5-HT2C Receptor Desensitization Moderates Anxiety in 5-HTT Deficient Mice: From Behavioral to Cellular Evidence

PubMed Central

Martin, Cédric BP; Martin, Vincent S.; Trigo, José M.; Chevarin, Caroline; Maldonado, Rafael; Fink, Latham H.; Cunningham, Kathryn A.; Hamon, Michel; Lanfumey, Laurence

2015-01-01

Background: Desensitization and blockade of 5-HT2C receptors (5-HT2CR) have long been thought to be central in the therapeutic action of antidepressant drugs. However, besides behavioral pharmacology studies, there is little in vivo data documenting antidepressant-induced 5-HT2CR desensitization in specific brain areas. Methods: Mice lacking the 5-HT reuptake carrier (5-HTT-/-) were used to model the consequences of chronic 5-HT reuptake inhibition with antidepressant drugs. The effect of this mutation on 5-HT2CR was evaluated at the behavioral (social interaction, novelty-suppressed feeding, and 5-HT2CR–induced hypolocomotion tests), the neurochemical, and the cellular (RT-qPCR, mRNA editing, and c-fos–induced expression) levels. Results: Although 5-HTT-/- mice had an anxiogenic profile in the novelty-suppressed feeding test, they displayed less 5-HT2CR–mediated anxiety in response to the agonist m-chlorophenylpiperazine in the social interaction test. In addition, 5-HT2CR–mediated inhibition of a stress-induced increase in 5-HT turnover, measured in various brain areas, was markedly reduced in 5-HTT-/- mutants. These indices of tolerance to 5-HT2CR stimulation were associated neither with altered levels of 5-HT2CR protein and mRNA nor with changes in pre-mRNA editing in the frontal cortex. However, basal c-fos mRNA production in cells expressing 5-HT2CR was higher in 5-HTT-/- mutants, suggesting an altered basal activity of these cells following sustained 5-HT reuptake carrier inactivation. Furthermore, the increased c-fos mRNA expression in 5-HT2CR–like immune-positive cortical cells observed in wild-type mice treated acutely with the 5-HT2CR agonist RO-60,0175 was absent in 5-HTT-/- mutants. Conclusions: Such blunted responsiveness of the 5-HT2CR system, observed at the cell signaling level, probably contributes to the moderation of the anxiety phenotype in 5-HTT-/- mice. PMID:25522398

Frequency of nuclear mutant huntingtin inclusion formation in neurons and glia is cell-type-specific.

PubMed

Jansen, Anne H P; van Hal, Maurik; Op den Kelder, Ilse C; Meier, Romy T; de Ruiter, Anna-Aster; Schut, Menno H; Smith, Donna L; Grit, Corien; Brouwer, Nieske; Kamphuis, Willem; Boddeke, H W G M; den Dunnen, Wilfred F A; van Roon, Willeke M C; Bates, Gillian P; Hol, Elly M; Reits, Eric A

2017-01-01

Huntington's disease (HD) is an autosomal dominant inherited neurodegenerative disorder that is caused by a CAG expansion in the Huntingtin (HTT) gene, leading to HTT inclusion formation in the brain. The mutant huntingtin protein (mHTT) is ubiquitously expressed and therefore nuclear inclusions could be present in all brain cells. The effects of nuclear inclusion formation have been mainly studied in neurons, while the effect on glia has been comparatively disregarded. Astrocytes, microglia, and oligodendrocytes are glial cells that are essential for normal brain function and are implicated in several neurological diseases. Here we examined the number of nuclear mHTT inclusions in both neurons and various types of glia in the two brain areas that are the most affected in HD, frontal cortex, and striatum. We compared nuclear mHTT inclusion body formation in three HD mouse models that express either full-length HTT or an N-terminal exon1 fragment of mHTT, and we observed nuclear inclusions in neurons, astrocytes, oligodendrocytes, and microglia. When studying the frequency of cells with nuclear inclusions in mice, we found that half of the population of neurons contained nuclear inclusions at the disease end stage, whereas the proportion of GFAP-positive astrocytes and oligodendrocytes having a nuclear inclusion was much lower, while microglia hardly showed any nuclear inclusions. Nuclear inclusions were also present in neurons and all studied glial cell types in human patient material. This is the first report to compare nuclear mHTT inclusions in glia and neurons in different HD mouse models and HD patient brains. GLIA 2016;65:50-61. © 2016 The Authors. Glia Published by Wiley Periodicals, Inc.

Environment-dependent striatal gene expression in the BACHD rat model for Huntington disease.

PubMed

Novati, Arianna; Hentrich, Thomas; Wassouf, Zinah; Weber, Jonasz J; Yu-Taeger, Libo; Déglon, Nicole; Nguyen, Huu Phuc; Schulze-Hentrich, Julia M

2018-04-11

Huntington disease (HD) is an autosomal dominant neurodegenerative disorder caused by a mutation in the huntingtin (HTT) gene which results in progressive neurodegeneration in the striatum, cortex, and eventually most brain areas. Despite being a monogenic disorder, environmental factors influence HD characteristics. Both human and mouse studies suggest that mutant HTT (mHTT) leads to gene expression changes that harbor potential to be modulated by the environment. Yet, the underlying mechanisms integrating environmental cues into the gene regulatory program have remained largely unclear. To better understand gene-environment interactions in the context of mHTT, we employed RNA-seq to examine effects of maternal separation (MS) and environmental enrichment (EE) on striatal gene expression during development of BACHD rats. We integrated our results with striatal consensus modules defined on HTT-CAG length and age-dependent co-expression gene networks to relate the environmental factors with disease progression. While mHTT was the main determinant of expression changes, both MS and EE were capable of modulating these disturbances, resulting in distinctive and in several cases opposing effects of MS and EE on consensus modules. This bivalent response to maternal separation and environmental enrichment may aid in explaining their distinct effects observed on disease phenotypes in animal models of HD and related neurodegenerative disorders.

AAV-mediated delivery of the transcription factor XBP1s into the striatum reduces mutant Huntingtin aggregation in a mouse model of Huntington's disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuleta, Amparo; Center for Molecular Studies of the Cell, Institute of Biomedical Sciences, University of Chile, Santiago; Vidal, Rene L.

2012-04-13

Highlights: Black-Right-Pointing-Pointer The contribution of ER stress to HD has not been directly addressed. Black-Right-Pointing-Pointer Expression of XBP1s using AAVs decreases Huntingtin aggregation in vivo. Black-Right-Pointing-Pointer We describe a new in vivo model of HD based on the expression of a large fragment of mHtt-RFP. -- Abstract: Huntington's disease (HD) is caused by mutations that expand a polyglutamine region in the amino-terminal domain of Huntingtin (Htt), leading to the accumulation of intracellular inclusions and progressive neurodegeneration. Recent reports indicate the engagement of endoplasmic reticulum (ER) stress responses in human HD post mortem samples and animal models of the disease. Adaptationmore » to ER stress is mediated by the activation of the unfolded protein response (UPR), an integrated signal transduction pathway that attenuates protein folding stress by controlling the expression of distinct transcription factors including X-Box binding protein 1 (XBP1). Here we targeted the expression of XBP1 on a novel viral-based model of HD. We delivered an active form of XBP1 locally into the striatum of adult mice using adeno-associated vectors (AAVs) and co-expressed this factor with a large fragment of mutant Htt as a fusion protein with RFP (Htt588{sup Q95}-mRFP) to directly visualize the accumulation of Htt inclusions in the brain. Using this approach, we observed a significant reduction in the accumulation of Htt588{sup Q95}-mRFP intracellular inclusion when XBP1 was co-expressed in the striatum. These results contrast with recent findings indicating a protective effect of XBP1 deficiency in neurodegeneration using knockout mice, and suggest a potential use of gene therapy strategies to manipulate the UPR in the context of HD.« less

Inhibition of Excessive Monoamine Oxidase A/B Activity Protects Against Stress-induced Neuronal Death in Huntington Disease.

PubMed

Ooi, Jolene; Hayden, Michael R; Pouladi, Mahmoud A

2015-12-01

Monoamine oxidases (MAO) are important components of the homeostatic machinery that maintains the levels of monoamine neurotransmitters, including dopamine, in balance. Given the imbalance in dopamine levels observed in Huntington disease (HD), the aim of this study was to examine MAO activity in a mouse striatal cell model of HD and in human neural cells differentiated from control and HD patient-derived induced pluripotent stem cell (hiPSC) lines. We show that mouse striatal neural cells expressing mutant huntingtin (HTT) exhibit increased MAO expression and activity. We demonstrate using luciferase promoter assays that the increased MAO expression reflects enhanced epigenetic activation in striatal neural cells expressing mutant HTT. Using cellular stress paradigms, we further demonstrate that the increase in MAO activity in mutant striatal neural cells is accompanied by enhanced susceptibility to oxidative stress and impaired viability. Treatment of mutant striatal neural cells with MAO inhibitors ameliorated oxidative stress and improved cellular viability. Finally, we demonstrate that human HD neural cells exhibit increased MAO-A and MAO-B expression and activity. Altogether, this study demonstrates abnormal MAO expression and activity and suggests a potential use for MAO inhibitors in HD.

Dysregulation of gene expression in the striatum of BACHD rats expressing full-length mutant huntingtin and associated abnormalities on molecular and protein levels.

PubMed

Yu-Taeger, Libo; Bonin, Michael; Stricker-Shaver, Janice; Riess, Olaf; Nguyen, Hoa Huu Phuc

2017-05-01

Huntington disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for the huntingtin protein (HTT). Mutant HTT (mHTT) has been proposed to cause neuronal dysfunction and neuronal loss through multiple mechanisms. Transcriptional changes may be a core pathogenic feature of HD. Utilizing the Affymetrix platform we performed a genome-wide RNA expression analysis in two BACHD transgenic rat lines (TG5 and TG9) at 12 months of age, both of which carry full-length human mHTT but with different expression levels. By defining the threshold of significance at p < 0.01, we found 1608 genes and 871 genes differentially expressed in both TG5 and TG9 rats when compared to the wild type littermates, respectively. We only chose the highly up-/down-regulated genes for further analysis by setting an additional threshold of 1.5 fold change. Comparing gene expression profiles of human HD brains and BACHD rats revealed a high concordance in both functional and IPA (Ingenuity Pathway Analysis) canonical pathways relevant to HD. In addition, we investigated the causes leading to gene expression changes at molecular and protein levels in BACHD rats including the involvement of polyQ-containing transcription factors TATA box-binding protein (TBP), Sp1 and CBP as well as the chromatin structure. We demonstrate that the BACHD rat model recapitulates the gene expression changes of the human disease supporting its role as a preclinical research animal model. We also show for the first time that TFIID complex formation is reduced, while soluble TBP is increased in an HD model. This finding suggests that mHTT is a competitor instead of a recruiter of polyQ-containing transcription factors in the transcription process in HD. Copyright © 2017 Elsevier Ltd. All rights reserved.

Huntingtin Haplotypes Provide Prioritized Target Panels for Allele-specific Silencing in Huntington Disease Patients of European Ancestry

PubMed Central

Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R

2015-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder. PMID:26201449

Mutant Huntingtin Inhibits αB-Crystallin Expression and Impairs Exosome Secretion from Astrocytes.

PubMed

Hong, Yan; Zhao, Ting; Li, Xiao-Jiang; Li, Shihua

2017-09-27

In the brain, astrocytes secrete diverse substances that regulate neuronal function and viability. Exosomes, which are vesicles produced through the formation of multivesicular bodies and their subsequent fusion with the plasma membrane, are also released from astrocytes via exocytotic secretion. Astrocytic exosomes carry heat shock proteins that can reduce the cellular toxicity of misfolded proteins and prevent neurodegeneration. Although mutant huntingtin (mHtt) affects multiple functions of astrocytes, it remains unknown whether mHtt impairs the production of exosomes from astrocytes. We found that mHtt is not present in astrocytic exosomes, but can decrease exosome secretion from astrocytes in HD140Q knock-in (KI) mice. N-terminal mHtt accumulates in the nuclei and forms aggregates, causing decreased secretion of exosomes from cultured astrocytes. Consistently, there is a significant decrease in secreted exosomes in both female and male HD KI mouse striatum in which abundant nuclear mHtt aggregates are present. Conversely, injection of astrocytic exosomes into the striatum of HD140Q KI mice reduces the density of mHtt aggregates. Further, mHtt in astrocytes decreased the expression of αB-crystallin, a small heat shock protein that is enriched in astrocytes and mediates exosome secretion, by reducing the association of Sp1 with the enhancer of the α B-crystallin gene. Importantly, overexpression of αB-crystallin rescues defective exosome release from HD astrocytes as well as mHtt aggregates in the striatum of HD140Q KI mice. Our results demonstrate that mHtt reduces the expression of αB-crystallin in astrocytes to decrease exosome secretion in the HD brains, contributing to non-cell-autonomous neurotoxicity in HD. SIGNIFICANCE STATEMENT Huntington's disease (HD) is characterized by selective neurodegeneration that preferentially occurs in the striatal medium spiny neurons. Recent studies in different HD mouse models demonstrated that dysfunction of astrocytes, a major type of glial cell, leads to neuronal vulnerability. Emerging evidence shows that exosomes secreted from astrocytes contain neuroprotective cargoes that could support the survival of neighboring neurons. We found that mHtt in astrocytes impairs exosome secretion by decreasing αB-crystallin, a protein that is expressed mainly in glial cells and mediates exosome secretion. Overexpression of αB-crystallin could alleviate the deficient exosome release and neuropathology in HD mice. Our results revealed a new pathological pathway that affects the critical support of glial cells to neurons in the HD brain. Copyright © 2017 the authors 0270-6474/17/379550-14$15.00/0.

Mutant Huntingtin Inhibits αB-Crystallin Expression and Impairs Exosome Secretion from Astrocytes

PubMed Central

2017-01-01

In the brain, astrocytes secrete diverse substances that regulate neuronal function and viability. Exosomes, which are vesicles produced through the formation of multivesicular bodies and their subsequent fusion with the plasma membrane, are also released from astrocytes via exocytotic secretion. Astrocytic exosomes carry heat shock proteins that can reduce the cellular toxicity of misfolded proteins and prevent neurodegeneration. Although mutant huntingtin (mHtt) affects multiple functions of astrocytes, it remains unknown whether mHtt impairs the production of exosomes from astrocytes. We found that mHtt is not present in astrocytic exosomes, but can decrease exosome secretion from astrocytes in HD140Q knock-in (KI) mice. N-terminal mHtt accumulates in the nuclei and forms aggregates, causing decreased secretion of exosomes from cultured astrocytes. Consistently, there is a significant decrease in secreted exosomes in both female and male HD KI mouse striatum in which abundant nuclear mHtt aggregates are present. Conversely, injection of astrocytic exosomes into the striatum of HD140Q KI mice reduces the density of mHtt aggregates. Further, mHtt in astrocytes decreased the expression of αB-crystallin, a small heat shock protein that is enriched in astrocytes and mediates exosome secretion, by reducing the association of Sp1 with the enhancer of the αB-crystallin gene. Importantly, overexpression of αB-crystallin rescues defective exosome release from HD astrocytes as well as mHtt aggregates in the striatum of HD140Q KI mice. Our results demonstrate that mHtt reduces the expression of αB-crystallin in astrocytes to decrease exosome secretion in the HD brains, contributing to non–cell-autonomous neurotoxicity in HD. SIGNIFICANCE STATEMENT Huntington's disease (HD) is characterized by selective neurodegeneration that preferentially occurs in the striatal medium spiny neurons. Recent studies in different HD mouse models demonstrated that dysfunction of astrocytes, a major type of glial cell, leads to neuronal vulnerability. Emerging evidence shows that exosomes secreted from astrocytes contain neuroprotective cargoes that could support the survival of neighboring neurons. We found that mHtt in astrocytes impairs exosome secretion by decreasing αB-crystallin, a protein that is expressed mainly in glial cells and mediates exosome secretion. Overexpression of αB-crystallin could alleviate the deficient exosome release and neuropathology in HD mice. Our results revealed a new pathological pathway that affects the critical support of glial cells to neurons in the HD brain. PMID:28893927

In vivo cell-autonomous transcriptional abnormalities revealed in mice expressing mutant huntingtin in striatal but not cortical neurons.

PubMed

Thomas, Elizabeth A; Coppola, Giovanni; Tang, Bin; Kuhn, Alexandre; Kim, SoongHo; Geschwind, Daniel H; Brown, Timothy B; Luthi-Carter, Ruth; Ehrlich, Michelle E

2011-03-15

Huntington's disease (HD), caused by a CAG repeat expansion in the huntingtin (HTT) gene, is characterized by abnormal protein aggregates and motor and cognitive dysfunction. Htt protein is ubiquitously expressed, but the striatal medium spiny neuron (MSN) is most susceptible to dysfunction and death. Abnormal gene expression represents a core pathogenic feature of HD, but the relative roles of cell-autonomous and non-cell-autonomous effects on transcription remain unclear. To determine the extent of cell-autonomous dysregulation in the striatum in vivo, we examined genome-wide RNA expression in symptomatic D9-N171-98Q (a.k.a. DE5) transgenic mice in which the forebrain expression of the first 171 amino acids of human Htt with a 98Q repeat expansion is limited to MSNs. Microarray data generated from these mice were compared with those generated on the identical array platform from a pan-neuronal HD mouse model, R6/2, carrying two different CAG repeat lengths, and a relatively high degree of overlap of changes in gene expression was revealed. We further focused on known canonical pathways associated with excitotoxicity, oxidative stress, mitochondrial dysfunction, dopamine signaling and trophic support. While genes related to excitotoxicity, dopamine signaling and trophic support were altered in both DE5 and R6/2 mice, which may be either cell autonomous or non-cell autonomous, genes related to mitochondrial dysfunction, oxidative stress and the peroxisome proliferator-activated receptor are primarily affected in DE5 transgenic mice, indicating cell-autonomous mechanisms. Overall, HD-induced dysregulation of the striatal transcriptome can be largely attributed to intrinsic effects of mutant Htt, in the absence of expression in cortical neurons.

Degradation of misfolded proteins by autophagy: is it a strategy for Huntington's disease treatment?

PubMed

Lin, Fang; Qin, Zheng-Hong

2013-01-01

Autophagy is a degradation pathway for long-lived cytoplasmic proteins, protein complexes, or damaged organelles. The accumulation and aggregation of misfolded proteins are hallmarks of several neurodegenerative diseases. Many researchers have reported that autophagy degrades disease-causing misfolded and aggregated proteins, including mutant huntingtin (Htt) in Huntington's disease, mutant synuclein in familial Parkingson's disease, mutant Cu, Zn-Superoxide dismutase (SOD1) in familial amyotrophic lateral sclerosis. In this review, we will bring up new evidence to elucidate the involvement of autophagy in degradation of mutant Htt, discuss the mechanisms regulating the degradation of mutant Htt by autophagy and the therapeutic effects of drugs that enhance autophagy to improve clearance of mutant Htt. We propose that enhancement of autophagy by drugs may be a strategy to treat or retard progression of Huntington's disease.

Dysregulation of C/EBPalpha by mutant Huntingtin causes the urea cycle deficiency in Huntington's disease.

PubMed

Chiang, Ming-Chang; Chen, Hui-Mei; Lee, Yi-Hsin; Chang, Hao-Hung; Wu, Yi-Chih; Soong, Bing-Wen; Chen, Chiung-Mei; Wu, Yih-Ru; Liu, Chin-San; Niu, Dau-Ming; Wu, Jer-Yuarn; Chen, Yuan-Tsong; Chern, Yijuang

2007-03-01

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by a CAG trinucleotide expansion in the Huntingtin (Htt) gene. Using two mouse models of HD, we demonstrate that the urea cycle deficiency characterized by hyperammonemia, high blood citrulline and suppression of urea cycle enzymes is a prominent feature of HD. The resultant ammonia toxicity might exacerbate the neurological deficits of HD. Suppression of C/EBPalpha, a crucial transcription factor for the transcription of urea cycle enzymes, appears to mediate the urea cycle deficiency in HD. We found that in the presence of mutant Htt, C/EBPalpha loses its ability to interact with an important cofactor (CREB-binding protein). Moreover, mutant Htt recruited C/EBPalpha into aggregates, as well as suppressed expression of the C/EBPalpha gene. Consumption of protein-restricted diets not only led to the restoration of C/EBPalpha's activity, and repair of the urea cycle deficiency and hyperammonemia, but also ameliorated the formation of Htt aggregates, the motor deterioration, the suppression of striatal brain-derived neurotrophic factor and the normalization of three protein chaperones (Hsp27, Hsp70 and Hsp90). Treatments aimed at repairing the urea cycle deficiency may provide a new strategy for dealing with HD.

Amyloid Precursor Protein Haploinsufficiency Preferentially Mediates Brain Iron Accumulation in Mice Transgenic for The Huntington's Disease Mutation.

PubMed

Berggren, Kiersten; Agrawal, Sonal; Fox, Julia A; Hildenbrand, Justin; Nelson, Ryan; Bush, Ashley I; Fox, Jonathan H

2017-01-01

Huntington's disease (HD) is an autosomal dominant disorder caused by a CAG expansion in the huntingtin gene that results in expression of mutant huntingtin protein. Iron accumulates in HD brain neurons. Amyloid precursor protein (APP) promotes neuronal iron export. However, the role of APP in brain iron accumulation in HD is unclear. To determine the effects of APP insufficiency on HD in YAC128 mice. We crossed APP hemizygous mice (APP+/-) with YAC128 mice that are transgenic (Tg) for human mutant huntingtin (hmHTT) to generate APP+/+ hmHTT-/-, APP+/- hmHTT-/-, APP+/+ hmHTT+/- and APP+/- hmHTT+/- progeny. Mice were evaluated for behavioral, biochemical and neuropathology HD outcomes at 2-12 months of age. APP heterozygosity decreased cortical APP 25% and 60% in non-Tg and Tg mice, respectively. Cerebral and striatal iron levels were increased by APP knockdown in Tg mice only. Nest-building behavior was decreased in Tg mice; APP knockdown decreased nest building in non-Tg but not Tg mice. Rota-rod endurance was decreased in Tg mice. APP+/- hHTT+/- mice demonstrated additional decreases in rota-rod endurance from 4-10 months of age. Tg mice had smaller striatal volumes and fewer striatal neurons but were not affected by APP knockdown. APP heterozygosity results in greater decreases of cortical APP in Tg versus non-Tg mice. Mutant huntingtin transgenic mice develop brain iron accumulation as a result of greater suppression of APP levels. Elevated brain iron in Tg mice was associated with a decline in motor endurance consistent with a disease promoting effect of iron in the YAC128 model of human HD.

Huntingtin regulates Ca(2+) chemotaxis and K(+)-facilitated cAMP chemotaxis, in conjunction with the monovalent cation/H(+) exchanger Nhe1, in a model developmental system: insights into its possible role in Huntington׳s disease.

PubMed

Wessels, Deborah; Lusche, Daniel F; Scherer, Amanda; Kuhl, Spencer; Myre, Michael A; Soll, David R

2014-10-01

Huntington׳s disease is a neurodegenerative disorder, attributable to an expanded trinucleotide repeat in the coding region of the human HTT gene, which encodes the protein huntingtin. These mutations lead to huntingtin fragment inclusions in the striatum of the brain. However, the exact function of normal huntingtin and the defect causing the disease remain obscure. Because there are indications that huntingtin plays a role in Ca(2+) homeostasis, we studied the deletion mutant of the HTT ortholog in the model developmental system Dictyostelium discoideum, in which Ca(2+) plays a role in receptor-regulated behavior related to the aggregation process that leads to multicellular morphogenesis. The D. discoideum htt(-)-mutant failed to undergo both K(+)-facilitated chemotaxis in spatial gradients of the major chemoattractant cAMP, and chemotaxis up a spatial gradient of Ca(2+), but behaved normally in Ca(2+)-facilitated cAMP chemotaxis and Ca(2+)-dependent flow-directed motility. This was the same phenotypic profile of the null mutant of Nhel, a monovalent cation/H(+)exchanger. The htt(-)-mutant also failed to orient correctly during natural aggregation, as was the case for the Nhel mutant. Moreover, in a K(+)-based buffer the normal localization of actin was similarly defective in both htt(-) and nhe1(-) cells in a K(+)-based buffer, and the normal localization of Nhe1 was disrupted in the htt(-) mutant. These observations demonstrate that Htt and Nhel play roles in the same specific cation-facilitated behaviors and that Nhel localization is directly or indirectly regulated by Htt. Similar cation-dependent behaviors and a similar relationship between Htt and Nhe1 have not been reported for mammalian neurons and deserves investigation, especially as it may relate to Huntington׳s disease. Copyright © 2014 Elsevier Inc. All rights reserved.

Huntingtin Acts Non Cell-Autonomously on Hippocampal Neurogenesis and Controls Anxiety-Related Behaviors in Adult Mouse

PubMed Central

Pla, Patrick; Orvoen, Sophie; Benstaali, Caroline; Dodier, Sophie; Gardier, Alain M.; David, Denis J.; Humbert, Sandrine; Saudou, Frédéric

2013-01-01

Huntington’s disease (HD) is a fatal neurodegenerative disease, characterized by motor defects and psychiatric symptoms, including mood disorders such as anxiety and depression. HD is caused by an abnormal polyglutamine (polyQ) expansion in the huntingtin (HTT) protein. The development and analysis of various mouse models that express pathogenic polyQ-HTT revealed a link between mutant HTT and the development of anxio-depressive behaviors and various hippocampal neurogenesis defects. However, it is unclear whether such phenotype is linked to alteration of HTT wild-type function in adults. Here, we report the analysis of a new mouse model in which HTT is inducibly deleted from adult mature cortical and hippocampal neurons using the CreERT2/Lox system. These mice present defects in both the survival and the dendritic arborization of hippocampal newborn neurons. Our data suggest that these non-cell autonomous effects are linked to defects in both BDNF transport and release upon HTT silencing in hippocampal neurons, and in BDNF/TrkB signaling. The controlled deletion of HTT also had anxiogenic-like effects. Our results implicate endogenous wild-type HTT in adult hippocampal neurogenesis and in the control of mood disorders. PMID:24019939

Sulforaphane enhances proteasomal and autophagic activities in mice and is a potential therapeutic reagent for Huntington's disease.

PubMed

Liu, Yanying; Hettinger, Casey L; Zhang, Dong; Rezvani, Khosrow; Wang, Xuejun; Wang, Hongmin

2014-05-01

The ubiquitin proteasome system (UPS) is impaired in Huntington's disease, a devastating neurodegenerative disorder. Sulforaphane, a naturally occurring compound, has been shown to stimulate UPS activity in cell cultures. To test whether sulforaphane enhances UPS function in vivo, we treated UPS function reporter mice ubiquitously expressing the green fluorescence protein (GFP) fused to a constitutive degradation signal that promotes its rapid degradation in the conditions of a healthy UPS. The modified GFP is termed GFP UPS reporter (GFPu). We found that both GFPu and ubiquitinated protein levels were significantly reduced and the three peptidase activities of the proteasome were increased in the brain and peripheral tissues of the mice. Interestingly, sulforaphane treatment also enhanced autophagy activity in the brain and the liver. To further examine whether sulforaphane promotes mutant huntingtin (mHtt) degradation, we treated Huntington's disease cells with sulforaphane and found that sulforaphane not only enhanced mHtt degradation but also reduced mHtt cytotoxicity. Sulforaphane-mediated mHtt degradation was mainly through the UPS pathway as the presence of a proteasome inhibitor abolished this effect. Taken together, these data indicate that sulforaphane activates protein degradation machineries in both the brain and peripheral tissues and may be a therapeutic reagent for Huntington's disease and other intractable disorders. Accumulation of mutant huntingtin (mHtt) protein causes Huntington's disease (HD). Sulforaphane (SFN), a naturally occurring compound, increased proteasome and autophagy activities in vivo and enhanced mHtt turnover and cell survival in HD cell models. SFN-mediated mHtt degradation is mainly through the proteasome pathway. These data suggest that SFN can be a therapeutic reagent for treating HD and other intractable disorders. © 2014 International Society for Neurochemistry.

Increased Steady-State Mutant Huntingtin mRNA in Huntington's Disease Brain.

PubMed

Liu, Wanzhao; Chaurette, Joanna; Pfister, Edith L; Kennington, Lori A; Chase, Kathryn O; Bullock, Jocelyn; Vonsattel, Jean Paul G; Faull, Richard L M; Macdonald, Douglas; DiFiglia, Marian; Zamore, Phillip D; Aronin, Neil

2013-01-01

Huntington's disease is caused by expansion of CAG trinucleotide repeats in the first exon of the huntingtin gene, which is essential for both development and neurogenesis. Huntington's disease is autosomal dominant. The normal allele contains 6 to 35 CAG triplets (average, 18) and the mutant, disease-causing allele contains >36 CAG triplets (average, 42). We examined 279 postmortem brain samples, including 148 HD and 131 non-HD controls. A total of 108 samples from 87 HD patients that are heterozygous at SNP rs362307, with a normal allele (18 to 27 CAG repeats) and a mutant allele (39 to 73 CAG repeats) were used to measure relative abundance of mutant and wild-type huntingtin mRNA. We used allele-specific, quantitative RT-PCR based on SNP heterozygosity to estimate the relative amount of mutant versus normal huntingtin mRNA in postmortem brain samples from patients with Huntington's disease. In the cortex and striatum, the amount of mRNA from the mutant allele exceeds that from the normal allele in 75% of patients. In the cerebellum, no significant difference between the two alleles was evident. Brain tissues from non-HD controls show no significant difference between two alleles of huntingtin mRNAs. Allelic differences were more pronounced at early neuropathological grades (grades 1 and 2) than at late grades (grades 3 and 4). More mutant HTT than normal could arise from increased transcription of mutant HTT allele, or decreased clearance of mutant HTT mRNA, or both. An implication is that equimolar silencing of both alleles would increase the mutant HTT to normal HTT ratio.

Possible involvement of self-defense mechanisms in the preferential vulnerability of the striatum in Huntington's disease

PubMed Central

Francelle, Laetitia; Galvan, Laurie; Brouillet, Emmanuel

2014-01-01

HD is caused by a mutation in the huntingtin gene that consists in a CAG repeat expansion translated into an abnormal poly-glutamine (polyQ) tract in the huntingtin (Htt) protein. The most striking neuropathological finding in HD is the atrophy of the striatum. The regional expression of mutant Htt (mHtt) is ubiquitous in the brain and cannot explain by itself the preferential vulnerability of the striatum in HD. mHtt has been shown to produce an early defect in transcription, through direct alteration of the function of key regulators of transcription and in addition, more indirectly, as a result of compensatory responses to cellular stress. In this review, we focus on gene products that are preferentially expressed in the striatum and have down- or up-regulated expression in HD and, as such, may play a crucial role in the susceptibility of the striatum to mHtt. Many of these striatal gene products are for a vast majority down-regulated and more rarely increased in HD. Recent research shows that some of these striatal markers have a pro-survival/neuroprotective role in neurons (e.g., MSK1, A2A, and CB1 receptors) whereas others enhance the susceptibility of striatal neurons to mHtt (e.g., Rhes, RGS2, D2 receptors). The down-regulation of these latter proteins may be considered as a potential self-defense mechanism to slow degeneration. For a majority of the striatal gene products that have been identified so far, their function in the striatum is unknown and their modifying effects on mHtt toxicity remain to be experimentally addressed. Focusing on these striatal markers may contribute to a better understanding of HD pathogenesis, and possibly the identification of novel therapeutic targets. PMID:25309327

Possible involvement of self-defense mechanisms in the preferential vulnerability of the striatum in Huntington's disease.

PubMed

Francelle, Laetitia; Galvan, Laurie; Brouillet, Emmanuel

2014-01-01

HD is caused by a mutation in the huntingtin gene that consists in a CAG repeat expansion translated into an abnormal poly-glutamine (polyQ) tract in the huntingtin (Htt) protein. The most striking neuropathological finding in HD is the atrophy of the striatum. The regional expression of mutant Htt (mHtt) is ubiquitous in the brain and cannot explain by itself the preferential vulnerability of the striatum in HD. mHtt has been shown to produce an early defect in transcription, through direct alteration of the function of key regulators of transcription and in addition, more indirectly, as a result of compensatory responses to cellular stress. In this review, we focus on gene products that are preferentially expressed in the striatum and have down- or up-regulated expression in HD and, as such, may play a crucial role in the susceptibility of the striatum to mHtt. Many of these striatal gene products are for a vast majority down-regulated and more rarely increased in HD. Recent research shows that some of these striatal markers have a pro-survival/neuroprotective role in neurons (e.g., MSK1, A2A, and CB1 receptors) whereas others enhance the susceptibility of striatal neurons to mHtt (e.g., Rhes, RGS2, D2 receptors). The down-regulation of these latter proteins may be considered as a potential self-defense mechanism to slow degeneration. For a majority of the striatal gene products that have been identified so far, their function in the striatum is unknown and their modifying effects on mHtt toxicity remain to be experimentally addressed. Focusing on these striatal markers may contribute to a better understanding of HD pathogenesis, and possibly the identification of novel therapeutic targets.

Quantification Assays for Total and Polyglutamine-Expanded Huntingtin Proteins

PubMed Central

Boogaard, Ivette; Smith, Melanie; Pulli, Kristiina; Szynol, Agnieszka; Albertus, Faywell; Lamers, Marieke B. A. C.; Dijkstra, Sipke; Kordt, Daniel; Reindl, Wolfgang; Herrmann, Frank; McAllister, George; Fischer, David F.; Munoz-Sanjuan, Ignacio

2014-01-01

The expansion of a CAG trinucleotide repeat in the huntingtin gene, which produces huntingtin protein with an expanded polyglutamine tract, is the cause of Huntington's disease (HD). Recent studies have reported that RNAi suppression of polyglutamine-expanded huntingtin (mutant HTT) in HD animal models can ameliorate disease phenotypes. A key requirement for such preclinical studies, as well as eventual clinical trials, aimed to reduce mutant HTT exposure is a robust method to measure HTT protein levels in select tissues. We have developed several sensitive and selective assays that measure either total human HTT or polyglutamine-expanded human HTT proteins on the electrochemiluminescence Meso Scale Discovery detection platform with an increased dynamic range over other methods. In addition, we have developed an assay to detect endogenous mouse and rat HTT proteins in pre-clinical models of HD to monitor effects on the wild type protein of both allele selective and non-selective interventions. We demonstrate the application of these assays to measure HTT protein in several HD in vitro cellular and in vivo animal model systems as well as in HD patient biosamples. Furthermore, we used purified recombinant HTT proteins as standards to quantitate the absolute amount of HTT protein in such biosamples. PMID:24816435

Impaired brain energy metabolism in the BACHD mouse model of Huntington's disease: critical role of astrocyte–neuron interactions

PubMed Central

Boussicault, Lydie; Hérard, Anne-Sophie; Calingasan, Noel; Petit, Fanny; Malgorn, Carole; Merienne, Nicolas; Jan, Caroline; Gaillard, Marie-Claude; Lerchundi, Rodrigo; Barros, Luis F; Escartin, Carole; Delzescaux, Thierry; Mariani, Jean; Hantraye, Philippe; Flint Beal, M; Brouillet, Emmanuel; Véga, Céline; Bonvento, Gilles

2014-01-01

Huntington's disease (HD) is caused by cytosine-adenine-guanine (CAG) repeat expansions in the huntingtin (Htt) gene. Although early energy metabolic alterations in HD are likely to contribute to later neurodegenerative processes, the cellular and molecular mechanisms responsible for these metabolic alterations are not well characterized. Using the BACHD mice that express the full-length mutant huntingtin (mHtt) protein with 97 glutamine repeats, we first demonstrated localized in vivo changes in brain glucose use reminiscent of what is observed in premanifest HD carriers. Using biochemical, molecular, and functional analyses on different primary cell culture models from BACHD mice, we observed that mHtt does not directly affect metabolic activity in a cell autonomous manner. However, coculture of neurons with astrocytes from wild-type or BACHD mice identified mutant astrocytes as a source of adverse non-cell autonomous effects on neuron energy metabolism possibly by increasing oxidative stress. These results suggest that astrocyte-to-neuron signaling is involved in early energy metabolic alterations in HD. PMID:24938402

Personalized gene silencing therapeutics for Huntington disease.

PubMed

Kay, C; Skotte, N H; Southwell, A L; Hayden, M R

2014-07-01

Gene silencing offers a novel therapeutic strategy for dominant genetic disorders. In specific diseases, selective silencing of only one copy of a gene may be advantageous over non-selective silencing of both copies. Huntington disease (HD) is an autosomal dominant disorder caused by an expanded CAG trinucleotide repeat in the Huntingtin gene (HTT). Silencing both expanded and normal copies of HTT may be therapeutically beneficial, but preservation of normal HTT expression is preferred. Allele-specific methods can selectively silence the mutant HTT transcript by targeting either the expanded CAG repeat or single nucleotide polymorphisms (SNPs) in linkage disequilibrium with the expansion. Both approaches require personalized treatment strategies based on patient genotypes. We compare the prospect of safe treatment of HD by CAG- and SNP-specific silencing approaches and review HD population genetics used to guide target identification in the patient population. Clinical implementation of allele-specific HTT silencing faces challenges common to personalized genetic medicine, requiring novel solutions from clinical scientists and regulatory authorities. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Methylene Blue Partially Rescues Heart Defects in a Drosophila Model of Huntington's Disease.

PubMed

Heidari, Raheleh; Monnier, Véronique; Martin, Elodie; Tricoire, Hervé

2015-01-01

Huntington's disease (HD) is a Polyglutamine disease caused by the presence of CAG repeats in the first exon of Huntingtin (Htt), a large protein with multiple functions. In addition to neurodegeneration of specific brain regions, notably the striatum, HD also shows alterations in peripheral tissues, such as the heart, skeletal muscles or peripheral endocrine glands. Mutant Huntingtin (mHtt)-driven mitochondrial impairment may underlie some of the CNS and peripheral tissues dysfunctions, especially in tissues with high energy demand such as the heart. The aim of this study is to characterize two new inducible Drosophila HD heart models and to assay the therapeutic potential of methylene blue in these HD models. We report the construction of inducible Drosophila HD heart models, expressing two Nter fragments of the protein encompassing either exon 1 or the first 171 amino acids and the characterization of heart phenotypes in vivo. We show that both mHtt fragments are able to impair fly cardiac function with different characteristics. Additionally, expression of mHtt, which was limited to adulthood only, leads to mild heart impairment, as opposed to a strong and age-dependent phenotype observed when mHtt expression was driven during both developmental and adult stages. We report that treatment with methylene blue (MB), a protective compound in mitochondria-related diseases, partially protects the fly's heart against mHtt-induced toxicity, but does not rescue neuronal or glial phenotypes in other fly models of HD. This may be linked to its low penetration through the fly's blood-brain barrier. Our data suggest that improvement of mitochondrial function by MB, or related compounds, could be an efficient therapeutic strategy to prevent cardiac failure in HD patients.

Cellular Models: HD Patient-Derived Pluripotent Stem Cells.

PubMed

Geater, Charlene; Hernandez, Sarah; Thompson, Leslie; Mattis, Virginia B

2018-01-01

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by expanded polyglutamine (polyQ)-encoding repeats in the Huntingtin (HTT) gene. Traditionally, HD cellular models consisted of either patient cells not affected by disease or rodent neurons expressing expanded polyQ repeats in HTT. As these models can be limited in their disease manifestation or proper genetic context, respectively, human HD pluripotent stem cells (PSCs) are currently under investigation as a way to model disease in patient-derived neurons and other neural cell types. This chapter reviews embryonic stem cell (ESC) and induced pluripotent stem cell (iPSC) models of disease, including published differentiation paradigms for neurons and their associated phenotypes, as well as current challenges to the field such as validation of the PSCs and PSC-derived cells. Highlighted are potential future technical advances to HD PSC modeling, including transdifferentiation, complex in vitro multiorgan/system reconstruction, and personalized medicine. Using a human HD patient model of the central nervous system, hopefully one day researchers can tease out the consequences of mutant HTT (mHTT) expression on specific cell types within the brain in order to identify and test novel therapies for disease.

Insertion mutation at the C-terminus of the serotonin transporter disrupts brain serotonin function and emotion-related behaviors in mice.

PubMed

Zhao, S; Edwards, J; Carroll, J; Wiedholz, L; Millstein, R A; Jaing, C; Murphy, D L; Lanthorn, T H; Holmes, A

2006-06-19

The 5-hydroxytryptamine transporter (5-HTT) regulates 5-hydroxytryptamine (5-HT) neurotransmission by removing 5-HT from the synaptic cleft. Emerging evidence from clinical and genetic studies implicates the 5-HTT in various neuropsychiatric conditions, including anxiety and depression. Here we report that a 5-HTT null mutant mouse line was generated by gene trapping that disrupted the sequence encoding the C-terminus of 5-HTT. This mutation resulted in significant reduction of 5-HTT mRNA and loss of 5-HTT protein. Brain levels of 5-HT and its major metabolite, 5-hydroxyindoleacetic acid, were markedly decreased in C-terminus 5-HTT -/- mice, while 5-HT uptake or 5-HT content in platelets was absent. Behavioral phenotyping showed that C-terminus 5-HTT -/- mice were normal on a screen for gross behavioral, neurological, and sensory functions. In the tail suspension test for depression-related behavior, C-terminus 5-HTT -/- mice showed increased immobility relative to their +/+ controls. By comparison, a previously generated line of 5-HTT -/- mice lacking exon 2, encoding the N-terminus of the 5-HTT, showed abnormally high immobility in response to repeated, but not acute, exposure to the tail suspension test. In a novel, brightly-lit open field, both C-terminus 5-HTT -/- mice and N-terminus 5-HTT -/- mice displayed decreased center time and reduced locomotor activity compared with their +/+ controls. Both mutant lines buried significantly fewer marbles than their +/+ controls in the marble burying test. These findings further demonstrate the neurobiological functions of the 5-HTT and add to a growing literature linking genetic variation in 5-HTT function with emotional abnormalities.

Huntington’s Disease: The Past, Present, and Future Search for Disease Modifiers

PubMed Central

Clabough, Erin B.D.

2013-01-01

Huntington’s disease (HD) is an autosomal dominant genetic disorder that specifically causes neurodegeneration of striatal neurons, resulting in a triad of symptoms that includes emotional, cognitive, and motor disturbances. The HD mutation causes a polyglutamine repeat expansion within the N-terminal of the huntingtin (Htt) protein. This expansion causes aggregate formation within the cytosol and nucleus due to the presence of misfolded mutant Htt, as well as altered interactions with Htt’s multiple binding partners, and changes in post-translational Htt modifications. The present review charts efforts toward a therapy that delays age of onset or slows symptom progression in patients affected by HD, as there is currently no effective treatment. Although silencing Htt expression appears promising as a disease modifying treatment, it should be attempted with caution in light of Htt’s essential roles in neural maintenance and development. Other therapeutic targets include those that boost aggregate dissolution, target excitotoxicity and metabolic issues, and supplement growth factors. PMID:23766742

Functions of Huntingtin in Germ Layer Specification and Organogenesis

PubMed Central

Nguyen, Giang D.; Molero, Aldrin E.; Gokhan, Solen; Mehler, Mark F.

2013-01-01

Huntington’s disease (HD) is a neurodegenerative disease caused by abnormal polyglutamine expansion in the huntingtin protein (Htt). Although both Htt and the HD pathogenic mutation (mHtt) are implicated in early developmental events, their individual involvement has not been adequately explored. In order to better define the developmental functions and pathological consequences of the normal and mutant proteins, respectively, we employed embryonic stem cell (ESC) expansion, differentiation and induction experiments using huntingtin knock-out (KO) and mutant huntingtin knock-in (Q111) mouse ESC lines. In KO ESCs, we observed impairments in the spontaneous specification and survival of ectodermal and mesodermal lineages during embryoid body formation and under inductive conditions using retinoic acid and Wnt3A, respectively. Ablation of BAX improves cell survival, but failed to correct defects in germ layer specification. In addition, we observed ensuing impairments in the specification and maturation of neural, hepatic, pancreatic and cardiomyocyte lineages. These developmental deficits occurred in concert with alterations in Notch, Hes1 and STAT3 signaling pathways. Moreover, in Q111 ESCs, we observed differential developmental stage-specific alterations in lineage specification and maturation. We also observed changes in Notch/STAT3 expression and activation. Our observations underscore essential roles of Htt in the specification of ectoderm, endoderm and mesoderm, in the specification of neural and non-neural organ-specific lineages, as well as cell survival during early embryogenesis. Remarkably, these developmental events are differentially deregulated by mHtt, raising the possibility that HD-associated early developmental impairments may contribute not only to region-specific neurodegeneration, but also to non-neural co-morbidities. PMID:23967334

Huntingtin protein: A new option for fixing the Huntington's disease countdown clock.

PubMed

Caterino, Marco; Squillaro, Tiziana; Montesarchio, Daniela; Giordano, Antonio; Giancola, Concetta; Melone, Mariarosa A B

2018-06-01

Huntington's disease is a dreadful, incurable disorder. It springs from the autosomal dominant mutation in the first exon of the HTT gene, which encodes for the huntingtin protein (HTT) and results in progressive neurodegeneration. Thus far, all the attempted approaches to tackle the mutant HTT-induced toxicity causing this disease have failed. The mutant protein comes with the aberrantly expanded poly-glutamine tract. It is primarily to blame for the build-up of β-amyloid-like HTT aggregates, deleterious once broadened beyond the critical ∼35-37 repeats threshold. Recent experimental findings have provided valuable information on the molecular basis underlying this HTT-driven neurodegeneration. These findings indicate that the poly-glutamine siding regions and many post-translation modifications either abet or counter the poly-glutamine tract. This review provides an overall, up-to-date insight into HTT biophysics and structural biology, particularly discussing novel pharmacological options to specifically target the mutated protein and thus inhibit its functions and toxicity. Copyright © 2018 Elsevier Ltd. All rights reserved.

Targeting the UPR transcription factor XBP1 protects against Huntington's disease through the regulation of FoxO1 and autophagy

PubMed Central

Vidal, Rene L.; Figueroa, Alicia; Court, Felipe A.; Thielen, Peter; Molina, Claudia; Wirth, Craig; Caballero, Benjamin; Kiffin, Roberta; Segura-Aguilar, Juan; Cuervo, Ana Maria; Glimcher, Laurie H.; Hetz, Claudio

2012-01-01

Mutations leading to expansion of a poly-glutamine track in Huntingtin (Htt) cause Huntington's disease (HD). Signs of endoplasmic reticulum (ER) stress have been recently reported in animal models of HD, associated with the activation of the unfolded protein response (UPR). Here we have investigated the functional contribution of ER stress to HD by targeting the expression of two main UPR transcription factors, XBP1 and ATF4 (activating transcription factor 4), in full-length mutant Huntingtin (mHtt) transgenic mice. XBP1-deficient mice were more resistant to developing disease features, associated with improved neuronal survival and motor performance, and a drastic decrease in mHtt levels. The protective effects of XBP1 deficiency were associated with enhanced macroautophagy in both cellular and animal models of HD. In contrast, ATF4 deficiency did not alter mHtt levels. Although, XBP1 mRNA splicing was observed in the striatum of HD transgenic brains, no changes in the levels of classical ER stress markers were detected in symptomatic animals. At the mechanistic level, we observed that XBP1 deficiency led to augmented expression of Forkhead box O1 (FoxO1), a key transcription factor regulating autophagy in neurons. In agreement with this finding, ectopic expression of FoxO1 enhanced autophagy and mHtt clearance in vitro. Our results provide strong evidence supporting an involvement of XBP1 in HD pathogenesis probably due to an ER stress-independent mechanism involving the control of FoxO1 and autophagy levels. PMID:22337954

Adeno-Associated Viral Vector Serotype DJ-Mediated Overexpression of N171-82Q-Mutant Huntingtin in the Striatum of Juvenile Mice Is a New Model for Huntington's Disease.

PubMed

Jang, Minhee; Lee, Seung Eun; Cho, Ik-Hyun

2018-01-01

Huntington's disease (HD) is an autosomal-dominant inherited neurodegenerative disorder characterized by motor, psychiatric and cognitive symptoms. HD is caused by an expansion of CAG repeats in the huntingtin ( HTT ) gene in various areas of the brain including striatum. There are few suitable animal models to study the pathogenesis of HD and validate therapeutic strategies. Recombinant adeno-associated viral (AAV) vectors successfully transfer foreign genes to the brain of adult mammalians. In this article, we report a novel mouse model of HD generated by bilateral intrastriatal injection of AAV vector serotype DJ (AAV-DJ) containing N171-82Q mutant HTT (82Q) and N171-18Q wild type HTT (18Q; sham). The AAV-DJ-82Q model displayed motor dysfunctions in pole and rotarod tests beginning 4 weeks after viral infection in juvenile mice (8 weeks after birth). They showed behaviors reflecting neurodegeneration. They also showed increased apoptosis, robust glial activation and upregulated representative inflammatory cytokines (tumor necrosis factor-alpha (TNF-α) and interleukin (IL)-6), mediators (cyclooxygenase-2 and inducible nitric oxide synthase) and signaling pathways (nuclear factor kappa B and signal transducer and activator of transcription 3 (STAT3)) in the striatum at 10 weeks after viral infection (14 weeks after birth) via successful transfection of mutant HTT into neurons, microglia, and astrocytes in the striatum. However, little evidence of any of these events was found in mice infected with the AAV-DJ-18Q expressing construct. Intrastriatal injection of AAV-DJ-82Q might be useful as a novel in vivo model to investigate the biology of truncated N-terminal fragment (N171) in the striatum and to explore the efficacy of therapeutic strategies for HD.

siRNA screen identifies QPCT as a druggable target for Huntington's disease.

PubMed

Jimenez-Sanchez, Maria; Lam, Wun; Hannus, Michael; Sönnichsen, Birte; Imarisio, Sara; Fleming, Angeleen; Tarditi, Alessia; Menzies, Fiona; Dami, Teresa Ed; Xu, Catherine; Gonzalez-Couto, Eduardo; Lazzeroni, Giulia; Heitz, Freddy; Diamanti, Daniela; Massai, Luisa; Satagopam, Venkata P; Marconi, Guido; Caramelli, Chiara; Nencini, Arianna; Andreini, Matteo; Sardone, Gian Luca; Caradonna, Nicola P; Porcari, Valentina; Scali, Carla; Schneider, Reinhard; Pollio, Giuseppe; O'Kane, Cahir J; Caricasole, Andrea; Rubinsztein, David C

2015-05-01

Huntington's disease (HD) is a currently incurable neurodegenerative condition caused by an abnormally expanded polyglutamine tract in huntingtin (HTT). We identified new modifiers of mutant HTT toxicity by performing a large-scale 'druggable genome' siRNA screen in human cultured cells, followed by hit validation in Drosophila. We focused on glutaminyl cyclase (QPCT), which had one of the strongest effects on mutant HTT-induced toxicity and aggregation in the cell-based siRNA screen and also rescued these phenotypes in Drosophila. We found that QPCT inhibition induced the levels of the molecular chaperone αB-crystallin and reduced the aggregation of diverse proteins. We generated new QPCT inhibitors using in silico methods followed by in vitro screening, which rescued the HD-related phenotypes in cell, Drosophila and zebrafish HD models. Our data reveal a new HD druggable target affecting mutant HTT aggregation and provide proof of principle for a discovery pipeline from druggable genome screen to drug development.

Selective Roles of Normal and Mutant Huntingtin in Neural Induction and Early Neurogenesis

PubMed Central

Nguyen, Giang D.; Gokhan, Solen; Molero, Aldrin E.; Mehler, Mark F.

2013-01-01

Huntington's disease (HD) is a neurodegenerative disorder caused by abnormal polyglutamine expansion in the amino-terminal end of the huntingtin protein (Htt) and characterized by progressive striatal and cortical pathology. Previous reports have shown that Htt is essential for embryogenesis, and a recent study by our group revealed that the pathogenic form of Htt (mHtt) causes impairments in multiple stages of striatal development. In this study, we have examined whether HD-associated striatal developmental deficits are reflective of earlier maturational alterations occurring at the time of neurulation by assessing differential roles of Htt and mHtt during neural induction and early neurogenesis using an in vitro mouse embryonic stem cell (ESC) clonal assay system. We demonstrated that the loss of Htt in ESCs (KO ESCs) severely disrupts the specification of primitive and definitive neural stem cells (pNSCs, dNSCs, respectively) during the process of neural induction. In addition, clonally derived KO pNSCs and dNSCs displayed impaired proliferative potential, enhanced cell death and altered multi-lineage potential. Conversely, as observed in HD knock-in ESCs (Q111 ESCs), mHtt enhanced the number and size of pNSC clones, which exhibited enhanced proliferative potential and precocious neuronal differentiation. The transition from Q111 pNSCs to fibroblast growth factor 2 (FGF2)-responsive dNSCs was marked by potentiation in the number of dNSCs and altered proliferative potential. The multi-lineage potential of Q111 dNSCs was also enhanced with precocious neurogenesis and oligodendrocyte progenitor elaboration. The generation of Q111 epidermal growth factor (EGF)-responsive dNSCs was also compromised, whereas their multi-lineage potential was unaltered. These abnormalities in neural induction were associated with differential alterations in the expression profiles of Notch, Hes1 and Hes5. These cumulative observations indicate that Htt is required for multiple stages of neural induction, whereas mHtt enhances this process and promotes precocious neurogenesis and oligodendrocyte progenitor cell elaboration. PMID:23691206

Huntingtin Protein is Essential for Mitochondrial Metabolism, Bioenergetics and Structure in Murine Embryonic Stem Cells

PubMed Central

Ismailoglu, Ismail; Chen, Qiuying; Popowski, Melissa; Yang, Lili; Gross, Steven S.; Brivanlou, Ali H.

2014-01-01

Mutations in the Huntington locus (htt) have devastating consequences. Gain-of-poly-Q repeats in Htt protein causes Huntington's disease (HD), while htt-/- mutants display early embryonic lethality. Despite its importance, the function of Htt remains elusive. To address this, we compared more than 3,700 compounds in three syngeneic mouse embryonic stem cell (mESC) lines: htt-/-, extended poly-Q (Htt-Q140/7), and wildtype mESCs (Htt-Q7/7) using untargeted metabolite profiling. While Htt-Q140/7 cells, did not show major differences in cellular bioenergetics, we find extensive metabolic aberrations in htt-/- mESCs, including: (i) complete failure of ATP production despite preservation of the mitochondrial membrane potential; (ii) near-maximal glycolysis, with little or no glycolytic reserve; (iii) marked ketogenesis; (iv) depletion of intracellular NTPs; (v) accelerated purine biosynthesis and salvage; and (vi) loss of mitochondrial structural integrity. Together, our findings reveal that Htt is necessary for mitochondrial structure and function from the earliest stages of embryogenesis, providing a molecular explanation for htt-/- early embryonic lethality. PMID:24780625

Huntingtin protein is essential for mitochondrial metabolism, bioenergetics and structure in murine embryonic stem cells.

PubMed

Ismailoglu, Ismail; Chen, Qiuying; Popowski, Melissa; Yang, Lili; Gross, Steven S; Brivanlou, Ali H

2014-07-15

Mutations in the Huntington locus (htt) have devastating consequences. Gain-of-poly-Q repeats in Htt protein causes Huntington's disease (HD), while htt(-/-) mutants display early embryonic lethality. Despite its importance, the function of Htt remains elusive. To address this, we compared more than 3700 compounds in three syngeneic mouse embryonic stem cell (mESC) lines: htt(-/-), extended poly-Q (Htt-Q140/7), and wild-type mESCs (Htt-Q7/7) using untargeted metabolite profiling. While Htt-Q140/7 cells did not show major differences in cellular bioenergetics, we find extensive metabolic aberrations in htt(-/-) mESCs, including (i) complete failure of ATP production despite preservation of the mitochondrial membrane potential; (ii) near-maximal glycolysis, with little or no glycolytic reserve; (iii) marked ketogenesis; (iv) depletion of intracellular NTPs; (v) accelerated purine biosynthesis and salvage; and (vi) loss of mitochondrial structural integrity. Together, our findings reveal that Htt is necessary for mitochondrial structure and function from the earliest stages of embryogenesis, providing a molecular explanation for htt(-/-) early embryonic lethality. Copyright © 2014 Elsevier Inc. All rights reserved.

Adeno-Associated Viral Vector Serotype DJ-Mediated Overexpression of N171-82Q-Mutant Huntingtin in the Striatum of Juvenile Mice Is a New Model for Huntington’s Disease

PubMed Central

Jang, Minhee; Lee, Seung Eun; Cho, Ik-Hyun

2018-01-01

Huntington’s disease (HD) is an autosomal-dominant inherited neurodegenerative disorder characterized by motor, psychiatric and cognitive symptoms. HD is caused by an expansion of CAG repeats in the huntingtin (HTT) gene in various areas of the brain including striatum. There are few suitable animal models to study the pathogenesis of HD and validate therapeutic strategies. Recombinant adeno-associated viral (AAV) vectors successfully transfer foreign genes to the brain of adult mammalians. In this article, we report a novel mouse model of HD generated by bilateral intrastriatal injection of AAV vector serotype DJ (AAV-DJ) containing N171-82Q mutant HTT (82Q) and N171-18Q wild type HTT (18Q; sham). The AAV-DJ-82Q model displayed motor dysfunctions in pole and rotarod tests beginning 4 weeks after viral infection in juvenile mice (8 weeks after birth). They showed behaviors reflecting neurodegeneration. They also showed increased apoptosis, robust glial activation and upregulated representative inflammatory cytokines (tumor necrosis factor-alpha (TNF-α) and interleukin (IL)-6), mediators (cyclooxygenase-2 and inducible nitric oxide synthase) and signaling pathways (nuclear factor kappa B and signal transducer and activator of transcription 3 (STAT3)) in the striatum at 10 weeks after viral infection (14 weeks after birth) via successful transfection of mutant HTT into neurons, microglia, and astrocytes in the striatum. However, little evidence of any of these events was found in mice infected with the AAV-DJ-18Q expressing construct. Intrastriatal injection of AAV-DJ-82Q might be useful as a novel in vivo model to investigate the biology of truncated N-terminal fragment (N171) in the striatum and to explore the efficacy of therapeutic strategies for HD. PMID:29946240

Small molecule modulator of protein disulfide isomerase attenuates mutant huntingtin toxicity and inhibits endoplasmic reticulum stress in a mouse model of Huntington's disease.

PubMed

Zhou, Xiao; Li, Gang; Kaplan, Anna; Gaschler, Michael M; Zhang, Xiaoyan; Hou, Zhipeng; Jiang, Mali; Zott, Roseann; Cremers, Serge; Stockwell, Brent R; Duan, Wenzhen

2018-05-01

Huntington's disease (HD) is caused by a cytosine-adenine-guanine (CAG) trinucleotide repeat expansion in the huntingtin (HTT) gene encoding an elongated polyglutamine tract within the N-terminal of the huntingtin protein (Htt) and leads to Htt misfolding, aberrant protein aggregation, and progressive appearance of disease symptoms. Chronic activation of endoplasmic reticulum (ER) stress by mutant Htt (mHtt) results in cellular dysfunction and ultimately cell death. Protein disulfide isomerase (PDI) is a chaperone protein located in the ER. Our previous studies demonstrated that mHtt caused PDI to accumulate at mitochondria-associated ER membranes and triggered cell death, and that modulating PDI activity using small molecules protected cells again mHtt toxicity in cell and brain slice models of HD. In this study, we demonstrated that PDI is upregulated in the HD human brain, in cell and mouse models. Chronic administration of a reversible, brain penetrable small molecule PDI modulator, LOC14 (20 mg/kg/day), significantly improved motor function, attenuated brain atrophy and extended survival in the N171-82Q HD mice. Moreover, LOC14 preserved medium spiny neuronal marker dopamine- and cyclic-AMP-regulated phosphoprotein of molecular weight 32 000 (DARPP32) levels in the striatum of HD mice. Mechanistic study revealed that LOC14 suppressed mHtt-induced ER stress, indicated by repressing the abnormally upregulated ER stress proteins in HD models. These findings suggest that LOC14 is promising to be further optimized for clinical trials of HD, and modulation of signaling pathways coping with ER stress may constitute an attractive approach to reduce mHtt toxicity and identify new therapeutic targets for treatment of HD.

Insulin and IGF-1 improve mitochondrial function in a PI-3K/Akt-dependent manner and reduce mitochondrial generation of reactive oxygen species in Huntington's disease knock-in striatal cells.

PubMed

Ribeiro, Márcio; Rosenstock, Tatiana R; Oliveira, Ana M; Oliveira, Catarina R; Rego, A Cristina

2014-09-01

Oxidative stress and mitochondrial dysfunction have been described in Huntington's disease, a disorder caused by expression of mutant huntingtin (mHtt). IGF-1 was previously shown to protect HD cells, whereas insulin prevented neuronal oxidative stress. In this work we analyzed the role of insulin and IGF-1 in striatal cells derived from HD knock-in mice on mitochondrial production of reactive oxygen species (ROS) and related antioxidant and signaling pathways influencing mitochondrial function. Insulin and IGF-1 decreased mitochondrial ROS induced by mHtt and normalized mitochondrial SOD activity, without affecting intracellular glutathione levels. IGF-1 and insulin promoted Akt phosphorylation without changing the nuclear levels of phosphorylated Nrf2 or Nrf2/ARE activity. Insulin and IGF-1 treatment also decreased mitochondrial Drp1 phosphorylation, suggesting reduced mitochondrial fragmentation, and ameliorated mitochondrial function in HD cells in a PI-3K/Akt-dependent manner. This was accompanied by increased total and phosphorylated Akt, Tfam, and mitochondrial-encoded cytochrome c oxidase II, as well as Tom20 and Tom40 in mitochondria of insulin- and IGF-1-treated mutant striatal cells. Concomitantly, insulin/IGF-1-treated mutant cells showed reduced apoptotic features. Hence, insulin and IGF-1 improve mitochondrial function and reduce mitochondrial ROS caused by mHtt by activating the PI-3K/Akt signaling pathway, in a process independent of Nrf2 transcriptional activity, but involving enhanced mitochondrial levels of Akt and mitochondrial-encoded complex IV subunit. Copyright © 2014 Elsevier Inc. All rights reserved.

Viral vector mediated expression of mutant huntingtin in the dorsal raphe produces disease-related neuropathology but not depressive-like behaviors in wildtype mice.

PubMed

Pitzer, Mark; Lueras, Jordan; Warden, Anna; Weber, Sydney; McBride, Jodi

2015-05-22

Huntington׳s disease (HD) is a neurodegenerative disorder caused by a mutation in the HTT gene (mHTT) encoding the protein huntingtin. An expansion in the gene׳s CAG repeat length renders a misfolded, dysfunctional protein with an abnormally long glutamine (Q) stretch at the N terminus that often incorporates into inclusion bodies and leads to neurodegeneration in many regions of the brain. HD is characterized by motor and cognitive decline as well as mood disorders, with depression being particularly common. Approximately 40% of the HD population suffers from depressive symptoms. Because these symptoms often manifest a decade or more prior to the knowledge that the person is at risk for the disease, a portion of the early depression in HD appears to be a consequence of the pathology arising from expression of the mutant gene. While the depression in HD patients is often treated with serotonin agonists, there is scant experimental evidence that the depression in HD responds well to these serotonin treatments or in a similar manner to how non-HD depression tends to respond. Additionally, at very early sub-threshold depression levels, abnormal changes in several neuronal populations are already detectable in HD patients, suggesting that a variety of brain structures may be involved. Taken together, the serotonin system is a viable candidate. However, at present there is limited evidence of the precise nuclei or circuits that play a role in HD depression. With this in mind, the current study was designed to control for the widespread brain neuropathology that occurs in HD and in transgenic mouse models of HD and focuses specifically on the influence of the midbrain dorsal raphe nucleus (DRN). The DRN provides the majority of the serotonin to the forebrain and exhibits cell loss in non-HD depression. Therefore, we employed a viral vector delivery system to investigate whether the over-expression of mHTT in the DRN׳s ventral sub-nuclei alone is sufficient to produce depressive-like behaviors. Wildtype mice were injected with an adeno-associated virus (AAV2/1) encoding HTT containing either a pathogenic (N171-82Q) or control (N171-16Q) CAG repeat length into the ventral DRN and depressive-like behaviors and motor behaviors were assessed for 12 weeks post-surgery. Quantitative PCR and immunohistochemistry (IHC) verified positive transduction in the ventral aspects of the DRN, including the ventral sub-nucleus (DRv) and interfascicular sub-nucleus (DRif). IHC demonstrated microgliosis in and around the injection site and mHTT-positive inclusions in serotonin-producing neurons and a small percentage of astrocytes in animals injected with N171-82Q compared to controls. Moreover, N171-82Q injected mice showed a 75% reduction in cells that stained positive for the serotonin synthesis enzyme, tryptophan hydroxylase-2 (TPH2) compared to controls (p<0.05). Despite mHTT-mediated pathology in the DRv and DRif, no significant changes in depressive-like behavior were detected. Consequently, we conclude that 12 weeks of N171-82Q expression in the ventral sub-nuclei of the DRN of wildtype mice causes characteristic disease-related cellular neuropathology but is not sufficient to elicit depressive-like behaviors. Ongoing studies are investigating whether a larger injection volume that transfects a larger percentage of the DRN and/or a longer time course of mHTT expression might elicit depressive-like behaviors. Moreover, mHTT expression in other regions of the brain, such as the hippocampal dentate gyrus and/or the frontal cortex might be necessary to elicit HD depression. Together, these results may prove helpful in addressing which therapeutic and/or pharmacological strategies might be most efficacious when treating depressive symptomology in patients suffering from HD. Copyright © 2015 Elsevier B.V. All rights reserved.

AMPK activation protects from neuronal dysfunction and vulnerability across nematode, cellular and mouse models of Huntington's disease

PubMed Central

Vázquez-Manrique, Rafael P.; Farina, Francesca; Cambon, Karine; Dolores Sequedo, María; Parker, Alex J.; Millán, José María; Weiss, Andreas; Déglon, Nicole; Neri, Christian

2016-01-01

The adenosine monophosphate activated kinase protein (AMPK) is an evolutionary-conserved protein important for cell survival and organismal longevity through the modulation of energy homeostasis. Several studies suggested that AMPK activation may improve energy metabolism and protein clearance in the brains of patients with vascular injury or neurodegenerative disease. However, in Huntington's disease (HD), AMPK may be activated in the striatum of HD mice at a late, post-symptomatic phase of the disease, and high-dose regiments of the AMPK activator 5-aminoimidazole-4-carboxamide ribonucleotide may worsen neuropathological and behavioural phenotypes. Here, we revisited the role of AMPK in HD using models that recapitulate the early features of the disease, including Caenorhabditis elegans neuron dysfunction before cell death and mouse striatal cell vulnerability. Genetic and pharmacological manipulation of aak-2/AMPKα shows that AMPK activation protects C. elegans neurons from the dysfunction induced by human exon-1 huntingtin (Htt) expression, in a daf-16/forkhead box O-dependent manner. Similarly, AMPK activation using genetic manipulation and low-dose metformin treatment protects mouse striatal cells expressing full-length mutant Htt (mHtt), counteracting their vulnerability to stress, with reduction of soluble mHtt levels by metformin and compensation of cytotoxicity by AMPKα1. Furthermore, AMPK protection is active in the mouse brain as delivery of gain-of-function AMPK-γ1 to mouse striata slows down the neurodegenerative effects of mHtt. Collectively, these data highlight the importance of considering the dynamic of HD for assessing the therapeutic potential of stress-response targets in the disease. We postulate that AMPK activation is a compensatory response and valid approach for protecting dysfunctional and vulnerable neurons in HD. PMID:26681807

A SNP in the HTT promoter alters NF-κB binding and is a bidirectional genetic modifier of Huntington disease.

PubMed

Bečanović, Kristina; Nørremølle, Anne; Neal, Scott J; Kay, Chris; Collins, Jennifer A; Arenillas, David; Lilja, Tobias; Gaudenzi, Giulia; Manoharan, Shiana; Doty, Crystal N; Beck, Jessalyn; Lahiri, Nayana; Portales-Casamar, Elodie; Warby, Simon C; Connolly, Colúm; De Souza, Rebecca A G; Tabrizi, Sarah J; Hermanson, Ola; Langbehn, Douglas R; Hayden, Michael R; Wasserman, Wyeth W; Leavitt, Blair R

2015-06-01

Cis-regulatory variants that alter gene expression can modify disease expressivity, but none have previously been identified in Huntington disease (HD). Here we provide in vivo evidence in HD patients that cis-regulatory variants in the HTT promoter are bidirectional modifiers of HD age of onset. HTT promoter analysis identified a NF-κB binding site that regulates HTT promoter transcriptional activity. A non-coding SNP, rs13102260:G > A, in this binding site impaired NF-κB binding and reduced HTT transcriptional activity and HTT protein expression. The presence of the rs13102260 minor (A) variant on the HD disease allele was associated with delayed age of onset in familial cases, whereas the presence of the rs13102260 (A) variant on the wild-type HTT allele was associated with earlier age of onset in HD patients in an extreme case-based cohort. Our findings suggest a previously unknown mechanism linking allele-specific effects of rs13102260 on HTT expression to HD age of onset and have implications for HTT silencing treatments that are currently in development.

Ubiquilin/Dsk2 promotes inclusion body formation and vacuole (lysosome)-mediated disposal of mutated huntingtin.

PubMed

Chuang, Kun-Han; Liang, Fengshan; Higgins, Ryan; Wang, Yanchang

2016-07-01

Ubiquilin proteins contain a ubiquitin-like domain (UBL) and ubiquitin-associated domain(s) that interact with the proteasome and ubiquitinated substrates, respectively. Previous work established the link between ubiquilin mutations and neurodegenerative diseases, but the function of ubiquilin proteins remains elusive. Here we used a misfolded huntingtin exon I containing a 103-polyglutamine expansion (Htt103QP) as a model substrate for the functional study of ubiquilin proteins. We found that yeast ubiquilin mutant (dsk2Δ) is sensitive to Htt103QP overexpression and has a defect in the formation of Htt103QP inclusion bodies. Our evidence further suggests that the UBL domain of Dsk2 is critical for inclusion body formation. Of interest, Dsk2 is dispensable for Htt103QP degradation when Htt103QP is induced for a short time before noticeable inclusion body formation. However, when the inclusion body forms after a long Htt103QP induction, Dsk2 is required for efficient Htt103QP clearance, as well as for autophagy-dependent delivery of Htt103QP into vacuoles (lysosomes). Therefore our data indicate that Dsk2 facilitates vacuole-mediated clearance of misfolded proteins by promoting inclusion body formation. Of importance, the defect of inclusion body formation in dsk2 mutants can be rescued by human ubiquilin 1 or 2, suggesting functional conservation of ubiquilin proteins. © 2016 Chuang et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Antisense oligonucleotide-mediated correction of transcriptional dysregulation is correlated with behavioral benefits in the YAC128 mouse model of Huntington's disease.

PubMed

Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S

2013-01-01

Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy shown associated with ASO-mediated correction of HD phenotypes and may provide a novel set of early biomarkers for evaluating future therapeutic concepts for HD.

Control of the structural landscape and neuronal proteotoxicity of mutant Huntingtin by domains flanking the polyQ tract

PubMed Central

Shen, Koning; Calamini, Barbara; Fauerbach, Jonathan A; Ma, Boxue; Shahmoradian, Sarah H; Serrano Lachapel, Ivana L; Chiu, Wah; Lo, Donald C; Frydman, Judith

2016-01-01

Many neurodegenerative diseases are linked to amyloid aggregation. In Huntington’s disease (HD), neurotoxicity correlates with an increased aggregation propensity of a polyglutamine (polyQ) expansion in exon 1 of mutant huntingtin protein (mHtt). Here we establish how the domains flanking the polyQ tract shape the mHtt conformational landscape in vitro and in neurons. In vitro, the flanking domains have opposing effects on the conformation and stabilities of oligomers and amyloid fibrils. The N-terminal N17 promotes amyloid fibril formation, while the C-terminal Proline Rich Domain destabilizes fibrils and enhances oligomer formation. However, in neurons both domains act synergistically to engage protective chaperone and degradation pathways promoting mHtt proteostasis. Surprisingly, when proteotoxicity was assessed in rat corticostriatal brain slices, either flanking region alone sufficed to generate a neurotoxic conformation, while the polyQ tract alone exhibited minimal toxicity. Linking mHtt structural properties to its neuronal proteostasis should inform new strategies for neuroprotection in polyQ-expansion diseases. DOI: http://dx.doi.org/10.7554/eLife.18065.001 PMID:27751235

The Analysis of Pendolino (peo) Mutants Reveals Differences in the Fusigenic Potential among Drosophila Telomeres

PubMed Central

Marzullo, Marta; Raffa, Grazia D.; Morciano, Patrizia; Raimondo, Domenico; Burla, Romina; Saggio, Isabella; Gatti, Maurizio

2015-01-01

Drosophila telomeres are sequence-independent structures that are maintained by transposition to chromosome ends of three specialized retroelements (HeT-A, TART and TAHRE; collectively designated as HTT) rather than telomerase activity. Fly telomeres are protected by the terminin complex (HOAP-HipHop-Moi-Ver) that localizes and functions exclusively at telomeres and by non-terminin proteins that do not serve telomere-specific functions. Although all Drosophila telomeres terminate with HTT arrays and are capped by terminin, they differ in the type of subtelomeric chromatin; the Y, XR, and 4L HTT are juxtaposed to constitutive heterochromatin, while the XL, 2L, 2R, 3L and 3R HTT are linked to the TAS repetitive sequences; the 4R HTT is associated with a chromatin that has features common to both euchromatin and heterochromatin. Here we show that mutations in pendolino (peo) cause telomeric fusions (TFs). The analysis of several peo mutant combinations showed that these TFs preferentially involve the Y, XR and 4th chromosome telomeres, a TF pattern never observed in the other 10 telomere-capping mutants so far characterized. peo encodes a non-terminin protein homologous to the E2 variant ubiquitin-conjugating enzymes. The Peo protein directly interacts with the terminin components, but peo mutations do not affect telomeric localization of HOAP, Moi, Ver and HP1a, suggesting that the peo-dependent telomere fusion phenotype is not due to loss of terminin from chromosome ends. peo mutants are also defective in DNA replication and PCNA recruitment. However, our results suggest that general defects in DNA replication are unable to induce TFs in Drosophila cells. We thus hypothesize that DNA replication in Peo-depleted cells results in specific fusigenic lesions concentrated in heterochromatin-associated telomeres. Alternatively, it is possible that Peo plays a dual function being independently required for DNA replication and telomere capping. PMID:26110638

A polymorphism in the 5'-flanking region of the serotonin transporter (5-HTT) gene affects fear-related behaviors of adult domestic chickens.

PubMed

Krause, E Tobias; Kjaer, Joergen B; Lüders, Carolin; van, Loc Phi

2017-07-14

The neural serotonin (5-HT)/serotonin transporter (5-HTT) system is involved in the regulation of physiological processes and emotional states. In humans, the short (S) allele in the 5-HTT gene-linked polymorphic region, which decreases 5-HTT expression, has been shown to be associated with behavioral changes including an increased level of anxiety. Also in birds a polymorphism in the 5-HTT gene is described, a deletion (D) has been found to have functional consequences on growth and locomotion. Furthermore, the D-allele leads to an increased 5-HTT expression compared to the wild type (W), a feature which is linked to lower levels of fear in mammalian species. Thus, we aimed here to test whether the polymorphism in the chicken 5-HTT gene also leads to respective alternations of fear-related behaviors. We tested 268 hens of three genotypes (W/W, W/D, D/D) in two behavioral paradigms (open field, light-dark test) to assess fear-related behavior. Both tests revealed that hens possessing the D-allele showed lower levels of fear than those having the W-allele. These similar outcomes in fear-related behaviors in an avian and a mammalian species are associated with an increased 5-HTT expression. In the human 5-HTT gene, the long (L) allele is linked to such increased expression, whereas in chickens it is the D-allele. Thus, increased 5-HTT expression causing decreased fear may be a general mechanism in vertebrates. Copyright © 2017 Elsevier B.V. All rights reserved.

Exosomes and Homeostatic Synaptic Plasticity Are Linked to Each other and to Huntington's, Parkinson's, and Other Neurodegenerative Diseases by Database-Enabled Analyses of Comprehensively Curated Datasets

PubMed Central

Wang, James K. T.; Langfelder, Peter; Horvath, Steve; Palazzolo, Michael J.

2017-01-01

Huntington's disease (HD) is a progressive and autosomal dominant neurodegeneration caused by CAG expansion in the huntingtin gene (HTT), but the pathophysiological mechanism of mutant HTT (mHTT) remains unclear. To study HD using systems biological methodologies on all published data, we undertook the first comprehensive curation of two key PubMed HD datasets: perturbation genes that impact mHTT-driven endpoints and therefore are putatively linked causally to pathogenic mechanisms, and the protein interactome of HTT that reflects its biology. We perused PubMed articles containing co-citation of gene IDs and MeSH terms of interest to generate mechanistic gene sets for iterative enrichment analyses and rank ordering. The HD Perturbation database of 1,218 genes highly overlaps the HTT Interactome of 1,619 genes, suggesting links between normal HTT biology and mHTT pathology. These two HD datasets are enriched for protein networks of key genes underlying two mechanisms not previously implicated in HD nor in each other: exosome synaptic functions and homeostatic synaptic plasticity. Moreover, proteins, possibly including HTT, and miRNA detected in exosomes from a wide variety of sources also highly overlap the HD datasets, suggesting both mechanistic and biomarker links. Finally, the HTT Interactome highly intersects protein networks of pathogenic genes underlying Parkinson's, Alzheimer's and eight non-HD polyglutamine diseases, ALS, and spinal muscular atrophy. These protein networks in turn highly overlap the exosome and homeostatic synaptic plasticity gene sets. Thus, we hypothesize that HTT and other neurodegeneration pathogenic genes form a large interlocking protein network involved in exosome and homeostatic synaptic functions, particularly where the two mechanisms intersect. Mutant pathogenic proteins cause dysfunctions at distinct points in this network, each altering the two mechanisms in specific fashion that contributes to distinct disease pathologies, depending on the gene mutation and the cellular and biological context. This protein network is rich with drug targets, and exosomes may provide disease biomarkers, thus enabling drug discovery. All the curated datasets are made available for other investigators. Elucidating the roles of pathogenic neurodegeneration genes in exosome and homeostatic synaptic functions may provide a unifying framework for the age-dependent, progressive and tissue selective nature of multiple neurodegenerative diseases. PMID:28611571

Exosomes and Homeostatic Synaptic Plasticity Are Linked to Each other and to Huntington's, Parkinson's, and Other Neurodegenerative Diseases by Database-Enabled Analyses of Comprehensively Curated Datasets.

PubMed

Wang, James K T; Langfelder, Peter; Horvath, Steve; Palazzolo, Michael J

2017-01-01

Huntington's disease (HD) is a progressive and autosomal dominant neurodegeneration caused by CAG expansion in the huntingtin gene ( HTT ), but the pathophysiological mechanism of mutant HTT (mHTT) remains unclear. To study HD using systems biological methodologies on all published data, we undertook the first comprehensive curation of two key PubMed HD datasets: perturbation genes that impact mHTT-driven endpoints and therefore are putatively linked causally to pathogenic mechanisms, and the protein interactome of HTT that reflects its biology. We perused PubMed articles containing co-citation of gene IDs and MeSH terms of interest to generate mechanistic gene sets for iterative enrichment analyses and rank ordering. The HD Perturbation database of 1,218 genes highly overlaps the HTT Interactome of 1,619 genes, suggesting links between normal HTT biology and mHTT pathology. These two HD datasets are enriched for protein networks of key genes underlying two mechanisms not previously implicated in HD nor in each other: exosome synaptic functions and homeostatic synaptic plasticity. Moreover, proteins, possibly including HTT, and miRNA detected in exosomes from a wide variety of sources also highly overlap the HD datasets, suggesting both mechanistic and biomarker links. Finally, the HTT Interactome highly intersects protein networks of pathogenic genes underlying Parkinson's, Alzheimer's and eight non-HD polyglutamine diseases, ALS, and spinal muscular atrophy. These protein networks in turn highly overlap the exosome and homeostatic synaptic plasticity gene sets. Thus, we hypothesize that HTT and other neurodegeneration pathogenic genes form a large interlocking protein network involved in exosome and homeostatic synaptic functions, particularly where the two mechanisms intersect. Mutant pathogenic proteins cause dysfunctions at distinct points in this network, each altering the two mechanisms in specific fashion that contributes to distinct disease pathologies, depending on the gene mutation and the cellular and biological context. This protein network is rich with drug targets, and exosomes may provide disease biomarkers, thus enabling drug discovery. All the curated datasets are made available for other investigators. Elucidating the roles of pathogenic neurodegeneration genes in exosome and homeostatic synaptic functions may provide a unifying framework for the age-dependent, progressive and tissue selective nature of multiple neurodegenerative diseases.

The de-ubiquitinating enzyme ataxin-3 does not modulate disease progression in a knock-in mouse model of Huntington disease.

PubMed

Zeng, Li; Tallaksen-Greene, Sara J; Wang, Bo; Albin, Roger L; Paulson, Henry L

2013-01-01

Ataxin-3 is a deubiquitinating enzyme (DUB) that participates in ubiquitin-dependent protein quality control pathways and, based on studies in model systems, may be neuroprotective against toxic polyglutamine proteins such as the Huntington's disease (HD) protein, huntingtin (htt). HD is one of at least nine polyglutamine neurodegenerative diseases in which disease-causing proteins accumulate in ubiquitin-positive inclusions within neurons. In studies crossing mice null for ataxin-3 to an established HD knock-in mouse model (HdhQ200), we tested whether loss of ataxin-3 alters disease progression, perhaps by impairing the clearance of mutant htt or the ubiquitination of inclusions. While loss of ataxin-3 mildly exacerbated age-dependent motor deficits, it did not alter inclusion formation, ubiquitination of inclusions or levels of mutant or normal htt. Ataxin-3, itself a polyglutamine-containing protein with multiple ubiquitin binding domains, was not observed to localize to htt inclusions. Changes in neurotransmitter receptor binding known to occur in HD knock-in mice also were not altered by the loss of ataxin-3, although we unexpectedly observed increased GABAA receptor binding in the striatum of HdhQ200 mice, which has not previously been noted. Finally, we confirmed that CNS levels of hsp70 are decreased in HD mice as has been reported in other HD mouse models, regardless of the presence or absence of ataxin-3. We conclude that while ataxin-3 may participate in protein quality control pathways, it does not critically regulate the handling of mutant htt or contribute to major features of disease pathogenesis in HD.

The role of tau in the pathological process and clinical expression of Huntington’s disease

PubMed Central

Vuono, Romina; Winder-Rhodes, Sophie; de Silva, Rohan; Cisbani, Giulia; Drouin-Ouellet, Janelle; Spillantini, Maria G.; Cicchetti, Francesca

2015-01-01

Huntington’s disease is a neurodegenerative disorder caused by an abnormal CAG repeat expansion within exon 1 of the huntingtin gene HTT. While several genetic modifiers, distinct from the Huntington’s disease locus itself, have been identified as being linked to the clinical expression and progression of Huntington’s disease, the exact molecular mechanisms driving its pathogenic cascade and clinical features, especially the dementia, are not fully understood. Recently the microtubule associated protein tau, MAPT, which is associated with several neurodegenerative disorders, has been implicated in Huntington’s disease. We explored this association in more detail at the neuropathological, genetic and clinical level. We first investigated tau pathology by looking for the presence of hyperphosphorylated tau aggregates, co-localization of tau with mutant HTT and its oligomeric intermediates in post-mortem brain samples from patients with Huntington’s disease (n = 16) compared to cases with a known tauopathy and healthy controls. Next, we undertook a genotype–phenotype analysis of a large cohort of patients with Huntington’s disease (n = 960) with a particular focus on cognitive decline. We report not only on the tau pathology in the Huntington’s disease brain but also the association between genetic variation in tau gene and the clinical expression and progression of the disease. We found extensive pathological inclusions containing abnormally phosphorylated tau protein that co-localized in some instances with mutant HTT. We confirmed this related to the disease process rather than age, by showing it is also present in two patients with young-onset Huntington’s disease (26 and 40 years old at death). In addition we demonstrate that tau oligomers (suggested to be the most likely neurotoxic tau entity) are present in the Huntington’s disease brains. Finally we highlight the clinical significance of this pathology by demonstrating that the MAPT haplotypes affect the rate of cognitive decline in a large cohort of patients with Huntington’s disease. Our findings therefore highlight a novel important role of tau in the pathogenic process and clinical expression of Huntington’s disease, which in turn opens up new therapeutic avenues for this incurable condition. PMID:25953777

Suppressing aberrant GluN3A expression rescues NMDA receptor dysfunction, synapse loss and motor and cognitive decline in Huntington's disease models

PubMed Central

Marco, Sonia; Giralt, Albert; Petrovic, Milos M.; Pouladi, Mahmoud A.; Martínez-Turrillas, Rebeca; Martínez-Hernández, José; Kaltenbach, Linda S.; Torres-Peraza, Jesús; Graham, Rona K.; Watanabe, Masahiko; Luján, Rafael; Nakanishi, Nobuki; Lipton, Stuart A.; Lo, Donald C.; Hayden, Michael R.; Alberch, Jordi; Wesseling, John F.

