (R-cells) of the PDF-null flies, on the other hand, exhibit de-synchrony of PER molecular oscillations, which manifests itself as increased variability of PER-specific immunofluorescence among the R-cells. Moreover, the daily pattern of expression of the presynaptic protein Bruchpilot (BRP) in the lamina terminals of the R-cells is changed in Pdf 0 mutant. Considering that PDFRs are also expressed by the marginal glia of the lamina that surround the R-cell terminals, the LNv pacemakers appear to be the likely modulators of molecular cycling in the peripheral clocks of both the glial cells and the photoreceptors of the compound eye. Consequently, some form of PDF-based coupling of the glial clocks and the photoreceptors of the eye with the central LNv pacemakers must be operational.
Górska-Andrzejak, Jolanta; Chwastek, Elżbieta M.; Walkowicz, Lucyna; Witek, Kacper
2018-01-01
We show that the level of the core protein of the circadian clock Period (PER) expressed by glial peripheral oscillators depends on their location in the Drosophila optic lobe. It appears to be controlled by the ventral lateral neurons (LNvs) that release the circadian neurotransmitter Pigment Dispersing Factor (PDF). We demonstrate that glial cells of the distal medulla neuropil (dMnGl) that lie in the vicinity of the PDF-releasing terminals of the LNvs possess receptors for PDF (PDFRs) and express PER at significantly higher level than other types of glia. Surprisingly, the amplitude of PER molecular oscillations in dMnGl is increased twofold in PDF-free environment, that is in Pdf0 mutants. The Pdf0 mutants also reveal an increased level of glia-specific protein REPO in dMnGl. The photoreceptors of the compound eye (R-cells) of the PDF-null flies, on the other hand, exhibit de-synchrony of PER molecular oscillations, which manifests itself as increased variability of PER-specific immunofluorescence among the R-cells. Moreover, the daily pattern of expression of the presynaptic protein Bruchpilot (BRP) in the lamina terminals of the R-cells is changed in Pdf0 mutant. Considering that PDFRs are also expressed by the marginal glia of the lamina that surround the R-cell terminals, the LNv pacemakers appear to be the likely modulators of molecular cycling in the peripheral clocks of both the glial cells and the photoreceptors of the compound eye. Consequently, some form of PDF-based coupling of the glial clocks and the photoreceptors of the eye with the central LNv pacemakers must be operational. PMID:29615925
Zhou, Bin; Xie, Jingyi; Liu, Xiaokai; Wang, Bin; Pan, Li
2016-11-15
HacA is a conserved basic leucine zipper transcription factor that serves as the master transcriptional regulator in the unfolded protein response (UPR). To comprehensively evaluate the role of HacA in Aspergillus oryzae, a homokaryotic hacA disruption mutant (HacA-DE) and a strain that expressed a constitutively active form of HacA (HacA-CA) were successfully generated, and transcriptome analyses of these mutants were performed. Growth and phenotypic profiles demonstrated that hyphal growth and sporulation were impaired in the HacA-DE and HacA-CA strains that were grown on complete and minimal media, and the growth impairment was more pronounced for the HacA-CA strain. Compared with a wild-type (WT) strain, the transcriptome results indicated that differentially expressed genes in these mutants mainly fell into four categories: the protein secretory pathway, amino acid metabolism, lipid metabolism, and carbohydrate metabolism. Furthermore, we identified 80 and 36 genes of the secretory pathway whose expression significantly differed in the HacA-CA strain (compared with the WT and HacA-DE strains) and HacA-DE strain (compared with the WT strain), respectively, which mostly belonged to protein folding/UPR, glycosylation, and vesicle transport processes. Both the HacA-CA and HacA-DE strains exhibited reduced expression of extracellular enzymes, especially amylolytic enzymes, which resulted from the activation of the repression under secretion stress mechanism in response to endoplasmic reticulum stress. Collectively, our results suggest that the function of HacA is important not only for UPR induction, but also for growth and fungal physiology, as it serves to reduce secretion stress in A. oryzae. Copyright © 2016 Elsevier B.V. All rights reserved.
Veltmaat, Jacqueline M; Relaix, Frédéric; Le, Lendy T; Kratochwil, Klaus; Sala, Frédéric G; van Veelen, Wendy; Rice, Ritva; Spencer-Dene, Bradley; Mailleux, Arnaud A; Rice, David P; Thiery, Jean Paul; Bellusci, Saverio
2006-06-01
Little is known about the regulation of cell fate decisions that lead to the formation of five pairs of mammary placodes in the surface ectoderm of the mouse embryo. We have previously shown that fibroblast growth factor 10 (FGF10) is required for the formation of mammary placodes 1, 2, 3 and 5. Here, we have found that Fgf10 is expressed only in the somites underlying placodes 2 and 3, in gradients across and within these somites. To test whether somitic FGF10 is required for the formation of these two placodes, we analyzed a number of mutants with different perturbations of somitic Fgf10 gradients for the presence of WNT signals and ectodermal multilayering, markers for mammary line and placode formation. The mammary line is displaced dorsally, and formation of placode 3 is impaired in Pax3ILZ/ILZ mutants, which do not form ventral somitic buds. Mammary line formation is impaired and placode 3 is absent in Gli3Xt-J/Xt-J and hypomorphic Fgf10 mutants, in which the somitic Fgf10 gradient is shortened dorsally and less overall Fgf10 is expressed, respectively. Recombinant FGF10 rescued mammogenesis in Fgf10(-/-) and Gli3Xt-J/Xt-J flanks. We correlate increasing levels of somitic FGF10 with progressive maturation of the surface ectoderm, and show that full expression of somitic Fgf10, co-regulated by GLI3, is required for the anteroposterior pattern in which the flank ectoderm acquires a mammary epithelial identity. We propose that the intra-somitic Fgf10 gradient, together with ventral elongation of the somites, determines the correct dorsoventral position of mammary epithelium along the flank.
Oh, Eun-Taex; Park, Moon-Taek; Choi, Bo-Hwa; Ro, Seonggu; Choi, Eun-Kyung; Jeong, Seong-Yun; Park, Heon Joo
2012-04-01
Histone deacetylase (HDAC) plays an important role in cancer onset and progression. Therefore, inhibition of HDAC offers potential as an effective cancer treatment regimen. CG200745, (E)-N(1)-(3-(dimethylamino)propyl)-N(8)-hydroxy-2-((naphthalene-1-loxy)methyl)oct-2-enediamide, is a novel HDAC inhibitor presently undergoing a phase I clinical trial. Enhancement of p53 acetylation by HDAC inhibitors induces cell cycle arrest, differentiation, and apoptosis in cancer cells. The purpose of the present study was to investigate the role of p53 acetylation in the cancer cell death caused by CG200745. CG200745-induced clonogenic cell death was 2-fold greater in RKO cells expressing wild-type p53 than in p53-deficient RC10.1 cells. CG200745 treatment was also cytotoxic to PC-3 human prostate cancer cells, which express wild-type p53. CG200745 increased acetylation of p53 lysine residues K320, K373, and K382. CG200745 induced the accumulation of p53, promoted p53-dependent transactivation, and enhanced the expression of MDM2 and p21(Waf1/Cip1) proteins, which are encoded by p53 target genes. An examination of CG200745 effects on p53 acetylation using cells transfected with various p53 mutants showed that cells expressing p53 K382R mutants were significantly resistant to CG200745-induced clonogenic cell death compared with wild-type p53 cells. Moreover, p53 transactivation in response to CG200745 was suppressed in all cells carrying mutant forms of p53, especially K382R. Taken together, these results suggest that acetylation of p53 at K382 plays an important role in CG200745-induced p53 transactivation and clonogenic cell death.
Interaction of herpes simplex virus glycoprotein gC with mammalian cell surface molecules.
Tal-Singer, R; Peng, C; Ponce De Leon, M; Abrams, W R; Banfield, B W; Tufaro, F; Cohen, G H; Eisenberg, R J
1995-01-01
The entry of herpes simplex virus (HSV) into mammalian cells is a multistep process beginning with an attachment step involving glycoproteins gC and gB. A second step requires the interaction of glycoprotein gD with a cell surface molecule. We explored the interaction between gC and the cell surface by using purified proteins in the absence of detergent. Truncated forms of gC and gD, gC1(457t), gC2(426t), and gD1(306t), lacking the transmembrane and carboxyl regions were expressed in the baculovirus system. We studied the ability of these proteins to bind to mammalian cells, to bind to immobilized heparin, to block HSV type 1 (HSV-1) attachment to cells, and to inhibit plaque formation by HSV-1. Each of these gC proteins bound to conformation-dependent monoclonal antibodies and to human complement component C3b, indicating that they maintained the same conformation of gC proteins expressed in mammalian cells. Biotinylated gC1(457t) and gC2(426t) each bind to several cell lines. Binding was inhibited by an excess of unlabeled gC but not by gD, indicating specificity. The attachment of gC to cells involves primarily heparan sulfate proteoglycans, since heparitinase treatment of cells reduced gC binding by 50% but had no effect on gD binding. Moreover, binding of gC to two heparan sulfate-deficient L-cell lines, gro2C and sog9, both of which are mostly resistant to HSV infection, was markedly reduced. Purified gD1 (306t), however, bound equally well to the two mutant cell lines. In contrast, saturating amounts of gC1(457t) interfered with HSV-1 attachment to cells but failed to block plaque formation, suggesting a role for gC in attachment but not penetration. A mutant form of gC lacking residues 33 to 123, gC1(delta 33-123t), expressed in the baculovirus system, bound significantly less well to cells than did gC1(457t) and competed poorly with biotinylated gC1(457t) for binding. These results suggest that residues 33 to 123 are important for gC attachment to cells. In contrast, both the mutant and wild-type forms of gC bound to immobilized heparin, indicating that binding of these proteins to the cell surface involves more than a simple interaction with heparin. To determine that the contribution of the N-terminal region of gC is important for HSV attachment, we compared several properties of a mutant HSV-1 which contains gC lacking amino acids 33 to 123 to those of its parental virus, which contains full-length gC. The mutant bound less well to cells than the parental virus but exhibited normal growth properties.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:7769707
The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses.
Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G
2002-07-01
Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants.
φX-174 Bacteriophage Structural Mutants Which Affect Deoxyribonucleic Acid Synthesis
Siegel, Jeff E. D.; Hayashi, Masaki
1969-01-01
Seven cistrons in φX-174 were identified and one in particular was studied intensively: cistron A, which is assigned a protein in the mature phage. Amber mutants in this cistron synthesize a new deoxyribonucleic acid (DNA) form in addition to circular phage DNA upon infection of the restrictive host. This DNA is linear, non-infectious, and single-stranded; it is formed from the phage strand of replicative form φX-174 DNA. These mutants produce two different defective particles in the restrictive host. One particle contains circular phage DNA but is not infectious; the other contains the new DNA form and is similar to the 70S particles found in wild-type phage lysates. The mutant A gene product acts independently of normal A protein upon mixed infection of the restrictive host with an A mutant and a mutant from any other cistron or wild type. PMID:5823229
Csf3r mutations in mice confer a strong clonal HSC advantage via activation of Stat5
Liu, Fulu; Kunter, Ghada; Krem, Maxwell M.; Eades, William C.; Cain, Jennifer A.; Tomasson, Michael H.; Hennighausen, Lothar; Link, Daniel C.
2008-01-01
A fundamental property of leukemic stem cells is clonal dominance of the bone marrow microenvironment. Truncation mutations of CSF3R, which encodes the G-CSF receptor (G-CSFR), are implicated in leukemic progression in patients with severe congenital neutropenia. Here we show that expression of a truncated mutant Csf3r in mice confers a strong clonal advantage at the HSC level that is dependent upon exogenous G-CSF. G-CSF–induced proliferation, phosphorylation of Stat5, and transcription of Stat5 target genes were increased in HSCs isolated from mice expressing the mutant Csf3r. Conversely, the proliferative advantage conferred by the mutant Csf3r was abrogated in myeloid progenitors lacking both Stat5A and Stat5B, and HSC function was reduced in mice expressing a truncated mutant Csf3r engineered to have impaired Stat5 activation. These data indicate that in mice, inappropriate Stat5 activation plays a key role in establishing clonal dominance by stem cells expressing mutant Csf3r. PMID:18292815
Analysis of Distinct Roles of CaMKK Isoforms Using STO-609-Resistant Mutants in Living Cells.
Fujiwara, Yuya; Hiraoka, Yuri; Fujimoto, Tomohito; Kanayama, Naoki; Magari, Masaki; Tokumitsu, Hiroshi
2015-06-30
To assess the isoform specificity of the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK)-mediated signaling pathway using a CaMKK inhibitor (STO-609) in living cells, we have established A549 cell lines expressing STO-609-resistant mutants of CaMKK isoforms. Following serial mutagenesis studies, we have succeeded in obtaining an STO-609-resistant CaMKKα mutant (Ala292Thr/Leu233Phe) and a CaMKKβ mutant (Ala328Thr/Val269Phe), which showed sensitivity to STO-609 that was 2-3 orders of magnitude lower without an appreciable effect on kinase activity or CaM requirement. These results are consistent with the results obtained for CaMKK activities in the extracts of A549 cells stably expressing the mutants of CaMKK isoforms. Ionomycin-induced 5'-AMP-activated protein kinase (AMPK) phosphorylation at Thr172 in A549 cells expressing either the wild-type or the STO-609-resistant mutant of CaMKKα was completely suppressed by STO-609 treatment but resistant to the inhibitor in the presence of the CaMKKβ mutant (Ala328Thr/Val269Phe). This result strongly suggested that CaMKKβ is responsible for ionomycin-induced AMPK activation, which supported previous reports. In contrast, ionomycin-induced CaMKIV phosphorylation at Thr196 was resistant to STO-609 treatment in A549 cells expressing STO-609-resistant mutants of both CaMKK isoforms, indicating that both CaMKK isoforms are capable of phosphorylating and activating CaMKIV in living cells. Considering these results together, STO-609-resistant CaMKK mutants developed in this study may be useful for distinguishing CaMKK isoform-mediated signaling pathways in combination with the use of an inhibitor compound.
Furumoto, T A; Miura, N; Akasaka, T; Mizutani-Koseki, Y; Sudo, H; Fukuda, K; Maekawa, M; Yuasa, S; Fu, Y; Moriya, H; Taniguchi, M; Imai, K; Dahl, E; Balling, R; Pavlova, M; Gossler, A; Koseki, H
1999-06-01
During axial skeleton development, the notochord is essential for the induction of the sclerotome and for the subsequent differentiation of cartilage forming the vertebral bodies and intervertebral discs. These functions are mainly mediated by the diffusible signaling molecule Sonic hedgehog. The products of the paired-box-containing Pax1 and the mesenchyme forkhead-1 (Mfh1) genes are expressed in the developing sclerotome and are essential for the normal development of the vertebral column. Here, we demonstrate that Mfh1 like Pax1 expression is dependent on Sonic hedgehog signals from the notochord, and Mfh1 and Pax1 act synergistically to generate the vertebral column. In Mfh1/Pax1 double mutants, dorsomedial structures of the vertebrae are missing, resulting in extreme spina bifida accompanied by subcutaneous myelomeningocoele, and the vertebral bodies and intervertebral discs are missing. The morphological defects in Mfh1/Pax1 double mutants strongly correlate with the reduction of the mitotic rate of sclerotome cells. Thus, both the Mfh1 and the Pax1 gene products cooperate to mediate Sonic hedgehog-dependent proliferation of sclerotome cells. Copyright 1999 Academic Press.
Uptake and effect of rare earth elements on gene expression in Methylosinus trichosporium OB3b
Gu, Wenyu; Farhan Ul Haque, Muhammad; DiSpirito, Alan A.; ...
2016-05-12
It is well-known that M. trichosporium OB3b has two forms of methane monooxygenase responsible for the initial conversion of methane to methanol, a cytoplasmic (soluble) methane monooxygenase (sMMO) and a membrane-associated (particulate) methane monooxygenase (pMMO) and that copper strongly regulates expression of these alternative forms of MMO. More recently, it has been discovered that M. trichosporium OB3b has multiple types of the methanol dehydrogenase (MeDH), i.e. the Mxa-MeDH and Xox-MeDH, and the expression of these two forms is regulated by the availability of the rare earth element, cerium. Here we extend these studies and show that lanthanum, praseodymium, neodymium andmore » samarium also regulate expression of alternative forms of MeDH. The effect of these rare earth elements on MeDH expression, however, was only observed in the absence of copper. Further, a mutant of M. trichosporium OB3b where the Mxa-MeDH was knocked out was able to grow in the presence of lanthanum, praseodymium and neodymium, but was not able to grow in the presence of samarium. In conclusion, collectively these data suggest that multiple levels of gene regulation by metals exist in M. trichosporium OB3b but that copper overrides the effect of other metals by an as yet unknown mechanism.« less
AmyR Is a Novel Negative Regulator of Amylovoran Production in Erwinia amylovora
Wang, Dongping; Korban, Schuyler S.; Pusey, P. Lawrence; Zhao, Youfu
2012-01-01
In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora. PMID:23028751
AmyR is a novel negative regulator of amylovoran production in Erwinia amylovora.
Wang, Dongping; Korban, Schuyler S; Pusey, P Lawrence; Zhao, Youfu
2012-01-01
In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora.
Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto
2015-01-01
Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. PMID:25511432
Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish
2014-01-01
MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095
Of channels and pumps: different ways to boost the aldosterone?
Bandulik, S
2017-07-01
The mineralocorticoid aldosterone is a major factor controlling the salt and water balance and thereby also the arterial blood pressure. Accordingly, primary aldosteronism (PA) characterized by an inappropriately high aldosterone secretion is the most common form of secondary hypertension. The physiological stimulation of aldosterone synthesis in adrenocortical glomerulosa cells by angiotensin II and an increased plasma K + concentration depends on a membrane depolarization and an increase in the cytosolic Ca 2+ activity. Recurrent gain-of-function mutations of ion channels and transporters have been identified in a majority of cases of aldosterone-producing adenomas and in familial forms of PA. In this review, the physiological role of these genes in the regulation of aldosterone synthesis and the altered function of the mutant proteins as well are described. The specific changes of the membrane potential and the cellular ion homoeostasis in adrenal cells expressing the different mutants are compared, and their impact on autonomous aldosterone production and proliferation is discussed. © 2016 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.
Normal Collagen and Bone Production by Gene-targeted Human Osteogenesis Imperfecta iPSCs
Deyle, David R; Khan, Iram F; Ren, Gaoying; Wang, Pei-Rong; Kho, Jordan; Schwarze, Ulrike; Russell, David W
2012-01-01
Osteogenesis imperfecta (OI) is caused by dominant mutations in the type I collagen genes. In principle, the skeletal abnormalities of OI could be treated by transplantation of patient-specific, bone-forming cells that no longer express the mutant gene. Here, we develop this approach by isolating mesenchymal cells from OI patients, inactivating their mutant collagen genes by adeno-associated virus (AAV)-mediated gene targeting, and deriving induced pluripotent stem cells (iPSCs) that were expanded and differentiated into mesenchymal stem cells (iMSCs). Gene-targeted iMSCs produced normal collagen and formed bone in vivo, but were less senescent and proliferated more than bone-derived MSCs. To generate iPSCs that would be more appropriate for clinical use, the reprogramming and selectable marker transgenes were removed by Cre recombinase. These results demonstrate that the combination of gene targeting and iPSC derivation can be used to produce potentially therapeutic cells from patients with genetic disease. PMID:22031238
Functional Characterization of CaVα2δ Mutations Associated with Sudden Cardiac Death*
Bourdin, Benoîte; Shakeri, Behzad; Tétreault, Marie-Philippe; Sauvé, Rémy; Lesage, Sylvie; Parent, Lucie
2015-01-01
L-type Ca2+ channels play a critical role in cardiac rhythmicity. These ion channels are oligomeric complexes formed by the pore-forming CaVα1 with the auxiliary CaVβ and CaVα2δ subunits. CaVα2δ increases the peak current density and improves the voltage-dependent activation gating of CaV1.2 channels without increasing the surface expression of the CaVα1 subunit. The functional impact of genetic variants of CACNA2D1 (the gene encoding for CaVα2δ), associated with shorter repolarization QT intervals (the time interval between the Q and the T waves on the cardiac electrocardiogram), was investigated after recombinant expression of the full complement of L-type CaV1.2 subunits in human embryonic kidney 293 cells. By performing side-by-side high resolution flow cytometry assays and whole-cell patch clamp recordings, we revealed that the surface density of the CaVα2δ wild-type protein correlates with the peak current density. Furthermore, the cell surface density of CaVα2δ mutants S755T, Q917H, and S956T was not significantly different from the cell surface density of the CaVα2δ wild-type protein expressed under the same conditions. In contrast, the cell surface expression of CaVα2δ D550Y, CaVα2δ S709N, and the double mutant D550Y/Q917H was reduced, respectively, by ≈30–33% for the single mutants and by 60% for the latter. The cell surface density of D550Y/Q917H was more significantly impaired than protein stability, suggesting that surface trafficking of CaVα2δ was disrupted by the double mutation. Co-expression with D550Y/Q917H significantly decreased CaV1.2 currents as compared with results obtained with CaVα2δ wild type. It is concluded that D550Y/Q917H reduced inward Ca2+ currents through a defect in the cell surface trafficking of CaVα2δ. Altogether, our results provide novel insight in the molecular mechanism underlying the modulation of CaV1.2 currents by CaVα2δ. PMID:25527503
Lee, Bheong-Uk; Choi, Moon-Seop; Oh, Kye-Heon
2015-01-01
Pseudomonas sp. HK-6 is able to utilize RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) as its sole nitrogen source. The role of the xenB gene, encoding xenobiotic reductase B, was investigated using HK-6 xenB knockout mutants. The xenB mutant degraded RDX to a level that was 10-fold less than that obtained with the wild-type HK-6 strain. After 60 days of culture with 25 or 50 μM RDX, no residual RDX was detected in the supernatants of the wild-type aerobically grown cultures, whereas approximately 90 % of the RDX remained in the xenB mutant cultures. The xenB mutant bacteria exhibited a 10(2)-10(4)-fold decrease in survival rate compared to the wild-type. The expression of DnaK and GroEL proteins, two typical stress shock proteins (SSPs), in the xenB mutant increased after immediate exposure to RDX, yet dramatically decreased after 4 h of exposure. In addition, DnaK and GroEL were more highly expressed in the cultures with 25 μM RDX in the medium but showed low expression in the cultures with 50 or 75 μM RDX. The expression levels of the dnaK and groEL genes measured by RT-qPCR were also much lower in the xenB genetic background. Analyses of the proteomes of the HK-6 and xenB mutant cells grown under conditions of RDX stress showed increased induction of several proteins, such as Alg8, alginate biosynthesis sensor histidine kinase, and OprH in the xenB mutants when compared to wild-type. However, many proteins, including two SSPs (DnaK and GroEL) and proteins involved in metabolism, exhibited lower expression levels in the xenB mutant than in the wild-type HK-6 strain. The xenB knockout mutation leads to reduced RDX degradation ability, which renders the mutant more sensitive to RDX stress and results in a lower survival rate and an altered proteomic profile under RDX stress.
Bin, Bum-Ho; Hojyo, Shintaro; Hosaka, Toshiaki; Bhin, Jinhyuk; Kano, Hiroki; Miyai, Tomohiro; Ikeda, Mariko; Kimura-Someya, Tomomi; Shirouzu, Mikako; Cho, Eun-Gyung; Fukue, Kazuhisa; Kambe, Taiho; Ohashi, Wakana; Kim, Kyu-Han; Seo, Juyeon; Choi, Dong-Hwa; Nam, Yeon-Ju; Hwang, Daehee; Fukunaka, Ayako; Fujitani, Yoshio; Yokoyama, Shigeyuki; Superti-Furga, Andrea; Ikegawa, Shiro; Lee, Tae Ryong; Fukada, Toshiyuki
2014-01-01
The zinc transporter protein ZIP13 plays critical roles in bone, tooth, and connective tissue development, and its dysfunction is responsible for the spondylocheirodysplastic form of Ehlers-Danlos syndrome (SCD-EDS, OMIM 612350). Here, we report the molecular pathogenic mechanism of SCD-EDS caused by two different mutant ZIP13 proteins found in human patients: ZIP13G64D, in which Gly at amino acid position 64 is replaced by Asp, and ZIP13ΔFLA, which contains a deletion of Phe-Leu-Ala. We demonstrated that both the ZIP13G64D and ZIP13ΔFLA protein levels are decreased by degradation via the valosin-containing protein (VCP)-linked ubiquitin proteasome pathway. The inhibition of degradation pathways rescued the protein expression levels, resulting in improved intracellular Zn homeostasis. Our findings uncover the pathogenic mechanisms elicited by mutant ZIP13 proteins. Further elucidation of these degradation processes may lead to novel therapeutic targets for SCD-EDS. PMID:25007800
NASA Astrophysics Data System (ADS)
Steidl, Rebecca J.; Lampa-Pastirk, Sanela; Reguera, Gemma
2016-08-01
Electricity generation by Geobacter sulfurreducens biofilms grown on electrodes involves matrix-associated electron carriers, such as c-type cytochromes. Yet, the contribution of the biofilm's conductive pili remains uncertain, largely because pili-defective mutants also have cytochrome defects. Here we report that a pili-deficient mutant carrying an inactivating mutation in the pilus assembly motor PilB has no measurable defects in cytochrome expression, yet forms anode biofilms with reduced electroactivity and is unable to grow beyond a threshold distance (~10 μm) from the underlying electrode. The defects are similar to those of a Tyr3 mutant, which produces poorly conductive pili. The results support a model in which the conductive pili permeate the biofilms to wire the cells to the conductive biofilm matrix and the underlying electrode, operating coordinately with cytochromes until the biofilm reaches a threshold thickness that limits the efficiency of the cytochrome pathway but not the functioning of the conductive pili network.
ESR1 ligand binding domain mutations in hormone-resistant breast cancer
Toy, Weiyi; Shen, Yang; Won, Helen; Green, Bradley; Sakr, Rita A.; Will, Marie; Li, Zhiqiang; Gala, Kinisha; Fanning, Sean; King, Tari A.; Hudis, Clifford; Chen, David; Taran, Tetiana; Hortobagyi, Gabriel; Greene, Geoffrey; Berger, Michael; Baselga, Jose; Chandarlapaty, Sarat
2013-01-01
Seventy percent of breast cancers express estrogen receptor (ER) and most of these are sensitive to ER inhibition. However, many such tumors become refractory to inhibition of estrogen action in the metastatic setting for unknown reasons. We conducted a comprehensive genetic analysis of two independent cohorts of metastatic ER+ breast tumors and identified mutations in the ligand binding domain (LBD) of ESR1 in 14/80 cases. These included highly recurrent mutations p.Tyr537Ser/Asn and p.Asp538Gly. Molecular dynamics simulations suggest the Tyr537Ser and Asp538Gly structures lead to hydrogen bonding of the mutant amino acid with Asp351, thus favoring the receptor’s agonist conformation. Consistent with this model, mutant receptors drive ER-dependent transcription and proliferation in the absence of hormone and reduce the efficacy of ER antagonists. These data implicate LBD mutant forms of ER in mediating clinical resistance to hormonal therapy and suggest that more potent ER antagonists may have significant therapeutic benefit. PMID:24185512
Leaños-Miranda, Alfredo; Ulloa-Aguirre, Alfredo; Ji, Tae H; Janovick, Jo Ann; Conn, P Michael
2003-07-01
Loss of function by 11 of 13 naturally occurring mutations in the human GnRH receptor (hGnRHR) was thought to result from impaired ligand binding or effector coupling, but actually results from receptor misrouting. Homo- or heterodimerization of mutant receptors with wild-type (WT) receptors occurs for other G protein-coupled receptors and may result in dominant-negative or -positive effects on the WT receptor. We tested the hypothesis that WT hGnRHR function was affected by misfolded hGnRHR mutants. hGnRHR mutants were found to inhibit the function of WT GnRHR (measured by activation of effector and ligand binding). Inhibition varied depending on the particular hGnRHR mutant coexpressed and the ratio of hGnRHR mutant to WT hGnRHR cDNA cotransfected. The hGnRHR mutants did not interfere with the function of genetically modified hGnRHRs bearing either a deletion of primate-specific Lys(191) or the carboxyl-terminal tail of the catfish GnRHR; these show intrinsically enhanced expression. Moreover, a peptidomimetic antagonist of GnRH enhanced the expression of WT hGnRHR, but not of genetically modified hGnRHR species. The dominant-negative effect of the naturally occurring receptor mutants occurred only for the WT hGnRHR, which has intrinsic low maturation efficiency. The data suggest that this dominant negative effect accompanies the diminished plasma membrane expression as a recent evolutionary event.