2013-01-01

Huntington's disease is caused by an expanded polyglutamine repeat in huntingtin (Htt), but the pathophysiological sequence of events that trigger synaptic failure and neuronal loss are not fully understood. Alterations in NMDA-type glutamate receptors (NMDARs) have been implicated, yet it remains unclear how the Htt mutation impacts NMDAR function and direct evidence for a causative role is missing. Here we show that mutant Htt re-directs an intracellular store of juvenile NMDARs to the surface of striatal neurons by sequestering and disrupting the subcellular localization of the GluN3A subunit-specific endocytic adaptor PACSIN1. Overexpressing GluN3A in wild-type striatum mimicked the synapse loss observed in Huntington's disease mouse models, whereas genetic deletion of GluN3A prevented synapse degeneration, ameliorated motor and cognitive decline, and reduced striatal atrophy and neuronal loss in the YAC128 model. Furthermore, GluN3A deletion corrected the abnormally enhanced NMDAR currents, which have been linked to cell death in Huntington's disease and other neurodegenerative conditions. Our findings reveal an early pathogenic role of GluN3A dysregulation in Huntington's disease, and suggest that therapies targeting GluN3A or pathogenic Htt-PACSIN1 interactions might prevent or delay disease progression. PMID:23852340

Blocking the association of HDAC4 with MAP1S accelerates autophagy clearance of mutant Huntingtin

PubMed Central

Yue, Fei; Li, Wenjiao; Zou, Jing; Chen, Qi; Xu, Guibin; Huang, Hai; Xu, Zhen; Zhang, Sheng; Gallinari, Paola; Wang, Fen; McKeehan, Wallace L.; Liu, Leyuan

2015-01-01

Autophagy controls and executes the turnover of abnormally aggregated proteins. MAP1S interacts with the autophagy marker LC3 and positively regulates autophagy flux. HDAC4 associates with the aggregation-prone mutant huntingtin protein (mHTT) that causes Huntington's disease, and colocalizes with it in cytosolic inclusions. It was suggested HDAC4 interacts with MAP1S in a yeast two-hybrid screening. Here, we found that MAP1S interacts with HDAC4 via a HDAC4-binding domain (HBD). HDAC4 destabilizes MAP1S, suppresses autophagy flux and promotes the accumulation of mHTT aggregates. This occurs by an increase in the deacetylation of the acetylated MAP1S. Either suppression of HDAC4 with siRNA or overexpression of the MAP1S HBD leads to stabilization of MAP1S, activation of autophagy flux and clearance of mHTT aggregates. Therefore, specific interruption of the HDAC4-MAP1S interaction with short peptides or small molecules to enhance autophagy flux may relieve the toxicity of mHTT associated with Huntington's disease and improve symptoms of HD patients. PMID:26540094

Targets for future clinical trials in Huntington's disease: what's in the pipeline?

PubMed

Wild, Edward J; Tabrizi, Sarah J

2014-09-15

The known genetic cause of Huntington's disease (HD) has fueled considerable progress in understanding its pathobiology and the development of therapeutic approaches aimed at correcting specific changes linked to the causative mutation. Among the most promising is reducing expression of mutant huntingtin protein (mHTT) with RNA interference or antisense oligonucleotides; human trials are now being planned. Zinc-finger transcriptional repression is another innovative method to reduce mHTT expression. Modulation of mHTT phosphorylation, chaperone upregulation, and autophagy enhancement represent attempts to alter cellular homeostasis to favor removal of mHTT. Inhibition of histone deacetylases (HDACs) remains of interest; recent work affirms HDAC4 as a target but questions the assumed centrality of its catalytic activity in HD. Phosphodiesterase inhibition, aimed at restoring synaptic function, has progressed rapidly to human trials. Deranged cellular signaling provides several tractable targets, but specificity and complexity are challenges. Restoring neurotrophic support in HD remains a key potential therapeutic approach. with several approaches being pursued, including brain-derived neurotrophic factor (BDNF) mimesis through tyrosine receptor kinase B (TrkB) agonism and monoclonal antibodies. An increasing understanding of the role of glial cells in HD has led to several new therapeutic avenues, including kynurenine monooxygenase inhibition, immunomodulation by laquinimod, CB2 agonism, and others. The complex metabolic derangements in HD remain under study, but no clear therapeutic strategy has yet emerged. We conclude that many exciting therapeutics are progressing through the development pipeline, and combining a better understanding of HD biology in human patients, with concerted medicinal chemistry efforts, will be crucial for bringing about an era of effective therapies. © 2014 The Authors. Movement Disorders published by Wiley Periodicals, Inc. on behalf of International Parkinson and Movement Disorder Society.

Prenatal stress-induced programming of genome-wide promoter DNA methylation in 5-HTT-deficient mice.

PubMed

Schraut, K G; Jakob, S B; Weidner, M T; Schmitt, A G; Scholz, C J; Strekalova, T; El Hajj, N; Eijssen, L M T; Domschke, K; Reif, A; Haaf, T; Ortega, G; Steinbusch, H W M; Lesch, K P; Van den Hove, D L

2014-10-21

The serotonin transporter gene (5-HTT/SLC6A4)-linked polymorphic region has been suggested to have a modulatory role in mediating effects of early-life stress exposure on psychopathology rendering carriers of the low-expression short (s)-variant more vulnerable to environmental adversity in later life. The underlying molecular mechanisms of this gene-by-environment interaction are not well understood, but epigenetic regulation including differential DNA methylation has been postulated to have a critical role. Recently, we used a maternal restraint stress paradigm of prenatal stress (PS) in 5-HTT-deficient mice and showed that the effects on behavior and gene expression were particularly marked in the hippocampus of female 5-Htt+/- offspring. Here, we examined to which extent these effects are mediated by differential methylation of DNA. For this purpose, we performed a genome-wide hippocampal DNA methylation screening using methylated-DNA immunoprecipitation (MeDIP) on Affymetrix GeneChip Mouse Promoter 1.0 R arrays. Using hippocampal DNA from the same mice as assessed before enabled us to correlate gene-specific DNA methylation, mRNA expression and behavior. We found that 5-Htt genotype, PS and their interaction differentially affected the DNA methylation signature of numerous genes, a subset of which showed overlap with the expression profiles of the corresponding transcripts. For example, a differentially methylated region in the gene encoding myelin basic protein (Mbp) was associated with its expression in a 5-Htt-, PS- and 5-Htt × PS-dependent manner. Subsequent fine-mapping of this Mbp locus linked the methylation status of two specific CpG sites to Mbp expression and anxiety-related behavior. In conclusion, hippocampal DNA methylation patterns and expression profiles of female prenatally stressed 5-Htt+/- mice suggest that distinct molecular mechanisms, some of which are promoter methylation-dependent, contribute to the behavioral effects of the 5-Htt genotype, PS exposure and their interaction.

Human mutant huntingtin disrupts vocal learning in transgenic songbirds.

PubMed

Liu, Wan-Chun; Kohn, Jessica; Szwed, Sarah K; Pariser, Eben; Sepe, Sharon; Haripal, Bhagwattie; Oshimori, Naoki; Marsala, Martin; Miyanohara, Atsushi; Lee, Ramee

2015-11-01

Speech and vocal impairments characterize many neurological disorders. However, the neurogenetic mechanisms of these disorders are not well understood, and current animal models do not have the necessary circuitry to recapitulate vocal learning deficits. We developed germline transgenic songbirds, zebra finches (Taneiopygia guttata) expressing human mutant huntingtin (mHTT), a protein responsible for the progressive deterioration of motor and cognitive function in Huntington's disease (HD). Although generally healthy, the mutant songbirds had severe vocal disorders, including poor vocal imitation, stuttering, and progressive syntax and syllable degradation. Their song abnormalities were associated with HD-related neuropathology and dysfunction of the cortical-basal ganglia (CBG) song circuit. These transgenics are, to the best of our knowledge, the first experimentally created, functional mutant songbirds. Their progressive and quantifiable vocal disorder, combined with circuit dysfunction in the CBG song system, offers a model for genetic manipulation and the development of therapeutic strategies for CBG-related vocal and motor disorders.

Cystathionine γ-lyase deficiency mediates neurodegeneration in Huntington’s disease

PubMed Central

Paul, Bindu D.; Sbodio, Juan I.; Xu, Risheng; Vandiver, M. Scott; Cha, Jiyoung Y.; Snowman, Adele M.; Snyder, Solomon H.

2015-01-01

Huntington’s disease is an autosomal dominant disease associated with a mutation in the gene encoding huntingtin (Htt) leading to expanded polyglutamine repeats of mutant Htt (mHtt) that elicit oxidative stress, neurotoxicity, and motor and behavioural changes1. Huntington’s disease is characterized by highly selective and profound damage to the corpus striatum, which regulates motor function. Striatal selectivity of Huntington’s disease may reflect the striatally selective small G protein Rhes binding to mHtt and enhancing its neurotoxicity2. Specific molecular mechanisms by which mHtt elicits neurodegeneration have been hard to determine. Here we show a major depletion of cystathionine γ-lyase (CSE), the biosynthetic enzyme for cysteine, in Huntington’s disease tissues, which may mediate Huntington’s disease pathophysiology. The defect occurs at the transcriptional level and seems to reflect influences of mHtt on specificity protein 1, a transcriptional activator for CSE. Consistent with the notion of loss of CSE as a pathogenic mechanism, supplementation with cysteine reverses abnormalities in cultures of Huntington’s disease tissues and in intact mouse models of Huntington’s disease, suggesting therapeutic potential. PMID:24670645

High resolution time-course mapping of early transcriptomic, molecular and cellular phenotypes in Huntington's disease CAG knock-in mice across multiple genetic backgrounds.

PubMed

Ament, Seth A; Pearl, Jocelynn R; Grindeland, Andrea; St Claire, Jason; Earls, John C; Kovalenko, Marina; Gillis, Tammy; Mysore, Jayalakshmi; Gusella, James F; Lee, Jong-Min; Kwak, Seung; Howland, David; Lee, Min Young; Baxter, David; Scherler, Kelsey; Wang, Kai; Geman, Donald; Carroll, Jeffrey B; MacDonald, Marcy E; Carlson, George; Wheeler, Vanessa C; Price, Nathan D; Hood, Leroy E

2017-03-01

Huntington's disease is a dominantly inherited neurodegenerative disease caused by the expansion of a CAG repeat in the HTT gene. In addition to the length of the CAG expansion, factors such as genetic background have been shown to contribute to the age at onset of neurological symptoms. A central challenge in understanding the disease progression that leads from the HD mutation to massive cell death in the striatum is the ability to characterize the subtle and early functional consequences of the CAG expansion longitudinally. We used dense time course sampling between 4 and 20 postnatal weeks to characterize early transcriptomic, molecular and cellular phenotypes in the striatum of six distinct knock-in mouse models of the HD mutation. We studied the effects of the HttQ111 allele on the C57BL/6J, CD-1, FVB/NCr1, and 129S2/SvPasCrl genetic backgrounds, and of two additional alleles, HttQ92 and HttQ50, on the C57BL/6J background. We describe the emergence of a transcriptomic signature in HttQ111/+  mice involving hundreds of differentially expressed genes and changes in diverse molecular pathways. We also show that this time course spanned the onset of mutant huntingtin nuclear localization phenotypes and somatic CAG-length instability in the striatum. Genetic background strongly influenced the magnitude and age at onset of these effects. This work provides a foundation for understanding the earliest transcriptional and molecular changes contributing to HD pathogenesis. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

OF MICE, RATS AND MEN: REVISITING THE QUINOLINIC ACID HYPOTHESIS OF HUNTINGTON’S DISEASE

PubMed Central

Schwarcz, R.; Guidetti, P.; Sathyasaikumar, K. V.; Muchowski, P. J.

2009-01-01

The neurodegenerative disease Huntington’s Disease (HD) is caused by an expanded polyglutamine (polyQ) tract in the protein huntingtin (htt). Although the gene encoding htt was identified and cloned more than 15 years ago, and in spite of impressive efforts to unravel the mechanism(s) by which mutant htt induces nerve cell death, these studies have so far not led to a good understanding of pathophysiology or an effective therapy. Set against a historical background, we review data supporting the idea that metabolites of the kynurenine pathway (KP) of tryptophan degradation provide a critical link between mutant htt and the pathophysiology of HD. New studies in HD brain and genetic model organisms suggest that the disease may in fact be causally related to early abnormalities in KP metabolism, favoring the formation of two neurotoxic metabolites, 3-hydroxykynurenine and quinolinic acid, over the related neuroprotective agent kynurenic acid. These findings not only link the excitotoxic hypothesis of HD pathology to an impairment of the KP but also define new drug targets and therefore have direct therapeutic implications. Thus, pharmacological normalization of the imbalance in brain KP metabolism may provide clinical benefits, which could be especially effective in the early stages of the disease. PMID:19394403

Huntingtin polyQ Mutation Impairs the 17β-Estradiol/Neuroglobin Pathway Devoted to Neuron Survival.

PubMed

Nuzzo, Maria Teresa; Fiocchetti, Marco; Totta, Pierangela; Melone, Mariarosa A B; Cardinale, Antonella; Fusco, Francesca R; Gustincich, Stefano; Persichetti, Francesca; Ascenzi, Paolo; Marino, Maria

2017-10-01

Among several mechanisms underlying the well-known trophic and protective effects of 17β-estradiol (E2) in the brain, we recently reported that E2 induces the up-regulation of two anti-apoptotic and neuroprotectant proteins: huntingtin (HTT) and neuroglobin (NGB). Here, we investigate the role of this up-regulation. The obtained results indicate that E2 promotes NGB-HTT association, induces the localization of the complex at the mitochondria, and protects SK-N-BE neuroblastoma cells and murine striatal cells, which express wild-type HTT (i.e., polyQ 7 ), against H 2 O 2 -induced apoptosis. All E2 effects were completely abolished in HTT-knocked out SK-N-BE cells and in striatal neurons expressing the mutated form of HTT (mHTT; i.e., polyQ 111 ) typical of Huntington's disease (HD). As a whole, these data provide a new function of wild-type HTT which drives E2-induced NGB in mitochondria modulating NGB anti-apoptotic activity. This new function is lost by HTT polyQ pathological expansion. These data evidence the existence of a novel E2/HTT/NGB neuroprotective axis that may play a relevant role in the development of HD therapeutics.

Early-onset sleep defects in Drosophila models of Huntington's disease reflect alterations of PKA/CREB signaling

PubMed Central

Gonzales, Erin D.; Tanenhaus, Anne K.; Zhang, Jiabin; Chaffee, Ryan P.; Yin, Jerry C.P.

2016-01-01

Huntington's disease (HD) is a progressive neurological disorder whose non-motor symptoms include sleep disturbances. Whether sleep and activity abnormalities are primary molecular disruptions of mutant Huntingtin (mutHtt) expression or result from neurodegeneration is unclear. Here, we report Drosophila models of HD exhibit sleep and activity disruptions very early in adulthood, as soon as sleep patterns have developed. Pan-neuronal expression of full-length or N-terminally truncated mutHtt recapitulates sleep phenotypes of HD patients: impaired sleep initiation, fragmented and diminished sleep, and nighttime hyperactivity. Sleep deprivation of HD model flies results in exacerbated sleep deficits, indicating that homeostatic regulation of sleep is impaired. Elevated PKA/CREB activity in healthy flies produces patterns of sleep and activity similar to those in our HD models. We were curious whether aberrations in PKA/CREB signaling were responsible for our early-onset sleep/activity phenotypes. Decreasing signaling through the cAMP/PKA pathway suppresses mutHtt-induced developmental lethality. Genetically reducing PKA abolishes sleep/activity deficits in HD model flies, restores the homeostatic response and extends median lifespan. In vivo reporters, however, show dCREB2 activity is unchanged, or decreased when sleep/activity patterns are abnormal, suggesting dissociation of PKA and dCREB2 occurs early in pathogenesis. Collectively, our data suggest that sleep defects may reflect a primary pathological process in HD, and that measurements of sleep and cAMP/PKA could be prodromal indicators of disease, and serve as therapeutic targets for intervention. PMID:26604145

Germline transmission in transgenic Huntington's disease monkeys.

PubMed

Moran, Sean; Chi, Tim; Prucha, Melinda S; Ahn, Kwang Sung; Connor-Stroud, Fawn; Jean, Sherrie; Gould, Kenneth; Chan, Anthony W S

2015-07-15

Transgenic nonhuman primate models are an increasingly popular model for neurologic and neurodegenerative disease because their brain functions and neural anatomies closely resemble those of humans. Transgenic Huntington's disease monkeys (HD monkeys) developed clinical features similar to those seen in HD patients, making the monkeys suitable for a preclinical study of HD. However, until HD monkey colonies can be readily expanded, their use in preclinical studies will be limited. In the present study, we confirmed germline transmission of the mutant huntingtin (mHTT) transgene in both embryonic stem cells generated from three male HD monkey founders (F0) and in second-generation offspring (F1) produced via artificial insemination by using intrauterine insemination technique. A total of five offspring were produced from 15 females that were inseminated by intrauterine insemination using semen collected from the three HD founders (5 of 15, 33%). Thus far, sperm collected from the HD founder (rHD8) has led to two F1 transgenic HD monkeys with germline transmission rate at 100% (2 of 2). mHTT expression was confirmed by quantitative real-time polymerase chain reaction using skin fibroblasts from the F1 HD monkeys and induced pluripotent stem cells established from one of the F1 HD monkeys (rHD8-2). Here, we report the stable germline transmission and expression of the mHTT transgene in HD monkeys, which suggest possible expansion of HD monkey colonies for preclinical and biomedical research studies. Copyright © 2015 Elsevier Inc. All rights reserved.

Expression analysis for inverted effects of serotonin transporter inactivation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ichikawa, Manabu; Okamura-Oho, Yuko; Shimokawa, Kazuro

2008-03-28

Inactivation of serotonin transporter (HTT) by pharmacologically in the neonate or genetically increases risk for depression in adulthood, whereas pharmacological inhibition of HTT ameliorates symptoms in depressed patients. The differing role of HTT function during early development and in adult brain plasticity in causing or reversing depression remains an unexplained paradox. To address this we profiled the gene expression of adult Htt knockout (Htt KO) mice and HTT inhibitor-treated mice. Inverted profile changes between the two experimental conditions were seen in 30 genes. Consistent results of the upstream regulatory element search and the co-localization search of these genes indicated thatmore » the regulation may be executed by Pax5, Pax7 and Gata3, known to be involved in the survival, proliferation, and migration of serotonergic neurons in the developing brain, and these factors are supposed to keep functioning to regulate downstream genes related to serotonin system in the adult brain.« less

A fully humanized transgenic mouse model of Huntington disease

PubMed Central

Southwell, Amber L.; Warby, Simon C.; Carroll, Jeffrey B.; Doty, Crystal N.; Skotte, Niels H.; Zhang, Weining; Villanueva, Erika B.; Kovalik, Vlad; Xie, Yuanyun; Pouladi, Mahmoud A.; Collins, Jennifer A.; Yang, X. William; Franciosi, Sonia; Hayden, Michael R.

2013-01-01

Silencing the mutant huntingtin gene (muHTT) is a direct and simple therapeutic strategy for the treatment of Huntington disease (HD) in principle. However, targeting the HD mutation presents challenges because it is an expansion of a common genetic element (a CAG tract) that is found throughout the genome. Moreover, the HTT protein is important for neuronal health throughout life, and silencing strategies that also reduce the wild-type HTT allele may not be well tolerated during the long-term treatment of HD. Several HTT silencing strategies are in development that target genetic sites in HTT that are outside of the CAG expansion, including HD mutation-linked single-nucleotide polymorphisms and the HTT promoter. Preclinical testing of these genetic therapies has required the development of a new mouse model of HD that carries these human-specific genetic targets. To generate a fully humanized mouse model of HD, we have cross-bred BACHD and YAC18 on the Hdh−/− background. The resulting line, Hu97/18, is the first murine model of HD that fully genetically recapitulates human HD having two human HTT genes, no mouse Hdh genes and heterozygosity of the HD mutation. We find that Hu97/18 mice display many of the behavioral changes associated with HD including motor, psychiatric and cognitive deficits, as well as canonical neuropathological abnormalities. This mouse line will be useful for gaining additional insights into the disease mechanisms of HD as well as for testing genetic therapies targeting human HTT. PMID:23001568

Modulating Neurotrophin Receptor Signaling as a Therapeutic Strategy for Huntington’s Disease

PubMed Central

Simmons, Danielle A.

2017-01-01

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by CAG repeat expansions in the IT15 gene which encodes the huntingtin (HTT) protein. Currently, no treatments capable of preventing or slowing disease progression exist. Disease modifying therapeutics for HD would be expected to target a comprehensive set of degenerative processes given the diverse mechanisms contributing to HD pathogenesis including neuroinflammation, excitotoxicity, and transcription dysregulation. A major contributor to HD-related degeneration is mutant HTT-induced loss of neurotrophic support. Thus, neurotrophin (NT) receptors have emerged as therapeutic targets in HD. The considerable overlap between NT signaling networks and those dysregulated by mutant HTT provides strong theoretical support for this approach. This review will focus on the contributions of disrupted NT signaling in HD-related neurodegeneration and how targeting NT receptors to augment pro-survival signaling and/or to inhibit degenerative signaling may combat HD pathologies. Therapeutic strategies involving NT delivery, peptidomimetics, and the targeting of specific NT receptors (e.g., Trks or p75NTR), particularly with small molecule ligands, are discussed. PMID:29254102

Length and sequence dependence in the association of Huntingtin protein with lipid membranes

NASA Astrophysics Data System (ADS)

Jawahery, Sudi; Nagarajan, Anu; Matysiak, Silvina

2013-03-01

There is a fundamental gap in our understanding of how aggregates of mutant Huntingtin protein (htt) with overextended polyglutamine (polyQ) sequences gain the toxic properties that cause Huntington's disease (HD). Experimental studies have shown that the most important step associated with toxicity is the binding of mutant htt aggregates to lipid membranes. Studies have also shown that flanking amino acid sequences around the polyQ sequence directly affect interactions with the lipid bilayer, and that polyQ sequences of greater than 35 glutamine repeats in htt are a characteristic of HD. The key steps that determine how flanking sequences and polyQ length affect the structure of lipid bilayers remain unknown. In this study, we use atomistic molecular dynamics simulations to study the interactions between lipid membranes of varying compositions and polyQ peptides of varying lengths and flanking sequences. We find that overextended polyQ interactions do cause deformation in model membranes, and that the flanking sequences do play a role in intensifying this deformation by altering the shape of the affected regions.

Cdk5 Contributes to Huntington's Disease Learning and Memory Deficits via Modulation of Brain Region-Specific Substrates.

PubMed

Alvarez-Periel, Elena; Puigdellívol, Mar; Brito, Verónica; Plattner, Florian; Bibb, James A; Alberch, Jordi; Ginés, Silvia

2017-12-29

Cognitive deficits are a major hallmark of Huntington's disease (HD) with a great impact on the quality of patient's life. Gaining a better understanding of the molecular mechanisms underlying learning and memory impairments in HD is, therefore, of critical importance. Cdk5 is a proline-directed Ser/Thr kinase involved in the regulation of synaptic plasticity and memory processes that has been associated with several neurodegenerative disorders. In this study, we aim to investigate the role of Cdk5 in learning and memory impairments in HD using a novel animal model that expresses mutant huntingtin (mHtt) and has genetically reduced Cdk5 levels. Genetic reduction of Cdk5 in mHtt knock-in mice attenuated both corticostriatal learning deficits as well as hippocampal-dependent memory decline. Moreover, the molecular mechanisms by which Cdk5 counteracts the mHtt-induced learning and memory impairments appeared to be differentially regulated in a brain region-specific manner. While the corticostriatal learning deficits are attenuated through compensatory regulation of NR2B surface levels, the rescue of hippocampal-dependent memory was likely due to restoration of hippocampal dendritic spine density along with an increase in Rac1 activity. This work identifies Cdk5 as a critical contributor to mHtt-induced learning and memory deficits. Furthermore, we show that the Cdk5 downstream targets involved in memory and learning decline differ depending on the brain region analyzed suggesting that distinct Cdk5 effectors could be involved in cognitive impairments in HD.

Huntingtin-interacting protein 1 influences worm and mouse presynaptic function and protects Caenorhabditis elegans neurons against mutant polyglutamine toxicity.

PubMed

Parker, J Alex; Metzler, Martina; Georgiou, John; Mage, Marilyne; Roder, John C; Rose, Ann M; Hayden, Michael R; Néri, Christian

2007-10-10

Huntingtin-interacting protein 1 (HIP1) was identified through its interaction with htt (huntingtin), the Huntington's disease (HD) protein. HIP1 is an endocytic protein that influences transport and function of AMPA and NMDA receptors in the brain. However, little is known about its contribution to neuronal dysfunction in HD. We report that the Caenorhabditis elegans HIP1 homolog hipr-1 modulates presynaptic activity and the abundance of synaptobrevin, a protein involved in synaptic vesicle fusion. Presynaptic function was also altered in hippocampal brain slices of HIP1-/- mice demonstrating delayed recovery from synaptic depression and a reduction in paired-pulse facilitation, a form of presynaptic plasticity. Interestingly, neuronal dysfunction in transgenic nematodes expressing mutant N-terminal huntingtin was specifically enhanced by hipr-1 loss of function. A similar effect was observed with several other mutant proteins that are expressed at the synapse and involved in endocytosis, such as unc-11/AP180, unc-26/synaptojanin, and unc-57/endophilin. Thus, HIP1 is involved in presynaptic nerve terminal activity and modulation of mutant polyglutamine-induced neuronal dysfunction. Moreover, synaptic proteins involved in endocytosis may protect neurons against amino acid homopolymer expansion.

A novel humanized mouse model of Huntington disease for preclinical development of therapeutics targeting mutant huntingtin alleles.

PubMed

Southwell, Amber L; Skotte, Niels H; Villanueva, Erika B; Østergaard, Michael E; Gu, Xiaofeng; Kordasiewicz, Holly B; Kay, Chris; Cheung, Daphne; Xie, Yuanyun; Waltl, Sabine; Dal Cengio, Louisa; Findlay-Black, Hailey; Doty, Crystal N; Petoukhov, Eugenia; Iworima, Diepiriye; Slama, Ramy; Ooi, Jolene; Pouladi, Mahmoud A; Yang, X William; Swayze, Eric E; Seth, Punit P; Hayden, Michael R

2017-03-15

Huntington disease (HD) is a neurodegenerative disease caused by a mutation in the huntingtin (HTT) gene. HTT is a large protein, interacts with many partners and is involved in many cellular pathways, which are perturbed in HD. Therapies targeting HTT directly are likely to provide the most global benefit. Thus there is a need for preclinical models of HD recapitulating human HTT genetics. We previously generated a humanized mouse model of HD, Hu97/18, by intercrossing BACHD and YAC18 mice with knockout of the endogenous mouse HD homolog (Hdh). Hu97/18 mice recapitulate the genetics of HD, having two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of Caucasian descent. We have now generated a companion model, Hu128/21, by intercrossing YAC128 and BAC21 mice on the Hdh-/- background. Hu128/21 mice have two full-length, genomic human HTT transgenes heterozygous for the HD mutation and polymorphisms associated with HD in populations of East Asian descent and in a minority of patients from other ethnic groups. Hu128/21 mice display a wide variety of HD-like phenotypes that are similar to YAC128 mice. Additionally, both transgenes in Hu128/21 mice match the human HTT exon 1 reference sequence. Conversely, the BACHD transgene carries a floxed, synthetic exon 1 sequence. Hu128/21 mice will be useful for investigations of human HTT that cannot be addressed in Hu97/18 mice, for developing therapies targeted to exon 1, and for preclinical screening of personalized HTT lowering therapies in HD patients of East Asian descent. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Gradual Phenotype Development in Huntington Disease Transgenic Minipig Model at 24 Months of Age.

PubMed

Vidinská, Daniela; Vochozková, Petra; Šmatlíková, Petra; Ardan, Taras; Klíma, Jiří; Juhás, Štefan; Juhásová, Jana; Bohuslavová, Božena; Baxa, Monika; Valeková, Ivona; Motlík, Jan; Ellederová, Zdenka

2018-06-05

Huntington disease (HD) is an incurable neurodegenerative disease caused by the expansion of a polyglutamine sequence in a gene encoding the huntingtin (Htt) protein, which is expressed in almost all cells of the body. In addition to small animal models, new therapeutic approaches (including gene therapy) require large animal models as their large brains are a more realistic model for translational research. In this study, we describe phenotype development in transgenic minipigs (TgHD) expressing the N-terminal part of mutated human Htt at the age of 24 months. TgHD and wild-type littermates were compared. Western blot analysis and subcellular fractionation of different tissues was used to determine the fragmentation of Htt. Immunohistochemistry and optical analysis of coronal sections measuring aggregates, Htt expression, neuroinflammation, and myelination was applied. Furthermore, the expression of Golgi protein acyl-CoA binding domain containing 3 (ACBD3) was analyzed. We found age-correlated Htt fragmentation in the brain. Among various tissues studied, the testes displayed the highest fragmentation, with Htt fragments detectable even in cell nuclei. Also, Golgi protein ACBD3 was upregulated in testes, which is in agreement with previously reported testicular degeneration in TgHD minipigs. Nevertheless, the TgHD-specific mutated Htt fragments were also present in the cytoplasm of striatum and cortex cells. Moreover, microglial cells were activated and myelination was slightly decreased, suggesting the development of a premanifest stage of neurodegeneration in TgHD minipigs. The gradual development of a neurodegenerative phenotype, ac-companied with testicular degeneration, is observed in 24- month-old TgHD minipigs. © 2018 S. Karger AG, Basel.

Upregulation of serotonin-receptor-2a and serotonin transporter expression in the pulmonary vasculature of nitrofen-induced congenital diaphragmatic hernia.

PubMed

Hofmann, Alejandro D; Friedmacher, Florian; Hunziker, Manuela; Takahashi, Hiromizu; Duess, Johannes W; Gosemann, Jan-Hendrik; Puri, Prem

2014-06-01

Congenital diaphragmatic hernia (CDH) is attributed to severe pulmonary hypoplasia and pulmonary hypertension (PH). PH is characterized by structural changes resulting in vascular remodeling. Serotonin, a potent vasoconstrictor, plays a central role in the development of PH. It exerts its constricting effects on the vessels via Serotonin receptor 2A (5-HT2A) and induces pulmonary smooth muscle cell proliferation via the serotonin transporter (5-HTT). This study was designed to investigate expressions of 5-HT2A and 5-HTT in the pulmonary vasculature of rats with nitrofen-induced CDH. Rats were exposed to nitrofen or vehicle on D9. Fetuses were sacrificed on D21 and divided into nitrofen and control group (n=32). Pulmonary RNA was extracted and mRNA level of 5HT2A was determined by qRT-PCR. Protein expression of 5HT2A and 5-HTT was investigated by western blotting. Confocal immunofluorescence double-staining for 5-HT2A, 5-HTT, and alpha smooth muscle actin were performed. Pulmonary 5-HT2A gene expression levels were significantly increased in nitrofen-induced CDH compared to controls. Western blotting and confocal microscopy confirmed increased pulmonary protein expression in CDH lungs compared to controls. Increased gene and protein expression of 5HT2A and 5-HTT in the pulmonary vasculature of nitrofen-induced CDH lungs suggest that 5HT2A and 5-HTT are important mediators of PH in nitrofen-induced CDH. Copyright © 2014 Elsevier Inc. All rights reserved.

Reduction of mutant huntingtin accumulation and toxicity by lysosomal cathepsins D and B in neurons

PubMed Central

2011-01-01

Background Huntington's disease is caused by aggregation of mutant huntingtin (mHtt) protein containing more than a 36 polyQ repeat. Upregulation of macroautophagy was suggested as a neuroprotective strategy to degrade mutant huntingtin. However, macroautophagy initiation has been shown to be highly efficient in neurons whereas lysosomal activities are rate limiting. The role of the lysosomal and other proteases in Huntington is not clear. Some studies suggest that certain protease activities may contribute to toxicity whereas others are consistent with protection. These discrepancies may be due to a number of mechanisms including distinct effects of the specific intermediate digestion products of mutant huntingtin generated by different proteases. These observations suggested a critical need to investigate the consequence of upregulation of individual lysosomal enzyme in mutant huntingtin accumulation and toxicity. Results In this study, we used molecular approaches to enhance lysosomal protease activities and examined their effects on mutant huntingtin level and toxicity. We found that enhanced expression of lysosomal cathepsins D and B resulted in their increased enzymatic activities and reduced both full-length and fragmented huntingtin in transfected HEK cells. Furthermore, enhanced expression of cathepsin D or B protected against mutant huntingtin toxicity in primary neurons, and their neuroprotection is dependent on macroautophagy. Conclusions These observations demonstrate a neuroprotective effect of enhancing lysosomal cathepsins in reducing mutant huntingtin level and toxicity in transfected cells. They highlight the potential importance of neuroprotection mediated by cathepsin D or B through macroautophagy. PMID:21631942

Surveying the landscape of Huntington's disease mechanisms, measurements, and medicines.

PubMed

Crook, Zachary R; Housman, David E

2013-01-01

Though 20 years have now passed since the cloning of the huntingtin gene (HTT), there remains no treatment for Huntington's Disease (HD) that alters the course of disease or lifespan of patients. The reasons for this are manifold, and likely have to do with the diverse cellular pathways disrupted by mutant HTT (mHTT) protein expression. Furthermore, the evaluation of efficacy using a putative intervention is complex, largely due to the slow course of disease and variability in the classic techniques for evaluating patient symptoms and quality of life, which make the patient populations and duration of trials particularly imposing. However, there are signs for hope both in the clinic and at the bench. This review serves three purposes. It discusses the known cellular pathologies in HD, the current and upcoming methods for clinical evaluation of disease progress, and the tested and untested interventions proposed to counter the progression in animal models and patients. With the vast knowledge of pathology accumulated over two decades of modeling HD in animals and following it in patients, as well as the advances in intervention techniques both pharmaceutical and genetic, there is reason for optimism in the field. Such optimism can only be tempered by the lack of success in the clinic to this point, though patients, scientists, and clinicians all remain enthusiastic about each new trial, and progress can only continue until an effective treatment is found.

Protein aggregates in Huntington’s disease

PubMed Central

Arrasate, Montserrat; Finkbeiner, Steven

2014-01-01

Huntington’s disease (HD) is an incurable neurodegenerative disease characterized by abnormal motor movements, personality changes, and early death. HD is caused by a mutation in the IT-15 gene that expands abnormally the number of CAG nucleotide repeats. As a result, the translated protein huntingtin contains disease-causing expansions of glutamines (polyQ) that make it prone to misfold and aggregate. While the gene and mutations that cause HD are known, the mechanisms underlying HD pathogenesis are not. Here we will review the state of knowledge of HD, focusing especially on a hallmark pathological feature—intracellular aggregates of mutant Htt called inclusion bodies (IBs). We will describe the role of IBs in the disease. We speculate that IB formation could be just one component of a broader coping response triggered by misfolded Htt whose efficacy may depend on the extent to which it clears toxic forms of mutant Htt. We will describe how IB formation might be regulated and which factors could determine different coping responses in different subsets of neurons. A differential regulation of IB formation as a function of the cellular context could, eventually, explain part of the neuronal vulnerability observed in HD. PMID:22200539

Sequestration of Sup35 by aggregates of huntingtin fragments causes toxicity of [PSI+] yeast.

PubMed

Zhao, Xiaohong; Park, Yang-Nim; Todor, Horia; Moomau, Christine; Masison, Daniel; Eisenberg, Evan; Greene, Lois E

2012-07-06

Expression of huntingtin fragments with 103 glutamines (HttQ103) is toxic in yeast containing either the [PIN(+)] prion, which is the amyloid form of Rnq1, or [PSI(+)] prion, which is the amyloid form of Sup35. We find that HttQP103, which has a polyproline region at the C-terminal end of the polyQ repeat region, is significantly more toxic in [PSI(+)] yeast than in [PIN(+)], even though HttQP103 formed multiple aggregates in both [PSI(+)] and [PIN(+)] yeast. This toxicity was only observed in the strong [PSI(+)] variant, not the weak [PSI(+)] variant, which has more soluble Sup35 present than the strong variant. Furthermore, expression of the MC domains of Sup35, which retains the C-terminal domain of Sup35, but lacks the N-terminal prion domain, almost completely rescued HttQP103 toxicity, but was less effective in rescuing HttQ103 toxicity. Therefore, the toxicity of HttQP103 in yeast containing the [PSI(+)] prion is primarily due to sequestration of the essential protein, Sup35.

The A2A adenosine receptor rescues the urea cycle deficiency of Huntington's disease by enhancing the activity of the ubiquitin-proteasome system.

PubMed

Chiang, Ming-Chang; Chen, Hui-Mei; Lai, Hsing-Lin; Chen, Hsiao-Wen; Chou, Szu-Yi; Chen, Chiung-Mei; Tsai, Fuu-Jen; Chern, Yijuang

2009-08-15

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by a CAG trinucleotide expansion in the Huntingtin (Htt) gene. The resultant mutant Htt protein (mHtt) forms aggregates in the brain and several peripheral tissues (e.g. the liver) and causes devastating neuronal degeneration. Metabolic defects resulting from Htt aggregates in peripheral tissues also contribute to HD pathogenesis. Simultaneous improvement of defects in both the CNS and peripheral tissues is thus the most effective therapeutic strategy and is highly desirable. We earlier showed that an agonist of the A(2A) adenosine receptor (A(2A) receptor), CGS21680 (CGS), attenuates neuronal symptoms of HD. We found herein that the A(2A) receptor also exists in the liver, and that CGS ameliorated the urea cycle deficiency by reducing mHtt aggregates in the liver. By suppressing aggregate formation, CGS slowed the hijacking of a crucial transcription factor (HSF1) and two protein chaperons (Hsp27 and Hsp70) into hepatic Htt aggregates. Moreover, the abnormally high levels of high-molecular-mass ubiquitin conjugates in the liver of an HD mouse model (R6/2) were also ameliorated by CGS. The protective effect of CGS against mHtt-induced aggregate formation was reproduced in two cells lines and was prevented by an antagonist of the A(2A) receptor and a protein kinase A (PKA) inhibitor. Most importantly, the mHtt-induced suppression of proteasome activity was also normalized by CGS through PKA. Our findings reveal a novel therapeutic pathway of A(2A) receptors in HD and further strengthen the concept that the A(2A) receptor can be a drug target in treating HD.

Speech acoustic markers of early stage and prodromal Huntington's disease: a marker of disease onset?

PubMed

Vogel, Adam P; Shirbin, Christopher; Churchyard, Andrew J; Stout, Julie C

2012-12-01

Speech disturbances (e.g., altered prosody) have been described in symptomatic Huntington's Disease (HD) individuals, however, the extent to which speech changes in gene positive pre-manifest (PreHD) individuals is largely unknown. The speech of individuals carrying the mutant HTT gene is a behavioural/motor/cognitive marker demonstrating some potential as an objective indicator of early HD onset and disease progression. Speech samples were acquired from 30 individuals carrying the mutant HTT gene (13 PreHD, 17 early stage HD) and 15 matched controls. Participants read a passage, produced a monologue and said the days of the week. Data were analysed acoustically for measures of timing, frequency and intensity. There was a clear effect of group across most acoustic measures, so that speech performance differed in-line with disease progression. Comparisons across groups revealed significant differences between the control and the early stage HD group on measures of timing (e.g., speech rate). Participants carrying the mutant HTT gene presented with slower rates of speech, took longer to say words and produced greater silences between and within words compared to healthy controls. Importantly, speech rate showed a significant correlation to burden of disease scores. The speech of early stage HD differed significantly from controls. The speech of PreHD, although not reaching significance, tended to lie between the performance of controls and early stage HD. This suggests that changes in speech production appear to be developing prior to diagnosis. Copyright © 2012 Elsevier Ltd. All rights reserved.

An evolutionary recent neuroepithelial cell adhesion function of huntingtin implicates ADAM10-Ncadherin.

PubMed

Lo Sardo, Valentina; Zuccato, Chiara; Gaudenzi, Germano; Vitali, Barbara; Ramos, Catarina; Tartari, Marzia; Myre, Michael A; Walker, James A; Pistocchi, Anna; Conti, Luciano; Valenza, Marta; Drung, Binia; Schmidt, Boris; Gusella, James; Zeitlin, Scott; Cotelli, Franco; Cattaneo, Elena

2012-05-01

The Huntington's disease gene product, huntingtin, is indispensable for neural tube formation, but its role is obscure. We studied neurulation in htt-null embryonic stem cells and htt-morpholino zebrafish embryos and found a previously unknown, evolutionarily recent function for this ancient protein. We found that htt was essential for homotypic interactions between neuroepithelial cells; it permitted neurulation and rosette formation by regulating metalloprotease ADAM10 activity and Ncadherin cleavage. This function was embedded in the N terminus of htt and was phenocopied by treatment of htt knockdown zebrafish with an ADAM10 inhibitor. Notably, in htt-null cells, reversion of the rosetteless phenotype occurred only with expression of evolutionarily recent htt heterologues from deuterostome organisms. Conversely, all of the heterologues that we tested, including htt from Drosophila melanogaster and Dictyostelium discoideum, exhibited anti-apoptotic activity. Thus, anti-apoptosis may have been one of htt’s ancestral function(s), but, in deuterostomes, htt evolved to acquire a unique regulatory activity for controlling neural adhesion via ADAM10-Ncadherin, with implications for brain evolution and development.

Bidirectional control of postsynaptic density-95 (PSD-95) clustering by Huntingtin.

PubMed

Parsons, Matthew P; Kang, Rujun; Buren, Caodu; Dau, Alejandro; Southwell, Amber L; Doty, Crystal N; Sanders, Shaun S; Hayden, Michael R; Raymond, Lynn A

2014-02-07

Huntington disease is associated with early alterations in corticostriatal synaptic function that precede cell death, and it is postulated that ameliorating such changes may delay clinical onset and/or prevent neurodegeneration. Although many of these synaptic alterations are thought to be attributable to a toxic gain of function of the mutant huntingtin protein, the role that nonpathogenic huntingtin (HTT) plays in synaptic function is relatively unexplored. Here, we compare the immunocytochemical localization of a major postsynaptic scaffolding protein, PSD-95, in striatal neurons from WT mice and mice overexpressing HTT with 18 glutamine repeats (YAC18, nonpathogenic). We found that HTT overexpression resulted in a palmitoylation- and BDNF-dependent increase in PSD-95 clustering at synaptic sites in striatal spiny projection neurons (SPNs) co-cultured with cortical neurons. Surprisingly, the latter effect was mediated presynaptically, as HTT overexpression in cortical neurons alone was sufficient to increase PSD-95 clustering in the postsynaptic SPNs. In contrast, antisense oligonucleotide knockdown of HTT in WT co-cultures resulted in a significant reduction of PSD-95 clustering in SPNs. Notably, despite these bidirectional changes in PSD-95 clustering, we did not observe an alteration in basal electrophysiological measures of AMPA and NMDA receptors. Thus, unlike in previous studies in the hippocampus, enhanced or decreased PSD-95 clustering alone was insufficient to drive AMPA or NMDA receptors into or out of SPN synapses. In all, our results demonstrate that nonpathogenic HTT can indeed influence synaptic protein localization and uncover a novel role of HTT in PSD-95 distribution.

Bidirectional Control of Postsynaptic Density-95 (PSD-95) Clustering by Huntingtin*

PubMed Central

Parsons, Matthew P.; Kang, Rujun; Buren, Caodu; Dau, Alejandro; Southwell, Amber L.; Doty, Crystal N.; Sanders, Shaun S.; Hayden, Michael R.; Raymond, Lynn A.

2014-01-01

Huntington disease is associated with early alterations in corticostriatal synaptic function that precede cell death, and it is postulated that ameliorating such changes may delay clinical onset and/or prevent neurodegeneration. Although many of these synaptic alterations are thought to be attributable to a toxic gain of function of the mutant huntingtin protein, the role that nonpathogenic huntingtin (HTT) plays in synaptic function is relatively unexplored. Here, we compare the immunocytochemical localization of a major postsynaptic scaffolding protein, PSD-95, in striatal neurons from WT mice and mice overexpressing HTT with 18 glutamine repeats (YAC18, nonpathogenic). We found that HTT overexpression resulted in a palmitoylation- and BDNF-dependent increase in PSD-95 clustering at synaptic sites in striatal spiny projection neurons (SPNs) co-cultured with cortical neurons. Surprisingly, the latter effect was mediated presynaptically, as HTT overexpression in cortical neurons alone was sufficient to increase PSD-95 clustering in the postsynaptic SPNs. In contrast, antisense oligonucleotide knockdown of HTT in WT co-cultures resulted in a significant reduction of PSD-95 clustering in SPNs. Notably, despite these bidirectional changes in PSD-95 clustering, we did not observe an alteration in basal electrophysiological measures of AMPA and NMDA receptors. Thus, unlike in previous studies in the hippocampus, enhanced or decreased PSD-95 clustering alone was insufficient to drive AMPA or NMDA receptors into or out of SPN synapses. In all, our results demonstrate that nonpathogenic HTT can indeed influence synaptic protein localization and uncover a novel role of HTT in PSD-95 distribution. PMID:24347167

Calcium Handling by Endoplasmic Reticulum and Mitochondria in a Cell Model of Huntington’s Disease

PubMed Central

De Mario, Agnese; Scarlatti, Chiara; Costiniti, Veronica; Primerano, Simona; Lopreiato, Raffaele; Calì, Tito; Brini, Marisa; Giacomello, Marta; Carafoli, Ernesto

2016-01-01

Huntington disease (HD) is caused by the CAG (Q) expansion in exon 1 of the IT15 gene encoding a polyglutamine (poly-Q) stretch of the Huntingtin protein (Htt). In the wild type protein, the repeats specify a stretch of up 34 Q in the N-terminal portion of Htt. In the pathological protein (mHtt) the poly-Q tract is longer. Proteolytic cleavage of the protein liberates an N-terminal fragment containing the expanded poly-Q tract becomes harmful to cells, in particular to striatal neurons. The fragments cause the transcriptional dysfunction of genes that are essential for neuronal survival. Htt, however, could also have non-transcriptional effects, e.g. it could directly alter Ca2+ homeostasis and/or mitochondrial morphology and function. Ca2+ dyshomeostasis and mitochondrial dysfunction are considered important in the molecular aetiology of the disease. Here we have analyzed the effect of the overexpression of Htt fragments (18Q, wild type form, wtHtt and 150Q mutated form, mHtt) on Ca2+ homeostasis in striatal neuronal precursor cells (Q7/7). We have found that the transient overexpression of the Htt fragments increases Ca2+ transients in the mitochondria of cells stimulated with Ca2+-mobilizing agonists. The bulk Ca2+ transients in the cytosol were unaffected, but the Ca2+ content of the endoplasmic reticulum was significantly decreased in the case of mHtt expression. To rule out possible transcriptional effects due to the presence of mHtt, we have measured the mRNA level of a subunit of the respiratory chain complex II, whose expression is commonly altered in many HD models. No effects on the mRNA level was found suggesting that, in our experimental condition, transcriptional action of Htt is not occurring and that the effects on Ca2+ homeostasis were dependent to non-transcriptional mechanisms. PMID:26819834

Calcium Handling by Endoplasmic Reticulum and Mitochondria in a Cell Model of Huntington's Disease.

PubMed

De Mario, Agnese; Scarlatti, Chiara; Costiniti, Veronica; Primerano, Simona; Lopreiato, Raffaele; Calì, Tito; Brini, Marisa; Giacomello, Marta; Carafoli, Ernesto

2016-01-06

Huntington disease (HD) is caused by the CAG (Q) expansion in exon 1 of the IT15 gene encoding a polyglutamine (poly-Q) stretch of the Huntingtin protein (Htt). In the wild type protein, the repeats specify a stretch of up 34 Q in the N-terminal portion of Htt. In the pathological protein (mHtt) the poly-Q tract is longer. Proteolytic cleavage of the protein liberates an N-terminal fragment containing the expanded poly-Q tract becomes harmful to cells, in particular to striatal neurons. The fragments cause the transcriptional dysfunction of genes that are essential for neuronal survival. Htt, however, could also have non-transcriptional effects, e.g. it could directly alter Ca2+ homeostasis and/or mitochondrial morphology and function. Ca2+ dyshomeostasis and mitochondrial dysfunction are considered important in the molecular aetiology of the disease. Here we have analyzed the effect of the overexpression of Htt fragments (18Q, wild type form, wtHtt and 150Q mutated form, mHtt) on Ca2+ homeostasis in striatal neuronal precursor cells (Q7/7). We have found that the transient overexpression of the Htt fragments increases Ca2+ transients in the mitochondria of cells stimulated with Ca2+-mobilizing agonists. The bulk Ca2+ transients in the cytosol were unaffected, but the Ca2+ content of the endoplasmic reticulum was significantly decreased in the case of mHtt expression. To rule out possible transcriptional effects due to the presence of mHtt, we have measured the mRNA level of a subunit of the respiratory chain complex II, whose expression is commonly altered in many HD models. No effects on the mRNA level was found suggesting that, in our experimental condition, transcriptional action of Htt is not occurring and that the effects on Ca2+ homeostasis were dependent to non-transcriptional mechanisms.

Huntingtin coordinates the dynein-mediated dynamic positioning of endosomes and lysosomes

PubMed Central

Caviston, Juliane P.; Zajac, Allison L.; Tokito, Mariko; Holzbaur, Erika L.F.

2011-01-01

Huntingtin (Htt) is a membrane-associated scaffolding protein that interacts with microtubule motors as well as actin-associated adaptor molecules. We examined a role for Htt in the dynein-mediated intracellular trafficking of endosomes and lysosomes. In HeLa cells depleted of either Htt or dynein, early, recycling, and late endosomes (LE)/lysosomes all become dispersed. Despite altered organelle localization, kinetic assays indicate only minor defects in intracellular trafficking. Expression of full-length Htt is required to restore organelle localization in Htt-depleted cells, supporting a role for Htt as a scaffold that promotes functional interactions along its length. In dynein-depleted cells, LE/lysosomes accumulate in tight patches near the cortex, apparently enmeshed by cortactin-positive actin filaments; Latrunculin B-treatment disperses these patches. Peripheral LE/lysosomes in dynein-depleted cells no longer colocalize with microtubules. Htt may be required for this off-loading, as the loss of microtubule association is not seen in Htt-depleted cells or in cells depleted of both dynein and Htt. Inhibition of kinesin-1 relocalizes peripheral LE/lysosomes induced by Htt depletion but not by dynein depletion, consistent with their detachment from microtubules upon dynein knockdown. Together, these data support a model of Htt as a facilitator of dynein-mediated trafficking that may regulate the cytoskeletal association of dynamic organelles. PMID:21169558

Discovery of Novel Isoforms of Huntingtin Reveals a New Hominid-Specific Exon

PubMed Central

Popowski, Melissa; Haremaki, Tomomi; Croft, Gist F.; Deglincerti, Alessia; Brivanlou, Ali H.

2015-01-01

Huntington’s disease (HD) is a devastating neurological disorder that is caused by an expansion of the poly-Q tract in exon 1 of the Huntingtin gene (HTT). HTT is an evolutionarily conserved and ubiquitously expressed protein that has been linked to a variety of functions including transcriptional regulation, mitochondrial function, and vesicle transport. This large protein has numerous caspase and calpain cleavage sites and can be decorated with several post-translational modifications such as phosphorylations, acetylations, sumoylations, and palmitoylations. However, the exact function of HTT and the role played by its modifications in the cell are still not well understood. Scrutiny of HTT function has been focused on a single, full length mRNA. In this study, we report the discovery of 5 novel HTT mRNA splice isoforms that are expressed in normal and HTT-expanded human embryonic stem cell (hESC) lines as well as in cortical neurons differentiated from hESCs. Interestingly, none of the novel isoforms generates a truncated protein. Instead, 4 of the 5 new isoforms specifically eliminate domains and modifications to generate smaller HTT proteins. The fifth novel isoform incorporates a previously unreported additional exon, dubbed 41b, which is hominid-specific and introduces a potential phosphorylation site in the protein. The discovery of this hominid-specific isoform may shed light on human-specific pathogenic mechanisms of HTT, which could not be investigated with current mouse models of the disease. PMID:26010866

Real-time imaging of Huntingtin aggregates diverting target search and gene transcription

PubMed Central

Li, Li; Liu, Hui; Dong, Peng; Li, Dong; Legant, Wesley R; Grimm, Jonathan B; Lavis, Luke D; Betzig, Eric; Tjian, Robert; Liu, Zhe

2016-01-01

The presumptive altered dynamics of transient molecular interactions in vivo contributing to neurodegenerative diseases have remained elusive. Here, using single-molecule localization microscopy, we show that disease-inducing Huntingtin (mHtt) protein fragments display three distinct dynamic states in living cells – 1) fast diffusion, 2) dynamic clustering and 3) stable aggregation. Large, stable aggregates of mHtt exclude chromatin and form 'sticky' decoy traps that impede target search processes of key regulators involved in neurological disorders. Functional domain mapping based on super-resolution imaging reveals an unexpected role of aromatic amino acids in promoting protein-mHtt aggregate interactions. Genome-wide expression analysis and numerical simulation experiments suggest mHtt aggregates reduce transcription factor target site sampling frequency and impair critical gene expression programs in striatal neurons. Together, our results provide insights into how mHtt dynamically forms aggregates and disrupts the finely-balanced gene control mechanisms in neuronal cells. DOI: http://dx.doi.org/10.7554/eLife.17056.001 PMID:27484239

Identification of hepta-histidine as a candidate drug for Huntington’s disease by in silico-in vitro- in vivo-integrated screens of chemical libraries

NASA Astrophysics Data System (ADS)

Imamura, Tomomi; Fujita, Kyota; Tagawa, Kazuhiko; Ikura, Teikichi; Chen, Xigui; Homma, Hidenori; Tamura, Takuya; Mao, Ying; Taniguchi, Juliana Bosso; Motoki, Kazumi; Nakabayashi, Makoto; Ito, Nobutoshi; Yamada, Kazunori; Tomii, Kentaro; Okano, Hideyuki; Kaye, Julia; Finkbeiner, Steven; Okazawa, Hitoshi

2016-09-01

We identified drug seeds for treating Huntington’s disease (HD) by combining in vitro single molecule fluorescence spectroscopy, in silico molecular docking simulations, and in vivo fly and mouse HD models to screen for inhibitors of abnormal interactions between mutant Htt and physiological Ku70, an essential DNA damage repair protein in neurons whose function is known to be impaired by mutant Htt. From 19,468 and 3,010,321 chemicals in actual and virtual libraries, fifty-six chemicals were selected from combined in vitro-in silico screens; six of these were further confirmed to have an in vivo effect on lifespan in a fly HD model, and two chemicals exerted an in vivo effect on the lifespan, body weight and motor function in a mouse HD model. Two oligopeptides, hepta-histidine (7H) and Angiotensin III, rescued the morphological abnormalities of primary neurons differentiated from iPS cells of human HD patients. For these selected drug seeds, we proposed a possible common structure. Unexpectedly, the selected chemicals enhanced rather than inhibited Htt aggregation, as indicated by dynamic light scattering analysis. Taken together, these integrated screens revealed a new pathway for the molecular targeted therapy of HD.

Identification of hepta-histidine as a candidate drug for Huntington’s disease by in silico-in vitro- in vivo-integrated screens of chemical libraries

PubMed Central

Imamura, Tomomi; Fujita, Kyota; Tagawa, Kazuhiko; Ikura, Teikichi; Chen, Xigui; Homma, Hidenori; Tamura, Takuya; Mao, Ying; Taniguchi, Juliana Bosso; Motoki, Kazumi; Nakabayashi, Makoto; Ito, Nobutoshi; Yamada, Kazunori; Tomii, Kentaro; Okano, Hideyuki; Kaye, Julia; Finkbeiner, Steven; Okazawa, Hitoshi

2016-01-01

We identified drug seeds for treating Huntington’s disease (HD) by combining in vitro single molecule fluorescence spectroscopy, in silico molecular docking simulations, and in vivo fly and mouse HD models to screen for inhibitors of abnormal interactions between mutant Htt and physiological Ku70, an essential DNA damage repair protein in neurons whose function is known to be impaired by mutant Htt. From 19,468 and 3,010,321 chemicals in actual and virtual libraries, fifty-six chemicals were selected from combined in vitro-in silico screens; six of these were further confirmed to have an in vivo effect on lifespan in a fly HD model, and two chemicals exerted an in vivo effect on the lifespan, body weight and motor function in a mouse HD model. Two oligopeptides, hepta-histidine (7H) and Angiotensin III, rescued the morphological abnormalities of primary neurons differentiated from iPS cells of human HD patients. For these selected drug seeds, we proposed a possible common structure. Unexpectedly, the selected chemicals enhanced rather than inhibited Htt aggregation, as indicated by dynamic light scattering analysis. Taken together, these integrated screens revealed a new pathway for the molecular targeted therapy of HD. PMID:27653664

Prefoldin Protects Neuronal Cells from Polyglutamine Toxicity by Preventing Aggregation Formation*

PubMed Central

Tashiro, Erika; Zako, Tamotsu; Muto, Hideki; Itoo, Yoshinori; Sörgjerd, Karin; Terada, Naofumi; Abe, Akira; Miyazawa, Makoto; Kitamura, Akira; Kitaura, Hirotake; Kubota, Hiroshi; Maeda, Mizuo; Momoi, Takashi; Iguchi-Ariga, Sanae M. M.; Kinjo, Masataka; Ariga, Hiroyoshi

2013-01-01

Huntington disease is caused by cell death after the expansion of polyglutamine (polyQ) tracts longer than ∼40 repeats encoded by exon 1 of the huntingtin (HTT) gene. Prefoldin is a molecular chaperone composed of six subunits, PFD1–6, and prevents misfolding of newly synthesized nascent polypeptides. In this study, we found that knockdown of PFD2 and PFD5 disrupted prefoldin formation in HTT-expressing cells, resulting in accumulation of aggregates of a pathogenic form of HTT and in induction of cell death. Dead cells, however, did not contain inclusions of HTT, and analysis by a fluorescence correlation spectroscopy indicated that knockdown of PFD2 and PFD5 also increased the size of soluble oligomers of pathogenic HTT in cells. In vitro single molecule observation demonstrated that prefoldin suppressed HTT aggregation at the small oligomer (dimer to tetramer) stage. These results indicate that prefoldin inhibits elongation of large oligomers of pathogenic Htt, thereby inhibiting subsequent inclusion formation, and suggest that soluble oligomers of polyQ-expanded HTT are more toxic than are inclusion to cells. PMID:23720755

HEAT-INDUCED TAS1 TARGET1 Mediates Thermotolerance via HEAT STRESS TRANSCRIPTION FACTOR A1a–Directed Pathways in Arabidopsis[C][W

PubMed Central

Li, Shuxia; Liu, Jinxin; Liu, Zhongyuan; Li, Xiaorong; Wu, Feijie; He, Yuke

2014-01-01

Many heat stress transcription factors (Hsfs) and heat shock proteins (Hsps) have been identified to play important roles in the heat tolerance of plants. However, many of the key factors mediating the heat response pathways remain unknown. Here, we report that two genes, which are targets of TAS1 (trans-acting siRNA precursor 1)–derived small interfering RNAs that we named HEAT-INDUCED TAS1 TARGET1 (HTT1) and HTT2, are involved in thermotolerance. Microarray analysis revealed that the HTT1 and HTT2 genes were highly upregulated in Arabidopsis thaliana seedlings in response to heat shock. Overexpression of TAS1a, whose trans-acting small interfering RNAs target the HTT genes, elevated accumulation of TAS1-siRNAs and reduced expression levels of the HTT genes, causing weaker thermotolerance. By contrast, overexpression of HTT1 and HTT2 upregulated several Hsf genes, leading to stronger thermotolerance. In heat-tolerant plants overexpressing HsfA1a, the HTT genes were upregulated, especially at high temperatures. Meanwhile, HsfA1a directly activated HTT1 and HTT2 through binding to their promoters. HTT1 interacted with the heat shock proteins Hsp70-14 and Hsp40 and NUCLEAR FACTOR Y, SUBUNIT C2. Taken together, these results suggest that HTT1 mediates thermotolerance pathways because it is targeted by TAS1a, mainly activated by HsfA1a, and acts as cofactor of Hsp70-14 complexes. PMID:24728648

Rhes suppression enhances disease phenotypes in Huntington's disease mice.

PubMed

Lee, John H; Sowada, Matthew J; Boudreau, Ryan L; Aerts, Andrea M; Thedens, Daniel R; Nopoulos, Peg; Davidson, Beverly L

2014-01-01

In Huntington's disease (HD) mutant HTT is ubiquitously expressed yet the striatum undergoes profound early degeneration. Cell culture studies suggest that a striatal-enriched protein, Rhes, may account for this vulnerability. We investigated the therapeutic potential of silencing Rhes in vivo using inhibitory RNAs (miRhes). While Rhes suppression was tolerated in wildtype mice, it failed to improve rotarod function in two distinct HD mouse models. Additionally, miRhes treated HD mice had increased anxiety-like behaviors and enhanced striatal atrophy as measured by longitudinal MRI when compared to control treated mice. These findings raise caution regarding the long-term implementation of inhibiting Rhes as a therapy for HD.

Serotonin transporter deficient mice are vulnerable to escape deficits following inescapable shocks.

PubMed

Muller, J M; Morelli, E; Ansorge, M; Gingrich, J A

2011-03-01

Modulation of serotonin transporter (5-HTT) function causes changes in affective behavior, both in humans and rodents. Stressful life events likewise affect emotional behavior. In humans, a low-expressing genetic 5-htt variant, the s allele of the 5-htt linked promoter region, has been associated with increased risk for depression only where there was a history of stressful life events. To investigate this gene by environment interaction in mice, we compared the effects of inescapable shocks on the behavior of wild-type (5-htt+/+), heterozygote (5-htt+/-) and serotonin transporter deficient (5-htt-/-) mice. Inescapable shocks induce behavioral changes including a shock escape deficit, in a subsequent test when escape is possible. Confirming a gene by environment interaction, we found that stress increases escape latencies in a gene-dose dependent manner (5-htt-/->5-htt+/->5-htt +/+), where as there were no differences among the genotypes in the unstressed condition. The vulnerability to increased escape latency could not be accounted for by enhanced fear learning, as 5-htt-/- mice did not show heightened fear conditioning. The interaction of 5-htt genotype and stress appeared to produce a selective behavioral vulnerability, because no interaction of 5-htt genotype and stress was observed in other measures of anxiety and depression-linked behavior, including the open field, novelty suppressed feeding, and forced swim tests. We replicated prior findings that the 5-htt-/- displays heightened anxiety and depression-like behavior at baseline (unstressed condition). In conclusion, our data offer the possibility for future investigation of the neural basis underlying 5-htt genotype-by-stress interaction shown here. © 2010 The Authors. Genes, Brain and Behavior © 2010 Blackwell Publishing Ltd and International Behavioural and Neural Genetics Society.

Comparison of mHTT Antibodies in Huntington’s Disease Mouse Models Reveal Specific Binding Profiles and Steady-State Ubiquitin Levels with Disease Development

PubMed Central

Bayram-Weston, Zubeyde; Jones, Lesley; Dunnett, Stephen B.; Brooks, Simon P.

2016-01-01

Huntington’s disease (HD) cellular pathology is characterised by the aggregation of mutant huntingtin (mHTT) protein into inclusion bodies. The present paper compared the sensitivity of five widely used mHTT antibodies (S830; MW8; EM48; 1C2; ubiquitin) against mice from five commonly used HD mouse models (R6/1; YAC128; HdhQ92; B6 HdhQ150; B6 x129/Ola HdhQ150) at two ages to determine: the most sensitive antibodies for each model; whether mHTT antibody binding differed depending on aggregation stage (diffuse versus frank inclusion); the role of ubiquitin during aggregation as the ubiquitin proteosome system has been implicated in disease development. The models demonstrated unique profiles of antibody binding even when the models varied only by background strain (HdhQ150). MW8 was highly sensitive for detecting frank inclusions in all lines whereas EM48, ubiquitin and 1C2 demonstrated consistent staining in all models irrespective of age or form of mHTT. MW8 and S830 were the most sensitive antibodies with 1C2 the least. Ubiquitin levels were stable for each model regardless of age. Ubiquitin was particularly sensitive in young YAC128 mice that demonstrate an absence of inclusions until ~12 months of age suggesting high affinity to mHTT in its diffuse form. The data indicate that generalisations across models regarding the quantification of aggregations may not be valid and that mHTT antibody binding is unique to the mouse model and sensitive to changes in inclusion development. PMID:27196694

Lack of huntingtin promotes neural stem cells differentiation into glial cells while neurons expressing huntingtin with expanded polyglutamine tracts undergo cell death.

PubMed

Conforti, Paola; Camnasio, Stefano; Mutti, Cesare; Valenza, Marta; Thompson, Morgan; Fossale, Elisa; Zeitlin, Scott; MacDonald, Marcy E; Zuccato, Chiara; Cattaneo, Elena

2013-02-01

Huntington's disease (HD) is a neurodegenerative disorder that affects muscle coordination and diminishes cognitive abilities. The genetic basis of the disease is an expansion of CAG repeats in the Huntingtin (Htt) gene. Here we aimed to generate a series of mouse neural stem (NS) cell lines that carried varying numbers of CAG repeats in the mouse Htt gene (Hdh CAG knock-in NS cells) or that had Hdh null alleles (Hdh knock-out NS cells). Towards this end, Hdh CAG knock-in mouse ES cell lines that carried an Htt gene with 20, 50, 111, or 140 CAG repeats or that were Htt null were neuralized and converted into self-renewing NS cells. The resulting NS cell lines were immunopositive for the neural stem cell markers NESTIN, SOX2, and BLBP and had similar proliferative rates and cell cycle distributions. After 14 days in vitro, wild-type NS cells gave rise to cultures composed of 70% MAP2(+) neurons and 30% GFAP(+) astrocytes. In contrast, NS cells with expanded CAG repeats underwent neuronal cell death, with only 38%±15% of the MAP2(+) cells remaining at the end of the differentiation period. Cell death was verified by increased caspase 3/7 activity on day 14 of the neuronal differentiation protocol. Interestingly, Hdh knock-out NS cells treated using the same neuronal differentiation protocol showed a dramatic increase in the number of GFAP(+) cells on day 14 (61%±20% versus 24%±10% in controls), and a massive decrease of MAP2(+) neurons (30%±11% versus 64%±17% in controls). Both Hdh CAG knock-in NS cells and Hdh knock-out NS cells showed reduced levels of Bdnf mRNA during neuronal differentiation, in agreement with data obtained previously in HD mouse models and in post-mortem brain samples from HD patients. We concluded that Hdh CAG knock-in and Hdh knock-out NS cells have potential as tools for investigating the roles of normal and mutant HTT in differentiated neurons and glial cells of the brain. Copyright © 2012 Elsevier Inc. All rights reserved.

Detection of Mutant Huntingtin Aggregation Conformers and Modulation of SDS-Soluble Fibrillar Oligomers by Small Molecules

PubMed Central

Sontag, Emily Mitchell; Lotz, Gregor P.; Yang, Guocheng; Sontag, Christopher J.; Cummings, Brian J.; Glabe, Charles G.; Muchowski, Paul J.; Thompson, Leslie Michels

2012-01-01

The Huntington’s disease (HD) mutation leads to a complex process of Huntingtin (Htt) aggregation into multimeric species that eventually form visible inclusions in cytoplasm, nuclei and neuronal processes. One hypothesis is that smaller, soluble forms of amyloid proteins confer toxic effects and contribute to early cell dysfunction. However, analysis of mutant Htt aggregation intermediates to identify conformers that may represent toxic forms of the protein and represent potential drug targets remains difficult. We performed a detailed analysis of aggregation conformers in multiple in vitro, cell and ex vivo models of HD. Conformation-specific antibodies were used to identify and characterize aggregation species, allowing assessment of multiple conformers present during the aggregation process. Using a series of assays together with these antibodies, several forms could be identified. Fibrillar oligomers, defined as having a β-sheet rich conformation, are observed in vitro using recombinant protein and in protein extracts from cells in culture or mouse brain and shown to be globular, soluble and non-sedimentable structures. Compounds previously described to modulate visible inclusion body formation and reduce toxicity in HD models were also tested and consistently found to alter the formation of fibrillar oligomers. Interestingly, these compounds did not alter the rate of visible inclusion formation, indicating that fibrillar oligomers are not necessarily the rate limiting step of inclusion body formation. Taken together, we provide insights into the structure and formation of mutant Htt fibrillar oligomers that are modulated by small molecules with protective potential in HD models. PMID:24086178

Nanoparticle-mediated intracellular lipid accumulation during C2C12 cell differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsukahara, Tamotsu, E-mail: ttamotsu@shinshu-u.ac.jp; Haniu, Hisao, E-mail: hhaniu@shinshu-u.ac.jp

2011-03-25

Research highlights: {yields} HTT2800 has a significant effect on intracellular lipid accumulation. {yields} HTT2800 reduced muscle-specific genes and led to the emergence of adipocyte-related genes. {yields} HT2800 converts the differentiation pathway of C2C12 myoblasts to that of adipoblast-like cells. -- Abstract: In this report, we sought to elucidate whether multiwall carbon nanotubes are involved in the modulation of the proliferation and differentiation of the skeletal muscle cell line C2C12. Skeletal muscle is a major mass peripheral tissue that accounts for 40% of total body weight and 50% of energy consumption. We focused on the differentiation pathway of myoblasts after exposuremore » to a vapor-grown carbon fiber, HTT2800, which is one of the most highly purified carbon nanotubes. This treatment leads in parallel to the expression of a typical adipose differentiation program. We found that HTT2800 stimulated intracellular lipid accumulation in C2C12 cells. We have also shown by quantified PCR analysis that the expression of adipose-related genes was markedly upregulated during HTT2800 exposure. Taken together, these results suggest that HTT2800 specifically converts the differentiation pathway of C2C12 myoblasts to that of adipoblast-like cells.« less

Bifunctional Anti-Huntingtin Proteasome-Directed Intrabodies Mediate Efficient Degradation of Mutant Huntingtin Exon 1 Protein Fragments

PubMed Central

Butler, David C.; Messer, Anne

2011-01-01

Huntington's disease (HD) is a fatal autosomal dominant neurodegenerative disorder caused by a trinucleotide (CAG)n repeat expansion in the coding sequence of the huntingtin gene, and an expanded polyglutamine (>37Q) tract in the protein. This results in misfolding and accumulation of huntingtin protein (htt), formation of neuronal intranuclear and cytoplasmic inclusions, and neuronal dysfunction/degeneration. Single-chain Fv antibodies (scFvs), expressed as intrabodies that bind htt and prevent aggregation, show promise as immunotherapeutics for HD. Intrastriatal delivery of anti-N-terminal htt scFv-C4 using an adeno-associated virus vector (AAV2/1) significantly reduces the size and number of aggregates in HDR6/1 transgenic mice; however, this protective effect diminishes with age and time after injection. We therefore explored enhancing intrabody efficacy via fusions to heterologous functional domains. Proteins containing a PEST motif are often targeted for proteasomal degradation and generally have a short half life. In ST14A cells, fusion of the C-terminal PEST region of mouse ornithine decarboxylase (mODC) to scFv-C4 reduces htt exon 1 protein fragments with 72 glutamine repeats (httex1-72Q) by ∼80–90% when compared to scFv-C4 alone. Proteasomal targeting was verified by either scrambling the mODC-PEST motif, or via proteasomal inhibition with epoxomicin. For these constructs, the proteasomal degradation of the scFv intrabody proteins themselves was reduced<25% by the addition of the mODC-PEST motif, with or without antigens. The remaining intrabody levels were amply sufficient to target N-terminal httex1-72Q protein fragment turnover. Critically, scFv-C4-PEST prevents aggregation and toxicity of httex1-72Q fragments at significantly lower doses than scFv-C4. Fusion of the mODC-PEST motif to intrabodies is a valuable general approach to specifically target toxic antigens to the proteasome for degradation. PMID:22216210

Early life stress predicts negative urgency through brooding, depending on 5-HTTLPR genotype: A pilot study with 6-month follow-up examining suicide ideation.

PubMed

Valderrama, Jorge; Miranda, Regina

2017-12-01

The present study examined the interaction between early life stress and 5-HTT genotypes in predicting two risk factors for suicidal behavior - the brooding subtype of rumination and impulsivity, in the form of negative urgency - over time. Furthermore, we examined early life stress, brooding, and impulsivity as predictors of suicidal ideation over time. Participants with and without a history of early life stress were genotyped for the 5-HTTLPR polymorphism and completed assessments assessing brooding and negative urgency at baseline and 6-month follow up. Early life emotional abuse was associated with negative urgency at follow-up. We found an indirect effect of early life emotional abuse on negative urgency through brooding among individuals with 5-HTT low expressing genotypes but not among individuals with 5-HTT high expressing genotypes. Further, a logistic regression analysis revealed that negative urgency was associated with higher odds (O.R. = 16.2) of reporting suicide ideation (versus no ideation) at follow-up. Our findings suggest that brooding and negative urgency may result from the interaction between early life emotional abuse and 5-HTT low expressing genotypes. Further research is necessary to understand how early life stress interacts with 5-HTT genotypes to confer risk for suicidal behavior through psychological mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.

Cell-to-cell Transmission of Polyglutamine Aggregates in C. elegans

PubMed Central

Kim, Dong-Kyu; Cho, Kyu-Won; Ahn, Woo Jung; Perez-Acuña, Dayana; Jeong, Hyunsu; Lee, He-Jin

2017-01-01

Huntington disease (HD) is an inherited neurodegenerative disorder characterized by motor and cognitive dysfunction caused by expansion of polyglutamine (polyQ) repeat in exon 1 of huntingtin (HTT). In patients, the number of glutamine residues in polyQ tracts are over 35, and it is correlated with age of onset, severity, and disease progression. Expansion of polyQ increases the propensity for HTT protein aggregation, process known to be implicated in neurodegeneration. These pathological aggregates can be transmitted from neuron to another neuron, and this process may explain the pathological spreading of polyQ aggregates. Here, we developed an in vivo model for studying transmission of polyQ aggregates in a highly quantitative manner in real time. HTT exon 1 with expanded polyQ was fused with either N-terminal or C-terminal fragments of Venus fluorescence protein and expressed in pharyngeal muscles and associated neurons, respectively, of C. elegans. Transmission of polyQ proteins was detected using bimolecular fluorescence complementation (BiFC). Mutant polyQ (Q97) was transmitted much more efficiently than wild type polyQ (Q25) and forms numerous inclusion bodies as well. The transmission of Q97 was gradually increased with aging of animal. The animals with polyQ transmission exhibited degenerative phenotypes, such as nerve degeneration, impaired pharyngeal pumping behavior, and reduced life span. The C. elegans model presented here would be a useful in vivo model system for the study of polyQ aggregate propagation and might be applied to the screening of genetic and chemical modifiers of the propagation. PMID:29302199

Association of MAOA, 5-HTT, and NET promoter polymorphisms with gene expression and protein activity in human placentas

PubMed Central

Zhang, Huiping; Smith, Graeme N.; Liu, Xudong

2010-01-01

Monoamine oxidase A (MAOA) and the transporters for serotonin (5-HTT) and norepinephrine (NET) may play important roles in regulating maternal monoamine neurotransmitters transferred across the placenta to the fetus. We investigated whether promoter polymorphisms in MAOA (uVNTR), 5-HTT (5-HTTLPR), and NET (NETpPR AAGG4) could influence gene expression and protein activity in human placentas. Normal term human placentas (n = 73) were collected, and placental MAOA, 5-HTT, and NET mRNA levels and protein activity were determined. The mRNA levels or protein activities were compared between different genotype groups. Placentas hemizygous (male fetus) or homozygous (female fetus) for MAOA uVNTR 4-repeat allele had significantly higher MAOA mRNA levels than those hemizygous or homozygous for the 3-repeat allele (P = 0.001). However, no significant difference in MAOA enzyme activity was found for these two groups of genotypes (P = 0.161). Placentas with the 5-HTTLPR short (S)-allele (S/S+S/L) had significantly lower 5-HTT mRNA levels and serotonin uptake rate than those homozygous for the long (L)-allele (L/L) (mRNA: P < 0.001; serotonin transporting activity: P < 0.001). Placentas homozygous for the NET AAGG4 L4 allele had significantly higher NET mRNA levels, as well as dopamine and norepinephrine uptake rates, than those with the S4/L4 genotype (mRNA: P < 0.001; dopamine transporting activity: P = 0.012; norepinephrine transporting activity: P = 0.011). These findings suggest that the three promoter polymorphisms of MAOA, 5-HTT, and NET influence gene expression levels and protein activity of these genes in human placentas, potentially leading to different fetal levels of maternal monoamine neurotransmitters, which may have an impact on fetal neurodevelopment. PMID:20332182

Association of MAOA, 5-HTT, and NET promoter polymorphisms with gene expression and protein activity in human placentas.

PubMed

Zhang, Huiping; Smith, Graeme N; Liu, Xudong; Holden, Jeanette J A

2010-06-01

Monoamine oxidase A (MAOA) and the transporters for serotonin (5-HTT) and norepinephrine (NET) may play important roles in regulating maternal monoamine neurotransmitters transferred across the placenta to the fetus. We investigated whether promoter polymorphisms in MAOA (uVNTR), 5-HTT (5-HTTLPR), and NET (NETpPR AAGG(4)) could influence gene expression and protein activity in human placentas. Normal term human placentas (n = 73) were collected, and placental MAOA, 5-HTT, and NET mRNA levels and protein activity were determined. The mRNA levels or protein activities were compared between different genotype groups. Placentas hemizygous (male fetus) or homozygous (female fetus) for MAOA uVNTR 4-repeat allele had significantly higher MAOA mRNA levels than those hemizygous or homozygous for the 3-repeat allele (P = 0.001). However, no significant difference in MAOA enzyme activity was found for these two groups of genotypes (P = 0.161). Placentas with the 5-HTTLPR short (S)-allele (S/S+S/L) had significantly lower 5-HTT mRNA levels and serotonin uptake rate than those homozygous for the long (L)-allele (L/L) (mRNA: P < 0.001; serotonin transporting activity: P < 0.001). Placentas homozygous for the NET AAGG(4) L(4) allele had significantly higher NET mRNA levels, as well as dopamine and norepinephrine uptake rates, than those with the S(4)/L(4) genotype (mRNA: P < 0.001; dopamine transporting activity: P = 0.012; norepinephrine transporting activity: P = 0.011). These findings suggest that the three promoter polymorphisms of MAOA, 5-HTT, and NET influence gene expression levels and protein activity of these genes in human placentas, potentially leading to different fetal levels of maternal monoamine neurotransmitters, which may have an impact on fetal neurodevelopment.

Cellular Inclusion Bodies of Mutant Huntingtin Exon 1 Obscure Small Fibrillar Aggregate Species

PubMed Central

Sahl, Steffen J.; Weiss, Lucien E.; Duim, Whitney C.; Frydman, Judith; Moerner, W. E.

2012-01-01

The identities of toxic aggregate species in Huntington's disease pathogenesis remain ambiguous. While polyQ-expanded huntingtin (Htt) is known to accumulate in compact inclusion bodies inside neurons, this is widely thought to be a protective coping response that sequesters misfolded conformations or aggregated states of the mutated protein. To define the spatial distributions of fluorescently-labeled Htt-exon1 species in the cell model PC12m, we employed highly sensitive single-molecule super-resolution fluorescence imaging. In addition to inclusion bodies and the diffuse pool of monomers and oligomers, fibrillar aggregates ~100 nm in diameter and up to ~1–2 µm in length were observed for pathogenic polyQ tracts (46 and 97 repeats) after targeted photo-bleaching of the inclusion bodies. These short structures bear a striking resemblance to fibers described in vitro. Definition of the diverse Htt structures in cells will provide an avenue to link the impact of therapeutic agents to aggregate populations and morphologies. PMID:23193437

Inhibition of specific HDACs and sirtuins suppresses pathogenesis in a Drosophila model of Huntington's disease.

PubMed

Pallos, Judit; Bodai, Laszlo; Lukacsovich, Tamas; Purcell, Judith M; Steffan, Joan S; Thompson, Leslie Michels; Marsh, J Lawrence

2008-12-01

Huntington's disease (HD) is associated with transcriptional dysregulation, and multiple studies with histone deacetylase (HDAC) inhibitors suggest that global approaches for restoring transcriptional balance and appropriate protein acetylation are therapeutically promising. To determine whether more targeted approaches might be effective, we have tested the impact of all the HDACs in Drosophila on Huntingtin (Htt)-induced pathology. Among the zinc-dependent or 'classic' HDACs, we find that neurodegeneration is most sensitive to levels of Rpd3. We also find that among the NAD(+)-dependent class III deacetylases, genetic or pharmacological reduction of either Sir2 or Sirt2 provides neuroprotection to Htt-challenged animals and that even greater neuroprotection is achieved when Rpd3 and Sir2 are simultaneously reduced. Our experiments suggest that longevity promoting strategies may be distinct from those that protect against neurodegeneration in Drosophila challenged with mutant human Htt. These results highlight a novel therapeutic approach for HD in the form of Sir2 inhibition and possible combinatorial inhibition of Sir2 and Rpd3.

Comparison of Modules of Wild Type and Mutant Huntingtin and TP53 Protein Interaction Networks: Implications in Biological Processes and Functions

PubMed Central

Basu, Mahashweta; Bhattacharyya, Nitai P.; Mohanty, Pradeep K.

2013-01-01

Disease-causing mutations usually change the interacting partners of mutant proteins. In this article, we propose that the biological consequences of mutation are directly related to the alteration of corresponding protein protein interaction networks (PPIN). Mutation of Huntingtin (HTT) which causes Huntington's disease (HD) and mutations to TP53 which is associated with different cancers are studied as two example cases. We construct the PPIN of wild type and mutant proteins separately and identify the structural modules of each of the networks. The functional role of these modules are then assessed by Gene Ontology (GO) enrichment analysis for biological processes (BPs). We find that a large number of significantly enriched () GO terms in mutant PPIN were absent in the wild type PPIN indicating the gain of BPs due to mutation. Similarly some of the GO terms enriched in wild type PPIN cease to exist in the modules of mutant PPIN, representing the loss. GO terms common in modules of mutant and wild type networks indicate both loss and gain of BPs. We further assign relevant biological function(s) to each module by classifying the enriched GO terms associated with it. It turns out that most of these biological functions in HTT networks are already known to be altered in HD and those of TP53 networks are altered in cancers. We argue that gain of BPs, and the corresponding biological functions, are due to new interacting partners acquired by mutant proteins. The methodology we adopt here could be applied to genetic diseases where mutations alter the ability of the protein to interact with other proteins. PMID:23741403

A modifier of Huntington's disease onset at the MLH1 locus.

PubMed

Lee, Jong-Min; Chao, Michael J; Harold, Denise; Abu Elneel, Kawther; Gillis, Tammy; Holmans, Peter; Jones, Lesley; Orth, Michael; Myers, Richard H; Kwak, Seung; Wheeler, Vanessa C; MacDonald, Marcy E; Gusella, James F

2017-10-01

Huntington's disease (HD) is a dominantly inherited neurodegenerative disease caused by an expanded CAG repeat in HTT. Many clinical characteristics of HD such as age at motor onset are determined largely by the size of HTT CAG repeat. However, emerging evidence strongly supports a role for other genetic factors in modifying the disease pathogenesis driven by mutant huntingtin. A recent genome-wide association analysis to discover genetic modifiers of HD onset age provided initial evidence for modifier loci on chromosomes 8 and 15 and suggestive evidence for a locus on chromosome 3. Here, genotyping of candidate single nucleotide polymorphisms in a cohort of 3,314 additional HD subjects yields independent confirmation of the former two loci and moves the third to genome-wide significance at MLH1, a locus whose mouse orthologue modifies CAG length-dependent phenotypes in a Htt-knock-in mouse model of HD. Both quantitative and dichotomous association analyses implicate a functional variant on ∼32% of chromosomes with the beneficial modifier effect that delays HD motor onset by 0.7 years/allele. Genomic DNA capture and sequencing of a modifier haplotype localize the functional variation to a 78 kb region spanning the 3'end of MLH1 and the 5'end of the neighboring LRRFIP2, and marked by an isoleucine-valine missense variant in MLH1. Analysis of expression Quantitative Trait Loci (eQTLs) provides modest support for altered regulation of MLH1 and LRRFIP2, raising the possibility that the modifier affects regulation of both genes. Finally, polygenic modification score and heritability analyses suggest the existence of additional genetic modifiers, supporting expanded, comprehensive genetic analysis of larger HD datasets. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Morphological remodeling of C. elegans neurons during aging is modified by compromised protein homeostasis

PubMed Central

Vayndorf, Elena M; Scerbak, Courtney; Hunter, Skyler; Neuswanger, Jason R; Toth, Marton; Parker, J Alex; Neri, Christian; Driscoll, Monica; Taylor, Barbara E

2016-01-01

Understanding cellular outcomes, such as neuronal remodeling, that are common to both healthy and diseased aging brains is essential to the development of successful brain aging strategies. Here, we used Caenorhabdits elegans to investigate how the expression of proteotoxic triggers, such as polyglutamine (polyQ)-expanded huntingtin and silencing of proteostasis regulators, such as the ubiquitin–proteasome system (UPS) and protein clearance components, may impact the morphological remodeling of individual neurons as animals age. We examined the effects of disrupted proteostasis on the integrity of neuronal cytoarchitecture by imaging a transgenic C. elegans strain in which touch receptor neurons express the first 57 amino acids of the human huntingtin (Htt) gene with expanded polyQs (128Q) and by using neuron-targeted RNA interference in adult wild-type neurons to knockdown genes encoding proteins involved in proteostasis. We found that proteostatic challenges conferred by polyQ-expanded Htt and knockdown of specific genes involved in protein homeostasis can lead to morphological changes that are restricted to specific domains of specific neurons. The age-associated branching of PLM neurons is suppressed by N-ter polyQ-expanded Htt expression, whereas ALM neurons with polyQ-expanded Htt accumulate extended outgrowths and other soma abnormalities. Furthermore, knockdown of genes important for ubiquitin-mediated degradation, lysosomal function, and autophagy modulated these age-related morphological changes in otherwise normal neurons. Our results show that the expression of misfolded proteins in neurodegenerative disease such as Huntington’s disease modifies the morphological remodeling that is normally associated with neuronal aging. Our results also show that morphological remodeling of healthy neurons during aging can be regulated by the UPS and other proteostasis pathways. Collectively, our data highlight a model in which morphological remodeling during neuronal aging is strongly affected by disrupted proteostasis and expression of disease-associated, misfolded proteins such as human polyQ-Htt species. PMID:27347427

Comparison of phosphodiesterase 10A, dopamine receptors D1 and D2 and dopamine transporter ligand binding in the striatum of the R6/2 and BACHD mouse models of Huntington's disease.