Tung, Ying-Tsen; Hsu, Wen-Ming; Lee, Hsinyu; Huang, Wei-Pang; Liao, Yung-Feng
2010-07-01
Mammalian p62/sequestosome-1 protein binds to both LC3, the mammalian homologue of yeast Atg8, and polyubiquitinated cargo proteins destined to undergo autophagy-mediated degradation. We previously identified a cargo receptor-binding domain in Atg8 that is essential for its interaction with the cargo receptor Atg19 in selective autophagic processes in yeast. We, thus, sought to determine whether this interaction is evolutionally conserved from yeast to mammals. Using an amino acid replacement approach, we demonstrate that cells expressing mutant LC3 (LC3-K30D, LC3-K51A, or LC3-L53A) all exhibit defective lipidation of LC3, a disrupted LC3-p62 interaction, and impaired autophagic degradation of p62, suggesting that the p62-binding site of LC3 is localized within an evolutionarily conserved domain. Importantly, whereas cells expressing these LC3 mutants exhibited similar overall autophagic activity comparable to that of cells expressing wild-type LC3, autophagy-mediated clearance of the aggregation-prone mutant Huntingtin was defective in the mutant-expressing cells. Together, these results suggest that p62 directly binds to the evolutionarily conserved cargo receptor-binding domain of Atg8/LC3 and selectively mediates the clearance of mutant Huntingtin.
Comparative Study on Different Expression Hosts for Alkaline Phytase Engineered in Escherichia coli.
Chen, Weiwei; Yu, Hongwei; Ye, Lidan
2016-07-01
The application of alkaline phytase as a feed additive is restricted by the poor specific activity. Escherichia coli is a frequently used host for directed evolution of proteins including alkaline phytase towards improved activity. However, it is not suitable for production of food-grade products due to potential pathogenicity. To combine the advantages of different expression systems, mutants of the alkaline phytase originated from Bacillus subtilis 168 (phy168) were first generated via directed evolution in E. coli and then transformed to food-grade hosts B. subtilis and Pichia pastoris for secretory expression. In order to investigate the suitability of different expression systems, the phy168 mutants expressed in different hosts were characterized and compared in terms of specific activity, pH profile, pH stability, temperature profile, and thermostability. The specific activity of B. subtilis-expressed D24G/K70R/K111E/N121S mutant at pH 7.0 and 60 °C was 30.4 U/mg, obviously higher than those in P. pastoris (22.7 U/mg) and E. coli (19.7 U/mg). Moreover, after 10 min incubation at 80 °C, the B. subtilis-expressed D24G/K70R/K111E/N121S retained about 70 % of the activity at pH 7.0 and 37 °C, whereas the values were only about 25 and 50 % when expressed in P. pastoris and E. coli, respectively. These results suggested B. subtilis as an appropriate host for expression of phy168 mutants and that the strategy of creating mutants in one host and expressing them in another might be a new solution to industrial production of proteins with desired properties.
Probing transcription-specific outputs of β-catenin in vivo.
Valenta, Tomas; Gay, Max; Steiner, Sarah; Draganova, Kalina; Zemke, Martina; Hoffmans, Raymond; Cinelli, Paolo; Aguet, Michel; Sommer, Lukas; Basler, Konrad
2011-12-15
β-Catenin, apart from playing a cell-adhesive role, is a key nuclear effector of Wnt signaling. Based on activity assays in Drosophila, we generated mouse strains where the endogenous β-catenin protein is replaced by mutant forms, which retain the cell adhesion function but lack either or both of the N- and the C-terminal transcriptional outputs. The C-terminal activity is essential for mesoderm formation and proper gastrulation, whereas N-terminal outputs are required later during embryonic development. By combining the double-mutant β-catenin with a conditional null allele and a Wnt1-Cre driver, we probed the role of Wnt/β-catenin signaling in dorsal neural tube development. While loss of β-catenin protein in the neural tube results in severe cell adhesion defects, the morphology of cells and tissues expressing the double-mutant form is normal. Surprisingly, Wnt/β-catenin signaling activity only moderately regulates cell proliferation, but is crucial for maintaining neural progenitor identity and for neuronal differentiation in the dorsal spinal cord. Our model animals thus allow dissecting signaling and structural functions of β-catenin in vivo and provide the first genetic tool to generate cells and tissues that entirely and exclusively lack canonical Wnt pathway activity. © 2011 by Cold Spring Harbor Laboratory Press
Hughes, James; Piltz, Sandra; Rogers, Nicholas; McAninch, Dale; Rowley, Lynn; Thomas, Paul
2013-01-01
Polyalanine expansions in transcription factors have been associated with eight distinct congenital human diseases. It is thought that in each case the polyalanine expansion causes misfolding of the protein that abrogates protein function. Misfolded proteins form aggregates when expressed in vitro; however, it is less clear whether aggregation is of relevance to these diseases in vivo. To investigate this issue, we used targeted mutagenesis of embryonic stem (ES) cells to generate mice with a polyalanine expansion mutation in Sox3 (Sox3-26ala) that is associated with X-linked Hypopituitarism (XH) in humans. By investigating both ES cells and chimeric mice, we show that endogenous polyalanine expanded SOX3 does not form protein aggregates in vivo but rather is present at dramatically reduced levels within the nucleus of mutant cells. Importantly, the residual mutant protein of chimeric embryos is able to rescue a block in gastrulation but is not sufficient for normal development of the hypothalamus, a region that is functionally compromised in Sox3 null embryos and individuals with XH. Together, these data provide the first definitive example of a disease-relevant PA mutant protein that is both nuclear and functional, thereby manifesting as a partial loss-of-function allele. PMID:23505376
KCNQ Channels Regulate Age-Related Memory Impairment
Cavaliere, Sonia; Malik, Bilal R.; Hodge, James J. L.
2013-01-01
In humans KCNQ2/3 heteromeric channels form an M-current that acts as a brake on neuronal excitability, with mutations causing a form of epilepsy. The M-current has been shown to be a key regulator of neuronal plasticity underlying associative memory and ethanol response in mammals. Previous work has shown that many of the molecules and plasticity mechanisms underlying changes in alcohol behaviour and addiction are shared with those of memory. We show that the single KCNQ channel in Drosophila (dKCNQ) when mutated show decrements in associative short- and long-term memory, with KCNQ function in the mushroom body α/βneurons being required for short-term memory. Ethanol disrupts memory in wildtype flies, but not in a KCNQ null mutant background suggesting KCNQ maybe a direct target of ethanol, the blockade of which interferes with the plasticity machinery required for memory formation. We show that as in humans, Drosophila display age-related memory impairment with the KCNQ mutant memory defect mimicking the effect of age on memory. Expression of KCNQ normally decreases in aging brains and KCNQ overexpression in the mushroom body neurons of KCNQ mutants restores age-related memory impairment. Therefore KCNQ is a central plasticity molecule that regulates age dependent memory impairment. PMID:23638087
Divinyl ether synthase gene and protein, and uses thereof
Howe, Gregg A [East Lansing, MI; Itoh, Aya [Tsuruoka, JP
2011-09-13
The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.
Divinyl ether synthase gene, and protein and uses thereof
Howe, Gregg A.; Itoh, Aya
2006-12-26
The present invention relates to divinyl ether synthase genes, proteins, and methods of their use. The present invention encompasses both native and recombinant wild-type forms of the synthase, as well as mutants and variant forms, some of which possess altered characteristics relative to the wild-type synthase. The present invention also relates to methods of using divinyl ether synthase genes and proteins, including in their expression in transgenic organisms and in the production of divinyl ether fatty acids, and to methods of suing divinyl ether fatty acids, including in the protection of plants from pathogens.
Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.
1993-01-01
Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274
Hoxb3 negatively regulates Hoxb1 expression in mouse hindbrain patterning.
Wong, Elaine Y M; Wang, Xing An; Mak, Siu Shan; Sae-Pang, Jearn Jang; Ling, Kam Wing; Fritzsch, Bernd; Sham, Mai Har
2011-04-15
The spatial regulation of combinatorial expression of Hox genes is critical for determining hindbrain rhombomere (r) identities. To address the cross-regulatory relationship between Hox genes in hindbrain neuronal specification, we have generated a gain-of-function transgenic mouse mutant Hoxb3(Tg) using the Hoxb2 r4-specific enhancer element. Interestingly, in r4 of the Hoxb3(Tg) mutant where Hoxb3 was ectopically expressed, the expression of Hoxb1 was specifically abolished. The hindbrain neuronal defects of the Hoxb3(Tg) mutant mice were similar to those of Hoxb1(-/-) mutants. Therefore, we hypothesized that Hoxb3 could directly suppress Hoxb1 expression. We first identified a novel Hoxb3 binding site S3 on the Hoxb1 locus and confirmed protein binding to this site by EMSA, and by in vivo ChIP analysis using P19 cells and hindbrain tissues from the Hoxb3(Tg) mutant. We further showed that Hoxb3 could suppress Hoxb1 transcriptional activity by chick in ovo luciferase reporter assay. Moreover, in E10.5 wildtype caudal hindbrain, where Hoxb1 is not expressed, we showed by in vivo ChIP that Hoxb3 was consistently bound to the S3 site on the Hoxb1 gene. This study reveals a novel negative regulatory mechanism by which Hoxb3 as a posterior gene serves to restrict Hoxb1 expression in r4 by direct transcriptional repression to maintain the rhombomere identity. Copyright © 2011 Elsevier Inc. All rights reserved.
Identification and analysis of novel genes involved in gravitropism of Arabidopsis thaliana.
NASA Astrophysics Data System (ADS)
Morita, Miyo T.; Tasaka, Masao; Masatoshi Taniguchi, .
2012-07-01
Gravitropism is a continuous control with regard to the orientation and juxtaposition of the various parts of the plant body in response to gravity. In higher plants, the relative directional change of gravity is mainly suscepted in specialized cells called statocytes, followed by signal conversion from physical information into physiological information within the statocytes. We have studied the early process of shoot gravitropism, gravity sensing and signaling process, mainly by molecular genetic approach. In Arabidopsis shoot, statocytes are the endodermal cells. sgr1/scarcrow (scr) and sgr7/short-root (shr) mutants fail to form the endodermis and to respond to gravity in their inflorescence stems. Since both SGR1/SCR and SGR7/SHR are transcriptional factors, at least a subset of their downstream genes can be expected to be involved in gravitropism. In addition, eal1 (endodermal-amyloplast less 1), which exhibits no gravitropism in inflorescence stem but retains ability to form endodermis, is a hypomorphic allele of sgr7/shr. Take advantage of these mutants, we performed DNA microarray analysis and compared gene expression profiles between wild type and the mutants. We found that approx. 40 genes were commonly down-regulated in these mutants and termed them DGE (DOWN-REGULATED GENE IN EAL1) genes. DGE1 has sequence similarity to Oryza sativa LAZY1 that is involved in shoot gravitropism of rice. DGE2 has a short region homologous to DGE1. DTL (DGE TWO-LIKE}) that has 54% identity to DGE2 is found in Arabidopsis genome. All three genes are conserved in angiosperm but have no known functional domains or motifs. We analyzed T-DNA insertion for these genes in single or multiple combinations. In dge1 dge2 dtl triple mutant, gravitropic response of shoot, hypocotyl and root dramatically reduced. Now we are carrying out further physiological and molecular genetic analysis of the triple mutant.
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-01-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the β clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25°C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25°C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42°C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25°C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25°C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway. PMID:18502852
Fujimitsu, Kazuyuki; Su'etsugu, Masayuki; Yamaguchi, Yoko; Mazda, Kensaku; Fu, Nisi; Kawakami, Hironori; Katayama, Tsutomu
2008-08-01
The chromosomal replication cycle is strictly coordinated with cell cycle progression in Escherichia coli. ATP-DnaA initiates replication, leading to loading of the DNA polymerase III holoenzyme. The DNA-loaded form of the beta clamp subunit of the polymerase binds the Hda protein, which promotes ATP-DnaA hydrolysis, yielding inactive ADP-DnaA. This regulation is required to repress overinitiation. In this study, we have isolated a novel cold-sensitive hda mutant, the hda-185 mutant. The hda-185 mutant caused overinitiation of chromosomal replication at 25 degrees C, which most likely led to blockage of replication fork progress. Consistently, the inhibition of colony formation at 25 degrees C was suppressed by disruption of the diaA gene, an initiation stimulator. Disruption of the seqA gene, an initiation inhibitor, showed synthetic lethality with hda-185 even at 42 degrees C. The cellular ATP-DnaA level was increased in an hda-185-dependent manner. The cellular concentrations of DnaA protein and dnaA mRNA were comparable at 25 degrees C to those in a wild-type hda strain. We also found that multiple copies of the ribonucleotide reductase genes (nrdAB or nrdEF) or dnaB gene repressed overinitiation. The cellular levels of dATP and dCTP were elevated in cells bearing multiple copies of nrdAB. The catalytic site within NrdA was required for multicopy suppression, suggesting the importance of an active form of NrdA or elevated levels of deoxyribonucleotides in inhibition of overinitiation in the hda-185 cells. Cell division in the hda-185 mutant was inhibited at 25 degrees C in a LexA regulon-independent manner, suggesting that overinitiation in the hda-185 mutant induced a unique division inhibition pathway.
Cell-type specific roles for PTEN in establishing a functional retinal architecture.
Cantrup, Robert; Dixit, Rajiv; Palmesino, Elena; Bonfield, Stephan; Shaker, Tarek; Tachibana, Nobuhiko; Zinyk, Dawn; Dalesman, Sarah; Yamakawa, Kazuhiro; Stell, William K; Wong, Rachel O; Reese, Benjamin E; Kania, Artur; Sauvé, Yves; Schuurmans, Carol
2012-01-01
The retina has a unique three-dimensional architecture, the precise organization of which allows for complete sampling of the visual field. Along the radial or apicobasal axis, retinal neurons and their dendritic and axonal arbors are segregated into layers, while perpendicular to this axis, in the tangential plane, four of the six neuronal types form patterned cellular arrays, or mosaics. Currently, the molecular cues that control retinal cell positioning are not well-understood, especially those that operate in the tangential plane. Here we investigated the role of the PTEN phosphatase in establishing a functional retinal architecture. In the developing retina, PTEN was localized preferentially to ganglion, amacrine and horizontal cells, whose somata are distributed in mosaic patterns in the tangential plane. Generation of a retina-specific Pten knock-out resulted in retinal ganglion, amacrine and horizontal cell hypertrophy, and expansion of the inner plexiform layer. The spacing of Pten mutant mosaic populations was also aberrant, as were the arborization and fasciculation patterns of their processes, displaying cell type-specific defects in the radial and tangential dimensions. Irregular oscillatory potentials were also observed in Pten mutant electroretinograms, indicative of asynchronous amacrine cell firing. Furthermore, while Pten mutant RGC axons targeted appropriate brain regions, optokinetic spatial acuity was reduced in Pten mutant animals. Finally, while some features of the Pten mutant retina appeared similar to those reported in Dscam-mutant mice, PTEN expression and activity were normal in the absence of Dscam. We conclude that Pten regulates somal positioning and neurite arborization patterns of a subset of retinal cells that form mosaics, likely functioning independently of Dscam, at least during the embryonic period. Our findings thus reveal an unexpected level of cellular specificity for the multi-purpose phosphatase, and identify Pten as an integral component of a novel cell positioning pathway in the retina.
Ivanova, Kira A; Tsyganova, Anna V; Brewin, Nicholas J; Tikhonovich, Igor A; Tsyganov, Viktor E
2015-11-01
Rhizobia are able to establish a beneficial interaction with legumes by forming a new organ, called the symbiotic root nodule, which is a unique ecological niche for rhizobial nitrogen fixation. Rhizobial infection has many similarities with pathogenic infection and induction of defence responses accompanies both interactions, but defence responses are induced to a lesser extent during rhizobial infection. However, strong defence responses may result from incompatible interactions between legumes and rhizobia due to a mutation in either macro- or microsymbiont. The aim of this research was to analyse different plant defence reactions in response to Rhizobium infection for several pea (Pisum sativum) mutants that result in ineffective symbiosis. Pea mutants were examined by histochemical and immunocytochemical analyses, light, fluorescence and transmission electron microscopy and quantitative real-time PCR gene expression analysis. It was observed that mutations in pea symbiotic genes sym33 (PsIPD3/PsCYCLOPS encoding a transcriptional factor) and sym40 (PsEFD encoding a putative negative regulator of the cytokinin response) led to suberin depositions in ineffective nodules, and in the sym42 there were callose depositions in infection thread (IT) and host cell walls. The increase in deposition of unesterified pectin in IT walls was observed for mutants in the sym33 and sym42; for mutant in the sym42, unesterified pectin was also found around degrading bacteroids. In mutants in the genes sym33 and sym40, an increase in the expression level of a gene encoding peroxidase was observed. In the genes sym40 and sym42, an increase in the expression levels of genes encoding a marker of hypersensitive reaction and PR10 protein was demonstrated. Thus, a range of plant defence responses like suberisation, callose and unesterified pectin deposition as well as activation of defence genes can be triggered by different pea single mutations that cause perception of an otherwise beneficial strain of Rhizobium as a pathogen.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srivastava, Avinash C.; Chen, Fang; Ray, Tui
One-carbon (C1) metabolism is important for synthesizing a range of biologically important compounds that are essential for life. In plants, the C1 pathway is crucial for the synthesis of a large number of secondary metabolites, including lignin. Tetrahydrofolate and its derivatives, collectively referred to as folates, are crucial co-factors for C1 metabolic pathway enzymes. Given the link between the C1 and phenylpropanoid pathways, we evaluated whether folylpolyglutamate synthetase (FPGS), an enzyme that catalyzes the addition of a glutamate tail to folates to form folylpolyglutamates, can be a viable target for reducing cell wall recalcitrance in plants. Consistent with its rolemore » in lignocellulosic formation, FPGS1 was preferentially expressed in vascular tissues. Total lignin was low in fpgs1 plants leading to higher saccharification efficiency of the mutant. The decrease in total lignin in fpgs1 was mainly due to lower guaiacyl (G) lignin levels. Glycome profiling revealed subtle alterations in the cell walls of fpgs1. Further analyses of hemicellulosic polysaccharides by NMR showed that the degree of methylation of 4-O-methyl glucuronoxylan was reduced in the fpgs1 mutant. Microarray analysis and real-time qRT-PCR revealed that transcripts of a number of genes in the C1 and lignin pathways had altered expression in fpgs1 mutants. Consistent with the transcript changes of C1-related genes, a significant reduction in S-adenosyl-l-methionine content was detected in the fpgs1 mutant. The modified expression of the various methyltransferases and lignin-related genes indicate possible feedback regulation of C1 pathway-mediated lignin biosynthesis. In conclusion, our observations provide genetic and biochemical support for the importance of folylpolyglutamates in the lignocellulosic pathway and reinforces previous observations that targeting a single FPGS isoform for down-regulation leads to reduced lignin in plants. Because fpgs1 mutants had no dramatic defects in above ground biomass, selective down-regulation of individual components of C1 metabolism is an approach that should be explored further for the improvement of lignocellulosic feedstocks.« less
Schulte, B A; Steel, K P
1994-07-01
Mice homozygous for mutations at the viable dominant spotting (Wv) and Steel-dickie (Sld) loci exhibit a similar phenotype which includes deafness. The auditory dysfunction derives from failure of the stria vascularis to develop normally and to generate a high positive endocochlear potential (EP). Because strial function is driven by Na,K-ATPase its expression was investigated in inner ears of Wv/Wv and Sld/Sld mice and their wild-type littermates by immunostaining with antisera against four of the enzyme's subunit isoforms. Wild-type mice from two different genetic backgrounds showed an identical distribution of subunit isoforms among inner ear transport cells. Several epithelial cell types coexpressed the alpha 1 and beta 1 subunits. Vestibular dark cells showed no reactivity for beta 1 but expressed abundant beta 2, whereas, strial marginal cells stained strongly for both beta isoforms. The only qualitative difference between mutant and wild-type mice was the absence of beta 1 subunit in marginal cells of the mutant's stria. However, it is unlikely that this difference accounts for failure of mutants to generate a high EP because the beta 1 subunit is not present in the stria vascularis of either rats or gerbils with normal EP values. Strong immunostaining for Na,K-ATPase in lateral wall fibrocytes of normal mice along with diminished immunoreactivity in the mutants supports the concept that these strategically located transport fibrocytes actively resorb K+ leaked across Reissner's membrane into scala vestibuli or effluxed from hair cells and nerves into scala tympani. It is further speculated that the resorbed K+ normally is siphoned down its concentration gradient into the intrastrial space through gap junctions between fibrocytes and strial basal and intermediate cells where it is recycled back to endolymph via marginal cells. Thus, failure of mutants to generate a positive EP could be explained by the absence of intermediate cells which may form the final link in the conduit for moving K+ from perilymph to the intrastrial compartment.