PubMed

Miller, Silke; Hill Della Puppa, Geraldine; Reidling, Jack; Marcora, Edoardo; Thompson, Leslie M; Treanor, James

2014-01-01

Phosphodiesterase 10A (PDE10A) is expressed at high levels in the striatum and has been proposed both as a biomarker for Huntington's disease pathology and as a target for intervention. PDE10A radiotracers have been successfully used to measure changes in binding density in Huntington's disease patients, but little is known about PDE10A binding in mouse models that are used extensively to model pathology and test therapeutic interventions. Our study investigated changes in PDE10A binding using the selective tracer 3H-7980 at specific ages of two Huntington's disease transgenic mouse models: R6/2, a short-lived model carrying exon-1 of mutant HTT and BACHD, a longer-lived model carrying full-length mutant HTT. PDE10A binding was compared to binding of known markers of striatal atrophy in Huntington's disease, e.g. dopamine transporter (DAT) and dopamine receptors D1 and D2. We found that in the R6/2 model at 6 weeks of age, mice showed high variability of binding, however binding of all ligands was significantly decreased at 8 and 12 weeks of age. In contrast, no changes were detectable in the BACHD model at 8, 10 or 12 month of age. These findings suggest that radiotracer binding of PDE10A, DAT, D1 and D2 receptor in the R6/2 model may be a good indicator of striatal pathological changes that are observed in Huntington's disease patients, and that the first 12 months in the BACHD model may be more reflective of early stages of the disease.

Protective effects of 3-alkyl luteolin derivatives are mediated by Nrf2 transcriptional activity and decreased oxidative stress in Huntington's disease mouse striatal cells.

PubMed

Oliveira, Ana M; Cardoso, Susana M; Ribeiro, Márcio; Seixas, Raquel S G R; Silva, Artur M S; Rego, A Cristina

2015-12-01

Huntington's disease (HD) is a polyglutamine-expansion neurodegenerative disorder caused by increased number of CAG repeats in the HTT gene, encoding for the huntingtin protein. The mutation is linked to several intracellular mechanisms, including oxidative stress. Flavones are compounds with a protective role in neurodegenerative pathologies. In the present study we analyzed the protective effect of luteolin (Lut, 3',4',5,7-tetrahydroxyflavone) and four luteolin derivatives bearing 3-alkyl chains of 1, 4, 6 and 10 carbons (Lut-C1, Lut-C4, Lut-C6, Lut-C10) in striatal cells derived from HD knock-in mice expressing mutant Htt (STHdh(Q111/Q111)) versus wild-type striatal cells (STHdh(Q7/Q7)). HD cells showed increased caspase-3-like activity and intracellular reactive oxygen species (ROS), which were significantly decreased following treatment with Lut-C4 and Lut-C6 under concentrations that enhanced cell viability. Interestingly, Lut-C4 and Lut-C6 rose the nuclear levels of phospho(Ser40)-nuclear factor (erythroid-derived-2)-like 2 (Nrf2) and Nrf2/ARE transcriptional activity. Concordantly with increased Nrf2/ARE transcription, Lut-C6 enhanced superoxide dismutase 1 (SOD1) mRNA and SOD activity and glutamate-cysteine ligase catalytic subunit (GCLc) mRNA and protein levels, while Lut-C4 induced mRNA levels of GCLc only in mutant striatal cells. Data suggest that Lut-C6 luteolin derivative (in particular) might be relevant for the development of antioxidant strategies in HD. Copyright © 2015 Elsevier Ltd. All rights reserved.

Genomic analysis of wig-1 pathways.

PubMed

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P

2012-01-01

Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer.

Genomic Analysis of wig-1 Pathways

PubMed Central

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P.

2012-01-01

Background Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Methods and Results Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Conclusion Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer. PMID:22347364

Long-term neuronal damage and recovery after a single dose of MDMA: expression and distribution of serotonin transporter in the rat brain.

PubMed

Kirilly, Eszter

2010-09-01

"Ecstasy", 3,4-methylenedioxymethamphetamine (MDMA), an amphetamine analogue is one of the most widely used recreational drugs. In spite of the fact that neurotoxic effects of MDMA has been found in several species from rodents to non-human primates, and results increasingly point to damage also in human MDMA users, data about the sensitivity of different brain areas and the recovery after neuronal damage are scarce. Serotonin transporter (5-HTT) mRNA in the raphe nuclei also has not been examined. Humans with genetic predisposition for the slow metabolism of MDMA, the so-called "poor metabolizers" of debrisoquin are at higher risk. Five- 9% of the Caucasian population is considered to carry this phenotype. These studies were carried out in Dark Agouti rats, a special strain that show decreased microsomal CYP2D1 isoenzyme activity, and thus may serve as a model of vulnerable human users. These works were designed to characterize MDMA-induced damage and recovery of the serotonergic system including sleep and morphological changes within 180 days. In our experiments we investigated the 5-HTT mRNA expression in the brainstem and medullary raphe nuclei, 5-HTT immunoreactive (IR) fibre densities in several brain areas, and 16 functional measures of sleep in response to a single dose of +/- MDMA (15mg\\kg). Furthermore, behavioural experiments were performed 21 days after MDMA treatment. We found similar changes in 5-HTT mRNA expression in the examined raphe nuclei, namely transient increases 7 days after MDMA treatment followed by transient decreases at 21 days. Significant (20-40%), widespread reductions in 5-HTT-IR fibre density were detected in most brain areas at 7 and 21 days after MDMA administration. All cortical, but only some brainstem areas were damaged. Parallel to the neuronal damage we observed significant reductions in rapid eye movement (REM) sleep latency, increased fragmentation of sleep and increases in delta power spectra in non-REM sleep. At 180 days almost all functional changes in sleep were normalized together with 5-HTT mRNA expression in the examined raphe nuclei and the recovery of 5-HTT-IR fibre density in most brain areas. Our results also suggest that the acute MDMA administration abolished aggressive behaviour but MDMA pretreatment and the consequent depletion of serotonergic terminals did not affect aggression. Our findings concerning the changes detected in 5-HTT mRNA expression and fibre density indicate lasting impairment of the serotonergic system and suggest that a single use of MDMA may be associated with long-lasting cognitive, learning, memory and mood deficits and sleep disturbances particularly when a constellation of genetic vulnerability and certain environmental factors are present. Our data provide further evidence for the connection between altered serotonergic functions and sleep disturbance.

Telomere fusion in Drosophila: The role of subtelomeric chromatin

PubMed Central

Marzullo, Marta; Gatti, Maurizio

2015-01-01

Drosophila telomeres are maintained by transposition to chromosome ends of the HeT-A, TART and TAHRE retrotransposons, collectively designated as HTT. Although all Drosophila telomeres terminate with HTT arrays and are capped by the terminin complex, they differ in the type of subtelomeric chromatin. The HTT sequences of YS, YL, XR, and 4L are juxtaposed to constitutive heterochromatin, while the HTTs of the other telomeres are linked to either the TAS repeat-associated chromatin (XL, 2L, 2R, 3L, 3R) or to the specialized 4R chromatin. We found that mutations in pendolino (peo) cause (telomeric fusions) that preferentially involve the heterochromatin-associated telomeres (Ha-telomeres), a telomeric fusion pattern never observed in the other 10 telomere-capping mutants characterized so far. Peo, is homologous to the E2 variant ubiquitin-conjugating enzymes and is required for DNA replication. Our analyses lead us to hypothesize that DNA replication in Peo-depleted cells results in specific fusigenic lesions concentrated in Ha-telomeres. These data provide the first demonstration that subtelomeres can affect telomere fusion. PMID:26786804

ROCK and PRK-2 Mediate the Inhibitory Effect of Y-27632 on Polyglutamine Aggregation

PubMed Central

Shao, Jieya; Welch, William J.; Diamond, Marc I.

2009-01-01

Polyglutamine expansion in huntingtin (Htt) and the androgen receptor (AR) causes untreatable neurodegenerative diseases. Y-27632, a therapeutic lead, reduces Htt and AR aggregation in cultured cells, and Htt-induced neurodegeneration in Drosophila. Y-27632 inhibits both Rho-associated kinases ROCK and PRK-2, making its precise intracellular target uncertain. Over-expression of either kinase increases Htt and AR aggregation. Three ROCK inhibitors (Y-27632, H-1077, HA-1152), and a specific ROCK inhibitory peptide reduce polyglutamine protein aggregation, as does knockdown of ROCK or PRK-2 by RNAi. RNAi also indicates that each kinase is required for the inhibitory effects of Y-27632 to manifest fully. These two actin regulatory kinases are thus involved in polyglutamine aggregation, and their simultaneous inhibition may be an important therapeutic goal. PMID:18423405

Prior fear conditioning does not impede enhanced active avoidance in serotonin transporter knockout rats.

PubMed

Schipper, Pieter; Henckens, Marloes J A G; Borghans, Bart; Hiemstra, Marlies; Kozicz, Tamas; Homberg, Judith R

2017-05-30

Stressors can be actively or passively coped with, and adequate adaption of the coping response to environmental conditions can reduce their potential deleterious effects. One major factor influencing stress coping behaviour is serotonin transporter (5-HTT) availability. Abolishment of 5-HTT is known to impair fear extinction but facilitates acquisition of signalled active avoidance (AA), a behavioural task in which an animal learns to avoid an aversive stimulus that is predicted by a cue. Flexibility in adapting coping behaviour to the nature of the stressor shapes resilience to stress-related disorders. Therefore, we investigated the relation between 5-HTT expression and ability to adapt a learned coping response to changing environmental conditions. To this end, we first established and consolidated a cue-conditioned passive fear response in 5-HTT -/- and wildtype rats. Next, we used the conditioned stimulus (CS) to signal oncoming shocks during signalled AA training in 5-HTT -/- and wildtype rats to study their capability to acquire an active coping response to the CS following fear conditioning. Finally, we investigated the behavioural response to the CS in a novel environment and measured freezing, exploration and self-grooming, behaviours reflective of stress coping strategy. We found that fear conditioned and sham conditioned 5-HTT -/- animals acquired the signalled AA response faster than wildtypes, while prior conditioning briefly delayed AA learning similarly in both genotypes. Subsequent exposure to the CS in the novel context reduced freezing and increased locomotion in 5-HTT -/- compared to wildtype rats. This indicates that improved AA performance in 5-HTT -/- rats resulted in a weaker residual passive fear response to the CS in a novel context. Fear conditioning prior to AA training did not affect freezing upon re-encountering the CS, although it did reduce locomotion in 5-HTT -/- rats. We conclude that independent of 5-HTT signalling, prior fear conditioning does not greatly impair the acquisition of subsequent active coping behaviour when the situation allows for it. Abolishment of 5-HTT results in a more active coping style in case of novelty-induced fear and upon CS encounter in a novel context after AA learning. Copyright © 2017 Elsevier B.V. All rights reserved.

The choreography of neuroinflammation in Huntington’s disease

PubMed Central

Crotti, Andrea; Glass, Christopher K.

2016-01-01

Currently, the concept of ‘neuroinflammation’ includes inflammation associated with neurodegenerative diseases, in which there is little or no infiltration of blood-derived immune cells into the brain. The roles of brain-resident and peripheral immune cells in these inflammatory settings are poorly understood, and it is unclear whether neuroinflammation results from immune reaction to neuronal dysfunction/degeneration, and/or represents cell-autonomous phenotypes of dysfunctional immune cells. Here, we review recent studies examining these questions in the context of Huntington’s disease (HD), where mutant Huntingtin (HTT) is expressed in both neurons and glia. Insights into the cellular and molecular mechanisms underlying neuroinflammation in HD may provide a better understanding of inflammation in more complex neurodegenerative disorders, and of the contribution of the neuroinflammatory component to neurodegenerative disease pathogenesis. PMID:26001312

Gene expression profiling of R6/2 transgenic mice with different CAG repeat lengths reveals genes associated with disease onset and progression in Huntington's disease.

PubMed

Tang, Bin; Seredenina, Tamara; Coppola, Giovanni; Kuhn, Alexandre; Geschwind, Daniel H; Luthi-Carter, Ruth; Thomas, Elizabeth A

2011-06-01

R6/2 transgenic mice with expanded CAG repeats (>300) have a surprisingly prolonged disease progression and longer lifespan than prototypical parent R6/2 mice (carrying 150 CAGs); however, the mechanism of this phenotype amelioration is unknown. We compared gene expression profiles in the striatum of R6/2 transgenic mice carrying ~300 CAG repeats (R6/2(Q300) transgenic mice) to those carrying ~150 CAG repeats (R6/2(Q150) transgenic mice) and littermate wildtype controls in order to identify genes that may play determinant roles in the time course of phenotypic expression in these mice. Of the top genes showing concordant expression changes in the striatum of both R6/2 lines, 85% were decreased in expression, while discordant expression changes were observed mostly for genes upregulated in R6/2(Q300) transgenic mice. Upregulated genes in the R6/2(Q300) mice were associated with the ubiquitin ligase complex, cell adhesion, protein folding, and establishment of protein localization. We qPCR-validated increases in expression of genes related to the latter category, including Lrsam1, Erp29, Nasp, Tap1, Rab9b, and Pfdn5 in R6/2(Q300) mice, changes that were not observed in R6/2 mice with shorter CAG repeats, even in late stages (i.e., 12 weeks of age). We further tested Lrsam1 and Erp29, the two genes showing the greatest upregulation in R6/2(Q300) transgenic mice, for potential neuroprotective effects in primary striatal cultures overexpressing a mutated human huntingtin (htt) fragment. Overexpression of Lrsam1 prevented the loss of NeuN-positive cell bodies in htt171-82Q cultures, concomitant with a reduction of nuclear htt aggregates. Erp29 showed no significant effects in this model. This is consistent with the distinct pattern of htt inclusion localization observed in R6/2(Q300) transgenic mice, in which smaller cytoplasmic inclusions represent the major form of insoluble htt in the cell, as opposed to large nuclear inclusions observed in R6/2(Q150) transgenic mice. We suggest that the prolonged onset and disease course observed in R6/2 mice with greatly expanded CAG repeats might result from differential upregulation of genes related to protein localization and clearance. Such genes may represent novel therapeutic avenues to decrease htt aggregate toxicity and cell death in HD patients, with Lrsam1 being a promising, novel candidate disease modifier. Copyright © 2011 Elsevier Inc. All rights reserved.

Sexual behavior and testis morphology in the BACHD rat model

PubMed Central

Novati, Arianna; Yu-Taeger, Libo; Gonzalez Menendez, Irene; Quintanilla Martinez, Leticia

2018-01-01

Background Huntington disease (HD) is an autosomal dominant neurodegenerative disorder caused by a mutation in the huntingtin (HTT) gene, which results in brain neurodegeneration and peripheral pathology affecting different organs including testis. Patients with HD suffer from motor and cognitive impairment, and multiple psychiatric symptoms. Among behavioral abnormalities in HD, sexual disturbances have often been reported, but scarcely investigated in animal models. The BACHD rat model of HD carries the human full-length mutated HTT (mHTT) genomic sequence with 97 CAG-CAA repeats and displays HD-like alterations at neuropathological and behavioral level. Objective This study aims to phenotype the BACHD rats’ sexual behavior and performance as well as testis morphology because alterations in these aspects have been associated to HD. Methods Two rat cohorts at the age of 3 and 7 months were subjected to mating tests to assess different parameters of sexual behavior. Histological analyses for testis morphology were performed in different rat cohorts at 1.5, 7 and 12 months of age whereas immunohistochemical analyses were carried out at 7 and 12 months of age to visualize the presence of mHTT in testicular tissue. Furthermore, western blot analyses were used to assess HTT and mHTT expression levels in striatum and testis at three months of age. Results At 3 months, BACHD rats showed a decreased time exploring the female anogenital area (AGA), decreased latency to mount, increased number of intromissions and ejaculations and enhanced hit rate. At 7 months, all sexual parameters were comparable between genotypes with the exception that BACHD rats explored the AGA less than wild type rats. Testis analyses did not reveal any morphological alteration at any of the examined ages, but showed presence of mHTT limited to Sertoli cells in transgenic rats at both 7 and 12 months. BACHD rat HTT and mHTT expression levels in testis were lower than striatum at 3 months of age. Conclusions The testis phenotype in the BACHD rat model does not mimic the changes observed in human HD testis. The altered sexual behavior in BACHD rats at three months of age could be to a certain extent representative of and share common underlying pathways with some of the sexual disturbances in HD patients. Further investigating the biological causes of the sexual phenotype in BACHD rats may therefore contribute to clarifying the mechanisms at the base of sexual behavior changes in HD. PMID:29883458

Replication study of Japanese cohorts supports the role of STX1A in autism susceptibility.

PubMed

Nakamura, Kazuhiko; Iwata, Yasuhide; Anitha, Ayyappan; Miyachi, Taishi; Toyota, Tomoko; Yamada, Satoru; Tsujii, Masatsugu; Tsuchiya, Kenji J; Iwayama, Yoshimi; Yamada, Kazuo; Hattori, Eiji; Matsuzaki, Hideo; Matsumoto, Kaori; Suzuki, Katsuaki; Suda, Shiro; Takebayashi, Kiyokazu; Takei, Nori; Ichikawa, Hironobu; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio

2011-03-30

Autism is a pervasive developmental disorder diagnosed in early childhood. Abnormalities of serotonergic neurotransmission have been reported in autism. Serotonin transporter (5-HTT), which modulates serotonin levels, is a major therapeutic target in autism. Therefore, factors that regulate 5-HTT expression might be implicated in autism. One candidate 5-HTT-regulatory protein is the presynaptic protein, syntaxin 1A (STX1A). We examined the association of STX1A with autism in a trio association study using DNA samples from Japanese trios with autistic probands. In TDT analysis, rs69510130 (p=0.027) showed nominal associations with autism; modest haplotype association was also observed. We further compared STX1A mRNA expression between the autistic and control groups in the postmortem brain. In the anterior cingulate gyrus region, STX1A expression in the autism group was found to be significantly lower than that of the control group. Thus, we suggest a possible role of STX1A in the pathogenesis of autism. Copyright © 2010 Elsevier Inc. All rights reserved.

Pitfalls in the detection of cholesterol in Huntington's disease models.

PubMed

Marullo, Manuela; Valenza, Marta; Leoni, Valerio; Caccia, Claudio; Scarlatti, Chiara; De Mario, Agnese; Zuccato, Chiara; Di Donato, Stefano; Carafoli, Ernesto; Cattaneo, Elena

2012-10-11

Background Abnormalities in brain cholesterol homeostasis have been reported in Huntington's disease (HD), an adult-onset neurodegenerative disorder caused by an expansion in the number of CAG repeats in the huntingtin (HTT) gene. However, the results have been contradictory with respect to whether cholesterol levels increase or decrease in HD models. Biochemical and mass spectrometry methods show reduced levels of cholesterol precursors and cholesterol in HD cells and in the brains of several HD animal models. Abnormal brain cholesterol homeostasis was also inferred from studies in HD patients. In contrast, colorimetric and enzymatic methods indicate cholesterol accumulation in HD cells and tissues. Here we used several methods to investigate cholesterol levels in cultured cells in the presence or absence of mutant HTT protein. Results Colorimetric and enzymatic methods with low sensitivity gave variable results, whereas results from a sensitive analytical method, gas chromatography-mass spectrometry, were more reliable. Sample preparation, high cell density and cell clonality also influenced the detection of intracellular cholesterol. Conclusions Detection of cholesterol in HD samples by colorimetric and enzymatic assays should be supplemented by detection using more sensitive analytical methods. Care must be taken to prepare the sample appropriately. By evaluating lathosterol levels using isotopic dilution mass spectrometry, we confirmed reduced cholesterol biosynthesis in knock-in cells expressing the polyQ mutation in a constitutive or inducible manner. *Correspondence should be addressed to Elena Cattaneo: elena.cattaneo@unimi.it.

The hnRNP-Htt axis regulates necrotic cell death induced by transcriptional repression through impaired RNA splicing.

PubMed

Mao, Y; Tamura, T; Yuki, Y; Abe, D; Tamada, Y; Imoto, S; Tanaka, H; Homma, H; Tagawa, K; Miyano, S; Okazawa, H

2016-04-28

In this study, we identify signaling network of necrotic cell death induced by transcriptional repression (TRIAD) by α-amanitin (AMA), the selective RNA polymerase II inhibitor, as a model of neurodegenerative cell death. We performed genetic screen of a knockdown (KD) fly library by measuring the ratio of transformation from pupa to larva (PL ratio) under TRIAD, and selected the cell death-promoting genes. Systems biology analysis of the positive genes mapped on protein-protein interaction databases predicted the signaling network of TRIAD and the core pathway including heterogeneous nuclear ribonucleoproteins (hnRNPs) and huntingtin (Htt). RNA sequencing revealed that AMA impaired transcription and RNA splicing of Htt, which is known as an endoplasmic reticulum (ER)-stabilizing molecule. The impairment in RNA splicing and PL ratio was rescued by overexpresion of hnRNP that had been also affected by transcriptional repression. Fly genetics with suppressor or expresser of Htt and hnRNP worsened or ameliorated the decreased PL ratio by AMA, respectively. Collectively, these results suggested involvement of RNA splicing and a regulatory role of the hnRNP-Htt axis in the process of the transcriptional repression-induced necrosis.

A new Caenorhabditis elegans model of human huntingtin 513 aggregation and toxicity in body wall muscles.

PubMed

Lee, Amy L; Ung, Hailey M; Sands, L Paul; Kikis, Elise A

2017-01-01

Expanded polyglutamine repeats in different proteins are the known determinants of at least nine progressive neurodegenerative disorders whose symptoms include cognitive and motor impairment that worsen as patients age. One such disorder is Huntington's Disease (HD) that is caused by a polyglutamine expansion in the human huntingtin protein (htt). The polyglutamine expansion destabilizes htt leading to protein misfolding, which in turn triggers neurodegeneration and the disruption of energy metabolism in muscle cells. However, the molecular mechanisms that underlie htt proteotoxicity have been somewhat elusive, and the muscle phenotypes have not been well studied. To generate tools to elucidate the basis for muscle dysfunction, we engineered Caenorhabditis elegans to express a disease-associated 513 amino acid fragment of human htt in body wall muscle cells. We show that this htt fragment aggregates in C. elegans in a polyglutamine length-dependent manner and is toxic. Toxicity manifests as motor impairment and a shortened lifespan. Compared to previous models, the data suggest that the protein context in which a polyglutamine tract is embedded alters aggregation propensity and toxicity, likely by affecting interactions with the muscle cell environment.

Conditioned Pain Modulation Is Associated with Common Polymorphisms in the Serotonin Transporter Gene

PubMed Central

Lindstedt, Fredrik; Berrebi, Jonathan; Greayer, Erik; Lonsdorf, Tina B.; Schalling, Martin; Ingvar, Martin; Kosek, Eva

2011-01-01

Background Variation in the serotonin transporter (5-HTT) gene (SLC6A4) has been shown to influence a wide range of affective processes. Low 5-HTT gene-expression has also been suggested to increase the risk of chronic pain. Conditioned pain modulation (CPM) - i.e. ‘pain inhibits pain’ - is impaired in chronic pain states and, reciprocally, aberrations of CPM may predict the development of chronic pain. Therefore we hypothesized that a common variation in the SLC6A4 is associated with inter-individual variation in CPM. Forty-five healthy subjects recruited on the basis of tri-allelic 5-HTTLPR genotype, with inferred high or low 5-HTT-expression, were included in a double-blind study. A submaximal-effort tourniquet test was used to provide a standardized degree of conditioning ischemic pain. Individualized noxious heat and pressure pain thresholds (PPTs) were used as subjective test-modalities and the nociceptive flexion reflex (NFR) was used to provide an objective neurophysiological window into spinal processing. Results The low, as compared to the high, 5-HTT-expressing group exhibited significantly reduced CPM-mediated pain inhibition for PPTs (p = 0.02) and heat-pain (p = 0.02). The CPM-mediated inhibition of the NFR, gauged by increases in NFR-threshold, did not differ significantly between groups (p = 0.75). Inhibition of PPTs and heat-pain were correlated (Spearman’s rho = 0.35, p = 0.02), whereas the NFR-threshold increase was not significantly correlated with degree of inhibition of these subjectively reported modalities. Conclusions Our results demonstrate the involvement of the tri-allelic 5-HTTLPR genotype in explaining clinically relevant inter-individual differences in pain perception and regulation. Our results also illustrate that shifts in NFR-thresholds do not necessarily correlate to the modulation of experienced pain. We discuss various possible mechanisms underlying these findings and suggest a role of regulation of 5-HT receptors along the neuraxis as a function of differential 5-HTT-expression. PMID:21464942

Consequences of Serotonin Transporter Genotype and Early Adversity on Behavioral Profile – Pathology or Adaptation?

PubMed Central

Heiming, Rebecca S.; Sachser, Norbert

2010-01-01

This review focuses on how behavioral profile is shaped by early adversity in individuals with varying serotonin transporter (5-HTT) genotype. In a recent study on 5-HTT knockout mice Heiming et al. (2009) simulated a ‘dangerous environment‘ by confronting pregnant and lactating females with odor cues of unfamiliar males, indicating the risk of infant killing. Growing up in a dangerous environment induced increased anxiety-related behavior and decreased exploratory locomotion in the offspring, the effects being most pronounced in mice lacking 5-HTT expression. We argue that these alterations in behavioral profile represent adaptive maternal effects that help the individuals to cope with adversity. In principle, such effects of adversity on behavioral profile should not automatically be regarded as pathological. Rather and in accordance with modern evolutionary theory they may represent adaptations, although individuals with 5-HTT genotype induced susceptibility to adversity may be at risk of developing pathologies. PMID:21151780

Genetic variation in HTR2A influences serotonin transporter binding potential as measured using PET and [11C]DASB.

PubMed

Laje, Gonzalo; Cannon, Dara M; Allen, Andrew S; Klaver, Jackie M; Peck, Summer A; Liu, Xinmin; Manji, Husseini K; Drevets, Wayne C; McMahon, Francis J

2010-07-01

In a previous study we showed that genetic variation in HTR2A, which encodes the serotonin 2A receptor, influenced outcome of citalopram treatment in patients with major depressive disorder. Since chronic administration of citalopram, which selectively and potently inhibits the serotonin transporter (5-HTT), putatively enhances serotonergic transmission, it is conceivable that genetic variation within HTR2A also influences pretreatment 5-HTT function or serotonergic transmission. The present study used positron emission tomography (PET) and the selective 5-HTT ligand, [11C]DASB, to investigate whether the HTR2A marker alleles that predict treatment outcome also predict differences in 5-HTT binding. Brain levels of 5-HTT were assessed in vivo using PET measures of the non-displaceable component of the [11C]DASB binding potential (BPND). DNA from 43 patients and healthy volunteers, all unmedicated, was genotyped with 14 single nucleotide polymorphisms located within or around HTR2A. Allelic association with BPND was assessed in eight brain regions, with covariates to control for race and ethnicity. We detected allelic association between [11C]DASB BPND in thalamus and three markers in a region spanning the 3' untranslated region and second intron of HTR2A (rs7333412, p=0.000045; rs7997012, p=0.000086; rs977003, p=0.000069). The association signal at rs7333412 remained significant (p<0.05) after applying corrections for multiple testing via permutation. Genetic variation in HTR2A that was previously associated with citalopram treatment outcome was also associated with thalamic 5-HTT binding. While further work is needed to identify the actual functional genetic variants involved, these results suggest that a relationship exists between genetic variation in HTR2A and either 5-HTT expression or central serotonergic transmission that influences the therapeutic response to 5-HTT inhibition in major depression.

Genetic variation in the serotonin transporter gene (5-HTTLPR, rs25531) influences the analgesic response to the short acting opioid Remifentanil in humans

PubMed Central

Kosek, Eva; Jensen, Karin B; Lonsdorf, Tina B; Schalling, Martin; Ingvar, Martin

2009-01-01

Background There is evidence from animal studies that serotonin (5-HT) can influence the antinociceptive effects of opioids at the spinal cord level. Therefore, there could be an influence of genetic polymorphisms in the serotonin system on individual variability in response to opioid treatment of pain. The serotonin transporter (5-HTT) is a key regulator of serotonin metabolism and availability and its gene harbors several known polymorphisms that are known to affect 5-HTT expression (e.g. 5-HTTLPR, rs25531). The aim of this study was to investigate if the triallelic 5-HTTLPR influences pain sensitivity or the analgesic effect of opioids in humans. 43 healthy volunteers (12 men, 31 women, mean age 26 years) underwent heat pain stimulations before and after intravenous injection of Remifentanil; a rapid and potent opioid drug acting on μ-type receptors. Subjects rated their perceived pain on a visual analogue scale (VAS). All participants were genotyped for the 5-HTTLPR and the rs25531 polymorphism. We recruited by advertising, with no history of drug abuse, chronic pain or psychiatric disorders. Results At baseline, there was no difference in pain ratings for the different triallelic 5-HTTLPR genotype groups. However, the opiod drug had a differential analgesic effect depending on the triallelic 5-HTTLPR genotype. Remifentanil had a significantly better analgesic effect in individuals with a genotype coding for low 5-HTT expression (SA/SA and SA/LG) as compared to those with high expression(LA/LA), p < 0.02. The analgesic effect for the three different genotype groups was linear to degree of 5-HTT expression. Conclusion This is the first report showing an influence of the triallelic 5-HTTLPR on pain sensitivity or the analgesic effect of opioids in humans. Previously the 5-HTTLPR s-allele has been associated with higher risk of developing chronic pain conditions but in this study we show that the genotype coding for low 5-HTT expression is associated with a better analgesic effect of an opioid. The s-allele has been associated with downregulation of 5-HT1 receptors and we suggest that individuals with a desensitization of 5-HT1 receptors have an increased analgesic response to opioids during acute pain stimuli, but may still be at increased risk of developing chronic pain conditions. PMID:19570226

Genetic variation in the serotonin transporter gene (5-HTTLPR, rs25531) influences the analgesic response to the short acting opioid Remifentanil in humans.

PubMed

Kosek, Eva; Jensen, Karin B; Lonsdorf, Tina B; Schalling, Martin; Ingvar, Martin

2009-07-01

There is evidence from animal studies that serotonin (5-HT) can influence the antinociceptive effects of opioids at the spinal cord level. Therefore, there could be an influence of genetic polymorphisms in the serotonin system on individual variability in response to opioid treatment of pain. The serotonin transporter (5-HTT) is a key regulator of serotonin metabolism and availability and its gene harbors several known polymorphisms that are known to affect 5-HTT expression (e.g. 5-HTTLPR, rs25531). The aim of this study was to investigate if the triallelic 5-HTTLPR influences pain sensitivity or the analgesic effect of opioids in humans. 43 healthy volunteers (12 men, 31 women, mean age 26 years) underwent heat pain stimulations before and after intravenous injection of Remifentanil; a rapid and potent opioid drug acting on micro-type receptors. Subjects rated their perceived pain on a visual analogue scale (VAS). All participants were genotyped for the 5-HTTLPR and the rs25531 polymorphism. We recruited by advertising, with no history of drug abuse, chronic pain or psychiatric disorders. At baseline, there was no difference in pain ratings for the different triallelic 5-HTTLPR genotype groups. However, the opiod drug had a differential analgesic effect depending on the triallelic 5-HTTLPR genotype. Remifentanil had a significantly better analgesic effect in individuals with a genotype coding for low 5-HTT expression (SA/SA and SA/LG) as compared to those with high expression(LA/LA), p < 0.02. The analgesic effect for the three different genotype groups was linear to degree of 5-HTT expression. This is the first report showing an influence of the triallelic 5-HTTLPR on pain sensitivity or the analgesic effect of opioids in humans. Previously the 5-HTTLPR s-allele has been associated with higher risk of developing chronic pain conditions but in this study we show that the genotype coding for low 5-HTT expression is associated with a better analgesic effect of an opioid. The s-allele has been associated with downregulation of 5-HT1 receptors and we suggest that individuals with a desensitization of 5-HT1 receptors have an increased analgesic response to opioids during acute pain stimuli, but may still be at increased risk of developing chronic pain conditions.

Social Defeat: Impact on Fear Extinction and Amygdala-Prefrontal Cortical Theta Synchrony in 5-HTT Deficient Mice

PubMed Central

Narayanan, Venu; Heiming, Rebecca S.; Jansen, Friederike; Lesting, Jörg; Sachser, Norbert; Pape, Hans-Christian; Seidenbecher, Thomas

2011-01-01

Emotions, such as fear and anxiety, can be modulated by both environmental and genetic factors. One genetic factor is for example the genetically encoded variation of the serotonin transporter (5-HTT) expression. In this context, the 5-HTT plays a key role in the regulation of central 5-HT neurotransmission, which is critically involved in the physiological regulation of emotions including fear and anxiety. However, a systematic study which examines the combined influence of environmental and genetic factors on fear-related behavior and the underlying neurophysiological basis is missing. Therefore, in this study we used the 5-HTT-deficient mouse model for studying emotional dysregulation to evaluate consequences of genotype specific disruption of 5-HTT function and repeated social defeat for fear-related behaviors and corresponding neurophysiological activities in the lateral amygdala (LA) and infralimbic region of the medial prefrontal cortex (mPFC) in male 5-HTT wild-type (+/+), homo- (−/−) and heterozygous (+/−) mice. Naive males and experienced losers (generated in a resident-intruder paradigm) of all three genotypes, unilaterally equipped with recording electrodes in LA and mPFC, underwent a Pavlovian fear conditioning. Fear memory and extinction of conditioned fear was examined while recording neuronal activity simultaneously with fear-related behavior. Compared to naive 5-HTT+/+ and +/− mice, 5-HTT−/− mice showed impaired recall of extinction. In addition, 5-HTT−/− and +/− experienced losers showed delayed extinction learning and impaired recall of extinction. Impaired behavioral responses were accompanied by increased theta synchronization between the LA and mPFC during extinction learning in 5-HTT-/− and +/− losers. Furthermore, impaired extinction recall was accompanied with increased theta synchronization in 5-HTT−/− naive and in 5-HTT−/− and +/− loser mice. In conclusion, extinction learning and memory of conditioned fear can be modulated by both the 5-HTT gene activity and social experiences in adulthood, accompanied by corresponding alterations of the theta activity in the amygdala-prefrontal cortex network. PMID:21818344

Pathophysiology and molecular basis of selected metabolic abnormalities in Huntington's disease.

PubMed

Krzysztoń-Russjan, Jolanta

2016-12-30

Huntington's disease (HD) is an incurable, devastating neurodegenerative disease with a known genetic background and autosomally dominant inheritance pattern. HTT gene mutation (mHTT) is associated with polymorphic fragment elongation above 35 repeats of the CAG triplet. The mHTT product is an altered protein with a poly-Q elongated fragment, with the highest expression determined in the central nervous system (CNS) and with differentiated expression outside the CNS. A drastic loss of striatal and deeper layers of the cerebral cortex neurons was determined in the CNS, but muscle and body weight mass loss with dysfunction of many organs was also observed. HD symptoms include neurological disturbances, such as choreal movements with dystonia, speech and swallowing impairments, and additionally a variety of psychiatric and behavioral symptoms with cognitive decline have been described. They are the result of disturbances of several cellular pathways related to signal transmission, mitochondrial dysfunction and energy metabolism impairment shown by gene and protein expression and alteration of their functions. Impairment of energy processes demonstrated by a decrease of ATP production and increase of oxidative stress markers was determined in- and outside of the CNS in glycolysis, the Krebs cycle and the electron transport chain. A correlation between the increase of energy metabolism impairment level and the increase in number of CAG repeats in HTT has often been described. The energy metabolism study is an initial stage of sensitive biomarkers and a new therapeutic investigative option for early application in order to inhibit pathological processes in HD. Identification of pathological changes outside the CNS requires a reevaluation of diagnostic and therapeutic rules in HD.

Pitfalls in the detection of cholesterol in Huntington’s disease models

PubMed Central

Marullo, Manuela; Valenza, Marta; Leoni, Valerio; Caccia, Claudio; Scarlatti, Chiara; De Mario, Agnese; Zuccato, Chiara; Di Donato, Stefano; Carafoli, Ernesto; Cattaneo, Elena

2012-01-01

Background Abnormalities in brain cholesterol homeostasis have been reported in Huntington’s disease (HD), an adult-onset neurodegenerative disorder caused by an expansion in the number of CAG repeats in the huntingtin (HTT) gene. However, the results have been contradictory with respect to whether cholesterol levels increase or decrease in HD models. Biochemical and mass spectrometry methods show reduced levels of cholesterol precursors and cholesterol in HD cells and in the brains of several HD animal models. Abnormal brain cholesterol homeostasis was also inferred from studies in HD patients. In contrast, colorimetric and enzymatic methods indicate cholesterol accumulation in HD cells and tissues. Here we used several methods to investigate cholesterol levels in cultured cells in the presence or absence of mutant HTT protein. Results Colorimetric and enzymatic methods with low sensitivity gave variable results, whereas results from a sensitive analytical method, gas chromatography-mass spectrometry, were more reliable. Sample preparation, high cell density and cell clonality also influenced the detection of intracellular cholesterol. Conclusions Detection of cholesterol in HD samples by colorimetric and enzymatic assays should be supplemented by detection using more sensitive analytical methods. Care must be taken to prepare the sample appropriately. By evaluating lathosterol levels using isotopic dilution mass spectrometry, we confirmed reduced cholesterol biosynthesis in knock-in cells expressing the polyQ mutation in a constitutive or inducible manner. *Correspondence should be addressed to Elena Cattaneo: elena.cattaneo@unimi.it PMID:23145355

Reciprocal Efficiency of RNQ1 and Polyglutamine Detoxification in the Cytosol and Nucleus

PubMed Central

Douglas, Peter M.; Summers, Daniel W.; Ren, Hong-Yu

2009-01-01

Onset of proteotoxicity is linked to change in the subcellular location of proteins that cause misfolding diseases. Yet, factors that drive changes in disease protein localization and the impact of residence in new surroundings on proteotoxicity are not entirely clear. To address these issues, we examined aspects of proteotoxicity caused by Rnq1-green fluorescent protein (GFP) and a huntingtin's protein exon-1 fragment with an expanded polyglutamine tract (Htt-103Q), which is dependent upon the intracellular presence of [RNQ+] prions. Increasing heat-shock protein 40 chaperone activity before Rnq1-GFP expression, shifted Rnq1-GFP aggregation from the cytosol to the nucleus. Assembly of Rnq1-GFP into benign amyloid-like aggregates was more efficient in the nucleus than cytosol and nuclear accumulation of Rnq1-GFP correlated with reduced toxicity. [RNQ+] prions were found to form stable complexes with Htt-103Q, and nuclear Rnq1-GFP aggregates were capable of sequestering Htt-103Q in the nucleus. On accumulation in the nucleus, conversion of Htt-103Q into SDS-resistant aggregates was dramatically reduced and Htt-103Q toxicity was exacerbated. Alterations in activity of molecular chaperones, the localization of intracellular interaction partners, or both can impact the cellular location of disease proteins. This, in turn, impacts proteotoxicity because the assembly of proteins to a benign state occurs with different efficiencies in the cytosol and nucleus. PMID:19656852

Widespread suppression of huntingtin with convection-enhanced delivery of siRNA.

PubMed

Stiles, David K; Zhang, Zhiming; Ge, Pei; Nelson, Brian; Grondin, Richard; Ai, Yi; Hardy, Peter; Nelson, Peter T; Guzaev, Andrei P; Butt, Mark T; Charisse, Klaus; Kosovrasti, Verbena; Tchangov, Lubomir; Meys, Michael; Maier, Martin; Nechev, Lubomir; Manoharan, Muthiah; Kaemmerer, William F; Gwost, Douglas; Stewart, Gregory R; Gash, Don M; Sah, Dinah W Y

2012-01-01

Huntington's disease is an autosomal dominant neurodegenerative disease caused by a toxic gain of function mutation in the huntingtin gene (Htt). Silencing of Htt with RNA interference using direct CNS delivery in rodent models of Huntington's disease has been shown to reduce pathology and promote neuronal recovery. A key translational step for this approach is extension to the larger non-human primate brain, achieving sufficient distribution of small interfering RNA targeting Htt (siHtt) and levels of Htt suppression that may have therapeutic benefit. We evaluated the potential for convection enhanced delivery (CED) of siHtt to provide widespread and robust suppression of Htt in nonhuman primates. siHtt was infused continuously for 7 or 28 days into the nonhuman primate putamen to analyze effects of infusion rate and drug concentration on the volume of effective suppression. Distribution of radiolabeled siHtt and Htt suppression were quantified by autoradiography and PCR, respectively, in tissue punches. Histopathology was evaluated and Htt suppression was also visualized in animals treated for 28 days. Seven days of CED led to widespread distribution of siHtt and significant Htt silencing throughout the nonhuman primate striatum in an infusion rate and dose dependent manner. Htt suppression at therapeutic dose levels was well tolerated by the brain. A model developed from these results predicts that continuous CED of siHtt can achieve significant coverage of the striatum of Huntington's disease patients. These findings suggest that this approach may provide an important therapeutic strategy for treating Huntington's disease. Copyright © 2011 Elsevier Inc. All rights reserved.

Genetic and expression analyses reveal elevated expression of syntaxin 1A ( STX1A) in high functioning autism.

PubMed

Nakamura, Kazuhiko; Anitha, Ayyappan; Yamada, Kazuo; Tsujii, Masatsugu; Iwayama, Yoshimi; Hattori, Eiji; Toyota, Tomoko; Suda, Shiro; Takei, Noriyoshi; Iwata, Yasuhide; Suzuki, Katsuaki; Matsuzaki, Hideo; Kawai, Masayoshi; Sekine, Yoshimoto; Tsuchiya, Kenji J; Sugihara, Gen-Ichi; Ouchi, Yasuomi; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio

2008-12-01

Autism is a pervasive developmental disorder diagnosed in early childhood. Abnormalities of serotonergic neurotransmission have been reported in autism. Serotonin transporter (5-HTT), which modulates serotonin levels, is a major therapeutic target in autism. Therefore, factors that regulate 5-HTT expression might be implicated in autism. One candidate 5-HTT-regulatory protein is the presynaptic protein, syntaxin 1A (STX1A). We examined the association of STX1A with autism in a trio association study using DNA samples from 249 AGRE trios with autistic probands. Only male probands were selected, since autism is more prevalent among males. The probands of 102 trios had IQ>70, and were considered as high functioning autism (HFA). In transmission disequilibrium test (TDT) analysis, rs2293485 (p=0.034) and rs4717806 (p=0.033) showed nominal associations with HFA; modest haplotype association was also observed. The SNPs that showed associations were related to early developmental abnormalities (ADI-R_D). We further compared STX1A mRNA expression in the lymphocytes of drug-naive HFA patients (n=12) and age- and sex-matched controls (n=13). STX1A expression in the HFA group was significantly higher (p=0.001) than that of controls. Thus, we suggest a possible role of STX1A in the pathogenesis of HFA. During early childhood, there is a period of high brain serotonin synthesis that is disrupted in autistic children; STX1A might influence the serotonergic system during this stage of neurodevelopment, as implied by the association with ADI-R_D.

Correlations of Behavioral Deficits with Brain Pathology Assessed through Longitudinal MRI and Histopathology in the HdhQ150/Q150 Mouse Model of Huntington’s Disease

PubMed Central

Rattray, Ivan; Smith, Edward J.; Crum, William R.; Walker, Thomas A.; Gale, Richard; Bates, Gillian P.

2017-01-01

A variety of mouse models have been developed that express mutant huntingtin (mHTT) leading to aggregates and inclusions that model the molecular pathology observed in Huntington’s disease. Here we show that although homozygous HdhQ150 knock-in mice developed motor impairments (rotarod, locomotor activity, grip strength) by 36 weeks of age, cognitive dysfunction (swimming T maze, fear conditioning, odor discrimination, social interaction) was not evident by 94 weeks. Concomitant to behavioral assessments, T2-weighted MRI volume measurements indicated a slower striatal growth with a significant difference between wild type (WT) and HdhQ150 mice being present even at 15 weeks. Indeed, MRI indicated significant volumetric changes prior to the emergence of the “clinical horizon” of motor impairments at 36 weeks of age. A striatal decrease of 27% was observed over 94 weeks with cortex (12%) and hippocampus (21%) also indicating significant atrophy. A hypothesis-free analysis using tensor-based morphometry highlighted further regions undergoing atrophy by contrasting brain growth and regional neurodegeneration. Histology revealed the widespread presence of mHTT aggregates and cellular inclusions. However, there was little evidence of correlations between these outcome measures, potentially indicating that other factors are important in the causal cascade linking the molecular pathology to the emergence of behavioral impairments. In conclusion, the HdhQ150 mouse model replicates many aspects of the human condition, including an extended pre-manifest period prior to the emergence of motor impairments. PMID:28099507

Transcriptomic study to understand thermal adaptation in a high temperature-tolerant strain of Pyropia haitanensis

PubMed Central

Wang, Wenlei; Teng, Fei; Lin, Yinghui; Ji, Dehua; Xu, Yan; Chen, Changsheng

2018-01-01

Pyropia haitanensis, a high-yield commercial seaweed in China, is currently undergoing increasing levels of high-temperature stress due to gradual global warming. The mechanisms of plant responses to high temperature stress vary with not only plant type but also the degree and duration of high temperature. To understand the mechanism underlying thermal tolerance in P. haitanensis, gene expression and regulation in response to short- and long-term temperature stresses (SHS and LHS) was investigated by performing genome-wide high-throughput transcriptomic sequencing for a high temperature tolerant strain (HTT). A total of 14,164 differential expression genes were identified to be high temperature-responsive in at least one time point by high-temperature treatment, representing 41.10% of the total number of unigenes. The present data indicated a decrease in the photosynthetic and energy metabolic rates in HTT to reduce unnecessary energy consumption, which in turn facilitated in the rapid establishment of acclimatory homeostasis in its transcriptome during SHS. On the other hand, an increase in energy consumption and antioxidant substance activity was observed with LHS, which apparently facilitates in the development of resistance against severe oxidative stress. Meanwhile, ubiquitin-mediated proteolysis, brassinosteroids, and heat shock proteins also play a vital role in HTT. The effects of SHS and LHS on the mechanism of HTT to resist heat stress were relatively different. The findings may facilitate further studies on gene discovery and the molecular mechanisms underlying high-temperature tolerance in P. haitanensis, as well as allow improvement of breeding schemes for high temperature-tolerant macroalgae that can resist global warming. PMID:29694388

Transcriptomic study to understand thermal adaptation in a high temperature-tolerant strain of Pyropia haitanensis.

PubMed

Wang, Wenlei; Teng, Fei; Lin, Yinghui; Ji, Dehua; Xu, Yan; Chen, Changsheng; Xie, Chaotian

2018-01-01

Pyropia haitanensis, a high-yield commercial seaweed in China, is currently undergoing increasing levels of high-temperature stress due to gradual global warming. The mechanisms of plant responses to high temperature stress vary with not only plant type but also the degree and duration of high temperature. To understand the mechanism underlying thermal tolerance in P. haitanensis, gene expression and regulation in response to short- and long-term temperature stresses (SHS and LHS) was investigated by performing genome-wide high-throughput transcriptomic sequencing for a high temperature tolerant strain (HTT). A total of 14,164 differential expression genes were identified to be high temperature-responsive in at least one time point by high-temperature treatment, representing 41.10% of the total number of unigenes. The present data indicated a decrease in the photosynthetic and energy metabolic rates in HTT to reduce unnecessary energy consumption, which in turn facilitated in the rapid establishment of acclimatory homeostasis in its transcriptome during SHS. On the other hand, an increase in energy consumption and antioxidant substance activity was observed with LHS, which apparently facilitates in the development of resistance against severe oxidative stress. Meanwhile, ubiquitin-mediated proteolysis, brassinosteroids, and heat shock proteins also play a vital role in HTT. The effects of SHS and LHS on the mechanism of HTT to resist heat stress were relatively different. The findings may facilitate further studies on gene discovery and the molecular mechanisms underlying high-temperature tolerance in P. haitanensis, as well as allow improvement of breeding schemes for high temperature-tolerant macroalgae that can resist global warming.

Are preterm newborns who have relative hyperthyrotropinemia at increased risk of brain damage?

PubMed

Korzeniewski, Steven J; Soto-Rivera, Carmen L; Fichorova, Raina N; Allred, Elizabeth N; Kuban, Karl C K; O'Shea, T Michael; Paneth, Nigel; Agus, Michael; Dammann, Olaf; Leviton, Alan

2014-11-01

We sought to disentangle the contributions of hyperthyrotropinemia (an indicator of thyroid dysfunction) (HTT) and intermittent or sustained systemic inflammation (ISSI) to structural and functional indicators of brain damage. We measured the concentrations of thyroid-stimulating hormone (TSH) on day 14 and of 25 inflammation-related proteins in blood collected during the first 2 postnatal weeks from 786 infants born before the 28th week of gestation who were not considered to have hypothyroidism. We defined hyperthyrotropinemia (HTT) as a TSH concentration in the highest quartile for gestational age on postnatal day 14 and ISSI was defined as a concentration in the top quartile for gestational age of a specific inflammation-related protein on 2 separate days a week apart during the first 2 postnatal weeks. We first assessed the risk of brain damage indicators by comparing 1) neonates who had HTT to those without (regardless of ISSI) and 2) neonates with HTT only, ISSI only, or HTT+ISSI to those who were exposed to neither HTT nor ISSI. In univariable models that compared those with HTT to those without, HTT was not significantly associated with any indicator of brain damage. In models that compared HTT only, ISSI only, and HTT+ISSI to those with neither, children with ISSI only or with HTT+ISSI were at significantly higher risk of ventriculomegaly [odds ratios (ORs) 2-6], whereas those with HTT only were at significantly reduced risk of a hypoechoic lesion (ORs 0.2-0.4). Children with HTT only had a higher risk of quadriparesis and those with ISSI alone had a higher risk of hemiparesis (ORs 1.6-2.4). Elevated risk of a very low mental development score was associated with both ISSI only and HTT+ISSI, whereas a very low motor development score and microcephaly were associated with HTT+ISSI. The association of HTT with increased or decreased risk of indicators of brain damage depends on the presence or absence of ISSI.

The cryo-electron microscopy structure of huntingtin

NASA Astrophysics Data System (ADS)

Guo, Qiang; Bin Huang; Cheng, Jingdong; Seefelder, Manuel; Engler, Tatjana; Pfeifer, Günter; Oeckl, Patrick; Otto, Markus; Moser, Franziska; Maurer, Melanie; Pautsch, Alexander; Baumeister, Wolfgang; Fernández-Busnadiego, Rubén; Kochanek, Stefan

2018-03-01

Huntingtin (HTT) is a large (348 kDa) protein that is essential for embryonic development and is involved in diverse cellular activities such as vesicular transport, endocytosis, autophagy and the regulation of transcription. Although an integrative understanding of the biological functions of HTT is lacking, the large number of identified HTT interactors suggests that it serves as a protein-protein interaction hub. Furthermore, Huntington’s disease is caused by a mutation in the HTT gene, resulting in a pathogenic expansion of a polyglutamine repeat at the amino terminus of HTT. However, only limited structural information regarding HTT is currently available. Here we use cryo-electron microscopy to determine the structure of full-length human HTT in a complex with HTT-associated protein 40 (HAP40; encoded by three F8A genes in humans) to an overall resolution of 4 Å. HTT is largely α-helical and consists of three major domains. The amino- and carboxy-terminal domains contain multiple HEAT (huntingtin, elongation factor 3, protein phosphatase 2A and lipid kinase TOR) repeats arranged in a solenoid fashion. These domains are connected by a smaller bridge domain containing different types of tandem repeats. HAP40 is also largely α-helical and has a tetratricopeptide repeat-like organization. HAP40 binds in a cleft and contacts the three HTT domains by hydrophobic and electrostatic interactions, thereby stabilizing the conformation of HTT. These data rationalize previous biochemical results and pave the way for improved understanding of the diverse cellular functions of HTT.

Control of Huntington's Disease-Associated Phenotypes by the Striatum-Enriched Transcription Factor Foxp2.

PubMed

Hachigian, Lea J; Carmona, Vitor; Fenster, Robert J; Kulicke, Ruth; Heilbut, Adrian; Sittler, Annie; Pereira de Almeida, Luís; Mesirov, Jill P; Gao, Fan; Kolaczyk, Eric D; Heiman, Myriam

2017-12-05

Alteration of corticostriatal glutamatergic function is an early pathophysiological change associated with Huntington's disease (HD). The factors that regulate the maintenance of corticostriatal glutamatergic synapses post-developmentally are not well understood. Recently, the striatum-enriched transcription factor Foxp2 was implicated in the development of these synapses. Here, we show that, in mice, overexpression of Foxp2 in the adult striatum of two models of HD leads to rescue of HD-associated behaviors, while knockdown of Foxp2 in wild-type mice leads to development of HD-associated behaviors. We note that Foxp2 encodes the longest polyglutamine repeat protein in the human reference genome, and we show that it can be sequestered into aggregates with polyglutamine-expanded mutant Huntingtin protein (mHTT). Foxp2 overexpression in HD model mice leads to altered expression of several genes associated with synaptic function, genes that present additional targets for normalization of corticostriatal dysfunction in HD. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

The assessment of the relationship between personality, the presence of the 5HTT and MAO-A polymorphisms, and the severity of climacteric and depressive symptoms in postmenopausal women.

PubMed

Jurczak, Anna; Szkup, Małgorzata; Wieder-Huszla, Sylwia; Grzywacz, Anna; Samochowiec, Agnieszka; Karakiewicz, Beata; Samochowiec, Jerzy; Grochans, Elżbieta

2015-08-01

The purpose of this study is to determine the relationship between personality, the serotonin transporter (5HTT) and monoamine oxidase A (MAO-A) polymorphisms and the severity of climacteric and depressive symptoms in postmenopausal women. The study involved 272 healthy postmenopausal women from Poland. This survey-based study was performed using the following: the Beck Depression Inventory for depressive symptoms, the Blatt-Kupperman Menopausal Index and the Neuroticism-Extroversion-Openness-Five Factor Inventory for personality. A polymerase chain reaction was employed to identify the DNA polymorphisms. The women were aged 55.4 ± 5.5 years on average. Significant correlations were proved between the allele frequency of the 30-bp variable-number tandem repeat (VNTR) polymorphism in the MAO-A promoter region and the incidence of depressive symptoms in the women analysed (p ≤ 0.05), as well as between the severity of climacteric symptoms in the postmenopausal women and the allele frequency of the polymorphism in the 5HTT gene (the 5HTT 's' variant) (p ≤ 0.05). There was a significant correlation between the severity of climacteric and depressive symptoms (p < 0.001). (1) The severity of climacteric and depressive symptoms depends on personality traits. (2) Personality traits are biologically determined, and the level of their expression is associated with the 5HTT polymorphism. (3) Identification of homogeneous groups of women having predispositions to depressive and severe climacteric symptoms may help to implement early prevention programmes for this group of recipients.

Hyalinizing Trabecular Tumor of the Thyroid Gland, a Diagnostic Challenge in Fine-Needle Aspiration Cytology: Case Report.

PubMed

Rhee, Ye-Young; Jung, Hong Kyu; Kim, Se Hoon; Kim, Soo Hee

2018-06-11

Hyalinizing trabecular tumor (HTT) is a rare thyroid tumor with low to minimal malignant potential. HTT is often misinterpreted as other thyroid tumors, including papillary thyroid carcinoma (PTC) and medullary thyroid carcinoma (MTC), on fine-needle aspiration (FNA) cytology, because of its overlapping cytologic features, such as nuclear grooves and intranulcear pseudoinclusions. Although cytopathologists cannot definitely conclude HTT by FNA cytology, suspicion of HTT is necessary to avoid misdiagnosing HTT as PTC or MTC and to avoid unnecessary aggressive treatment. Here, we report a case of HTT with novel cytologic features in CellPrep liquid based cytology that was diagnosed as suspicious for papillary carcinoma by FNA and finally diagnosed as HTT in the surgical specimen.

Inhibiting nucleation of amyloid structure in a huntingtin fragment by targeting α-helix rich oligomeric intermediates

PubMed Central

Mishra, Rakesh; Jayaraman, Murali; Roland, Bartholomew P.; Landrum, Elizabeth; Fullam, Timothy; Kodali, Ravindra; Thakur, Ashwani K.; Arduini, Irene; Wetzel, Ronald

2011-01-01

Although oligomeric intermediates are transiently formed in almost all known amyloid assembly reactions, their mechanistic roles are poorly understood. Recently we demonstrated a critical role for the 17 amino acid N-terminal segment (httNT) of huntingtin (htt) in oligomer-mediated amyloid assembly of htt N-terminal fragments. In this mechanism, the httNT segment forms the α-helix rich core of the oligomers, leaving most or all of each polyglutamine (polyQ) segment disordered and solvent-exposed. Nucleation of amyloid structure occurs within this local high concentration of disordered polyQ. Here we demonstrate the kinetic importance of httNT self-assembly by describing inhibitory httNT-containing peptides that appear to work by targeting nucleation within the oligomer fraction. These molecules inhibit amyloid nucleation by forming mixed oligomers with the httNT domains of polyQ-containing htt N-terminal fragments. In one class of inhibitor, nucleation is passively suppressed due to the reduced local concentration of polyQ within the mixed oligomer. In the other class, nucleation is actively suppressed by a proline-rich polyQ segment covalently attached to httNT. Studies with D-amino acid and scrambled sequence versions of httNT suggest that inhibition activity is strongly linked to the propensity of inhibitory peptides to make amphipathic α-helices. HttNT derivatives with C-terminal cell penetrating peptide segments, also exhibit excellent inhibitory activity. The httNT-based peptides described here, especially those with protease-resistant D-amino acids and/or with cell penetrating sequences, may prove useful as lead therapeutics for inhibiting nucleation of amyloid formation in Huntington’s disease. PMID:22178478

Inhibition of mitochondrial fragmentation diminishes Huntington’s disease–associated neurodegeneration

PubMed Central

Guo, Xing; Disatnik, Marie-Helene; Monbureau, Marie; Shamloo, Mehrdad; Mochly-Rosen, Daria; Qi, Xin

2013-01-01

Huntington’s disease (HD) is the result of expression of a mutated Huntingtin protein (mtHtt), and is associated with a variety of cellular dysfunctions including excessive mitochondrial fission. Here, we tested whether inhibition of excessive mitochondrial fission prevents mtHtt-induced pathology. We developed a selective inhibitor (P110-TAT) of the mitochondrial fission protein dynamin-related protein 1 (DRP1). We found that P110-TAT inhibited mtHtt-induced excessive mitochondrial fragmentation, improved mitochondrial function, and increased cell viability in HD cell culture models. P110-TAT treatment of fibroblasts from patients with HD and patients with HD with iPS cell–derived neurons reduced mitochondrial fragmentation and corrected mitochondrial dysfunction. P110-TAT treatment also reduced the extent of neurite shortening and cell death in iPS cell–derived neurons in patients with HD. Moreover, treatment of HD transgenic mice with P110-TAT reduced mitochondrial dysfunction, motor deficits, neuropathology, and mortality. We found that p53, a stress gene involved in HD pathogenesis, binds to DRP1 and mediates DRP1-induced mitochondrial and neuronal damage. Furthermore, P110-TAT treatment suppressed mtHtt-induced association of p53 with mitochondria in multiple HD models. These data indicate that inhibition of DRP1-dependent excessive mitochondrial fission with a P110-TAT–like inhibitor may prevent or slow the progression of HD. PMID:24231356

Modeling Huntington׳s disease with patient-derived neurons.

PubMed

Mattis, Virginia B; Svendsen, Clive N

2017-02-01

Huntington׳s Disease (HD) is a fatal neurodegenerative disorder caused by expanded polyglutamine repeats in the Huntingtin (HTT) gene. While the gene was identified over two decades ago, it remains poorly understood why mutant HTT (mtHTT) is initially toxic to striatal medium spiny neurons (MSNs). Models of HD using non-neuronal human patient cells and rodents exhibit some characteristic HD phenotypes. While these current models have contributed to the field, they are limited in disease manifestation and may vary in their response to treatments. As such, human HD patient MSNs for disease modeling could greatly expand the current understanding of HD and facilitate the search for a successful treatment. It is now possible to use pluripotent stem cells, which can generate any tissue type in the body, to study and potentially treat HD. This review covers disease modeling in vitro and, via chimeric animal generation, in vivo using human HD patient MSNs differentiated from embryonic stem cells or induced pluripotent stem cells. This includes an overview of the differentiation of pluripotent cells into MSNs, the established phenotypes found in cell-based models and transplantation studies using these cells. This review not only outlines the advancements in the rapidly progressing field of HD modeling using neurons derived from human pluripotent cells, but also it highlights several remaining controversial issues such as the 'ideal' series of pluripotent lines, the optimal cell types to use and the study of a primarily adult-onset disease in a developmental model. This article is part of a Special Issue entitled SI: Exploiting human neurons. Copyright © 2015 Elsevier B.V. All rights reserved.

A small molecule p75NTR ligand normalizes signalling and reduces Huntington’s disease phenotypes in R6/2 and BACHD mice

PubMed Central

Belichenko, Nadia P.; Ford, Ellen C.; Semaan, Sarah; Monbureau, Marie; Aiyaswamy, Sruti; Holman, Cameron M.; Condon, Christina; Shamloo, Mehrdad; Massa, Stephen M.; Longo, Frank M.

2016-01-01

Abstract Decreases in the ratio of neurotrophic versus neurodegenerative signalling play a critical role in Huntington’s disease (HD) pathogenesis and recent evidence suggests that the p75 neurotrophin receptor (NTR) contributes significantly to disease progression. p75NTR signalling intermediates substantially overlap with those promoting neuronal survival and synapse integrity and with those affected by the mutant huntingtin (muHtt) protein. MuHtt increases p75NTR-associated deleterious signalling and decreases survival signalling suggesting that p75NTR could be a valuable therapeutic target. This hypothesis was investigated by examining the effects of an orally bioavailable, small molecule p75NTR ligand, LM11A-31, on HD-related neuropathology in HD mouse models (R6/2, BACHD). LM11A-31 restored striatal AKT and other pro-survival signalling while inhibiting c-Jun kinase (JNK) and other degenerative signalling. Normalizing p75NTR signalling with LM11A-31 was accompanied by reduced Htt aggregates and striatal cholinergic interneuron degeneration as well as extended survival in R6/2 mice. The p75NTR ligand also decreased inflammation, increased striatal and hippocampal dendritic spine density, and improved motor performance and cognition in R6/2 and BACHD mice. These results support small molecule modulation of p75NTR as an effective HD therapeutic strategy. LM11A-31 has successfully completed Phase I safety and pharmacokinetic clinical trials and is therefore a viable candidate for clinical studies in HD. PMID:28171570

Rolling Bearing Fault Diagnosis Based on an Improved HTT Transform

PubMed Central

Tang, Guiji; Tian, Tian; Zhou, Chong

2018-01-01

When rolling bearing failure occurs, vibration signals generally contain different signal components, such as impulsive fault feature signals, background noise and harmonic interference signals. One of the most challenging aspects of rolling bearing fault diagnosis is how to inhibit noise and harmonic interference signals, while enhancing impulsive fault feature signals. This paper presents a novel bearing fault diagnosis method, namely an improved Hilbert time–time (IHTT) transform, by combining a Hilbert time–time (HTT) transform with principal component analysis (PCA). Firstly, the HTT transform was performed on vibration signals to derive a HTT transform matrix. Then, PCA was employed to de-noise the HTT transform matrix in order to improve the robustness of the HTT transform. Finally, the diagonal time series of the de-noised HTT transform matrix was extracted as the enhanced impulsive fault feature signal and the contained fault characteristic information was identified through further analyses of amplitude and envelope spectrums. Both simulated and experimental analyses validated the superiority of the presented method for detecting bearing failures. PMID:29662013

Effects of hydrothermal treatment on the pyrolysis behavior of Chinese fan palm.

PubMed

Yao, Zhongliang; Ma, Xiaoqian

2018-01-01

The effect of hydrothermal treatment (HTT) on Chinese fan palm pyrolysis was investigated. It indicated that HTT could effectively remove a large portion of alkali/alkaline earth metals and disrupt the chemical structure to a certain extent. HTT delayed the initial decomposition temperature but accelerated the pyrolysis process completely. HTT also increased the relative contents of both sugars and hydrocarbons in pyrolysis. At 210°C, HTT had the most significant promotion effect on the sugars formation with the relative content of 30.58%. While, The relative content of phenols, acids, furans, aldehydes, esters and CO 2 decreased more or less after HTT. With increasing pyrolysis temperature, the relative content of most groups of chemicals except hydrocarbons decreased. Response contours were analyzed to find the optimal reaction conditions for generating acids, phenols, sugars and hydrocarbons, respectively. The results indicated both pyrolysis temperature and HTT temperature had distinct influence on relative contents of products. Copyright © 2017 Elsevier Ltd. All rights reserved.

Quantitative fluorescence loss in photobleaching for analysis of protein transport and aggregation

PubMed Central

2012-01-01

Background Fluorescence loss in photobleaching (FLIP) is a widely used imaging technique, which provides information about protein dynamics in various cellular regions. In FLIP, a small cellular region is repeatedly illuminated by an intense laser pulse, while images are taken with reduced laser power with a time lag between the bleaches. Despite its popularity, tools are lacking for quantitative analysis of FLIP experiments. Typically, the user defines regions of interest (ROIs) for further analysis which is subjective and does not allow for comparing different cells and experimental settings. Results We present two complementary methods to detect and quantify protein transport and aggregation in living cells from FLIP image series. In the first approach, a stretched exponential (StrExp) function is fitted to fluorescence loss (FL) inside and outside the bleached region. We show by reaction–diffusion simulations, that the StrExp function can describe both, binding/barrier–limited and diffusion-limited FL kinetics. By pixel-wise regression of that function to FL kinetics of enhanced green fluorescent protein (eGFP), we determined in a user-unbiased manner from which cellular regions eGFP can be replenished in the bleached area. Spatial variation in the parameters calculated from the StrExp function allow for detecting diffusion barriers for eGFP in the nucleus and cytoplasm of living cells. Polyglutamine (polyQ) disease proteins like mutant huntingtin (mtHtt) can form large aggregates called inclusion bodies (IB’s). The second method combines single particle tracking with multi-compartment modelling of FL kinetics in moving IB’s to determine exchange rates of eGFP-tagged mtHtt protein (eGFP-mtHtt) between aggregates and the cytoplasm. This method is self-calibrating since it relates the FL inside and outside the bleached regions. It makes it therefore possible to compare release kinetics of eGFP-mtHtt between different cells and experiments. Conclusions We present two complementary methods for quantitative analysis of FLIP experiments in living cells. They provide spatial maps of exchange dynamics and absolute binding parameters of fluorescent molecules to moving intracellular entities, respectively. Our methods should be of great value for quantitative studies of intracellular transport. PMID:23148417

The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes.

PubMed

Merienne, Nicolas; Vachey, Gabriel; de Longprez, Lucie; Meunier, Cécile; Zimmer, Virginie; Perriard, Guillaume; Canales, Mathieu; Mathias, Amandine; Herrgott, Lucas; Beltraminelli, Tim; Maulet, Axelle; Dequesne, Thomas; Pythoud, Catherine; Rey, Maria; Pellerin, Luc; Brouillet, Emmanuel; Perrier, Anselme L; du Pasquier, Renaud; Déglon, Nicole

2017-09-19

Neurodegenerative disorders are a major public health problem because of the high frequency of these diseases. Genome editing with the CRISPR/Cas9 system is making it possible to modify the sequence of genes linked to these disorders. We designed the KamiCas9 self-inactivating editing system to achieve transient expression of the Cas9 protein and high editing efficiency. In the first application, the gene responsible for Huntington's disease (HD) was targeted in adult mouse neuronal and glial cells. Mutant huntingtin (HTT) was efficiently inactivated in mouse models of HD, leading to an improvement in key markers of the disease. Sequencing of potential off-targets with the constitutive Cas9 system in differentiated human iPSC revealed a very low incidence with only one site above background level. This off-target frequency was significantly reduced with the KamiCas9 system. These results demonstrate the potential of the self-inactivating CRISPR/Cas9 editing for applications in the context of neurodegenerative diseases. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Maintenance of Chronic Fatigue Syndrome (CFS) in Young CFS Patients Is Associated with the 5-HTTLPR and SNP rs25531 A > G Genotype.

PubMed

Meyer, Benedicte; Nguyen, Chinh Bkrong Thuy; Moen, Aurora; Fagermoen, Even; Sulheim, Dag; Nilsen, Hilde; Wyller, Vegard Bruun; Gjerstad, Johannes

2015-01-01

Earlier studies have shown that genetic variability in the SLC6A4 gene encoding the serotonin transporter (5-HTT) may be important for the re-uptake of serotonin (5-HT) in the central nervous system. In the present study we investigated how the 5-HTT genotype i.e. the short (S) versus long (L) 5-HTTLPR allele and the SNP rs25531 A > G affect the physical and psychosocial functioning in patients with chronic fatigue syndrome (CFS). All 120 patients were recruited from The Department of Paediatrics at Oslo University Hospital, Norway, a national referral center for young CFS patients (12-18 years). Main outcomes were number of steps per day obtained by an accelerometer and disability scored by the Functional Disability Inventory (FDI). Patients with the 5-HTT SS or SLG genotype had a significantly lower number of steps per day than patients with the 5-HTT LALG, SLA or LALA genotype. Patients with the 5-HTT SS or SLG genotype also had a significantly higher FDI score than patients with the 5-HTT LALG, SLA or LALA genotype. Thus, CFS patients with the 5-HTT SS or SLG genotype had worse 30 weeks outcome than CFS patients with the 5-HTT LALG, SLA or LALA genotype. The present study suggests that the 5-HTT genotype may be a factor that contributes to maintenance of CFS.

Maintenance of Chronic Fatigue Syndrome (CFS) in Young CFS Patients Is Associated with the 5-HTTLPR and SNP rs25531 A > G Genotype

PubMed Central

Meyer, Benedicte; Nguyen, Chinh Bkrong Thuy; Moen, Aurora; Fagermoen, Even; Sulheim, Dag; Nilsen, Hilde; Wyller, Vegard Bruun; Gjerstad, Johannes

2015-01-01

Earlier studies have shown that genetic variability in the SLC6A4 gene encoding the serotonin transporter (5-HTT) may be important for the re-uptake of serotonin (5-HT) in the central nervous system. In the present study we investigated how the 5-HTT genotype i.e. the short (S) versus long (L) 5-HTTLPR allele and the SNP rs25531 A > G affect the physical and psychosocial functioning in patients with chronic fatigue syndrome (CFS). All 120 patients were recruited from The Department of Paediatrics at Oslo University Hospital, Norway, a national referral center for young CFS patients (12–18 years). Main outcomes were number of steps per day obtained by an accelerometer and disability scored by the Functional Disability Inventory (FDI). Patients with the 5-HTT SS or SLG genotype had a significantly lower number of steps per day than patients with the 5-HTT LALG, SLA or LALA genotype. Patients with the 5-HTT SS or SLG genotype also had a significantly higher FDI score than patients with the 5-HTT LALG, SLA or LALA genotype. Thus, CFS patients with the 5-HTT SS or SLG genotype had worse 30 weeks outcome than CFS patients with the 5-HTT LALG, SLA or LALA genotype. The present study suggests that the 5-HTT genotype may be a factor that contributes to maintenance of CFS. PMID:26473596

Full Length Human Mutant Huntingtin with a Stable Polyglutamine Repeat Can Elicit Progressive and Selective Neuropathogenesis in BACHD Mice

PubMed Central

Gray, Michelle; Shirasaki, Dyna I.; Cepeda, Carlos; Andre, Veronique M.; Wilburn, Brian; Lu, Xiao-Hong; Tao, Jifang; Yamazaki, Irene; Li, Shi-Hua; Sun, Yi E.; Li, Xiao-Jiang; Levine, Michael S.; William Yang, X

2008-01-01

To elucidate the pathogenic mechanisms in Huntington’s disease (HD) elicited by expression of full-length human mutant huntingtin (fl-mhtt), a Bacterial Artificial Chromosome (BAC)-mediated transgenic mouse model (BACHD) was developed expressing fl-mhtt with 97 glutamine repeats under the control of endogenous htt regulatory machinery on the BAC. BACHD mice exhibit progressive motor deficits, neuronal synaptic dysfunction, and late-onset selective neuropathology, which includes significant cortical and striatal atrophy and striatal dark neuron degeneration. Power analyses reveal the robustness of the behavioral and neuropathological phenotypes, suggesting BACHD as a suitable fl-mhtt mouse model for preclinical studies. Further analyses of BACHD mice provide additional insights into how mhtt may elicit neuropathogenesis. First, unlike prior fl-mhtt mouse models, BACHD mice reveal that the slowly progressive and selective pathogenic process in HD mouse brains can occur without early and diffuse nuclear accumulation of aggregated mhtt (i.e. as detected by immunostaining with the EM48 antibody). Instead, a relatively steady-state level of predominantly full-length mhtt and a small amount of mhtt N-terminal fragments are sufficient to elicit the disease process. Second, the polyglutamine repeat within fl-mhtt in BACHD mice is encoded by a mixed CAA-CAG repeat, which is stable in both the germline and somatic tissues including the cortex and striatum at the onset of neuropathology. Therefore, our results suggest that somatic repeat instability does not play a necessary role in selective neuropathogenesis in BACHD mice. In summary, the BACHD model constitutes a novel and robust in vivo paradigm for the investigation of HD pathogenesis and treatment. PMID:18550760

HTT-DB: horizontally transferred transposable elements database.

PubMed

Dotto, Bruno Reis; Carvalho, Evelise Leis; Silva, Alexandre Freitas; Duarte Silva, Luiz Fernando; Pinto, Paulo Marcos; Ortiz, Mauro Freitas; Wallau, Gabriel Luz

2015-09-01

Horizontal transfer of transposable (HTT) elements among eukaryotes was discovered in the mid-1980s. As then, >300 new cases have been described. New findings about HTT are revealing the evolutionary impact of this phenomenon on host genomes. In order to provide an up to date, interactive and expandable database for such events, we developed the HTT-DB database. HTT-DB allows easy access to most of HTT cases reported along with rich information about each case. Moreover, it allows the user to generate tables and graphs based on searches using Transposable elements and/or host species classification and export them in several formats. This database is freely available on the web at http://lpa.saogabriel.unipampa.edu.br:8080/httdatabase. HTT-DB was developed based on Java and MySQL with all major browsers supported. Tools and software packages used are free for personal or non-profit projects. bdotto82@gmail.com or gabriel.wallau@gmail.com. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Ensiling and hydrothermal pretreatment of grass: consequences for enzymatic biomass conversion and total monosaccharide yields

PubMed Central

2014-01-01

Background Ensiling may act as a pretreatment of fresh grass biomass and increase the enzymatic conversion of structural carbohydrates to fermentable sugars. However, ensiling does not provide sufficient severity to be a standalone pretreatment method. Here, ensiling of grass is combined with hydrothermal treatment (HTT) with the aim of improving the enzymatic biomass convertibility and decrease the required temperature of the HTT. Results Grass silage (Festulolium Hykor) was hydrothermally treated at temperatures of 170, 180, and 190°C for 10 minutes. Relative to HTT treated dry grass, ensiling increased the solubilization of dry matter (DM) during HTT and gave increased glucan content, but lower lignin in the insoluble fiber fraction. Ensiling improved glucose yields in the enzymatic hydrolysis of the washed solid fiber fraction at the lower HTT temperatures. At 170°C glucose yield improved from 17 to 24 (w/w)% (45 to 57% cellulose convertibility), and at 180°C glucose yield improved from 22 to 29 (w/w)% (54 to 69% cellulose convertibility). Direct HTT of grass at 190°C gave the same high glucose yield as for grass silage (35 (w/w)% (77% cellulose convertibility)) and improved xylan yields (27% xylan convertibility). The effect of ensiling of grass prior to HTT improved the enzymatic conversion of cellulose for HTT at 170 and 180°C, but the increased glucose release did not make up for the loss of water soluble carbohydrates (WSC) during ensiling. Overall, sugar yields (C6 + C5) were similar for HTT of grass and grass silage at both 170 and 180°C, but at 190°C the overall sugar yield was better for HTT of dry grass. Conclusions This study unequivocally establishes that ensiling of grass as a biomass pretreatment method comes with a loss of WSC. The loss of WSC by ensiling is not necessarily compensated for by providing a lower temperature requirement for HTT for high enzymatic monosaccharide release. However, ensiling can be an advantageous storage method prior to grass processing. PMID:25024743

Convergent genetic modulation of the endocrine stress response involves polymorphic variations of 5-HTT, COMT and MAOA.

PubMed

Jabbi, M; Korf, J; Kema, I P; Hartman, C; van der Pompe, G; Minderaa, R B; Ormel, J; den Boer, J A

2007-05-01

Highly prevalent stress-related disorders such as major depression (MD) are characterised by a dysregulation of the neuroendocrine system. Although heritability for these disorders is high, the role of genes in the underlying pathophysiology is poorly understood. Here, we show that polymorphic variations in genes coding for serotonin transporter (5-HTT), catechol-O-methyl transferase (COMT) and monoamine oxidase A (MAOA) as well as sex differences influence the regulation of hypothalamic-pituitary-adrenal (HPA)-axis response to acute psychological and endocrine challenges. In our sample, the effects of COMT on the release of adrenocorticotrophin hormone (ACTH) depend on the presence of the low-expression MAOA variant in the same individual. By including individuals varying in their degree of susceptibility to MD, we showed evidence of interactions between 5-HTT and MD susceptibility in baseline cortisol, and between MAOA and MD susceptibility in baseline ACTH measures, indicating a role for these genotypes in stable-state endocrine regulation. Collectively, these results indicate that the simultaneous investigation of multiple monoaminergic genes in interaction with gender have to be measured to understand the endocrine regulation of stress. These findings point towards a genetic susceptibility to stress-related disorders.

Free-Energy Landscape of the Amino-Terminal Fragment of Huntingtin in Aqueous Solution

PubMed Central

Binette, Vincent; Côté, Sébastien; Mousseau, Normand

2016-01-01

The first exon of Huntingtin—a protein with multiple biological functions whose misfolding is related to Huntington’s disease—modulates its localization, aggregation, and function within the cell. It is composed of a 17-amino-acid amphipathic segment (Htt17), an amyloidogenic segment of consecutive glutamines (QN), and a proline-rich segment. Htt17 is of fundamental importance: it serves as a membrane anchor to control the localization of huntingtin, it modulates huntingtin’s function through posttranslational modifications, and it controls the self-assembly of the amyloidogenic QN segment into oligomers and fibrils. Experimentally, the conformational ensemble of the Htt17 monomer, as well as the impact of the polyglutamine and proline-rich segments, remains, however, mostly uncharacterized at the atomic level due to its intrinsic flexibility. Here, we unveil the free-energy landscape of Htt17, Htt17Q17, and Htt17Q17P11 using Hamiltonian replica exchange combined with well-tempered metadynamics. We characterize the free-energy landscape of these three fragments in terms of a few selected collective variables. Extensive simulations reveal that the free energy of Htt17 is dominated by a broad ensemble of configurations that agree with solution NMR chemical shifts. Addition of Q17 at its carboxy-terminus reduces the extent of the main basin to more extended configurations of Htt17 with lower helix propensity. Also, the aliphatic carbons of Q17 partially sequester the nonpolar amino acids of Htt17. For its part, addition of Q17P11 shifts the overall landscape to a more extended and helical Htt17 stabilized by interactions with Q17 and P11, which almost exclusively form a PPII-helix, as well as by intramolecular H-bonds and salt bridges. Our characterization of Huntingtin’s amino-terminus provides insights into the structural origin of its ability to oligomerize and interact with phospholipid bilayers, processes closely linked to the biological functions of this protein. PMID:26958885

[The value of 5-HTT gene polymorphism for the assessment and prediction of male adolescence violence].

PubMed

Yu, Yue; Liu, Xiang; Yang, Zhen-xing; Qiu, Chang-jian; Ma, Xiao-hong

2012-08-01

To establish an adolescent violence crime prediction model, and to assess the value of serotonin transporter (5-HTT) gene polymorphism for the assessment and prediction of violent crime. Investigative tools were used to analyze the difference in personality dimensions, social support, coping styles, aggressiveness, impulsivity, and family condition scale between 223 adolescents with violence behavior and 148 adolescents without violence behavior. The distribution of 5-HTT gene polymorphisms (5-HTTLPR and 5-HTTVNTR) was compared between the two groups. The role of 5-HTT gene polymorphism on adolescent personality, impulsion and aggression scale also was also analyzed. Stepwise logistic regression was used to establish a predictive model for adolescent violent crime. Significant difference was found between the violence group and the control group on multiple dimensions of psychology and environment scales. However, no statistical difference was found with regard to the 5-HTT genotypes and alleles between adolescents with violent behaviors and normal controls. The rate of prediction accuracy was not significantly improved when 5-HTT gene polymorphism was taken into the model. The violent crime of adolescents was closely related with social and environmental factors. No association was found between 5-HTT polymorphisms and adolescent violence criminal behavior.

Involvement of Serotonin Transporter Gene Polymorphisms (5-HTT) in Impulsive Behavior in the Japanese Population

PubMed Central

Nomura, Michio; Kaneko, Masayuki; Okuma, Yasunobu; Nomura, Jun; Kusumi, Ichiro; Koyama, Tsukasa; Nomura, Yasuyuki

2015-01-01

The serotonergic pathway has been implicated in the pathogenesis of impulsivity, and sensitivity to aversive outcomes may be linked to serotonin (5-HT) levels. Polymorphisms in the gene that encodes the serotonin transporter (5-HTT), which have differential effects on the level of serotonin transmission, display alternate responses to aversive stimuli. However, recent studies have shown that 5-HT does not affect motor function, which suggests that the functioning of the serotonin-transporter-linked polymorphic region (5-HTTLPR) does not directly affect the behavioral regulatory process itself, but instead exerts an effect via the evaluation of the potential risk associated with particular behavioral outputs. The aim of the present study was to examine the effect of specific 5-HTTLPR genotypes on the motor regulatory process, as observed during a Go/Nogo punishment feedback task. 5-HTT gene-linked promoter polymorphisms were analyzed by polymerase chain reaction, using lymphocytes from 61 healthy Japanese volunteers. Impulsivity was defined as the number of commission errors (responding when one should not) made during a Go/Nogo task. We found that the s/s genotype group made fewer impulsive responses, specifically under aversive conditions for committing such errors, compared to those in the s/l group, without affecting overall motor inhibition. These results suggest that 5-HTTLPRs do not directly affect the behavioral regulatory process itself, but may instead exert an effect on the evaluation of potential risk. The results also indicate that under such aversive conditions, decreased expression of 5-HTT may promote motor inhibitory control. PMID:25775400

Association of VNTR polymorphisms in DRD4, 5-HTT and DAT1 genes with obesity.

PubMed

Uzun, Mustafa; Saglar, Emel; Kucukyildirim, Sibel; Erdem, Beril; Unlu, Hande; Mergen, Hatice

2015-05-01

To investigate the association between VNTR polymorphisms of DRD4, DAT1 and 5-HTT genes and obesity. Peripheral blood samples of 234 obese (BMI ≥ 30) and 148 healthy individuals (BMI ≤ 25) were objected to PCR to detect the VNTR of the 2nd intron of 5-HTT, 3rd exon of DRD4 and 3'UTR of DAT1 genes. The association between obesity and genotype distributions of 5-HTT, DAT1 and DRD4 genes and between obesity and distributions of allele frequencies were tested by Chi Square (χ(2)) test and were not found statistically significant. BMI values for genotype of obese and morbidly obese (BMI > 40) individuals were analyzed by Kruskal-Wallis and not found statistically significant differences between BMI values for the most frequent genotypes of 5-HTT, DAT1 and DRD4 genes. As a conclusion, there was no association between 5-HTT, DAT1 and DRD4 genes VNTR polymorphisms and obesity.

Loss of Huntingtin stimulates capture of retrograde dense-core vesicles to increase synaptic neuropeptide stores.

PubMed

Bulgari, Dinara; Deitcher, David L; Levitan, Edwin S

2017-08-01

The Huntington's disease protein Huntingtin (Htt) regulates axonal transport of dense-core vesicles (DCVs) containing neurotrophins and neuropeptides. DCVs travel down axons to reach nerve terminals where they are either captured in synaptic boutons to support later release or reverse direction to reenter the axon as part of vesicle circulation. Currently, the impact of Htt on DCV dynamics in the terminal is unknown. Here we report that knockout of Drosophila Htt selectively reduces retrograde DCV flux at proximal boutons of motoneuron terminals. However, initiation of retrograde transport at the most distal bouton and transport velocity are unaffected suggesting that synaptic capture rate of these retrograde DCVs could be altered. In fact, tracking DCVs shows that retrograde synaptic capture efficiency is significantly elevated by Htt knockout or knockdown. Furthermore, synaptic boutons contain more neuropeptide in Htt knockout larvae even though bouton size, single DCV fluorescence intensity, neuropeptide release in response to electrical stimulation and subsequent activity-dependent capture are unaffected. Thus, loss of Htt increases synaptic capture as DCVs travel by retrograde transport through boutons resulting in reduced transport toward the axon and increased neuropeptide in the terminal. These results therefore identify native Htt as a regulator of synaptic capture and neuropeptide storage. Copyright © 2017 Elsevier GmbH. All rights reserved.

Free-Energy Landscape of the Amino-Terminal Fragment of Huntingtin in Aqueous Solution.