Srivastava, Avinash C.; Chen, Fang; Ray, Tui; ...
2015-12-21
One-carbon (C1) metabolism is important for synthesizing a range of biologically important compounds that are essential for life. In plants, the C1 pathway is crucial for the synthesis of a large number of secondary metabolites, including lignin. Tetrahydrofolate and its derivatives, collectively referred to as folates, are crucial co-factors for C1 metabolic pathway enzymes. Given the link between the C1 and phenylpropanoid pathways, we evaluated whether folylpolyglutamate synthetase (FPGS), an enzyme that catalyzes the addition of a glutamate tail to folates to form folylpolyglutamates, can be a viable target for reducing cell wall recalcitrance in plants. Consistent with its rolemore » in lignocellulosic formation, FPGS1 was preferentially expressed in vascular tissues. Total lignin was low in fpgs1 plants leading to higher saccharification efficiency of the mutant. The decrease in total lignin in fpgs1 was mainly due to lower guaiacyl (G) lignin levels. Glycome profiling revealed subtle alterations in the cell walls of fpgs1. Further analyses of hemicellulosic polysaccharides by NMR showed that the degree of methylation of 4-O-methyl glucuronoxylan was reduced in the fpgs1 mutant. Microarray analysis and real-time qRT-PCR revealed that transcripts of a number of genes in the C1 and lignin pathways had altered expression in fpgs1 mutants. Consistent with the transcript changes of C1-related genes, a significant reduction in S-adenosyl-l-methionine content was detected in the fpgs1 mutant. The modified expression of the various methyltransferases and lignin-related genes indicate possible feedback regulation of C1 pathway-mediated lignin biosynthesis. In conclusion, our observations provide genetic and biochemical support for the importance of folylpolyglutamates in the lignocellulosic pathway and reinforces previous observations that targeting a single FPGS isoform for down-regulation leads to reduced lignin in plants. Because fpgs1 mutants had no dramatic defects in above ground biomass, selective down-regulation of individual components of C1 metabolism is an approach that should be explored further for the improvement of lignocellulosic feedstocks.« less
Falk, Alexander T; Yazbeck, Nathalie; Guibert, Nicolas; Chamorey, Emmanuel; Paquet, Agnès; Ribeyre, Lydia; Bence, Coraline; Zahaf, Katia; Leroy, Sylvie; Marquette, Charles-Hugo; Cohen, Charlotte; Mograbi, Baharia; Mazières, Julien; Hofman, Véronique; Brest, Patrick; Hofman, Paul; Ilié, Marius
2018-07-01
The effect of anti-PD-1/PD-L1 inhibitors on lung adenocarcinomas (LADCs) with KRAS mutations is debatable. We examined the association between specific mutant KRAS proteins and the immune infiltrates with the outcome of patients with LADCs. In 219 LADCs harboring either wild-type (WT) or mutated KRAS gene, we quantified the density of several immune markers by immunohistochemistry followed by automated digital image analysis. Data were correlated to clinicopathological parameters and outcome of patients. Tumors harboring mutant KRAS-G12 V had a significantly higher PD-L1 expression compared to other tumors (p = 0.044), while mutant KRAS-G12D tumors showed an increase in the density of CD66b+ cells (p = 0.001). High PD-L1 expression in tumor cells was associated to improved overall survival (OS) in KRAS mutant patients (p = 0.012), but not in the WT population (p = 0.385), whereas increased PD-L1 expression in immune cells correlated to poor OS of KRAS-WT patients (p = 0.025), with no difference in patients with KRAS mutations. KRAS mutational status can affect the immune microenvironment and survival of LADC patients in a heterogeneous way, implying that specific mutant KRAS variants expressed by the tumor should be considered when stratifying patients for immunotherapy. Copyright © 2018 Elsevier B.V. All rights reserved.
Jonsson, Ing-Marie; Juuti, Jarmo T; François, Patrice; AlMajidi, Rana; Pietiäinen, Milla; Girard, Myriam; Lindholm, Catharina; Saller, Manfred J; Driessen, Arnold J M; Kuusela, Pentti; Bokarewa, Maria; Schrenzel, Jacques; Kontinen, Vesa P
2010-12-02
Ecs is an ATP-binding cassette (ABC) transporter present in aerobic and facultative anaerobic gram-positive Firmicutes. Inactivation of Bacillus subtilis Ecs causes pleiotropic changes in the bacterial phenotype including inhibition of intramembrane proteolysis. The molecule(s) transported by Ecs is (are) still unknown. In this study we mutated the ecsAB operon in two Staphylococcus aureus strains, Newman and LS-1. Phenotypic and functional characterization of these Ecs deficient mutants revealed a defect in growth, increased autolysis and lysostaphin sensitivity, altered composition of cell wall proteins including the precursor form of staphylokinase and an altered bacterial surface texture. DNA microarray analysis indicated that the Ecs deficiency changed expression of the virulence factor regulator protein Rot accompanied by differential expression of membrane transport proteins, particularly ABC transporters and phosphate-specific transport systems, protein A, adhesins and capsular polysaccharide biosynthesis proteins. Virulence of the ecs mutants was studied in a mouse model of hematogenous S. aureus infection. Mice inoculated with the ecs mutant strains developed markedly milder infections than those inoculated with the wild-type strains and had consequently lower mortality, less weight loss, milder arthritis and decreased persistence of staphylococci in the kidneys. The ecs mutants had higher susceptibility to ribosomal antibiotics and plant alkaloids chelerythrine and sanguinarine. Our results show that Ecs is essential for staphylococcal virulence and antimicrobial resistance probably since the transport function of Ecs is essential for the normal structure and function of the cell wall. Thus targeting Ecs may be a new approach in combating staphylococcal infection.
Moreau, Manon; Azzopardi, Marianne; Clément, Gilles; Dobrenel, Thomas; Marchive, Chloé; Renne, Charlotte; Martin-Magniette, Marie-Laure; Taconnat, Ludivine; Renou, Jean-Pierre; Robaglia, Christophe; Meyer, Christian
2012-01-01
The conserved Target of Rapamycin (TOR) kinase forms high molecular mass complexes and is a major regulator of cellular adaptations to environmental cues. The Lethal with Sec Thirteen 8/G protein β subunit-like (LST8/GβL) protein is a member of the TOR complexes, and two putative LST8 genes are present in Arabidopsis thaliana, of which only one (LST8-1) is significantly expressed. The Arabidopsis LST8-1 protein is able to complement yeast lst8 mutations and interacts with the TOR kinase. Mutations in the LST8-1 gene resulted in reduced vegetative growth and apical dominance with abnormal development of flowers. Mutant plants were also highly sensitive to long days and accumulated, like TOR RNA interference lines, higher amounts of starch and amino acids, including proline and glutamine, while showing reduced concentrations of inositol and raffinose. Accordingly, transcriptomic and enzymatic analyses revealed a higher expression of genes involved in nitrate assimilation when lst8-1 mutants were shifted to long days. The transcriptome of lst8-1 mutants in long days was found to share similarities with that of a myo-inositol 1 phosphate synthase mutant that is also sensitive to the extension of the light period. It thus appears that the LST8-1 protein has an important role in regulating amino acid accumulation and the synthesis of myo-inositol and raffinose during plant adaptation to long days. PMID:22307851
Hirata, Hiromi; Wen, Hua; Kawakami, Yu; Naganawa, Yuriko; Ogino, Kazutoyo; Yamada, Kenta; Saint-Amant, Louis; Low, Sean E.; Cui, Wilson W.; Zhou, Weibin; Sprague, Shawn M.; Asakawa, Kazuhide; Muto, Akira; Kawakami, Koichi; Kuwada, John Y.