PubMed

Binette, Vincent; Côté, Sébastien; Mousseau, Normand

2016-03-08

The first exon of Huntingtin-a protein with multiple biological functions whose misfolding is related to Huntington's disease-modulates its localization, aggregation, and function within the cell. It is composed of a 17-amino-acid amphipathic segment (Htt17), an amyloidogenic segment of consecutive glutamines (QN), and a proline-rich segment. Htt17 is of fundamental importance: it serves as a membrane anchor to control the localization of huntingtin, it modulates huntingtin's function through posttranslational modifications, and it controls the self-assembly of the amyloidogenic QN segment into oligomers and fibrils. Experimentally, the conformational ensemble of the Htt17 monomer, as well as the impact of the polyglutamine and proline-rich segments, remains, however, mostly uncharacterized at the atomic level due to its intrinsic flexibility. Here, we unveil the free-energy landscape of Htt17, Htt17Q17, and Htt17Q17P11 using Hamiltonian replica exchange combined with well-tempered metadynamics. We characterize the free-energy landscape of these three fragments in terms of a few selected collective variables. Extensive simulations reveal that the free energy of Htt17 is dominated by a broad ensemble of configurations that agree with solution NMR chemical shifts. Addition of Q17 at its carboxy-terminus reduces the extent of the main basin to more extended configurations of Htt17 with lower helix propensity. Also, the aliphatic carbons of Q17 partially sequester the nonpolar amino acids of Htt17. For its part, addition of Q17P11 shifts the overall landscape to a more extended and helical Htt17 stabilized by interactions with Q17 and P11, which almost exclusively form a PPII-helix, as well as by intramolecular H-bonds and salt bridges. Our characterization of Huntingtin's amino-terminus provides insights into the structural origin of its ability to oligomerize and interact with phospholipid bilayers, processes closely linked to the biological functions of this protein. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

The targetable A1 Huntington disease haplotype has distinct Amerindian and European origins in Latin America

PubMed Central

Kay, Chris; Tirado-Hurtado, Indira; Cornejo-Olivas, Mario; Collins, Jennifer A; Wright, Galen; Inca-Martinez, Miguel; Veliz-Otani, Diego; Ketelaar, Maria E; Slama, Ramy A; Ross, Colin J; Mazzetti, Pilar; Hayden, Michael R

2017-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin (HTT) gene. HD occurs worldwide, but the causative mutation is found on different HTT haplotypes in distinct ethnic groups. In Latin America, HD is thought to have European origins, but indigenous Amerindian ancestry has not been investigated. Here, we report dense HTT haplotypes in 62 mestizo Peruvian HD families, 17 HD families from across Latin America, and 42 controls of defined Peruvian Amerindian ethnicity to determine the origin of HD in populations of admixed Amerindian and European descent. HD in Peru occurs most frequently on the A1 HTT haplotype (73%), as in Europe, but on an unexpected indigenous variant also found in Amerindian controls. This Amerindian A1 HTT haplotype predominates over the European A1 variant among geographically disparate Latin American controls and in HD families from across Latin America, supporting an indigenous origin of the HD mutation in mestizo American populations. We also show that a proportion of HD mutations in Peru occur on a C1 HTT haplotype of putative Amerindian origin (14%). The majority of HD mutations in Latin America may therefore occur on haplotypes of Amerindian ancestry rather than on haplotypes resulting from European admixture. Despite the distinct ethnic ancestry of Amerindian and European A1 HTT, alleles on the parent A1 HTT haplotype allow for development of identical antisense molecules to selectively silence the HD mutation in the greatest proportion of patients in both Latin American and European populations. PMID:28000697

Interaction with Polyglutamine-expanded Huntingtin Alters Cellular Distribution and RNA Processing of Huntingtin Yeast Two-hybrid Protein A (HYPA)*

PubMed Central

Jiang, Ya-Jun; Che, Mei-Xia; Yuan, Jin-Qiao; Xie, Yuan-Yuan; Yan, Xian-Zhong; Hu, Hong-Yu

2011-01-01

Huntington disease (HD) is an autosomal inherited disorder that causes the deterioration of brain cells. The polyglutamine (polyQ) expansion of huntingtin (Htt) is implicated in the pathogenesis of HD via interaction with an RNA splicing factor, Htt yeast two-hybrid protein A/forming-binding protein 11 (HYPA/FBP11). Besides the pathogenic polyQ expansion, Htt also contains a proline-rich region (PRR) located exactly in the C terminus to the polyQ tract. However, how the polyQ expansion influences the PRR-mediated protein interaction and how this abnormal interaction leads to the biological consequence remain elusive. Our NMR structural analysis indicates that the PRR motif of Htt cooperatively interacts with the tandem WW domains of HYPA through domain chaperoning effect of WW1 on WW2. The polyQ-expanded Htt sequesters HYPA to the cytosolic location and then significantly reduces the efficiency of pre-mRNA splicing. We propose that the toxic gain-of-function of the polyQ-expanded Htt that causes dysfunction of cellular RNA processing contributes to the pathogenesis of HD. PMID:21566141

Interaction with polyglutamine-expanded huntingtin alters cellular distribution and RNA processing of huntingtin yeast two-hybrid protein A (HYPA).

PubMed

Jiang, Ya-Jun; Che, Mei-Xia; Yuan, Jin-Qiao; Xie, Yuan-Yuan; Yan, Xian-Zhong; Hu, Hong-Yu

2011-07-15

Huntington disease (HD) is an autosomal inherited disorder that causes the deterioration of brain cells. The polyglutamine (polyQ) expansion of huntingtin (Htt) is implicated in the pathogenesis of HD via interaction with an RNA splicing factor, Htt yeast two-hybrid protein A/forming-binding protein 11 (HYPA/FBP11). Besides the pathogenic polyQ expansion, Htt also contains a proline-rich region (PRR) located exactly in the C terminus to the polyQ tract. However, how the polyQ expansion influences the PRR-mediated protein interaction and how this abnormal interaction leads to the biological consequence remain elusive. Our NMR structural analysis indicates that the PRR motif of Htt cooperatively interacts with the tandem WW domains of HYPA through domain chaperoning effect of WW1 on WW2. The polyQ-expanded Htt sequesters HYPA to the cytosolic location and then significantly reduces the efficiency of pre-mRNA splicing. We propose that the toxic gain-of-function of the polyQ-expanded Htt that causes dysfunction of cellular RNA processing contributes to the pathogenesis of HD.

Huntingtin Is Required for Epithelial Polarity through RAB11A-Mediated Apical Trafficking of PAR3-aPKC

PubMed Central

Elias, Salah; McGuire, John Russel; Yu, Hua; Humbert, Sandrine

2015-01-01

The establishment of apical-basolateral polarity is important for both normal development and disease, for example, during tumorigenesis and metastasis. During this process, polarity complexes are targeted to the apical surface by a RAB11A-dependent mechanism. Huntingtin (HTT), the protein that is mutated in Huntington disease, acts as a scaffold for molecular motors and promotes microtubule-based dynamics. Here, we investigated the role of HTT in apical polarity during the morphogenesis of the mouse mammary epithelium. We found that the depletion of HTT from luminal cells in vivo alters mouse ductal morphogenesis and lumen formation. HTT is required for the apical localization of PAR3-aPKC during epithelial morphogenesis in virgin, pregnant, and lactating mice. We show that HTT forms a complex with PAR3, aPKC, and RAB11A and ensures the microtubule-dependent apical vesicular translocation of PAR3-aPKC through RAB11A. We thus propose that HTT regulates polarized vesicular transport, lumen formation and mammary epithelial morphogenesis. PMID:25942483

Structural formation of huntingtin-like aggregates probed by small-angle neutron scattering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stanley, Christopher B; Perevozchikova, Tatiana; Berthelier-Jung, Valerie M

2011-01-01

In several neurodegenerative disorders, including Huntington s disease (HD), aspects concerning the earliest of protein structures that form along the aggregation pathway have increasingly gained attention since these particular species are likely to be neurotoxic. We used time-resolved small-angle neutron scattering (SANS) to probe in solution these transient structures formed by peptides having the N-terminal sequence context of mutant huntingtin (Htt) exon 1. We obtained snapshots of the formed aggregates as the kinetic reaction ensued to yield quantitative information on their size and mass. At the early stage, small precursor species with an initial radius of gyration (Rg) of 16.1more » 5.9 and average mass of a dimer to trimer were monitored. Structural growth was treated as two modes with a transition from three-dimensional early aggregate formation to two-dimensional fibril growth and association. Our SANS results on the internal structure of the mature fibrils demonstrate loose packing with about 1 peptide per 4.75 -sheet repeat distance, which is shown to be quantitatively consistent with a -helix model. This research provides new insights into the structures forming along the pathway of Htt exon 1 aggregation and should assist in determining the role that precursors play in neuronal toxicity.« less

Serotonin transporter promoter variants: Analysis in Indian autistic and control population.

PubMed

Guhathakurta, Subhrangshu; Ghosh, Sagarmoy; Sinha, Swagata; Chatterjee, Anindita; Ahmed, Shabina; Chowdhury, Susanta Roy; Gangopadhyay, Prasanta Kumar; Ghosh, Saurabh; Singh, Manoranjan; Usha, Rajamma

2006-05-30

Serotonin transporter (5-HTT) is a transmembrane protein belonging to Na+/Cl- dependent membrane transporter family and transports 5-HT across the membranes of presynaptic neurons. 5-HTT-linked polymorphic region (5-HTTLPR) gained much interest because of the differential regulation of expression and activity of 5-HTT by its various genotypes. A population-based study has been conducted on 5-HTTLPR with 358 individuals, which included 79 autistic probands, 136 parents, and 143 controls from two subpopulations of east and northeast regions of India. The genotypic frequencies of all the groups conform to Hardy-Weinberg equilibrium. With the finding of efficacy of serotonin reuptake inhibitors in ameliorating ritualistic behavior in autistic disorder, 5-HTT emerged as a putative candidate gene for autism and association studies have been carried out in different ethnic populations. But these studies were inconclusive due to conflicting results on association. Because such a study has never been performed in the Indian population, we have tested the possible involvement of 5-HTTLPR polymorphism with autism. The present study failed to establish any association or linkage of 5-HTTLPR with autism in the Indian population by case-control studies (chi2 = 1.314, P = 0.63) and family-based approaches (TDT chi2 = 0.22, P = 0.64 and HHRR-chi2 = 0.25, P = 0.61). However, when a meta-analysis of all the available TDT data, inclusive of the present study is carried out, we observed a significant preferential transmission of S-allele from parents to the affected offspring (chi2 = 7.51, P = 0.006) indicating an association of 5-HTTLPR with autism.

Impaired ERAD and ER stress are early and specific events in polyglutamine toxicity

PubMed Central

Duennwald, Martin L.; Lindquist, Susan

2008-01-01

Protein misfolding, whether caused by aging, environmental factors, or genetic mutations, is a common basis for neurodegenerative diseases. The misfolding of proteins with abnormally long polyglutamine (polyQ) expansions causes several neurodegenerative disorders, such as Huntington’s disease (HD). Although many cellular pathways have been documented to be impaired in HD, the primary triggers of polyQ toxicity remain elusive. We report that yeast cells and neuron-like PC12 cells expressing polyQ-expanded huntingtin (htt) fragments display a surprisingly specific, immediate, and drastic defect in endoplasmic reticulum (ER)-associated degradation (ERAD). We further decipher the mechanistic basis for this defect in ERAD: the entrapment of the essential ERAD proteins Npl4, Ufd1, and p97 by polyQ-expanded htt fragments. In both yeast and mammalian neuron-like cells, overexpression of Npl4 and Ufd1 ameliorates polyQ toxicity. Our results establish that impaired ER protein homeostasis is a broad and highly conserved contributor to polyQ toxicity in yeast, in PC12 cells, and, importantly, in striatal cells expressing full-length polyQ-expanded huntingtin. PMID:19015277

The interaction of polyglutamine peptides with lipid membranes is regulated by flanking sequences associated with huntingtin.

PubMed

Burke, Kathleen A; Kauffman, Karlina J; Umbaugh, C Samuel; Frey, Shelli L; Legleiter, Justin

2013-05-24

Huntington disease (HD) is caused by an expanded polyglutamine (poly(Q)) repeat near the N terminus of the huntingtin (htt) protein. Expanded poly(Q) facilitates formation of htt aggregates, eventually leading to deposition of cytoplasmic and intranuclear inclusion bodies containing htt. Flanking sequences directly adjacent to the poly(Q) domain, such as the first 17 amino acids on the N terminus (Nt17) and the polyproline (poly(P)) domain on the C-terminal side of the poly(Q) domain, heavily influence aggregation. Additionally, htt interacts with a variety of membraneous structures within the cell, and Nt17 is implicated in lipid binding. To investigate the interaction between htt exon1 and lipid membranes, a combination of in situ atomic force microscopy, Langmuir trough techniques, and vesicle permeability assays were used to directly monitor the interaction of a variety of synthetic poly(Q) peptides with different combinations of flanking sequences (KK-Q35-KK, KK-Q35-P10-KK, Nt17-Q35-KK, and Nt17-Q35-P10-KK) on model membranes and surfaces. Each peptide aggregated on mica, predominately forming extended, fibrillar aggregates. In contrast, poly(Q) peptides that lacked the Nt17 domain did not appreciably aggregate on or insert into lipid membranes. Nt17 facilitated the interaction of peptides with lipid surfaces, whereas the poly(P) region enhanced this interaction. The aggregation of Nt17-Q35-P10-KK on the lipid bilayer closely resembled that of a htt exon1 construct containing 35 repeat glutamines. Collectively, this data suggests that the Nt17 domain plays a critical role in htt binding and aggregation on lipid membranes, and this lipid/htt interaction can be further modulated by the presence of the poly(P) domain.

Dopamine and serotonin transporter genotypes moderate sensitivity to maternal expressed emotion: the case of conduct and emotional problems in attention deficit/hyperactivity disorder.

PubMed

Sonuga-Barke, Edmund J S; Oades, Robert D; Psychogiou, Lamprini; Chen, Wai; Franke, Barbara; Buitelaar, Jan; Banaschewski, Tobias; Ebstein, Richard P; Gil, Michael; Anney, Richard; Miranda, Ana; Roeyers, Herbert; Rothenberger, Aribert; Sergeant, Joseph; Steinhausen, Hans Christoph; Thompson, Margaret; Asherson, Philip; Faraone, Stephen V

2009-09-01

Mothers' positive emotions expressed about their children with attention deficit/hyperactivity disorder (ADHD) are associated with a reduced likelihood of comorbid conduct problems (CP). We examined whether this association with CP, and one with emotional problems (EMO), is moderated by variants within three genes, previously reported to be associated with ADHD and to moderate the impact of environmental risks on conduct and/or emotional problems; the dopamine transporter gene (SLC6A3/DAT1), the dopamine D4 receptor gene (DRD4) and the serotonin transporter gene (SLC6A4/5HTT). Seven hundred and twenty-eight males between the ages of 5 and 17 with a DSM-IV research diagnosis of combined type ADHD were included in these analyses. Parents and teachers rated children's conduct and emotional problems. Positive maternal expressed emotion (PMEE) was coded by independent observers on comments made during a clinical assessment with the mother based on current or recent medication-free periods. Sensitivity to the effects of PMEE on CP was moderated by variants of the DAT1 and 5HTT genes. Only children who did not carry the DAT1 10R/10R or the 5HTT l/l genotypes showed altered levels of CP when exposed to PMEE. The effect was most marked where the child with ADHD had both these genotypes. For EMO, sensitivity to PMEE was found only with those who carried the DAT1 9R/9R. There was no effect of DRD4 on CP or EMO. The gene-environment interactions observed suggested that genetic make-up can alter the degree of sensitivity an ADHD patients has to their family environment. Further research should focus on distinguishing general sensitivity genotypes from those conferring risk or protective qualities.

Fibril polymorphism affects immobilized non-amyloid flanking domains of huntingtin exon1 rather than its polyglutamine core

PubMed Central

Lin, Hsiang-Kai; Boatz, Jennifer C.; Krabbendam, Inge E.; Kodali, Ravindra; Hou, Zhipeng; Wetzel, Ronald; Dolga, Amalia M.; Poirier, Michelle A.; van der Wel, Patrick C. A.

2017-01-01

Polyglutamine expansion in the huntingtin protein is the primary genetic cause of Huntington's disease (HD). Fragments coinciding with mutant huntingtin exon1 aggregate in vivo and induce HD-like pathology in mouse models. The resulting aggregates can have different structures that affect their biochemical behaviour and cytotoxic activity. Here we report our studies of the structure and functional characteristics of multiple mutant htt exon1 fibrils by complementary techniques, including infrared and solid-state NMR spectroscopies. Magic-angle-spinning NMR reveals that fibrillar exon1 has a partly mobile α-helix in its aggregation-accelerating N terminus, and semi-rigid polyproline II helices in the proline-rich flanking domain (PRD). The polyglutamine-proximal portions of these domains are immobilized and clustered, limiting access to aggregation-modulating antibodies. The polymorphic fibrils differ in their flanking domains rather than the polyglutamine amyloid structure. They are effective at seeding polyglutamine aggregation and exhibit cytotoxic effects when applied to neuronal cells. PMID:28537272

Fibril polymorphism affects immobilized non-amyloid flanking domains of huntingtin exon1 rather than its polyglutamine core

NASA Astrophysics Data System (ADS)

Lin, Hsiang-Kai; Boatz, Jennifer C.; Krabbendam, Inge E.; Kodali, Ravindra; Hou, Zhipeng; Wetzel, Ronald; Dolga, Amalia M.; Poirier, Michelle A.; van der Wel, Patrick C. A.

2017-05-01

Polyglutamine expansion in the huntingtin protein is the primary genetic cause of Huntington's disease (HD). Fragments coinciding with mutant huntingtin exon1 aggregate in vivo and induce HD-like pathology in mouse models. The resulting aggregates can have different structures that affect their biochemical behaviour and cytotoxic activity. Here we report our studies of the structure and functional characteristics of multiple mutant htt exon1 fibrils by complementary techniques, including infrared and solid-state NMR spectroscopies. Magic-angle-spinning NMR reveals that fibrillar exon1 has a partly mobile α-helix in its aggregation-accelerating N terminus, and semi-rigid polyproline II helices in the proline-rich flanking domain (PRD). The polyglutamine-proximal portions of these domains are immobilized and clustered, limiting access to aggregation-modulating antibodies. The polymorphic fibrils differ in their flanking domains rather than the polyglutamine amyloid structure. They are effective at seeding polyglutamine aggregation and exhibit cytotoxic effects when applied to neuronal cells.

Trehalose rescues glial cell dysfunction in striatal cultures from HD R6/1 mice at early postnatal development.

PubMed

Perucho, Juan; Gómez, Ana; Muñoz, María Paz; de Yébenes, Justo García; Mena, María Ángeles; Casarejos, María José

2016-07-01

The pathological hallmark of Huntington disease (HD) is the intracellular aggregation of mutant huntingtin (mHTT) in striatal neurons and glia associated with the selective loss of striatal medium-sized spiny neurons. Up to the present, the role of glia in HD is poorly understood and has been classically considered secondary to neuronal disorder. Trehalose is a disaccharide known to possess many pharmacological properties, acting as an antioxidant, a chemical chaperone, and an inducer of autophagy. In this study, we analyzed at an early postnatal development stage the abnormalities observed in striatal glial cell cultures of postnatal R6/1 mice (HD glia), under baseline and stressing conditions and the protective effects of trehalose. Our data demonstrate that glial HD alterations already occur at early stages of postnatal development. After 20 postnatal days in vitro, striatal HD glia cultures showed more reactive astrocytes with increased expression of glial fibrillary acidic protein (GFAP) but with less replication capacity, less A2B5(+) glial progenitors and more microglia than wild-type (WT) cultures. HD glia had lower levels of intracellular glutathione (GSH) and was more susceptible to H2O2 and epoxomicin insults. The amount of expressed GDNF and secreted mature-BDNF by HD astrocytes were much lower than by WT astrocytes. In addition, HD glial cultures showed a deregulation of the major proteolytic systems, the ubiquitin-proteasomal system (UPS), and the autophagic pathway. This produces a defective protein quality control, indicated by the elevated levels of ubiquitination and p62 protein. Interestingly, we show that trehalose, through its capacity to induce autophagy, inhibited p62/SQSTM1 accumulation and facilitated the degradation of cytoplasmic aggregates from mHTT and α-synuclein proteins. Trehalose also reduced microglia activation and reversed the disrupted cytoskeleton of astrocytes accompanied with an increase in the replication capacity. In addition, trehalose up-regulated mature-BDNF neurotrophic factor expression and secretion, probably mediating cytoskeletal organization and helping in vesicular BDNF transport. Together, these findings indicate that glia suffers functional early changes in the disease process, changes that may contribute to HD neurodegeneration. Trehalose could be a very promising compound for treatment of HD and other diseases with abnormal protein aggregates. Furthermore our study identifies glial cells as a novel target for trehalose to induce neurotrophic and neuroprotective actions in HD. Copyright © 2016 Elsevier Inc. All rights reserved.

SUMO-1 is associated with a subset of lysosomes in glial protein aggregate diseases.

PubMed

Wong, Mathew B; Goodwin, Jacob; Norazit, Anwar; Meedeniya, Adrian C B; Richter-Landsberg, Christiane; Gai, Wei Ping; Pountney, Dean L

2013-01-01

Oligodendroglial inclusion bodies characterize a subset of neurodegenerative diseases. Multiple system atrophy (MSA) is characterized by α-synuclein glial cytoplasmic inclusions and progressive supranuclear palsy (PSP) is associated with glial tau inclusions. The ubiquitin homologue, SUMO-1, has been identified in inclusion bodies in MSA, located in discrete sub-domains in α-synuclein-positive inclusions. We investigated SUMO-1 associated with oligodendroglial inclusion bodies in brain tissue from MSA and PSP and in glial cell models. We examined MSA and PSP cases and compared to age-matched normal controls. Fluorescence immunohistochemistry revealed frequent SUMO-1 sub-domains within and surrounding inclusions bodies in both diseases and showed punctate co-localization of SUMO-1 and the lysosomal marker, cathepsin D, in affected brain regions. Cell counting data revealed that 70-75 % of lysosomes in inclusion body-positive oligodendrocytes were SUMO-1-positive consistently across MSA and PSP cases, compared to 20 % in neighbouring inclusion body negative oligodendrocytes and 10 % in normal brain tissue. Hsp90 co-localized with some SUMO-1 puncta. We examined the SUMO-1 status of lysosomes in 1321N1 human glioma cells over-expressing α-synuclein and in immortalized rat oligodendrocyte cells over-expressing the four repeat form of tau following treatment with the proteasome inhibitor, MG132. We also transfected 1321N1 cells with the inherently aggregation-prone huntingtin exon 1 mutant, HttQ74-GFP. Each cell model showed the association of SUMO-1-positive lysosomes around focal cytoplasmic accumulations of α-synuclein, tau or HttQ74-GFP, respectively. Association of SUMO-1 with lysosomes was also detected in glial cells bearing α-synuclein aggregates in a rotenone-lesioned rat model. SUMO-1 labelling of lysosomes showed a major increase between 24 and 48 h post-incubation of 1321N1 cells with MG132 resulting in an increase in a 90 kDa SUMO-1-positive band that was immunopositive for Hsp90 and immunoprecipitated with an anti-SUMO-1 antibody. That SUMO-1 co-localizes with a subset of lysosomes in neurodegenerative diseases with glial protein aggregates and in glial cell culture models of protein aggregation suggests a role for SUMO-1 in lysosome function.

Prevalence of Huntington's disease gene CAG trinucleotide repeat alleles in patients with bipolar disorder.

PubMed

Ramos, Eliana Marisa; Gillis, Tammy; Mysore, Jayalakshmi S; Lee, Jong-Min; Alonso, Isabel; Gusella, James F; Smoller, Jordan W; Sklar, Pamela; MacDonald, Marcy E; Perlis, Roy H

2015-06-01

Huntington's disease is a neurodegenerative disorder characterized by motor, cognitive, and psychiatric symptoms that are caused by huntingtin gene (HTT) CAG trinucleotide repeat alleles of 36 or more units. A greater than expected prevalence of incompletely penetrant HTT CAG repeat alleles observed among individuals diagnosed with major depressive disorder raises the possibility that another mood disorder, bipolar disorder, could likewise be associated with Huntington's disease. We assessed the distribution of HTT CAG repeat alleles in a cohort of individuals with bipolar disorder. HTT CAG allele sizes from 2,229 Caucasian individuals diagnosed with DSM-IV bipolar disorder were compared to allele sizes in 1,828 control individuals from multiple cohorts. We found that HTT CAG repeat alleles > 35 units were observed in only one of 4,458 chromosomes from individuals with bipolar disorder, compared to three of 3,656 chromosomes from control subjects. These findings do not support an association between bipolar disorder and Huntington's disease. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Motivational, proteostatic and transcriptional deficits precede synapse loss, gliosis and neurodegeneration in the B6.HttQ111/+ model of Huntington's disease.

PubMed

Bragg, Robert M; Coffey, Sydney R; Weston, Rory M; Ament, Seth A; Cantle, Jeffrey P; Minnig, Shawn; Funk, Cory C; Shuttleworth, Dominic D; Woods, Emily L; Sullivan, Bonnie R; Jones, Lindsey; Glickenhaus, Anne; Anderson, John S; Anderson, Michael D; Dunnett, Stephen B; Wheeler, Vanessa C; MacDonald, Marcy E; Brooks, Simon P; Price, Nathan D; Carroll, Jeffrey B

2017-02-08

We investigated the appearance and progression of disease-relevant signs in the B6.Htt Q111/+ mouse, a genetically precise model of the mutation that causes Huntington's disease (HD). We find that B6.Htt Q111/+ mice are healthy, show no overt signs of central or peripheral inflammation, and no gross motor impairment as late as 12 months of age. Behaviorally, we find that 4-9 month old B6.Htt Q111/+ mice have normal activity levels and show no clear signs of anxiety or depression, but do show clear signs of reduced motivation. The neuronal density, neuronal size, synaptic density and number of glia is normal in B6.Htt Q111/+ striatum, the most vulnerable brain region in HD, up to 12 months of age. Despite this preservation of the synaptic and cellular composition of the striatum, we observe clear progressive, striatal-specific transcriptional dysregulation and accumulation of neuronal intranuclear inclusions (NIIs). Simulation studies suggest these molecular endpoints are sufficiently robust for future preclinical studies, and that B6.Htt Q111/+ mice are a useful tool for modeling disease-modifying or neuroprotective strategies for disease processes before the onset of overt phenotypes.

The influence of exercise intensity on heat acclimation in trained subjects.

PubMed

Houmard, J A; Costill, D L; Davis, J A; Mitchell, J B; Pascoe, D D; Robergs, R A

1990-10-01

Low-intensity exercise (less than or equal to 50% VO2max) has been demonstrated to produce heat acclimation (HA) in trained subjects. The purpose of this study was to determine whether shorter-duration, moderate-intensity exercise would also result in HA. Nine trained runners performed two 9-d exercise heat-stress protocols. Each protocol consisted of a 90-min heat tolerance test on days 1 (HTT1) and 9 (HTT2). On days 2-8 the subjects exercised at 50% VO2max for 60 min.d-1 (T50) or at 75% VO2max for 30-35 min.d-1 (T75). Final HTT2 heart rate and rectal temperature (Tr) were significantly (P less than 0.001) reduced, as compared to HTT1, with no differences between T50 and T75. Both protocols resulted in significant (P less than 0.05) reductions in HTT2 pre-exercise Tr and total exercising caloric expenditure, both of which are known to contribute to HA. No changes in resting plasma volume, osmolality, protein, post-HTT aldosterone, and exercising sweat rate were observed. These results demonstrate that equal levels of HA were obtained with T50 and T75, which suggests that moderate-intensity, short-duration exercise in the heat can produce HA in trained subjects.

Motivational, proteostatic and transcriptional deficits precede synapse loss, gliosis and neurodegeneration in the B6.HttQ111/+ model of Huntington’s disease

PubMed Central

Bragg, Robert M.; Coffey, Sydney R.; Weston, Rory M.; Ament, Seth A.; Cantle, Jeffrey P.; Minnig, Shawn; Funk, Cory C.; Shuttleworth, Dominic D.; Woods, Emily L.; Sullivan, Bonnie R.; Jones, Lindsey; Glickenhaus, Anne; Anderson, John S.; Anderson, Michael D.; Dunnett, Stephen B.; Wheeler, Vanessa C.; MacDonald, Marcy E.; Brooks, Simon P.; Price, Nathan D.; Carroll, Jeffrey B.

2017-01-01

We investigated the appearance and progression of disease-relevant signs in the B6.HttQ111/+ mouse, a genetically precise model of the mutation that causes Huntington’s disease (HD). We find that B6.HttQ111/+ mice are healthy, show no overt signs of central or peripheral inflammation, and no gross motor impairment as late as 12 months of age. Behaviorally, we find that 4–9 month old B6.HttQ111/+ mice have normal activity levels and show no clear signs of anxiety or depression, but do show clear signs of reduced motivation. The neuronal density, neuronal size, synaptic density and number of glia is normal in B6.HttQ111/+ striatum, the most vulnerable brain region in HD, up to 12 months of age. Despite this preservation of the synaptic and cellular composition of the striatum, we observe clear progressive, striatal-specific transcriptional dysregulation and accumulation of neuronal intranuclear inclusions (NIIs). Simulation studies suggest these molecular endpoints are sufficiently robust for future preclinical studies, and that B6.HttQ111/+ mice are a useful tool for modeling disease-modifying or neuroprotective strategies for disease processes before the onset of overt phenotypes. PMID:28176805

HttQ111/+ Huntington's Disease Knock-in Mice Exhibit Brain Region-Specific Morphological Changes and Synaptic Dysfunction.

PubMed

Kovalenko, Marina; Milnerwood, Austen; Giordano, James; St Claire, Jason; Guide, Jolene R; Stromberg, Mary; Gillis, Tammy; Sapp, Ellen; DiFiglia, Marian; MacDonald, Marcy E; Carroll, Jeffrey B; Lee, Jong-Min; Tappan, Susan; Raymond, Lynn; Wheeler, Vanessa C

2018-01-01

Successful disease-modifying therapy for Huntington's disease (HD) will require therapeutic intervention early in the pathogenic process. Achieving this goal requires identifying phenotypes that are proximal to the HTT CAG repeat expansion. To use Htt CAG knock-in mice, precise genetic replicas of the HTT mutation in patients, as models to study proximal disease events. Using cohorts of B6J.HttQ111/+ mice from 2 to 18 months of age, we analyzed pathological markers, including immunohistochemistry, brain regional volumes and cortical thickness, CAG instability, electron microscopy of striatal synapses, and acute slice electrophysiology to record glutamatergic transmission at striatal synapses. We also incorporated a diet perturbation paradigm for some of these analyses. B6J.HttQ111/+ mice did not exhibit significant neurodegeneration or gliosis but revealed decreased striatal DARPP-32 as well as subtle but regional-specific changes in brain volumes and cortical thickness that parallel those in HD patients. Ultrastructural analyses of the striatum showed reduced synapse density, increased postsynaptic density thickness and increased synaptic cleft width. Acute slice electrophysiology showed alterations in spontaneous AMPA receptor-mediated postsynaptic currents, evoked NMDA receptor-mediated excitatory postsynaptic currents, and elevated extrasynaptic NMDA currents. Diet influenced cortical thickness, but did not impact somatic CAG expansion, nor did it show any significant interaction with genotype on immunohistochemical, brain volume or cortical thickness measures. These data show that a single HttQ111 allele is sufficient to elicit brain region-specific morphological changes and early neuronal dysfunction, highlighting an insidious disease process already apparent in the first few months of life.

Aggression and 5HTT polymorphism in females: study of synchronized swimming and control groups.

PubMed

Sysoeva, Olga V; Maluchenko, Natalia V; Timofeeva, Marina A; Portnova, Galina V; Kulikova, Maria A; Tonevitsky, Alexandr G; Ivanitsky, Alexey M

2009-05-01

Aggression is a heterogeneous heritable psychological trait, also influenced by environmental factors. Previous studies, mostly conducted on male population, have found some associations of the aggression with the polymorphisms of genes, regulating the activity of serotonin (5-HT) in the brain. However, psychological as well as biochemical manifestations of the aggression are different in males and females. Our study aimed to investigate the association of 5-HTT gene polymorphism with different facets of aggression (BDHI) in females. Two groups: the synchronized swimming and non-athlete control, - were examined to study the possible modulation effect of sport on the association between 5-HTT gene polymorphism and aggression. It was found that in both groups the low-active 5-HTT polymorphism (SS) was associated with increased scores on Indirect Hostility scale and decreased scores on Negativism scale, compared to LL genotype. No interaction effect between sport and 5-HTT polymorphism was found. The higher percentage of LL-carriers and lower of LS-carriers in the synchronized swimming group compared to the control one was observed. This may be the sign of the importance of LL polymorphism of 5-HTT gene, previously associated with higher resistance to stress factors, for being an athlete, although this result has to be taken cautiously keeping in mind the stratification problem. Synchronized swimmers had lower scores on Assault, Negativism, Irritability and Verbal Hostility compared to age-matched control girls (in general and for each 5-HTT genotype separately), suggesting that they may have more matured emotional system (older control group has also lower scores on these scales).

Reduced bioavailable manganese causes striatal urea cycle pathology in Huntington's disease mouse model.

PubMed

Bichell, Terry Jo V; Wegrzynowicz, Michal; Tipps, K Grace; Bradley, Emma M; Uhouse, Michael A; Bryan, Miles; Horning, Kyle; Fisher, Nicole; Dudek, Karrie; Halbesma, Timothy; Umashanker, Preethi; Stubbs, Andrew D; Holt, Hunter K; Kwakye, Gunnar F; Tidball, Andrew M; Colbran, Roger J; Aschner, Michael; Neely, M Diana; Di Pardo, Alba; Maglione, Vittorio; Osmand, Alexander; Bowman, Aaron B

2017-06-01

Huntington's disease (HD) is caused by a mutation in the huntingtin gene (HTT), resulting in profound striatal neurodegeneration through an unknown mechanism. Perturbations in the urea cycle have been reported in HD models and in HD patient blood and brain. In neurons, arginase is a central urea cycle enzyme, and the metal manganese (Mn) is an essential cofactor. Deficient biological responses to Mn, and reduced Mn accumulation have been observed in HD striatal mouse and cell models. Here we report in vivo and ex vivo evidence of a urea cycle metabolic phenotype in a prodromal HD mouse model. Further, either in vivo or in vitro Mn supplementation reverses the urea-cycle pathology by restoring arginase activity. We show that Arginase 2 (ARG2) is the arginase enzyme present in these mouse brain models, with ARG2 protein levels directly increased by Mn exposure. ARG2 protein is not reduced in the prodromal stage, though enzyme activity is reduced, indicating that altered Mn bioavailability as a cofactor leads to the deficient enzymatic activity. These data support a hypothesis that mutant HTT leads to a selective deficiency of neuronal Mn at an early disease stage, contributing to HD striatal urea-cycle pathophysiology through an effect on arginase activity. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

HdhQ111 Mice Exhibit Tissue Specific Metabolite Profiles that Include Striatal Lipid Accumulation

PubMed Central

Carroll, Jeffrey B.; Deik, Amy; Fossale, Elisa; Weston, Rory M.; Guide, Jolene R.; Arjomand, Jamshid; Kwak, Seung; Clish, Clary B.; MacDonald, Marcy E.

2015-01-01

The HTT CAG expansion mutation causes Huntington’s Disease and is associated with a wide range of cellular consequences, including altered metabolism. The mutant allele is expressed widely, in all tissues, but the striatum and cortex are especially vulnerable to its effects. To more fully understand this tissue-specificity, early in the disease process, we asked whether the metabolic impact of the mutant CAG expanded allele in heterozygous B6.HdhQ111/+ mice would be common across tissues, or whether tissues would have tissue-specific responses and whether such changes may be affected by diet. Specifically, we cross-sectionally examined steady state metabolite concentrations from a range of tissues (plasma, brown adipose tissue, cerebellum, striatum, liver, white adipose tissue), using an established liquid chromatography-mass spectrometry pipeline, from cohorts of 8 month old mutant and wild-type littermate mice that were fed one of two different high-fat diets. The differential response to diet highlighted a proportion of metabolites in all tissues, ranging from 3% (7/219) in the striatum to 12% (25/212) in white adipose tissue. By contrast, the mutant CAG-expanded allele primarily affected brain metabolites, with 14% (30/219) of metabolites significantly altered, compared to wild-type, in striatum and 11% (25/224) in the cerebellum. In general, diet and the CAG-expanded allele both elicited metabolite changes that were predominantly tissue-specific and non-overlapping, with evidence for mutation-by-diet interaction in peripheral tissues most affected by diet. Machine-learning approaches highlighted the accumulation of diverse lipid species as the most genotype-predictive metabolite changes in the striatum. Validation experiments in cell culture demonstrated that lipid accumulation was also a defining feature of mutant HdhQ111 striatal progenitor cells. Thus, metabolite-level responses to the CAG expansion mutation in vivo were tissue specific and most evident in brain, where the striatum featured signature accumulation of a set of lipids including sphingomyelin, phosphatidylcholine, cholesterol ester and triglyceride species. Importantly, in the presence of the CAG mutation, metabolite changes were unmasked in peripheral tissues by an interaction with dietary fat, implying that the design of studies to discover metabolic changes in HD mutation carriers should include metabolic perturbations. PMID:26295712

Polymorphisms in the serotonin transporter and monoamine oxidase A genes and their relationship to personality traits measured by the Temperament and Character Inventory and NEO Five-Factor Inventory in healthy volunteers.

PubMed

Samochowiec, Jerzy; Syrek, Szymon; Michał, Parus; Ryzewska-Wódecka, Aneta; Samochowiec, Agnieszka; Horodnicki, Jan; Zakrzewska, Marzena; Kucharska-Mazur, Jolanta

2004-01-01

The associations between 5-HTT-linked polymorphic region (5-HTT-LPR), monoamine oxidase A (MAOA)-LPR and the dimensions of temperament evaluated using the Temperament and Character Inventory (TCI) and NEO Five-Factor Inventory (NEO-FFI) were studied. One hundred healthy volunteers (without psychiatric disorders) were recruited to represent a cross-section of the population of Szczecin (Poland) in terms of sex, age and education. No associations between 5-HTT-LPR and the TCI harm avoidance dimension and between 5-HTT-LPR and the NEO-FFI neuroticism dimension were found. Males carrying the 3-VNTR MAOA gene variant (209 bp) had significantly lower values on the NEO-FFI openness dimension (p = 0.039) and obtained higher scores on the subdimension 3 of the TCI reward dependence (RD3), i.e. attachment vs. detachment (p = 0.005). Individuals carrying the 'short' variant of 5-HTT-LPR had lower values on the reward dependence dimension and the RD4 subdimension (dependence vs. independence) than individuals not carrying the 'short' variant (p = 0.039 and p = 0.011, respectively). Females carrying the 'short' variant had lower values on NS1 (exploratory excitability vs. stoic rigidity) and RD4 (dependence vs. independence) than those not carrying the variant (p = 0.042 and 0.043, respectively). The obtained level of significance with respect to the observed associations between 5-HTT-LPR and the reward dependence scales and subscales and between 5-HTT-LPR and the NS1 subscale are too weak for further interpretation. Our results do not confirm the hypothesis that there is a simple correlation between single gene polymorphisms and a personality trait measured by the TCI and NEO-FFI scales.

HttQ111/+ Huntington’s Disease Knock-in Mice Exhibit Brain Region-Specific Morphological Changes and Synaptic Dysfunction

PubMed Central

Kovalenko, Marina; Milnerwood, Austen; Giordano, James; St. Claire, Jason; Guide, Jolene R.; Stromberg, Mary; Gillis, Tammy; Sapp, Ellen; DiFiglia, Marian; MacDonald, Marcy E.; Carroll, Jeffrey B.; Lee, Jong-Min; Tappan, Susan; Raymond, Lynn; Wheeler, Vanessa C.

2018-01-01

Background: Successful disease-modifying therapy for Huntington’s disease (HD) will require therapeutic intervention early in the pathogenic process. Achieving this goal requires identifying phenotypes that are proximal to the HTT CAG repeat expansion. Objective: To use Htt CAG knock-in mice, precise genetic replicas of the HTT mutation in patients, as models to study proximal disease events. Methods: Using cohorts of B6J.HttQ111/+ mice from 2 to 18 months of age, we analyzed pathological markers, including immunohistochemistry, brain regional volumes and cortical thickness, CAG instability, electron microscopy of striatal synapses, and acute slice electrophysiology to record glutamatergic transmission at striatal synapses. We also incorporated a diet perturbation paradigm for some of these analyses. Results: B6J.HttQ111/+ mice did not exhibit significant neurodegeneration or gliosis but revealed decreased striatal DARPP-32 as well as subtle but regional-specific changes in brain volumes and cortical thickness that parallel those in HD patients. Ultrastructural analyses of the striatum showed reduced synapse density, increased postsynaptic density thickness and increased synaptic cleft width. Acute slice electrophysiology showed alterations in spontaneous AMPA receptor-mediated postsynaptic currents, evoked NMDA receptor-mediated excitatory postsynaptic currents, and elevated extrasynaptic NMDA currents. Diet influenced cortical thickness, but did not impact somatic CAG expansion, nor did it show any significant interaction with genotype on immunohistochemical, brain volume or cortical thickness measures. Conclusions: These data show that a single HttQ111 allele is sufficient to elicit brain region-specific morphological changes and early neuronal dysfunction, highlighting an insidious disease process already apparent in the first few months of life. PMID:29480209

Genetic linkage study of bipolar disorder and the serotonin transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kelsoe, J.R.; Morison, M.; Mroczkowski-Parker, Z.

1996-04-09

The serotonin transporter (HTT) is an important candidate gene for the genetic transmission of bipolar disorder. It is the site of action of many antidepressants, and plays a key role in the regulation of serotonin neurotransmission. Many studies of affectively ill patients have found abnormalities in serotonin metabolism, and dysregulation of the transporter itself. The human serotonin transporter has been recently cloned and mapped to chromosome 17. We have identified a PstI RFLP at the HTT locus, and here report our examination of this polymorphism for possible linkage to bipolar disorder. Eighteen families were examined from three populations: the Oldmore » Order Amish, Iceland, and the general North American population. In addition to HTT, three other microsatellite markers were examined, which span an interval known to contain HTT. Linkage analyses were conducted under both dominant and recessive models, as well as both narrow (bipolar only) and broad (bipolar + recurrent unipolar) diagnostic models. Linkage could be excluded to HTT under all models examined. Linkage to the interval spanned by the microsatellites was similarly excluded under the dominant models. In two individual families, maximum lod scores of 1.02 and 0.84 were obtained at D17S798 and HTT, respectively. However, these data overall do not support the presence of a susceptibility locus for bipolar disorder near the serotonin transporter. 20 refs., 2 tabs.« less

Fibrillar α-Synuclein and Huntingtin Exon 1 Assemblies Are Toxic to the Cells

PubMed Central

Pieri, Laura; Madiona, Karine; Bousset, Luc; Melki, Ronald

2012-01-01

The aggregation of alpha-synuclein (α-syn) and huntingtin (htt) into fibrillar assemblies in nerve and glial cells is a molecular hallmark of Parkinson's and Huntington's diseases. Within the aggregation process, prefibrillar and fibrillar oligomeric species form. Prefibrillar assemblies rather than fibrils are nowadays considered cytotoxic. However, recent reports describing spreading of fibrillar assemblies from one cell to another, in cell cultures, animal models, and brains of grafted patients suggest a critical role for fibrillar assemblies in pathogenesis. Here we compare the cytotoxic effect of defined and comparable particle concentrations of on-assembly pathway oligomeric and fibrillar α-syn and Htt fragment corresponding to the first exon of the protein (HttEx1). We show that homogeneous populations of α-syn and HttEx1 fibrils, rather than their precursor on-assembly pathway oligomers, are highly toxic to cultured cells and induce apoptotic cell death. We document the reasons that make fibrils toxic. We show that α-syn and HttEx1 fibrils bind and permeabilize lipid vesicles. We also show that fibrils binding to the plasma membrane in cultured cells alter Ca2+ homeostasis. Overall, our data indicate that fibrillar α-syn and HttEx1, rather than their precursor oligomers, are highly cytotoxic, the toxicity being associated to their ability to bind and permeabilize the cell membranes. PMID:22735540

Serotonin transporter gene polymorphisms and hyperserotonemia in autistic disorder.

PubMed

Betancur, C; Corbex, M; Spielewoy, C; Philippe, A; Laplanche, J L; Launay, J M; Gillberg, C; Mouren-Siméoni, M C; Hamon, M; Giros, B; Nosten-Bertrand, M; Leboyer, M

2002-01-01

Previous studies have provided conflicting evidence regarding the association of the serotonin transporter (5-HTT) gene with autism. Two polymorphisms have been identified in the human 5-HTT gene, a VNTR in intron 2 and a functional deletion/insertion in the promoter region (5-HTTLPR) with short and long variants. Positive associations of the 5-HTTLPR polymorphism with autism have been reported by two family-based studies, but one found preferential transmission of the short allele and the other of the long allele. Two subsequent studies failed to find evidence of transmission disequilibrium at the 5-HTTLPR locus. These conflicting results could be due to heterogeneity of clinical samples with regard to serotonin (5-HT) blood levels, which have been found to be elevated in some autistic subjects. Thus, we examined the association of the 5-HTTLPR and VNTR polymorphisms of the 5-HTT gene with autism, and we investigated the relationship between 5-HTT variants and whole-blood 5-HT. The transmission/disequilibrium test (TDT) revealed no linkage disequilibrium at either loci in a sample of 96 families comprising 43 trios and 53 sib pairs. Furthermore, no significant relationship between 5-HT blood levels and 5-HTT gene polymorphisms was found. Our results suggest that the 5-HTT gene is unlikely to play a major role as a susceptibility factor in autism.

Serotonin transporter gene polymorphisms and hyperserotonemia in autistic disorder

PubMed Central

Betancur, Catalina; Corbex, Marylis; Spielewoy, Cécile; Philippe, Anne; Laplanche, Jean-Louis; Launay, Jean-Marie; Gillberg, Christopher; Mouren-Simeoni, Marie-Christine; Hamon, Michel; Giros, Bruno; Nosten-Bertrand, Marika; Leboyer, Marion

2002-01-01

Previous studies have provided conflicting evidence regarding the association of the serotonin transporter (5-HTT) gene with autism. Two polymorphisms have been identified in the human 5-HTT gene, a VNTR in intron 21 and a functional deletion/insertion in the promoter region (5-HTTLPR) with short and long variants.2 Positive associations of the 5-HTTLPR polymorphism with autism have been reported by two family-based studies, but one found preferential transmission of the short allele3 and the other of the long allele.4 Two subsequent studies failed to find evidence of transmission disequilibrium at the 5-HTTLPR locus.5,6 These conflicting results could be due to heterogeneity of clinical samples with regard to serotonin (5-HT) blood levels, which have been found to be elevated in some autistic subjects.7–9 Thus, we examined the association of the 5-HTTLPR and VNTR polymorphisms of the 5-HTT gene with autism, and we investigated the relationship between 5-HTT variants and whole-blood 5-HT. The transmission/disequilibrium test (TDT) revealed no linkage disequilibrium at either loci in a sample of 96 families comprising 43 trios and 53 sib pairs. Furthermore, no significant relationship between 5-HT blood levels and 5-HTT gene polymorphisms was found. Our results suggest that the 5-HTT gene is unlikely to play a major role as a susceptibility factor in autism. PMID:11803447

Correlation of histological and ex-vivo confocal tumor thickness in malignant melanoma.

PubMed

Hartmann, Daniela; Krammer, Sebastian; Ruini, Cristel; Ruzicka, Thomas; von Braunmühl, Tanja

2016-07-01

The ex-vivo confocal laser scanning microscopy (ex-vivo CLSM) is a novel diagnostic method for fresh tissue examination, which has already shown promising results in the evaluation of healthy skin and different skin tumors. In malignant melanoma, the histological tumor thickness plays an essential role for further treatment strategies. The immediate perioperative measurement of tumor thickness by means of ex-vivo CLSM might accelerate the decision for further operating procedures in malignant melanoma. Ten histologically confirmed malignant melanomas from various donor sites were blindly examined by two investigators via ex-vivo CLSM and conventional light microscopy. The histopathological tumor thickness (HTT) and confocal tumor thickness (CTT) were measured independently and evaluated using correlation curves, Spearman's correlation coefficient, and Bland-Altman plots. Bland-Altman plots for HTT and reflectance-mode CTT, as well as for fluorescence-mode CTT, showed high correlations. Spearman's correlation coefficient of HTT and CTT was 1.00 in FM and RM. The mean difference of RM-CTT and FM-CTT versus HTT was 0.09 ± 0.30 mm and 0.19 ± 0.35 mm. In one case, the HTT was identical to the CTT in both modes. This pilot study shows high conformity of CTT and HTT measured in malignant melanoma underlining the potential of ex-vivo CLSM for perioperative decisions on safety margin excisions of malignant melanoma in the future.

Structural insights into the specific binding of huntingtin proline-rich region with the SH3 and WW domains.

PubMed

Gao, Yong-Guang; Yan, Xian-Zhong; Song, Ai-Xin; Chang, Yong-Gang; Gao, Xue-Chao; Jiang, Nan; Zhang, Qi; Hu, Hong-Yu

2006-12-01

The interactions of huntingtin (Htt) with the SH3 domain- or WW domain-containing proteins have been implicated in the pathogenesis of Huntington's disease (HD). We report the specific interactions of Htt proline-rich region (PRR) with the SH3GL3-SH3 domain and HYPA-WW1-2 domain pair by NMR. The results show that Htt PRR binds with the SH3 domain through nearly its entire chain, and that the binding region on the domain includes the canonical PxxP-binding site and the specificity pocket. The C terminus of PRR orients to the specificity pocket, whereas the N terminus orients to the PxxP-binding site. Htt PRR can also specifically bind to WW1-2; the N-terminal portion preferentially binds to WW1, while the C-terminal portion binds to WW2. This study provides structural insights into the specific interactions between Htt PRR and its binding partners as well as the alteration of these interactions that involve PRR, which may have implications for the understanding of HD.

Synergistic effect of rice husk addition on hydrothermal treatment of sewage sludge: fate and environmental risk of heavy metals.

PubMed

Shi, Wansheng; Liu, Chunguang; Shu, Youju; Feng, Chuanping; Lei, Zhongfang; Zhang, Zhenya

2013-12-01

Hydrothermal treatment (HTT) at 200°C was applied to immobilize heavy metals (HMs) and the effect of rice husk (RH) addition was investigated based on total HMs concentration, fractionation and leaching tests. The results indicated that a synergistic effect of RH addition and HTT could be achieved on reducing the risk of HMs from medium and low risk to no risk. Metals were redistributed and transformed from weakly bounded state to stable state during the HTT process under RH addition. Notably at a RH/sludge ratio of 1/1.75 (d.w.), all the HMs showed no eco-toxicity and no leaching toxicity, with the concentrations of leachable Cr, Ni, Cu and Cd decreased by 17%, 89%, 95% and 93%, respectively. This synergistic effect of RH addition and HTT on the risk reduction of HMs implies that HTT process with RH addition could be a promising and safe disposal technology for sewage sludge treatment in practice. Copyright © 2013 Elsevier Ltd. All rights reserved.

Lack of serotonin reuptake during brain development alters rostral raphe-prefrontal network formation.

PubMed

Witteveen, Josefine S; Middelman, Anthonieke; van Hulten, Josephus A; Martens, Gerard J M; Homberg, Judith R; Kolk, Sharon M

2013-01-01

Besides its "classical" neurotransmitter function, serotonin (5-HT) has been found to also act as a neurodevelopmental signal. During development, the 5-HT projection system, besides an external placental source, represents one of the earliest neurotransmitter systems to innervate the brain. One of the targets of the 5-HT projection system, originating in the brainstem raphe nuclei, is the medial prefrontal cortex (mPFC), an area involved in higher cognitive functions and important in the etiology of many neurodevelopmental disorders. Little is known, however, about the exact role of 5-HT and its signaling molecules in the formation of the raphe-prefrontal network. Using explant essays, we here studied the role of the 5-HT transporter (5-HTT), an important modulator of the 5-HT signal, in rostral raphe-prefrontal network formation. We found that the chemotrophic nature of the interaction between the origin (rostral raphe cluster) and a target (mPFC) of the 5-HT projection system was affected in rats lacking the 5-HTT (5-HTT(-/-)). While 5-HTT deficiency did not affect the dorsal raphe 5-HT-positive outgrowing neurites, the median raphe 5-HT neurites switched from a strong repulsive to an attractive interaction when co-cultured with the mPFC. Furthermore, the fasciculation of the mPFC outgrowing neurites was dependent on the amount of 5-HTT. In the mPFC of 5-HTT(-/-) pups, we observed clear differences in 5-HT innervation and the identity of a class of projection neurons of the mPFC. In the absence of the 5-HTT, the 5-HT innervation in all subareas of the early postnatal mPFC increased dramatically and the number of Satb2-positive callosal projection neurons was decreased. Together, these results suggest a 5-HTT dependency during early development of these brain areas and in the formation of the raphe-prefrontal network. The tremendous complexity of the 5-HT projection system and its role in several neurodevelopmental disorders highlights the need for further research in this largely unexplored area.

The role of polyglutamine expansion and protein context in disease-related huntingtin/lipid interactions

NASA Astrophysics Data System (ADS)

Burke, Kathleen Anne

Huntington's Disease (HD) is a neurodegenerative disorder that is defined by the accumulation of nanoscale aggregates comprised of the huntingtin (htt) protein. Aggregation is directly caused by an expanded polyglutamine (polyQ) domain in htt, leading to a diverse population of aggregate species, such as oligomers, fibrils, and annular aggregates. Furthermore, the length of this polyQ domain is directly related to onset and severity of disease. The first 17 amino acids on the N-terminus (N17) and the polyproline domain on the C-terminal side of the polyQ domain have been shown to further modulate the aggregation process. Additionally, N17 appears to have lipid binding properties as htt interacts with a variety of membrane-containing structures present in cells, such as organelles, and interactions with these membrane surfaces may further modulate htt aggregation. To investigate the interaction between htt exon1 and lipid bilayers, in situ atomic force microscopy (AFM) was used to directly monitor the aggregation of htt exon1 constructs with varying Q-length (35Q, 46Q, 51Q, and myc- 53Q) or synthetic peptides with different polyQ domain flanking sequences (KK-Q35-KK, KK-Q 35-P10-KK, N17-Q35-KK, and N 17-Q35-P10-KK) on supported lipid membranes comprised of total brain lipid extract. The exon1 fragments accumulated on the lipid membranes, causing disruption of the membrane, in a polyQ dependent manner. By adding N-terminal tags to the htt exon1 fragments, the interaction with the lipid bilayer was impeded. The KK-Q35-KK and KK-Q 35-P10-KK peptides had no appreciable interaction with lipid bilayers. Interestingly, polyQ peptides with the N17 flanking sequence interacted with the bilayer. N17-Q35-KK formed discrete aggregates on the bilayer, but there was minimal membrane disruption. The N17-Q35-P10-KK peptide interacted more aggressively with the lipid bilayer in a manner reminiscent of the htt exon1 proteins.

Massive horizontal transfer of transposable elements in insects

PubMed Central

Peccoud, Jean; Loiseau, Vincent; Cordaux, Richard

2017-01-01

Horizontal transfer (HT) of genetic material is central to the architecture and evolution of prokaryote genomes. Within eukaryotes, the majority of HTs reported so far are transfers of transposable elements (TEs). These reports essentially come from studies focusing on specific lineages or types of TEs. Because of the lack of large-scale survey, the amount and impact of HT of TEs (HTT) in eukaryote evolution, as well as the trends and factors shaping these transfers, are poorly known. Here, we report a comprehensive analysis of HTT in 195 insect genomes, representing 123 genera and 13 of the 28 insect orders. We found that these insects were involved in at least 2,248 HTT events that essentially occurred during the last 10 My. We show that DNA transposons transfer horizontally more often than retrotransposons, and unveil phylogenetic relatedness and geographical proximity as major factors facilitating HTT in insects. Even though our study is restricted to a small fraction of insect biodiversity and to a recent evolutionary timeframe, the TEs we found to be horizontally transferred generated up to 24% (2.08% on average) of all nucleotides of insect genomes. Together, our results establish HTT as a major force shaping insect genome evolution. PMID:28416702

High Protein Diet and Huntington's Disease

PubMed Central

Wu, Yih-Ru; Chen, Pei; Tsai, Fuu-Jen; Yang, Chueh-Lien; Tsao, Ya-Tzu; Chang, Wen; Hsieh, I-Shan; Chern, Yijuang; Soong, Bing-Wen

2015-01-01

Huntington’s disease (HD) is a neurodegenerative disorder caused by the huntingtin (HTT) gene with expanded CAG repeats. In addition to the apparent brain abnormalities, impairments also occur in peripheral tissues. We previously reported that mutant Huntingtin (mHTT) exists in the liver and causes urea cycle deficiency. A low protein diet (17%) restores urea cycle activity and ameliorates symptoms in HD model mice. It remains unknown whether the dietary protein content should be monitored closely in HD patients because the normal protein consumption is lower in humans (~15% of total calories) than in mice (~22%). We assessed whether dietary protein content affects the urea cycle in HD patients. Thirty HD patients were hospitalized and received a standard protein diet (13.7% protein) for 5 days, followed by a high protein diet (HPD, 26.3% protein) for another 5 days. Urea cycle deficiency was monitored by the blood levels of citrulline and ammonia. HD progression was determined by the Unified Huntington’s Disease Rating Scale (UHDRS). The HPD increased blood citrulline concentration from 15.19 μmol/l to 16.30 μmol/l (p = 0.0378) in HD patients but did not change blood ammonia concentration. A 2-year pilot study of 14 HD patients found no significant correlation between blood citrulline concentration and HD progression. Our results indicated a short period of the HPD did not markedly compromise urea cycle function. Blood citrulline concentration is not a reliable biomarker of HD progression. PMID:25992839

Huntingtin gene repeat size variations affect risk of lifetime depression.

PubMed

Gardiner, Sarah L; van Belzen, Martine J; Boogaard, Merel W; van Roon-Mom, Willeke M C; Rozing, Maarten P; van Hemert, Albert M; Smit, Johannes H; Beekman, Aartjan T F; van Grootheest, Gerard; Schoevers, Robert A; Oude Voshaar, Richard C; Roos, Raymund A C; Comijs, Hannie C; Penninx, Brenda W J H; van der Mast, Roos C; Aziz, N Ahmad

2017-12-11

Huntington disease (HD) is a severe neuropsychiatric disorder caused by a cytosine-adenine-guanine (CAG) repeat expansion in the HTT gene. Although HD is frequently complicated by depression, it is still unknown to what extent common HTT CAG repeat size variations in the normal range could affect depression risk in the general population. Using binary logistic regression, we assessed the association between HTT CAG repeat size and depression risk in two well-characterized Dutch cohorts─the Netherlands Study of Depression and Anxiety and the Netherlands Study of Depression in Older Persons─including 2165 depressed and 1058 non-depressed persons. In both cohorts, separately as well as combined, there was a significant non-linear association between the risk of lifetime depression and HTT CAG repeat size in which both relatively short and relatively large alleles were associated with an increased risk of depression (β = -0.292 and β = 0.006 for the linear and the quadratic term, respectively; both P < 0.01 after adjustment for the effects of sex, age, and education level). The odds of lifetime depression were lowest in persons with a HTT CAG repeat size of 21 (odds ratio: 0.71, 95% confidence interval: 0.52 to 0.98) compared to the average odds in the total cohort. In conclusion, lifetime depression risk was higher with both relatively short and relatively large HTT CAG repeat sizes in the normal range. Our study provides important proof-of-principle that repeat polymorphisms can act as hitherto unappreciated but complex genetic modifiers of depression.

Environmental enrichment reduces innate anxiety with no effect on depression-like behaviour in mice lacking the serotonin transporter.

PubMed

Rogers, Jake; Li, Shanshan; Lanfumey, Laurence; Hannan, Anthony J; Renoir, Thibault

2017-08-14

Along with being the main target of many antidepressant medications, the serotonin transporter (5-HTT) is known to be involved in the pathophysiology of depression and anxiety disorders. In line with this, mice with varying 5-HTT genotypes are invaluable tools to study depression- and anxiety-like behaviours as well as the mechanisms mediating potential therapeutics. There is clear evidence that both genetic and environmental factors play a role in the aetiology of psychiatric disorders. In that regard, housing paradigms which seek to enhance cognitive stimulation and physical activity have been shown to exert beneficial effects in animal models of neuropsychiatric disorders. In the present study, we examined the effects of environmental enrichment on affective-like behaviours and sensorimotor gating function of 5-HTT knock-out (KO) mice. Using the elevated-plus maze and the light-dark box, we found that environmental enrichment ameliorated the abnormal innate anxiety of 5-HTT KO mice on both tests. In contrast, environmental enrichment did not rescue the depression-like behaviour displayed by 5-HTT KO mice in the forced-swim test. Finally, measuring pre-pulse inhibition, we found no effect of genotype or treatment on sensorimotor gating. In conclusion, our data suggest that environmental enrichment specifically reduces innate anxiety of 5-HTT KO mice with no amelioration of the depression-like behaviour. This has implications for the current use of clinical interventions for patients with symptoms of both anxiety and depression. Copyright © 2017 Elsevier B.V. All rights reserved.

A New Drug Design Targeting the Adenosinergic System for Huntington's Disease

PubMed Central

Lin, Jiun-Tsai; Lin, Chia-I; Liu, Eric Minwei; Lin, Chun-Jung; Chen, Wan-Ping; Shen, Yuh-Chiang; Chen, Hui-Mei; Chen, Jhih-Bin; Lai, Hsing-Lin; Yang, Chieh-Wen; Chiang, Ming-Chang; Wu, Yu-Shuo; Chang, Chen; Chen, Jiang-Fan; Fang, Jim-Min; Lin, Yun-Lian; Chern, Yijuang

2011-01-01

Background Huntington's disease (HD) is a neurodegenerative disease caused by a CAG trinucleotide expansion in the Huntingtin (Htt) gene. The expanded CAG repeats are translated into polyglutamine (polyQ), causing aberrant functions as well as aggregate formation of mutant Htt. Effective treatments for HD are yet to be developed. Methodology/Principal Findings Here, we report a novel dual-function compound, N 6-(4-hydroxybenzyl)adenine riboside (designated T1-11) which activates the A2AR and a major adenosine transporter (ENT1). T1-11 was originally isolated from a Chinese medicinal herb. Molecular modeling analyses showed that T1-11 binds to the adenosine pockets of the A2AR and ENT1. Introduction of T1-11 into the striatum significantly enhanced the level of striatal adenosine as determined by a microdialysis technique, demonstrating that T1-11 inhibited adenosine uptake in vivo. A single intraperitoneal injection of T1-11 in wildtype mice, but not in A2AR knockout mice, increased cAMP level in the brain. Thus, T1-11 enters the brain and elevates cAMP via activation of the A2AR in vivo. Most importantly, addition of T1-11 (0.05 mg/ml) to the drinking water of a transgenic mouse model of HD (R6/2) ameliorated the progressive deterioration in motor coordination, reduced the formation of striatal Htt aggregates, elevated proteasome activity, and increased the level of an important neurotrophic factor (brain derived neurotrophic factor) in the brain. These results demonstrate the therapeutic potential of T1-11 for treating HD. Conclusions/Significance The dual functions of T1-11 enable T1-11 to effectively activate the adenosinergic system and subsequently delay the progression of HD. This is a novel therapeutic strategy for HD. Similar dual-function drugs aimed at a particular neurotransmitter system as proposed herein may be applicable to other neurotransmitter systems (e.g., the dopamine receptor/dopamine transporter and the serotonin receptor/serotonin transporter) and may facilitate the development of new drugs for other neurodegenerative diseases. PMID:21713039

The Role of Heat Tolerance Testing in Recovery and Return to Duty

DTIC Science & Technology

2008-10-01

CV diseases Hyperthyroidism Pheochromocytoma Infectious diseases Diabetes mellitus Psychiatric illness Parkinsonism Congenital abnormalities: CF...environments. To assess the heat tolerance status of prior heat stroke patient. Heat tolerance test (HTT) “HTT was effective in evaluating the heat tolerance

Simulate the volcanic radiation features in medium wave infrared channels

NASA Astrophysics Data System (ADS)

Gong, Cailan; Jiang, Shan; Liu, Fengyi; Hu, Yong

2015-10-01

There are different scales and intensities of the volcanic eruption in the world every year. Existing medium wave infrared (MWI) remote sensing channels are often at atmospheric window in 3-5μm, lack of water vapor and carbon dioxide(CO2) absorption channels data, such as 2.2μm, 2.7μm and so on, however the 2.7μm absorption bands can be used as volcanoes, forest fires and other hot target identification. In order to obtain the high-temperature targets (HTT)radiation features, such as volcanic eruptions and forest fires in the water vapor absorption channels, Firstly, the HTT should be identified from the existing bands based on the temperature differences between the objects and the surrounding environment. Then, the HTT radiation features were simulated, and the correlation between the radiations of different bands were established with statistical analysis method. The HTT reorganization from remote sensing data, radiation characteristics simulation in different atmospheric models were described, then the bands transformed models were set up. The volcanic HTT radiation characteristics were simulated in wavelength 2.7μm and 4.433-4.498μm (band 24 of MODIS) based on the known bands of 3.55 -3.93μm (band 3 of FengYun-3 Visible and Infrared Scanning Radiometer (VIRR)). The simulated results were tested by the volcanic HTT radiation characteristics with 4.433-4.498μm by known bands of MODIS image and the simulated 4.433-4.498μm image. The causes of errors generated were analyzed. The study methods were useful to the new remote sensor bands imaging characteristics simulation analysis.

11C-Choline PET/CT based Helical Tomotherapy as Treatment Approach for Bone Metastases in Recurrent Prostate Cancer Patients.

PubMed

Incerti, Elena; Gangemi, Vincenzo; Mapelli, Paola; Deantoni, Chiara Lucrezia; Giovacchini, Giampiero; Fallanca, Federico; Fodor, Andrei; Ciarmiello, Andrea; Baldari, Sergio; Gianolli, Luigi; Di Muzio, Nadia; Picchio, Maria

2017-11-10

To evaluate the efficacy of 11C-choline PET/CT (CHO-PET/CT) based helical tomotherapy (HTT) as a therapeutic approach for bone metastases in recurrent prostate cancer (PCa) patients. This retrospective study includes 20 PCa patients (median age: 67; range: 51-80 years) presenting biochemical relapse after primary treatment who underwent CHO-PET/CT based HTT on positive bone metastases from December 2007 to June 2014. The effectiveness of HTT has been assessed with biochemical response at 3/6/12 months, biochemical relapse free survival (bRFS) and overall survival (OS) at 2 years. Toxicity has also been considered and assessed according to Common Terminology Criteria for Adverse Events (CTCAE). All patients presented a relapse at the time of CHO-PET/CT at bone level. In addition 15/20 (75%) also at lymph nodes (LNs) level (total lesions= 54). All patients underwent HTT on bone metastases and 19/20 concomitantly on prostatic bed and LNs. The median follow-up from CHO-PET/CT was 2 years (range: 1-7 years). At 3 months after the beginning of HTT treatment complete or partial biochemical response occurred in 79% of patients, at 6 months in 82% and at 12 months in 63% of patients. bRFS and OS at 2 years were 50% and 55% of patients, respectively. Patients presented mostly grade 1 or 2 toxicity according to CTCAE. The only grade 3 late toxicity has been observed in one patient. CHO-PET/CT based HTT is a suitable therapeutic approach in patients with recurrent PCa presenting bone metastases with a medium-low toxicity. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Aggregation landscapes of Huntingtin exon 1 protein fragments and the critical repeat length for the onset of Huntington’s disease

PubMed Central

Chen, Mingchen; Wolynes, Peter G.

2017-01-01

Huntington’s disease (HD) is a neurodegenerative disease caused by an abnormal expansion in the polyglutamine (polyQ) track of the Huntingtin (HTT) protein. The severity of the disease depends on the polyQ repeat length, arising only in patients with proteins having 36 repeats or more. Previous studies have shown that the aggregation of N-terminal fragments (encoded by HTT exon 1) underlies the disease pathology in mouse models and that the HTT exon 1 gene product can self-assemble into amyloid structures. Here, we provide detailed structural mechanisms for aggregation of several protein fragments encoded by HTT exon 1 by using the associative memory, water-mediated, structure and energy model (AWSEM) to construct their free energy landscapes. We find that the addition of the N-terminal 17-residue sequence (NT17) facilitates polyQ aggregation by encouraging the formation of prefibrillar oligomers, whereas adding the C-terminal polyproline sequence (P10) inhibits aggregation. The combination of both terminal additions in HTT exon 1 fragment leads to a complex aggregation mechanism with a basic core that resembles that found for the aggregation of pure polyQ repeats using AWSEM. At the extrapolated physiological concentration, although the grand canonical free energy profiles are uphill for HTT exon 1 fragments having 20 or 30 glutamines, the aggregation landscape for fragments with 40 repeats has become downhill. This computational prediction agrees with the critical length found for the onset of HD and suggests potential therapies based on blocking early binding events involving the terminal additions to the polyQ repeats. PMID:28400517

Myricetin Reduces Toxic Level of CAG Repeats RNA in Huntington's Disease (HD) and Spino Cerebellar Ataxia (SCAs).

PubMed

Khan, Eshan; Tawani, Arpita; Mishra, Subodh Kumar; Verma, Arun Kumar; Upadhyay, Arun; Kumar, Mohit; Sandhir, Rajat; Mishra, Amit; Kumar, Amit

2018-01-19

Huntington's disease (HD) is a neurodegenerative disorder that is caused by abnormal expansion of CAG repeats in the HTT gene. The transcribed mutant RNA contains expanded CAG repeats that translate into a mutant huntingtin protein. This expanded CAG repeat also causes mis-splicing of pre-mRNA due to sequestration of muscle blind like-1 splicing factor (MBNL1), and thus both of these elicit the pathogenesis of HD. Targeting the onset as well as progression of HD by small molecules could be a potent therapeutic approach. We have screened a set of small molecules to target this transcript and found Myricetin, a flavonoid, as a lead molecule that interacts with the CAG motif and thus prevents the translation of mutant huntingtin protein as well as sequestration of MBNL1. Here, we report the first solution structure of the complex formed between Myricetin and RNA containing the 5'CAG/3'GAC motif. Myricetin interacts with this RNA via base stacking at the AA mismatch. Moreover, Myricetin was also found reducing the proteo-toxicity generated due to the aggregation of polyglutamine, and further, its supplementation also improves neurobehavioral deficits in the HD mouse model. Our study provides the structural and mechanistic basis of Myricetin as an effective therapeutic candidate for HD and other polyQ related disorders.

Cell membrane reactivity of MIB-1 antibody to Ki67 in human tumors: fact or artifact?

PubMed

Leonardo, Eugenio; Volante, Marco; Barbareschi, Mattia; Cavazza, Alberto; Dei Tos, Angelo Paolo; Bussolati, Gianni; Papotti, Mauro

2007-06-01

Ki67 immunohistochemistry is a widely used marker of the tumor proliferative fraction. Apart from the nuclear staining of dividing cells, MIB-1 monoclonal antibody was also found to stain the cell membrane of some tumor types. Indeed, such membrane reactivity was proposed as a diagnostic feature of hyalinizing trabecular tumor (HTT) of the thyroid. To verify the diagnostic role of Ki67 membrane pattern, 6 HTTs, 8 pulmonary sclerosing hemangiomas (SH), and 6 other human tumors with MIB-1 cell membrane immunoreactivity were stained by immunoperoxidase with 5 different anti-Ki67 antibodies in different experimental conditions. We show here that the cell membrane reactivity reported in HTT is produced only by MIB-1 and not by other antibodies to Ki67 (including commercially available mouse and rabbit monoclonal antibodies). In addition, this peculiar pattern is obtained only if the reaction is performed at room temperature, because automated immunostainers which operate at 37 degrees C do not produce any MIB-1 membrane localization. The same findings were obtained in the other 6 tumors. Conversely, sclerosing hemangioma of the lung did not produce any MIB-1 cell membrane reactivity in our hands. A cross-reactivity of the MIB-1 monoclonal antibody with an epitope expressed at the cell membrane level (rather than an artifact) seems the most likely explanation for this finding, because the immunoreactivity is generally intense and uniform in the membrane positive tumors. We conclude that when Ki67 immunohistochemistry is used for diagnostic purposes in a suspected HTT, only MIB-1 clone at room temperature should be employed.

Establishing a probabilistic reversal learning test in mice: evidence for the processes mediating reward-stay and punishment-shift behaviour and for their modulation by serotonin.

PubMed

Ineichen, Christian; Sigrist, Hannes; Spinelli, Simona; Lesch, Klaus-Peter; Sautter, Eva; Seifritz, Erich; Pryce, Christopher R

2012-11-01

Valid animal models of psychopathology need to include behavioural readouts informed by human findings. In the probabilistic reversal learning (PRL) task, human subjects are confronted with serial reversal of the contingency between two operant stimuli and reward/punishment and, superimposed on this, a low probability (0.2) of punished correct responses/rewarded incorrect responses. In depression, reward-stay and reversals completed are unaffected but response-shift following punished correct response trials, referred to as negative feedback sensitivity (NFS), is increased. The aims of this study were to: establish an operant spatial PRL test appropriate for mice; obtain evidence for the processes mediating reward-stay and punishment-shift responding; and assess effects thereon of genetically- and pharmacologically-altered serotonin (5-HT) function. The study was conducted with wildtype (WT) and heterozygous mutant (HET) mice from a 5-HT transporter (5-HTT) null mutant strain. Mice were mildly food deprived and reward was sugar pellet and punishment was 5-s time out. Mice exhibited high motivation and adaptive reversal performance. Increased probability of punished correct response (PCR) trials per session (p = 0.1, 0.2 or 0.3) led to monotonic decrease in reward-stay and reversals completed, suggesting accurate reward prediction. NFS differed from chance-level at p PCR = 0.1, suggesting accurate punishment prediction, whereas NFS was at chance-level at p = 0.2-0.3. At p PCR = 0.1, HET mice exhibited lower NFS than WT mice. The 5-HTT blocker escitalopram was studied acutely at p PCR = 0.2: a low dose (0.5-1.5 mg/kg) resulted in decreased NFS, increased reward-stay and increased reversals completed, and similarly in WT and HET mice. This study demonstrates that testing PRL in mice can provide evidence on the regulation of reward and punishment processing that is, albeit within certain limits, of relevance to human emotional-cognitive processing, its dysfunction and treatment. Copyright © 2012 Elsevier Ltd. All rights reserved.

The Role of Light in the Emergence of Weeds: Using Camelina microcarpa as an Example.

PubMed

Royo-Esnal, Aritz; Gesch, Russell W; Forcella, Frank; Torra, Joel; Recasens, Jordi; Necajeva, Jevgenija

2015-01-01

When modelling the emergence of weeds, two main factors are considered that condition this process: temperature and soil moisture. Optimum temperature is necessary for metabolic processes that generate energy for growth, while turgor pressure is necessary for root and shoot elongation which eventually leads to seedling emergence from the soil. Most emergence models do not usually consider light as a residual factor, but it could have an important role as it can alter directly or indirectly the dormancy and germination of seeds. In this paper, inclusion of light as an additional factor to photoperiod and radiation in emergence models is explored and compared with the classical hydrothermal time (HTT) model using Camelina microcarpa as an example. HTT based on hourly estimates is also compared with that based on daily estimates. Results suggest that, although HTT based models are accurate enough for local applications, the precision of these models is improved when HTT is estimated hourly and solar radiation is included as a factor.

The aggregation and inheritance of damaged proteins determines cell fate during mitosis

PubMed Central

Bufalino, Mary Rose; van der Kooy, Derek

2014-01-01

Recent evidence suggests that proliferating cells polarize damaged proteins during mitosis to protect one cell from aging, and that the structural conformation of damaged proteins mediates their toxicity. We report that the growth, resistance to stress, and differentiation characteristics of a cancer cell line (PC12) with an inducible Huntingtin (Htt) fused to enhanced green fluorescent protein (GFP) are dependent on the conformation of Htt. Cell progeny containing inclusion bodies have a longer cell cycle and increased resistance to stress than those with diffuse Htt. Using live imaging, we demonstrate that asymmetric division resulting from a cell containing a single inclusion body produces sister cells with different fates. The cell that receives the inclusion body has decreased proliferation and increased differentiation compared with its sister cell without Htt. This is the first report that reveals a functional consequence of the asymmetric division of damaged proteins in mammalian cells, and we suggest that this is a result of inclusion body-induced proteasome impairment. PMID:24553116

Cellular cytotoxic response induced by highly purified multi-wall carbon nanotube in human lung cells.

PubMed

Tsukahara, Tamotsu; Haniu, Hisao

2011-06-01

Carbon nanotubes, a promising nanomaterial with unique characteristics, have applications in a variety of fields. The cytotoxic effects of carbon nanotubes are partially due to the induction of oxidative stress; however, the detailed mechanisms of nanotube cytotoxicity and their interaction with cells remain unclear. In this study, the authors focus on the acute toxicity of vapor-grown carbon fiber, HTT2800, which is one of the most highly purified multi-wall carbon nanotubes (MWCNT) by high-temperature thermal treatment. The authors exposed human bronchial epithelial cells (BEAS-2B) to HTT2800 and measured the cellular uptake, mitochondrial function, cellular LDH release, apoptotic signaling, reactive oxygen species (ROS) generation and pro-inflammatory cytokine release. The HTT2800-exposed cells showed cellular uptake of the carbon nanotube, increased cell death, enhanced DNA damage, and induced cytokine release. However, the exposed cells showed no obvious intracellular ROS generation. These cellular and molecular findings suggest that HTT2800 could cause a potentially adverse inflammatory response in BEAS-2B cells.

Hydrothermal emergence model for ripgut brome (Bromus diandrus)

USDA-ARS?s Scientific Manuscript database

A model that describes the emergence of ripgut brome (Bromus diandrus) was developed using a two-season data set from a no-tilled field in northeastern Spain. The relationship between cumulative emergence and hydrothermal time (HTT) was described by a sigmoid growth function (Chapman equation). HTT ...

Dystrophic Serotonergic Axons in Neurodegenerative Diseases

PubMed Central

Azmitia, Efrain C.; Nixon, Ralph

2012-01-01

Neurodegenerative diseases such as Parkinson's disease (PD), frontal lobe dementia (FLD) and Diffuse Lewy-Body dementia (DLBD) have diverse neuropathologic features. Here we report that serotonin fibers are dystrophic in the brains of individuals with these three diseases. In neuropathologically normal (control) brains (n=3), serotonin axons immunoreactive (IR) with antibodies against the serotonin transporter (5-HTT) protein were widely distributed in cortex (entorhinal and dorsolateral prefrontal), hippocampus and rostral brainstem. 5-HTT-IR fibers of passage appeared thick, smooth, and un-branched in medial forebrain bundle, medial lemniscus and cortex white matter. The terminal branches were fine, highly branched and varicose in substantia nigra, hippocampus and cortical gray matter. In the diseased brains, however, 5-HTT-IR fibers in the forebrain were reduced in number and were frequently bulbous, splayed, tightly clustered and enlarged. Morphometric analysis revealed significant differences in the size distribution of the 5-HTT-IR profiles in dorsolateral prefrontal area between neurodegenerative diseases and controls. Our observations provide direct morphologic evidence for degeneration of human serotonergic axons in the brains of patients with neurodegenerative diseases despite the limited size (n=3 slices for each region (3) from each brain (4), total slices was n=36) and lack of extensive clinical characterization of the analyzed cohort. This is the first report of dystrophic 5-HTT-IR axons in postmortem human tissue PMID:18502405

Environmental surveillance and monitoring the next frontier for pathway-based high throughput screening

EPA Science Inventory

In response to a proposed vision and strategy for toxicity testing in the 21st century nascent high throughput toxicology (HTT) programs have tested thousands of chemicals in hundreds of pathway-based biological assays. Although, to date, use of HTT data for safety assessment of ...

Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons

PubMed Central

2012-01-01

Background A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Results Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Conclusions Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. PMID:22413862

Large-scale functional RNAi screen in C. elegans identifies genes that regulate the dysfunction of mutant polyglutamine neurons.

PubMed

Lejeune, François-Xavier; Mesrob, Lilia; Parmentier, Frédéric; Bicep, Cedric; Vazquez-Manrique, Rafael P; Parker, J Alex; Vert, Jean-Philippe; Tourette, Cendrine; Neri, Christian

2012-03-13

A central goal in Huntington's disease (HD) research is to identify and prioritize candidate targets for neuroprotective intervention, which requires genome-scale information on the modifiers of early-stage neuron injury in HD. Here, we performed a large-scale RNA interference screen in C. elegans strains that express N-terminal huntingtin (htt) in touch receptor neurons. These neurons control the response to light touch. Their function is strongly impaired by expanded polyglutamines (128Q) as shown by the nearly complete loss of touch response in adult animals, providing an in vivo model in which to manipulate the early phases of expanded-polyQ neurotoxicity. In total, 6034 genes were examined, revealing 662 gene inactivations that either reduce or aggravate defective touch response in 128Q animals. Several genes were previously implicated in HD or neurodegenerative disease, suggesting that this screen has effectively identified candidate targets for HD. Network-based analysis emphasized a subset of high-confidence modifier genes in pathways of interest in HD including metabolic, neurodevelopmental and pro-survival pathways. Finally, 49 modifiers of 128Q-neuron dysfunction that are dysregulated in the striatum of either R/2 or CHL2 HD mice, or both, were identified. Collectively, these results highlight the relevance to HD pathogenesis, providing novel information on the potential therapeutic targets for neuroprotection in HD. © 2012 Lejeune et al; licensee BioMed Central Ltd.

Valorization of residual bacterial biomass waste after polyhydroxyalkanoate isolation by hydrothermal treatment.

PubMed

Wei, Liqing; Liang, Shaobo; Coats, Erik R; McDonald, Armando G

2015-12-01

Hydrothermal treatment (HTT) was used to convert residual bacterial biomass (RBB), recovered from poly(3-hydroxybutyrate-co-3-hydroxyvalerate) production, into valuable bioproducts. The effect of processing temperatures (150, 200, and 250°C) on the bioproducts (water-solubles (WSs), bio-oil, insoluble residue, and gas) was investigated. The yields of bio-oil and gas were higher at higher temperatures. The maximum WS content (28 wt%) was obtained at 200°C. GCMS analysis showed higher content of aromatics and N-containing compounds with increasing temperature. ESI-MS revealed chemical compounds (e.g. protein, carbohydrate, lipids, and lignin) associated with RBB are fragmented into smaller molecules (monomers) at higher HTT temperatures. The WS fraction contained totally 838, 889 and 886mg/g acids and 160, 31 and 21 mg/g carbohydrate for HTT at 150, 200, and 250°C, respectively. The solid residues contain unconverted compounds, especially after HTT at 150°C. The WS products (acids and carbohydrates) could be used directly for PHA biosynthesis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Huntingtons Disease: The Value of Transcranial Meganetic Stimulation

PubMed

Medina, F J; Túnez, I

2010-01-01

Huntington's disease (HD) is a genetic neurodegenerative process whose etiology is based on a localized disturbance in the short arm of chromosome 4 that encodes the huntingtin protein (Htt). The elongation of triple CAG for glutamine characterizes this change. Mutated Htt (mHtt) causes the appearance of intracellular aggregates inducing alterations in mitochondrial metabolism in the form of reactive oxygen species (ROS) and ATP depletion. The oxidative imbalance caused by mHtt leads the neurons to a state of oxidative stress resulting in damage to macromolecules and cellular death. Since the discovery of certain mechanisms underlying the pathogenesis of HD, several therapeutic procedures have been shown to delay or slow the evolution of the condition and have demonstrated the biochemical and molecular mechanism involved. The studies have reported that transcranial magnetic stimulation (TMS) may improve motor and other symptoms associated with neurodegenerative and neuropsychiatric processes such as major depression, schizophrenia, epilepsy, neuropathic pain, amyotrophic lateral sclerosis, progressive muscle atrophy, multiple sclerosis, stroke, Alzheimer's disease, Parkinson's disease or HD. This study focuses on the effect of TMS on oxidative stress and neurogenesis in studies and its possible usefulness in HD.

[Relationship between genetic polymorphisms of 3 SNP loci in 5-HTT gene and paranoid schizophrenia].

PubMed

Xuan, Jin-Feng; Ding, Mei; Pang, Hao; Xing, Jia-Xin; Sun, Yi-Hua; Yao, Jun; Zhao, Yi; Li, Chun-Mei; Wang, Bao-Jie

2012-12-01

To investigate the population genetic data of 3 SNP loci (rs25533, rs34388196 and rs1042173) of 5-hydroxytryptamine transporter (5-HTT) gene and the association with paranoid schizophrenia. Three SNP loci of 5-HTT gene were examined in 132 paranoid schizophrenia patients and 150 unrelated healthy individuals of Northern Chinese Han population by PCR-RFLP technique. The Hardy-Weinberg equilibrium test was performed using the chi-square test and the data of haplotype frequency and population genetics parameters were statistically analyzed. Among these three SNP loci, four haplotypes were obtained. There were no statistically significant differences between the patient group and the control group (P > 0.05). The DP values of the 3 SNP loci were 0.276, 0.502 and 0.502. The PIC of them were 0.151, 0.281 and 0.281. The PE of them were 0.014, 0.072 and 0.072. The three SNP loci and four haplotypes of 5-HTT gene have no association with paranoid schizophrenia, while the polymorphism still have high potential application in forensic practice.

A dual-process account of auditory change detection.

PubMed

McAnally, Ken I; Martin, Russell L; Eramudugolla, Ranmalee; Stuart, Geoffrey W; Irvine, Dexter R F; Mattingley, Jason B

2010-08-01

Listeners can be "deaf" to a substantial change in a scene comprising multiple auditory objects unless their attention has been directed to the changed object. It is unclear whether auditory change detection relies on identification of the objects in pre- and post-change scenes. We compared the rates at which listeners correctly identify changed objects with those predicted by change-detection models based on signal detection theory (SDT) and high-threshold theory (HTT). Detected changes were not identified as accurately as predicted by models based on either theory, suggesting that some changes are detected by a process that does not support change identification. Undetected changes were identified as accurately as predicted by the HTT model but much less accurately than predicted by the SDT models. The process underlying change detection was investigated further by determining receiver-operating characteristics (ROCs). ROCs did not conform to those predicted by either a SDT or a HTT model but were well modeled by a dual-process that incorporated HTT and SDT components. The dual-process model also accurately predicted the rates at which detected and undetected changes were correctly identified.

Effects of oxidation on surface heterogeneity of carbosils

NASA Astrophysics Data System (ADS)

Charmas, B.; Leboda, R.; Gérard, G.; Villiéras, F.