2012-01-01
In many tissues and organs, connexin proteins assemble between neighboring cells to form gap junctions. These gap junctions facilitate direct intercellular communication between adjoining cells, allowing for the transmission of both chemical and electrical signals. In rodents, gap junctions are found in differentiating myoblasts and are important for myogenesis. Although gap junctions were once believed to be absent from differentiated skeletal muscle in mammals, recent studies in teleosts revealed that differentiated muscle does express connexins and is electrically coupled, at least at the larval stage. These findings raised questions regarding the functional significance of gap junctions in differentiated muscle. Our analysis of gap junctions in muscle began with the isolation of a zebrafish motor mutant that displayed weak coiling at day 1 of development, a behavior known to be driven by slow-twitch muscle (slow muscle). We identified a missense mutation in the gene encoding Connexin 39.9. In situ hybridization found connexin 39.9 to be expressed by slow muscle. Paired muscle recordings uncovered that wild-type slow muscles are electrically coupled, whereas mutant slow muscles are not. The further examination of cellular activity revealed aberrant, arrhythmic touch-evoked Ca2+ transients in mutant slow muscle and a reduction in the number of muscle fibers contracting in response to touch in mutants. These results indicate that Connexin 39.9 facilitates the spreading of neuronal inputs, which is irregular during motor development, beyond the muscle cells and that gap junctions play an essential role in the efficient recruitment of slow muscle fibers. PMID:22075003
Chemical chaperones reduce endoplasmic reticulum stress and prevent mutant HFE aggregate formation.
de Almeida, Sérgio F; Picarote, Gonçalo; Fleming, John V; Carmo-Fonseca, Maria; Azevedo, Jorge E; de Sousa, Maria
2007-09-21
HFE C282Y, the mutant protein associated with hereditary hemochromatosis (HH), fails to acquire the correct conformation in the endoplasmic reticulum (ER) and is targeted for degradation. We have recently shown that an active unfolded protein response (UPR) is present in the cells of patients with HH. Now, by using HEK 293T cells, we demonstrate that the stability of HFE C282Y is influenced by the UPR signaling pathway that promotes its degradation. Treatment of HFE C282Y-expressing cells with tauroursodeoxycholic acid (TUDCA), a bile acid derivative with chaperone properties, or with the chemical chaperone sodium 4-phenylbutyrate (4PBA) impeded the UPR activation. However, although TUDCA led to an increased stability of the mutant protein, 4PBA contributed to a more efficient disposal of HFE C282Y to the degradation route. Fluorescence microscopy and biochemical analysis of the subcellular localization of HFE revealed that a major portion of the C282Y mutant protein forms intracellular aggregates. Although neither TUDCA nor 4PBA restored the correct folding and intracellular trafficking of HFE C282Y, 4PBA prevented its aggregation. These data suggest that TUDCA hampers the UPR activation by acting directly on its signal transduction pathway, whereas 4PBA suppresses ER stress by chemically enhancing the ER capacity to cope with the expression of misfolded HFE, facilitating its degradation. Together, these data shed light on the molecular mechanisms involved in HFE C282Y-related HH and open new perspectives on the use of orally active chemical chaperones as a therapeutic approach for HH.
Yang, Kunlong; Zhuang, Zhenhong; Zhang, Feng; Song, Fengqin; Zhong, Hong; Ran, Fanlei; Yu, Song; Xu, Gaopo; Lan, Faxiu; Wang, Shihua
2015-01-01
Aflatoxins (AFs) are a group of highly oxygenated polyketidese-derived toxins mainly produced by Aspergillus flavus and A. parasiticus, whose biosynthesis mechanisms are extremely sophisticated. Methylation is known as the major form of epigenetic regulation, which is correlated with gene expression. As the DNA methylation inhibitor 5-azacytidine (5-AC) blocks AF production, we studied AFB1 metabolism and morphological changes of A. flavus by treatment with 5-AC in liquid culture. The results show that 5-AC caused a decrease in AF production and concurrent changes in morphology. In addition, we isolated a non-aflatoxigenic mutant of A. flavus, showing a significant reduction in pigment production, after 5-AC treatment. This mutant showed significant reduction in the expression of genes in the AF biosynthesis pathway, and conidia formation. Furthermore, as AF biosynthesis and oxidative stress are intimately related events, we assessed the viability of A. flavus to oxidative stress after treatment with 5-AC, which showed that the mutant was more sensitive to the strong oxidant hydrogen peroxide. We found that the non-aflatoxigenic mutant showed a decrease in reactive oxygen species (ROS) and metabolites indicative of oxidative stress, which may be caused by the disruption of the defence system against excessive ROS formation after 5-AC treatment. These data indicate that 5-AC, as an inactivator of DNA methyltransferase, plays a very important role in AFB1 metabolism and the development of A. flavus, which might provide an effective strategy to pre- or post-harvest control of AFs.
Xu, X; Ehdaie, B; Ohara, N; Yoshino, T; Deng, C-X
2010-02-04
Mutations of SMAD4/DPC4 are found in about 60% of human invasive pancreatic ductal adenocarcinomas (PDACs); yet, the manner in which SMAD4 deficiency enhances tumorigenesis remains elusive. Using a Cre-LoxP approach, we generated a mutant mouse carrying a targeted deletion of Smad4 in the pancreas. We showed that the absence of Smad4 alone did not trigger pancreas tumor formation; however, it increased the expression of an inactivated form of Pten, suggesting a role of Pten in preventing Smad4-/- cells from undergoing malignancy. To investigate this, we disrupted both Pten and Smad4. We showed that Pten deficiency initiated widespread premalignant lesions, and a low tumor incidence that was significantly accelerated by Smad4-deficiency. The absence of Smad4 in a Pten-mutant background enhanced cell proliferation and triggered transdifferentiation from acinar, centroacinar and islet cells, accompanied by activation of Notch1 signaling. We showed that all tumors developed in the Smad4/Pten-mutant pancreas exhibited high levels of pAKT and mTOR, and that about 50 and 83% of human pancreatic cancers examined showed increased pAKT and pmTOR, respectively. Besides the similarity in gene expression, the pAKT and/or pmTOR-positive human PDACs and mouse pancreatic tumors also shared some histopathological similarities. These observations indicate that Smad4/Pten-mutant mice mimic the tumor progression of human pancreatic cancers that are driven by activation of the AKT-mTOR pathway, and uncovered a synergistic action of Smad4 and Pten in repressing pancreatic tumorigenesis.
Synthesis and assembly of Hepatitis B virus envelope protein-derived particles in Escherichia coli.
Li, Hao; Onbe, Keisuke; Liu, Qiushi; Iijima, Masumi; Tatematsu, Kenji; Seno, Masaharu; Tada, Hiroko; Kuroda, Shun' Ichi
2017-08-19
Hepatitis B virus (HBV) envelope particles have been synthesized in eukaryotic cells (e.g., mammalian cells, insect cells, and yeast cells) as an HB vaccine immunogen and drug delivery system (DDS) nanocarrier. Many researchers had made attempts to synthesize the particles in Escherichia coli for minimize the cost and time for producing HBV envelope particles, but the protein was too deleterious to be synthesized in E. coli. In this study, we generated deletion mutants of HBV envelope L protein (389 amino acid residues (aa)) containing three transmembrane domains (TM1, TM2, TM3). The ΔNC mutant spanning from TM2 to N-terminal half of TM3 (from 237 aa to 335 aa) was found as a shortest form showing spontaneous particle formation. After the N-terminal end of ΔNC mutant was optimized by the N-end rule for E. coli expression, the modified ΔNC mutant (mΔNC) was efficiently expressed as particles in E. coli. The molecular mass of mΔNC particle was approx. 670 kDa, and the diameter was 28.5 ± 6.2 nm (mean ± SD, N = 61). The particle could react with anti-HBV envelope S protein antibody, indicating the particles exhibited S antigenic domain outside as well as HBV envelope particles. Taken together, the E. coli-derived mΔNC particles could be used as a substitute of eukaryotic cell-derived HBV envelope particles for versatile applications. Copyright © 2017 Elsevier Inc. All rights reserved.
Mutant calreticulin-expressing cells induce monocyte hyperreactivity through a paracrine mechanism
Garbati, Michael R.; Welgan, Catherine A.; Landefeld, Sally H.; Newell, Laura F.; Agarwal, Anupriya; Dunlap, Jennifer B.; Chourasia, Tapan K.; Lee, Hyunjung; Elferich, Johannes; Traer, Elie; Rattray, Rogan; Cascio, Michael J.; Press, Richard D.; Bagby, Grover C.; Tyner, Jeffrey W.; Druker, Brian J.; Dao, Kim-Hien T.
2016-01-01
Mutations in the calreticulin gene (CALR) were recently identified in approximately 70–80% of patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. All frameshift mutations generate a recurring novel C-terminus. Here we provide evidence that mutant calreticulin does not accumulate efficiently in cells and is abnormally enriched in the nucleus and extracellular space compared to wildtype calreticulin. The main determinant of these findings is the loss of the calcium-binding and KDEL domains. Expression of type I mutant CALR in Ba/F3 cells confers minimal IL-3-independent growth. Interestingly, expression of type I and type II mutant CALR in a non-hematopoietic cell line does not directly activate JAK/STAT signaling compared to JAK2-V617F expression. These results led us to investigate paracrine mechanisms of JAK/STAT activation. Here we show that conditioned media from cells expressing type I mutant CALR exaggerate cytokine production from normal monocytes with or without treatment with a toll-like receptor agonist. These effects are not dependent on the novel C-terminus. These studies offer novel insights into the mechanism of JAK/STAT activation in patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. PMID:26573090
Gibberellin regulates pollen viability and pollen tube growth in rice.
Chhun, Tory; Aya, Koichiro; Asano, Kenji; Yamamoto, Eiji; Morinaka, Yoichi; Watanabe, Masao; Kitano, Hidemi; Ashikari, Motoyuki; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako
2007-12-01
Gibberellins (GAs) play many biological roles in higher plants. We collected and performed genetic analysis on rice (Oryza sativa) GA-related mutants, including GA-deficient and GA-insensitive mutants. Genetic analysis of the mutants revealed that rice GA-deficient mutations are not transmitted as Mendelian traits to the next generation following self-pollination of F1 heterozygous plants, although GA-insensitive mutations are transmitted normally. To understand these differences in transmission, we examined the effect of GA on microsporogenesis and pollen tube elongation in rice using new GA-deficient and GA-insensitive mutants that produce semifertile flowers. Phenotypic analysis revealed that the GA-deficient mutant reduced pollen elongation1 is defective in pollen tube elongation, resulting in a low fertilization frequency, whereas the GA-insensitive semidominant mutant Slr1-d3 is mainly defective in viable pollen production. Quantitative RT-PCR revealed that GA biosynthesis genes tested whose mutations are transmitted to the next generation at a lower frequency are preferentially expressed after meiosis during pollen development, but expression is absent or very low before the meiosis stage, whereas GA signal-related genes are actively expressed before meiosis. Based on these observations, we predict that the transmission of GA-signaling genes occurs in a sporophytic manner, since the protein products and/or mRNA transcripts of these genes may be introduced into pollen-carrying mutant alleles, whereas GA synthesis genes are transmitted in a gametophytic manner, since these genes are preferentially expressed after meiosis.