2002-08-01

Carbon-silica adsorbents (carbosils), prepared by pyrolysis of methylene chloride (CH 2Cl 2) on the surface of a porous silica gel, were subjected to an oxidizing hydrothermal treatment (HTT) at 200 °C, using a hydrogen peroxide water solution as a modification medium. Conventional nitrogen adsorption volumetry and low-pressure argon and nitrogen adsorption techniques were used to analyze and compare textural properties and surface heterogeneity of initial and hydrothermally treated samples. In the presence of carbon, the mesoporous network of silica gel is protected from the massive collapse generally observed after oxidizing HTT. For carbosils, some changes occur during HTT, leading to a slight decrease of specific surface areas accompanied by an increase in mean mesopore size. The argon and nitrogen condensation energy distributions, derived from low-pressure adsorption experiments, indicate that both silica and pyrocarbon materials were modified during HTT. Depolymerization and recondensation processes occur for silica, creating new silica surfaces. These processes are responsible of the decrease in specific surface areas. For pyrocarbon, similar depolymerization and recondensation processes probably occur, creating new and high-energy surface sites.

Base-driven sunlight oxidation of silver nanoprisms for label-free visual colorimetric detection of hexahydro-1,3,5-trinitro-1,3,5-triazine explosive.

PubMed

He, Yi; Wang, Li

2017-05-05

Here we report a label-free method for visual colorimetric detection of hexahydro-1,3,5-trinitro-1,3,5-triazine (HTT) explosive based on base-driven sunlight oxidation of silver nanoprisms (AgNPRs). Under natural sunlight illumination, the surface plasmon of AgNPRs is excited, which populates O 2 antibonding orbitals to generate negative-ion state (O 2 - ). The resultant O 2 - with a strong oxidation activity can etch AgNPRs to smaller nanodisks with the aid of NaOH aqueous solution, leading to a blue shift of the absorption peak and color change from blue to pink. However, when HTT is introduced, the resultant O 2 - will be consumed by the nitrite and formaldehyde that are produced from the alkaline hydrolysis of HTT. Under this condition, the etching of AgNPRs does not occur, and the detection solution remains blue. This assay can sensitively detect as low as 1nM HTT, a level which is three orders of magnitude lower than that of gold nanoparticle-based colorimetric assays (2.6μM), and shows linearity in the range of 0.003-3.3μM. The lowest detectable concentration with the naked eye is 0.1μM. Additionally, the present assay exhibits good selectivity, and can be applied in the detection of HTT in natural water and soil samples with recoveries ranging from 90% to 100%. Copyright © 2017 Elsevier B.V. All rights reserved.

Serotonin transporter, 5-HT1A receptor, and behavior in DBA/2J mice in comparison with four inbred mouse strains.

PubMed

Popova, Nina K; Naumenko, Vladimir S; Tibeikina, Marina A; Kulikov, Alexander V

2009-12-01

Prepulse inhibition (PPI), the reduction in acoustic startle produced when it is preceded by a weak prepulse stimulus, is impaired in schizophrenic patients. The DBA/2J mouse strain displayed deficient PPI and is therefore suggested as an experimental animal model for the loss of sensorimotor gating in schizophrenia. Brain serotonin (5-HT) has been implicated in the pathophysiology of several psychiatric disorders, including major depressive disorder and schizophrenia. In the present study, behavior, 5-HT transporter (5-HTT) mRNA level, 5-HT(1A) receptor mRNA level, and 5-HT(1A) receptor density in the brain regions were studied in DBA/2J mice in comparison with four inbred mouse strains (CBA/Lac, C57BL/6, BALB/c, and ICR). A decrease in 5-HTT mRNA level in the midbrain and a reduced density of 5-HT(1A) receptors in the frontal cortex without significant changes in 5-HT(1A) receptor mRNA level in DBA/2J mice were found. It was shown that, along with decreased PPI, DBA/2J mice demonstrated considerably reduced immobility in the tail suspension test and in the forced swim test. No significant interstrain differences in intermale aggression, or in light-dark box and elevated plus-maze tests, were found. The results suggested the involvement of decreased 5-HTT gene expression and 5-HT(1A) receptor density in genetically defined PPI deficiency and showed a lack of any association between PPI deficiency and predisposition to aggressive, anxiety, and depressive-like behaviors. Copyright 2009 Wiley-Liss, Inc.

The influence of the serotonergic system on the personality and quality of life of postmenopausal women.

PubMed

Schneider-Matyka, Daria; Jurczak, Anna; Szkup, Małgorzata; Samochowiec, Agnieszka; Grzywacz, Anna; Wieder-Huszla, Sylwia; Grochans, Elżbieta

2017-01-01

The aim of this study was to establish the relationship between personality traits of postmenopausal women and the presence of the 44-bp VNTR polymorphism in the serotonin transporter (5-HTT) ( SLC6A4 ) promoter region and the 30-bp VNTR polymorphism in the MAO-A promoter region. The study's aim was also to determine the influence of personality traits on the quality of postmenopausal women's lives. The study involved 214 postmenopausal women from northwest Poland, with an average age of 56.8±4.08 years. It was performed using the Temperament and Character Inventory-Revised and the Short Form Health Survey. DNA polymorphisms were identified by means of polymerase chain reaction. Analysis demonstrated that the s/s genotype was significantly more common than the l/l genotype in women with higher fear of uncertainty. In a group with higher enlightened second nature and empathy, the l/s genotype was considerably more common than the l/l genotype. There were statistically significant associations between selected aspects of quality of life and personality traits such as enlightened second nature, transpersonal identification, purposefulness, and self-transcendence. The s/s genotype of the 44-bp VNTR polymorphism in the 5-HTT ( SLC6A4 ) promoter region may increase the tendency to avoid harm within the fear of uncertainty dimension. Carriers of this genotype may have predisposition to anxiety and depressive disorders. The l/s genotype of the 44-bp VNTR polymorphism in the 5-HTT ( SLC6A4 ) promoter region contributes to increased expression of enlightened second nature and empathy. Some personality traits may influence the quality of women's lives.

The influence of the serotonergic system on the personality and quality of life of postmenopausal women

PubMed Central

Schneider-Matyka, Daria; Jurczak, Anna; Szkup, Małgorzata; Samochowiec, Agnieszka; Grzywacz, Anna; Wieder-Huszla, Sylwia; Grochans, Elżbieta

2017-01-01

The aim of this study was to establish the relationship between personality traits of postmenopausal women and the presence of the 44-bp VNTR polymorphism in the serotonin transporter (5-HTT) (SLC6A4) promoter region and the 30-bp VNTR polymorphism in the MAO-A promoter region. The study’s aim was also to determine the influence of personality traits on the quality of postmenopausal women’s lives. The study involved 214 postmenopausal women from northwest Poland, with an average age of 56.8±4.08 years. It was performed using the Temperament and Character Inventory-Revised and the Short Form Health Survey. DNA polymorphisms were identified by means of polymerase chain reaction. Analysis demonstrated that the s/s genotype was significantly more common than the l/l genotype in women with higher fear of uncertainty. In a group with higher enlightened second nature and empathy, the l/s genotype was considerably more common than the l/l genotype. There were statistically significant associations between selected aspects of quality of life and personality traits such as enlightened second nature, transpersonal identification, purposefulness, and self-transcendence. The s/s genotype of the 44-bp VNTR polymorphism in the 5-HTT (SLC6A4) promoter region may increase the tendency to avoid harm within the fear of uncertainty dimension. Carriers of this genotype may have predisposition to anxiety and depressive disorders. The l/s genotype of the 44-bp VNTR polymorphism in the 5-HTT (SLC6A4) promoter region contributes to increased expression of enlightened second nature and empathy. Some personality traits may influence the quality of women’s lives. PMID:28670115

Huntingtin gene evolution in Chordata and its peculiar features in the ascidian Ciona genus

PubMed Central

Gissi, Carmela; Pesole, Graziano; Cattaneo, Elena; Tartari, Marzia

2006-01-01

Background To gain insight into the evolutionary features of the huntingtin (htt) gene in Chordata, we have sequenced and characterized the full-length htt mRNA in the ascidian Ciona intestinalis, a basal chordate emerging as new invertebrate model organism. Moreover, taking advantage of the availability of genomic and EST sequences, the htt gene structure of a number of chordate species, including the cogeneric ascidian Ciona savignyi, and the vertebrates Xenopus and Gallus was reconstructed. Results The C. intestinalis htt transcript exhibits some peculiar features, such as spliced leader trans-splicing in the 98 nt-long 5' untranslated region (UTR), an alternative splicing in the coding region, eight alternative polyadenylation sites, and no similarities of both 5' and 3'UTRs compared to homologs of the cogeneric C. savignyi. The predicted protein is 2946 amino acids long, shorter than its vertebrate homologs, and lacks the polyQ and the polyP stretches found in the the N-terminal regions of mammalian homologs. The exon-intron organization of the htt gene is almost identical among vertebrates, and significantly conserved between Ciona and vertebrates, allowing us to hypothesize an ancestral chordate gene consisting of at least 40 coding exons. Conclusion During chordate diversification, events of gain/loss, sliding, phase changes, and expansion of introns occurred in both vertebrate and ascidian lineages predominantly in the 5'-half of the htt gene, where there is also evidence of lineage-specific evolutionary dynamics in vertebrates. On the contrary, the 3'-half of the gene is highly conserved in all chordates at the level of both gene structure and protein sequence. Between the two Ciona species, a fast evolutionary rate and/or an early divergence time is suggested by the absence of significant similarity between UTRs, protein divergence comparable to that observed between mammals and fishes, and different distribution of repetitive elements. PMID:17092333

A positron emission tomography study of the serotonergic system in relation to anxiety in depression.

PubMed

Iscan, Zafer; Rakesh, Gopalkumar; Rossano, Samantha; Yang, Jie; Zhang, Mengru; Miller, Jeffrey; Sullivan, Gregory M; Sharma, Priya; McClure, Matthew; Oquendo, Maria A; Mann, J John; Parsey, Ramin V; DeLorenzo, Christine

2017-10-01

Symptoms of anxiety are highly comorbid with major depressive disorder (MDD) and are known to alter the course of the disease. To help elucidate the biological underpinnings of these prevalent disorders, we previously examined the relationship between components of anxiety (somatic, psychic and motoric) and serotonin 1A receptor (5-HT 1A ) binding in MDD and found that higher psychic and lower somatic anxiety was associated with greater 5-HT 1A binding. In this work, we sought to examine the correlation between these anxiety symptom dimensions and 5-HTT binding. Positron emission tomography with [ 11 C]-3-amino-4-(3-dimethylamino-methylphenylsulfanyl)-benzonitrile ([ 11 C]DASB) and a metabolite-corrected arterial input function were used to estimate regional 5-HTT binding in 55 subjects with MDD and anxiety symptoms. Somatic anxiety was negatively correlated with 5-HTT binding in the thalamus (β=-.33, p=.025), amygdala (β=-.31, p=.007) and midbrain (β=-.72, p<.001). Psychic anxiety was positively correlated with 5-HTT binding in midbrain only (β=.46, p=.0025). To relate to our previous study, correlation between 5-HT 1A and 5-HTT binding was examined, and none was found. We also examined how much of the variance in anxiety symptom dimensions could be explained by both 5-HTT and 5-HT 1A binding. The developed model was able to explain 68% (p<.001), 38% (p=.012) and 32% (p=.038) of the total variance in somatic, psychic, and motoric anxiety, respectively. Results indicate the tight coupling between the serotonergic system and anxiety components, which may be confounded when using aggregate anxiety measures. Uncovering serotonin's role in anxiety and depression in this way may give way to a new generation of therapeutics and treatment strategies. Copyright © 2017 Elsevier B.V. and ECNP. All rights reserved.

Toxicity and efficacy of salvage carbon 11-choline positron emission tomography/computed tomography-guided radiation therapy in patients with lymph node recurrence of prostate cancer.

PubMed

Fodor, Andrei; Berardi, Genoveffa; Fiorino, Claudio; Picchio, Maria; Busnardo, Elena; Kirienko, Margarita; Incerti, Elena; Dell'Oca, Italo; Cozzarini, Cesare; Mangili, Paola; Pasetti, Marcella; Calandrino, Riccardo; Gianolli, Luigi; Di Muzio, Nadia G

2017-03-01

To report the 3-year toxicity and outcomes of carbon 11 (11C)-choline-positron emission tomography (PET)/computed tomography (CT)-guided radiotherapy (RT), delivered via helical tomotherapy (HTT; Tomotherapy ® Hi-Art II ® Treatment System, Accuray Inc., Sunnyvale, CA, USA) after lymph node (LN) relapses in patients with prostate cancer. From January 2005 to March 2013, 81 patients with biochemical recurrence after surgery, with or without adjuvant/salvage RT or radical RT, and with evidence of LN 11C-choline-PET/CT pathological uptake, underwent HTT (median [range] prostate-specific antigen level 2.59 [0.61-187] ng/mL). Of the 81 patients, 72 were treated at the pelvic and/or lumbar-aortic LN chain with HTT at 51.8 Gy/28 fr and with simultaneous integrated boost to a median dose of 65.5 Gy on the pathological uptake sites detected by 11C-choline-PET/CT. Nine patients were treated without simultaneous integrated boost (50-65.5 Gy, 25-30 fr). With a median (range) follow-up of 36 (9-116) months, 91.4% of the patients had a PSA reduction 3 months after HTT. The 3-year overall, local relapse-free and clinical relapse-free survival rates were 80.0, 89.8 and 61.8%, respectively. The 3-year actuarial incidences of ≥grade 2 rectal and ≥grade 2 genitourinary toxicity were 6.6% (±2.9%) and 26.3% (±5.5%), respectively. A PSA nadir of ≥0.26 ng/mL (hazard ratio [HR] 3.6, 95% confidence interval [CI] 1.7-7.7; P = 0.001), extrapelvic 11C-choline-PET/CT-positive LN location (HR 2.4, 95% CI 0.9-6.4; P = 0.07), RT previous to HTT (HR 2.7; 95% CI 1.07-6.9, P = 0.04) and number of positive LNs (HR 1.13, 95% CI 1.04-1.22; P = 0.003) were the main predictors of clinical relapse after HTT. 11C-choline-PET/CT-guided HTT is safe and effective in the treatment of LN relapses of prostate cancer in previously treated patients. © 2016 The Authors BJU International © 2016 BJU International Published by John Wiley & Sons Ltd.

(11)C-Choline PET/CT as a guide to radiation treatment planning of lymph-node relapses in prostate cancer patients.

PubMed

Picchio, M; Berardi, G; Fodor, A; Busnardo, E; Crivellaro, C; Giovacchini, G; Fiorino, C; Kirienko, M; Incerti, E; Messa, C; Gianolli, L; Di Muzio, N

2014-07-01

To evaluate, in prostate cancer (PCa) patients the potential of (11)C-choline PET/CT as a guide to helical tomotherapy (HTT) of lymph-node (LN) relapses with simultaneous integrated boost (SIB). The efficacy and feasibility of HTT in terms of acute toxicity were assessed. We enrolled 83 PCa patients (mean age 68 years, range 51 - 82 years) with biochemical recurrence after radical primary treatment (mean serum PSA 7.61 ng/ml, range 0.37 - 187.00 ng/ml; PSA0) who showed pathological findings on (11)C-choline PET/CT only at the LN site. (11)C-Choline PET/CT was performed for restaging and then for radiation treatment planning (PET/CT0). Of the 83 patients, 8 experienced further LN relapse, of whom 5 were retreated once and 3 were retreated twice (total 94 radiotherapy treatments). All pelvic and/or abdominal LNs positive on PET/CT0 were treated with high doses using SIB. Doses were in the range 36 - 74 Gy administered in 28 fractions. After the end of HTT (mean 83 days, range 16 - 365 days), serum PSA was measured in all patients (PSA1) and compared with PSA0 to evaluate early biochemical response. In 47 patients PET/CT was repeated (PET/CT1) to assess metabolic responses at the treated areas. Toxicity criteria of the Radiation Therapy Oncology Group (RTOG) were used to assess acute toxicity. PET/CT0 revealed pathological LNs in the pelvis in 49 patients, pathological LNs in the abdomen in 15 patients pathological LNs in both the pelvis and abdomen in 18 patients, and pathological LNs in the pelvis or abdomen and other sites in 12 patients. All these sites were treated with HTT. With respect to PSA0, PSA1 (mean 6.28 ng/ml, range 0.00 - 220.46 ng/ml) showed a complete biochemical response after 66 of the 94 HTT treatments, a partial response after 12 treatments, stable disease after 1 treatment and progression of disease after 15 treatments. Of the 47 patients receiving PET/CT1, 20 showed a complete metabolic response at the treated area, 22 a partial metabolic response, 3 progression of disease and 2 stable disease. HTT with SIB was well tolerated in all patients. Grade 3 acute toxicity in the genitourinary tract was observed in two patients. (11)C-Choline PET/CT is a valuable tool for planning and monitoring HTT in LN relapse after primary treatment. High-dose hypofractionated (11)C-choline PET/CT-guided HTT with SIB is well tolerated and is associated with a high early biochemical response rate.

Application of hybrid organic/inorganic polymers as coatings on metallic substrates

NASA Astrophysics Data System (ADS)

Augustinho, T. R.; Motz, G.; Ihlow, S.; Machado, R. A. F.

2016-09-01

Acrylic polymers, particularly poly (methyl methacrylate) (PMMA), have certain specific properties, such as good film formation, transparency, and good mechanical properties, which have been widely used in paints, coatings and adhesives. However, the limited chemical and physical stability of these pure polymers limits their applications when exposed to hostile conditions, as in ship hulls, for example. A suitable way to enhance PMMA properties is the addition of silicon polymers with very good protective characteristics. In this study, a PMMA and HTT 1800 (commercial silazane) copolymer were applied on metallic substrate and compared to pure PMMA and HTT 1800. All the materials were applied as coatings. They were applied on stainless steel via dip-coating to investigate the coating properties. Thermal cycling was employed to analyze coating durability at high temperatures (50 °C to 600 °C). Optical microscopy (OM) and scanning electron microscopy (SEM) were used to characterize the coated surfaces, and the adhesion of pure PMMA, pure HTT 1800 and PMMA/HTT 1800 coatings on metallic substrate was investigated by Cross-Cut-Test (ASTM D 3359). The sessile drop method was used to determine the contact angle. PMMA coatings presented complete degradation from 250 °C, while hybrid coatings of PMMA and HTT 1800 have good protection until 400 °C. The adherence of the coating on metallic substrate showed improvement in all synthesized materials when compared to pure PMMA, obtaining the best adherence possible. The contact angle test showed that the hydrophobicity of the hybrid coatings is higher than that of the pure coatings.

Huntington disease in the South African population occurs on diverse and ethnically distinct genetic haplotypes

PubMed Central

Baine, Fiona K; Kay, Chris; Ketelaar, Maria E; Collins, Jennifer A; Semaka, Alicia; Doty, Crystal N; Krause, Amanda; Jacquie Greenberg, L; Hayden, Michael R

2013-01-01

Huntington disease (HD) is a neurodegenerative disorder resulting from the expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene. Worldwide prevalence varies geographically with the highest figures reported in populations of European ancestry. HD in South Africa has been reported in Caucasian, black and mixed subpopulations, with similar estimated prevalence in the Caucasian and mixed groups and a lower estimate in the black subpopulation. Recent studies have associated specific HTT haplotypes with HD in distinct populations. Expanded HD alleles in Europe occur predominantly on haplogroup A (specifically high-risk variants A1/A2), whereas in East Asian populations, HD alleles are associated with haplogroup C. Whether specific HTT haplotypes associate with HD in black Africans and how these compare with haplotypes found in European and East Asian populations remains unknown. The current study genotyped the HTT region in unaffected individuals and HD patients from each of the South African subpopulations, and haplotypes were constructed. CAG repeat sizes were determined and phased to haplotype. Results indicate that HD alleles from Caucasian and mixed patients are predominantly associated with haplogroup A, signifying a similar European origin for HD. However, in black patients, HD occurs predominantly on haplogroup B, suggesting several distinct origins of the mutation in South Africa. The absence of high-risk variants (A1/A2) in the black subpopulation may also explain the reported low prevalence of HD. Identification of haplotypes associated with HD-expanded alleles is particularly relevant to the development of population-specific therapeutic targets for selective suppression of the expanded HTT transcript. PMID:23463025

Hydrothermal time models for conidial germination and mycelial growth of the seed pathogen Pyrenophora semeniperda

Treesearch

Connor W. Barth; Susan E. Meyer; Julie Beckstead; Phil S. Allen

2015-01-01

Population-based threshold models using hydrothermal time (HTT) have been widely used to model seed germination. We used HTT to model conidial germination and mycelial growth for the seed pathogen Pyrenophora semeniperda in a novel approach to understanding its interactions with host seeds. Germination time courses and mycelial growth rates for P.semeniperda were...

Loss of thalamic serotonin transporters in early drug-naïve Parkinson’s disease patients is associated with tremor: an [123I]β-CIT SPECT study

PubMed Central

Stoffers, D.; Winogrodzka, A.; Isaias, I.-U.; Costantino, G.; Pezzoli, G.; Ferrarese, C.; Antonini, A.; Wolters, E.-Ch.; Booij, J.

2008-01-01

In vitro studies revealed serotonin transporter (5-HTT) decline in Parkinson’s disease (PD). Yet, few studies investigated thalamic 5-HTT in vivo and its effect on PD heterogeneity. We analyzed thalamic [123I]β-CIT binding (mainly reflecting 5-HTT binding) in 32 drug-naïve PD patients and 13 controls with SPECT. Twenty-six patients were examined twice (17 months apart). Based on UPDRS scores, we identified subgroups of patients with moderate/severe tremor (PDT) and without tremor (PDWT) at the time of clinical diagnosis. Additionally, depressive symptoms were evaluated using the Beck Depression Inventory (BDI) at baseline. Mean thalamic specific to non-specific [123I]β-CIT binding ratio was lower in patients when compared to controls, and further decreased during follow-up. At baseline, average thalamic ratio was significantly lower in the PDT than in the PDWT subgroup. No correlation was found between BDI scores and thalamic binding ratios. Our findings show decline of [123I]β-CIT binding to thalamic 5-HTT in PD and its possible contribution to tremor onset. PMID:18335163

Role of CB2 receptors in social and aggressive behavior in male mice.

PubMed

Rodríguez-Arias, Marta; Navarrete, Francisco; Blanco-Gandia, M Carmen; Arenas, M Carmen; Aguilar, María A; Bartoll-Andrés, Adrián; Valverde, Olga; Miñarro, José; Manzanares, Jorge

2015-08-01

Male CB1KO mice exhibit stronger aggressive responses than wild-type mice. This study was designed to examine the role of cannabinoid CB2r in social and aggressive behavior. The social interaction test and resident-intruder paradigm were performed in mice lacking CB2r (CB2KO) and in wild-type (WT) littermates. The effects of the CB2r selective agonist JWH133 (1 and 2 mg/kg) on aggression were also evaluated in Oncins France 1 (OF1) mice. Gene expression analyses of monoamine oxidase-A (MAO-A), catechol-o-methyltransferase (COMT), 5-hydroxytryptamine transporter (5-HTT), and 5-HT1B receptor (5HT1Br) in the dorsal raphe nuclei (DR) and the amygdala (AMY) were carried out using real-time PCR. Group-housed CB2KO mice exhibited higher levels of aggression in the social interaction test and displayed more aggression than resident WT mice. Isolation increased aggressive behavior in WT mice but did not affect CB2KO animals; however, the latter mice exhibited higher levels of social interaction with their WT counterparts. MAO-A and 5-HTT gene expression was significantly higher in grouped CB2KO mice. The expression of 5HT1Br, COMT, and MAO-A in the AMY was more pronounced in CB2KO mice than in WT counterparts. Acute administration of the CB2 agonist JWH133 significantly reduced the level of aggression in aggressive isolated OF1 mice, an effect that decreased after pretreatment with the CB2 receptor antagonist AM630. Our results suggest that CB2r is implicated in social interaction and aggressive behavior and deserves further consideration as a potential new target for the management of aggression.

Using hydrothermal time concepts to model seed germination response to temperature, dormancy loss, and priming effects in Elymus elymoides

Treesearch

Susan E. Meyer; Susan B. Debaene-Gill; Phil S. Allen

2000-01-01

Hydrothermal time (HTT) describes progress toward seed germination under various combinations of incubation water potential ( ) and temperature (T). To examine changes in HTT parameters during dormancy loss, seeds from two populations of the bunchgrass Elymus elymoides were incubated under seven temperature regimes following dry storage at 10, 20 and 30°C for intervals...

The effects of smoking and nicotine ingestion on exercise heat tolerance.

PubMed

Druyan, Amit; Atias, Danit; Ketko, Itay; Cohen-Sivan, Yoav; Heled, Yuval

2017-03-01

Smoking has a thermogenic effect and is associated with low physical performance. Nevertheless, a direct, quantitative effect of acute smoking on exercise heat tolerance has not been reported. Sixteen healthy young male volunteers, eight cigarette smokers, and eight non-smokers participated in the study. All subjects performed a maximal oxygen consumption test (VO2max) and a standardized heat tolerance test (HTT) after at least 12 h without smoking under the following conditions: no nicotine exposure, 10 min after nicotine exposure (2 mg nicotine lozenge), and 10 min after smoking two cigarettes (0.8 mg nicotine in each cigarette, smokers only). There was no significant effect of nicotine exposure on physiological performance and heat tolerance in the non-smokers group. In the smokers group, cigarette smoking, but not nicotine ingestion, resulted with higher heart rate (by 9±9 bpm) at the end of the HTT (p<0.05). Moreover, both smoking and nicotine ingestion increased smokers' rectal temperature at the end of the HTT (by 0.24±0.16°C and 0.21±0.26°C, respectively, p<0.05) and were associated with higher sweat rate during the HTT (by 0.08±0.07 g/h and 0.06±0.08 g/h, respectively, p<0.05). Heart rate variability (HRV) analysis also revealed a higher LF/HF (low frequency/high frequency) ratio after exposure to nicotine and smoking in the smokers group compared with no exposure (2.13±2.57 and 2.48±2.76, respectively, p<0.05), indicating a higher sympathetic tone. According to this preliminary study, cigarette smoking and nicotine ingestion increase the physiological strain during a HTT in smokers. Acute smoking may, therefore, increase heat intolerance and the risk to heat injuries.

Temperament, character and serotonin activity in the human brain: a positron emission tomography study based on a general population cohort.

PubMed

Tuominen, L; Salo, J; Hirvonen, J; Någren, K; Laine, P; Melartin, T; Isometsä, E; Viikari, J; Cloninger, C R; Raitakari, O; Hietala, J; Keltikangas-Järvinen, L

2013-04-01

The psychobiological model of personality by Cloninger and colleagues originally hypothesized that interindividual variability in the temperament dimension 'harm avoidance' (HA) is explained by differences in the activity of the brain serotonin system. We assessed brain serotonin transporter (5-HTT) density in vivo with positron emission tomography (PET) in healthy individuals with high or low HA scores using an 'oversampling' study design. Method Subjects consistently in either upper or lower quartiles for the HA trait were selected from a population-based cohort in Finland (n = 2075) with pre-existing Temperament and Character Inventory (TCI) scores. A total of 22 subjects free of psychiatric and somatic disorders were included in the matched high- and low-HA groups. The main outcome measure was regional 5-HTT binding potential (BPND) in high- and low-HA groups estimated with PET and [11C]N,N-dimethyl-2-(2-amino-4-methylphenylthio)benzylamine ([11C]MADAM). In secondary analyses, 5-HTT BPND was correlated with other TCI dimensions. 5-HTT BPND did not differ between high- and low-HA groups in the midbrain or any other brain region. This result remained the same even after adjusting for other relevant TCI dimensions. Higher 5-HTT BPND in the raphe nucleus predicted higher scores in 'self-directedness'. This study does not support an association between the temperament dimension HA and serotonin transporter density in healthy subjects. However, we found a link between high serotonin transporter density and high 'self-directedness' (ability to adapt and control one's behaviour to fit situations in accord with chosen goals and values). We suggest that biological factors are more important in explaining variability in character than previously thought.

Integrating Aggregate Exposure Pathway (AEP) and Adverse ...

EPA Pesticide Factsheets

High throughput toxicity testing (HTT) holds the promise of providing data for tens of thousands of chemicals that currently have no data due to the cost and time required for animal testing. Interpretation of these results require information linking the perturbations seen in vitro with adverse outcomes in vivo and requires knowledge of how estimated exposure to the chemicals compare to the in vitro concentrations that show an effect. This abstract discusses how Adverse Outcome Pathways (AOPs) can be used to link HTT with adverse outcomes of regulatory significance and how Aggregate Exposure Pathways (AEPs) can connect concentrations of environment stressors at a source with an expected target site concentration designed to provide exposure estimates that are comparable to concentrations identified in HTT. Presentation at the ICCA-LRI and JRC Workshop: Fit-For-Purpose Exposure Assessment For Risk-Based Decision Making

Eicosapentaenoic and docosahexaenoic acids have different effects on peripheral phospholipase A2 gene expressions in acute depressed patients.

PubMed

Su, Kuan-Pin; Yang, Hui-Ting; Chang, Jane Pei-Chen; Shih, Yin-Hua; Guu, Ta-Wei; Kumaran, Satyanarayanan Senthil; Gałecki, Piotr; Walczewska, Anna; Pariante, Carmine M

2018-01-03

Omega-3 polyunsaturated fatty acids (PUFAs) have been proven critical in the development and management of major depressive disorder (MDD) by a number of epidemiological, clinical and preclinical studies, but the molecular mechanisms underlying this therapeutic action are yet to be understood. Although eicosapentaenoic acid (EPA) seems to be the active component of omega-3 PUFAs' antidepressant effects, the biological research about the difference of specific genetic regulations between EPA and docosahexaenoic acid (DHA), the two main components of omega-3 PUFAs, is still lacking in human subjects. We conducted a 12-week randomized-controlled trial comparing the effects of EPA and DHA on gene expressions of phospholipase A2 (cPLA2) and cyclooxygenase-2 (COX2), serotonin transporter (5HTT), and Tryptophan hydroxylase 2 (TPH-2) in 27 MDD patients. In addition, the erythrocyte PUFA compositions and the candidate gene expressions were also compared between these 27 MDD patients and 22 healthy controls. EPA was associated with a significant decrease in HAM-D scores (CI: -13 to -21, p<0.001) and significant increases in erythrocyte levels of EPA (CI: +1.0% to +2.9%, p=0.001) and DHA (CI: +2.9% to +5.6%, p=0.007). DHA treatment was associated with a significant decrease in HAM-D scores (CI: -6 to -14, p<0.001) and a significant increase in DHA levels (CI: +0.2% to +2.3%, p=0.047), but not of EPA levels. The cPLA2 gene expression levels were significantly increased in patients received EPA (1.9 folds, p=0.038), but not DHA (1.08 folds, p=0.92). There was a tendency for both EPA and DHA groups to decrease COX-2 gene expressions. The gene expressions of COX-2, cPLA2, TPH-2 and 5-HTT did not differ between MDD cases and healthy controls. EPA differentiates from DHA in clinical antidepressant efficacy and in upregulating cPLA2 gene regulations, which supports the clinical observation showing the superiority of EPA's antidepressant effects. ClinicalTrials.gov identifier: NCT02615405. Copyright © 2017 Elsevier Inc. All rights reserved.

Stress-induced activation of the brainstem Bcl-xL gene expression in rats treated with fluoxetine: correlations with serotonin metabolism and depressive-like behavior.

PubMed

Shishkina, Galina T; Kalinina, Tatyana S; Berezova, Inna V; Dygalo, Nikolay N

2012-01-01

Mechanisms underlying stress-induced depression and antidepressant drug action were shown to involve alterations in serotonergic (5-HT) neurotransmission and expression of genes coding for proteins associated with neurotrophic signaling pathways and cell-survival in the hippocampus and cortex. Expression of these genes in the brainstem containing 5-HT neurons may also be related to vulnerability or resilience to stress-related psychopathology. Here we investigated 5-HT markers and expression of genes for Brain-Derived Neurotrophic Factor (BDNF) and apoptotic proteins in the brainstem in relation to swim stress-induced behavioral despair. We found that anti-apoptotic Bcl-xL gene is sensitive to stress during the course of fluoxetine administration. Responsiveness of this gene to stress appeared concomitantly with an antidepressant-like effect of fluoxetine in the forced swim test. Bcl-xL transcript levels showed negative correlations with duration of immobility in the test and 5-HT turnover in the brainstem. In contrast, BDNF and pro-apoptotic protein Bax mRNA levels were unchanged by either fluoxetine or stress, suggesting specificity of Bcl-xL gene responses to these treatments. We also found that the levels of mRNAs for tryptophan hydroxylase-2 (TPH2) and 5-HT transporter (5-HTT) were significantly down-regulated following prolonged treatment with fluoxetine, but were not affected by stress. Unlike TPH2 and 5-HTT, 5-HT1A receptor mRNA levels were not altered by fluoxetine but significantly increased in response to swim stress. These data show that long-term fluoxetine treatment leads to changes in 5-HT and Bcl-xL responses to stress associated with antidepressant-like effects of the drug. This article is part of a Special Issue entitled 'Anxiety and Depression'. Copyright © 2011 Elsevier Ltd. All rights reserved.

Impact of Institutional Care on Attachment Disorganization and Insecurity of Ukrainian Preschoolers: Protective Effect of the Long Variant of the Serotonin Transporter Gene (5HTT)

ERIC Educational Resources Information Center

Bakermans-Kranenburg, Marian J.; Dobrova-Krol, Natasha; van IJzendoorn, Marinus

2012-01-01

Institutional care has been shown to lead to insecure and disorganized attachments and indiscriminate friendliness. Some children, however, are surprisingly resilient to the adverse environment. Here the protective role of the long variant of the serotonin receptor gene (5HTT) is explored in a small hypothesis-generating study of 37 Ukrainian…

The Human Terrain System: Achieving a Competitive Advantage Through Enhanced Population-Centric Knowledge Flows

DTIC Science & Technology

2008-09-01

of behavior ( Fetterman , 1998, p. 35). Moreover, the goal of the participating observer is to internalize fundamental “beliefs, fears, hopes and...expectations of the people under study” ( Fetterman , 1998, p. 35). Additionally, HTT members frequently conduct informal interviews (open ended casual...techniques, and questionnaires ( Fetterman , 1998, p. 35). The third principle method HTT members use to learn the population is the semi- structured

Modification of crystal anisotropy and enhancement of magnetic moment of Co-doped SnO2 thin films annealed under magnetic field

PubMed Central

2014-01-01

Co-doped SnO2 thin films were grown by sputtering technique on SiO2/Si(001) substrates at room temperature, and then, thermal treatments with and without an applied magnetic field (HTT) were performed in vacuum at 600°C for 20 min. HTT was applied parallel and perpendicular to the substrate surface. Magnetic M(H) measurements reveal the coexistence of a strong antiferromagnetic (AFM) signal and a ferromagnetic (FM) component. The AFM component has a Néel temperature higher than room temperature, the spin axis lies parallel to the substrate surface, and the highest magnetic moment m =7 μB/Co at. is obtained when HTT is applied parallel to the substrate surface. Our results show an enhancement of FM moment per Co+2 from 0.06 to 0.42 μB/Co at. for the sample on which HTT was applied perpendicular to the surface. The FM order is attributed to the coupling of Co+2 ions through electrons trapped at the site of oxygen vacancies, as described by the bound magnetic polaron model. Our results suggest that FM order is aligned along [101] direction of Co-doped SnO2 nanocrystals, which is proposed to be the easy magnetization axis. PMID:25489286

Environmental surveillance and monitoring. The next frontiers ...

EPA Pesticide Factsheets

High throughput toxicity testing (HTT) technologies along with the world-wide web are revolutionizing both generation and access to data regarding the bioactivities that chemicals can elicit when they interact with specific proteins, genes, or other targets in the body of an organism. However, to date, most of the focus has been on the application of such data to assessment of individual chemicals. We suggest that environmental surveillance and monitoring represent the next frontiers for HTT. Resources already exist in curated databases of chemical-biological interactions, including highly standardized quantitative dose-response data generated from nascent HTT programs like ToxCast and Tox21, to link chemicals detected through environmental analytical chemistry to known biological activities. The emergence of the adverse outcome pathway framework and associated knowledgebase for linking molecular or pathway-level perturbations of biological systems to adverse outcomes traditionally considered in risk assessment and regulatory decision-making through a series of measureable biological changes provides a critical link between activity and hazard. Furthermore, environmental samples can be directly analyzed via HTT platforms to provide an unprecedented breadth of biological activity characterization that integrates the effects of all compounds present in a mixture, whether known or not. Novel application of these chemical-biological interaction data provide an oppor

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain

PubMed Central

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A.; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-01-01

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology. PMID:24381309

TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain.

PubMed

Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

2014-05-15

Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology.

A Fiber-Optic Probe Design for Combustion Chamber Flame Detection Applications-Design Criteria, Performance Specifications, and Fabrication Technique

NASA Technical Reports Server (NTRS)

Borg, Stephen E.; Harper, Samuel E.

2001-01-01

This paper documents the design and development of the fiber-optic probes utilized in the flame detection systems used in NASA Langley Research Center's 8-Foot High Temperature Tunnel (8-ft HTT). Two independent flame detection systems are utilized to monitor the presence and stability of the main-burner and pilot-level flames during facility operation. Due to the harsh environment within the combustor, the successful development of a rugged and efficient fiber-optic probe was a critical milestone in the development of these flame detection systems. The final optical probe design for the two flame detection systems resulted from research that was conducted in Langley's 7-in High Temperature Pilot Tunnel (7-in HTT). A detailed description of the manufacturing process behind the optical probes used in the 8-ft HTT is provided in Appendix A of this report.

BACHD rats expressing full-length mutant huntingtin exhibit differences in social behavior compared to wild-type littermates

PubMed Central

Manfré, Giuseppe; Novati, Arianna; Faccini, Ilaria; Rossetti, Andrea C.; Bosch, Kari; Molteni, Raffaella; Riva, Marco A.; Van der Harst, Johanneke E.; Homberg, Judith R.

2018-01-01

Background Huntington disease (HD) is a devastating inherited neurodegenerative disorder characterized by progressive motor, cognitive, and psychiatric symptoms without any cure to slow down or stop the progress of the disease. The BACHD rat model for HD carrying the human full-length mutant huntingtin protein (mHTT) with 97 polyQ repeats has been recently established as a promising model which reproduces several HD-like features. While motor and cognitive functions have been characterized in BACHD rats, little is known about their social phenotype. Objective This study focuses especially on social behavior since evidence for social disturbances exists in human patients. Our objective was to compare social behavior in BACHD and wild-type (WT) rats at different ages, using two different measures of sociability. Methods Animals were tested longitudinally at the age of 2, 4 and 8 months in the social interaction test to examine different parameters of sociability. A separate cohort of 7 month old rats was tested in the three chamber social test to measure both sociability and social novelty. Gene expression analyses in 8 months old animals were performed by real time qRT-PCR to evaluate a potential involvement of D1 and D2 dopaminergic receptors and the contribution of Brain-derived neurotrophic factor (BDNF) to the observed behavioral alterations. Results In the social interaction test, BACHD rats showed age-dependent changes in behaviour when they were-re introduced to their cagemate after a 24 hours-period of individual housing. The time spent on nape attacks increased with aging. Furthermore, a significant higher level of pinning at 2 months of age was shown in the BACHD rats compared to wild-types, followed by a reduction at 4 and 8 months. On the other hand, BACHD rats exhibited a decreased active social behaviour compared to wild-types, reflected by genotype-effects on approaching, following and social nose contact. In the three chamber social test, BACHD rats seemed to show a mild deficit in preference for social novelty, but no changes in social interest. Molecular analyses revealed that BACHD animals exposed to the social interaction test displayed decreased mRNA levels of the total form of BDNF in ventral striatum and unaltered striatal expression of D1 and D2 dopamine receptors. Conclusions Taken together, these results indicate deficits in several parameters representative of sociability. Altered BDNF expression in the ventral striatum may contribute to the deficits in sociability in 8 months old BACHD rats. These data support the validity of the BACHD rat model in mimicking features of certain social deficits that could be relevant to symptoms in patients. PMID:29415038

Simvastatin mitigates functional and structural impairment of lung and right ventricle in a rat model of cigarette smoke-induced COPD.

PubMed

Wang, Yajie; Jiang, Xue; Zhang, Lihai; Wang, Lihong; Li, Zhu; Sun, Wuzhuang

2014-01-01

This study is conducted to investigate an effect of simvastatin on cigarette smoke-induced COPD. Rats were exposed to air (control) and cigarette smoke (smoking) in presence and absence of simvastatin. Heart and lung tissues were harvested for histopathologic and morphometric analysis. Body weight of rat, mean liner intercept (MLI), mean alveolar number (MAN), lung function test, mean pulmonary artery pressure (mPAP), right ventricular hypertrophy index (RVHI) and 5-HTT level in serum and BALF were examined in experimental rats, respectively. Application of simvastatin mitigated peribronchiolar inflammation and pulmonary bullae formed in the smoke-exposed lungs with weight gain as compared to the smoking rats (P < 0.05). Simvastatin-treated rats showed slight but significant decreases in MLI and MAN with a partial reversal of lung function decline (all P < 0.05). Treatment with simvastatin resulted in a significant decrease not only in mPAP and RVHI but also in a 5-HTT level in serum and BALF (P < 0.01 or 0.05) with a good correlation between the 5-HTT level and mPAP or RVHI (r = 0.693 and 0.479; 0.675 and 0.508). Simvastatin partly reverses lung function decline and attenuates structural impairments of lung and right ventricle possibly through reducing 5-HTT content in the model of COPD.

Simvastatin mitigates functional and structural impairment of lung and right ventricle in a rat model of cigarette smoke-induced COPD

PubMed Central

Wang, Yajie; Jiang, Xue; Zhang, Lihai; Wang, Lihong; Li, Zhu; Sun, Wuzhuang

2014-01-01

Objectives: This study is conducted to investigate an effect of simvastatin on cigarette smoke-induced COPD. Methods: Rats were exposed to air (control) and cigarette smoke (smoking) in presence and absence of simvastatin. Heart and lung tissues were harvested for histopathologic and morphometric analysis. Body weight of rat, mean liner intercept (MLI), mean alveolar number (MAN), lung function test, mean pulmonary artery pressure (mPAP), right ventricular hypertrophy index (RVHI) and 5-HTT level in serum and BALF were examined in experimental rats, respectively. Results: Application of simvastatin mitigated peribronchiolar inflammation and pulmonary bullae formed in the smoke-exposed lungs with weight gain as compared to the smoking rats (P < 0.05). Simvastatin-treated rats showed slight but significant decreases in MLI and MAN with a partial reversal of lung function decline (all P < 0.05). Treatment with simvastatin resulted in a significant decrease not only in mPAP and RVHI but also in a 5-HTT level in serum and BALF (P < 0.01 or 0.05) with a good correlation between the 5-HTT level and mPAP or RVHI (r = 0.693 and 0.479; 0.675 and 0.508). Conclusion: Simvastatin partly reverses lung function decline and attenuates structural impairments of lung and right ventricle possibly through reducing 5-HTT content in the model of COPD. PMID:25674219

The Unexpected Effects of Beneficial and Adverse Social Experiences during Adolescence on Anxiety and Aggression and Their Modulation by Genotype

PubMed Central

Meyer, Neele; Richter, S. Helene; Schreiber, Rebecca S.; Kloke, Vanessa; Kaiser, Sylvia; Lesch, Klaus-Peter; Sachser, Norbert

2016-01-01

Anxiety and aggression are part of the behavioral repertoire of humans and animals. However, in their exaggerated form both can become maladaptive and result in psychiatric disorders. On the one hand, genetic predisposition has been shown to play a crucial modulatory role in anxiety and aggression. On the other hand, social experiences have been implicated in the modulation of these traits. However, so far, mainly experiences in early life phases have been considered crucial for shaping anxiety-like and aggressive behavior, while the phase of adolescence has largely been neglected. Therefore, the aim of the present study was to elucidate how levels of anxiety-like and aggressive behavior are shaped by social experiences during adolescence and serotonin transporter (5-HTT) genotype. For this purpose, male mice of a 5-HTT knockout mouse model including all three genotypes (wildtype, heterozygous and homozygous 5-HTT knockout mice) were either exposed to an adverse social situation or a beneficial social environment during adolescence. This was accomplished in a custom-made cage system where mice experiencing the adverse environment were repeatedly introduced to the territory of a dominant opponent but had the possibility to escape to a refuge cage. Mice encountering beneficial social conditions had free access to a female mating partner. Afterwards, anxiety-like and aggressive behavior was assessed in a battery of tests. Surprisingly, unfavorable conditions during adolescence led to a decrease in anxiety-like behavior and an increase in exploratory locomotion. Additionally, aggressive behavior was augmented in animals that experienced social adversity. Concerning genotype, homozygous 5-HTT knockout mice were more anxious and less aggressive than heterozygous 5-HTT knockout and wildtype mice. In summary, adolescence is clearly an important phase in which anxiety-like and aggressive behavior can be shaped. Furthermore, it seems that having to cope with challenge during adolescence instead of experiencing throughout beneficial social conditions leads to reduced levels of anxiety-like behavior. PMID:27303275

Size distribution of carbon layer planes in biochar from different plant type of feedstock with different heating temperatures.

PubMed

Lu, Guan-Yang; Ikeya, Kosuke; Watanabe, Akira

2016-11-01

Biochar application to soil is a strategy to decelerate the increase in the atmospheric carbon concentration. The composition of condensed aromatic clusters appears to be an important determinant of the degradation rate of char in soil. The objective of the present study was to determine the size distribution of carbon layer planes in biochars produced from different types of feedstock (a broadleaf and a coniferous tree and two herbs) using different heating treatment temperatures (HTT; 400 °C-800 °C) using X-ray diffraction 11 band profile analysis. (13)C nuclear magnetic resonance with the phase-adjusted spinning side bands of the chars indicated different spectral features depending on the HTT and similar carbon composition among the plant types at each HTT. Both the content and composition of carbon layer planes in biochar produced using the same HTT were also similar among the plant types. The carbon layer plane size in the 400 °C and 600 °C chars was distributed from 0.24 to 1.68 or 1.92 nm (corresponding to 37 or 52 rings) with the mean size of 0.79-0.92 and 0.80-1.14 nm, respectively. The carbon layer planes in the 800 °C chars ranged from 0.72-0.96 nm (7-14 rings) to 2.64-3.60 nm (91-169 rings) and the mean values were 1.47-1.89 nm. The relative carbon layer plane content in the 600 °C and 800 °C chars was typically 2 and 3 times that in the 400 °C chars. These results indicate the progression of the formation and/or the size development of graphite-like structures, suggesting that a char produced at a higher HTT would have better carbon sequestrating characteristics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Partially Defective Store Operated Calcium Entry and Hem(ITAM) Signaling in Platelets of Serotonin Transporter Deficient Mice

PubMed Central

Wolf, Karen; Braun, Attila; Haining, Elizabeth J.; Tseng, Yu-Lun; Kraft, Peter; Schuhmann, Michael K.; Gotru, Sanjeev K.; Chen, Wenchun; Hermanns, Heike M.; Stoll, Guido; Lesch, Klaus-Peter; Nieswandt, Bernhard

2016-01-01

Background Serotonin (5-hydroxytryptamin, 5-HT) is an indolamine platelet agonist, biochemically derived from tryptophan. 5-HT is secreted from the enterochromaffin cells into the gastrointestinal tract and blood. Blood 5-HT has been proposed to regulate hemostasis by acting as a vasoconstrictor and by triggering platelet signaling through 5-HT receptor 2A (5HTR2A). Although platelets do not synthetize 5-HT, they take 5-HT up from the blood and store it in their dense granules which are secreted upon platelet activation. Objective To identify the molecular composite of the 5-HT uptake system in platelets and elucidate the role of platelet released 5-HT in thrombosis and ischemic stroke. Methods: 5-HT transporter knockout mice (5Htt-/-) were analyzed in different in vitro and in vivo assays and in a model of ischemic stroke. Results In 5Htt-/- platelets, 5-HT uptake from the blood was completely abolished and agonist-induced Ca2+ influx through store operated Ca2+ entry (SOCE), integrin activation, degranulation and aggregation responses to glycoprotein VI (GPVI) and C-type lectin-like receptor 2 (CLEC-2) were reduced. These observed in vitro defects in 5Htt-/- platelets could be normalized by the addition of exogenous 5-HT. Moreover, reduced 5-HT levels in the plasma, an increased bleeding time and the formation of unstable thrombi were observed ex vivo under flow and in vivo in the abdominal aorta and carotid artery of 5Htt-/- mice. Surprisingly, in the transient middle cerebral artery occlusion (tMCAO) model of ischemic stroke 5Htt-/- mice showed nearly normal infarct volume and the neurological outcome was comparable to control mice. Conclusion Although secreted platelet 5-HT does not appear to play a crucial role in the development of reperfusion injury after stroke, it is essential to amplify the second phase of platelet activation through SOCE and plays an important role in thrombus stabilization. PMID:26800051

Differentially expressed genes in the ovary of the sixth day of pupal "Ming" lethal egg mutant of silkworm, Bombyx mori.

PubMed

Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng

2013-09-15

The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Serotonin transporter gene and childhood trauma--a G × E effect on anxiety sensitivity.

PubMed

Klauke, Benedikt; Deckert, Jürgen; Reif, Andreas; Pauli, Paul; Zwanzger, Peter; Baumann, Christian; Arolt, Volker; Glöckner-Rist, Angelika; Domschke, Katharina

2011-12-21

Genetic factors and environmental factors are assumed to interactively influence the pathogenesis of anxiety disorders. Thus, a gene-environment interaction (G × E) study was conducted with respect to anxiety sensitivity (AS) as a promising intermediate phenotype of anxiety disorders. Healthy subjects (N = 363) were assessed for AS, childhood maltreatment (Childhood Trauma Questionnaire), and genotyped for functional serotonin transporter gene variants (5-HTTLPR/5-HTT rs25531). The influence of genetic and environmental variables on AS and its subdimensions was determined by a step-wise hierarchical regression and a multiple indicator multiple cause (MIMIC) model. A significant G × E effect of the more active 5-HTT genotypes and childhood maltreatment on AS was observed. Furthermore, genotype (LL)-childhood trauma interaction particularly influenced somatic AS subdimensions, whereas cognitive subdimensions were affected by childhood maltreatment only. Results indicate a G × E effect of the more active 5-HTT genotypes and childhood maltreatment on AS, with particular impact on its somatic subcomponent. © 2011 Wiley Periodicals, Inc.

Coordination preference and magnetic properties of FeII assemblies with a bis-azole bearing 1,2,4-triazole and tetrazole

NASA Astrophysics Data System (ADS)

Naik, Anil D.; Railliet, Antoine P.; Dîrtu, Marinela M.; Garcia, Yann

2012-03-01

With a new bis-azole molecular fragment ( Htt) bearing 1,2,4-triazole and tetrazole, a mononuclear complex [Fe(tt)2(H2O)4]·2H2O ( 1), a trinuclear complex [Fe3(tt)6(H2O)6]·2H2O ( 2) and a 1D coordination polymer [Fe(tt)(Htt)2]BF4·2CH3OH ( 3) were obtained by varying reaction conditions. Htt acts either as an anionic or neutral ligand depending upon the reaction medium and pH. Thermal variation of spin states of 1- 3 were investigated in the range 77-300 K by 57Fe Mössbauer spectroscopy. 1 totally remains in high-spin state over the entire temperature range whereas no spin crossover was evidenced in 2. Nearly 1:1 high-spin and low-spin population ratio is found in 3, which remains constant over the entire temperature range investigated.

NESC Review of the 8-Foot High Temperature Tunnel (HTT) Oxygen Storage Pressure Vessel Inspection Requirements

NASA Technical Reports Server (NTRS)

Gilbert, Michael; Raju, Ivatury; Piascik, Robert; Cameron, Kenneth; Kirsch, Michael; Hoffman, Eric; Murthy, Pappu; Hopson, George; Greulich, Owen; Frazier, Wayne

2009-01-01

The 8-Foot HTT (refer to Figure 4.0-1) is used to conduct tests of air-breathing hypersonic propulsion systems at Mach numbers 4, 5, and 7. Methane, Air, and LOX are mixed and burned in a combustor to produce test gas stream containing 21 percent by volume oxygen. The NESC was requested by the NASA LaRC Executive Safety Council to review the rationale for a proposed change to the recertification requirements, specifically the internal inspection requirements, of the 8-Foot HTT LOX Run Tank and LOX Storage Tank. The Run Tank is an 8,000 gallon cryogenic tank used to provide LOX to the tunnel during operations, and is pressured during the tunnel run to 2,250 pounds per square inch gage (psig). The Storage Tank is a 25,000 gallon cryogenic tank used to store LOX at slightly above atmospheric pressure as a external shell, with space between the shells maintained under vacuum conditions.

Genetics of generalized anxiety disorder and related traits.

PubMed

Gottschalk, Michael G; Domschke, Katharina

2017-06-01

This review serves as a systematic guide to the genetics of generalized anxiety disorder (GAD) and further focuses on anxiety-relevant endophenotypes, such as pathological worry fear of uncertainty, and neuroticism. We inspect clinical genetic evidence for the familialityl heritability of GAD and cross-disorder phenotypes based on family and twin studies. Recent advances of linkage studies, genome-wide association studies, and candidate gene studies (eg, 5-HTT, 5-HT1A, MAOA, BDNF ) are outlined. Functional and structural neuroimaging and neurophysiological readouts relating to peripheral stress markers and psychophysiology are further integrated, building a multilevel disease framework. We explore etiologic factors in gene-environment interaction approaches investigating childhood trauma, environmental adversity, and stressful life events in relation to selected candidate genes ( 5-HTT, NPSR1, COMT, MAOA, CRHR1, RGS2 ), Additionally, the pharmacogenetics of selective serotonin reuptake inhibitor/serotonin-norepinephrine reuptake inhibitor treatment are summarized ( 5-HTT, 5-HT2A, COMT, CRHR1 ). Finally, GAD and trait anxiety research challenges and perspectives in the field of genetics, including epigenetics, are discussed.

Generalized Two-Dimensional Perturbation Correlation Infrared Spectroscopy reveals Mechanisms for the Development of Surface Charge and Recalcitrance in Plant-derived Biochars

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harvey, Omar R.; Herbert, Bruce; Kuo, Li-Jung

2012-09-05

Fundamental knowledge of how biochars develop surface-charge and resistance to environmental degradation (or recalcitrance) is crucial to their production for customized applications or, understanding their functions in the environment. Two-dimensional perturbation-based correlation infrared spectroscopy (2D-PCIS) was used to study the biochar formation process in three taxonomically-different plant biomass, under oxygen-limited conditions along a heat-treatment-temperature gradient (HTT; 200-650 oC). Results from 2D-PCIS pointed to the systematic, HTT-induced defragmenting of lignocellulose H-bonding network, and demethylenation/demethylation, oxidation or dehydroxylation/dehydrogenation of lignocellulose fragments as the primary reactions controlling biochar properties along the HTT gradient. The cleavage of OH O-type H-bonds, oxidation of free primarymore » hydroxyls (HTT≤500 oC), and their subsequent dehydrogenation/dehydroxylation (HTT>500 oC) controlled surface charge on the biochars; while the dehydrogenation of methylene groups, which yielded increasingly condensed structures (R-CH2-R →R=CH-R →R=C=R), controlled biochar recalcitrance. Variations in biochar properties across plant biomass type were attributable to taxa-specific transformations. For example, apparent inefficiencies in the cleavage of wood-specific H-bonds, and their subsequent oxidation to carboxyls, lead to lower surface charge in wood biochars (compared to grass biochars). Both non-taxa and taxa-specific transformations highlighted by 2D-PCIS could have significant implications for biochar functioning in fire-impacted or biochar-amended systems.« less

Thermal Analysis and Testing of Candidate Materials for PAIDAE Inflatable Aeroshell

NASA Technical Reports Server (NTRS)

DelCorso, Joseph A.; Bruce, Walter E., III; Liles, Kaitlin A.; Hughes, Stephen J.

2009-01-01

The Program to Advance Inflatable-Decelerators for Atmospheric Entry (PAIDAE) is a NASA project tasked with developing and evaluating viable inflatable-decelerator aeroshell geometries and materials. Thermal analysis of material layups supporting an inflatable aeroshell was completed in order to identify expected material response, failure times, and to establish an experimental test matrix to keep barrier layer materials from reaching critical temperature limits during thermal soak. Material layups were then tested in the 8- foot High Temperature Tunnel (8'HTT), where they were subjected to hypersonic aerothermal heating conditions, similar to those expected for a Mars entry. This paper presents a broad overview of the thermal analysis supporting multiple materials, and layup configurations tested in the 8'HTT at flight conditions similar to those that would be experienced during Mars entry trajectories. Direct comparison of TPS samples tested in the 8'HTT verify that the thermal model accurately predicted temperature profiles when there are up to four materials in the test layup. As the number of material layers in each test layup increase (greater than 4), the accuracy of the prediction decreases significantly. The inaccuracy of the model predictions for layups with more than four material layers is believed to be a result of the contact resistance values used throughout the model being inaccurate. In addition, the harsh environment of the 8'HTT, including hot gas penetrating through the material layers, could also be a contributing factor.

Waste-to-energy: Dehalogenation of plastic-containing wastes.

PubMed

Shen, Yafei; Zhao, Rong; Wang, Junfeng; Chen, Xingming; Ge, Xinlei; Chen, Mindong

2016-03-01

The dehalogenation measurements could be carried out with the decomposition of plastic wastes simultaneously or successively. This paper reviewed the progresses in dehalogenation followed by thermochemical conversion of plastic-containing wastes for clean energy production. The pre-treatment method of MCT or HTT can eliminate the halogen in plastic wastes. The additives such as alkali-based metal oxides (e.g., CaO, NaOH), iron powders and minerals (e.g., quartz) can work as reaction mediums and accelerators with the objective of enhancing the mechanochemical reaction. The dehalogenation of waste plastics could be achieved by co-grinding with sustainable additives such as bio-wastes (e.g., rice husk), recyclable minerals (e.g., red mud) via MCT for solid fuels production. Interestingly, the solid fuel properties (e.g., particle size) could be significantly improved by HTT in addition with lignocellulosic biomass. Furthermore, the halogenated compounds in downstream thermal process could be eliminated by using catalysts and adsorbents. Most dehalogenation of plastic wastes primarily focuses on the transformation of organic halogen into inorganic halogen in terms of halogen hydrides or salts. The integrated process of MCT or HTT with the catalytic thermal decomposition is a promising way for clean energy production. The low-cost additives (e.g., red mud) used in the pre-treatment by MCT or HTT lead to a considerable synergistic effects including catalytic effect contributing to the follow-up thermal decomposition. Copyright © 2015 Elsevier Ltd. All rights reserved.

Tetrahydrocannabinolic acid is a potent PPARγ agonist with neuroprotective activity.

PubMed

Nadal, Xavier; Del Río, Carmen; Casano, Salvatore; Palomares, Belén; Ferreiro-Vera, Carlos; Navarrete, Carmen; Sánchez-Carnerero, Carolina; Cantarero, Irene; Bellido, Maria Luz; Meyer, Stefan; Morello, Gaetano; Appendino, Giovanni; Muñoz, Eduardo

2017-12-01

Phytocannabinoids are produced in Cannabis sativa L. in acidic form and are decarboxylated upon heating, processing and storage. While the biological effects of decarboxylated cannabinoids such as Δ 9 -tetrahydrocannabinol have been extensively investigated, the bioactivity of Δ 9 -tetahydrocannabinol acid (Δ 9 -THCA) is largely unknown, despite its occurrence in different Cannabis preparations. Here we have assessed possible neuroprotective actions of Δ 9 -THCA through modulation of PPARγ pathways. The effects of six phytocannabinoids on PPARγ binding and transcriptional activity were investigated. The effect of Δ 9 -THCA on mitochondrial biogenesis and PPARγ coactivator 1-α expression was investigated in Neuro-2a (N2a) cells. The neuroprotective effect was analysed in STHdh Q111/Q111 cells expressing a mutated form of the huntingtin protein and in N2a cells infected with an adenovirus carrying human huntingtin containing 94 polyQ repeats (mHtt-q94). The in vivo neuroprotective activity of Δ 9 -THCA was investigated in mice intoxicated with the mitochondrial toxin 3-nitropropionic acid (3-NPA). Cannabinoid acids bind and activate PPARγ with higher potency than their decarboxylated products. Δ 9 -THCA increased mitochondrial mass in neuroblastoma N2a cells and prevented cytotoxicity induced by serum deprivation in STHdh Q111/Q111 cells and by mutHtt-q94 in N2a cells. Δ 9 -THCA, through a PPARγ-dependent pathway, was neuroprotective in mice treated with 3-NPA, improving motor deficits and preventing striatal degeneration. In addition, Δ 9 -THCA attenuated microgliosis, astrogliosis and up-regulation of proinflammatory markers induced by 3-NPA. Δ 9 -THCA shows potent neuroprotective activity, which is worth considering for the treatment of Huntington's disease and possibly other neurodegenerative and neuroinflammatory diseases. © 2017 The British Pharmacological Society.

Huntingtin interacting protein 1 can regulate neurogenesis in Drosophila.

PubMed

Moores, Justin N; Roy, Sophie; Nicholson, Donald W; Staveley, Brian E

2008-08-01

Huntington's disease (HD) is associated with a range of cellular consequences including selective neuronal death and decreased levels of neurogenesis. Ultimately, these altered processes are dependent upon proteins that interact with Huntingtin (Htt) such as the Huntingtin-interacting protein 1 (Hip1) which has a reduced binding preference to expanded Htt. These effects are similar to those observed with modified Notch signal transduction. As Hip1 plays a key role in endocytosis and intracellular transport, and activation of the Notch signal requires both, we investigated putative links between Hip1 and Notch signaling in flies. We have identified two forms of Hip1 that may be produced through the use of alternative first exons: a version of Hip1 with a lipid-binding ANTH domain and Hip1DeltaANTH lacking this domain. The directed expression of Hip1 decreases, while expression of Hip1DeltaANTH increases, the density of sensory microchaetae on the dorsal notum, a classical model of neurogenesis. A reduction in microchaetae density associated with Notch(Microchaetae Deficient (MCD)) (N(MCD) ) alleles is sensitive to both Hip1 and Hip1DeltaANTH levels, as are the bristle phenotypes generated by misexpression of deltex, a key mediator of Notch signaling. Genetic studies further demonstrate that the observed effects of Hip1 and of Hip1DeltaANTH are sensitive to achaete gene dosage while insensitive to the levels of E(Spl), suggesting a non-canonical Notch neurogenic signal through a deltex-dependent pathway. The novel role we describe for Hip1 in Notch-mediated neurogenesis provides a functional link between Notch signaling and proteins related to HD.

Candidate genes for panhypopituitarism identified by gene expression profiling

PubMed Central

Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

2011-01-01

Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Age-dependent changes in nitric oxide synthase activity and protein expression in striata of mice transgenic for the Huntington's disease mutation.

PubMed

Pérez-Severiano, Francisca; Escalante, Bruno; Vergara, Paula; Ríos, Camilo; Segovia, José

2002-09-27

Huntington's disease (HD) is an autosomal hereditary neurodegenerative disorder caused by an abnormal expansion of the CAG repeats that code for a polyglutamine tract in a novel protein called huntingtin (htt). Both patients and experimental animals exhibit oxidative damage in specific areas of the brain, particularly the striatum. Nitric oxide (NO) is involved in many different physiological processes, and under pathological conditions it may promote oxidative damage through the formation of the highly reactive metabolite peroxynitrite; however, it may also play a role protecting cells from oxidative damage. We previously showed a correlation between the progression of the neurological phenotype and striatal oxidative damage in a line of transgenic mice, R6/1, which expresses a human mutated htt exon 1 with 116 CAG repeats. The purpose of the present work was to explore the participation of NO in the progressive oxidative damage that occurs in the striata of R6/1 mice. We analyzed the role of NO by measuring the activity of nitric oxide synthase (NOS) in the striata of transgenic and control mice at different ages. There was no difference in NOS activity between transgenic and wild-type mice at 11 weeks of age. In contrast, 19-week-old transgenic mice showed a significant increase in NOS activity, compared with same age controls. By 35 weeks of age, there was a decrease in NOS activity in transgenic mice when compared with wild-type controls. NOS protein expression was also determined in 11-, 19- and 35-week-old transgenic mice and wild-type littermates. Our results show increased neuronal NOS expression in 19-week-old transgenic mice, followed by a decreased level in 35-week-old mice, compared with controls, a phenomenon that parallels the changes in NOS enzyme activity. The present results suggest that NO is involved in the process leading to striatal oxidative damage and that it is associated with the onset of the progressive neurological phenotype in mice transgenic for the HD mutation.

Treadmill exercise delays the onset of non-motor behaviors and striatal pathology in the CAG140 knock-in mouse model of Huntington's disease.

PubMed

Stefanko, D P; Shah, V D; Yamasaki, W K; Petzinger, G M; Jakowec, M W

2017-09-01

Depression, cognitive impairments, and other neuropsychiatric disturbances are common during the prodromal phase of Huntington's disease (HD) well before the onset of classical motor symptoms of this degenerative disorder. The purpose of this study was to examine the potential impact of physical activity in the form of exercise on a motorized treadmill on non-motor behavioral features including depression-like behavior and cognition in the CAG 140 knock-in (KI) mouse model of HD. The CAG 140 KI mouse model has a long lifespan compared to other HD rodent models with HD motor deficits emerging after 12months of age and thus provides the opportunity to investigate early life interventions such as exercise on disease progression. Motorized treadmill running was initiated at 4weeks of age (1h per session, 3 times per week) and continued for 6months. Non-motor behaviors were assessed up to 6months of age and included analysis of depression-like behavior (using the tail-suspension and forced-swim tests) and cognition (using the T-maze and object recognition tests). At both 4 and 6months of age, CAG 140 KI mice displayed significant depression-like behavior in the forced swim and tail suspension tests and cognitive impairment by deficits in reversal relearning in the T-maze test. These deficits were not evident in mice engaged in treadmill running. In addition, exercise restored striatal dopamine D2 receptor expression and dopamine neurotransmitter levels both reduced in sedentary HD mice. Finally, we examined the pattern of striatal expression of mutant huntingtin (mHTT) protein and showed that the number and intensity of immunohistochemical staining patterns of intranuclear aggregates were significantly reduced with exercise. Altogether these findings begin to address the potential impact of lifestyle and early intervention such as exercise on modifying HD progression. Copyright © 2017 Elsevier Inc. All rights reserved.

Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya

2006-08-04

Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less

Characterization of Staphylococcus aureus mutants expressing reduced susceptibility to common house-cleaners

PubMed Central

Davis, A.O.; O’Leary, J.O.; Muthaiyan, A.; Langevin, M.J.; Delgado, A.; Abalos, A.T.; Fajardo, A.R.; Marek, J.; Wilkinson, B.J.; Gustafson, J.E.

2013-01-01

Aims To characterize mutants of Staphylococcus aureus expressing reduced susceptibility to house cleaners (HC), assess the impact of the alternative sigma factor SigB on HC susceptibility, and determine the MIC of clinical methicillin-resistant S. aureus (MRSA) to a HC. Methods and Results Susceptibility to HC, HC components, H2O2, vancomycin and oxacillin and physiological parameters were determined for HC-reduced susceptibility (HCRS) mutants, parent strain COL and COLsigB::kan. HCRS mutants selected with three HC expressed reduced susceptibility to multiple HC, HC components, H2O2 and vancomycin. Two unique HCRS mutants also lost the methicillin resistance determinant. In addition, all HCRS mutants exhibited better growth at two temperatures, and one HCRS mutant expressed reduced carotenoid production. COLsigB::kan demonstrated increased susceptibility to all HC and many HC components. sigB operon mutations were not detected in one HCRS mutant background. Of 76 clinical MRSA, 20 exhibited reduced susceptibility to a HC. Conclusions HCRS mutants demonstrate altered susceptibility to multiple antimicrobials. While sigB is required for full HC resistance, one HCRS mechanism does not involve sigB operon mutations. Clinical MRSA expressing reduced susceptibility to a common HC were detected. Significance and Impact of the Study This study suggests that HCRS mutants are not protected against, nor selected by, practical HC concentrations. PMID:15659191

Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume.

PubMed

Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A

2018-05-11

Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.

Testing differential susceptibility: Plasticity genes, the social environment, and their interplay in adolescent response inhibition.

PubMed

Richards, Jennifer S; Arias Vásquez, Alejandro; van Rooij, Daan; van der Meer, Dennis; Franke, Barbara; Hoekstra, Pieter J; Heslenfeld, Dirk J; Oosterlaan, Jaap; Faraone, Stephen V; Hartman, Catharina A; Buitelaar, Jan K

2017-06-01

Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments. Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation). A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate. While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.

5HTT genotype moderates the influence of early institutional deprivation on emotional problems in adolescence: evidence from the English and Romanian Adoptee (ERA) study.

PubMed

Kumsta, Robert; Stevens, Suzanne; Brookes, Keeley; Schlotz, Wolff; Castle, Jenny; Beckett, Celia; Kreppner, Jana; Rutter, Michael; Sonuga-Barke, Edmund

2010-07-01

A common polymorphism in the serotonin transporter gene (SLC6A4, 5HTT) has been repeatedly shown to moderate the influence of childhood adversity and stressful life events on the development of psychopathology. Using data from the English and Romanian Adoptee Study, a prospective-longitudinal study of individuals (n = 125) exposed to severe early institutional deprivation (ID), we tested whether the effect of ID on adolescent emotional problems is moderated by 5HTT genotype and stressful life events in adolescence. Emotional problems were assessed using questionnaire data (age 11), and on the basis of the CAPA diagnostic interview (age 15). Additionally, the number of stressful life events was measured. There was a significant effect for genotype (p = .003) and a gene x environment interaction (p = .008) that was independent of age at testing. Carriers of the s/l and s/s genotype who experienced severe ID showed the highest emotional problem scores, while l/l homozygotes in the severe ID group showed the lowest overall levels. Furthermore, s/s carriers in the severe ID group who experienced a high number of stressful life events between 11 and 15 years had the largest increases in emotional problem scores, while a low number of stressful life events was associated with the largest decrease (4-way interaction: p = .05). The effects of severe early ID on emotional problems in adolescence are moderated by 5HTT genotype, and influenced by stressful life events in adolescence.

Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

PubMed

Loging, W T; Reisman, D

1999-11-01

The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

Possible association between serotonin transporter promoter region polymorphism and extremely violent crime in Chinese males.

PubMed

Liao, Ding-Lieh; Hong, Chen-Jee; Shih, Hao-Ling; Tsai, Shih-Jen

2004-01-01

The neurotransmitter, serotonin, has been implicated in aggressive behavior. The serotonin transporter (5-HTT), which reuptakes serotonin into the nerve terminal, plays a critical role in the regulation of serotonergic function. Previous western reports have demonstrated that the low-activity short (S) allele of the 5-HTT gene-linked polymorphic-region (5-HTTLPR) polymorphism is associated with aggressive behavior and associated personality traits. In the present study, we investigated this 5-HTTLPR genetic polymorphism in a group of Chinese males who had been convicted for extremely violent crime (n = 135) and a normal control group (n = 111). The proportion of S-allele carriers was significantly higher in the criminal group than in the controls (p = 0.006). A significant association was not demonstrated for the relationship between the 5-HTTLPR polymorphism and antisocial personality disorder, substance abuse or alcohol abuse in the criminal group. Our findings demonstrate that carriage of the low-activity S allele is associated with extremely violent criminal behavior in Chinese males, and suggests that the 5-HTT may be implicated in the mechanisms underlying violent behaviors.

Influence of heat treatment temperature on the morphological and structural aspects of reticulated vitreous carbon used in polyaniline electrosynthesis

NASA Astrophysics Data System (ADS)

Gonçalves, E. S.; Dalmolin, C.; Biaggio, S. R.; Nascente, P. A. P.; Rezende, M. C.; Ferreira, N. G.

2007-08-01

Reticulated vitreous carbon (RVC) was obtained from different heat treatment temperature (HTT), in the range from 700 up to 2000 °C, and used as a substrate for polyaniline growth from electrosynthesis. The influence of HTT on RVC chemical surface was studied by X-ray photoelectron spectroscopy (XPS) and correlated to electrochemical parameters used in the electrosynthesis. XPS analyses have shown that RVC heteroatoms decrease as HTT increases. The results reveal the migration of chemical bonds from oxidized carbon forms towards carbon atoms as the unique final product. Cyclic voltammetry, electrochemical impedance spectroscopy, and stability test of polyaniline films were performed from oxidized and non-oxidized RVC substrates. Cyclic voltammetry in 0.5 mol L -1 H 2SO 4 revealed higher capacitance for the RVC treated at 1000 °C and oxidized in a hot H 2SO 4 solution. The charge accumulation after RVC chemical treatment has increased around ten times. The lowest electric resistivities and impedances were obtained for the RVC treated at 2000 °C, which also showed the highest polyaniline stability.

Reduced mycorrhizal colonization (rmc) tomato mutant lacks expression of SymRK signaling pathway genes

PubMed Central

Nair, Aswathy; Bhargava, Sujata

2012-01-01

Comparison of the expression of 13 genes involved in arbuscular mycorrhizal (AM) symbiosis was performed in a wild type tomato (Solanum lycopersicum cv 76R) and its reduced mycorrhizal colonization mutant rmc in response to colonization with Glomus fasiculatum. Four defense-related genes were induced to a similar extent in the mutant and wild type AM colonized plants, indicating a systemic response to AM colonization. Genes related to nutrient exchange between the symbiont partners showed higher expression in the AM roots of wild type plants than the mutant plants, which correlated with their arbuscular frequency. A symbiosis receptor kinase that is involved in both nodulation and AM symbiosis was not expressed in the rmc mutant. The fact that some colonization was observed in rmc was suggestive of the existence of an alternate colonization signaling pathway for AM symbiosis in this mutant. PMID:23221680

Ecological networks to unravel the routes to horizontal transposon transfers.

PubMed

Venner, Samuel; Miele, Vincent; Terzian, Christophe; Biémont, Christian; Daubin, Vincent; Feschotte, Cédric; Pontier, Dominique

2017-02-01

Transposable elements (TEs) represent the single largest component of numerous eukaryotic genomes, and their activity and dispersal constitute an important force fostering evolutionary innovation. The horizontal transfer of TEs (HTT) between eukaryotic species is a common and widespread phenomenon that has had a profound impact on TE dynamics and, consequently, on the evolutionary trajectory of many species' lineages. However, the mechanisms promoting HTT remain largely unknown. In this article, we argue that network theory combined with functional ecology provides a robust conceptual framework and tools to delineate how complex interactions between diverse organisms may act in synergy to promote HTTs.

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant

PubMed Central

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A.; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K.; Altenbach, Christian; Hong, Yuan; Hanson, Susan M.; Palazzo, Maria C.; Chen, Jeannie; Hubbell, Wayne L.; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

2013-01-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. PMID:24012956

Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant.

PubMed

Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K; Altenbach, Christian; Hong, Yuan; Hanson, Susan M; Palazzo, Maria C; Chen, Jeannie; Hubbell, Wayne L; Gurevich, Eugenia V; Gurevich, Vsevolod V

2013-12-01

Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. © 2013.

Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

PubMed

Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

2016-10-07

CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

PubMed Central

Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

2008-01-01

Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

Gene-to-gene interactions regulate endogenous pain modulation in fibromyalgia patients and healthy controls—antagonistic effects between opioid and serotonin-related genes

PubMed Central

Tour, Jeanette; Löfgren, Monika; Mannerkorpi, Kaisa; Gerdle, Björn; Larsson, Anette; Palstam, Annie; Bileviciute-Ljungar, Indre; Bjersing, Jan; Martin, Ingvar; Ernberg, Malin; Schalling, Martin; Kosek, Eva

2017-01-01

Abstract Chronic pain is associated with dysfunctional endogenous pain modulation, involving both central opioid and serotonergic (5-HT) signaling. Fibromyalgia (FM) is a chronic pain syndrome, characterized by widespread musculoskeletal pain and reduced exercise-induced hypoalgesia (EIH). In this study, we assessed the effects of 3 functional genetic polymorphisms on EIH in 130 patients with FM and 132 healthy controls. Subjects were genotyped regarding the mu-opioid receptor (OPRM1) gene (rs1799971), the serotonin transporter (5-HTT) gene (5-HTTLPR/rs25531), and the serotonin-1a receptor (5-HT1a) gene (rs6296). The patients with FM had increased pain sensitivity and reduced EIH compared with healthy controls. None of the polymorphisms had an effect on EIH on their own. We found significant gene-to-gene interactions between OPRM1 x 5-HTT and OPRM1 x 5-HT1a regarding activation of EIH, with no statistically significant difference between groups. Better EIH was found in individuals with genetically inferred strong endogenous opioid signaling (OPRM1 G) in combination with weak 5-HT tone (5-HTT low/5-HT1a G), compared with strong 5-HT tone (5-HTT high/5-HT1a CC). Based on the proposed mechanisms of these genetic variants, the findings indicate antagonistic interactions between opioid and serotonergic mechanisms during EIH. Moreover, despite different baseline pain level, similar results were detected in FM and controls, not supporting an altered interaction between opioid and 5-HT mechanisms as the basis for dysfunction of EIH in patients with FM. In summary, our results suggest that, by genetic association, the mu-opioid receptor interacts with 2 major serotonergic structures involved in 5-HT reuptake and release, to modulate EIH. PMID:28282362

Inhibition of serotonin transporters disrupts the enhancement of fear memory extinction by 3,4-methylenedioxymethamphetamine (MDMA).

PubMed

Young, Matthew B; Norrholm, Seth D; Khoury, Lara M; Jovanovic, Tanja; Rauch, Sheila A M; Reiff, Collin M; Dunlop, Boadie W; Rothbaum, Barbara O; Howell, Leonard L

2017-10-01

3,4-Methylenedioxymethamphetamine (MDMA) persistently improves symptoms of post-traumatic stress disorder (PTSD) when combined with psychotherapy. Studies in rodents suggest that these effects can be attributed to enhancement of fear memory extinction. Therefore, MDMA may improve the effects of exposure-based therapy for PTSD, particularly in treatment-resistant patients. However, given MDMA's broad pharmacological profile, further investigation is warranted before moving to a complex clinical population. We aimed to inform clinical research by providing a translational model of MDMA's effect, and elucidating monoaminergic mechanisms through which MDMA enhances fear extinction. We explored the importance of monoamine transporters targeted by MDMA to fear memory extinction, as measured by reductions in conditioned freezing and fear-potentiated startle (FPS) in mice. Mice were treated with selective inhibitors of individual monoamine transporters prior to combined MDMA treatment and fear extinction training. MDMA enhanced the lasting extinction of FPS. Acute and chronic treatment with a 5-HT transporter (5-HTT) inhibitor blocked MDMA's effect on fear memory extinction. Acute inhibition of dopamine (DA) and norepinephrine (NE) transporters had no effect. 5-HT release alone did not enhance extinction. Blockade of MDMA's effect by 5-HTT inhibition also downregulated 5-HT 2A -mediated behavior, and 5-HT 2A antagonism disrupted MDMA's effect on extinction. We validate enhancement of fear memory extinction by MDMA in a translational behavioral model, and reveal the importance of 5-HTT and 5-HT 2A receptors to this effect. These observations support future clinical research of MDMA as an adjunct to exposure therapy, and provide important pharmacological considerations for clinical use in a population frequently treated with 5-HTT inhibitors.

Dopamine and serotonin signaling during two sensitive developmental periods differentially impact adult aggressive and affective behaviors in mice.

PubMed

Yu, Q; Teixeira, C M; Mahadevia, D; Huang, Y; Balsam, D; Mann, J J; Gingrich, J A; Ansorge, M S

2014-06-01

Pharmacologic blockade of monoamine oxidase A (MAOA) or serotonin transporter (5-HTT) has antidepressant and anxiolytic efficacy in adulthood. Yet, genetically conferred MAOA or 5-HTT hypoactivity is associated with altered aggression and increased anxiety/depression. Here we test the hypothesis that increased monoamine signaling during development causes these paradoxical aggressive and affective phenotypes. We find that pharmacologic MAOA blockade during early postnatal development (P2-P21) but not during peri-adolescence (P22-41) increases anxiety- and depression-like behavior in adult (>P90) mice, mimicking the effect of P2-21 5-HTT inhibition. Moreover, MAOA blockade during peri-adolescence, but not P2-21 or P182-201, increases adult aggressive behavior, and 5-HTT blockade from P22-P41 reduced adult aggression. Blockade of the dopamine transporter, but not the norepinephrine transporter, during P22-41 also increases adult aggressive behavior. Thus, P2-21 is a sensitive period during which 5-HT modulates adult anxiety/depression-like behavior, and P22-41 is a sensitive period during which DA and 5-HT bi-directionally modulate adult aggression. Permanently altered DAergic function as a consequence of increased P22-P41 monoamine signaling might underlie altered aggression. In support of this hypothesis, we find altered aggression correlating positively with locomotor response to amphetamine challenge in adulthood. Proving that altered DA function and aggression are causally linked, we demonstrate that optogenetic activation of VTA DAergic neurons increases aggression. It therefore appears that genetic and pharmacologic factors impacting dopamine and serotonin signaling during sensitive developmental periods can modulate adult monoaminergic function and thereby alter risk for aggressive and emotional dysfunction.

Endotoxaemia resulting from decreased serotonin tranporter (5-HTT) function: a reciprocal risk factor for depression and insulin resistance?

PubMed

Pomytkin, Igor A; Cline, Brandon H; Anthony, Daniel C; Steinbusch, Harry W; Lesch, Klaus-Peter; Strekalova, Tatyana

2015-01-01

Depression and diabetes are serious diseases with an increasing global prevalence. Intriguingly, recent meta-analyses have highlighted an asymmetrical relationship between the two conditions as depressed patients were found to display a higher risk of developing type 2 diabetes than those individuals suffering from diabetes are to become depressed. Based on recent findings, we favor a hypothesis where by decreased peripheral serotonin (5-HT) transporter (5-HTT) function is a reciprocal risk factor for the co-morbidity of depression and diabetes, as it can trigger inflammatory pathogenetic mechanisms of both conditions. Higher intestinal levels of 5-HT and 5-HT3 receptor stimulation lead to increased intestinal permeability in 5-HTT deficient mice, which is viewed one of the most relevant animal models of depression. We hypothesize that this leakage of bacterial endotoxins can activate both central and peripheral Toll-like receptor 4 (TLR4), which inhibits insulin signaling and IRS1/PI3K/Akt and thus, contribute to the pathogenesis of diabetes and depression that are associated with this pathway. Antidepressant therapies, which also suppress intestinal 5-HTT, may have potentiating effects on the association between depression and diabetes. It is also of interest that high carbohydrate and fat intake ("cafeteria-type diet") increases intestinal 5-HT leading to TLR4 activation. Thus, endotoxaemia and inflammation owing to increased intestinal 5-HT may underpin the depression and diabetes association, where the risk of the latter pathology becomes particularly preeminent after the onset of depression and not vice versa. The evidence presented here shows the further investigation into peripheral mechanisms that linked diabetes to depression is clearly warranted. Copyright © 2014. Published by Elsevier B.V.

Inhibition of serotonin but not norepinephrine transport during development produces delayed, persistent perturbations of emotional behaviors in mice.

PubMed

Ansorge, Mark S; Morelli, Emanuela; Gingrich, Jay A

2008-01-02

Serotonin (5-HT) acts as a neurotransmitter, but also modulates brain maturation during early development. The demonstrated influence of genetic variants on brain function, personality traits, and susceptibility to neuropsychiatric disorders suggests a critical importance of developmental mechanisms. However, little is known about how and when developmentally perturbed 5-HT signaling affects circuitry and resulting behavior. The 5-HT transporter (5-HTT) is a key regulator of extracellular 5-HT levels and we used pharmacologic strategies to manipulate 5-HTT function during development and determine behavioral consequences. Transient exposure to the 5-HTT inhibitors fluoxetine, clomipramine, and citalopram from postnatal day 4 (P4) to P21 produced abnormal emotional behaviors in adult mice. Similar treatment with the norepinephrine transporter (NET) inhibitor, desipramine, did not adversely affect adult behavior, suggesting that 5-HT and norepinephrine (NE) do not share the same effects on brain development. Shifting our period of treatment/testing to P90/P185 failed to mimic the effect of earlier exposure, demonstrating that 5-HT effects on adult behavior are developmentally specific. We have hypothesized that early-life perturbations of 5-HT signaling affect corticolimbic circuits that do not reach maturity until the peri-adolescent period. In support of this idea, we found that abnormal behaviors resulting from postnatal fluoxetine exposure have a post-pubescent onset and persist long after reaching adult age. A better understanding of the underlying 5-HT sensitive circuits and how they are perturbed should lead to new insights into how various genetic polymorphisms confer their risk to carriers. Furthermore, these studies should help determine whether in utero exposure to 5-HTT blocking drugs poses a risk for behavioral abnormalities in later life.

Differential long-term effects of MDMA on the serotoninergic system and hippocampal cell proliferation in 5-HTT knock-out vs. wild-type mice.

PubMed

Renoir, Thibault; Païzanis, Eleni; El Yacoubi, Malika; Saurini, Françoise; Hanoun, Naïma; Melfort, Maxette; Lesch, Klaus Peter; Hamon, Michel; Lanfumey, Laurence

2008-12-01

Although numerous studies investigated the mechanisms underlying 3,4-methylenedioxymethamphetamine (MDMA)-induced neurotoxicity, little is known about its long-term functional consequences on 5-HT neurotransmission in mice. This led us to evaluate the delayed effects of MDMA exposure on the 5-HT system, using in-vitro and in-vivo approaches in both 5-HTT wild-type and knock-out mice. Acute MDMA in-vitro application on slices of the dorsal raphe nucleus (DRN) induced concentration-dependent 5-HT release and 5-HT cell firing inhibition. Four weeks after MDMA administration (20 mg/kg b.i.d for 4 d), a 2-fold increase in the potency of the 5-HT1A receptor agonist ipsapirone to inhibit the discharge of DRN 5-HT neurons and a larger hypothermic response to 8-OH-DPAT were observed in MDMA- compared to saline-treated mice. This adaptive 5-HT1A autoreceptor supersensitivity was associated with decreases in 5-HT levels but no changes of [3H]citalopram binding in brain. Long-term MDMA treatment also induced a 30% decrease in BrdU labelling of proliferating hippocampal cells and an increased immobility duration in the forced swim test suggesting a depressive-like behaviour induced by MDMA treatment. All these effects were abolished in 5-HTT-/- knock-out mice. These data indicated that, in mice, MDMA administration induced a delayed adaptive supersensitivity of 5-HT1A autoreceptors in the DRN, a deficit in hippocampal cell proliferation and a depressive-like behaviour. These 5-HTT-dependent effects, opposite to those of antidepressants, might contribute to MDMA-induced mood disorders.

Association study of serotonin transporter gene polymorphisms with obstructive sleep apnea syndrome in Chinese Han population.

PubMed

Yue, Weihua; Liu, Huiguo; Zhang, Jishui; Zhang, Xianghui; Wang, Xiaoping; Liu, Tieqiao; Liu, Pozi; Hao, Wei

2008-11-01

Since the serotonin (5-HT) is associated with circadian rhythm and breathing regulation, the serotonin transporter (5-HTT), which plays an important role in serotoninergic transmission, might be a strong candidate gene in the pathogenesis of obstructive sleep apnea syndrome (OSAS). To investigate the association of 5-HTT gene polymorphisms with OSAS and clinical characteristics. We genotyped the 5-HTT gene linked polymorphic region (5-HTTLPR) and a variable number of tandem repeats at intron 2 (STin2.VNTR) in 254 OSAS patients and 338 healthy controls in Chinese Han population. In total sample, the 10-repeat allele of STin2.VNTR was significantly associated with OSAS (P = 0.007, OR = 1.72, 95% CI = 1.15-2.58), but no association was found in 5-HTTLPR. In male subjects, both polymorphisms showed significant association with OSAS (Allele L: P = 0.005, OR = 1.44, 95% CI = 1.11 to 1.87; Allele 10: P = 0.002, OR= 1.94, 95% CI = 1.26 to 3.00). Two haplotypes, S-12 and L-10, constructed by the above polymorphisms also revealed significant associations with OSAS (global P-values were 0.020 for total sample and 0.0006 for male subjects, respectively). Male patients carrying the haplotype S-12 showed a significantly lower apnea / hypopnea index (AHI), depressive factor, plasma 5-HT level and 5-hydroxyindolacetic acid (5-HIAA) levels, but higher episodic memory, when compared with non-S-12 carriers (P < 0.05). However, no significant differences were found in excessive daytime sleepiness or other psychological function across haplotype carriers (P > 0.05). These findings support that 5-HTT gene may be involved in susceptibility to OSAS, especially with sex-dependent effect.

Use of anti-depressants and the risk of fracture of the hip or femur.

PubMed

van den Brand, M W M; Pouwels, S; Samson, M M; van Staa, T P; Thio, B; Cooper, C; Leufkens, H G M; Egberts, A C G; Verhaar, H J J; de Vries, F

2009-10-01

Anti-depressants are used largely, but have serious side effects. We show that both selective serotonin re-uptake inhibitors (SSRIs) and tricyclic anti-depressants (TCAs) increase the risk of hip/femur fracture and that this risk is time related and depends on the degree of serotonin transporter inhibition. This should be considered when prescribing anti-depressants to patients. Anti-depressants are known to have serious side effects. We examined the association between the use of anti-depressants and the risk of hip/femur fractures with a special focus on the relation with the degree of 5-hydroxytryptamine transporter (5-HTT) inhibition and the duration of use. A case-control study was conducted within the Dutch PHARMO-RLS database. Cases (n = 6,763) were adult patients with a first hip/femur fracture during the study period. For each case, four controls (n = 26341) were matched by age, gender and geographic region. The risk of hip/femur fracture increased with current use of SSRIs (adjusted odds ratio (OR(adj)) 2.35 [95% confidence interval (CI) 1.94-2.84]) and TCAs (ORadj 1.76 [95% CI 1.45-2.15]). The risk of hip/femur fracture declined rapidly after discontinuation of use. The risk of hip/femur fracture increased as the degree of 5-HTT inhibition of all anti-depressants increased from OR(adj) 1.64 [95% CI 1.14-2.35] for drugs with low 5-HTT inhibition to OR(adj) 2.31 [95% CI 1.94-2.76] for those with high 5-HTT inhibiting properties. Current use of both SSRIs and TCAs increase hip/femur fracture risk. Further studies are needed to elucidate the mechanistic pathways and the relation with the underlying pathophysiology. Until then, the elevated fracture risk should be considered when prescribing anti-depressants.

Gene-to-gene interactions regulate endogenous pain modulation in fibromyalgia patients and healthy controls-antagonistic effects between opioid and serotonin-related genes.

PubMed

Tour, Jeanette; Löfgren, Monika; Mannerkorpi, Kaisa; Gerdle, Björn; Larsson, Anette; Palstam, Annie; Bileviciute-Ljungar, Indre; Bjersing, Jan; Martin, Ingvar; Ernberg, Malin; Schalling, Martin; Kosek, Eva

2017-07-01

Chronic pain is associated with dysfunctional endogenous pain modulation, involving both central opioid and serotonergic (5-HT) signaling. Fibromyalgia (FM) is a chronic pain syndrome, characterized by widespread musculoskeletal pain and reduced exercise-induced hypoalgesia (EIH). In this study, we assessed the effects of 3 functional genetic polymorphisms on EIH in 130 patients with FM and 132 healthy controls. Subjects were genotyped regarding the mu-opioid receptor (OPRM1) gene (rs1799971), the serotonin transporter (5-HTT) gene (5-HTTLPR/rs25531), and the serotonin-1a receptor (5-HT1a) gene (rs6296). The patients with FM had increased pain sensitivity and reduced EIH compared with healthy controls. None of the polymorphisms had an effect on EIH on their own. We found significant gene-to-gene interactions between OPRM1 x 5-HTT and OPRM1 x 5-HT1a regarding activation of EIH, with no statistically significant difference between groups. Better EIH was found in individuals with genetically inferred strong endogenous opioid signaling (OPRM1 G) in combination with weak 5-HT tone (5-HTT low/5-HT1a G), compared with strong 5-HT tone (5-HTT high/5-HT1a CC). Based on the proposed mechanisms of these genetic variants, the findings indicate antagonistic interactions between opioid and serotonergic mechanisms during EIH. Moreover, despite different baseline pain level, similar results were detected in FM and controls, not supporting an altered interaction between opioid and 5-HT mechanisms as the basis for dysfunction of EIH in patients with FM. In summary, our results suggest that, by genetic association, the mu-opioid receptor interacts with 2 major serotonergic structures involved in 5-HT reuptake and release, to modulate EIH.

Tau hyperphosphorylation and deregulation of calcineurin in mouse models of Huntington's disease.

PubMed

Gratuze, Maud; Noël, Anastasia; Julien, Carl; Cisbani, Giulia; Milot-Rousseau, Philippe; Morin, Françoise; Dickler, Maya; Goupil, Claudia; Bezeau, François; Poitras, Isabelle; Bissonnette, Stéphanie; Whittington, Robert A; Hébert, Sébastien S; Cicchetti, Francesca; Parker, J Alex; Samadi, Pershia; Planel, Emmanuel

2015-01-01

Huntington's disease (HD) is an autosomal-dominant neurodegenerative disorder caused by polyglutamine expansions in the amino-terminal region of the huntingtin (Htt) protein. At the cellular level, neuronal death is accompanied by the proteolytic cleavage, misfolding and aggregation of huntingtin. Abnormal hyperphosphorylation of tau protein is a characteristic feature of a class of neurodegenerative diseases called tauopathies. As a number of studies have reported tau pathology in HD patients, we investigated whether HD pathology may promote tau hyperphosphorylation and if so tackle some of its underlying mechanisms. For that purpose, we used the R6/2 mouse, a well-characterized model of HD, and analyzed tau phosphorylation before and after the onset of HD-like symptoms. We found a significant increase in tau hyperphosphorylation at the PHF-1 epitope in pre-symptomatic R6/2 mice, whereas symptomatic mice displayed tau hyperphosphorylation at multiple tau phosphoepitopes (AT8, CP13, PT205 and PHF-1). There was no activation of major tau kinases that could explain this observation. However, when we examined tau phosphatases, we found that calcineurin/PP2B was downregulated by 30% in pre-symptomatic and 50% in symptomatic R6/2 mice, respectively. We observed similar changes in tau phosphorylation and calcineurin expression in Q175 mice, another HD model. Calcineurin was also reduced in Q111 compared with Q7 cells. Finally, pharmacological or genetic inhibition of endogenous calcineurin was sufficient to promote tau hyperphosphorylation in neuronal cells. Taken together, our data suggest that mutant huntingtin can induce abnormal tau hyperphosphorylation in vivo, via the deregulation of calcineurin. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

PubMed

Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

2015-07-16

p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice

PubMed Central

Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.

2008-01-01

Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803

P01.29 Mutant (R132H) IDH1-driven cellular transformation makes cells dependent on continued wild type IDH1 expression in a model of in vitro gliomagenesis

PubMed Central

Johannessen, T.; Mukherjee, J.; Wood, M.; Viswanath, P.; Ohba, S.; Ronen, S.; Berkvig, R.; Pieper, R.

2017-01-01

Abstract Introduction: Missense R132H mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. We recently showed (Mol Cancer Res 14: 976–983, 2016) that although mutant IDH1 expression in hTERT-immortalized, p53/pRb-deficient astrocytes can drive cellular transformation and gliomagenesis, selective pharmacologic inhibition and elimination of 2-HG by the mutant IDH1 inhibitor AGI-5198 has little effect on the growth or clonagenicity of these transformed cells. To address the possible role of WT IDH1 in the growth of mutant IDH-driven tumor cells, we used a slightly different gliomagenesis model in which the transformation of TERT-deficient, p53/pRb-deficient astrocytes (pre-crisis cells) occurs only after prolonged expression of mutant IDH and passage through cellular crisis (post-crisis cells, Cancer Res 76:6680–6689, 2016). METHODS AND MATERIALS: Using this system we introduced AGI-5198, or siRNA targeting both WT and mutant forms of IDH1 into p53/pRb-deficient, mutant IDH1-expressing human astrocytes prior to or following their transformation, and compared the effects on cell growth and clonagenicity. Results: AGI-5198 exposure decreased levels of 2HG by greater than 90%, and as previously reported had no effect on the growth of either the pre-or post-crisis cell populations. A one-day exposure to a pan IDH1 siRNA resulted in a similar, prolonged (greater than 6 day), 80% inhibition of both WT and mutant IDH1 protein levels and 2HG in both cell groups. While the growth of the mutant IDH-expressing, non-transformed cells was similar to that of scramble siRNA controls, the growth of the mutant IDH-transformed cells was significantly reduced. This growth suppression was also accompanied by a four-fold increase in annexin V-positive apoptotic cells. Furthermore, the growth suppression in the cells transformed by mutant IDH1 expression could not be reversed by addition of a cell-permeable form of 2-HG. Conclusions: These results show that the in vitro transformative events driven by expression of mutant IDH1 make cells dependent not on continued mutant IDH1 expression, but rather on continued WT IDH1 expression. The data also support the development and testing of agents that can inhibit both the WT and mutant forms of IDH1.

Purkinje Cell Compartmentation in the Cerebellum of the Lysosomal Acid Phosphatase 2 Mutant Mouse (Nax - Naked-Ataxia Mutant Mouse)

PubMed Central

Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan

2014-01-01

The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417

notch3 is essential for oligodendrocyte development and vascular integrity in zebrafish

PubMed Central

Zaucker, Andreas; Mercurio, Sara; Sternheim, Nitzan; Talbot, William S.; Marlow, Florence L.

2013-01-01

SUMMARY Mutations in the human NOTCH3 gene cause CADASIL syndrome (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy). CADASIL is an inherited small vessel disease characterized by diverse clinical manifestations including vasculopathy, neurodegeneration and dementia. Here we report two mutations in the zebrafish notch3 gene, one identified in a previous screen for mutations with reduced expression of myelin basic protein (mbp) and another caused by a retroviral insertion. Reduced mbp expression in notch3 mutant embryos is associated with fewer oligodendrocyte precursor cells (OPCs). Despite an early neurogenic phenotype, mbp expression recovered at later developmental stages and some notch3 homozygous mutants survived to adulthood. These mutants, as well as adult zebrafish carrying both mutant alleles together, displayed a striking stress-associated accumulation of blood in the head and fins. Histological analysis of mutant vessels revealed vasculopathy, including: an enlargement (dilation) of vessels in the telencephalon and fin, disorganization of the normal stereotyped arrangement of vessels in the fin, and an apparent loss of arterial morphological structure. Expression of hey1, a well-known transcriptional target of Notch signaling, was greatly reduced in notch3 mutant fins, suggesting that Notch3 acts via a canonical Notch signaling pathway to promote normal vessel structure. Ultrastructural analysis confirmed the presence of dilated vessels in notch3 mutant fins and revealed that the vessel walls of presumed arteries showed signs of deterioration. Gaps in the arterial wall and the presence of blood cells outside of vessels in mutants indicated that compromised vessel structure led to hemorrhage. In notch3 heterozygotes, we found elevated expression of both notch3 itself and target genes, indicating that specific alterations in gene expression due to partial loss of Notch3 function might contribute to the abnormalities observed in heterozygous larvae and adults. Our analysis of zebrafish notch3 mutants indicates that Notch3 regulates OPC development and mbp gene expression in larvae, and maintains vascular integrity in adults. PMID:23720232

Horizontal transfer of OC1 transposons in the Tasmanian devil.

PubMed

Gilbert, Clement; Waters, Paul; Feschotte, Cedric; Schaack, Sarah

2013-02-27

There is growing recognition that horizontal DNA transfer, a process known to be common in prokaryotes, is also a significant source of genomic variation in eukaryotes. Horizontal transfer of transposable elements (HTT) may be especially prevalent in eukaryotes given the inherent mobility, widespread occurrence, and prolific abundance of these elements in many eukaryotic genomes. Here, we provide evidence for a new case of HTT of the transposon family OposCharlie1 (OC1) in the Tasmanian devil, Sarcophilus harrisii. Bioinformatic analyses of OC1 sequences in the Tasmanian devil genome suggest that this transposon infiltrated the common ancestor of the Dasyuridae family ~17 million years ago. This estimate is corroborated by a PCR-based screen for the presence/absence of this family in Tasmanian devils and closely-related species. This case of HTT is the first to be reported in dasyurids. It brings the number of animal lineages independently invaded by OC1 to 12, and adds a fourth continent to the pandemic-like pattern of invasion of this transposon. In the context of these data, we discuss the evolutionary history of this transposon family and its potential impact on the diversification of marsupials.

Horizontal transfer of OC1 transposons in the Tasmanian devil

PubMed Central

2013-01-01

Background There is growing recognition that horizontal DNA transfer, a process known to be common in prokaryotes, is also a significant source of genomic variation in eukaryotes. Horizontal transfer of transposable elements (HTT) may be especially prevalent in eukaryotes given the inherent mobility, widespread occurrence, and prolific abundance of these elements in many eukaryotic genomes. Results Here, we provide evidence for a new case of HTT of the transposon family OposCharlie1 (OC1) in the Tasmanian devil, Sarcophilus harrisii. Bioinformatic analyses of OC1 sequences in the Tasmanian devil genome suggest that this transposon infiltrated the common ancestor of the Dasyuridae family ~17 million years ago. This estimate is corroborated by a PCR-based screen for the presence/absence of this family in Tasmanian devils and closely-related species. Conclusions This case of HTT is the first to be reported in dasyurids. It brings the number of animal lineages independently invaded by OC1 to 12, and adds a fourth continent to the pandemic-like pattern of invasion of this transposon. In the context of these data, we discuss the evolutionary history of this transposon family and its potential impact on the diversification of marsupials. PMID:23445260

Removal of Zinc from Aqueous Solution by Optimized Oil Palm Empty Fruit Bunches Biochar as Low Cost Adsorbent

PubMed Central

Salleh, M. A. Mohd; Asady, Bahareh

2017-01-01

This study aims to produce optimized biochar from oil palm empty fruit bunches (OPEFB), as a green, low cost adsorbent for uptake of zinc from aqueous solution. The impact of pyrolysis conditions, namely, highest treatment temperature (HTT), heating rate (HR), and residence time (RT) on biochar yield and adsorption capacity towards zinc, was investigated. Mathematical modeling and optimization of independent variables were performed employing response surface methodology (RSM). HTT was found to be the most influential variable, followed by residence time and heating rate. Based on the central composite design (CCD), two quadratic models were developed to correlate three independent variables to responses. The optimum production condition for OPEFB biochar was found as follows: HTT of 615°C, HR of 8°C/min, and RT of 128 minutes. The optimum biochar showed 15.18 mg/g adsorption capacity for zinc and 25.49% of yield which was in agreement with the predicted values, satisfactory. Results of the characterization of optimum product illustrated well-developed BET surface area and porous structure in optimum product which favored its sorptive ability. PMID:28420949

Genetic exchange in eukaryotes through horizontal transfer: connected by the mobilome.

PubMed

Wallau, Gabriel Luz; Vieira, Cristina; Loreto, Élgion Lúcio Silva

2018-01-01

All living species contain genetic information that was once shared by their common ancestor. DNA is being inherited through generations by vertical transmission (VT) from parents to offspring and from ancestor to descendant species. This process was considered the sole pathway by which biological entities exchange inheritable information. However, Horizontal Transfer (HT), the exchange of genetic information by other means than parents to offspring, was discovered in prokaryotes along with strong evidence showing that it is a very important process by which prokaryotes acquire new genes. For some time now, it has been a scientific consensus that HT events were rare and non-relevant for evolution of eukaryotic species, but there is growing evidence supporting that HT is an important and frequent phenomenon in eukaryotes as well. Here, we will discuss the latest findings regarding HT among eukaryotes, mainly HT of transposons (HTT), establishing HTT once and for all as an important phenomenon that should be taken into consideration to fully understand eukaryotes genome evolution. In addition, we will discuss the latest development methods to detect such events in a broader scale and highlight the new approaches which should be pursued by researchers to fill the knowledge gaps regarding HTT among eukaryotes.

Mid-infrared spectrometry of milk for dairy metabolomics: a comparison of two sampling techniques and effect of homogenization.

PubMed

Aernouts, Ben; Polshin, Evgeny; Saeys, Wouter; Lammertyn, Jeroen

2011-10-31

Milk production is a dominant factor in the metabolism of dairy cows involving a very intensive interaction with the blood circulation. As a result, the extracted milk contains valuable information on the metabolic status of the cow. On-line measurement of milk components during milking two or more times a day would promote early detection of systemic and local alterations, thus providing a great input for strategic and management decisions. The objective of this study was to investigate the potential of mid-infrared (mid-IR) spectroscopy to measure the milk composition using two different measurement modes: micro attenuated total reflection (μATR) and high throughput transmission (HTT). Partial least squares (PLS) regression was used for prediction of fat, crude protein, lactose and urea after preprocessing IR data and selecting the most informative wavenumber variables. The prediction accuracies were determined separately for raw and homogenized copies of a wide range of milk samples in order to estimate the possibility for on-line analysis of the milk. In case of fat content both measurement modes resulted in an excellent prediction for homogenized samples (R(2)>0.92) but in poor results for raw samples (R(2)<0.70). Homogenization was however not mandatory to achieve good predictions for crude protein and lactose with both μATR and HTT, and urea with μATR spectroscopy. Excellent results were obtained for prediction of crude protein, lactose and urea content (R(2)>0.99, 0.98 and 0.86 respectively) in raw and homogenized milk using μATR IR spectroscopy. These results were significantly better than those obtained by HTT IR spectroscopy. However, the prediction performance of HTT was still good for crude protein and lactose content (R(2)>0.86 and 0.78 respectively) in raw and homogenized samples. However, the detection of urea in milk with HTT spectroscopy was significantly better (R(2)=0.69 versus 0.16) after homogenization of the milk samples. Based on these observations it can be concluded that μATR approach is most suitable for rapid at line or even on-line milk composition measurement, although homogenization is crucial to achieve good prediction of the fat content. Copyright © 2011 Elsevier B.V. All rights reserved.

Role of Myofibril-Inducing RNA in cardiac TnT expression in developing Mexican axolotl

PubMed Central

Sferrazza, Gian-Franco; Zhang, Chi; Jia, Pingping; Lemanski, Sharon L.; Athauda, Gagani; Stassi, Alyssa; Halager, Kristine; Maier, Jennifer A.; Rueda-de-Leon, Elena; Gupta, Amit; Dube, Syamalima; Huang, Xupei; Prentice, Howard M.; Dube, Dipak K.; Lemanski, Larry F.

2007-01-01

The Mexican axolotl, Ambystoma mexicanum, has been a useful animal model to study heart development and cardiac myofibrillogenesis. A naturally-occurring recessive mutant, gene “c”, for cardiac non-function in the Mexican axolotl causes a failure of myofibrillogenesis due to a lack of tropomyosin expression in homozygous mutant (c/c) embryonic hearts.. Myofibril-Inducing RNA (MIR) rescues mutant hearts in vitro by promoting tropomyosin expression and myofibril formation thereafter. We have studied the effect of MIR on the expression of various isoforms of cardiac Troponin-T (cTnT), a component of the thin filament that binds with tropomyosin. Four alternatively spliced cTnT isoforms have been characterized from developing axolotl heart. The expression of various cTnT isoforms in normal, mutant, and mutant hearts corrected with MIR, is evaluated by real-time RT-PCR using isoform specific primer pairs; MIR affects the total transcription as well as the splicing of the cTnT in axolotl heart PMID:17408593

A gain-of-function mutation of plastidic invertase alters nuclear gene expression with sucrose treatment partially via GENOMES UNCOUPLED1-mediated signaling.

PubMed

Maruta, Takanori; Miyazaki, Nozomi; Nosaka, Ryota; Tanaka, Hiroyuki; Padilla-Chacon, Daniel; Otori, Kumi; Kimura, Ayako; Tanabe, Noriaki; Yoshimura, Kazuya; Tamoi, Masahiro; Shigeoka, Shigeru

2015-05-01

Plastid gene expression (PGE) is one of the signals that regulate the expression of photosynthesis-associated nuclear genes (PhANGs) via GENOMES UNCOUPLED1 (GUN1)-dependent retrograde signaling. We recently isolated Arabidopsis sugar-inducible cotyledon yellow-192 (sicy-192), a gain-of-function mutant of plastidic invertase, and showed that following the treatment of this mutant with sucrose, the expression of PhANGs as well as PGE decreased, suggesting that the sicy-192 mutation activates a PGE-evoked and GUN1-mediated retrograde pathway. To clarify the relationship between the sicy-192 mutation, PGE, and GUN1-mediated pathway, plastid and nuclear gene expression in a double mutant of sicy-192 and gun1-101, a null mutant of GUN1 was studied. Plastid-encoded RNA polymerase (PEP)-dependent PGE was markedly suppressed in the sicy-192 mutant by the sucrose treatment, but the suppression as well as cotyledon yellow phenotype was not mitigated by GUN1 disruption. Microarray analysis revealed that the altered expression of nuclear genes such as PhANG in the sucrose-treated sicy-192 mutant was largely dependent on GUN1. The present findings demonstrated that the sicy-192 mutation alters nuclear gene expression with sucrose treatment via GUN1, which is possibly followed by inhibiting PEP-dependent PGE, providing a new insight into the role of plastid sugar metabolism in nuclear gene expression. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis.

PubMed

Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok

2015-10-26

Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.

Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157 : H7.

PubMed

Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L

2010-05-01

Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.

Synergistic Toxicity of Polyglutamine-Expanded TATA-Binding Protein in Glia and Neuronal Cells: Therapeutic Implications for Spinocerebellar Ataxia 17

PubMed Central

Yang, Yang; Cui, Yiting; Tang, Beisha

2017-01-01

Spinocerebellar ataxia 17 (SCA17) is caused by polyglutamine (polyQ) repeat expansion in the TATA-binding protein (TBP) and is among a family of neurodegenerative diseases in which polyQ expansion leads to preferential neuronal loss in the brain. Although previous studies have demonstrated that expression of polyQ-expanded proteins in glial cells can cause neuronal injury via noncell-autonomous mechanisms, these studies investigated animal models that overexpress transgenic mutant proteins. Since glial cells are particularly reactive to overexpressed mutant proteins, it is important to investigate the in vivo role of glial dysfunction in neurodegeneration when mutant polyQ proteins are endogenously expressed. In the current study, we generated two conditional TBP-105Q knock-in mouse models that specifically express mutant TBP at the endogenous level in neurons or in astrocytes. We found that mutant TBP expression in neuronal cells or astrocytes alone only caused mild neurodegeneration, whereas severe neuronal toxicity requires the expression of mutant TBP in both neuronal and glial cells. Coculture of neurons and astrocytes further validated that mutant TBP in astrocytes promoted neuronal injury. We identified activated inflammatory signaling pathways in mutant TBP-expressing astrocytes, and blocking nuclear factor κB (NF-κB) signaling in astrocytes ameliorated neurodegeneration. Our results indicate that the synergistic toxicity of mutant TBP in neuronal and glial cells plays a critical role in SCA17 pathogenesis and that targeting glial inflammation could be a potential therapeutic approach for SCA17 treatment. SIGNIFICANCE STATEMENT Mutant TBP with polyglutamine expansion preferentially affects neuronal viability in SCA17 patients. Whether glia, the cells that support and protect neurons, contribute to neurodegeneration in SCA17 remains mostly unexplored. In this study, we provide both in vivo and in vitro evidence arguing that endogenous expression of mutant TBP in neurons and glia synergistically impacts neuronal survival. Hyperactivated inflammatory signaling pathways, particularly the NF-κB pathway, underlie glia-mediated neurotoxicity. Moreover, blocking NF-κB activity with small chemical inhibitors alleviated such neurotoxicity. Our study establishes glial dysfunction as an important component of SCA17 pathogenesis and suggests targeting glial inflammation as a potential therapeutic approach for SCA17 treatment. PMID:28821675

Root-expressed maize lipoxygenase 3 negatively regulates induced systemic resistance to Colletotrichum graminicola in shoots

PubMed Central

Constantino, Nasie N.; Mastouri, Fatemeh; Damarwinasis, Ramadhika; Borrego, Eli J.; Moran-Diez, Maria E.; Kenerley, Charley M.; Gao, Xiquan; Kolomiets, Michael V.

2013-01-01

We have previously reported that disruption of a maize root-expressed 9-lipoxygenase (9-LOX) gene, ZmLOX3, results in dramatic increase in resistance to diverse leaf and stalk pathogens. Despite evident economic significance of these findings, the mechanism behind this increased resistance remained elusive. In this study, we found that increased resistance of the lox3-4 mutants is due to constitutive activation of induced systemic resistance (ISR) signaling. We showed that ZmLOX3 lacked expression in leaves in response to anthracnose leaf blight pathogen Colletotrichum graminicola, but was expressed constitutively in the roots, thus, prompting our hypothesis: the roots of lox3-4 mutants are the source of increased resistance in leaves. Supporting this hypothesis, treatment of wild-type plants (WT) with xylem sap of lox3-4 mutant induced resistance to C. graminicola to the levels comparable to those observed in lox3-4 mutant. Moreover, treating mutants with the sap collected from WT plants partially restored the susceptibility to C. graminicola. lox3-4 mutants showed primed defense responses upon infection, which included earlier and greater induction of defense-related PAL and GST genes compared to WT. In addition to the greater expression of the octadecanoid pathway genes, lox3-4 mutant responded earlier and with a greater accumulation of H2O2 in response to C. graminicola infection or treatment with alamethicin. These findings suggest that lox3-4 mutants display constitutive ISR-like signaling. In support of this idea, root colonization by Trichoderma virens strain GV29-8 induced the same level of disease resistance in WT as the treatment with the mutant sap, but had no additional resistance effect in lox3-4 mutant. While treatment with T. virens GV29 strongly and rapidly suppressed ZmLOX3 expression in hydroponically grown WT roots, T. virens Δsml mutant, which is deficient in ISR induction, was unable to suppress expression of ZmLOX3, thus, providing genetic evidence that SM1 function in ISR, at least in part, by suppressing host ZmLOX3 gene. This study and the genetic tools generated herein will allow the identification of the signals regulating the induction of resistance to aboveground attackers by beneficial soil microorganisms in the future. PMID:24391653

Synthetic Lethality of a Novel Small Molecule Against Mutant KRAS-Expressing Cancer Cells Involves AKT-Dependent ROS Production.

PubMed

Iskandar, Kartini; Rezlan, Majidah; Yadav, Sanjiv Kumar; Foo, Chuan Han Jonathan; Sethi, Gautam; Qiang, Yu; Bellot, Gregory L; Pervaiz, Shazib

2016-05-10

We recently reported the death-inducing activity of a small-molecule compound, C1, which triggered reactive oxygen species (ROS)-dependent autophagy-associated apoptosis in a variety of human cancer cell lines. In this study, we examine the ability of the compound to specifically target cancer cells harboring mutant KRAS with minimal activity against wild-type (WT) RAS-expressing cells. HCT116 cells expressing mutated KRAS are susceptible, while the WT-expressing HT29 cells are resistant. Interestingly, C1 triggers activation of mutant RAS, which results in the downstream phosphorylation and activation of AKT/PKB. Gene knockdown of KRAS or AKT or their pharmacological inhibition resulted in the abrogation of C1-induced ROS production and rescued tumor colony-forming ability. We also made use of HCT116 mutant KRAS knockout (KO) cells, which express only a single WT KRAS allele. Exposure of KO cells to C1 failed to increase mitochondrial ROS and cell death, unlike the parental cells harboring mutant KRAS. Similarly, mutant KRAS-transformed prostate epithelial cells (RWPE-1-RAS) were more sensitive to the ROS-producing and death-inducing effects of C1 than the vector only expressing RWPE-1 cells. An in vivo model of xenograft tumors generated with HCT116 KRAS(WT/MUT) or KRAS(WT/-) cells showed the efficacy of C1 treatment and its ability to affect the relative mitotic index in tumors harboring KRAS mutant. These data indicate a synthetic lethal effect against cells carrying mutant KRAS, which could have therapeutic implications given the paucity of KRAS-specific chemotherapeutic strategies. Antioxid. Redox Signal. 24, 781-794.

Cellular and molecular mechanisms of autosomal dominant form of progressive hearing loss, DFNA2.

PubMed

Kim, Hyo Jeong; Lv, Ping; Sihn, Choong-Ryoul; Yamoah, Ebenezer N

2011-01-14

Despite advances in identifying deafness genes, determination of the underlying cellular and functional mechanisms for auditory diseases remains a challenge. Mutations of the human K(+) channel hKv7.4 lead to post-lingual progressive hearing loss (DFNA2), which affects world-wide population with diverse racial backgrounds. Here, we have generated the spectrum of point mutations in the hKv7.4 that have been identified as diseased mutants. We report that expression of five point mutations in the pore region, namely L274H, W276S, L281S, G285C, and G296S, as well as the C-terminal mutant G321S in the heterologous expression system, yielded non-functional channels because of endoplasmic reticulum retention of the mutant channels. We mimicked the dominant diseased conditions by co-expressing the wild-type and mutant channels. As compared with expression of wild-type channel alone, the blend of wild-type and mutant channel subunits resulted in reduced currents. Moreover, the combinatorial ratios of wild type:mutant and the ensuing current magnitude could not be explained by the predictions of a tetrameric channel and a dominant negative effect of the mutant subunits. The results can be explained by the dependence of cell surface expression of the mutant on the wild-type subunit. Surprisingly, a transmembrane mutation F182L, which has been identified in a pre-lingual progressive hearing loss patient in Taiwan, yielded cell surface expression and functional features that were similar to that of the wild type, suggesting that this mutation may represent redundant polymorphism. Collectively, these findings provide traces of the cellular mechanisms for DFNA2.

Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai

Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species.more » The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.« less

A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

PubMed Central

Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

2015-01-01

Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

Prominent dominant negative effect of a mutant Fas molecule lacking death domain on cell-mediated induction of apoptosis.

PubMed

Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata

2005-01-01

Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.

Expression in Bacillus subtilis of the Bacillus thuringiensis cryIIIA toxin gene is not dependent on a sporulation-specific sigma factor and is increased in a spo0A mutant.

PubMed

Agaisse, H; Lereclus, D

1994-08-01

Expression of the Bacillus thuringiensis cryIIIA gene encoding a Coleoptera-specific toxin is weak during vegetative growth and is activated at the onset of the stationary phase. cryIIIA'-'lacZ fusions and primer extension analysis show that the regulation of cryIIIA expression is similar in Bacillus subtilis and in B. thuringiensis. Activation of cryIIIA expression was not altered in B. subtilis mutant strains deficient for the sigma H and sigma E sporulation-specific sigma factors or for minor sigma factors such as sigma B, sigma D, or sigma L. This result and the nucleotide sequence of the -35 and -10 regions of the cryIIIA promoter suggest that cryIIIA expression might be directed by the E sigma A form of RNA polymerase. Expression of the cryIIIA'-'lacZ fusion is shut off after t2 (2 h after time zero) of sporulation in the B. subtilis wild-type strain grown on nutrient broth sporulation medium. However, no decrease in cryIIIA-directed beta-galactosidase activity occurred in sigma H, kinA, or spo0A mutant strains. Moreover, beta-galactosidase activity was higher and remained elevated after t2 in the spo0A mutant strain. beta-Galactosidase activity was weak in abrB and spo0A abrB mutant strains, suggesting that AbrB is responsible for the higher level of cryIIIA expression observed in a spo0A mutant. However, both in spo0A and spo0A abrB mutant strains, beta-galactosidase activity remained elevated after t2, suggesting that even in the absence of AbrB, cryIIIA expression is controlled through modulation of the phosphorylated form of Spo0A. When the cryIIIA gene is expressed in a B. subtilis spo0A mutant strain or in the 168 wild-type strain, large amounts of toxins are produced and accumulate to form a flat rectangular crystal characteristic of the coleopteran-specific B. thuringiensis strains.

The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females

PubMed Central

Sakai, Takaomi; Kasuya, Junko; Kitamoto, Toshihiro; Aigaki, Toshiro

2009-01-01

Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. Here we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNAi in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. On the other hand, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity. PMID:19531155

The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females.

PubMed

Sakai, T; Kasuya, J; Kitamoto, T; Aigaki, T

2009-07-01

Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. In this study, we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNA interference (RNAi) in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. However, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity.

Identification of Novel Glycosyltransferases Required for Assembly of the Pasteurella multocida A:1 Lipopolysaccharide and Their Involvement in Virulence▿ †

PubMed Central

Boyce, John D.; Harper, Marina; St. Michael, Frank; John, Marietta; Aubry, Annie; Parnas, Henrietta; Logan, Susan M.; Wilkie, Ian W.; Ford, Mark; Cox, Andrew D.; Adler, Ben

2009-01-01

We previously determined the structure of the Pasteurella multocida Heddleston type 1 lipopolysaccharide (LPS) molecule and characterized some of the transferases essential for LPS biosynthesis. We also showed that P. multocida strains expressing truncated LPS display reduced virulence. Here, we have identified all of the remaining glycosyltransferases required for synthesis of the oligosaccharide extension of the P. multocida Heddleston type 1 LPS, including a novel α-1,6 glucosyltransferase, a β-1,4 glucosyltransferase, a putative bifunctional galactosyltransferase, and two heptosyltransferases. In addition, we identified a novel oligosaccharide extension expressed only in a heptosyltransferase (hptE) mutant background. All of the analyzed mutants expressing LPS with a truncated main oligosaccharide extension displayed reduced virulence, but those expressing LPS with an intact heptose side chain were able to persist for long periods in muscle tissue. The hptC mutant, which expressed LPS with the shortest oligosaccharide extension and no heptose side chain, was unable to persist on the muscle or cause any disease. Furthermore, all of the mutants displayed increased sensitivity to the chicken antimicrobial peptide fowlicidin 1, with mutants expressing highly truncated LPS being the most sensitive. PMID:19168738

Determining the Advantages, Costs, and Trade-Offs of a Novel Sodium Channel Mutation in the Copepod Acartia hudsonica to Paralytic Shellfish Toxins (PST)

PubMed Central

Finiguerra, Michael; Avery, David E.; Dam, Hans G.

2015-01-01

The marine copepod Acartia hudsonica was shown to be adapted to dinoflagellate prey, Alexandrium fundyense, which produce paralytic shellfish toxins (PST). Adaptation to PSTs in other organisms is caused by a mutation in the sodium channel. Recently, a mutation in the sodium channel in A. hudsonica was found. In this study, we rigorously tested for advantages, costs, and trade-offs associated with the mutant isoform of A. hudsonica under toxic and non-toxic conditions. We combined fitness with wild-type: mutant isoform ratio measurements on the same individual copepod to test our hypotheses. All A. hudsonica copepods express both the wild-type and mutant sodium channel isoforms, but in different proportions; some individuals express predominantly mutant (PMI) or wild-type isoforms (PWI), while most individuals express relatively equal amounts of each (EI). There was no consistent pattern of improved performance as a function of toxin dose for egg production rate (EPR), ingestion rate (I), and gross growth efficiency (GGE) for individuals in the PMI group relative to individuals in the PWI expression group. Neither was there any evidence to indicate a fitness benefit to the mutant isoform at intermediate toxin doses. No clear advantage under toxic conditions was associated with the mutation. Using a mixed-diet approach, there was also no observed relationship between individual wild-type: mutant isoform ratios and among expression groups, on both toxic and non-toxic diets, for eggs produced over three days. Lastly, expression of the mutant isoform did not mitigate the negative effects of the toxin. That is, the reductions in EPR from a toxic to non-toxic diet for copepods were independent of expression groups. Overall, the results did not support our hypotheses; the mutant sodium channel isoform does not appear to be related to adaptation to PST in A. hudsonica. Other potential mechanisms responsible for the adaptation are discussed. PMID:26075900

Genetic requirements for high constitutive SOS expression in recA730 mutants of Escherichia coli.

PubMed

Vlašić, Ignacija; Šimatović, Ana; Brčić-Kostić, Krunoslav

2011-09-01

The RecA protein in its functional state is in complex with single-stranded DNA, i.e., in the form of a RecA filament. In SOS induction, the RecA filament functions as a coprotease, enabling the autodigestion of the LexA repressor. The RecA filament can be formed by different mechanisms, but all of them require three enzymatic activities essential for the processing of DNA double-stranded ends. These are helicase, 5'-3' exonuclease, and RecA loading onto single-stranded DNA (ssDNA). In some mutants, the SOS response can be expressed constitutively during the process of normal DNA metabolism. The RecA730 mutant protein is able to form the RecA filament without the help of RecBCD and RecFOR mediators since it better competes with the single-strand binding (SSB) protein for ssDNA. As a consequence, the recA730 mutants show high constitutive SOS expression. In the study described in this paper, we studied the genetic requirements for constitutive SOS expression in recA730 mutants. Using a β-galactosidase assay, we showed that the constitutive SOS response in recA730 mutants exhibits different requirements in different backgrounds. In a wild-type background, the constitutive SOS response is partially dependent on RecBCD function. In a recB1080 background (the recB1080 mutation retains only helicase), constitutive SOS expression is partially dependent on RecBCD helicase function and is strongly dependent on RecJ nuclease. Finally, in a recB-null background, the constitutive SOS expression of the recA730 mutant is dependent on the RecJ nuclease. Our results emphasize the importance of the 5'-3' exonuclease for high constitutive SOS expression in recA730 mutants and show that RecBCD function can further enhance the excellent intrinsic abilities of the RecA730 protein in vivo. Copyright © 2011, American Society for Microbiology. All Rights Reserved.

Induction of expression and co-localization of heat shock polypeptides with the polyalanine expansion mutant of poly(A)-binding protein N1 after chemical stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Qishan; Bag, Jnanankur

Formation of nuclear inclusions consisting of aggregates of a polyalanine expansion mutant of nuclear poly(A)-binding protein (PABPN1) is the hallmark of oculopharyngeal muscular dystrophy (OPMD). OPMD is a late onset autosomal dominant disease. Patients with this disorder exhibit progressive swallowing difficulty and drooping of their eye lids, which starts around the age of 50. Previously we have shown that treatment of cells expressing the mutant PABPN1 with a number of chemicals such as ibuprofen, indomethacin, ZnSO{sub 4}, and 8-hydroxy-quinoline induces HSP70 expression and reduces PABPN1 aggregation. In these studies we have shown that expression of additional HSPs including HSP27, HSP40,more » and HSP105 were induced in mutant PABPN1 expressing cells following exposure to the chemicals mentioned above. Furthermore, all three additional HSPs were translocated to the nucleus and probably helped to properly fold the mutant PABPN1 by co-localizing with this protein.« less

The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib

PubMed Central

Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Kirkwood, John; Avogadri-Connors, Francesca; Cutler Jr, Richard E.; Lalani, Alshad S.; Dent, Paul

2018-01-01

ABSTRACT The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins. PMID:29219657

The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib.

PubMed

Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

2018-02-01

The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins.

Functional Heterologous Protein Expression by Genetically Engineered Probiotic Yeast Saccharomyces boulardii

PubMed Central

Hudson, Lauren E.; Fasken, Milo B.; McDermott, Courtney D.; McBride, Shonna M.; Kuiper, Emily G.; Guiliano, David B.; Corbett, Anita H.; Lamb, Tracey J.

2014-01-01

Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders. PMID:25391025

Functional heterologous protein expression by genetically engineered probiotic yeast Saccharomyces boulardii.

PubMed

Hudson, Lauren E; Fasken, Milo B; McDermott, Courtney D; McBride, Shonna M; Kuiper, Emily G; Guiliano, David B; Corbett, Anita H; Lamb, Tracey J

2014-01-01

Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders.

Study the Expression of ompf Gene in Esherichia coli Mutants.

PubMed

Jaktaji, R Pourahmad; Heidari, F

2013-09-01

The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5' end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription.

First molecular modeling report on novel arylpyrimidine kynurenine monooxygenase inhibitors through multi-QSAR analysis against Huntington's disease: A proposal to chemists!

PubMed

Amin, Sk Abdul; Adhikari, Nilanjan; Jha, Tarun; Gayen, Shovanlal

2016-12-01

Huntington's disease (HD) is caused by mutation of huntingtin protein (mHtt) leading to neuronal cell death. The mHtt induced toxicity can be rescued by inhibiting the kynurenine monooxygenase (KMO) enzyme. Therefore, KMO is a promising drug target to address the neurodegenerative disorders such as Huntington's diseases. Fiftysix arylpyrimidine KMO inhibitors are structurally explored through regression and classification based multi-QSAR modeling, pharmacophore mapping and molecular docking approaches. Moreover, ten new compounds are proposed and validated through the modeling that may be effective in accelerating Huntington's disease drug discovery efforts. Copyright © 2016 Elsevier Ltd. All rights reserved.

Stress Marker Signatures in Lesion Mimic Single and Double Mutants Identify a Crucial Leaf Age-Dependent Salicylic Acid Related Defense Signal.

PubMed

Kaurilind, Eve; Brosché, Mikael

2017-01-01

Plants are exposed to abiotic and biotic stress conditions throughout their lifespans that activates various defense programs. Programmed cell death (PCD) is an extreme defense strategy the plant uses to manage unfavorable environments as well as during developmentally induced senescence. Here we investigated the role of leaf age on the regulation of defense gene expression in Arabidopsis thaliana. Two lesion mimic mutants with misregulated cell death, catalase2 (cat2) and defense no death1 (dnd1) were used together with several double mutants to dissect signaling pathways regulating defense gene expression associated with cell death and leaf age. PCD marker genes showed leaf age dependent expression, with the highest expression in old leaves. The salicylic acid (SA) biosynthesis mutant salicylic acid induction deficient2 (sid2) had reduced expression of PCD marker genes in the cat2 sid2 double mutant demonstrating the importance of SA biosynthesis in regulation of defense gene expression. While the auxin- and jasmonic acid (JA)- insensitive auxin resistant1 (axr1) double mutant cat2 axr1 also led to decreased expression of PCD markers; the expression of several marker genes for SA signaling (ISOCHORISMATE SYNTHASE 1, PR1 and PR2) were additionally decreased in cat2 axr1 compared to cat2. The reduced expression of these SA markers genes in cat2 axr1 implicates AXR1 as a regulator of SA signaling in addition to its known role in auxin and JA signaling. Overall, the current study reinforces the important role of SA signaling in regulation of leaf age-related transcript signatures.

Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

PubMed Central

Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

1999-01-01

Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

Computational method to predict thermodynamic, transport, and flow properties for the modified Langley 8-foot high-temperature tunnel

NASA Technical Reports Server (NTRS)

Venkateswaran, S.; Hunt, L. Roane; Prabhu, Ramadas K.

1992-01-01

The Langley 8 foot high temperature tunnel (8 ft HTT) is used to test components of hypersonic vehicles for aerothermal loads definition and structural component verification. The test medium of the 8 ft HTT is obtained by burning a mixture of methane and air under high pressure; the combustion products are expanded through an axisymmetric conical contoured nozzle to simulate atmospheric flight at Mach 7. This facility was modified to raise the oxygen content of the test medium to match that of air and to include Mach 4 and Mach 5 capabilities. These modifications will facilitate the testing of hypersonic air breathing propulsion systems for a wide range of flight conditions. A computational method to predict the thermodynamic, transport, and flow properties of the equilibrium chemically reacting oxygen enriched methane-air combustion products was implemented in a computer code. This code calculates the fuel, air, and oxygen mass flow rates and test section flow properties for Mach 7, 5, and 4 nozzle configurations for given combustor and mixer conditions. Salient features of the 8 ft HTT are described, and some of the predicted tunnel operational characteristics are presented in the carpet plots to assist users in preparing test plans.

Interaction of Huntingtin Exon-1 Peptides with Lipid-Based Micellar Nanoparticles Probed by Solution NMR and Q-Band Pulsed EPR.

PubMed

Ceccon, Alberto; Schmidt, Thomas; Tugarinov, Vitali; Kotler, Samuel A; Schwieters, Charles D; Clore, G Marius

2018-05-23

Lipid-based micellar nanoparticles promote aggregation of huntingtin exon-1 peptides. Here we characterize the interaction of two such peptides, htt NT Q  7 and htt NT Q  10 comprising the N-terminal amphiphilic domain of huntingtin followed by 7 and 10 glutamine repeats, respectively, with 8 nm lipid micelles using NMR chemical exchange saturation transfer (CEST), circular dichroism and pulsed Q-band EPR. Exchange between free and micelle-bound htt NT Q  n peptides occurs on the millisecond time scale with a K D ∼ 0.5-1 mM. Upon binding micelles, residues 1-15 adopt a helical conformation. Oxidation of Met 7 to a sulfoxide reduces the binding affinity for micelles ∼3-4-fold and increases the length of the helix by a further two residues. A structure of the bound monomer unit is calculated from the backbone chemical shifts of the micelle-bound state obtained from CEST. Pulsed Q-band EPR shows that a monomer-dimer equilibrium exists on the surface of the micelles and that the two helices of the dimer adopt a parallel orientation, thereby bringing two disordered polyQ tails into close proximity which may promote aggregation upon dissociation from the micelle surface.

Adverse Outcome Pathways – Organizing Toxicological ...

EPA Pesticide Factsheets

The number of chemicals for which environmental regulatory decisions are required far exceeds the current capacity for toxicity testing. High throughput screening (HTS) commonly used for drug discovery has the potential to increase this capacity. The adverse outcome pathway (AOP) concept has emerged as a natural framework for connecting high throughput toxicity testing (HTT) results to potential impacts on humans and wildlife populations. An AOP consists of two main components that describe the biological mechanisms driving toxicity. Key events represent biological processes essential for causing the adverse outcome that are also measurable experimentally. Key event relationships capture the biological processes connecting the key events. Evidence documented for each KER based on measurements of the KEs can provide the confidence needed for extrapolating HTT from early key events to overt toxicity represented by later key events based on the AOP. The IPCS mode of action (MOA) framework incorporates information required for making a chemical-specific toxicity determination. Given the close relationship between the AOP and MOA frameworks, it is possible to assemble an MOA by incorporating HTT results, chemical properties including absorption, distribution, metabolism, and excretion (ADME), and an AOP describing the biological basis of toxicity thereby streamlining the process. While current applications focus on the assessment of risk for environmental chemicals,

Investigating the Structural Impact of the Glutamine Repeat in Huntingtin Assembly

DOE Office of Scientific and Technical Information (OSTI.GOV)

Perevozchikova, Tatiana; Stanley, Christopher B; McWilliams-Koeppen, Helen P

2014-01-01

Acquiring detailed structural information about the various aggregation states of the huntingtin-exon1 protein (Htt-exon1) is crucial not only for identifying the true nature of the neurotoxic species responsible for Huntington s disease (HD) but also for designing effective therapeutics. Using time-resolved small-angle neutron scattering (TR-SANS), we followed the conformational changes that occurred during fibrillization of the pathologic form of Htt-exon1 (NtQ42P10) and compared the results with those obtained for the wild-type (NtQ22P10). Our results show that the aggregation pathway of NtQ22P10 is very different from that of NtQ42P10, as the initial steps require a monomer to 7-mer transition stage. Inmore » contrast, the earliest species identified for NtQ42P10 are monomer and dimer. The divergent pathways ultimately result in NtQ22P10 fibrils that possess a pack- ing arrangement consistent with the common amyloid sterical zipper model, whereas NtQ42P10 fibrils present a better fit to the Perutz b-helix structural model. The structural details obtained by TR-SANS should help to delineate the key mechanisms that underpin Htt-exon1 aggregation leading to HD.« less

Assembly of Huntingtin headpiece into α-helical bundles.

PubMed

Ozgur, Beytullah; Sayar, Mehmet

2017-05-24

Protein aggregation is a hallmark of neurodegenerative disorders. In this group of brain-related disorders, a disease-specific "host" protein or fragment misfolds and adopts a metastatic, aggregate-prone conformation. Often, this misfolded conformation is structurally and thermodynamically different from its native state. Intermolecular contacts, which arise in this non-native state, promote aggregation. In this regard, understanding the molecular principles and mechanisms that lead to the formation of such a non-native state and further promote the formation of the critical nucleus for fiber growth is essential. In this study, the authors analyze the aggregation propensity of Huntingtin headpiece (htt NT ), which is known to facilitate the polyQ aggregation, in relation to the helix mediated aggregation mechanism proposed by the Wetzel group. The authors demonstrate that even though htt NT displays a degenerate conformational spectrum on its own, interfaces of macroscopic or molecular origin can promote the α-helix conformation, eliminating all other alternatives in the conformational phase space. Our findings indicate that htt NT molecules do not have a strong orientational preference for parallel or antiparallel orientation of the helices within the aggregate. However, a parallel packed bundle of helices would support the idea of increased polyglutamine concentration, to pave the way for cross-β structures.

The electron donating capacity of biochar is dramatically underestimated

PubMed Central

Prévoteau, Antonin; Ronsse, Frederik; Cid, Inés; Boeckx, Pascal; Rabaey, Korneel

2016-01-01

Biochars have gathered considerable interest for agronomic and engineering applications. In addition to their high sorption ability, biochars have been shown to accept or donate considerable amounts of electrons to/from their environment via abiotic or microbial processes. Here, we measured the electron accepting (EAC) and electron donating (EDC) capacities of wood-based biochars pyrolyzed at three different highest treatment temperatures (HTTs: 400, 500, 600 °C) via hydrodynamic electrochemical techniques using a rotating disc electrode. EACs and EDCs varied with HTT in accordance with a previous report with a maximal EAC at 500 °C (0.4 mmol(e−).gchar−1) and a large decrease of EDC with HTT. However, while we monitored similar EAC values than in the preceding study, we show that the EDCs have been underestimated by at least 1 order of magnitude, up to 7 mmol(e−).gchar−1 for a HTT of 400 °C. We attribute this existing underestimation to unnoticed slow kinetics of electron transfer from biochars to the dissolved redox mediators used in the monitoring. The EDC of other soil organic constituents such as humic substances may also have been underestimated. These results imply that the redox properties of biochars may have a much bigger impact on soil biogeochemical processes than previously conjectured. PMID:27628746

Andrographolide induces degradation of mutant p53 via activation of Hsp70.

PubMed

Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

2018-05-22

The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

Mutant TDP-43 within motor neurons drives disease onset but not progression in amyotrophic lateral sclerosis.

PubMed

Ditsworth, Dara; Maldonado, Marcus; McAlonis-Downes, Melissa; Sun, Shuying; Seelman, Amanda; Drenner, Kevin; Arnold, Eveline; Ling, Shuo-Chien; Pizzo, Donald; Ravits, John; Cleveland, Don W; Da Cruz, Sandrine

2017-06-01

Mutations in TDP-43 cause amyotrophic lateral sclerosis (ALS), a fatal paralytic disease characterized by degeneration and premature death of motor neurons. The contribution of mutant TDP-43-mediated damage within motor neurons was evaluated using mice expressing a conditional allele of an ALS-causing TDP-43 mutant (Q331K) whose broad expression throughout the central nervous system mimics endogenous TDP-43. TDP-43 Q331K mice develop age- and mutant-dependent motor deficits from degeneration and death of motor neurons. Cre-recombinase-mediated excision of the TDP-43 Q331K gene from motor neurons is shown to delay onset of motor symptoms and appearance of TDP-43-mediated aberrant nuclear morphology, and abrogate subsequent death of motor neurons. However, reduction of mutant TDP-43 selectively in motor neurons did not prevent age-dependent degeneration of axons and neuromuscular junction loss, nor did it attenuate astrogliosis or microgliosis. Thus, disease mechanism is non-cell autonomous with mutant TDP-43 expressed in motor neurons determining disease onset but progression defined by mutant acting within other cell types.

Zebrafish aussicht mutant embryos exhibit widespread overexpression of ace (fgf8) and coincident defects in CNS development.

PubMed

Heisenberg, C P; Brennan, C; Wilson, S W

1999-05-01

During the development of the zebrafish nervous system both noi, a zebrafish pax2 homolog, and ace, a zebrafish fgf8 homolog, are required for development of the midbrain and cerebellum. Here we describe a dominant mutation, aussicht (aus), in which the expression of noi and ace is upregulated. In aus mutant embryos, ace is upregulated at many sites in the embryo, while noi expression is only upregulated in regions of the forebrain and midbrain which also express ace. Subsequent to the alterations in noi and ace expression, aus mutants exhibit defects in the differentiation of the forebrain, midbrain and eyes. Within the forebrain, the formation of the anterior and postoptic commissures is delayed and the expression of markers within the pretectal area is reduced. Within the midbrain, En and wnt1 expression is expanded. In heterozygous aus embryos, there is ectopic outgrowth of neural retina in the temporal half of the eyes, whereas in putative homozygous aus embryos, the ventral retina is reduced and the pigmented retinal epithelium is expanded towards the midline. The observation that aus mutant embryos exhibit widespread upregulation of ace raised the possibility that aus might represent an allele of the ace gene itself. However, by crossing carriers for both aus and ace, we were able to generate homozygous ace mutant embryos that also exhibited the aus phenotype. This indicated that aus is not tightly linked to ace and is unlikely to be a mutation directly affecting the ace locus. However, increased Ace activity may underly many aspects of the aus phenotype and we show that the upregulation of noi in the forebrain of aus mutants is partially dependent upon functional Ace activity. Conversely, increased ace expression in the forebrain of aus mutants is not dependent upon functional Noi activity. We conclude that aus represents a mutation involving a locus normally required for the regulation of ace expression during embryogenesis.

Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

PubMed Central

Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

2015-01-01

Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

Dominant negative mutant of ionotropic glutamate receptor subunit GluR3: implications for the role of a cysteine residue for its channel activity and pharmacological properties.

PubMed Central

Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K

1997-01-01

We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754

Integration of multiple stimuli-sensing systems to regulate HrpS and type III secretion system in Erwinia amylovora.

PubMed

Lee, Jae Hoon; Zhao, Youfu

2018-02-01

The bacterial enhancer binding protein (bEBP) HrpS is essential for Erwinia amylovora virulence by activating the type III secretion system (T3SS). However, how the hrpS gene is regulated remains poorly understood in E. amylovora. In this study, 5' rapid amplification of cDNA ends and promoter deletion analyses showed that the hrpS gene contains two promoters driven by HrpX/HrpY and the Rcs phosphorelay system, respectively. Electrophoretic mobility shift and gene expression assays demonstrated that integration host factor IHF positively regulates hrpS expression through directly binding the hrpX promoter and positively regulating hrpX/hrpY expression. Moreover, hrpX expression was down-regulated in the relA/spoT ((p)ppGpp-deficient) mutant and the dksA mutant, but up-regulated when the wild-type strain was treated with serine hydroxamate, which induced (p)ppGpp-mediated stringent response. Furthermore, the csrA mutant showed significantly reduced transcripts of major hrpS activators, including the hrpX/hrpY, rcsA and rcsB genes, indicating that CsrA is required for full hrpS expression. On the other hand, the csrB mutant exhibited up-regulation of the rcsA and rcsB genes, and hrpS expression was largely diminished in the csrB/rcsB mutant, indicating that the Rcs system is mainly responsible for the increased hrpS expression in the csrB mutant. These findings suggest that E. amylovora recruits multiple stimuli-sensing systems, including HrpX/HrpY, the Rcs phosphorelay system and the Gac-Csr system, to regulate hrpS and T3SS gene expression.

Mutants with Enhanced Nitrogenase Activity in Hydroponic Azospirillum brasilense-Wheat Associations

PubMed Central

Pereg Gerk, Lily; Gilchrist, Kate; Kennedy, Ivan R.

2000-01-01

The effect of a mutation affecting flocculation, differentiation into cyst-like forms, and root colonization on nitrogenase expression by Azospirillum brasilense is described. The gene flcA of strain Sp7 restored these phenotypes in spontaneous mutants of both strains Sp7 and Sp245. Employing both constitutive pLA-lacZ and nifH-lacZ reporter fusions expressed in situ, the colony morphology, colonization pattern, and potential for nitrogenase activity of spontaneous mutants and flcA Tn5-induced mutants were established. The results of this study show that the ability of Sp7 and Sp245 mutant strains to remain in a vegetative form improved their ability to express nitrogenase activity in association with wheat in a hydroponic system. Restoring the cyst formation and colonization pattern to the spontaneous mutant Sp7-S reduced nitrogenase activity rates in association with plants to that of the wild-type Sp7. Although Tn5-induced flcA mutants showed higher potentials for nitrogenase expression than Sp7, their potentials were lower than that of Sp7-S, indicating that other factors in this strain contribute to its exceptional nitrogenase activity rates on plants. The lack of lateral flagella is not one of these factors, as Sp7-PM23, a spontaneous mutant impaired in swarming and lateral-flagellum production but not in flocculation, showed wild-type nitrogenase activity and expression. The results also suggest factors of importance in evolving an effective symbiosis between Azospirillum and wheat, such as increasing the availability of microaerobic niches along the root, increased supply of carbon sources by the plant, and the retention of the bacterial cells in vegetative form for faster metabolism. PMID:10788397

Detection of receptor ligands by monitoring selective stabilization of a Renilla luciferase-tagged, constitutively active mutant, G-protein-coupled receptor

PubMed Central

Ramsay, Douglas; Bevan, Nicola; Rees, Stephen; Milligan, Graeme

2001-01-01

The wild-type β2-adrenoceptor and a constitutively active mutant of this receptor were C-terminally tagged with luciferase from the sea pansy Renilla reniformis. C-terminal addition of Renilla luciferase did not substantially alter the levels of expression of either form of the receptor, the elevated constitutive activity of the mutant β2-adrenoceptor nor the capacity of isoprenaline to elevate cyclic AMP levels in intact cells expressing these constructs. Treatment of cells expressing constitutively active mutant β2-adrenoceptor-Renilla luciferase with antagonist/inverse agonist ligands resulted in upregulation of levels of this polypeptide which could be monitored by the elevated luciferase activity. The pEC50 for ligand-induced luciferase upregulation and ligand affinity to bind the receptor were highly correlated. Similar upregulation could be observed following sustained treatment with agonist ligands. These effects were only observed at a constitutively active mutant of the β2-adrenoceptor. Co-expression of the wild-type β2-adrenoceptor C-terminally tagged with the luciferase from Photinus pyralis did not result in ligand-induced upregulation of the levels of activity of this luciferase. Co-expression of the constitutively active mutant β2-adrenoceptor-Renilla luciferase and an equivalent mutant of the α1b-adrenoceptor C-terminally tagged with green fluorescent protein allowed pharmacological selectivity of adrenoceptor antagonists to be demonstrated. This approach offers a sensitive and convenient means, which is amenable to high throughput analysis, to monitor ligand binding to a constitutively active mutant receptor. As no prior knowledge of receptor ligands is required this approach may be suitable to identify ligands at orphan G protein-coupled receptors. PMID:11350868

Che-1 gene silencing induces osteosarcoma cell apoptosis by inhibiting mutant p53 expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Ming; Wang, Dan, E-mail: danwangwdd@163.com; Li, Ning

2016-04-22

The transcriptional cofactor Che-1 is an RNA polymerase II (Pol II) which is involved in tumorigenesis, such as breast cancer and multiple myeloma. Che-1 can also regulate mutant p53 expression, which plays roles in many types of cancer. In this study, we aimed to investigate the effects and specific mechanism of Che-1 in the regulation of osteosarcoma (OS) cell growth. We found that Che-1 is highly expressed in several kinds of OS cells compared with osteoblast hFOB1.19 cells. MTT and flow cytometry assays showed that Che-1 depletion by siRNA markedly suppressed MG-63 and U2OS cell proliferation and promoted apoptosis. The chromatinmore » immunoprecipitation (ChIP) assay verified the presence of Che-1 on the p53 promoter in MG-63 and U2OS cells carrying mutant p53. Further studies showed that Che-1 depletion inhibited mutant p53 expression. Notably, our study showed that the loss of Che-1 inhibits proliferation and promotes apoptosis in MG-63 cells by decreasing the level of mutant p53. Therefore, these findings open the possibility that silencing of Che-1 will have therapeutic benefit in OS. - Highlights: • Che-1 is highly expressed in several kinds of OS cells. • Che-1 depletion suppressed MG-63 and U2OS cell growth. • Che-1 is existed in the p53 promoter in MG-63 and U2OS cells. • Che-1 depletion inhibited mutant p53 expression. • Che-1 depletion inhibits cell growth by decreasing the level of mutant p53.« less

RNA interference-mediated silencing of mutant superoxide dismutase rescues cyclosporin A-induced death in cultured neuroblastoma cells

PubMed Central

Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.

2004-01-01

Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234

Decrease in REM latency and changes in sleep quality parallel serotonergic damage and recovery after MDMA: a longitudinal study over 180 days.

PubMed

Kirilly, Eszter; Molnar, Eszter; Balogh, Brigitta; Kantor, Sandor; Hansson, Stefan R; Palkovits, Miklos; Bagdy, Gyorgy

2008-09-01

The recreational drug ecstasy [3,4-methylenedioxymethamphetamine (MDMA)], has been found to selectively damage brain serotonin neurons in experimental animals, and probably in human MDMA users, but detailed morphometric analyses and parallel functional measures during damage and recovery are missing. Since there is evidence that serotonin regulates sleep, we have compared serotonergic markers parallel with detailed analysis of sleep patterns at three time-points within 180 d after a single dose of 15 mg/kg MDMA in male Dark Agouti rats. At 7 d and 21 d after MDMA treatment, significant(30-40%), widespread reductions in serotonin transporter (5-HTT) density were detected in the cerebral cortex, hippocampus, most parts of the hypothalamus, and some of the brainstem nuclei. With the exception of the hippocampus, general recovery was observed in the brain 180 d after treatment. Transient increases followed by decreases were detected in 5-HTT mRNA expression of dorsal and median raphe nuclei at 7 d and 21 d after the treatment. Significant reductions in rapid eye movement (REM) sleep latency, increases in delta power spectra in non-rapid eye movement sleep and increased fragmentation of sleep were also detected, but all these alterations disappeared by the 180th day. The present data provide evidence for long-term, albeit, except for the hippocampus, transient changes in the terminal and cellular regions of the serotonergic system after this drug. Reduced REM latency and increased sleep fragmentation are the most characteristic alterations of sleep consistently described in depression using EEG sleep polygraphy.

Temperature-responsive genetic loci in the plant pathogen Pseudomonas syringae pv. glycinea.

PubMed

Ullrich, M S; Schergaut, M; Boch, J; Ullrich, B

2000-10-01

Plant-pathogenic bacteria may sense variations in environmental factors, such as temperature, to adapt to plant-associated habitats during pathogenesis or epiphytic growth. The bacterial blight pathogen of soybean, Pseudomonas syringae pv. glycinea PG4180, preferentially produces the phytotoxin coronatine at 18 degrees C and infects the host plant under conditions of low temperature and high humidity. A miniTn5-based promoterless glucuronidase (uidA) reporter gene was used to identify genetic loci of PG4180 preferentially expressed at 18 or 28 degrees C. Out of 7500 transposon mutants, 61 showed thermoregulated uidA expression as determined by a three-step screening procedure. Two-thirds of these mutants showed an increased reporter gene expression at 18 degrees C whilst the remainder exhibited higher uidA expression at 28 degrees C. MiniTn5-uidA insertion loci from these mutants were subcloned and their nucleotide sequences were determined. Several of the mutants induced at 18 degrees C contained the miniTn5-uidA insertion within the 32.8 kb coronatine biosynthetic gene cluster. Among the other mutants with increased uidA expression at 18 degrees C, insertions were found in genes encoding formaldehyde dehydrogenase, short-chain dehydrogenase and mannuronan C-5-epimerase, in a plasmid-borne replication protein, and in the hrpT locus, involved in pathogenicity of P. syringae. Among the mutants induced at 28 degrees C, insertions disrupted loci with similarities to a repressor of conjugal plasmid transfer, UV resistance determinants, an isoflavanoid-degrading enzyme, a HU-like DNA-binding protein, two additional regulatory proteins, a homologue of bacterial adhesins, transport proteins, LPS synthesis enzymes and two proteases. Genetic loci from 13 mutants did not show significant similarities to any database entries. Results of plant inoculations showed that three of the mutants tested were inhibited in symptom development and in planta multiplication rates. Temperature-shift experiments suggested that all of the identified loci showed a rather slow induction of expression upon change of temperature.

Study the Expression of ompf Gene in Esherichia coli Mutants

PubMed Central

Jaktaji, R. Pourahmad; Heidari, F.

2013-01-01

The outer membrane porin proteins are the major factors in controlling the permeability of cell membrane. OmpF is an example of porin proteins in Esherichia coli. In normal growth condition a large amount of this protein is synthesised, but under stress condition, such as the presence of antibiotics in environment its expression is decreased inhibiting the entrance of antibiotics into cell. The expression of ompF is inhibited by antisense RNA transcribed from micF. In normal condition the expression of micF is low, but in the presence of antibiotics its expression is increased and causes multiple resistances to irrelevant antibiotics. The aims of this research were to study first, the intactness of micF and then quantify the expression of ompF in ciprofloxacin and tetracycline resistant mutants of E. coli. For this purpose the 5’ end of micF was amplified and then sequenced. None of these mutants except one and its clone has a mutation in this gene. Then the relative expression of ompF in these mutants was quantified by real time PCR. There was no significant difference between ompF transcription of mutants and wild type strain. Based on this study and previous study it is concluded that low to intermediate levels of resistance to ciprofloxacin and tetracycline does not decrease ompF transcription. PMID:24403654

Zebrafish mab21l2 is specifically expressed in the presumptive eye and tectum from early somitogenesis onwards.

PubMed

Kudoh, T; Dawid, I B

2001-11-01

Random screening for tissue specific genes in zebrafish by in situ hybridization led us to isolate a gene which showed highly restricted expression in the developing eyes and midbrain at somitogenesis stages. This gene was very similar to mouse and human mab21l2. The characteristic expression pattern of mab21l2 facilitates a detailed description of the morphogenesis of the eyes and midbrain in the zebrafish. In the eye field, mab21l2 expression illustrates the transformation of the eye field to form two separate eyes in the anterior neural plate. Mab21l2 staining in the cyclopic mutants, cyc and oep, exhibited incomplete splitting of the eye primodium. In the midbrain, mab21l2 is expressed in the tectum, and its expression follows the expansion of the tectal region. In mutants affecting the mid-hindbrain boundary (MHB), mab21l2 expression is affected differentially. In the noi/pax2.1 mutant, mab21l2 is down-regulated and the size of the tectum remains small, whereas in the ace/fgf8 mutant, mab21l2 expression persists although the shape of the tectum is altered.

Establishment of a tissue-specific RNAi system in C. elegans.

PubMed

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo

2007-10-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.

Establishment of a tissue-specific RNAi system in C. elegans

PubMed Central

Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo

2011-01-01

In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718

Tlx and Pax6 co-operate genetically to establish the pallio-subpallial boundary in the embryonic mouse telencephalon.

PubMed

Stenman, Jan; Yu, Ruth T; Evans, Ronald M; Campbell, Kenneth

2003-03-01

We have examined the role of Tlx, an orphan nuclear receptor, in dorsal-ventral patterning of the mouse telencephalon. Tlx is expressed broadly in the ventricular zone, with the exception of the dorsomedial and ventromedial regions. The expression spans the pallio-subpallial boundary, which separates the dorsal (i.e. pallium) and ventral (i.e. subpallium) telencephalon. Despite being expressed on both sides of the pallio-subpallial boundary, Tlx homozygous mutants display alterations in the development of this boundary. These alterations include a dorsal shift in the expression limits of certain genes that abut at the pallio-subpallial boundary as well as the abnormal formation of the radial glial palisade that normally marks this boundary. The Tlx mutant phenotype is similar to, but less severe than, that seen in Small eye (i.e. Pax6) mutants. Interestingly, removal of one allele of Pax6 on the homozygous Tlx mutant background significantly worsens the phenotype. Thus Tlx and Pax6 cooperate genetically to regulate the establishment of the pallio-subpallial boundary. The patterning defects in the Tlx mutant telencephalon result in a loss of region-specific gene expression in the ventral-most pallial region. This correlates well with the malformation of the lateral and basolateral amygdala in Tlx mutants, both of which have been suggested to derive from ventral portions of the pallium.

Diabetes and exocrine pancreatic insufficiency in E2F1/E2F2 double-mutant mice.

PubMed

Iglesias, Ainhoa; Murga, Matilde; Laresgoiti, Usua; Skoudy, Anouchka; Bernales, Irantzu; Fullaondo, Asier; Moreno, Bernardino; Lloreta, José; Field, Seth J; Real, Francisco X; Zubiaga, Ana M

2004-05-01

E2F transcription factors are thought to be key regulators of cell growth control. Here we use mutant mouse strains to investigate the function of E2F1 and E2F2 in vivo. E2F1/E2F2 compound-mutant mice develop nonautoimmune insulin-deficient diabetes and exocrine pancreatic dysfunction characterized by endocrine and exocrine cell dysplasia, a reduction in the number and size of acini and islets, and their replacement by ductal structures and adipose tissue. Mutant pancreatic cells exhibit increased rates of DNA replication but also of apoptosis, resulting in severe pancreatic atrophy. The expression of genes involved in DNA replication and cell cycle control was upregulated in the E2F1/E2F2 compound-mutant pancreas, suggesting that their expression is repressed by E2F1/E2F2 activities and that the inappropriate cell cycle found in the mutant pancreas is likely the result of the deregulated expression of these genes. Interestingly, the expression of ductal cell and adipocyte differentiation marker genes was also upregulated, whereas expression of pancreatic cell marker genes were downregulated. These results suggest that E2F1/E2F2 activity negatively controls growth of mature pancreatic cells and is necessary for the maintenance of differentiated pancreatic phenotypes in the adult.

BIM and mTOR expression levels predict outcome to erlotinib in EGFR-mutant non-small-cell lung cancer.

PubMed

Karachaliou, Niki; Codony-Servat, Jordi; Teixidó, Cristina; Pilotto, Sara; Drozdowskyj, Ana; Codony-Servat, Carles; Giménez-Capitán, Ana; Molina-Vila, Miguel Angel; Bertrán-Alamillo, Jordi; Gervais, Radj; Massuti, Bartomeu; Morán, Teresa; Majem, Margarita; Felip, Enriqueta; Carcereny, Enric; García-Campelo, Rosario; Viteri, Santiago; González-Cao, María; Morales-Espinosa, Daniela; Verlicchi, Alberto; Crisetti, Elisabetta; Chaib, Imane; Santarpia, Mariacarmela; Luis Ramírez, José; Bosch-Barrera, Joaquim; Felipe Cardona, Andrés; de Marinis, Filippo; López-Vivanco, Guillermo; Miguel Sánchez, José; Vergnenegre, Alain; Sánchez Hernández, José Javier; Sperduti, Isabella; Bria, Emilio; Rosell, Rafael

2015-12-07

BIM is a proapoptotic protein that initiates apoptosis triggered by EGFR tyrosine kinase inhibitors (TKI). mTOR negatively regulates apoptosis and may influence response to EGFR TKI. We examined mRNA expression of BIM and MTOR in 57 patients with EGFR-mutant NSCLC from the EURTAC trial. Risk of mortality and disease progression was lower in patients with high BIM compared with low/intermediate BIM mRNA levels. Analysis of MTOR further divided patients with high BIM expression into two groups, with those having both high BIM and MTOR experiencing shorter overall and progression-free survival to erlotinib. Validation of our results was performed in an independent cohort of 19 patients with EGFR-mutant NSCLC treated with EGFR TKIs. In EGFR-mutant lung adenocarcinoma cell lines with high BIM expression, concomitant high mTOR expression increased IC50 of gefitinib for cell proliferation. We next sought to analyse the signalling pattern in cell lines with strong activation of mTOR and its substrate P-S6. We showed that mTOR and phosphodiesterase 4D (PDE4D) strongly correlate in resistant EGFR-mutant cancer cell lines. These data suggest that the combination of EGFR TKI with mTOR or PDE4 inhibitors could be adequate therapy for EGFR-mutant NSCLC patients with high pretreatment levels of BIM and mTOR.

The Thiamine Biosynthesis Gene THI1 Promotes Nodule Growth and Seed Maturation1

PubMed Central

Nagae, Miwa; Kawaguchi, Masayoshi; Takeda, Naoya

2016-01-01

Thiamine (vitamin B1) is essential for living organisms. Unlike animals, plants can synthesize thiamine. In Lotus japonicus, the expression of two thiamine biosynthesis genes, THI1 and THIC, was enhanced by inoculation with rhizobia but not by inoculation with arbuscular mycorrhizal fungi. THIC and THI2 (a THI1 paralog) were expressed in uninoculated leaves. THI2-knockdown plants and the transposon insertion mutant thiC had chlorotic leaves. This typical phenotype of thiamine deficiency was rescued by an exogenous supply of thiamine. In wild-type plants, THI1 was expressed mainly in roots and nodules, and the thi1 mutant had green leaves even in the absence of exogenous thiamine. THI1 was highly expressed in actively dividing cells of nodule primordia. The thi1 mutant had small nodules, and this phenotype was rescued by exogenous thiamine and by THI1 complementation. Exogenous thiamine increased nodule diameter, but the level of arbuscular mycorrhizal colonization was unaffected in the thi1 mutant or by exogenous thiamine. Expression of symbiotic marker genes was induced normally, implying that mainly nodule growth was delayed in the thi1 mutant. Furthermore, this mutant formed many immature seeds with reduced seed weight. These results indicate that thiamine biosynthesis mediated by THI1 enhances nodule enlargement and is required for seed development in L. japonicus. PMID:27702844

The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.

PubMed

Ren, Jun; Prescott, John F

2004-11-15

An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.

Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene ExpressionW⃞

PubMed Central

Hunter, Brenda G.; Beatty, Mary K.; Singletary, George W.; Hamaker, Bruce R.; Dilkes, Brian P.; Larkins, Brian A.; Jung, Rudolf

2002-01-01

Maize starchy endosperm mutants have kernel phenotypes that include a brittle texture, susceptibility to insect pests, and inferior functional characteristics of products made from their flour. At least 18 such mutants have been identified, but only in the cases of opaque2 (o2) and floury2 (fl2), which affect different aspects of storage protein synthesis, is the molecular basis of the mutation known. To better understand the relationship between the phenotypes of these mutants and their biochemical bases, we characterized the protein and amino acid composition, as well as the mRNA transcript profiles, of nearly isogenic inbred lines of W64A o1, o2, o5, o9, o11, Mucuronate (Mc), Defective endosperm B30 (DeB30), and fl2. The largest reductions in zein protein synthesis occur in the W64A o2, DeB30, and fl2 mutants, which have ∼35 to 55% of the wild-type level of storage proteins. Zeins in W64A o5, o9, o11, and Mc are within 80 to 90% of the amount found in the wild type. Only in the cases of o5 and Mc were significant qualitative changes in zein synthesis observed. The pattern of gene expression in normal and mutant genotypes was assayed by profiling endosperm mRNA transcripts at 18 days after pollination with an Affymetrix GeneChip containing >1400 selected maize gene sequences. Compared with W64A sugary1, a mutant defective in starch synthesis, alterations in the gene expression patterns of the opaque mutants are very pleiotropic. Increased expression of genes associated with physiological stress, and the unfolded protein response, are common features of the opaque mutants. Based on global patterns of gene expression, these mutants were categorized in four phenotypic groups as follows: W64A+ and o1; o2; o5/o9/o11; and Mc and fl2. PMID:12368507

Rescue of protein expression defects may not be enough to abolish the pro-arrhythmic phenotype of long QT type 2 mutations.

PubMed

Perry, Matthew D; Ng, Chai Ann; Phan, Kevin; David, Erikka; Steer, Kieran; Hunter, Mark J; Mann, Stefan A; Imtiaz, Mohammad; Hill, Adam P; Ke, Ying; Vandenberg, Jamie I

2016-07-15

Most missense long QT syndrome type 2 (LQTS2) mutations result in Kv11.1 channels that show reduced levels of membrane expression. Pharmacological chaperones that rescue mutant channel expression could have therapeutic potential to reduce the risk of LQTS2-associated arrhythmias and sudden cardiac death, but only if the mutant Kv11.1 channels function normally (i.e. like WT channels) after membrane expression is restored. Fewer than half of mutant channels exhibit relatively normal function after rescue by low temperature. The remaining rescued missense mutant Kv11.1 channels have perturbed gating and/or ion selectivity characteristics. Co-expression of WT subunits with gating defective missense mutations ameliorates but does not eliminate the functional abnormalities observed for most mutant channels. For patients with mutations that affect gating in addition to expression, it may be necessary to use a combination therapy to restore both normal function and normal expression of the channel protein. In the heart, Kv11.1 channels pass the rapid delayed rectifier current (IKr ) which plays critical roles in repolarization of the cardiac action potential and in the suppression of arrhythmias caused by premature stimuli. Over 500 inherited mutations in Kv11.1 are known to cause long QT syndrome type 2 (LQTS2), a cardiac electrical disorder associated with an increased risk of life threatening arrhythmias. Most missense mutations in Kv11.1 reduce the amount of channel protein expressed at the membrane and, as a consequence, there has been considerable interest in developing pharmacological agents to rescue the expression of these channels. However, pharmacological chaperones will only have clinical utility if the mutant Kv11.1 channels function normally after membrane expression is restored. The aim of this study was to characterize the gating phenotype for a subset of LQTS2 mutations to assess what proportion of mutations may be suitable for rescue. As an initial screen we used reduced temperature to rescue expression defects of mutant channels expressed in Xenopus laevis oocytes. Over half (∼56%) of Kv11.1 mutants exhibited functional gating defects that either dramatically reduced the amount of current contributing to cardiac action potential repolarization and/or reduced the amount of protective current elicited in response to premature depolarizations. Our data demonstrate that if pharmacological rescue of protein expression defects is going to have clinical utility in the treatment of LQTS2 then it will be important to assess the gating phenotype of LQTS2 mutations before attempting rescue. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.

PubMed

Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G

1993-04-01

Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.

Effects of mutant human Ki-ras{sup G12C} gene dosage on murine lung tumorigenesis and signaling to its downstream effectors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dance-Barnes, Stephanie T.; Kock, Nancy D.; Floyd, Heather S.

2008-08-15

Studies in cell culture have suggested that the level of RAS expression can influence the transformation of cells and the signaling pathways stimulated by mutant RAS expression. However, the levels of RAS expression in vivo appear to be subject to feedback regulation, limiting the total amount of RAS protein that can be expressed. We utilized a bitransgenic mouse lung tumor model that expressed the human Ki-ras{sup G12C} allele in a tetracycline-inducible, lung-specific manner. Treatment for 12 months with 500 {mu}g/ml of doxycycline (DOX) allowed for maximal expression of the human Ki-ras{sup G12C} allele in the lung, and resulted in themore » development of focal hyperplasia and adenomas. We determined if different levels of mutant RAS expression would influence the phenotype of the lung lesions. Treatment with 25, 100 and 500 {mu}g/ml of DOX resulted in dose-dependent increases in transgene expression and tumor multiplicity. Microscopic analysis of the lungs of mice treated with the 25 {mu}g/ml dose of DOX revealed infrequent foci of hyperplasia, whereas mice treated with the 100 and 500 {mu}g/ml doses exhibited numerous hyperplastic foci and also adenomas. Immunohistochemical and RNA analysis of the downstream effector pathways demonstrated that different levels of mutant RAS transgene expression resulted in differences in the expression and/or phosphorylation of specific signaling molecules. Our results suggest that the molecular alterations driving tumorigenesis may differ at different levels of mutant Ki-ras{sup G12C} expression, and this should be taken into consideration when inducible transgene systems are utilized to promote tumorigenesis in mouse models.« less

Lon Protease of Azorhizobium caulinodans ORS571 Is Required for Suppression of reb Gene Expression

PubMed Central

Nakajima, Azusa; Tsukada, Shuhei; Siarot, Lowela; Ogawa, Tetsuhiro; Oyaizu, Hiroshi

2012-01-01

Bacterial Lon proteases play important roles in a variety of biological processes in addition to housekeeping functions. In this study, we focused on the Lon protease of Azorhizobium caulinodans, which can fix nitrogen both during free-living growth and in stem nodules of the legume Sesbania rostrata. The nitrogen fixation activity of an A. caulinodans lon mutant in the free-living state was not significantly different from that of the wild-type strain. However, the stem nodules formed by the lon mutant showed little or no nitrogen fixation activity. By microscopic analyses, two kinds of host cells were observed in the stem nodules formed by the lon mutant. One type has shrunken host cells containing a high density of bacteria, and the other type has oval or elongated host cells containing a low density or no bacteria. This phenotype is similar to a praR mutant highly expressing the reb genes. Quantitative reverse transcription-PCR analyses revealed that reb genes were also highly expressed in the lon mutant. Furthermore, a lon reb double mutant formed stem nodules showing higher nitrogen fixation activity than the lon mutant, and shrunken host cells were not observed in these stem nodules. These results suggest that Lon protease is required to suppress the expression of the reb genes and that high expression of reb genes in part causes aberrance in the A. caulinodans-S. rostrata symbiosis. In addition to the suppression of reb genes, it was found that Lon protease was involved in the regulation of exopolysaccharide production and autoagglutination of bacterial cells. PMID:22752172

[Correlation of chromosome 1p and 19q status and expression of R132H mutant IDH1 protein in oligodendroglial tumors].

PubMed

Yao, Kun; Duan, Zejun; Hu, Zeliang; Bian, Yu; Qi, Xueling

2014-10-01

To correlate the presence of chromosome 1p/19q deletion with the expression of R132H mutant IDH1 status in oligodendroglial tumors, and to explore molecular markers for predicting chemosensitivity of oligodendroglial tumors. The study included 75 oligodendroglial tumors (38 oligodendrogliomas and 37 oligoastrocytomas). Immunohistochemistry was used to detect the expression of R132H mutant IDH1 protein, and fluorescence in situ hybridization (FISH) was employed to detect 1p/19q deletion. Deletion of chromosome 1p and/or 19q was detected in 37 cases (37/75, 49.3%), among which co-deletion of 1p and 19q was seen in 34 cases (closely correlated, P < 0.01). Oligodendrogliomas WHOIIhad a slightly higher deletion rate than oligodendrogliomas WHO III, although without statistical significance. Oligodendrogliomas WHO IIand WHO III had a significantly higher deletion rate of chromosome 1p/19q than oligoastrocytomas WHO II and WHO III (P < 0.05). While combined loss of 1p/19q was always detected in oligodendrogliomas when FISH was positive, isolated 1p or 19q deletion was only found in oligoastrocytomas. The expression of R132H mutant IDH1 was detected in 51 of 75 cases (68.0%), in which oligodendrogliomas had a higher positive rate than oligoastrocytomas. Statistical analysis demonstrated a significant correlation between the expression of R132H mutant IDH1 protein and the presence of combined 1p/19q deletion in oligodendrogliomas (P < 0.05). A significant correlation was observed between the expression of R132H mutant protein and 1p/19q LOH.Expression of 132H mutant IDH1 protein is the potential biomarker for predicating the presence of 1p/19q deletion in oligodendrogliomas.

The Arabidopsis mutant cev1 links cell wall signaling to jasmonate and ethylene responses.

PubMed

Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G

2002-07-01

Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants.

Csf3r mutations in mice confer a strong clonal HSC advantage via activation of Stat5

PubMed Central

Liu, Fulu; Kunter, Ghada; Krem, Maxwell M.; Eades, William C.; Cain, Jennifer A.; Tomasson, Michael H.; Hennighausen, Lothar; Link, Daniel C.

2008-01-01

A fundamental property of leukemic stem cells is clonal dominance of the bone marrow microenvironment. Truncation mutations of CSF3R, which encodes the G-CSF receptor (G-CSFR), are implicated in leukemic progression in patients with severe congenital neutropenia. Here we show that expression of a truncated mutant Csf3r in mice confers a strong clonal advantage at the HSC level that is dependent upon exogenous G-CSF. G-CSF–induced proliferation, phosphorylation of Stat5, and transcription of Stat5 target genes were increased in HSCs isolated from mice expressing the mutant Csf3r. Conversely, the proliferative advantage conferred by the mutant Csf3r was abrogated in myeloid progenitors lacking both Stat5A and Stat5B, and HSC function was reduced in mice expressing a truncated mutant Csf3r engineered to have impaired Stat5 activation. These data indicate that in mice, inappropriate Stat5 activation plays a key role in establishing clonal dominance by stem cells expressing mutant Csf3r. PMID:18292815

Analysis of Distinct Roles of CaMKK Isoforms Using STO-609-Resistant Mutants in Living Cells.