Nunes, Paula; Haines, Nicola; Kuppuswamy, Venkat; Fleet, David J.
2006-01-01
N-ethylmaleimide sensitive factor (NSF) can dissociate the soluble NSF attachment receptor (SNARE) complex, but NSF also participates in other intracellular trafficking functions by virtue of SNARE-independent activity. Drosophila that express a neural transgene encoding a dominant-negative form of NSF2 show an 80% reduction in the size of releasable synaptic vesicle pool, but no change in the number of vesicles in nerve terminal boutons. Here we tested the hypothesis that vesicles in the NSF2 mutant terminal are less mobile. Using a combination of genetics, pharmacology, and imaging we find a substantial reduction in vesicle mobility within the nerve terminal boutons of Drosophila NSF2 mutant larvae. Subsequent analysis revealed a decrease of filamentous actin in both NSF2 dominant-negative and loss-of-function mutants. Lastly, actin-filament disrupting drugs also decrease vesicle movement. We conclude that a factor contributing to the NSF mutant phenotype is a reduction in vesicle mobility, which is associated with decreased presynaptic F-actin. Our data are consistent with a model in which actin filaments promote vesicle mobility and suggest that NSF participates in establishing or maintaining this population of actin. PMID:16914524
Mishina, Yuji; Starbuck, Michael W; Gentile, Michael A; Fukuda, Tomokazu; Kasparcova, Viera; Seedor, J Gregory; Hanks, Mark C; Amling, Michael; Pinero, Gerald J; Harada, Shun-ichi; Behringer, Richard R
2004-06-25
Bone morphogenetic proteins (BMPs) function during various aspects of embryonic development including skeletogenesis. However, their biological functions after birth are less understood. To investigate the role of BMPs during bone remodeling, we generated a postnatal osteoblast-specific disruption of Bmpr1a that encodes the type IA receptor for BMPs in mice. Mutant mice were smaller than controls up to 6 months after birth. Irregular calcification and low bone mass were observed, but there were normal numbers of osteoblasts. The ability of the mutant osteoblasts to form mineralized nodules in culture was severely reduced. Interestingly, bone mass was increased in aged mutant mice due to reduced bone resorption evidenced by reduced bone turnover. The mutant mice lost more bone after ovariectomy likely resulting from decreased osteoblast function which could not overcome ovariectomy-induced bone resorption. In organ culture of bones from aged mice, ablation of the Bmpr1a gene by adenoviral Cre recombinase abolished the stimulatory effects of BMP4 on the expression of lysosomal enzymes essential for osteoclastic bone resorption. These results demonstrate essential and age-dependent roles for BMP signaling mediated by BMPRIA (a type IA receptor for BMP) in osteoblasts for bone remodeling.
Rondón, Ana G; Jimeno, Sonia; García-Rubio, María; Aguilera, Andrés
2003-10-03
THO/TREX is a conserved eukaryotic complex formed by the core THO complex plus proteins involved in mRNA metabolism and export such as Sub2 and Yra1. Mutations in any of the THO/TREX structural genes cause pleiotropic phenotypes such as transcription impairment, increased transcription-associated recombination, and mRNA export defects. To assay the relevance of THO/TREX complex in transcription, we performed in vitro transcription elongation assays in mutant cell extracts using supercoiled DNA templates containing two G-less cassettes. With these assays, we demonstrate that hpr1delta, tho2delta, and mft1delta mutants of the THO complex and sub2 mutants show significant reductions in the efficiency of transcription elongation. The mRNA expression defect of hpr1delta mutants was not due to an increase in mRNA decay, as determined by mRNA half-life measurements and mRNA time course accumulation experiments in the absence of Rrp6p exoribonuclease. This work demonstrates that THO and Sub2 are required for efficient transcription elongation, providing further evidence for the coupling between transcription and mRNA metabolism and export.
Avery, Simon V.; Malkapuram, Srividya; Mateus, Carolina; Babb, Kimberly S.
2000-01-01
Saccharomyces cerevisiae, along with other eukaryotes, is resistant to tetracyclines. We found that deletion of SOD1 (encoding Cu/Zn superoxide dismutase) rendered S. cerevisiae hypersensitive to oxytetracycline (OTC): a sod1Δ mutant exhibited a >95% reduction in colony-forming ability at an OTC concentration of 20 μg ml−1, whereas concentrations of up to 1,000 μg ml−1 had no effect on the growth of the wild type. OTC resistance was restored in the sod1Δ mutant by complementation with wild-type SOD1. The effect of OTC appeared to be cytotoxic and was not evident in a ctt1Δ (cytosolic catalase) mutant or in the presence of tetracycline. SOD1 transcription was not induced by OTC, suggesting that constitutive SOD1 expression is sufficient for wild-type OTC resistance. OTC uptake levels in wild-type and sod1Δ strains were similar. However, lipid peroxidation and protein oxidation were both enhanced during exposure of the sod1Δ mutant, but not the wild type, to OTC. We propose that Sod1p protects S. cerevisiae against a mode of OTC action that is dependent on oxidative damage. PMID:10613865
Farhan Ul Haque, Muhammad; Gu, Wenyu; DiSpirito, Alan A.
2015-01-01
Methanotrophs have remarkable redundancy in multiple steps of the central pathway of methane oxidation to carbon dioxide. For example, it has been known for over 30 years that two forms of methane monooxygenase, responsible for oxidizing methane to methanol, exist in methanotrophs, i.e., soluble methane monooxygenase (sMMO) and particulate methane monooxygenase (pMMO), and that expression of these two forms is controlled by the availability of copper. Specifically, sMMO expression occurs in the absence of copper, while pMMO expression increases with increasing copper concentrations. More recently, it was discovered that multiple forms of methanol dehydrogenase (MeDH), Mxa MeDH and Xox MeDH, also exist in methanotrophs and that the expression of these alternative forms is regulated by the availability of cerium. That is, expression of Xox MeDH increases in the presence of cerium, while Mxa MeDH expression decreases in the presence of cerium. As it had been earlier concluded that pMMO and Mxa MeDH form a supercomplex in which electrons from Mxa MeDH are back donated to pMMO to drive the initial oxidation of methane, we speculated that Mxa MeDH could be rendered inactive through marker-exchange mutagenesis but growth on methane could still be possible if cerium was added to increase the expression of Xox MeDH under sMMO-expressing conditions. Here we report that mxaF, encoding the large subunit of Mxa MeDH, could indeed be knocked out in Methylosinus trichosporium OB3b, yet growth on methane was still possible, so long as cerium was added. Interestingly, growth of this mutant occurred in both the presence and the absence of copper, suggesting that Xox MeDH can replace Mxa MeDH regardless of the form of MMO expressed. PMID:26712545
Zebrafish pit1 mutants lack three pituitary cell types and develop severe dwarfism.
Nica, Gabriela; Herzog, Wiebke; Sonntag, Carmen; Hammerschmidt, Matthias
2004-05-01
The Pou domain transcription factor Pit-1 is required for lineage determination and cellular commitment processes during mammalian adenohypophysis development. Here we report the cloning and mutational analysis of a pit1 homolog from zebrafish. Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. However, as in the mouse, expression is restricted to a subset of pituitary cell types, excluding proopiomelanocortin (pomc)-expressing cells (corticotropes, melanotropes) and possibly gonadotropes. We could identify two N-ethyl-N-nitrosourea-induced zebrafish pit1 null mutants. Most mutants die during larval stages, whereas survivors develop severe dwarfism. Mutant larvae lack lactotropes, somatotropes, and thyrotropes, although the adenohypophysis is of normal size, without any sign of increased apoptosis rates. Instead, mutant embryos initiate ectopic expression of pomc in pit1-positive cells, leading to an expansion of the Pomc lineage. Similarly, the number of gonadotropes seems increased, as indicated by the expression of gsualpha, a marker for thyrotropes and gonadotropes. In pit1 mutants, the total number of gsualpha-positive cells is normal despite the loss of gsualpha and tshbeta coexpressing cells. Together, these data suggest a transfating of the Pit1 lineage to the Pomc and possibly the gonadotroph lineages in the mutant, and a pomc- and gonadotropin-repressive role of Pit1 during normal zebrafish development. This is different from mouse, for which a repressive role of Pit-1 has only been reported for the gonadotropin Lhbeta, but not for Pomc. In sum, our data point to both conserved and class-specific aspects of Pit1 function during pituitary development in different vertebrate species.
Bartlett, Heather L.; Sutherland, Lillian; Kolker, Sandra J.; Welp, Chelsea; Tajchman, Urszula; Desmarais, Vera; Weeks, Daniel L.
2007-01-01
Nkx2-5 is a homeobox containing transcription factor that is conserved and expressed in organisms that form hearts. Fruit flies lacking the gene (tinman) fail to form a dorsal vessel, mice that are homozygous null for Nkx2-5 form small, deformed hearts, and several human cardiac defects have been linked to dominant mutations in the Nkx2-5 gene. The Xenopus homologs (XNkx2-5) of two truncated forms of Nkx2-5 that have been identified in humans with congenital heart defects were used in the studies reported here. mRNAs encoding these mutations were injected into single cell Xenopus embryos, and heart development was monitored. Our results indicate that the introduction of truncated XNkx2-5 variants leads to three principle developmental defects. The atrial septum and the valve of the atrioventricular canal were both abnormal. In addition, video microscopic timing of heart contraction indicated that embryos injected with either mutant form of XNkx2-5 have conduction defects. PMID:17685485