PubMed

Fujiwara, Yuya; Hiraoka, Yuri; Fujimoto, Tomohito; Kanayama, Naoki; Magari, Masaki; Tokumitsu, Hiroshi

2015-06-30

To assess the isoform specificity of the Ca(2+)/calmodulin-dependent protein kinase kinase (CaMKK)-mediated signaling pathway using a CaMKK inhibitor (STO-609) in living cells, we have established A549 cell lines expressing STO-609-resistant mutants of CaMKK isoforms. Following serial mutagenesis studies, we have succeeded in obtaining an STO-609-resistant CaMKKα mutant (Ala292Thr/Leu233Phe) and a CaMKKβ mutant (Ala328Thr/Val269Phe), which showed sensitivity to STO-609 that was 2-3 orders of magnitude lower without an appreciable effect on kinase activity or CaM requirement. These results are consistent with the results obtained for CaMKK activities in the extracts of A549 cells stably expressing the mutants of CaMKK isoforms. Ionomycin-induced 5'-AMP-activated protein kinase (AMPK) phosphorylation at Thr172 in A549 cells expressing either the wild-type or the STO-609-resistant mutant of CaMKKα was completely suppressed by STO-609 treatment but resistant to the inhibitor in the presence of the CaMKKβ mutant (Ala328Thr/Val269Phe). This result strongly suggested that CaMKKβ is responsible for ionomycin-induced AMPK activation, which supported previous reports. In contrast, ionomycin-induced CaMKIV phosphorylation at Thr196 was resistant to STO-609 treatment in A549 cells expressing STO-609-resistant mutants of both CaMKK isoforms, indicating that both CaMKK isoforms are capable of phosphorylating and activating CaMKIV in living cells. Considering these results together, STO-609-resistant CaMKK mutants developed in this study may be useful for distinguishing CaMKK isoform-mediated signaling pathways in combination with the use of an inhibitor compound.

AmyR Is a Novel Negative Regulator of Amylovoran Production in Erwinia amylovora

PubMed Central

Wang, Dongping; Korban, Schuyler S.; Pusey, P. Lawrence; Zhao, Youfu

2012-01-01

In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora. PMID:23028751

AmyR is a novel negative regulator of amylovoran production in Erwinia amylovora.

PubMed

Wang, Dongping; Korban, Schuyler S; Pusey, P Lawrence; Zhao, Youfu

2012-01-01

In this study, we attempted to understand the role of an orphan gene amyR in Erwinia amylovora, a functionally conserved ortholog of ybjN in Escherichia coli, which has recently been characterized. Amylovoran, a high molecular weight acidic heteropolymer exopolysaccharide, is a virulent factor of E. amylovora. As reported earlier, amylovoran production in an amyR knockout mutant was about eight-fold higher than that in the wild type (WT) strain of E. amylovora. When a multicopy plasmid containing the amyR gene was introduced into the amyR mutant or WT strains, amylovoran production was strongly inhibited. Furthermore, amylovoran production was also suppressed in various amylovoran-over-producing mutants, such as grrSA containing multicopies of the amyR gene. Consistent with amylovoran production, an inverse correlation was observed between in vitro expression of amyR and that of amylovoran biosynthetic genes. However, both the amyR knockout mutant and over-expression strains showed reduced levan production, another exopolysaccharide produced by E. amylovora. Virulence assays demonstrated that while the amyR mutant was capable of inducing slightly greater disease severity than that of the WT strain, strains over-expressing the amyR gene did not incite disease on apple shoots or leaves, and only caused reduced disease on immature pear fruits. Microarray studies revealed that amylovoran biosynthesis and related membrane protein-encoding genes were highly expressed in the amyR mutant, but down-regulated in the amyR over-expression strains in vitro. Down-regulation of amylovoran biosynthesis genes in the amyR over-expression strain partially explained why over-expression of amyR led to non-pathogenic or reduced virulence in vivo. These results suggest that AmyR plays an important role in regulating exopolysaccharide production, and thus virulence in E. amylovora.

The role of dileucine in the expression and function of human organic anion transporter 1 (hOAT1)

PubMed Central

Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

2011-01-01

Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1. PMID:21494320

The Role of Dileucine in the Expression and Function of Human Organic Anion Transporter 1 (hOAT1).

PubMed

Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

2011-01-01

Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1.

Comprehensive Gene Expression Analysis of Rice Aleurone Cells: Probing the Existence of an Alternative Gibberellin Receptor1

PubMed Central

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-01-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. PMID:25511432

Therapygenetics: 5-HTTLPR genotype predicts the response to exposure therapy for agoraphobia.

PubMed

Knuts, Inge; Esquivel, Gabriel; Kenis, Gunter; Overbeek, Thea; Leibold, Nicole; Goossens, Lies; Schruers, Koen

2014-08-01

This study was intended to assess the extent to which the low-expression allele of the serotonin transporter gene promoter predicts better response to exposure-based behavior therapy in patients with panic disorder with agoraphobia (PDA). Ninety-nine patients with PDA underwent a 1-week in vivo exposure-based behavior therapy program and provided saliva samples to extract genomic DNA and classify individuals according to four allelic forms (SA, SG, LA, LG) of the 5-HTT-linked polymorphic region (5-HTTLPR). We determined whether the 5-HTTLPR genotype predicted change in avoidance behavior in PDA following treatment. After controlling for pre-treatment avoidance behavior, the 5-HTTLPR low-expression genotypes showed a more favorable response to exposure therapy two weeks following treatment, compared to the other patients. This study suggests a genetic contribution to treatment outcome following behavior therapy and implicates the serotonergic system in response to exposure-based treatments in PDA. Copyright © 2014 Elsevier B.V. and ECNP. All rights reserved.

Epigenetic alterations mediate iPSC normalization of DNA-repair expression and TNR stability in Huntington's disease.

PubMed

Mollica, Peter A; Zamponi, Martina; Reid, John A; Sharma, Deepak K; White, Alyson E; Ogle, Roy C; Bruno, Robert D; Sachs, Patrick C

2018-06-13

Huntington's disease (HD) is a rare autosomal dominant neurodegenerative disorder caused by a cytosine-adenine-guanine (CAG) trinucleotide repeat (TNR) expansion within the HTT gene. The mechanisms underlying HD-associated cellular dysfunction during pluripotency and neurodevelopment, are poorly understood. Here we tested the hypothesis that hypomethylation during cellular reprogramming leads to up-regulation of DNA repair genes and stabilization of TNRs in HD cells. We sought to determine how the HD TNR region is affected by global epigenetic changes through cellular reprogramming and early neurodifferentiation. We find that early-stage HD-affected neural stem cells (NSCs) contain increased levels of global 5-hydroxymethylation (5-hmC) and normalized DNA repair gene expression. We confirm TNR stability is induced during pluripotency, and maintained in HD-NSCs. We also identify up-regulation of 5-hmC catalyzing ten-eleven translocation (TET1/2) proteins, and show their knockdown leads to a corresponding decrease in select DNA repair gene expression. We further confirm decreased expression of TET regulating miR-29 family members in HD-NSCs. Our findings demonstrate that mechanisms involved in pluripotency recover the selected DNA repair gene expression and stabilizes pathogenic TNRs in HD. © 2018. Published by The Company of Biologists Ltd.

Misfolded rhodopsin mutants display variable aggregation properties.

PubMed

Gragg, Megan; Park, Paul S-H

2018-06-08

The largest class of rhodopsin mutations causing autosomal dominant retinitis pigmentosa (adRP) is mutations that lead to misfolding and aggregation of the receptor. The misfolding mutants have been characterized biochemically, and categorized as either partial or complete misfolding mutants. This classification is incomplete and does not provide sufficient information to fully understand the disease pathogenesis and evaluate therapeutic strategies. A Förster resonance energy transfer (FRET) method was utilized to directly assess the aggregation properties of misfolding rhodopsin mutants within the cell. Partial (P23H and P267L) and complete (G188R, H211P, and P267R) misfolding mutants were characterized to reveal variability in aggregation properties. The complete misfolding mutants all behaved similarly, forming aggregates when expressed alone, minimally interacting with the wild-type receptor when coexpressed, and were unresponsive to treatment with the pharmacological chaperone 9-cis retinal. In contrast, variability was observed between the partial misfolding mutants. In the opsin form, the P23H mutant behaved similarly as the complete misfolding mutants. In contrast, the opsin form of the P267L mutant existed as both aggregates and oligomers when expressed alone and formed mostly oligomers with the wild-type receptor when coexpressed. The partial misfolding mutants both reacted similarly to the pharmacological chaperone 9-cis retinal, displaying improved folding and oligomerization when expressed alone but aggregating with wild-type receptor when coexpressed. The observed differences in aggregation properties and effect of 9-cis retinal predict different outcomes in disease pathophysiology and suggest that retinoid-based chaperones will be ineffective or even detrimental. Copyright © 2018 Elsevier B.V. All rights reserved.

Selective targeting of KRAS-Mutant cells by miR-126 through repression of multiple genes essential for the survival of KRAS-Mutant cells

PubMed Central

Hara, Toshifumi; Jones, Matthew F.; Subramanian, Murugan; Li, Xiao Ling; Ou, Oliver; Zhu, Yuelin; Yang, Yuan; Wakefield, Lalage M.; Hussain, S. Perwez; Gaedcke, Jochen; Ried, Thomas; Luo, Ji; Caplen, Natasha J.; Lal, Ashish

2014-01-01

MicroRNAs (miRNAs) regulate the expression of hundreds of genes. However, identifying the critical targets within a miRNA-regulated gene network is challenging. One approach is to identify miRNAs that exert a context-dependent effect, followed by expression profiling to determine how specific targets contribute to this selective effect. In this study, we performed miRNA mimic screens in isogenic KRAS-Wild-type (WT) and KRAS-Mutant colorectal cancer (CRC) cell lines to identify miRNAs selectively targeting KRAS-Mutant cells. One of the miRNAs we identified as a selective inhibitor of the survival of multiple KRAS-Mutant CRC lines was miR-126. In KRAS-Mutant cells, miR-126 over-expression increased the G1 compartment, inhibited clonogenicity and tumorigenicity, while exerting no effect on KRAS-WT cells. Unexpectedly, the miR-126-regulated transcriptome of KRAS-WT and KRAS-Mutant cells showed no significant differences. However, by analyzing the overlap between miR-126 targets with the synthetic lethal genes identified by RNAi in KRAS-Mutant cells, we identified and validated a subset of miR-126-regulated genes selectively required for the survival and clonogenicity of KRAS-Mutant cells. Our strategy therefore identified critical target genes within the miR-126-regulated gene network. We propose that the selective effect of miR-126 on KRAS-Mutant cells could be utilized for the development of targeted therapy for KRAS mutant tumors. PMID:25245095

Characterization and proteomic analysis of the Pseudomonas sp. HK-6 xenB knockout mutant under RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) stress.

PubMed

Lee, Bheong-Uk; Choi, Moon-Seop; Oh, Kye-Heon

2015-01-01

Pseudomonas sp. HK-6 is able to utilize RDX (hexahydro-1,3,5-trinitro-1,3,5-triazine) as its sole nitrogen source. The role of the xenB gene, encoding xenobiotic reductase B, was investigated using HK-6 xenB knockout mutants. The xenB mutant degraded RDX to a level that was 10-fold less than that obtained with the wild-type HK-6 strain. After 60 days of culture with 25 or 50 μM RDX, no residual RDX was detected in the supernatants of the wild-type aerobically grown cultures, whereas approximately 90 % of the RDX remained in the xenB mutant cultures. The xenB mutant bacteria exhibited a 10(2)-10(4)-fold decrease in survival rate compared to the wild-type. The expression of DnaK and GroEL proteins, two typical stress shock proteins (SSPs), in the xenB mutant increased after immediate exposure to RDX, yet dramatically decreased after 4 h of exposure. In addition, DnaK and GroEL were more highly expressed in the cultures with 25 μM RDX in the medium but showed low expression in the cultures with 50 or 75 μM RDX. The expression levels of the dnaK and groEL genes measured by RT-qPCR were also much lower in the xenB genetic background. Analyses of the proteomes of the HK-6 and xenB mutant cells grown under conditions of RDX stress showed increased induction of several proteins, such as Alg8, alginate biosynthesis sensor histidine kinase, and OprH in the xenB mutants when compared to wild-type. However, many proteins, including two SSPs (DnaK and GroEL) and proteins involved in metabolism, exhibited lower expression levels in the xenB mutant than in the wild-type HK-6 strain. The xenB knockout mutation leads to reduced RDX degradation ability, which renders the mutant more sensitive to RDX stress and results in a lower survival rate and an altered proteomic profile under RDX stress.

tortuga refines Notch pathway gene expression in the zebrafish presomitic mesoderm at the post-transcriptional level.

PubMed

Dill, Kariena K; Amacher, Sharon L

2005-11-15

We have identified the zebrafish tortuga (tor) gene by an ENU-induced mutation that disrupts the presomitic mesoderm (PSM) expression of Notch pathway genes. In tor mutants, Notch pathway gene expression persists in regions of the PSM where expression is normally off in wild type embryos. The expression of hairy/Enhancer of split-related 1 (her1) is affected first, followed by the delta genes deltaC and deltaD, and finally, by another hairy/Enhancer of split-related gene, her7. In situ hybridization with intron-specific probes for her1 and deltaC indicates that transcriptional bursts of expression are normal in tor mutants, suggesting that tor normally functions to refine her1 and deltaC message levels downstream of transcription. Despite the striking defects in Notch pathway gene expression, somite boundaries form normally in tor mutant embryos, although somitic mesoderm defects are apparent later, when cells mature to form muscle fibers. Thus, while the function of Notch pathway genes is required for proper somite formation, the tor mutant phenotype suggests that precise oscillations of Notch pathway transcripts are not essential for establishing segmental pattern in the presomitic mesoderm.

Dominant-negative action of disease-causing gonadotropin-releasing hormone receptor (GnRHR) mutants: a trait that potentially coevolved with decreased plasma membrane expression of GnRHR in humans.

PubMed

Leaños-Miranda, Alfredo; Ulloa-Aguirre, Alfredo; Ji, Tae H; Janovick, Jo Ann; Conn, P Michael

2003-07-01

Loss of function by 11 of 13 naturally occurring mutations in the human GnRH receptor (hGnRHR) was thought to result from impaired ligand binding or effector coupling, but actually results from receptor misrouting. Homo- or heterodimerization of mutant receptors with wild-type (WT) receptors occurs for other G protein-coupled receptors and may result in dominant-negative or -positive effects on the WT receptor. We tested the hypothesis that WT hGnRHR function was affected by misfolded hGnRHR mutants. hGnRHR mutants were found to inhibit the function of WT GnRHR (measured by activation of effector and ligand binding). Inhibition varied depending on the particular hGnRHR mutant coexpressed and the ratio of hGnRHR mutant to WT hGnRHR cDNA cotransfected. The hGnRHR mutants did not interfere with the function of genetically modified hGnRHRs bearing either a deletion of primate-specific Lys(191) or the carboxyl-terminal tail of the catfish GnRHR; these show intrinsically enhanced expression. Moreover, a peptidomimetic antagonist of GnRH enhanced the expression of WT hGnRHR, but not of genetically modified hGnRHR species. The dominant-negative effect of the naturally occurring receptor mutants occurred only for the WT hGnRHR, which has intrinsic low maturation efficiency. The data suggest that this dominant negative effect accompanies the diminished plasma membrane expression as a recent evolutionary event.

The evolutionarily conserved interaction between LC3 and p62 selectively mediates autophagy-dependent degradation of mutant huntingtin.

PubMed

Tung, Ying-Tsen; Hsu, Wen-Ming; Lee, Hsinyu; Huang, Wei-Pang; Liao, Yung-Feng

2010-07-01

Mammalian p62/sequestosome-1 protein binds to both LC3, the mammalian homologue of yeast Atg8, and polyubiquitinated cargo proteins destined to undergo autophagy-mediated degradation. We previously identified a cargo receptor-binding domain in Atg8 that is essential for its interaction with the cargo receptor Atg19 in selective autophagic processes in yeast. We, thus, sought to determine whether this interaction is evolutionally conserved from yeast to mammals. Using an amino acid replacement approach, we demonstrate that cells expressing mutant LC3 (LC3-K30D, LC3-K51A, or LC3-L53A) all exhibit defective lipidation of LC3, a disrupted LC3-p62 interaction, and impaired autophagic degradation of p62, suggesting that the p62-binding site of LC3 is localized within an evolutionarily conserved domain. Importantly, whereas cells expressing these LC3 mutants exhibited similar overall autophagic activity comparable to that of cells expressing wild-type LC3, autophagy-mediated clearance of the aggregation-prone mutant Huntingtin was defective in the mutant-expressing cells. Together, these results suggest that p62 directly binds to the evolutionarily conserved cargo receptor-binding domain of Atg8/LC3 and selectively mediates the clearance of mutant Huntingtin.

Comparative Study on Different Expression Hosts for Alkaline Phytase Engineered in Escherichia coli.

PubMed

Chen, Weiwei; Yu, Hongwei; Ye, Lidan

2016-07-01

The application of alkaline phytase as a feed additive is restricted by the poor specific activity. Escherichia coli is a frequently used host for directed evolution of proteins including alkaline phytase towards improved activity. However, it is not suitable for production of food-grade products due to potential pathogenicity. To combine the advantages of different expression systems, mutants of the alkaline phytase originated from Bacillus subtilis 168 (phy168) were first generated via directed evolution in E. coli and then transformed to food-grade hosts B. subtilis and Pichia pastoris for secretory expression. In order to investigate the suitability of different expression systems, the phy168 mutants expressed in different hosts were characterized and compared in terms of specific activity, pH profile, pH stability, temperature profile, and thermostability. The specific activity of B. subtilis-expressed D24G/K70R/K111E/N121S mutant at pH 7.0 and 60 °C was 30.4 U/mg, obviously higher than those in P. pastoris (22.7 U/mg) and E. coli (19.7 U/mg). Moreover, after 10 min incubation at 80 °C, the B. subtilis-expressed D24G/K70R/K111E/N121S retained about 70 % of the activity at pH 7.0 and 37 °C, whereas the values were only about 25 and 50 % when expressed in P. pastoris and E. coli, respectively. These results suggested B. subtilis as an appropriate host for expression of phy168 mutants and that the strategy of creating mutants in one host and expressing them in another might be a new solution to industrial production of proteins with desired properties.

Gli function is essential for motor neuron induction in zebrafish.

PubMed

Vanderlaan, Gary; Tyurina, Oksana V; Karlstrom, Rolf O; Chandrasekhar, Anand

2005-06-15

The Gli family of zinc-finger transcription factors mediates Hedgehog (Hh) signaling in all vertebrates. However, their roles in ventral neural tube patterning, in particular motor neuron induction, appear to have diverged across species. For instance, cranial motor neurons are essentially lost in zebrafish detour (gli1(-)) mutants, whereas motor neuron development is unaffected in mouse single gli and some double gli knockouts. Interestingly, the expression of some Hh-regulated genes (ptc1, net1a, gli1) is mostly unaffected in the detour mutant hindbrain, suggesting that other Gli transcriptional activators may be involved. To better define the roles of the zebrafish gli genes in motor neuron induction and in Hh-regulated gene expression, we examined these processes in you-too (yot) mutants, which encode dominant repressor forms of Gli2 (Gli2(DR)), and following morpholino-mediated knockdown of gli1, gli2, and gli3 function. Motor neuron induction at all axial levels was reduced in yot (gli2(DR)) mutant embryos. In addition, Hh target gene expression at all axial levels except in rhombomere 4 was also reduced, suggesting an interference with the function of other Glis. Indeed, morpholino-mediated knockdown of Gli2(DR) protein in yot mutants led to a suppression of the defective motor neuron phenotype. However, gli2 knockdown in wild-type embryos generated no discernable motor neuron phenotype, while gli3 knockdown reduced motor neuron induction in the hindbrain and spinal cord. Significantly, gli2 or gli3 knockdown in detour (gli1(-)) mutants revealed roles for Gli2 and Gli3 activator functions in ptc1 expression and spinal motor neuron induction. Similarly, gli1 or gli3 knockdown in yot (gli2(DR)) mutants resulted in severe or complete loss of motor neurons, and of ptc1 and net1a expression, in the hindbrain and spinal cord. In addition, gli1 expression was greatly reduced in yot mutants following gli3, but not gli1, knockdown, suggesting that Gli3 activator function is specifically required for gli1 expression. These observations demonstrate that Gli activator function (encoded by gli1, gli2, and gli3) is essential for motor neuron induction and Hh-regulated gene expression in zebrafish.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

Hoxb3 negatively regulates Hoxb1 expression in mouse hindbrain patterning.

PubMed

Wong, Elaine Y M; Wang, Xing An; Mak, Siu Shan; Sae-Pang, Jearn Jang; Ling, Kam Wing; Fritzsch, Bernd; Sham, Mai Har

2011-04-15

The spatial regulation of combinatorial expression of Hox genes is critical for determining hindbrain rhombomere (r) identities. To address the cross-regulatory relationship between Hox genes in hindbrain neuronal specification, we have generated a gain-of-function transgenic mouse mutant Hoxb3(Tg) using the Hoxb2 r4-specific enhancer element. Interestingly, in r4 of the Hoxb3(Tg) mutant where Hoxb3 was ectopically expressed, the expression of Hoxb1 was specifically abolished. The hindbrain neuronal defects of the Hoxb3(Tg) mutant mice were similar to those of Hoxb1(-/-) mutants. Therefore, we hypothesized that Hoxb3 could directly suppress Hoxb1 expression. We first identified a novel Hoxb3 binding site S3 on the Hoxb1 locus and confirmed protein binding to this site by EMSA, and by in vivo ChIP analysis using P19 cells and hindbrain tissues from the Hoxb3(Tg) mutant. We further showed that Hoxb3 could suppress Hoxb1 transcriptional activity by chick in ovo luciferase reporter assay. Moreover, in E10.5 wildtype caudal hindbrain, where Hoxb1 is not expressed, we showed by in vivo ChIP that Hoxb3 was consistently bound to the S3 site on the Hoxb1 gene. This study reveals a novel negative regulatory mechanism by which Hoxb3 as a posterior gene serves to restrict Hoxb1 expression in r4 by direct transcriptional repression to maintain the rhombomere identity. Copyright © 2011 Elsevier Inc. All rights reserved.

The zebrafish gene cloche acts upstream of a flk-1 homologue to regulate endothelial cell differentiation.

PubMed

Liao, W; Bisgrove, B W; Sawyer, H; Hug, B; Bell, B; Peters, K; Grunwald, D J; Stainier, D Y

1997-01-01

The zebrafish cloche mutation affects both the endothelial and hematopoietic lineages at a very early stage (Stainier, D. Y. R., Weinstein, B. M., Detrich, H. W., Zon, L. I. and Fishman, M. C. (1995). Development 121, 3141-3150). The most striking vascular phenotype is the absence of endocardial cells from the heart. Microscopic examination of mutant embryos reveals the presence of endothelial-like cells in the lower trunk and tail regions while head vessels appear to be missing, indicating a molecular diversification of the endothelial lineage. Cell transplantation experiments show that cloche acts cell-autonomously within the endothelial lineage. To analyze further the role of cloche in regulating endothelial cell differentiation, we have examined the expression of flk-1 and tie, two receptor tyrosine kinase genes expressed early and sequentially in the endothelial lineage. In wild-type fish, flk-1-positive cells are found throughout the embryo and differentiate to form the nascent vasculature. In cloche mutants, flk-1-positive cells are found only in the lower trunk and tail regions, and this expression is delayed as compared to wild-type. Unlike the flk-1-positive cells in wild-type embryos, those in cloche mutants do not go on to express tie, suggesting that their differentiation is halted at an early stage. We also find that the cloche mutation is not linked to flk-1. These data indicate that cloche affects the differentiation of all endothelial cells and that it acts at a very early stage, either by directly regulating flk-1 expression or by controlling the differentiation of cells that normally develop to express flk-1. cloche mutants also have a blood deficit and their hematopoietic tissues show no expression of the hematopoietic transcription factor genes GATA-1 or GATA-2 at early stages. Because the appearance of distinct levels of flk-1 expression is delayed in cloche mutants, we examined GATA-1 expression at late embryonic stages and found some blood cell differentiation that appears to be limited to the region lined by the flk-1-expressing cells. The spatial restriction of blood in the ventroposterior-most region of cloche mutant embryos may be indicative of a ventral source of signal(s) controlling hematopoietic differentiation. In addition, the restricted colocalization of blood and endothelium in cloche mutants suggests that important interactions occur between these two lineages during normal development.

Porous Ti-6Al-4V alloy fabricated by spark plasma sintering for biomimetic surface modification.

PubMed

Kon, Masayuki; Hirakata, Luciana M; Asaoka, Kenzo

2004-01-15

Porous compacts with both biological and biomechanical compatibilities and high strength were developed. Spherical powders of Ti-6Al-4V alloy, which were either as received or surface modified with the use of calcium ions by hydrothermal treatment (HTT), were fabricated by a spark plasma sintering process. The porous compacts of pure Ti were used as reference materials. Porosity was approximately 30%, and compressive strengths were 113 and 125 MPa for the as-received Ti alloy powders and those modified by the HTT process, respectively. The bending strength and elastic modulus of as-received Ti alloy powders were 128-178 MPa and 16-18 GPa, respectively. Each of the compacts was immersed in simulated body fluid (SBF). The amount of adsorption/precipitation of calcium phosphate through the compacts was measured by weight change and was observed by SEM. The compacts were covered with calcium phosphate after 2 weeks of immersion in SBF. The compacts of Ti alloy had plenty of precipitated apatite crystals, and modification by HTT accumulated more precipitation. Because calcium phosphate is a mineral component of bone, apatite, which is precipitated on the surface of the compacts, could adsorb proteins and/or drugs such as antibiotics. It is expected that a large amount of proteins and/or drugs could be impregnated when the porous compacts developed are used. Copyright 2003 Wiley Periodicals, Inc.

Characterisation of the ruminal fermentation and microbiome in lambs supplemented with hydrolysable and condensed tannins.

PubMed

Salami, Saheed A; Valenti, Bernardo; Bella, Marco; O'Grady, Michael N; Luciano, Giuseppe; Kerry, Joseph P; Jones, Eleanor; Priolo, Alessandro; Newbold, Charles J

2018-05-01

This study characterised the response of ruminal fermentation and the rumen microbiome in lambs fed commercial vegetal sources of hydrolysable tannins (HT) and condensed tannins (CT). Forty-four lambs (19.56 ± 2.06 kg) were randomly assigned to either a concentrate diet (CON, n = 8) or CON supplemented with 4% of two HT [chestnut (Castanea sativa, HT-c) and tara (Caesalpinia spinosa, HT-t)] and CT [mimosa (Acacia negra, CT-m) and gambier (Uncaria gambir, CT-g)] extracts (all, n = 9) for 75 days pre-slaughter. Tannin supplementation did not influence ruminal fermentation traits. Quantitative PCR demonstrated that tannins did not affect the absolute abundance of ruminal bacteria or fungi. However, CT-m (-12.8%) and CT-g (-11.5%) significantly reduced the abundance of methanogens, while HT-t (-20.7%) and CT-g (-20.8%) inhibited protozoal abundance. Ribosomal amplicon sequencing revealed that tannins caused changes in the phylogenetic structure of the bacterial and methanogen communities. Tannins inhibited the fibrolytic bacterium, Fibrobacter and tended to suppress the methanogen genus, Methanosphaera. Results demonstrated that both HT and CT sources could impact the ruminal microbiome when supplemented at 4% inclusion level. HT-t, CT-m and CT-g extracts displayed specific antimicrobial activity against methanogens and protozoa without compromising ruminal fermentation in a long-term feeding trial.

Effect of mutant variants of the KRAS gene on PD-L1 expression and on the immune microenvironment and association with clinical outcome in lung adenocarcinoma patients.

PubMed

Falk, Alexander T; Yazbeck, Nathalie; Guibert, Nicolas; Chamorey, Emmanuel; Paquet, Agnès; Ribeyre, Lydia; Bence, Coraline; Zahaf, Katia; Leroy, Sylvie; Marquette, Charles-Hugo; Cohen, Charlotte; Mograbi, Baharia; Mazières, Julien; Hofman, Véronique; Brest, Patrick; Hofman, Paul; Ilié, Marius

2018-07-01

The effect of anti-PD-1/PD-L1 inhibitors on lung adenocarcinomas (LADCs) with KRAS mutations is debatable. We examined the association between specific mutant KRAS proteins and the immune infiltrates with the outcome of patients with LADCs. In 219 LADCs harboring either wild-type (WT) or mutated KRAS gene, we quantified the density of several immune markers by immunohistochemistry followed by automated digital image analysis. Data were correlated to clinicopathological parameters and outcome of patients. Tumors harboring mutant KRAS-G12 V had a significantly higher PD-L1 expression compared to other tumors (p = 0.044), while mutant KRAS-G12D tumors showed an increase in the density of CD66b+ cells (p = 0.001). High PD-L1 expression in tumor cells was associated to improved overall survival (OS) in KRAS mutant patients (p = 0.012), but not in the WT population (p = 0.385), whereas increased PD-L1 expression in immune cells correlated to poor OS of KRAS-WT patients (p = 0.025), with no difference in patients with KRAS mutations. KRAS mutational status can affect the immune microenvironment and survival of LADC patients in a heterogeneous way, implying that specific mutant KRAS variants expressed by the tumor should be considered when stratifying patients for immunotherapy. Copyright © 2018 Elsevier B.V. All rights reserved.

Mutant calreticulin-expressing cells induce monocyte hyperreactivity through a paracrine mechanism

PubMed Central

Garbati, Michael R.; Welgan, Catherine A.; Landefeld, Sally H.; Newell, Laura F.; Agarwal, Anupriya; Dunlap, Jennifer B.; Chourasia, Tapan K.; Lee, Hyunjung; Elferich, Johannes; Traer, Elie; Rattray, Rogan; Cascio, Michael J.; Press, Richard D.; Bagby, Grover C.; Tyner, Jeffrey W.; Druker, Brian J.; Dao, Kim-Hien T.

2016-01-01

Mutations in the calreticulin gene (CALR) were recently identified in approximately 70–80% of patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. All frameshift mutations generate a recurring novel C-terminus. Here we provide evidence that mutant calreticulin does not accumulate efficiently in cells and is abnormally enriched in the nucleus and extracellular space compared to wildtype calreticulin. The main determinant of these findings is the loss of the calcium-binding and KDEL domains. Expression of type I mutant CALR in Ba/F3 cells confers minimal IL-3-independent growth. Interestingly, expression of type I and type II mutant CALR in a non-hematopoietic cell line does not directly activate JAK/STAT signaling compared to JAK2-V617F expression. These results led us to investigate paracrine mechanisms of JAK/STAT activation. Here we show that conditioned media from cells expressing type I mutant CALR exaggerate cytokine production from normal monocytes with or without treatment with a toll-like receptor agonist. These effects are not dependent on the novel C-terminus. These studies offer novel insights into the mechanism of JAK/STAT activation in patients with JAK2-V617F-negative essential thrombocytosis and primary myelofibrosis. PMID:26573090

Superoxide-Dismutase Deficient Mutants in Common Beans (Phaseolus vulgaris L.): Genetic Control, Differential Expressions of Isozymes, and Sensitivity to Arsenic

PubMed Central

Talukdar, Dibyendu; Talukdar, Tulika

2013-01-01

Two common bean (Phaseolus vulgaris L.) mutants, sodPv 1 and sodPv 2, exhibiting foliar superoxide dismutase (SOD) activity of only 25% and 40% of their mother control (MC) cv. VL 63 were isolated in EMS-mutagenized (0.15%, 8 h) M2 progeny. Native-PAGE analysis revealed occurrence of Mn SOD, Fe SOD, Cu/Zn SOD I and Cu/Zn SOD II isozymes in MC, while Fe SOD, and Mn SOD were not formed in sodPv 1 and sodPv 2 leaves, respectively. In-gel activity of individual isozymes differed significantly among the parents. SOD deficiency is inherited as recessive mutations, controlled by two different nonallelic loci. Gene expressions using qRT PCR confirmed higher expressions of Cu/Zn SOD transcripts in both mutants and the absence of Fe SOD in sodPv 1 and Mn SOD in sodPv 2. In 50 μM arsenic, Cu/Zn SODs genes were further upregulated but other isoforms downregulated in the two mutants, maintaining SOD activity in its control level. In an F2 double mutants of sodPv 1 × sodPv 2, no Fe SOD, and Mn SOD expressions were detectable, while both Cu/Zn SODs are down-regulated and arsenic-induced leaf necrosis appeared. In contrast to both mutants, ROS-imaging study revealed overaccumulation of both superoxides and H2O2 in leaves of double mutant. PMID:24078924

Gibberellin regulates pollen viability and pollen tube growth in rice.

PubMed

Chhun, Tory; Aya, Koichiro; Asano, Kenji; Yamamoto, Eiji; Morinaka, Yoichi; Watanabe, Masao; Kitano, Hidemi; Ashikari, Motoyuki; Matsuoka, Makoto; Ueguchi-Tanaka, Miyako

2007-12-01

Gibberellins (GAs) play many biological roles in higher plants. We collected and performed genetic analysis on rice (Oryza sativa) GA-related mutants, including GA-deficient and GA-insensitive mutants. Genetic analysis of the mutants revealed that rice GA-deficient mutations are not transmitted as Mendelian traits to the next generation following self-pollination of F1 heterozygous plants, although GA-insensitive mutations are transmitted normally. To understand these differences in transmission, we examined the effect of GA on microsporogenesis and pollen tube elongation in rice using new GA-deficient and GA-insensitive mutants that produce semifertile flowers. Phenotypic analysis revealed that the GA-deficient mutant reduced pollen elongation1 is defective in pollen tube elongation, resulting in a low fertilization frequency, whereas the GA-insensitive semidominant mutant Slr1-d3 is mainly defective in viable pollen production. Quantitative RT-PCR revealed that GA biosynthesis genes tested whose mutations are transmitted to the next generation at a lower frequency are preferentially expressed after meiosis during pollen development, but expression is absent or very low before the meiosis stage, whereas GA signal-related genes are actively expressed before meiosis. Based on these observations, we predict that the transmission of GA-signaling genes occurs in a sporophytic manner, since the protein products and/or mRNA transcripts of these genes may be introduced into pollen-carrying mutant alleles, whereas GA synthesis genes are transmitted in a gametophytic manner, since these genes are preferentially expressed after meiosis.

Zebrafish pit1 mutants lack three pituitary cell types and develop severe dwarfism.

PubMed

Nica, Gabriela; Herzog, Wiebke; Sonntag, Carmen; Hammerschmidt, Matthias

2004-05-01

The Pou domain transcription factor Pit-1 is required for lineage determination and cellular commitment processes during mammalian adenohypophysis development. Here we report the cloning and mutational analysis of a pit1 homolog from zebrafish. Compared with mouse, zebrafish pit1 starts to be expressed at a much earlier stage of adenohypophysis development. However, as in the mouse, expression is restricted to a subset of pituitary cell types, excluding proopiomelanocortin (pomc)-expressing cells (corticotropes, melanotropes) and possibly gonadotropes. We could identify two N-ethyl-N-nitrosourea-induced zebrafish pit1 null mutants. Most mutants die during larval stages, whereas survivors develop severe dwarfism. Mutant larvae lack lactotropes, somatotropes, and thyrotropes, although the adenohypophysis is of normal size, without any sign of increased apoptosis rates. Instead, mutant embryos initiate ectopic expression of pomc in pit1-positive cells, leading to an expansion of the Pomc lineage. Similarly, the number of gonadotropes seems increased, as indicated by the expression of gsualpha, a marker for thyrotropes and gonadotropes. In pit1 mutants, the total number of gsualpha-positive cells is normal despite the loss of gsualpha and tshbeta coexpressing cells. Together, these data suggest a transfating of the Pit1 lineage to the Pomc and possibly the gonadotroph lineages in the mutant, and a pomc- and gonadotropin-repressive role of Pit1 during normal zebrafish development. This is different from mouse, for which a repressive role of Pit-1 has only been reported for the gonadotropin Lhbeta, but not for Pomc. In sum, our data point to both conserved and class-specific aspects of Pit1 function during pituitary development in different vertebrate species.

Chaperone-mediated autophagy degrades mutant p53

PubMed Central

Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

2013-01-01

Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

Role of inositol 1,4,5-trisphosphate receptors in pathogenesis of Huntington's disease and spinocerebellar ataxias.

PubMed

Bezprozvanny, Ilya

2011-07-01

Huntington's disease (HD) and spinocerebellar ataxias (SCAs) are autosomal-dominant neurodegenerative disorders. HD is caused by polyglutamine (polyQ) expansion in the amino-terminal region of a protein huntingtin (Htt) and primarily affects medium spiny striatal neurons (MSN). Many SCAs are caused by polyQ-expansion in ataxin proteins and primarily affect cerebellar Purkinje cells. The reasons for neuronal dysfunction and death in HD and SCAs remain poorly understood and no cure is available for the patients. Our laboratory discovered that mutant huntingtin, ataxin-2 and ataxin-3 proteins specifically bind to the carboxy-terminal region of the type 1 inositol 1,4,5-trisphosphate receptor (IP(3)R1), an intracellular Ca(2+) release channel. Moreover, we found that association of mutant huntingtin or ataxins with IP(3)R1 causes sensitization of IP(3)R1 to activation by IP(3) in planar lipid bilayers and in neuronal cells. These results suggested that deranged neuronal Ca(2+) signaling might play an important role in pathogenesis of HD, SCA2 and SCA3. In support of this idea, we demonstrated a connection between abnormal Ca(2+) signaling and neuronal cell death in experiments with HD, SCA2 and SCA3 transgenic mouse models. Additional data in the literature indicate that abnormal neuronal Ca(2+) signaling may also play an important role in pathogenesis of SCAl, SCA5, SCA6, SCA14 and SCA15/16. Based on these results I propose that IP(3)R and other Ca(2+) signaling proteins should be considered as potential therapeutic targets for treatment of HD and SCAs.

Rice PLASTOCHRON genes regulate leaf maturation downstream of the gibberellin signal transduction pathway.

PubMed

Mimura, Manaki; Nagato, Yasuo; Itoh, Jun-Ichi

2012-05-01

Rice PLASTOCHRON 1 (PLA1) and PLA2 genes regulate leaf maturation and plastochron, and their loss-of-function mutants exhibit small organs and rapid leaf emergence. They encode a cytochrome P450 protein CYP78A11 and an RNA-binding protein, respectively. Their homologs in Arabidopsis and maize are also associated with plant development/organ size. Despite the importance of PLA genes in plant development, their molecular functions remain unknown. Here, we investigated how PLA1 and PLA2 genes are related to phytohormones. We found that gibberellin (GA) is the major phytohormone that promotes PLA1 and PLA2 expression. GA induced PLA1 and PLA2 expression, and conversely the GA-inhibitor uniconazole suppressed PLA1 and PLA2 expression. In pla1-4 and pla2-1 seedlings, expression levels of GA biosynthesis genes and the signal transduction gene were similar to those in wild-type seedlings. GA treatment slightly down-regulated the GA biosynthesis gene GA20ox2 and up-regulated the GA-catabolizing gene GA2ox4, whereas the GA biosynthesis inhibitor uniconazole up-regulated GA20ox2 and down-regulated GA2ox4 both in wild-type and pla mutants, suggesting that the GA feedback mechanism is not impaired in pla1 and pla2. To reveal how GA signal transduction affects the expression of PLA1 and PLA2, PLA expression in GA-signaling mutants was examined. In GA-insensitive mutant, gid1 and less-sensitive mutant, Slr1-d1, PLA1 and PLA2 expression was down-regulated. On the other hand, the expression levels of PLA1 and PLA2 were highly enhanced in a GA-constitutive-active mutant, slr1-1, causing ectopic overexpression. These results indicate that both PLA1 and PLA2 act downstream of the GA signal transduction pathway to regulate leaf development.

Characterization and Complementation of a Chlorophyll-Less Dominant Mutant GL1 in Lagerstroemia indica.

PubMed

Wang, Shu'an; Wang, Peng; Gao, Lulu; Yang, Rutong; Li, Linfang; Zhang, Enliang; Wang, Qing; Li, Ya; Yin, Zengfang

2017-05-01

Crape myrtle (Lagerstroemia indica) is a woody ornamental plant popularly grown because of its long-lasting, midsummer blooms and beautiful colors. The GL1 dominant mutant is the first chlorophyll-less mutant identified in crape myrtle. It was obtained from a natural yellow leaf bud mutation. We previously revealed that leaf color of the GL1 mutant is affected by light intensity. However, the mechanism of the GL1 mutant on light response remained unclear. The acclimation response of mutant and wild-type (WT) plants was assessed in a time series after transferring from low light (LL) to high light (HL) by analyzing chlorophyll synthesis precursor content, photosynthetic performance, and gene expression. In LL conditions, coproporphyrinogen III (Coprogen III) content had the greatest amount of accumulation in the mutant compared with WT, increasing by 100%. This suggested that the yellow leaf phenotype of the GL1 dominant mutant might be caused by disruption of coproporphyrinogen III oxidase (CPO) biosynthesis. Furthermore, the candidate gene, oxygen-independent CPO (HEMN), might only affect expression of upstream genes involved in chlorophyll metabolism in the mutant. Moreover, two genes, photosystem II (PSII) 10 kDa protein (psbR) and chlorophyll a/b binding protein gene (CAB1), had decreased mRNA levels in the GL1 mutant within the first 96 h following LL/HL transfer compared with the WT. Hierarchical clustering revealed that these two genes shared a similar expression trend as the oxygen-dependent CPO (HEMF). These findings provide evidence that GL1 is highly coordinated with PSII stability and chloroplast biogenesis.

Life satisfaction in the new country: a multilevel longitudinal analysis of effects of culture and 5-HTT allele frequency distribution in country of origin

PubMed Central

Kent, Stephen; Kashima, Yoshihisa

2015-01-01

Life satisfaction of migrants to Australia from 17 countries, assessed at 4–5 months, 16–17 months and 3½ years after arrival, was analyzed with a longitudinal, multilevel analysis. The results indicated that migrants were more satisfied, if the national average life satisfaction was higher in their country of origin, after adjustment for individual-level income, age, and sex and a linear temporal trend. Simultaneously, the migrants were also happier if people in their country of origin had a higher frequency of 5-HTT long allele, a genotype known to be associated with resilience under life stresses. These two relationships were independent, suggesting that both culture and gene matter in international transitions. PMID:24532702

Amino acids Thr56 and Thr58 are not essential for elongation factor 2 function in yeast.

PubMed

Bartish, Galyna; Moradi, Hossein; Nygård, Odd

2007-10-01

Yeast elongation factor 2 is an essential protein that contains two highly conserved threonine residues, T56 and T58, that could potentially be phosphorylated by the Rck2 kinase in response to environmental stress. The importance of residues T56 and T58 for elongation factor 2 function in yeast was studied using site directed mutagenesis and functional complementation. Mutations T56D, T56G, T56K, T56N and T56V resulted in nonfunctional elongation factor 2 whereas mutated factor carrying point mutations T56M, T56C, T56S, T58S and T58V was functional. Expression of mutants T56C, T56S and T58S was associated with reduced growth rate. The double mutants T56M/T58W and T56M/T58V were also functional but the latter mutant caused increased cell death and considerably reduced growth rate. The results suggest that the physiological role of T56 and T58 as phosphorylation targets is of little importance in yeast under standard growth conditions. Yeast cells expressing mutants T56C and T56S were less able to cope with environmental stress induced by increased growth temperatures. Similarly, cells expressing mutants T56M and T56M/T58W were less capable of adapting to increased osmolarity whereas cells expressing mutant T58V behaved normally. All mutants tested were retained their ability to bind to ribosomes in vivo. However, mutants T56D, T56G and T56K were under-represented on the ribosome, suggesting that these nonfunctional forms of elongation factor 2 were less capable of competing with wild-type elongation factor 2 in ribosome binding. The presence of nonfunctional but ribosome binding forms of elongation factor 2 did not affect the growth rate of yeast cells also expressing wild-type elongation factor 2.

A De Novo Floral Transcriptome Reveals Clues into Phalaenopsis Orchid Flower Development

PubMed Central

Huang, Jian-Zhi; Lin, Chih-Peng; Cheng, Ting-Chi; Chang, Bill Chia-Han; Cheng, Shu-Yu; Chen, Yi-Wen; Lee, Chen-Yu; Chin, Shih-Wen; Chen, Fure-Chyi

2015-01-01

Phalaenopsis has a zygomorphic floral structure, including three outer tepals, two lateral inner tepals and a highly modified inner median tepal called labellum or lip; however, the regulation of its organ development remains unelucidated. We generated RNA-seq reads with the Illumina platform for floral organs of the Phalaenopsis wild-type and peloric mutant with a lip-like petal. A total of 43,552 contigs were obtained after de novo assembly. We used differentially expressed gene profiling to compare the transcriptional changes in floral organs for both the wild-type and peloric mutant. Pair-wise comparison of sepals, petals and labellum between peloric mutant and its wild-type revealed 1,838, 758 and 1,147 contigs, respectively, with significant differential expression. PhAGL6a (CUFF.17763), PhAGL6b (CUFF.17763.1), PhMADS1 (CUFF.36625.1), PhMADS4 (CUFF.25909) and PhMADS5 (CUFF.39479.1) were significantly upregulated in the lip-like petal of the peloric mutant. We used real-time PCR analysis of lip-like petals, lip-like sepals and the big lip of peloric mutants to confirm the five genes’ expression patterns. PhAGL6a, PhAGL6b and PhMADS4 were strongly expressed in the labellum and significantly upregulated in lip-like petals and lip-like sepals of peloric-mutant flowers. In addition, PhAGL6b was significantly downregulated in the labellum of the big lip mutant, with no change in expression of PhAGL6a. We provide a comprehensive transcript profile and functional analysis of Phalaenopsis floral organs. PhAGL6a PhAGL6b, and PhMADS4 might play crucial roles in the development of the labellum in Phalaenopsis. Our study provides new insights into how the orchid labellum differs and why the petal or sepal converts to a labellum in Phalaenopsis floral mutants. PMID:25970572

Functions of transmembrane domain 3 of human melanocortin-4 receptor.

PubMed

Mo, Xiu-Lei; Yang, Rui; Tao, Ya-Xiong

2012-12-01

The melanocortin-4 receptor (MC4R) is a G protein-coupled receptor critical for maintaining energy homeostasis. Transmembrane domain 3 (TM3) of MC4R contains residues that were suggested to be essential in ligand binding and signaling. Several MC4R mutations in TM3 are associated with human obesity. To gain a better understanding of the functions of TM3, we analyzed the functions of 26 residues in TM3 using alanine-scanning mutagenesis. We showed that all mutants had normal cell-surface expression. Four mutants were defective in ligand binding and signaling and six mutants had normal ligand binding but impaired cAMP production. L140A had increased basal cAMP level. To further characterize the function of L140, we generated 17 additional L140 mutants. Fifteen L140 mutants had significantly decreased cell-surface expression, with L140R and L140V expressed normally. Ten L140 mutants had increased basal cAMP activities. Four L140 mutants were defective in ligand-stimulated cAMP generation. Interestingly, with the ERK1/2 pathway, we showed that nine constitutively active mutants had similar levels of basal pERK1/2 as that of WT, and two signaling defective mutants had similar levels of pERK1/2 as that of WT upon agonist stimulation, different from their cAMP signaling properties, suggesting biased signaling in these mutant receptors. In summary, we identified 13 residues in TM3 that were essential for ligand binding and/or signaling. Moreover, L140 was critical for locking MC4R in inactive conformation and several mutants showed biased signaling in cAMP and ERK1/2 signaling pathways.

Gene expression profile analysis of Ligon lintless-1 (Li1) mutant reveals important genes and pathways in cotton leaf and fiber development.

PubMed

Ding, Mingquan; Jiang, Yurong; Cao, Yuefen; Lin, Lifeng; He, Shae; Zhou, Wei; Rong, Junkang

2014-02-10

Ligon lintless-1 (Li1) is a monogenic dominant mutant of Gossypium hirsutum (upland cotton) with a phenotype of impaired vegetative growth and short lint fibers. Despite years of research involving genetic mapping and gene expression profile analysis of Li1 mutant ovule tissues, the gene remains uncloned and the underlying pathway of cotton fiber elongation is still unclear. In this study, we report the whole genome-level deep-sequencing analysis of leaf tissues of the Li1 mutant. Differentially expressed genes in leaf tissues of mutant versus wild-type (WT) plants are identified, and the underlying pathways and potential genes that control leaf and fiber development are inferred. The results show that transcription factors AS2, YABBY5, and KANDI-like are significantly differentially expressed in mutant tissues compared with WT ones. Interestingly, several fiber development-related genes are found in the downregulated gene list of the mutant leaf transcriptome. These genes include heat shock protein family, cytoskeleton arrangement, cell wall synthesis, energy, H2O2 metabolism-related genes, and WRKY transcription factors. This finding suggests that the genes are involved in leaf morphology determination and fiber elongation. The expression data are also compared with the previously published microarray data of Li1 ovule tissues. Comparative analysis of the ovule transcriptomes of Li1 and WT reveals that a number of pathways important for fiber elongation are enriched in the downregulated gene list at different fiber development stages (0, 6, 9, 12, 15, 18dpa). Differentially expressed genes identified in both leaf and fiber samples are aligned with cotton whole genome sequences and combined with the genetic fine mapping results to identify a list of candidate genes for Li1. Copyright © 2013 Elsevier B.V. All rights reserved.

Enhanced cellulase producing mutants developed from heterokaryotic Aspergillus strain.

PubMed

Kaur, Baljit; Oberoi, H S; Chadha, B S

2014-03-01

A heterokaryon 28, derived through protoplast fusion between Aspergillus nidulans and Aspergillus tubingensis (Dal8), was subjected cyclic mutagenesis followed by selection on increasing levels of 2-deoxy glucose (2-DG) as selection marker. The derived deregulated cellulase hyper producing mutant '64', when compared to fusant 28, produced 9.83, 7.8, 3.2, 4.2 and 19.74 folds higher endoglucanase, β-glucosidase, cellobiohydrolase, FPase and xylanase, respectively, under shake cultures. The sequence analysis of PCR amplified β-glucosidase gene from wild and mutant showed nucleotide deletion/substitution. The mutants showed highly catalytic efficient β-glucosidase as evident from low Km and high Vmax values. The expression profiling through zymogram analysis also indicated towards over-expression of cellulases. The up/down regulated expressed proteins observed through SDS-PAGE were identified by Peptide mass fingerprinting The cellulase produced by mutants in conjunction with cellulase free xylanase derived from Thermomyces lanuginosus was used for efficient utilization of alkali treated rice straw for obtaining xylo-oligosaccharides and ethanol. Copyright © 2014 Elsevier Ltd. All rights reserved.

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

Functional assessment of the Medicago truncatula NIP/LATD protein demonstrates that it is a high-affinity nitrate transporter.

PubMed

Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D Janine; Dickstein, Rebecca

2012-10-01

The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function.

Functional Assessment of the Medicago truncatula NIP/LATD Protein Demonstrates That It Is a High-Affinity Nitrate Transporter1[W][OA

PubMed Central

Bagchi, Rammyani; Salehin, Mohammad; Adeyemo, O. Sarah; Salazar, Carolina; Shulaev, Vladimir; Sherrier, D. Janine; Dickstein, Rebecca

2012-01-01

The Medicago truncatula NIP/LATD (for Numerous Infections and Polyphenolics/Lateral root-organ Defective) gene encodes a protein found in a clade of nitrate transporters within the large NRT1(PTR) family that also encodes transporters of dipeptides and tripeptides, dicarboxylates, auxin, and abscisic acid. Of the NRT1(PTR) members known to transport nitrate, most are low-affinity transporters. Here, we show that M. truncatula nip/latd mutants are more defective in their lateral root responses to nitrate provided at low (250 μm) concentrations than at higher (5 mm) concentrations; however, nitrate uptake experiments showed no discernible differences in uptake in the mutants. Heterologous expression experiments showed that MtNIP/LATD encodes a nitrate transporter: expression in Xenopus laevis oocytes conferred upon the oocytes the ability to take up nitrate from the medium with high affinity, and expression of MtNIP/LATD in an Arabidopsis chl1(nrt1.1) mutant rescued the chlorate susceptibility phenotype. X. laevis oocytes expressing mutant Mtnip-1 and Mtlatd were unable to take up nitrate from the medium, but oocytes expressing the less severe Mtnip-3 allele were proficient in nitrate transport. M. truncatula nip/latd mutants have pleiotropic defects in nodulation and root architecture. Expression of the Arabidopsis NRT1.1 gene in mutant Mtnip-1 roots partially rescued Mtnip-1 for root architecture defects but not for nodulation defects. This suggests that the spectrum of activities inherent in AtNRT1.1 is different from that possessed by MtNIP/LATD, but it could also reflect stability differences of each protein in M. truncatula. Collectively, the data show that MtNIP/LATD is a high-affinity nitrate transporter and suggest that it could have another function. PMID:22858636

Effective non-denaturing purification method for improving the solubility of recombinant actin-binding proteins produced by bacterial expression.

PubMed

Chung, Jeong Min; Lee, Sangmin; Jung, Hyun Suk

2017-05-01

Bacterial expression is commonly used to produce recombinant and truncated mutant eukaryotic proteins. However, heterologous protein expression may render synthesized proteins insoluble. The conventional method used to express a poorly soluble protein, which involves denaturation and refolding, is time-consuming and inefficient. There are several non-denaturing approaches that can increase the solubility of recombinant proteins that include using different bacterial cell strains, altering the time of induction, lowering the incubation temperature, and employing different detergents for purification. In this study, we compared several non-denaturing protocols to express and purify two insoluble 34 kDa actin-bundling protein mutants. The solubility of the mutant proteins was not affected by any of the approaches except for treatment with the detergent sarkosyl. These results indicate that sarkosyl can effectively improve the solubility of insoluble proteins during bacterial expression. Copyright © 2016. Published by Elsevier Inc.

An extension of hypotheses regarding rapid-acting, treatment-refractory, and conventional antidepressant activity of dextromethorphan and dextrorphan.

PubMed

Lauterbach, Edward C

2012-06-01

It was previously hypothesized that dextromethorphan (DM) and dextrorphan (DX) may possess antidepressant properties, including rapid and conventional onsets of action and utility in treatment-refractory depression, based on pharmacodynamic similarities to ketamine. These similarities included sigma-1 (σ(1)) agonist and NMDA antagonist properties, calcium channel blockade, muscarinic binding, serotonin transporter (5HTT) inhibition, and μ receptor potentiation. Here, six specific hypotheses are developed in light of additional mechanisms and evidence. Comparable potencies to ketamine for DM and DX are detailed for σ(1) (DX>DM>ketamine), NMDA PCP site (DX>ketamine>DM), and muscarinic (DX>ketamine>DM) receptors, 5HTT (DM>DX≫ketamine), and NMDA antagonist potentiation of μ receptor stimulation (DM>ketamine). Rapid acting antidepressant properties of DM include NMDA high-affinity site, NMDR-2A, and functional NMDR-2B receptor antagonism, σ(1) stimulation, putative mTOR activation (by σ(1) stimulation, μ potentiation, and 5HTT inhibition), putative AMPA receptor trafficking (by mTOR activation, PCP antagonism, σ(1) stimulation, μ potentiation, and 5HTT inhibition), and dendritogenesis, spinogenesis, synaptogenesis, and neuronal survival by NMDA antagonism and σ(1) and mTOR signaling. Those for dextrorphan include NMDA high-affinity site and NMDR-2A antagonism, σ(1) stimulation, putative mTOR activation (by σ(1) stimulation and ß adrenoreceptor stimulation), putative AMPA receptor trafficking (by mTOR activation, PCP antagonism, σ(1) stimulation, ß stimulation, and μ antagonism), and dendritogenesis, spinogenesis, synaptogenesis, and neuronal survival by NMDA antagonism and σ(1) and mTOR signaling. Conventional antidepressant properties for dextromethorphan and dextrorphan include 5HTT and norepinephrine transporter inhibition, σ(1) stimulation, NMDA and PCP antagonism, and possible serotonin 5HT1b/d receptor stimulation. Additional properties for dextromethorphan include possible presynaptic α(2) adrenoreceptor antagonism or postsynaptic α(2) stimulation and, for dextrorphan, ß stimulation and possible muscarinic and μ antagonism. Treatment-refractory depression properties include increased serotonin and norepinephrine availability, PCP, NMDR-2B, presynaptic alpha-2 antagonism, and the multiplicity of other antidepressant receptor mechanisms. Suggestions for clinical trials are provided for oral high-dose dextromethorphan and Nuedexta (dextromethorphan combined with quinidine to block metabolism to dextrorphan, thereby increasing dextromethorphan plasma concentrations). Suggestions include exclusionary criteria, oral dosing, observation periods, dose-response approaches, and safety and tolerability are considered. Although oral dextromethorphan may be somewhat more likely to show efficacy through complementary antidepressant mechanisms of dextrorphan, a clinical trial will be more logistically complex than one of Nuedexta due to high doses and plasma level variability. Clinical trials may increase our therapeutic armamentarium and our pharmacological understanding of treatment-refractory depression and antidepressant onset of action. Copyright © 2012 Elsevier Ltd. All rights reserved.

Novel CLCNKB mutations causing Bartter syndrome affect channel surface expression.

PubMed

Keck, Mathilde; Andrini, Olga; Lahuna, Olivier; Burgos, Johanna; Cid, L Pablo; Sepúlveda, Francisco V; L'hoste, Sébastien; Blanchard, Anne; Vargas-Poussou, Rosa; Lourdel, Stéphane; Teulon, Jacques

2013-09-01

Mutations in the CLCNKB gene encoding the ClC-Kb Cl(-) channel cause Bartter syndrome, which is a salt-losing renal tubulopathy. Here, we investigate the functional consequences of seven mutations. When expressed in Xenopus laevis oocytes, four mutants carried no current (c.736G>C, p.Gly246Arg; c.1271G>A, p.Gly424Glu; c.1313G>A, p.Arg438His; c.1316T>C, p.Leu439Pro), whereas others displayed a 30%-60% reduction in conductance as compared with wild-type ClC-Kb (c.242T>C, p.Leu81Pro; c.274C>T, p.Arg92Trp; c.1052G>C, p.Arg351Pro). Anion selectivity and sensitivity to external Ca(2+) and H(+), typical of the ClC-Kb channel, were not modified in the partially active mutants. In oocytes, we found that all the mutations reduced surface expression with a profile similar to that observed for currents. In HEK293 cells, the currents in the mutants had similar profiles to those obtained in oocytes, except for p.Leu81Pro, which produced no current. Furthermore, p.Arg92Trp and p.Arg351Pro mutations did not modify the unit-conductance of closely related ClC-K1. Western blot analysis in HEK293 cells showed that ClC-Kb protein abundance was lower for the nonconducting mutants but similar to wild-type for other mutants. Overall, two classes of mutants can be distinguished: nonconducting mutants associated with low total protein expression, and partially conducting mutants with unaltered channel properties and ClC-Kb protein abundance. © 2013 WILEY PERIODICALS, INC.

Lovastatin synergizes with itraconazole against planktonic cells and biofilms of Candida albicans through the regulation on ergosterol biosynthesis pathway.

PubMed

Zhou, Yujie; Yang, Hong; Zhou, Xuedong; Luo, Hongke; Tang, Fan; Yang, Jin; Alterovitz, Gil; Cheng, Lei; Ren, Biao

2018-06-01

The increase of fungal infectious diseases and lack of safe and efficacious antifungal drugs result in the urgent need of new therapeutic strategies. Here, we repurposed the lovastatin (LOV) as a synergistic antifungal potentiator to itraconazole (ITZ) against Candida albicans planktonic cells and biofilms in vitro for the first time. Mutants from ergosterol biosynthesis pathway were employed and key gene expression profiles of ergosterol pathway were also measured. LOV single treatment was unable to inhibit C. albicans strains except the ERG3 and ERG11 double mutant. LOV and ITZ combination was capable of inhibiting the C. albicans planktonic cells and biofilms synergistically including the ITZ resistant mutants. The synergistic antifungal ability was stronger in either ERG11 or ERG3 dysfunctional mutants compared to wild type. The combination lost the synergistic activities in the ERG11 and ERG3 double mutant, while it was sensitive to LOV single treatment. The expression of HMG1, encoding HMG-CoA the target of LOV, was significantly upregulated in ERG11 and ERG3 double mutant strain by the treatment of the combination at 1.5 and 3 h. The combination also significantly increased the HMG1 expression in mutants from ergosterol pathway compared with wild type. The ERG11 and ERG3 gene expressions were upregulated by ITZ and its combination with LOV, but seemingly not by LOV single treatment after 1.5 and 3 h. The combination of LOV and ITZ on C. albicans planktonic cells and biofilms highlights its potential clinical practice especially against the azole drug-resistant mutants.

The Arabidopsis Mutant cev1 Links Cell Wall Signaling to Jasmonate and Ethylene Responses

PubMed Central

Ellis, Christine; Karafyllidis, Ioannis; Wasternack, Claus; Turner, John G.

2002-01-01

Biotic and abiotic stresses stimulate the synthesis of jasmonates and ethylene, which, in turn, induce the expression of genes involved in stress response and enhance defense responses. The cev1 mutant has constitutive expression of stress response genes and has enhanced resistance to fungal pathogens. Here, we show that cev1 plants have increased production of jasmonate and ethylene and that its phenotype is suppressed by mutations that interrupt jasmonate and ethylene signaling. Genetic mapping, complementation analysis, and sequence analysis revealed that CEV1 is the cellulose synthase CeSA3. CEV1 was expressed predominantly in root tissues, and cev1 roots contained less cellulose than wild-type roots. Significantly, the cev1 mutant phenotype could be reproduced by treating wild-type plants with cellulose biosynthesis inhibitors, and the cellulose synthase mutant rsw1 also had constitutive expression of VSP. We propose that the cell wall can signal stress responses in plants. PMID:12119374

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Xiaohong; Zhang Shuhui; Lin Jing

The role of the hepatitis B virus X protein (HBx) in hepatocarcinogenesis remains controversial. To investigate the biological impact of hepatitis B virus x gene (HBx) mutation on hepatoma cells, plasmids expressing the full-length HBx or HBx deletion mutants were constructed. The biological activities in these transfectants were analyzed by a series of assays. Results showed that HBx3'-20 and HBx3'-40 amino acid deletion mutants exhibited an increase in cellular proliferation, focus formation, tumorigenicity, and invasive growth and metastasis through promotion of the cell cycle from G0/G1 to the S phase, when compared with the full-length HBx. In contrast, HBx3'-30 aminomore » acid deletion mutant repressed cell proliferation by blocking in G1 phase. The expression of P53, p21{sup WAF1}, p14{sup ARF}, and MDM2 proteins was regulated by expression of HBx mutants. In conclusions, HBx variants showed different effects and functions on cell proliferation and invasion by regulation of the cell cycle progression and its associated proteins expression.« less

Role of CTGF in White Matter Development in Tuberous Sclerosis

DTIC Science & Technology

2015-02-01

previously shown to affect CTGF expression. Our preliminary results show that SRF is downregulated in Tsc1 mutant brains and this can be rescued by rapamycin ...expression. Our preliminary results show that SRF is downregulated in Tsc1 mutant brains and this can be rescued by rapamycin treatment suggesting a...on SRF pathway in our previous report, here we show that SRF levels are decreased in vivo in mutant mice, and this can be rescued by rapamycin

Mutant p53-associated myosin-X upregulation promotes breast cancer invasion and metastasis.

PubMed

Arjonen, Antti; Kaukonen, Riina; Mattila, Elina; Rouhi, Pegah; Högnäs, Gunilla; Sihto, Harri; Miller, Bryan W; Morton, Jennifer P; Bucher, Elmar; Taimen, Pekka; Virtakoivu, Reetta; Cao, Yihai; Sansom, Owen J; Joensuu, Heikki; Ivaska, Johanna

2014-03-01

Mutations of the tumor suppressor TP53 are present in many forms of human cancer and are associated with increased tumor cell invasion and metastasis. Several mechanisms have been identified for promoting dissemination of cancer cells with TP53 mutations, including increased targeting of integrins to the plasma membrane. Here, we demonstrate a role for the filopodia-inducing motor protein Myosin-X (Myo10) in mutant p53-driven cancer invasion. Analysis of gene expression profiles from 2 breast cancer data sets revealed that MYO10 was highly expressed in aggressive cancer subtypes. Myo10 was required for breast cancer cell invasion and dissemination in multiple cancer cell lines and murine models of cancer metastasis. Evaluation of a Myo10 mutant without the integrin-binding domain revealed that the ability of Myo10 to transport β₁ integrins to the filopodia tip is required for invasion. Introduction of mutant p53 promoted Myo10 expression in cancer cells and pancreatic ductal adenocarcinoma in mice, whereas suppression of endogenous mutant p53 attenuated Myo10 levels and cell invasion. In clinical breast carcinomas, Myo10 was predominantly expressed at the invasive edges and correlated with the presence of TP53 mutations and poor prognosis. These data indicate that Myo10 upregulation in mutant p53-driven cancers is necessary for invasion and that plasma-membrane protrusions, such as filopodia, may serve as specialized metastatic engines.

Mutants of Neurospora crassa that alter gene expression and conidia development.

PubMed Central

Madi, L; Ebbole, D J; White, B T; Yanofsky, C

1994-01-01

Several genes have been identified that are highly expressed during conidiation. Inactivation of these genes has no observable phenotypic effect. Transcripts of two such genes, con-6 and con-10, are normally absent from vegetative mycelia. To identify regulatory genes that affect con-6 and/or con-10 expression, strains were prepared in which the regulatory regions for these genes were fused to a gene conferring hygromycin resistance. Mutants were then selected that were resistant to the drug during mycelial growth. Mutations in several of the isolates had trans effects; they activated transcription of the corresponding intact gene and, in most isolates, one or more of the other con genes. Most interestingly, resistant mutants were obtained that were defective at different stages of conidiation. One mutant conidiated under conditions that do not permit conidiation in wild type. Images PMID:8016143

Interaction theory of mammalian mitochondria.

PubMed

Nakada, K; Inoue, K; Hayashi, J

2001-11-09

We generated mice with deletion mutant mtDNA by its introduction from somatic cells into mouse zygotes. Expressions of disease phenotypes are limited to tissues expressing mitochondrial dysfunction. Considering that all these mice share the same nuclear background, these observations suggest that accumulation of the mutant mtDNA and resultant expressions of mitochondrial dysfunction are responsible for expression of disease phenotypes. On the other hand, mitochondrial dysfunction and expression of clinical abnormalities were not observed until the mutant mtDNA accumulated predominantly. This protection is due to the presence of extensive and continuous interaction between exogenous mitochondria from cybrids and recipient mitochondria from embryos. Thus, we would like to propose a new hypothesis on mitochondrial biogenesis, interaction theory of mitochondria: mammalian mitochondria exchange genetic contents, and thus lost the individuality and function as a single dynamic cellular unit. Copyright 2001 Academic Press.

spiel ohne grenzen/pou2 is required during establishment of the zebrafish midbrain-hindbrain boundary organizer.

PubMed

Belting, H G; Hauptmann, G; Meyer, D; Abdelilah-Seyfried, S; Chitnis, A; Eschbach, C; Söll, I; Thisse, C; Thisse, B; Artinger, K B; Lunde, K; Driever, W

2001-11-01

The vertebrate midbrain-hindbrain boundary (MHB) organizes patterning and neuronal differentiation in the midbrain and anterior hindbrain. Formation of this organizing center involves multiple steps, including positioning of the MHB within the neural plate, establishment of the organizer and maintenance of its regional identity and signaling activities. Juxtaposition of the Otx2 and Gbx2 expression domains positions the MHB. How the positional information is translated into activation of Pax2, Wnt1 and Fgf8 expression during MHB establishment remains unclear. In zebrafish spiel ohne grenzen (spg) mutants, the MHB is not established, neither isthmus nor cerebellum form, the midbrain is reduced in size and patterning abnormalities develop within the hindbrain. In spg mutants, despite apparently normal expression of otx2, gbx1 and fgf8 during late gastrula stages, the initial expression of pax2.1, wnt1 and eng2, as well as later expression of fgf8 in the MHB primordium are reduced. We show that spg mutants have lesions in pou2, which encodes a POU-domain transcription factor. Maternal pou2 transcripts are distributed evenly in the blastula, and zygotic expression domains include the midbrain and hindbrain primordia during late gastrulation. Microinjection of pou2 mRNA can rescue pax2.1 and wnt1 expression in the MHB of spg/pou2 mutants without inducing ectopic expression. This indicates an essential but permissive role for pou2 during MHB establishment. pou2 is expressed normally in noi/pax2.1 and ace/fgf8 zebrafish mutants, which also form no MHB. Thus, expression of pou2 does not depend on fgf8 and pax2.1. Our data suggest that pou2 is required for the establishment of the normal expression domains of wnt1 and pax2.1 in the MHB primordium.

Association Study of Serotonin Transporter Gene Polymorphisms with Obstructive Sleep Apnea Syndrome in Chinese Han Population

PubMed Central

Yue, Weihua; Liu, Huiguo; Zhang, Jishui; Zhang, Xianghui; Wang, Xiaoping; Liu, Tieqiao; Liu, Pozi; Hao, Wei

2008-01-01

Background: Since the serotonin (5-HT) is associated with circadian rhythm and breathing regulation, the serotonin transporter (5-HTT), which plays an important role in serotoninergic transmission, might be a strong candidate gene in the pathogenesis of obstructive sleep apnea syndrome (OSAS). Objective: To investigate the association of 5-HTT gene polymorphisms with OSAS and clinical characteristics. Methods: We genotyped the 5-HTT gene linked polymorphic region (5-HTTLPR) and a variable number of tandem repeats at intron 2 (STin2.VNTR) in 254 OSAS patients and 338 healthy controls in Chinese Han population. Results: In total sample, the 10-repeat allele of STin2.VNTR was significantly associated with OSAS (P = 0.007, OR = 1.72, 95% CI = 1.15~2.58), but no association was found in 5-HTTLPR. In male subjects, both polymorphisms showed significant association with OSAS (Allele L: P = 0.005, OR = 1.44, 95% CI = 1.11 to 1.87; Allele 10: P = 0.002, OR = 1.94, 95% CI = 1.26 to 3.00). Two haplotypes, S-12 and L-10, constructed by the above polymorphisms also revealed significant associations with OSAS (global P-values were 0.020 for total sample and 0.0006 for male subjects, respectively). Male patients carrying the haplotype S-12 showed a significantly lower apnea / hypopnea index (AHI), depressive factor, plasma 5-HT level and 5-hydroxyindolacetic acid (5-HIAA) levels, but higher episodic memory, when compared with non-S-12 carriers (P < 0.05). However, no significant differences were found in excessive daytime sleepiness or other psychological function across haplotype carriers (P > 0.05). Conclusions: These findings support that 5-HTT gene may be involved in susceptibility to OSAS, especially with sex-dependent effect. Citation: Yue W; Liu H; Zhang J; Zhang X; Wang X; Liu T; Liu P; Hao W. Association study of serotonin transporter gene polymorphisms with obstructive sleep apnea syndrome in chinese han population. SLEEP 2008;31(11):1535–1541. PMID:19014073

Association between the serotonin transporter promoter polymorphism and personality traits in a primarily female population sample.

PubMed

Greenberg, B D; Li, Q; Lucas, F R; Hu, S; Sirota, L A; Benjamin, J; Lesch, K P; Hamer, D; Murphy, D L

2000-04-03

The serotonin transporter (5-HTT) regulates serotonergic neurotransmission and is thought to influence emotion. A 5-HTT-linked polymorphic region (5-HTTLPR) has two common variants, short (s) and long (l). We previously found population and within-family associations between the lower-expressing s allele and neuroticism, a trait related to anxiety, hostility, and depression, on a standard measure (the NEO Personality Inventory, Revised [NEO-PI-R]) in a primarily male population (n=505), and that the s allele was dominant. We investigated this association in a new sample (n=397, 84% female, primarily sib-pairs). The results robustly replicated the 5-HTTLPR neuroticism association, and the dominance of the s allele. Combined data from the two studies (n=902) showed a highly significant association between the s allele and higher NEO Neuroticism both across individuals and within families. Association between genotype and a related measure, Anxiety on the 16PF inventory, was replicated in the new population and within families in the combined sample. Association to another trait, estimated TPQ Harm Avoidance, was not replicated in the new sample but found only within the combined sibship group. Another association found in our original study, between the s allele and lower scores on NEO-PI-R Agreeableness, was also replicated and was more robust in the current and the combined samples. Associations between the functional 5-HTTLPR polymorphism were similar in women and men. These results help to define specific personality features reproducibly associated with 5-HTTLPR genotype. Such associations were strongest for traits defined by the NEO, enhancing the attractiveness of the five-factor personality model in genetic research on complex behavioral dimensions. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:202-216, 2000. Published 2000 Wiley-Liss, Inc.

Proteotoxic Stress Induces Phosphorylation of p62/SQSTM1 by ULK1 to Regulate Selective Autophagic Clearance of Protein Aggregates

PubMed Central

Lim, Junghyun; Lachenmayer, M. Lenard; Wu, Shuai; Liu, Wenchao; Kundu, Mondira; Wang, Rong; Komatsu, Masaaki; Oh, Young J.; Zhao, Yanxiang; Yue, Zhenyu

2015-01-01

Disruption of proteostasis, or protein homeostasis, is often associated with aberrant accumulation of misfolded proteins or protein aggregates. Autophagy offers protection to cells by removing toxic protein aggregates and injured organelles in response to proteotoxic stress. However, the exact mechanism whereby autophagy recognizes and degrades misfolded or aggregated proteins has yet to be elucidated. Mounting evidence demonstrates the selectivity of autophagy, which is mediated through autophagy receptor proteins (e.g. p62/SQSTM1) linking autophagy cargos and autophagosomes. Here we report that proteotoxic stress imposed by the proteasome inhibition or expression of polyglutamine expanded huntingtin (polyQ-Htt) induces p62 phosphorylation at its ubiquitin-association (UBA) domain that regulates its binding to ubiquitinated proteins. We find that autophagy-related kinase ULK1 phosphorylates p62 at a novel phosphorylation site S409 in UBA domain. Interestingly, phosphorylation of p62 by ULK1 does not occur upon nutrient starvation, in spite of its role in canonical autophagy signaling. ULK1 also phosphorylates S405, while S409 phosphorylation critically regulates S405 phosphorylation. We find that S409 phosphorylation destabilizes the UBA dimer interface, and increases binding affinity of p62 to ubiquitin. Furthermore, lack of S409 phosphorylation causes accumulation of p62, aberrant localization of autophagy proteins and inhibition of the clearance of ubiquitinated proteins or polyQ-Htt. Therefore, our data provide mechanistic insights into the regulation of selective autophagy by ULK1 and p62 upon proteotoxic stress. Our study suggests a potential novel drug target in developing autophagy-based therapeutics for the treatment of proteinopathies including Huntington’s disease. PMID:25723488

Brain urea increase is an early Huntington's disease pathogenic event observed in a prodromal transgenic sheep model and HD cases.

PubMed

Handley, Renee R; Reid, Suzanne J; Brauning, Rudiger; Maclean, Paul; Mears, Emily R; Fourie, Imche; Patassini, Stefano; Cooper, Garth J S; Rudiger, Skye R; McLaughlan, Clive J; Verma, Paul J; Gusella, James F; MacDonald, Marcy E; Waldvogel, Henry J; Bawden, C Simon; Faull, Richard L M; Snell, Russell G

2017-12-26

The neurodegenerative disorder Huntington's disease (HD) is typically characterized by extensive loss of striatal neurons and the midlife onset of debilitating and progressive chorea, dementia, and psychological disturbance. HD is caused by a CAG repeat expansion in the Huntingtin ( HTT ) gene, translating to an elongated glutamine tract in the huntingtin protein. The pathogenic mechanism resulting in cell dysfunction and death beyond the causative mutation is not well defined. To further delineate the early molecular events in HD, we performed RNA-sequencing (RNA-seq) on striatal tissue from a cohort of 5-y-old OVT73 -line sheep expressing a human CAG-expansion HTT cDNA transgene. Our HD OVT73 sheep are a prodromal model and exhibit minimal pathology and no detectable neuronal loss. We identified significantly increased levels of the urea transporter SLC14A1 in the OVT73 striatum, along with other important osmotic regulators. Further investigation revealed elevated levels of the metabolite urea in the OVT73 striatum and cerebellum, consistent with our recently published observation of increased urea in postmortem human brain from HD cases. Extending that finding, we demonstrate that postmortem human brain urea levels are elevated in a larger cohort of HD cases, including those with low-level neuropathology (Vonsattel grade 0/1). This elevation indicates increased protein catabolism, possibly as an alternate energy source given the generalized metabolic defect in HD. Increased urea and ammonia levels due to dysregulation of the urea cycle are known to cause neurologic impairment. Taken together, our findings indicate that aberrant urea metabolism could be the primary biochemical disruption initiating neuropathogenesis in HD.

Tyrosine Phosphorylation of the Human Serotonin Transporter: A Role in the Transporter Stability and Function

PubMed Central

Annamalai, Balasubramaniam; Mannangatti, Padmanabhan; Arapulisamy, Obulakshmi; Shippenberg, Toni S.; Jayanthi, Lankupalle D.

2012-01-01

The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and threonine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labeled SERT was found in rat platelets, and Src-tyrosine kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo [3,4,d]pyrimidine (PP2) decreased platelet SERT function and expression. In human placental trophoblast cells expressing SERT, PP2 reduced transporter function, expression, and stability. Although siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared with WT-SERT, SERT tyrosine mutants Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell surface expression levels. Moreover, Src-coexpression increased total and cell surface expression of Y47F and Y142F SERT mutants without affecting their 5-HT transport capacity. It is noteworthy that Y47F and Y142F mutants exhibited higher protein stability compared with WT-SERT. However, similar to WT-SERT, PP2 treatment decreased the stability of Y47F and Y142F mutants. Furthermore, compared with WT-SERT, Y47F and Y142F mutants exhibited lower basal tyrosine phosphorylation and no further enhancement of tyrosine phosphorylation in response to Src coexpression. These results provide the first evidence that SERT tyrosine phosphorylation supports transporter protein stability and 5HT transport. PMID:21992875

Airways in smooth muscle α-actin null mice experience a compensatory mechanism that modulates their contractile response.

PubMed

Shardonofsky, Felix R; Moore, Joan; Schwartz, Robert J; Boriek, Aladin M

2012-03-01

We hypothesized that ablation of smooth muscle α-actin (SM α-A), a contractile-cytoskeletal protein expressed in airway smooth muscle (ASM) cells, abolishes ASM shortening capacity and decreases lung stiffness. In both SM α-A knockout and wild-type (WT) mice, airway resistance (Raw) determined by the forced oscillation technique rose in response to intravenous methacholine (Mch). However, the slope of Raw (cmH(2)O·ml(-1)·s) vs. log(2) Mch dose (μg·kg(-1)·min(-1)) was lower (P = 0.007) in mutant (0.54 ± 0.14) than in WT mice (1.23 ± 0.19). RT-PCR analysis performed on lung tissues confirmed that mutant mice lacked SM α-A mRNA and showed that these mice had robust expressions of both SM γ-A mRNA and skeletal muscle (SKM) α-A mRNA, which were not expressed in WT mice, and an enhanced SM22 mRNA expression relative to that in WT mice. Compared with corresponding spontaneously breathing mice, mechanical ventilation-induced lung mechanical strain increased the expression of SM α-A mRNA in WT lungs; in mutant mice, it augmented the expressions of SM γ-A mRNA and SM22 mRNA and did not alter that of SKM α-A mRNA. In mutant mice, the expression of SM γ-A mRNA in the lung during spontaneous breathing and its enhanced expression following mechanical ventilation are consistent with the likely possibility that in the absence of SM α-A, SM γ-A underwent polymerization and interacted with smooth muscle myosin to produce ASM shortening during cholinergic stimulation. Thus our data are consistent with ASM in mutant mice experiencing compensatory mechanisms that modulated its contractile muscle capacity.

Altered Expression of Retinal Molecular Markers in the Canine RPE65 Model of Leber Congenital Amaurosis

PubMed Central

Hernández, Maria; Pearce-Kelling, Susan E.; Rodriguez, F. David; Aguirre, Gustavo D.; Vecino, Elena

2010-01-01

Purpose. Leber congenital amaurosis (LCA) is a group of childhood-onset retinal diseases characterized by severe visual impairment or blindness. One form is caused by mutations in the RPE65 gene, which encodes the retinal pigment epithelium (RPE) isomerase. In this study, the retinal structure and expression of molecular markers for different retinal cell types were characterized, and differences between control and RPE65 mutant dogs during the temporal evolution of the disease were analyzed. Methods. Retinas from normal and mutant dogs of different ages were examined by immunofluorescence with a panel of 16 different antibodies. Results. Cones and rods were preserved in the mutant retinas, and the number of cones was normal. However, there was altered expression of cone arrestin and delocalization of rod opsin. The ON bipolar cells showed sprouting of the dendritic arbors toward the outer nuclear layer (ONL) and retraction of their axons in the inner nuclear layer (INL). A decreased expression of GABA, and an increased expression of intermediate filament glial markers was also found in the mutant retinas. These changes were more evident in the adult than the young mutant retinas. Conclusions. The structure of the retina is well preserved in the mutant retina, but several molecular changes take place in photoreceptors and in bipolar and amacrine cells. Some of these changes are structural, whereas others reflect a change in localization of the examined proteins. This study provides new information that can be applied to the interpretation of outcomes of retinal gene therapy in animal models and humans. PMID:20671290

Differential transcriptional activation by human T-cell leukemia virus type 1 Tax mutants is mediated by distinct interactions with CREB binding protein and p300.

PubMed

Bex, F; Yin, M J; Burny, A; Gaynor, R B

1998-04-01

The human T-cell leukemia virus type 1 Tax protein transforms human T lymphocytes, which can lead to the development of adult T-cell leukemia. Tax transformation is related to its ability to activate gene expression via the ATF/CREB and the NF-kappaB pathways. Transcriptional activation of these pathways is mediated by the actions of the related coactivators CREB binding protein (CBP) and p300. In this study, immunocytochemistry and confocal microscopy were used to localize CBP and p300 in cells expressing wild-type Tax or Tax mutants that are able to selectively activate gene expression from either the NF-kappaB or ATF/CREB pathway. Wild-type Tax colocalized with both CBP and p300 in nuclear bodies which also contained ATF-1 and the RelA subunit of NF-kappaB. However, a Tax mutant that selectively activates gene expression from only the ATF/CREB pathway colocalized with CBP but not p300, while a Tax mutant that selectively activates gene expression from only the NF-kappaB pathway colocalized with p300 but not CBP. In vitro and in vivo protein interaction studies indicated that the integrity of two independent domains of Tax delineated by these mutants was involved in the direct interaction of Tax with either CBP or p300. These studies are consistent with a model in which activation of either the NF-kappaB or the ATF/CREB pathway by specific Tax mutants is mediated by distinct interactions with related coactivator proteins.

Distinct functions of capsid protein in assembly and movement of tobacco etch potyvirus in plants.

PubMed Central

Dolja, V V; Haldeman, R; Robertson, N L; Dougherty, W G; Carrington, J C

1994-01-01

Tobacco etch potyvirus engineered to express the reporter protein beta-glucuronidase (TEV-GUS) was used for direct observation and quantitation of virus translocation in plants. Four TEV-GUS mutants were generated containing capsid proteins (CPs) with single amino acid substitutions (R154D and D198R), a double substitution (DR), or a deletion of part of the N-terminal domain (delta N). Each modified virus replicated as well as the parental virus in protoplasts, but was defective in cell-to-cell movement through inoculated leaves. The R154D, D198R and DR mutants were restricted essentially to single, initially infected cells. The delta N variant exhibited slow cell-to-cell movement in inoculated leaves, but was unable to move systemically due to a lack of entry into or replication in vascular-associated cells. Both cell-to-cell and systemic movement defects of each mutant were rescued in transgenic plants expressing wild-type TEV CP. Cell-to-cell movement, but not systemic movement, of the DR mutant was rescued partially in transgenic plants expressing TEV CP lacking the C-terminal domain, and in plants expressing CP from the heterologous potyvirus, potato virus Y. Despite comparable levels of accumulation of parental virus and each mutant in symptomatic tissue of TEV CP-expressing transgenic plants, virions were detected only in parental virus- and delta N mutant-infected plants, as revealed using three independent assays. These data suggest that the potyvirus CP possesses distinct, separable activities required for virion assembly, cell-to-cell movement and long-distance transport. Images PMID:7511101

Mutations in CIC and IDH1 cooperatively regulate 2-hydroxyglutarate levels and cell clonogenicity

PubMed Central

Chittaranjan, Suganthi; Chan, Susanna; Yang, Cindy; Yang, Kevin C.; Chen, Vincent; Moradian, Annie; Firme, Marlo; Song, Jungeun; Go, Nancy E.; Blough, Michael D.; Chan, Jennifer A.; Cairncross, J. Gregory; Gorski, Sharon M.; Morin, Gregg B.; Yip, Stephen; Marra, Marco A.

2014-01-01

The majority of oligodendrogliomas (ODGs) exhibit combined losses of chromosomes 1p and 19q and mutations of isocitrate dehydrogenase (IDH1-R132H or IDH2-R172K). Approximately 70% of ODGs with 1p19q co-deletions harbor somatic mutations in the Capicua Transcriptional Repressor (CIC) gene on chromosome 19q13.2. Here we show that endogenous long (CIC-L) and short (CIC-S) CIC proteins are predominantly localized to the nucleus or cytoplasm, respectively. Cytoplasmic CIC-S is found in close proximity to the mitochondria. To study wild type and mutant CIC function and motivated by the paucity of 1p19q co-deleted ODG lines, we created HEK293 and HOG stable cell lines ectopically co-expressing CIC and IDH1. Non-mutant lines displayed increased clonogenicity, but cells co-expressing the mutant IDH1-R132H with either CIC-S-R201W or -R1515H showed reduced clonogenicity in an additive manner, demonstrating cooperative effects in our assays. Expression of mutant CIC-R1515H increased cellular 2-Hydroxyglutarate (2HG) levels compared to wild type CIC in IDH1-R132H background. Levels of phosphorylated ATP-citrate Lyase (ACLY) were lower in cell lines expressing mutant CIC-S proteins compared to cells expressing wild type CIC-S, supporting a cytosolic citrate metabolism-related mechanism of reduced clonogenicity in our in vitro model systems. ACLY or phospho-ACLY were similarly reduced in CIC-mutant 1p19q co-deleted oligodendroglioma patient samples. PMID:25277207

Arabidopsis shaker pollen inward K+ channel SPIK functions in SnRK1 complex-regulated pollen hydration on the stigma.

PubMed

Li, Dan-Dan; Guan, Huan; Li, Fei; Liu, Chang-Zhen; Dong, Yu-Xiu; Zhang, Xian-Sheng; Gao, Xin-Qi

2017-09-01

Pollen hydration is a critical step that determines pollen germination on the stigma. KINβγ is a plant-specific subunit of the SNF1-related protein kinase 1 complex (SnRK1 complex). In pollen of the Arabidopsis kinβγ mutant, the levels of reactive oxygen species were decreased which lead to compromised hydration of the mutant pollen on the stigma. In this study, we analyzed gene expression in kinβγ mutant pollen by RNA-seq and found the expression of inward shaker K + channel SPIK was down-regulated in the kinβγ pollen. Furthermore, we showed that the pollen hydration of the Arabidopsis spik mutant was defective on the wild-type stigma, although the mutant pollen demonstrated normal hydration in vitro. Additionally, the defective hydration of spik mutant pollen could not be rescued by the wild-type pollen on the stigma, indicating that the spik mutation deprived the capability of pollen absorption on the stigma. Our results suggest that the Arabidopsis SnRK1 complex regulates SPIK expression, which functions in determining pollen hydration on the stigma. © 2017 Institute of Botany, Chinese Academy of Sciences.

The transcriptional response to the inactivation of the PaMpk1 and PaMpk2 MAP kinase pathways in Podospora anserina.

PubMed

Bidard, Frédérique; Coppin, Evelyne; Silar, Philippe

2012-08-01

Transcription pattern during mycelium growth of Podospora anserina was assayed by microarray analysis in wild type and in mutants affected in the MAP kinase genes PaMpk1 and PaMpk2 and in the NADPH oxidase gene PaNox1. 15% of the genes have their expression modified by a factor two or more as growth proceeds in wild type. The genes whose expression is modified during growth in P. anserina are either not conserved or differently regulated in Neurospora crassa and Aspergillus niger, two fungi for which transcriptome data during growth are available. The P. anserina mutants display a similar alteration of their transcriptome profile, with nearly 1000 genes affected similarly in the three mutants, accounting for their similar growth phenotypes. Yet, each mutant has its specific set of modified transcripts, in line with particular phenotypes exhibited by each mutant. Again, there is limited conservation during evolution of the genes regulated at the transcription level by MAP kinases, as indicated by the comparison the P. anserina data, with those of Aspergillus fumigatus and N. crassa, two fungi for which gene expression data are available for mutants of the MAPK pathways. Among the genes regulated in wild type and affected in the mutants, those involved in carbohydrate and secondary metabolisms appear prominent. The vast majority of the genes differentially expressed are of unknown function. Availability of their transcription profile at various stages of development should help to decipher their role in fungal physiology and development. Copyright © 2012 Elsevier Inc. All rights reserved.

A representative prescription for emotional disease, Ding-Zhi-Xiao-Wan restores 5-HT system deficit through interfering the synthesis and transshipment in chronic mild stress-induced depressive rats.

PubMed

Dong, Xian-Zhe; Li, Zhao-Liang; Zheng, Xiao-Li; Mu, Li-Hua; Zhang, Gang-qiang; Liu, Ping

2013-12-12

Ding-Zhi-Xiao-Wan (DZ, also known as Kai-Xin-San) is a famous traditional Chinese medicine used for the treatment of emotional disease. Previously, we have found that in a variety of animal models of depression (such as tail suspension model, model of chronic fatigue and forced swimming model) DZ demonstrated significant antidepressant behavior and promoted the production of 5-hydroxytryptamine (5-HT). However, the mechanisms of 5-HT regulation are still unclear. Therefore, the current study is designed to further investigate the antidepressant effect of DZ by observing its influence on 5-HT synthesis, metabolism, transport and other key links, so as to clarify the molecular mechanism of its 5-HT regulation. Solitary rising combined with the chronic unpredictable mild stress (CMS) was used to establish the rat model of depression. The rats were given DZ for 3 weeks, the behavior change and the following items in hippocampus and prefrontal cortex were detected simultaneously: 5-HT, 5-hydroxyindoleacetic acid (5-HIAA), tryptophan hydroxylase (TPH), aromatic amino acid decarboxylase (AADC), monoamine oxidase (MAO) and 5-HT transporter (5-HTT) were observed. Our results showed that treatment with the DZ significantly improved the behavior and simultaneously increased the 5-HT level in the hippocampus, prefrontal cortex tissues and hippocampus extracellular of depressive rats. In future studies revealed that DZ could significantly increase the protein and mRNA expression of the key enzymes TPH during the 5-HT synthesis process in the hippocampus and prefrontal cortex of the depressed rats, and suppress the expression of 5-HTT protein and mRNA at the same time. But it had no effects on MAO-A and MAO-B activities. We believe that antidepressant effect of DZ is caused by the increase of 5-HT synthesis and reduction of 5-HT re-uptake, and eventually increase the content of 5-HT in the brain and the synaptic gaps. © 2013 Published by Elsevier Ireland Ltd.

Analysis of Induced Pluripotent Stem Cells from a BRCA1 Mutant Family

PubMed Central

Soyombo, Abigail A.; Wu, Yipin; Kolski, Lauren; Rios, Jonathan J.; Rakheja, Dinesh; Chen, Alice; Kehler, James; Hampel, Heather; Coughran, Alanna; Ross, Theodora S.

2013-01-01

Summary Understanding BRCA1 mutant cancers is hampered by difficulties in obtaining primary cells from patients. We therefore generated and characterized 24 induced pluripotent stem cell (iPSC) lines from fibroblasts of eight individuals from a BRCA1 5382insC mutant family. All BRCA1 5382insC heterozygous fibroblasts, iPSCs, and teratomas maintained equivalent expression of both wild-type and mutant BRCA1 transcripts. Although no difference in differentiation capacity was observed between BRCA1 wild-type and mutant iPSCs, there was elevated protein kinase C-theta (PKC-theta) in BRCA1 mutant iPSCs. Cancer cell lines with BRCA1 mutations and hormone-receptor-negative breast cancers also displayed elevated PKC-theta. Genome sequencing of the 24 iPSC lines showed a similar frequency of reprogramming-associated de novo mutations in BRCA1 mutant and wild-type iPSCs. These data indicate that iPSC lines can be derived from BRCA1 mutant fibroblasts to study the effects of the mutation on gene expression and genome stability. PMID:24319668

Genetic Analysis of Resistance to Benzimidazoles in Physarum: Differential Expression of β-Tubulin Genes

PubMed Central

Burland, Timothy G.; Schedl, Tim; Gull, Keith; Dove, William F.

1984-01-01

Physarum displays two vegetative cell types, uninucleate myxamoebae and multinucleate plasmodia. Mutant myxamoebae of Physarum resistant to the antitubulin drug methylbenzimidazole-2-yl-carbamate (MBC) were isolated. All mutants tested were cross-resistant to other benzimidazoles but not to cycloheximide or emetine. Genetic analysis showed that mutation to MBC resistance can occur at any one of four unlinked loci, benA, benB, benC or benD. MBC resistance of benB and benD mutants was expressed in plasmodia, but benA and benC mutant plasmodia were MBC sensitive, suggesting that benA and benC encode myxamoeba-specific products. Myxamoebae carrying the recessive benD210 mutation express a β-tubulin with noval electrophoretic mobility, in addition to a β-tubulin with wild-type mobility. This and other evidence indicates that benD is a structural gene for β-tubulin, and that at least two β-tubulin genes are expressed in myxamoebae. Comparisons of the β-tubulins of wildtype and benD210 strains by gel electrophoresis revealed that, of the three (or more) β-tubulin genes expressed in Physarum, one, benD, is expressed in both myxamoebae and plasmodia, one is expressed specifically in myxamoebae and one is expressed specifically in plasmodia. However, mutation in only one gene, benD, is sufficient to confer MBC resistance on both myxamoebae and plasmodia. PMID:6479584

Akt mediated ROS-dependent selective targeting of mutant KRAS tumors.

PubMed

Iskandar, Kartini; Rezlan, Majidah; Pervaiz, Shazib

2014-10-01

Reactive oxygen species (ROS) play a critical role in a variety of cellular processes, ranging from cell survival and proliferation to cell death. Previously, we reported the ability of a small molecule compound, C1, to induce ROS dependent autophagy associated apoptosis in human cancer cell lines and primary tumor cells (Wong C. et al. 2010). Our ongoing investigations have unraveled a hitherto undefined novel signaling network involving hyper-phosphorylation of Akt and Akt-mediated ROS production in cancer cell lines. Interestingly, drug-induced Akt activation is selectively seen in cell lines that carry mutant KRAS; HCT116 cells that carry the V13D KRAS mutation respond favorably to C1 while HT29 cells expressing wild type KRAS are relatively resistant. Of note, not only does the compound target mutant KRAS expressing cells but also induces RAS activation as evidenced by the PAK pull down assay. Corroborating this, pharmacological inhibition as well as siRNA mediated silencing of KRAS or Akt, blocked C1-induced ROS production and rescued tumor colony forming ability in HCT116 cells. To further confirm the involvement of KRAS, we made use of mutant KRAS transformed RWPE-1 prostate epithelial cells. Notably, drug-induced ROS generation and death sensitivity was significantly higher in RWPE-1-KRAS cells than the RWPE-1-vector cells, thus confirming the results obtained with mutant KRAS colorectal carcinoma cell line. Lastly, we made use of HCT116 mutant KRAS knockout cells (KO) where the mutant KRAS allele had been deleted, thus expressing a single wild-type KRAS allele. Exposure of the KO cells to C1 failed to induce Akt activation and mitochondrial ROS production. Taken together, results show the involvement of activated Akt in ROS-mediated selective targeting of mutant KRAS expressing tumors, which could have therapeutic implications given the paucity of chemotherapeutic strategies specifically targeting KRAS mutant cancers. Copyright © 2014. Published by Elsevier Inc.

AGO1 controls arabidopsis inflorescence architecture possibly by regulating TFL1 expression.

PubMed

Fernández-Nohales, P; Domenech, M J; Martínez de Alba, A E; Micol, J L; Ponce, M R; Madueño, F

2014-11-01

The TERMINAL FLOWER 1 (TFL1) gene is pivotal in the control of inflorescence architecture in arabidopsis. Thus, tfl1 mutants flower early and have a very short inflorescence phase, while TFL1-overexpressing plants have extended vegetative and inflorescence phases, producing many coflorescences. TFL1 is expressed in the shoot meristems, never in the flowers. In the inflorescence apex, TFL1 keeps the floral genes LEAFY (LFY) and APETALA1 (AP1) restricted to the flower, while LFY and AP1 restrict TFL1 to the inflorescence meristem. In spite of the central role of TFL1 in inflorescence architecture, regulation of its expression is poorly understood. This study aims to expand the understanding of inflorescence development by identifying and studying novel TFL1 regulators. Mutagenesis of an Arabidopsis thaliana line carrying a TFL1::GUS (β-glucuronidase) reporter construct was used to isolate a mutant with altered TFL1 expression. The mutated gene was identified by positional cloning. Expression of TFL1 and TFL1::GUS was analysed by real-time PCR and histochemical GUS detection. Double-mutant analysis was used to assess the contribution of TFL1 to the inflorescence mutant phenotype. A mutant with both an increased number of coflorescences and high and ectopic TFL1 expression was isolated. Cloning of the mutated gene showed that both phenotypes were caused by a mutation in the ARGONAUTE1 (AGO1) gene, which encodes a key component of the RNA silencing machinery. Analysis of another ago1 allele indicated that the proliferation of coflorescences and ectopic TFL1 expression phenotypes are not allele specific. The increased number of coflorescences is suppressed in ago1 tfl1 double mutants. The results identify AGO1 as a repressor of TFL1 expression. Moreover, they reveal a novel role for AGO1 in inflorescence development, controlling the production of coflorescences. AGO1 seems to play this role through regulating TFL1 expression. © The Author 2014. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Region of Herpes Simplex Virus Type 1 Latency-Associated Transcript Sufficient for Wild-Type Spontaneous Reactivation Promotes Cell Survival in Tissue Culture

PubMed Central

Inman, Melissa; Perng, Guey-Chuen; Henderson, Gail; Ghiasi, Homayon; Nesburn, Anthony B.; Wechsler, Steven L.; Jones, Clinton

2001-01-01

The latency-associated transcript (LAT) is the only abundant herpes simplex virus type 1 (HSV-1) transcript expressed during latency. In the rabbit eye model, LAT null mutants do not reactivate efficiently from latency. We recently demonstrated that the LAT null mutant dLAT2903 induces increased levels of apoptosis in trigeminal ganglia of infected rabbits compared to LAT+ strains (G.-C. Perng, C. Jones, J. Ciacci-Zarella, M. Stone, G. Henderson, A. Yokht, S. M. Slanina, F. M. Hoffman, H. Ghiasi, A. B. Nesburn, and C. S. Wechsler, Science 287:1500–1503, 2000).The same study also demonstrated that a plasmid expressing LAT nucleotides 301 to 2659 enhanced cell survival of transfected cells after induction of apoptosis. Consequently, we hypothesized that LAT enhances spontaneous reactivation in part, because it promotes survival of infected neurons. Here we report on the ability of plasmids expressing different portions of the 5′ end of LAT to promote cell survival after induction of apoptosis. A plasmid expressing the first 1.5 kb of LAT (LAT nucleotides 1 to 1499) promoted cell survival in neuro-2A (mouse neuronal) and CV-1 (monkey fibroblast) cells. A plasmid expressing just the first 811 nucleotides of LAT promoted cell survival less efficiently. Plasmids expressing the first 661 nucleotides or less of LAT did not promote cell survival. We previously showed that a mutant expressing just the first 1.5 kb of LAT has wild-type spontaneous reactivation in rabbits, and a mutant expressing just the first 811 nucleotides of LAT has a reactivation frequency higher than that of dLAT2903 but lower than that of wild-type virus. In addition, mutants reported here for the first time, expressing just the first 661 or 76 nucleotides of LAT, had spontaneous reactivation indistinguishable from that of the LAT null mutant dLAT2903. In summary, these studies provide evidence that there is a functional relationship between the ability of LAT to promote cell survival and its ability to enhance spontaneous reactivation. PMID:11264353

Comprehensive gene expression analysis of rice aleurone cells: probing the existence of an alternative gibberellin receptor.

PubMed

Yano, Kenji; Aya, Koichiro; Hirano, Ko; Ordonio, Reynante Lacsamana; Ueguchi-Tanaka, Miyako; Matsuoka, Makoto

2015-02-01

Current gibberellin (GA) research indicates that GA must be perceived in plant nuclei by its cognate receptor, GIBBERELLIN INSENSITIVE DWARF1 (GID1). Recognition of GA by GID1 relieves the repression mediated by the DELLA protein, a model known as the GID1-DELLA GA perception system. There have been reports of potential GA-binding proteins in the plasma membrane that perceive GA and induce α-amylase expression in cereal aleurone cells, which is mechanistically different from the GID1-DELLA system. Therefore, we examined the expression of the rice (Oryza sativa) α-amylase genes in rice mutants impaired in the GA receptor (gid1) and the DELLA repressor (slender rice1; slr1) and confirmed their lack of response to GA in gid1 mutants and constitutive expression in slr1 mutants. We also examined the expression of GA-regulated genes by genome-wide microarray and quantitative reverse transcription-polymerase chain reaction analyses and confirmed that all GA-regulated genes are modulated by the GID1-DELLA system. Furthermore, we studied the regulatory network involved in GA signaling by using a set of mutants defective in genes involved in GA perception and gene expression, namely gid1, slr1, gid2 (a GA-related F-box protein mutant), and gamyb (a GA-related trans-acting factor mutant). Almost all GA up-regulated genes were regulated by the four named GA-signaling components. On the other hand, GA down-regulated genes showed different expression patterns with respect to GID2 and GAMYB (e.g. a considerable number of genes are not controlled by GAMYB or GID2 and GAMYB). Based on these observations, we present a comprehensive discussion of the intricate network of GA-regulated genes in rice aleurone cells. © 2015 American Society of Plant Biologists. All Rights Reserved.

Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer

PubMed Central

Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

2017-01-01

Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo, erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity. PMID:29312548

Mimicking the BIM BH3 domain overcomes resistance to EGFR tyrosine kinase inhibitors in EGFR-mutant non-small cell lung cancer.

PubMed

Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui

2017-12-12

Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo , erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity.

Induction of CD69 expression by cagPAI-positive Helicobacter pylori infection

PubMed Central

Mori, Naoki; Ishikawa, Chie; Senba, Masachika

2011-01-01

AIM: To investigate and elucidate the molecular mechanism that regulates inducible expression of CD69 by Helicobacter pylori (H. pylori) infection. METHODS: The expression levels of CD69 in a T-cell line, Jurkat, primary human peripheral blood mononuclear cells (PBMCs), and CD4+ T cells, were assessed by immunohistochemistry, reverse transcription polymerase chain reaction, and flow cytometry. Activation of CD69 promoter was detected by reporter gene. Nuclear factor (NF)-κB activation in Jurkat cells infected with H. pylori was evaluated by electrophoretic mobility shift assay. The role of NF-κB signaling in H. pylori-induced CD69 expression was analyzed using inhibitors of NF-κB and dominant-negative mutants. The isogenic mutants with disrupted cag pathogenicity island (cagPAI) and virD4 were used to elucidate the role of cagPAI-encoding type IV secretion system and CagA in CD69 expression. RESULTS: CD69 staining was detected in mucosal lymphocytes and macrophages in specimens of patients with H. pylori-positive gastritis. Although cagPAI-positive H. pylori and an isogenic mutant of virD4 induced CD69 expression, an isogenic mutant of cagPAI failed to induce this in Jurkat cells. H. pylori also induced CD69 expression in PBMCs and CD4+ T cells. The activation of the CD69 promoter by H. pylori was mediated through NF-κB. Transfection of dominant-negative mutants of IκBs, IκB kinases, and NF-κB-inducing kinase inhibited H. pylori-induced CD69 activation. Inhibitors of NF-κB suppressed H. pylori-induced CD69 mRNA expression. CONCLUSION: The results suggest that H. pylori induces CD69 expression through the activation of NF-κB. cagPAI might be relevant in the induction of CD69 expression in T cells. CD69 in T cells may play a role in H. pylori-induced gastritis. PMID:21990950

Carbon Fibers Conductivity Studies

NASA Technical Reports Server (NTRS)

Yang, C. Y.; Butkus, A. M.

1980-01-01

In an attempt to understand the process of electrical conduction in polyacrylonitrile (PAN)-based carbon fibers, calculations were carried out on cluster models of the fiber consisting of carbon, nitrogen, and hydrogen atoms using the modified intermediate neglect of differential overlap (MINDO) molecular orbital (MO) method. The models were developed based on the assumption that PAN carbon fibers obtained with heat treatment temperatures (HTT) below 1000 C retain nitrogen in a graphite-like lattice. For clusters modeling an edge nitrogen site, analysis of the occupied MO's indicated an electron distribution similar to that of graphite. A similar analysis for the somewhat less stable interior nitrogen site revealed a partially localized II electron distribution around the nitrogen atom. The differences in bonding trends and structural stability between edge and interior nitrogen clusters led to a two-step process proposed for nitrogen evolution with increasing HTT.

Horizontal transfer of transposons between and within crustaceans and insects

PubMed Central

2014-01-01

Background Horizontal transfer of transposable elements (HTT) is increasingly appreciated as an important source of genome and species evolution in eukaryotes. However, our understanding of HTT dynamics is still poor in eukaryotes because the diversity of species for which whole genome sequences are available is biased and does not reflect the global eukaryote diversity. Results In this study we characterized two Mariner transposable elements (TEs) in the genome of several terrestrial crustacean isopods, a group of animals particularly underrepresented in genome databases. The two elements have a patchy distribution in the arthropod tree and they are highly similar (>93% over the entire length of the element) to insect TEs (Diptera and Hymenoptera), some of which were previously described in Ceratitis rosa (Crmar2) and Drosophila biarmipes (Mariner-5_Dbi). In addition, phylogenetic analyses and comparisons of TE versus orthologous gene distances at various phylogenetic levels revealed that the taxonomic distribution of the two elements is incompatible with vertical inheritance. Conclusions We conclude that the two Mariner TEs each underwent at least three HTT events. Both elements were transferred once between isopod crustaceans and insects and at least once between isopod crustacean species. Crmar2 was also transferred between tephritid and drosophilid flies and Mariner-5 underwent HT between hymenopterans and dipterans. We demonstrate that these various HTTs took place recently (most likely within the last 3 million years), and propose iridoviruses and/or Wolbachia endosymbionts as potential vectors of these transfers. PMID:24472097

Horizontal transfer of transposons between and within crustaceans and insects.

PubMed

Dupeyron, Mathilde; Leclercq, Sébastien; Cerveau, Nicolas; Bouchon, Didier; Gilbert, Clément

2014-01-29

Horizontal transfer of transposable elements (HTT) is increasingly appreciated as an important source of genome and species evolution in eukaryotes. However, our understanding of HTT dynamics is still poor in eukaryotes because the diversity of species for which whole genome sequences are available is biased and does not reflect the global eukaryote diversity. In this study we characterized two Mariner transposable elements (TEs) in the genome of several terrestrial crustacean isopods, a group of animals particularly underrepresented in genome databases. The two elements have a patchy distribution in the arthropod tree and they are highly similar (>93% over the entire length of the element) to insect TEs (Diptera and Hymenoptera), some of which were previously described in Ceratitis rosa (Crmar2) and Drosophila biarmipes (Mariner-5_Dbi). In addition, phylogenetic analyses and comparisons of TE versus orthologous gene distances at various phylogenetic levels revealed that the taxonomic distribution of the two elements is incompatible with vertical inheritance. We conclude that the two Mariner TEs each underwent at least three HTT events. Both elements were transferred once between isopod crustaceans and insects and at least once between isopod crustacean species. Crmar2 was also transferred between tephritid and drosophilid flies and Mariner-5 underwent HT between hymenopterans and dipterans. We demonstrate that these various HTTs took place recently (most likely within the last 3 million years), and propose iridoviruses and/or Wolbachia endosymbionts as potential vectors of these transfers.

Association of Anxiety-Related Polymorphisms with Sports Performance in Chilean Long Distance Triathletes: A Pilot Study

PubMed Central

Sanhueza, Jorge A.; Zambrano, Tomás; Bahamondes-Avila, Carlos; Salazar, Luis A.

2016-01-01

Different factors affecting athletic performance are well established: intensity and type of training, anthropometric characteristics as well as an important psychological component. However, the contribution of the genetic background has been less investigated. The aim of the present study was to investigate the influence of polymorphisms within genes associated with stress and anxiety (5HTT, CRH2R, ACE, NK1R, 5HT1AR and CRF-BP) on the physical capability and sports performance in triathletes. One hundred and ninety two (192) unrelated Chilean triathletes who participated in the 2014 70.3 Pucón city triathlon were divided into opposite subgroups of sports performance according to their time results. We identified significant associations for five polymorphisms (5HTT 5-HTTLPR, ACE I/D, NK1R rs6715729, 5HT1AR -1019C>G and CRF-BP CRF-BPs11) with athletic performance. Our results indicate that these polymorphisms are associated with differential sports performance in Chilean triathletes, establishing an initial background for better understanding the relationship between physical performance, genetics and anxiety disorders. Key points Genetic factors influencing sports performance in the Chilean population are unknown. Differential outcomes from athletes who completed a triathlon competition were associated with five polymorphisms (5HTT 5-HTTLPR, ACE I/D, NK1R rs6715729, 5HT1AR -1019C>G and CRF-BP CRF-BPs11). We show that genetic variants within stress- and anxiety-related genes affect athletic performance. PMID:27928199

Rha1, a new mutant of Arabidopsis disturbed in root slanting, gravitropism and auxin physiology.

PubMed

Fortunati, Alessio; Piconese, Silvia; Tassone, Paola; Ferrari, Simone; Migliaccio, Fernando

2008-11-01

A new Arabidopsis mutant is characterized (rha1) that shows, in the roots, reduced right-handed slanting, reduced gravitropism and resistance to 2,4-D, TIBA, NPA and ethylene. It also shows reduced length in the shoot and root, reduced number of lateral roots and shorter siliques. The gene was cloned through TAIL-PCR and resulted in a HSF. Because none of the known gravitropic and auxinic mutants result from damage in a HSF, rha1 seems to belong to a new class of this group of mutants. Quantitative PCR analysis showed that the expression of the gene is increased by heat and cold shock, and by presence of 2,4-D in the media. Study of the expression through the GUS reporter gene revealed increased expression in clinostated and gravistimulated plants, but only in adult tissues, and not in the apical meristems of shoots and roots.

Rha1, a new mutant of Arabidopsis disturbed in root slanting, gravitropism and auxin physiology

PubMed Central

Fortunati, Alessio; Piconese, Silvia; Tassone, Paola; Ferrari, Simone

2008-01-01

A new Arabidopsis mutant is characterized (rha1) that shows, in the roots, reduced right-handed slanting, reduced gravitropism and resistance to 2,4-D, TIBA, NPA and ethylene. It also shows reduced length in the shoot and root, reduced number of lateral roots and shorter siliques. The gene was cloned through TAIL-PCR and resulted in a HSF. Because none of the known gravitropic and auxinic mutants result from damage in a HSF, rha1 seems to belong to a new class of this group of mutants. Quantitative PCR analysis showed that the expression of the gene is increased by heat and cold shock, and by presence of 2,4-D in the media. Study of the expression through the GUS reporter gene revealed increased expression in clinostated and gravistimulated plants, but only in adult tissues, and not in the apical meristems of shoots and roots. PMID:19704429

Linking a compound-heterozygous Parkin mutant (Q311R and A371T) to Parkinson's disease by using proteomic and molecular approaches.

PubMed

Ozgul, Sinem; Kasap, Murat; Akpinar, Gurler; Kanli, Aylin; Güzel, Nil; Karaosmanoglu, Kübra; Baykal, Ahmet Tarik; Iseri, Pervin

2015-01-01

Parkin is an E3-protein ubiquitin ligase, which plays an important role as a scavenger in cell metabolism. Since the discovery of the link between Parkin and Parkinson's disease, Parkin was placed in the center of Parkinson's disease research. Previously, we isolated a mutant form of the Parkin protein (Q311R and A371T) from a Parkinson's disease patient. In this study, we aimed at characterizing this mutant Parkin protein by using biochemical and proteomic approaches. We used neuroblastoma cells (SH-SY5Y) as our model and created two inducible cell lines that expressed the wild type and the mutant Parkin proteins. We first investigated the effect of expressing both the wild type and the mutant Parkin proteins on the overall proteome by using 2D-DIGE approach. The experiments yielded the identification of 22 differentially regulated proteins, of which 13 were regulated in the mutant Parkin expressing cells. Classification of the identified proteins based on biological process and molecular function revealed that the majority of the regulated proteins belonged to protein folding and energy metabolism. Ingenuity Pathway Analysis predicted the presence of a link between the regulated proteins of the mutant Parkin expressing cells and Parkinson's disease. We also performed biochemical characterization studies on the wild type and the mutant Parkin proteins to make sense out of the differences observed at the proteome level. Both proteins displayed biological activity, had similar stabilities and localized similarly to the cytoplasm and the nucleus in SH-SY5Y cells. The mutant protein, however, was cut by a protease and subjected to a post-translational modification. The observed differences at the proteome level might be due to the differences in processing of the mutant Parkin protein. Overall, we were able to create a possible link between a pair of Parkin mutations to its pertinent disease by using 2D-DIGE in combination with biochemical and molecular approaches. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation, characterization, and expression analyses of tryptophan aminotransferase genes in a maize dek18 mutant

USDA-ARS?s Scientific Manuscript database

The dek18 mutant of maize has decreased auxin content in kernels. Molecular and functional characterization of this mutant line offers the possibility to better understand auxin biology in maize seed development. Seeds of the dek18 mutants are smaller compared to wild type seeds and the vegetative d...

Problem-Solving Test: Tryptophan Operon Mutants

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2010-01-01

This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

Disruption of LACCASE4 and 17 Results in Tissue-Specific Alterations to Lignification of Arabidopsis thaliana Stems[W

PubMed Central

Berthet, Serge; Demont-Caulet, Nathalie; Pollet, Brigitte; Bidzinski, Przemyslaw; Cézard, Laurent; Le Bris, Phillipe; Borrega, Nero; Hervé, Jonathan; Blondet, Eddy; Balzergue, Sandrine; Lapierre, Catherine; Jouanin, Lise

2011-01-01

Peroxidases have been shown to be involved in the polymerization of lignin precursors, but it remains unclear whether laccases (EC 1.10.3.2) participate in constitutive lignification. We addressed this issue by studying laccase T-DNA insertion mutants in Arabidopsis thaliana. We identified two genes, LAC4 and LAC17, which are strongly expressed in stems. LAC17 was mainly expressed in the interfascicular fibers, whereas LAC4 was expressed in vascular bundles and interfascicular fibers. We produced two double mutants by crossing the LAC17 (lac17) mutant with two LAC4 mutants (lac4-1 and lac4-2). The single and double mutants grew normally in greenhouse conditions. The single mutants had moderately low lignin levels, whereas the stems of lac4-1 lac17 and lac4-2 lac17 mutants had lignin contents that were 20 and 40% lower than those of the control, respectively. These lower lignin levels resulted in higher saccharification yields. Thioacidolysis revealed that disrupting LAC17 principally affected the deposition of G lignin units in the interfascicular fibers and that complementation of lac17 with LAC17 restored a normal lignin profile. This study provides evidence that both LAC4 and LAC17 contribute to the constitutive lignification of Arabidopsis stems and that LAC17 is involved in the deposition of G lignin units in fibers. PMID:21447792

Leptin gene promoter DNA methylation in WNIN obese mutant rats

PubMed Central

2014-01-01

Background Obesity has become an epidemic in worldwide population. Leptin gene defect could be one of the causes for obesity. Two mutant obese rats WNIN/Ob and WNIN/GROb, isolated at National Centre for Laboratory Animal Sciences (NCLAS), Hyderabad, India, were found to be leptin resistant. The present study aims to understand the regulatory mechanisms underlying the resistance by promoter DNA methylation of leptin gene in these mutant obese rats. Methods Male obese mutant homozygous, carrier and heterozygous rats of WNIN/Ob and WNIN/GROb strain of 6 months old were studied to check the leptin gene expression (RT-PCR) and promoter DNA methylation (MassARRAY Compact system, SEQUENOM) of leptin gene by invivo and insilico approach. Results Homozygous WNIN/Ob and WNIN/GROb showed significantly higher leptin gene expression compared to carrier and lean counterparts. Leptin gene promoter DNA sequence region was analyzed ranging from transcription start site (TSS) to-550 bp length and found four CpGs in this sequence among them only three CpG loci (-309, -481, -502) were methylated in these WNIN mutant rat phenotypes. Conclusion The increased percentage of methylation in WNIN mutant lean and carrier phenotypes is positively correlated with transcription levels. Thus genetic variation may have effect on methylation percentages and subsequently on the regulation of leptin gene expression which may lead to obesity in these obese mutant rat strains. PMID:24495350

Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

PubMed

Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

2017-06-01

Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

Mutant IDH1 Disrupts the Mouse Subventricular Zone and Alters Brain Tumor Progression

PubMed Central

Pirozzi, Christopher J.; Carpenter, Austin B.; Waitkus, Matthew S.; Wang, Catherine Y.; Zhu, Huishan; Hansen, Landon J.; Chen, Lee H.; Greer, Paula K.; Feng, Jie; Wang, Yu; Bock, Cheryl B.; Fan, Ping; Spasojevic, Ivan; McLendon, Roger E.; Bigner, Darell D.; He, Yiping; Yan, Hai

2017-01-01

IDH1 mutations occur in the majority of low-grade gliomas and lead to the production of the oncometabolite, D-2-hydroxyglutarate (D-2HG). To understand the effects of tumor-associated mutant IDH1 (IDH1-R132H) on both the neural stem cell (NSC) population and brain tumorigenesis, genetically faithful cell lines and mouse model systems were generated. Here, it is reported that mouse NSCs expressing Idh1-R132H displayed reduced proliferation due to p53-mediated cell cycle arrest as well as a decreased ability to undergo neuronal differentiation. In vivo, Idh1-R132H expression reduced proliferation of cells within the germinal zone of the subventricular zone (SVZ). The NSCs within this area were dispersed and disorganized in mutant animals, suggesting that Idh1-R132H perturbed the NSCs and the microenvironment from which gliomas arise. Additionally, tumor-bearing animals expressing mutant Idh1 displayed a prolonged survival and also overexpressed Olig2, features consistent with IDH1-mutated human gliomas. These data indicate that mutant Idh1 disrupts the NSC microenvironment and the candidate cell of origin for glioma; thus, altering the progression of tumorigenesis. Additionally, this study provides a mutant Idh1 brain tumor model that genetically recapitulates human disease, laying the foundation for future investigations on mutant IDH1-mediated brain tumorigenesis and targeted therapy. PMID:28148827

Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells.

PubMed

Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

2016-01-01

Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future.

Epidermal Growth Factor Receptor Mutation Enhances Expression of Cadherin-5 in Lung Cancer Cells

PubMed Central

Hung, Ming-Szu; Chen, I-Chuan; Lung, Jr-Hau; Lin, Paul-Yann; Li, Ya-Chin; Tsai, Ying-Huang

2016-01-01

Epidermal growth factor receptor (EGFR) activation has been shown to play a critical role in tumor angiogenesis. In this study, we investigate the correlation between EGFR mutations and cadherin-5 (CDH5), which is an angiogenic factor, in lung cancer cells. Increased expression CDH5 is observed in lung cancer cells with EGFR mutations. Stable lung cancer cell lines expressing mutant (exon 19 deletion E746-A750, and exon 21 missense mutation L858R) and wild type EGFR genes are established. A significantly higher expression of CDH5 is observed in exon 19 deletion stable lung cancer cells and mouse xenografts. Further studies show that expression of CDH5 is decreased after the inhibition of EGFR and downstream Akt pathways in lung cancer cells with EGFR mutation. In addition, mutant EGFR genes potentiates angiogenesis in lung cancer cells, which is inhibited by CDH5 siRNA, and potentiates migration and invasion in lung cancer cells. Our study shows that mutant EGFR genes are associated with overexpression of CDH5 through increased phosphorylation of EGFR and downstream Akt pathways. Our result may provide an insight into the association of mutant EGFR and CDH5 expression in lung cancer and aid further development of target therapy for NSCLC in the future. PMID:27362942

Spontaneous hepatic repopulation in transgenic mice expressing mutant human α1-antitrypsin by wild-type donor hepatocytes.

PubMed

Ding, Jianqiang; Yannam, Govardhana R; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I; Wong, Ronald J; Avsar, Yesim; Guha, Chandan; Perlmutter, David H; Fox, Ira J; Roy-Chowdhury, Jayanta

2011-05-01

α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z-expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%-98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z-expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals.

Drosophila Torsin Protein Regulates Motor Control and Stress Sensitivity and Forms a Complex with Fragile-X Mental Retardation Protein

PubMed Central

Ahn, Hyo-Min; Koh, Young Ho

2016-01-01

We investigated unknown in vivo functions of Torsin by using Drosophila as a model. Downregulation of Drosophila Torsin (DTor) by DTor-specific inhibitory double-stranded RNA (RNAi) induced abnormal locomotor behavior and increased susceptibility to H2O2. In addition, altered expression of DTor significantly increased the numbers of synaptic boutons. One important biochemical consequence of DTor-RNAi expression in fly brains was upregulation of alcohol dehydrogenase (ADH). Altered expression of ADH has also been reported in Drosophila Fragile-X mental retardation protein (DFMRP) mutant flies. Interestingly, expression of DFMRP was altered in DTor mutant flies, and DTor and DFMRP were present in the same protein complexes. In addition, DTor and DFMRP immunoreactivities were partially colocalized in several cellular organelles in larval muscles. Furthermore, there were no significant differences between synaptic morphologies of dfmrp null mutants and dfmrp mutants expressing DTor-RNAi. Taken together, our evidences suggested that DTor and DFMRP might be present in the same signaling pathway regulating synaptic plasticity. In addition, we also found that human Torsin1A and human FMRP were present in the same protein complexes, suggesting that this phenomenon is evolutionarily conserved. PMID:27313903

BIG: a calossin-like protein required for polar auxin transport in Arabidopsis

PubMed Central

Gil, Pedro; Dewey, Elizabeth; Friml, Jiri; Zhao, Yunde; Snowden, Kimberley C.; Putterill, Jo; Palme, Klaus; Estelle, Mark; Chory, Joanne

2001-01-01

Polar auxin transport is crucial for the regulation of auxin action and required for some light-regulated responses during plant development. We have found that two mutants of Arabidopsis—doc1, which displays altered expression of light-regulated genes, and tir3, known for its reduced auxin transport—have similar defects and define mutations in a single gene that we have renamed BIG. BIG is very similar to the Drosophila gene Calossin/Pushover, a member of a gene family also present in Caenorhabditis elegans and human genomes. The protein encoded by BIG is extraordinary in size, 560 kD, and contains several putative Zn-finger domains. Expression-profiling experiments indicate that altered expression of multiple light-regulated genes in doc1 mutants can be suppressed by elevated levels of auxin caused by overexpression of an auxin biosynthetic gene, suggesting that normal auxin distribution is required to maintain low-level expression of these genes in the dark. Double mutants of tir3 with the auxin mutants pin1, pid, and axr1 display severe defects in auxin-dependent growth of the inflorescence. Chemical inhibitors of auxin transport change the intracellular localization of the auxin efflux carrier PIN1 in doc1/tir3 mutants, supporting the idea that BIG is required for normal auxin efflux. PMID:11485992

The C. elegans ceh-36 gene encodes a putative homemodomain transcription factor involved in chemosensory functions of ASE and AWC neurons.

PubMed

Koga, Makoto; Ohshima, Yasumi

2004-02-20

Chemotaxis to water-soluble chemicals such as sodium ion is an important behavior of Caenorhabditis elegans for seeking food, and ASE chemosensory neurons have a major role in this behavior. We isolated mutants defective in chemotaxis to sodium acetate. We show here that among them ks86 had a mutation in the ceh-36 gene. ceh-36 :: gfp reporter constructs were expressed in ASE and AWC neurons. In a mutant of the che-1 gene, which encodes another transcription factor and is required for specification of ASE neurons, expression of the ceh-36 :: gfp reporter in ASE is lost. This indicates that the ceh-36 gene functions downstream of the che-1 gene in ASE. In the ceh-36(ks86) mutant, expression of the tax-2 gene encoding a cyclic nucleotide-gated channel was reduced in ASE and AWC. This affords an explanation for defects of the ceh-36 mutant in the chemotaxis mediated by ASE and AWC. When a ceh-36 cDNA was expressed in an adult ceh-36 mutant by a heat shock promoter, chemotaxis to sodium acetate was recovered. These results suggest that ceh-36 is required for functions, and not for development, of ASE.

[Expression in E.coli and bioactivity assay of Micrococcus luteus resuscitation promoting factor domain and its mutants].

PubMed

Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li

2008-10-01

To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.

Differential requirements of two recA mutants for constitutive SOS expression in Escherichia coli K-12.

PubMed

Long, Jarukit Edward; Renzette, Nicholas; Centore, Richard C; Sandler, Steven J

2008-01-01

Repairing DNA damage begins with its detection and is often followed by elicitation of a cellular response. In E. coli, RecA polymerizes on ssDNA produced after DNA damage and induces the SOS Response. The RecA-DNA filament is an allosteric effector of LexA auto-proteolysis. LexA is the repressor of the SOS Response. Not all RecA-DNA filaments, however, lead to an SOS Response. Certain recA mutants express the SOS Response (recA(C)) in the absence of external DNA damage in log phase cells. Genetic analysis of two recA(C) mutants was used to determine the mechanism of constitutive SOS (SOS(C)) expression in a population of log phase cells using fluorescence of single cells carrying an SOS reporter system (sulAp-gfp). SOS(C) expression in recA4142 mutants was dependent on its initial level of transcription, recBCD, recFOR, recX, dinI, xthA and the type of medium in which the cells were grown. SOS(C) expression in recA730 mutants was affected by none of the mutations or conditions tested above. It is concluded that not all recA(C) alleles cause SOS(C) expression by the same mechanism. It is hypothesized that RecA4142 is loaded on to a double-strand end of DNA and that the RecA filament is stabilized by the presence of DinI and destabilized by RecX. RecFOR regulate the activity of RecX to destabilize the RecA filament. RecA730 causes SOS(C) expression by binding to ssDNA in a mechanism yet to be determined.

Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

PubMed

Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

2016-05-01

Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

Staying Alive: Cancer Cells Expressing Mutant KRas Depend on ERH for Survival | Center for Cancer Research

Cancer.gov

The small G-protein KRas acts like a molecular switch, turning on and off pro-growth signaling pathways within cells when appropriate. In a large number of cancers, KRas is permanently turned on by a variety of mutations and drives the constant growth of these tumor cells. KRas itself has proved to be a poor drug target so researchers in the laboratory of Ji Luo, Ph.D., in CCR’s Medical Oncology Branch decided to look for other pathways that are essential for the growth of cells expressing mutant KRas. These pathways could present new drug targets, and blocking their activities might selectively affect cells that express mutant KRas.

Sterol Methyl Oxidases Affect Embryo Development via Auxin-Associated Mechanisms.

PubMed

Zhang, Xia; Sun, Shuangli; Nie, Xiang; Boutté, Yohann; Grison, Magali; Li, Panpan; Kuang, Susu; Men, Shuzhen

2016-05-01

Sterols are essential molecules for multiple biological processes, including embryogenesis, cell elongation, and endocytosis. The plant sterol biosynthetic pathway is unique in the involvement of two distinct sterol 4α-methyl oxidase (SMO) families, SMO1 and SMO2, which contain three and two isoforms, respectively, and are involved in sequential removal of the two methyl groups at C-4. In this study, we characterized the biological functions of members of the SMO2 gene family. SMO2-1 was strongly expressed in most tissues during Arabidopsis (Arabidopsis thaliana) development, whereas SMO2-2 showed a more specific expression pattern. Although single smo2 mutants displayed no obvious phenotype, the smo2-1 smo2-2 double mutant was embryonic lethal, and the smo2-1 smo2-2/+ mutant was dwarf, whereas the smo2-1/+ smo2-2 mutant exhibited a moderate phenotype. The phenotypes of the smo2 mutants resembled those of auxin-defective mutants. Indeed, the expression of DR5rev:GFP, an auxin-responsive reporter, was reduced and abnormal in smo2-1 smo2-2 embryos. Furthermore, the expression and subcellular localization of the PIN1 auxin efflux facilitator also were altered. Consistent with these observations, either the exogenous application of auxin or endogenous auxin overproduction (YUCCA9 overexpression) partially rescued the smo2-1 smo2-2 embryonic lethality. Surprisingly, the dwarf phenotype of smo2-1 smo2-2/+ was completely rescued by YUCCA9 overexpression. Gas chromatography-mass spectrometry analysis revealed a substantial accumulation of 4α-methylsterols, substrates of SMO2, in smo2 heterozygous double mutants. Together, our data suggest that SMO2s are important for correct sterol composition and function partially through effects on auxin accumulation, auxin response, and PIN1 expression to regulate Arabidopsis embryogenesis and postembryonic development. © 2016 American Society of Plant Biologists. All Rights Reserved.

Sterol Methyl Oxidases Affect Embryo Development via Auxin-Associated Mechanisms1

PubMed Central

Zhang, Xia; Sun, Shuangli; Nie, Xiang; Boutté, Yohann; Grison, Magali; Li, Panpan; Kuang, Susu

2016-01-01

Sterols are essential molecules for multiple biological processes, including embryogenesis, cell elongation, and endocytosis. The plant sterol biosynthetic pathway is unique in the involvement of two distinct sterol 4α-methyl oxidase (SMO) families, SMO1 and SMO2, which contain three and two isoforms, respectively, and are involved in sequential removal of the two methyl groups at C-4. In this study, we characterized the biological functions of members of the SMO2 gene family. SMO2-1 was strongly expressed in most tissues during Arabidopsis (Arabidopsis thaliana) development, whereas SMO2-2 showed a more specific expression pattern. Although single smo2 mutants displayed no obvious phenotype, the smo2-1 smo2-2 double mutant was embryonic lethal, and the smo2-1 smo2-2/+ mutant was dwarf, whereas the smo2-1/+ smo2-2 mutant exhibited a moderate phenotype. The phenotypes of the smo2 mutants resembled those of auxin-defective mutants. Indeed, the expression of DR5rev:GFP, an auxin-responsive reporter, was reduced and abnormal in smo2-1 smo2-2 embryos. Furthermore, the expression and subcellular localization of the PIN1 auxin efflux facilitator also were altered. Consistent with these observations, either the exogenous application of auxin or endogenous auxin overproduction (YUCCA9 overexpression) partially rescued the smo2-1 smo2-2 embryonic lethality. Surprisingly, the dwarf phenotype of smo2-1 smo2-2/+ was completely rescued by YUCCA9 overexpression. Gas chromatography-mass spectrometry analysis revealed a substantial accumulation of 4α-methylsterols, substrates of SMO2, in smo2 heterozygous double mutants. Together, our data suggest that SMO2s are important for correct sterol composition and function partially through effects on auxin accumulation, auxin response, and PIN1 expression to regulate Arabidopsis embryogenesis and postembryonic development. PMID:27006488

Potentiation of antileukemic therapies by the dual PI3K/PDK-1 inhibitor, BAG956: effects on BCR-ABL– and mutant FLT3-expressing cells

PubMed Central

Weisberg, Ellen; Banerji, Lolita; Wright, Renee D.; Barrett, Rosemary; Ray, Arghya; Moreno, Daisy; Catley, Laurence; Jiang, Jingrui; Hall-Meyers, Elizabeth; Sauveur-Michel, Maira; Stone, Richard; Galinsky, Ilene; Fox, Edward; Kung, Andrew L.

2008-01-01

Mediators of PI3K/AKT signaling have been implicated in chronic myeloid leukemia (CML) and acute myeloid leukemia (AML). Studies have shown that inhibitors of PI3K/AKT signaling, such as wortmannin and LY294002, are able to inhibit CML and AML cell proliferation and synergize with targeted tyrosine kinase inhi-bitors. We investigated the ability of BAG956, a dual PI3K/PDK-1 inhibitor, to be used in combination with inhibitors of BCR-ABL and mutant FLT3, as well as with the mTOR inhibitor, rapamycin, and the rapamycin derivative, RAD001. BAG956 was shown to block AKT phosphorylation induced by BCR-ABL–, and induce apoptosis of BCR-ABL–expressing cell lines and patient bone marrow cells at concentrations that also inhibit PI3K signaling. Enhancement of the inhibitory effects of the tyrosine kinase inhibitors, imatinib and nilotinib, by BAG956 was demonstrated against BCR-ABL expressing cells both in vitro and in vivo. We have also shown that BAG956 is effective against mutant FLT3-expressing cell lines and AML patient bone marrow cells. Enhancement of the inhibitory effects of the tyrosine kinase inhibitor, PKC412, by BAG956 was demonstrated against mutant FLT3-expressing cells. Finally, BAG956 and rapamycin/RAD001 were shown to combine in a nonantagonistic fashion against BCR-ABL– and mutant FLT3-expressing cells both in vitro and in vivo. PMID:18184863

Serum response factor: positive and negative regulation of an epithelial gene expression network in the destrin mutant cornea

PubMed Central

Kawakami-Schulz, Sharolyn V.; Verdoni, Angela M.; Sattler, Shannon G.; Jessen, Erik; Kao, Winston W.-Y.; Ikeda, Akihiro

2014-01-01

Increased angiogenesis, inflammation, and proliferation are hallmarks of diseased tissues, and in vivo models of these disease phenotypes can provide insight into disease pathology. Dstncorn1 mice, deficient for the actin depolymerizing factor destrin (DSTN), display an increase of serum response factor (SRF) that results in epithelial hyperproliferation, inflammation, and neovascularization in the cornea. Previous work demonstrated that conditional ablation of Srf from the corneal epithelium of Dstncorn1 mice returns the cornea to a wild-type (WT) like state. This result implicated SRF as a major regulator of genes that contributes to abnormal phenotypes in Dstncorn1 cornea. The purpose of this study is to identify gene networks that are affected by increased expression of Srf in the Dstncorn1 cornea. Microarray analysis led to characterization of gene expression changes that occur when conditional knockout of Srf rescues mutant phenotypes in the cornea of Dstncorn1 mice. Comparison of gene expression values from WT, Dstncorn1 mutant, and Dstncorn1 rescued cornea identified >400 differentially expressed genes that are downstream from SRF. Srf ablation had a significant effect on genes associated with epithelial cell-cell junctions and regulation of actin dynamics. The majority of genes affected by SRF are downregulated in the Dstncorn1 mutant cornea, suggesting that increased SRF negatively affects transcription of SRF gene targets. ChIP-seq analysis on Dstncorn1 mutant and WT tissue revealed that, despite being present in higher abundance, SRF binding is significantly decreased in the Dstncorn1 mutant cornea. This study uses a unique model combining genetic and genomic approaches to identify genes that are regulated by SRF. These findings expand current understanding of the role of SRF in both normal and abnormal tissue homeostasis. PMID:24550211

Loss of protein phosphatase 6 in mouse keratinocytes enhances K-rasG12D -driven tumor promotion.

PubMed

Kurosawa, Koreyuki; Inoue, Yui; Kakugawa, Yoichiro; Yamashita, Yoji; Kanazawa, Kosuke; Kishimoto, Kazuhiro; Nomura, Miyuki; Momoi, Yuki; Sato, Ikuro; Chiba, Natsuko; Suzuki, Mai; Ogoh, Honami; Yamada, Hidekazu; Miura, Koh; Watanabe, Toshio; Tanuma, Nobuhiro; Tachi, Masahiro; Shima, Hiroshi

2018-05-14

Here, we address the function of protein phosphatase 6 (PP6) loss on K-ras-initiated tumorigenesis in keratinocytes. To do so, we developed tamoxifen-inducible double mutant (K-ras G12D -expressing and Ppp6c-deficient) mice in which K-ras G12D expression is driven by the cytokeratin 14 (K14) promoter. Doubly-mutant mice showed early onset tumor formation in lip, nipples, external genitalia, anus and palms, and had to be sacrificed by three weeks after induction by tamoxifen, while comparably-treated K-ras G12D -expressing mice did not. HE-staining of lip tumors before euthanasia revealed that all were papillomas, some containing focal squamous cell carcinoma. Immunohistochemical analysis of lip of doubly-mutant versus K-ras G12D mice revealed that cell proliferation and cell size increased approximately two-fold relative to K-ras G12D -expressing mutants, and epidermal thickness of lip tissue greatly increased relative to that seen in K-ras G12D only mice. Moreover, AKT phosphorylation increased in K-ras G12D -expressing/Ppp6c-deficient cells, as did phosphorylation of the downstream effectors 4EBP1, S6, and GSK3, suggesting that protein synthesis and survival signals are enhanced in lip tissues of doubly-mutant mice. Finally, increased numbers of K14-positive cells were present in the suprabasal layer of doubly-mutant mice, indicating abnormal keratinocyte differentiation, and γH2AX-positive cells accumulated, indicating perturbed DNA repair. Taken together, Ppp6c deficiency enhances K-ras G12D -dependent tumor promotion. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Mutant matrix metalloproteinase-9 reduces postoperative peritoneal adhesions in rats.

PubMed

Atta, Hussein; El-Rehany, Mahmoud; Roeb, Elke; Abdel-Ghany, Hend; Ramzy, Maggie; Gaber, Shereen

2016-02-01

Postoperative peritoneal adhesions continue to be a major source of morbidity and occasional mortality. Studies have shown that matrix metalloproteinase-9 (MMP-9) levels are decreased postoperatively which may limits matrix degradation and participate in the development of peritoneal adhesions. In this proof-of-principle study, we evaluated the effect of gene therapy with catalytically inactive mutant MMP-9 on postoperative peritoneal adhesions in rats. Adenovirus encoding mutant MMP-9 (Ad-mMMP-9) or saline was instilled in the peritoneal cavity after cecal and parietal peritoneal injury in rats. Expression of mutant MMP-9 transcript was verified by sequencing. Adenovirus E4 gene expression, adhesion scores, MMP-9, tissue plasminogen activator (tPA), plasminogen activator inhibitor-1 (PAI-1) and transforming growth factor-β1 (TGF-β1) expression were evaluated at sacrifice one week after treatment. Both mutant MMP-9 transcripts and adenovirus E4 gene were expressed in Ad-mMMP-9 treated adhesions. Adhesions severity decreased significantly (p = 0.036) in the Ad-mMMP-9-treated compared with saline-treated adhesions. Expression of MMP-9 mRNA and protein were elevated (p = 0.001 and p = 0.029, respectively) in the Ad-mMMP-9-treated adhesions compared with saline-treated adhesions. While tPA levels were increased (p = 0.02) in Ad-mMMP-9 treated adhesions compared with saline-treated adhesions, TGF-β1 and PAI-1 levels were decreased (p = 0.017 and p = 0.042, respectively). No difference in mortality were found between groups (p = 0.64). Mutant MMP-9 gene therapy effectively transduced peritoneal adhesions resulting in reduction of severity of primary peritoneal adhesions. Copyright © 2016 IJS Publishing Group Limited. Published by Elsevier Ltd. All rights reserved.

The plasma membrane Ca2+ pump PMCA4b inhibits the migratory and metastatic activity of BRAF mutant melanoma cells.

PubMed

Hegedũs, Luca; Garay, Tamás; Molnár, Eszter; Varga, Karolina; Bilecz, Ágnes; Török, Szilvia; Padányi, Rita; Pászty, Katalin; Wolf, Matthias; Grusch, Michael; Kállay, Enikõ; Döme, Balázs; Berger, Walter; Hegedũs, Balázs; Enyedi, Agnes

2017-06-15

Oncogenic mutations of BRAF lead to constitutive ERK activity that supports melanoma cell growth and survival. While Ca 2+ signaling is a well-known regulator of tumor progression, the crosstalk between Ca 2+ signaling and the Ras-BRAF-MEK-ERK pathway is much less explored. Here we show that in BRAF mutant melanoma cells the abundance of the plasma membrane Ca 2+ ATPase isoform 4b (PMCA4b, ATP2B4) is low at baseline but markedly elevated by treatment with the mutant BRAF specific inhibitor vemurafenib. In line with these findings gene expression microarray data also shows decreased PMCA4b expression in cutaneous melanoma when compared to benign nevi. The MEK inhibitor selumetinib-similarly to that of the BRAF-specific inhibitor-also increases PMCA4b levels in both BRAF and NRAS mutant melanoma cells suggesting that the MAPK pathway is involved in the regulation of PMCA4b expression. The increased abundance of PMCA4b in the plasma membrane enhances [Ca 2+ ] i clearance from cells after Ca 2+ entry. Moreover we show that both vemurafenib treatment and PMCA4b overexpression induce marked inhibition of migration of BRAF mutant melanoma cells. Importantly, reduced migration of PMCA4b expressing BRAF mutant cells is associated with a marked decrease in their metastatic potential in vivo. Taken together, our data reveal an important crosstalk between Ca 2+ signaling and the MAPK pathway through the regulation of PMCA4b expression and suggest that PMCA4b is a previously unrecognized metastasis suppressor. © 2016 UICC.

Murine Denys-Drash syndrome: evidence of podocyte de-differentiation and systemic mediation of glomerulosclerosis.

PubMed

Patek, Charles E; Fleming, Stewart; Miles, Colin G; Bellamy, Christopher O; Ladomery, Michael; Spraggon, Lee; Mullins, John; Hastie, Nicholas D; Hooper, Martin L

2003-09-15

Denys-Drash syndrome (DDS) is caused by dominant mutations of the Wilms' tumour suppressor gene, WT1, and characterized by a nephropathy involving diffuse mesangial sclerosis, male pseudohermaphroditism and/or Wilms' tumourigenesis. Previously, we reported that heterozygosity for the Wt1tmT396 mutation induces DDS in heterozygous and chimeric (Wt1tmT396/+<-->+/+) mice. In the present study, the fate of Wt1 mutant cells in chimeric kidneys was assessed by in situ marker analysis, and immunocytochemistry was used to re-examine the claim that glomerulosclerosis (GS) is caused by loss of WT1 and persistent Pax-2 expression by podocytes. Wt1 mutant cells colonized glomeruli efficiently, including podocytes, but some sclerotic glomeruli contained no detectable Wt1 mutant cells. The development of GS was preceded by widespread loss of ZO-1 signal in podocytes (even in kidneys where <5% of glomeruli contained Wt1 mutant podocytes), increased intra-renal renin expression, and de novo podocyte TGF-beta1 expression, but not podocyte Pax-2 expression or loss of WT1, synaptopodin, alpha-actinin-4 or nephrin expression. However, podocytes in partially sclerotic glomeruli that still expressed WT1 at high levels showed reduced vimentin expression, cell cycle re-entry, and re-expressed desmin, cytokeratin and Pax-2. The results suggest that: (i) GS is not due to loss of WT1 expression by podocytes; (ii) podocyte Pax-2 expression reflects re-expression rather than persistent expression, and is the consequence of GS; (iii) GS is mediated systemically and the mechanism involves activation of the renin-angiotensin system; and (iv) podocytes undergo typical maturational changes but subsequently de-differentiate and revert to an immature phenotype during disease progression.

Deciphering the role of the signal- and Sty1 kinase-dependent phosphorylation of the stress-responsive transcription factor Atf1 on gene activation.

PubMed

Salat-Canela, Clàudia; Paulo, Esther; Sánchez-Mir, Laura; Carmona, Mercè; Ayté, José; Oliva, Baldo; Hidalgo, Elena

2017-08-18

Adaptation to stress triggers the most dramatic shift in gene expression in fission yeast ( Schizosaccharomyces pombe ), and this response is driven by signaling via the MAPK Sty1. Upon activation, Sty1 accumulates in the nucleus and stimulates expression of hundreds of genes via the nuclear transcription factor Atf1, including expression of atf1 itself. However, the role of stress-induced, Sty1-mediated Atf1 phosphorylation in transcriptional activation is unclear. To this end, we expressed Atf1 phosphorylation mutants from a constitutive promoter to uncouple Atf1 activity from endogenous, stress-activated Atf1 expression. We found that cells expressing a nonphosphorylatable Atf1 variant are sensitive to oxidative stress because of impaired transcription of a subset of stress genes whose expression is also controlled by another transcription factor, Pap1. Furthermore, cells expressing a phospho-mimicking Atf1 mutant display enhanced stress resistance, and although expression of the Pap1-dependent genes still relied on stress induction, another subset of stress-responsive genes was constitutively expressed in these cells. We also observed that, in cells expressing the phospho-mimicking Atf1 mutant, the presence of Sty1 was completely dispensable, with all stress defects of Sty1-deficient cells being suppressed by expression of the Atf1 mutant. We further demonstrated that Sty1-mediated Atf1 phosphorylation does not stimulate binding of Atf1 to DNA but, rather, establishes a platform of interactions with the basal transcriptional machinery to facilitate transcription initiation. In summary, our results provide evidence that Atf1 phosphorylation by the MAPK Sty1 is required for oxidative stress responses in fission yeast cells by promoting transcription initiation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Tricarboxylic acid cycle without malate dehydrogenase in Streptomyces coelicolor M-145.

PubMed

Takahashi-Íñiguez, Tóshiko; Barrios-Hernández, Joana; Rodríguez-Maldonado, Marion; Flores, María Elena

2018-06-23

The oxidation of malate to oxaloacetate is catalysed only by a nicotinamide adenine dinucleotide-dependent malate dehydrogenase encoded by SCO4827 in Streptomyces coelicolor. A mutant lacking the malate dehydrogenase gene was isolated and no enzymatic activity was detected. As expected, the ∆mdh mutant was unable to grow on malate as the sole carbon source. However, the mutant grew less in minimal medium with glucose and there was a delay of 36 h. The same behaviour was observed when the mutant was grown on minimal medium with casamino acids or glycerol. For unknown reasons, the mutant was not able to grow in YEME medium with glucose. The deficiency of malate dehydrogenase affected the expression of the isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase genes, decreasing the expression of both genes by approximately two- to threefold.

Herpes Simplex Virus Selectively Induces Expression of the CC Chemokine RANTES/CCL5 in Macrophages through a Mechanism Dependent on PKR and ICP0

PubMed Central

Melchjorsen, Jesper; Pedersen, Finn S.; Mogensen, Søren C.; Paludan, Søren R.

2002-01-01

Recruitment of leukocytes is essential for eventual control of virus infections. Macrophages represent a leukocyte population involved in the first line of defense against many infections, including herpes simplex virus (HSV) infection. Through presentation of antigens to T cells and production of cytokines and chemokines, macrophages also constitute an important link between the innate and adaptive immune systems. Here, we have investigated the chemokine expression profile of macrophages after HSV infection and the virus-cell interactions involved. By reverse transcription-PCR and cDNA arrays, we found that HSV type 1 (HSV-1) and HSV-2 induced expression of the CC chemokine RANTES/CCL5 in murine macrophage cell lines and peritoneal cells. The CXC chemokine BCA-1/CXCL13 was also induced in peritoneal cells. Twenty-six other chemokines tested were not affected. Accumulation of RANTES mRNA was detectable after 5 h of infection, was sensitive to UV irradiation of the virus, and was preceded by accumulation of viral immediate-early mRNA and proteins. The viral components responsible for initiation of RANTES expression were examined with virus mutants and RAW 264.7 macrophage-like cells expressing a dominant negative mutant of the double-stranded-RNA-activated protein kinase (PKR). The PKR mutant cell line displayed reduced constitutive and HSV-inducible RANTES expression compared to the control cell line. HSV-1 mutants deficient in genes encoding the immediate-early proteins ICP4, ICP22, and ICP27 remained fully capable of inducing RANTES expression in macrophages. By contrast, the ability of an ICP0-deficient HSV-1 mutant to induce RANTES expression was compromised. Thus, HSV selectively induces expression of RANTES in macrophages through a mechanism dependent on cellular PKR and viral ICP0. PMID:11861845

Amino- and carboxy-terminal deletion mutants of Gs alpha are localized to the particulate fraction of transfected COS cells

PubMed Central

1992-01-01

To elucidate the structural basis for membrane attachment of the alpha subunit of the stimulatory G protein (Gs alpha), mutant Gs alpha cDNAs with deletions of amino acid residues in the amino and/or carboxy termini were transiently expressed in COS-7 cells. The particulate and soluble fractions prepared from these cells were analyzed by immunoblot using peptide specific antibodies to monitor distribution of the expressed proteins. Transfection of mutant forms of Gs alpha with either 26 amino terminal residues deleted (delta 3-28) or with 59 amino terminal residues deleted (delta 1-59) resulted in immunoreactive proteins which localized primarily to the particulate fraction. Similarly, mutants with 10 (delta 385-394), 32 (delta 353-384), or 42 (delta 353-394) amino acid residues deleted from the carboxy terminus also localized to the particulate fraction, as did a mutant form of Gs alpha lacking amino acid residues at both the amino and carboxy termini (delta 3-28)/(delta 353-384). Mutant and wild type forms of Gs alpha demonstrated a similar degree of tightness in their binding to membranes as demonstrated by treatment with 2.5 M NaCl or 6 M urea, but some mutant forms were relatively resistant compared with wild type Gs alpha to solubilization by 15 mM NaOH or 1% sodium cholate. We conclude that: (a) deletion of significant portions of the amino and/or carboxyl terminus of Gs alpha is still compatible with protein expression; (b) deletion of these regions is insufficient to cause cytosolic localization of the expressed protein. The basis of Gs alpha membrane targeting remains to be elucidated. PMID:1400589

A Phex Mutation in a Murine Model of X-linked Hypophosphatemia Alters Phosphate Responsiveness of Bone Cells

PubMed Central

Ichikawa, Shoji; Austin, Anthony M.; Gray, Amie K.; Econs, Michael J.

2011-01-01

Mutations in the PHEX gene cause X-linked hypophosphatemia (XLH). Hypophosphatemia in XLH results from increased circulating levels of a phosphaturic hormone, fibroblast growth factor 23 (FGF23), which inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D (calcitriol) synthesis. The current standard therapy for XLH – high dose phosphate and calcitriol – further increases FGF23 concentrations, suggesting that patients with XLH may have an altered response to extracellular phosphate. To test for the presence of abnormal phosphate responsiveness, we compared serum biochemistries and femoral Fgf23 mRNA expression between wild-type mice, murine models of XLH (PhexK496X) and hyperphosphatemic tumoral calcinosis (Galnt3 -/-), and Galnt3/Phex double mutant mice. Phex mutant mice had not only increased Fgf23 expression, but also reduced proteolytic cleavage of intact Fgf23 protein, resulting in markedly elevated intact Fgf23 levels and consequent hypophosphatemia. In contrast, despite markedly increased Fgf23 expression, Galnt3 knockout mice had significantly high proteolytic cleavage of Fgf23 protein, leading to low intact Fgf23 concentrations and hyperphosphatemia. Galnt3/Phex double mutant mice had an intermediate biochemical phenotype between wild-type and Phex mutant mice, including slightly elevated intact Fgf23 concentrations with milder hypophosphatemia. Despite the hypophosphatemia, double mutant mice attempted to reduce serum phosphate back to the level of Phex mutant mice by up-regulating Fgf23 expression as much as 24 fold higher than Phex mutant mice. These data suggest that Phex mutations alter the responsiveness of bone cells to extracellular phosphate concentrations and may create a lower set point for “normal” phosphate levels. PMID:22006791

A Phex mutation in a murine model of X-linked hypophosphatemia alters phosphate responsiveness of bone cells.

PubMed

Ichikawa, Shoji; Austin, Anthony M; Gray, Amie K; Econs, Michael J

2012-02-01

Mutations in the PHEX gene cause X-linked hypophosphatemia (XLH). Hypophosphatemia in XLH results from increased circulating levels of a phosphaturic hormone, fibroblast growth factor 23 (FGF23), which inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D (calcitriol) synthesis. The current standard therapy for XLH--high-dose phosphate and calcitriol--further increases FGF23 concentrations, suggesting that patients with XLH may have an altered response to extracellular phosphate. To test for the presence of abnormal phosphate responsiveness, we compared serum biochemistries and femoral Fgf23 mRNA expression between wild-type mice, murine models of XLH (Phex(K496X)) and hyperphosphatemic tumoral calcinosis (Galnt3(-/-)), and Galnt3/Phex double-mutant mice. Phex mutant mice had not only increased Fgf23 expression but also reduced proteolytic cleavage of intact Fgf23 protein, resulting in markedly elevated intact Fgf23 levels and consequent hypophosphatemia. In contrast, despite markedly increased Fgf23 expression, Galnt3 knockout mice had significantly high proteolytic cleavage of Fgf23 protein, leading to low intact Fgf23 concentrations and hyperphosphatemia. Galnt3/Phex double-mutant mice had an intermediate biochemical phenotype between wild-type and Phex mutant mice, including slightly elevated intact Fgf23 concentrations with milder hypophosphatemia. Despite the hypophosphatemia, double-mutant mice attempted to reduce serum phosphate back to the level of Phex mutant mice by upregulating Fgf23 expression as much as 24-fold higher than Phex mutant mice. These data suggest that Phex mutations alter the responsiveness of bone cells to extracellular phosphate concentrations and may create a lower set point for "normal" phosphate levels.

Characterization of Haemophilus ducreyi cdtA, cdtB, and cdtC Mutants in In Vitro and In Vivo Systems

PubMed Central

Lewis, David A.; Stevens, Marla K.; Latimer, Jo L.; Ward, Christine K.; Deng, Kaiping; Blick, Robert; Lumbley, Sheryl R.; Ison, Catherine A.; Hansen, Eric J.

2001-01-01

Haemophilus ducreyi expresses a soluble cytolethal distending toxin (CDT) that is encoded by the cdtABC gene cluster and can be detected in culture supernatant fluid by its ability to kill HeLa cells. The cdtA, cdtB, and cdtC genes of H. ducreyi were cloned independently into plasmid vectors, and their encoded proteins expressed singly or in various combinations in an Escherichia coli background. All three gene products had to be expressed in order for E. coli-derived culture supernatant fluids to demonstrate cytotoxicity for HeLa cells. Isogenic H. ducreyi cdtA and cdtB mutants were constructed and used in combination with the wild-type parent strain and a previously described H. ducreyi cdtC mutant (M. K. Stevens, J. L. Latimer, S. R. Lumbley, C. K. Ward, L. D. Cope, T. Lagergard, and E. J. Hansen, Infect. Immun. 67:3900–3908, 1999) to determine the relative contributions of the CdtA, CdtB, and CdtC proteins to CDT activity. Expression of CdtA, CdtB, and CdtC appeared necessary for H. ducreyi-derived culture supernatant fluid to exhibit cytotoxicity for HeLa cells. Whole-cell sonicates and periplasmic extracts from the cdtB and cdtC mutants had no effect on HeLa cells, whereas these same fractions from a cdtA mutant had a very modest cytotoxic effect on these same human cells. CdtA appeared to be primarily associated with the H. ducreyi cell envelope, whereas both CdtB and CdtC were present primarily in the soluble fraction from sonicated cells. Both the cdtA mutant and the cdtB mutant were found to be fully virulent in the temperature-dependent rabbit model for experimental chancroid. PMID:11500438

Functional rescue of mutant ABCA1 proteins by sodium 4-phenylbutyrate.

PubMed

Sorrenson, Brie; Suetani, Rachel J; Williams, Michael J A; Bickley, Vivienne M; George, Peter M; Jones, Gregory T; McCormick, Sally P A

2013-01-01

Mutations in the ATP-binding cassette transporter A1 (ABCA1) are a major cause of decreased HDL cholesterol (HDL-C), which infers an increased risk of cardiovascular disease (CVD). Many ABCA1 mutants show impaired localization to the plasma membrane. The aim of this study was to investigate whether the chemical chaperone, sodium 4-phenylbutyrate (4-PBA) could improve cellular localization and function of ABCA1 mutants. Nine different ABCA1 mutants (p.A594T, p.I659V, p.R1068H, p.T1512M, p.Y1767D, p.N1800H, p.R2004K, p.A2028V, p.Q2239N) expressed in HEK293 cells, displaying different degrees of mislocalization to the plasma membrane and discrete impacts on cholesterol efflux, were subject to treatment with 4-PBA. Treatment restored localization to the plasma membrane and increased cholesterol efflux function for the majority of mutants. Treatment with 4-PBA also increased ABCA1 protein expression in all transfected cell lines. In fibroblast cells obtained from low HDL-C subjects expressing two of the ABCA1 mutants (p.R1068H and p.N1800H), 4-PBA increased cholesterol efflux without any increase in ABCA1 expression. Our study is the first to investigate the effect of the chemical chaperone, 4-PBA on ABCA1 and shows that it is capable of restoring plasma membrane localization and enhancing the cholesterol efflux function of mutant ABCA1s both in vitro and ex vivo. These results suggest 4-PBA may warrant further investigation as a potential therapy for increasing cholesterol efflux and HDL-C levels.

Development of EMS-induced mutation population for amylose and resistant starch variation in bread wheat (Triticum aestivum) and identification of candidate genes responsible for amylose variation.

PubMed

Mishra, Ankita; Singh, Anuradha; Sharma, Monica; Kumar, Pankaj; Roy, Joy

2016-10-06

Starch is a major part of cereal grain. It comprises two glucose polymer fractions, amylose (AM) and amylopectin (AP), that make up about 25 and 75 % of total starch, respectively. The ratio of the two affects processing quality and digestibility of starch-based food products. Digestibility determines nutritional quality, as high amylose starch is considered a resistant or healthy starch (RS type 2) and is highly preferred for preventive measures against obesity and related health conditions. The topic of nutrition security is currently receiving much attention and consumer demand for food products with improved nutritional qualities has increased. In bread wheat (Triticum aestivum L.), variation in amylose content is narrow, hence its limited improvement. Therefore, it is necessary to produce wheat lines or populations showing wide variation in amylose/resistant starch content. In this study, a set of EMS-induced M4 mutant lines showing dynamic variation in amylose/resistant starch content were produced. Furthermore, two diverse mutant lines for amylose content were used to study quantitative expression patterns of 20 starch metabolic pathway genes and to identify candidate genes for amylose biosynthesis. A population comprising 101 EMS-induced mutation lines (M4 generation) was produced in a bread wheat (Triticum aestivum) variety. Two methods of amylose measurement in grain starch showed variation in amylose content ranging from ~3 to 76 % in the population. The method of in vitro digestion showed variation in resistant starch content from 1 to 41 %. One-way ANOVA analysis showed significant variation (p < 0.05) in amylose and resistant starch content within the population. A multiple comparison test (Dunnett's test) showed that significant variation in amylose and resistant starch content, with respect to the parent, was observed in about 89 and 38 % of the mutant lines, respectively. Expression pattern analysis of 20 starch metabolic pathway genes in two diverse mutant lines (low and high amylose mutants) showed higher expression of key genes of amylose biosynthesis (GBSSI and their isoforms) in the high amylose mutant line, in comparison to the parent. Higher expression of amylopectin biosynthesis (SBE) was observed in the low amylose mutant lines. An additional six candidate genes showed over-expression (BMY, SPA) and reduced-expression (SSIII, SBEI, SBEIII, ISA3) in the high amylose mutant line, indicating that other starch metabolic genes may also contribute to amylose biosynthesis. In this study a set of 101 EMS-induced mutant lines (M4 generation) showing variation in amylose and resistant starch content in seed were produced. This population serves as useful germplasm or pre-breeding material for genome-wide study and improvement of starch-based processing and nutrition quality in wheat. It is also useful for the study of the genetic and molecular basis of amylose/resistant starch variation in wheat. Furthermore, gene expression analysis of 20 starch metabolic genes in the two diverse mutant lines (low and high amylose mutants) indicates that in addition to key genes, several other genes (such as phosphorylases, isoamylases, and pullulanases) may also be involved in contributing to amylose/amylopectin biosynthesis.

Molecular and immunohistochemical analyses of cardiac troponin T during cardiac development in the Mexican axolotl, Ambystoma mexicanum.

PubMed

Zhang, C; Pietras, K M; Sferrazza, G F; Jia, P; Athauda, G; Rueda-de-Leon, E; Rveda-de-Leon, E; Maier, J A; Dube, D K; Lemanski, S L; Lemanski, L F

2007-01-01

The Mexican axolotl, Ambystoma mexicanum, is an excellent animal model for studying heart development because it carries a naturally occurring recessive genetic mutation, designated gene c, for cardiac nonfunction. The double recessive mutants (c/c) fail to form organized myofibrils in the cardiac myoblasts resulting in hearts that fail to beat. Tropomyosin expression patterns have been studied in detail and show dramatically decreased expression in the hearts of homozygous mutant embryos. Because of the direct interaction between tropomyosin and troponin T (TnT), and the crucial functions of TnT in the regulation of striated muscle contraction, we have expanded our studies on this animal model to characterize the expression of the TnT gene in cardiac muscle throughout normal axolotl development as well as in mutant axolotls. In addition, we have succeeded in cloning the full-length cardiac troponin T (cTnT) cDNA from axolotl hearts. Confocal microscopy has shown a substantial, but reduced, expression of TnT protein in the mutant hearts when compared to normal during embryonic development. 2006 Wiley-Liss, Inc.

Cell Transformation by PTP1B Truncated Mutants Found in Human Colon and Thyroid Tumors.

PubMed

Mei, Wenhan; Wang, Kemin; Huang, Jian; Zheng, Xinmin

2016-01-01

Expression of wild-type protein tyrosine phosphatase (PTP) 1B may act either as a tumor suppressor by dysregulation of protein tyrosine kinases or a tumor promoter through Src dephosphorylation at Y527 in human breast cancer cells. To explore whether mutated PTP1B is involved in human carcinogenesis, we have sequenced PTP1B cDNAs from human tumors and found splice mutations in ~20% of colon and thyroid tumors. The PTP1BΔE6 mutant expressed in these two tumor types and another PTP1BΔE5 mutant expressed in colon tumor were studied in more detail. Although PTP1BΔE6 revealed no phosphatase activity compared with wild-type PTP1B and the PTP1BΔE5 mutant, its expression induced oncogenic transformation of rat fibroblasts without Src activation, indicating that it involved signaling pathways independent of Src. The transformed cells were tumourigenic in nude mice, suggesting that the PTP1BΔE6 affected other molecule(s) in the human tumors. These observations may provide a novel therapeutic target for colon and thyroid cancer.

Low-energy N-ion beam biotechnology application in the induction of Thai jasmine rice mutant with improved seed storability

NASA Astrophysics Data System (ADS)

Semsang, Nuananong; Techarang, Jiranat; Yu, Liangdeng; Phanchaisri, Boonrak

2018-06-01

Low-energy heavy-ion beam is a novel biotechnology used for mutation induction in plants. We used a low-energy N-ion beam to induce mutations in Thai jasmine rice (Oryza sativa L. cv. KDML 105) to improve the yield and seed quality. Seeds of BKOS6, a Thai jasmine rice mutant previously induced by ion beams, were re-bombarded with 60-kV-accelerated N-ions (N++N2+) to fluences of 1-2 × 1016 ions/cm2. The resulting mutant, named HyKOS21, exhibited photoperiod insensitivity, semi-dwarfness, and high yield potential. Seed storability of the mutant was studied in natural and accelerated ageing conditions and compared to that of KDML 105 and six other Thai rice varieties. In both testing conditions, HyKOS21 mutant had the highest seed storability among the tested varieties. After storage in the natural condition for 18 months, HyKOS21 had a seed germination percentage nearly two times as that of the original KDML 105. Biochemical analysis showed that the lipid peroxidation level of the mutant seeds was the lowest among those of the tested varieties. Furthermore, an expression analysis of genes encoding lipoxygenase isoenzyme (lox1, lox2, and lox3) revealed that the mutant lacked expression of lox1 and lox2 and expressed only lox3 in seeds. These results may explain the improved seed longevity of the mutant after storage. This work provides further evidence of the modification of biological materials using a low-energy ion beam to produce rice mutants with improved yield and seed storability. The benefits of this technology, to create new varieties with improved values, could serve for local economic development.

The E3 ubiquitin ligase CHIP selectively regulates mutant epidermal growth factor receptor by ubiquitination and degradation.

PubMed

Chung, Chaeuk; Yoo, Geon; Kim, Tackhoon; Lee, Dahye; Lee, Choong-Sik; Cha, Hye Rim; Park, Yeon Hee; Moon, Jae Young; Jung, Sung Soo; Kim, Ju Ock; Lee, Jae Cheol; Kim, Sun Young; Park, Hee Sun; Park, Myoungrin; Park, Dong Il; Lim, Dae-Sik; Jang, Kang Won; Lee, Jeong Eun

2016-10-14

Somatic mutation in the tyrosine kinase domain of epidermal growth factor receptor (EGFR) is a decisive factor for the therapeutic response to EGFR tyrosine kinase inhibitors (EGFR-TKIs) in lung adenocarcinoma. The stability of mutant EGFR is maintained by various regulators, including heat shock protein 90 (Hsp90). The C terminus of Hsc70-interacting protein (CHIP) is a Hsp70/Hsp90 co-chaperone and exhibits E3 ubiquitin ligase activity. The high-affinity Hsp90-CHIP complex recognizes and selectively regulates their client proteins. CHIP also works with its own E3 ligase activity independently of Hsp70/Hsp90. Here, we investigated the role of CHIP in regulating EGFR in lung adenocarcinoma and also evaluated the specificity of CHIP's effects on mutant EGFR. In HEK 293T cells transfected with either WT EGFR or EGFR mutants, the overexpression of CHIP selectively decreased the expression of certain EGFR mutants (G719S, L747_E749del A750P and L858R) but not WT EGFR. In a pull-down assay, CHIP selectively interacted with EGFR mutants and simultaneously induced their ubiquitination and proteasomal degradation. The expressions of mutant EGFR in PC9 and H1975 were diminished by CHIP, while the expression of WT EGFR in A549 was nearly not affected. In addition, CHIP overexpression inhibited cell proliferation and xenograft's tumor growth of EGFR mutant cell lines, but not WT EGFR cell lines. EGFR mutant specific ubiquitination by CHIP may provide a crucial regulating mechanism for EGFR in lung adenocarcinoma. Our results suggest that CHIP can be novel therapeutic target for overcoming the EGFR TKI resistance. Copyright © 2016 Elsevier Inc. All rights reserved.

A Novel Intergenic ETnII-β Insertion Mutation Causes Multiple Malformations in Polypodia Mice

PubMed Central

Lehoczky, Jessica A.; Thomas, Peedikayil E.; Patrie, Kevin M.; Owens, Kailey M.; Villarreal, Lisa M.; Galbraith, Kenneth; Washburn, Joe; Johnson, Craig N.; Gavino, Bryant; Borowsky, Alexander D.; Millen, Kathleen J.; Wakenight, Paul; Law, William; Van Keuren, Margaret L.; Gavrilina, Galina; Hughes, Elizabeth D.; Saunders, Thomas L.; Brihn, Lesil; Nadeau, Joseph H.; Innis, Jeffrey W.

2013-01-01

Mouse early transposon insertions are responsible for ∼10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd), a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5′ LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development. PMID:24339789

Clausa, a Tomato Mutant with a Wide Range of Phenotypic Perturbations, Displays a Cell Type-Dependent Expression of the Homeobox Gene LeT6/TKn21

PubMed Central

Avivi, Yigal; Lev-Yadun, Simcha; Morozova, Nadya; Libs, Laurence; Williams, Leor; Zhao, Jing; Varghese, George; Grafi, Gideon

2000-01-01

Class I knox genes play an important role in shoot meristem function and are thus involved in the ordered development of stems, leaves, and reproductive organs. To elucidate the mechanism underlying the expression pattern of these homeobox genes, we studied a spontaneous tomato (Lycopersicon esculentum) mutant that phenotypically resembles, though is more extreme than, transgenic plants misexpressing class I knox genes. This mutant was found to carry a recessive allele, denoted clausa:shootyleaf (clau:shl)—a newly identified allele of clausa. Mutant plants exhibited abnormal leaf and flower morphology, epiphyllus inflorescences, fusion of organs, calyx asymmetry, and navel-like fruits. Analysis by scanning electron microscopy revealed that such fruits carried ectopic ovules, various vegetative primordia, as well as “forests” of stalked glandular trichomes. In situ RNA hybridization showed a peculiar expression pattern of the class I knox gene LeT6/TKn2; expression was restricted to the vascular system and palisade layer of mature leaves and to the inner part of ovules integuments. We conclude that CLAUSA regulates various aspects of tomato plant development, at least partly, by rendering the LeT6/TKn2 gene silent in specific tissues during development. Considering the expression pattern of LeT6/TKn2 in the clausa mutant, we suggest that the control over a given homeobox gene is maintained by several different regulatory mechanisms, in a cell type-dependent manner. PMID:11027705

Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

PubMed

Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

2010-05-01

Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

Naringenin Regulates Expression of Genes Involved in Cell Wall Synthesis in Herbaspirillum seropedicae▿

PubMed Central

Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.

2011-01-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805

Naringenin regulates expression of genes involved in cell wall synthesis in Herbaspirillum seropedicae.

PubMed

Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A

2011-03-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.

Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli

PubMed Central

Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

2013-01-01

MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms. PMID:24523773

Study the Expression of marA Gene in Ciprofloxacin and Tetracycline Resistant Mutants of Esherichia coli.

PubMed

Pourahmad Jaktaji, Razieh; Ebadi, Rayhaneh

2013-01-01

MarA activates two membrane dependent mechanisms of resistance to different antibiotics, such as ciprofloxacin and tetracycline, including promotion of outflux and inhibition of influx of antibiotics. Thus, MarA causes multiple antibiotic resistance phenotype. The activation of these mechanisms needs overexpression of marA. This could happen through mutation in marR. Thus, the aim of this study was to measure marA expression in ciprofloxacin resistant E. coli gyrA mutants and clones with or without marR mutation. For this purpose, real time PCR was used to measure relative expression of marA in above mutants and clones. Results showed that two clones, C14 and C17 overexpressed marA. It is concluded that the level of marA expression is important for activation of above mechanisms.

The Agrobacterium tumefaciens rnd Homolog Is Required for TraR-Mediated Quorum-Dependent Activation of Ti Plasmid tra Gene Expression

PubMed Central

Luo, Zhao-Qing; Farrand, Stephen K.

2001-01-01

Conjugal transfer of Agrobacterium tumefaciens Ti plasmids is regulated by quorum sensing via TraR and its cognate autoinducer, N-(3-oxo-octanoyl)-l-homoserine lactone. We isolated four Tn5-induced mutants of A. tumefaciens C58 deficient in TraR-mediated activation of tra genes on pTiC58ΔaccR. These mutations also affected the growth of the bacterium but had no detectable influence on the expression of two tester gene systems that are not regulated by quorum sensing. In all four mutants Tn5 was inserted in a chromosomal open reading frame (ORF) coding for a product showing high similarity to RNase D, coded for by rnd of Escherichia coli, an RNase known to be involved in tRNA processing. The wild-type allele of the rnd homolog cloned from C58 restored the two phenotypes to each mutant. Several ORFs, including a homolog of cya2, surround A. tumefaciens rnd, but none of these genes exerted a detectable effect on the expression of the tra reporter. In the mutant, traR was expressed from the Ti plasmid at a level about twofold lower than that in NT1. The expression of tra, but not the growth rate, was partially restored by increasing the copy number of traR or by disrupting traM, a Ti plasmid gene coding for an antiactivator specific for TraR. The mutation in rnd also slightly reduced expression of two tested vir genes but had no detectable effect on tumor induction by this mutant. Our data suggest that the defect in tra gene induction in the mutants results from lowered levels of TraR. In turn, production of sufficient amounts of TraR apparently is sensitive to a cellular function requiring RNase D. PMID:11395455